Sample records for twisted pair cable

  1. Advanced Twisted Pair Cables for Distributed Local Area Networks in Intelligent Structure Systems

    NASA Astrophysics Data System (ADS)

    Semenov, Andrey

    2018-03-01

    The possibility of a significant increase in the length of cable communication channels of local area networks of automation and engineering support systems of buildings in the case of their implementation on balanced twisted pair cables is shown. Assuming a direct connection scheme and an effective speed of 100 Mbit/s, analytical relationships are obtained for the calculation of the maximum communication distance. The necessity of using in the linear part of such systems of twisted pair cables with U/UTP structure and interference parameters at the level of category 5e is grounded.

  2. Down hole transmission system

    DOEpatents

    Hall, David R [Provo, UT; Hall, Jr., H. Tracy

    2007-07-24

    A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. The electrically conducting coil comprises at least two generally fractional loops. In the preferred embodiment, the transmission elements are connected by an electrical conductor. Preferably, the electrical conductor is a coaxial cable. Preferably, the MCEI trough comprises ferrite. In the preferred embodiment, the fractional loops are connected by a connecting cable. In one aspect of the present invention, the connecting cable is a pair of twisted wires. In one embodiment the connecting cable is a shielded pair of twisted wires. In another aspect of the present invention, the connecting cable is a coaxial cable. The connecting cable may be disposed outside of the MCEI circular trough.

  3. Shielded-Twisted-Pair Cable Model for Chafe Fault Detection via Time-Domain Reflectometry

    NASA Technical Reports Server (NTRS)

    Schuet, Stefan R.; Timucin, Dogan A.; Wheeler, Kevin R.

    2012-01-01

    This report details the development, verification, and validation of an innovative physics-based model of electrical signal propagation through shielded-twisted-pair cable, which is commonly found on aircraft and offers an ideal proving ground for detection of small holes in a shield well before catastrophic damage occurs. The accuracy of this model is verified through numerical electromagnetic simulations using a commercially available software tool. The model is shown to be representative of more realistic (analytically intractable) cable configurations as well. A probabilistic framework is developed for validating the model accuracy with reflectometry data obtained from real aircraft-grade cables chafed in the laboratory.

  4. Local Area Networks.

    ERIC Educational Resources Information Center

    Marks, Kenneth E.; Nielsen, Steven

    1991-01-01

    Discusses cabling that is needed in local area networks (LANs). Types of cables that may be selected are described, including twisted pair, coaxial cables (or ethernet), and fiber optics; network topologies, the manner in which the cables are laid out, are considered; and cable installation issues are discussed. (LRW)

  5. Estudio de un microcable de par trenzado para la comunicacion y lectura del modulo de pixeles del experimento CMS

    NASA Astrophysics Data System (ADS)

    Oliveros Tautiva, Sandra Jimena

    The Compact Muon Solenoid (CMS) is one of the two most important experiments at the Large Hadron Collider (LHC). The pixel detector is the component closest to the collision in CMS and it receives large doses of radiation which will affect its performance. The pixel detector will be replaced by a new one after four years. The aim is to reduce material in the sensitive zone of the new pixel detector, which leads to the implementation of a type of micro twisted pair cable that will replace the existing kapton cables and some connections will be eliminated. The purpose of this work was to study the viability of using these micro twisted pair cables in the existing 40 MHz analog readout. The electrical parameters of micro cables were determined, and operational tests were performed in a module using these cables for communicating and reading. Three different lengths of micro cables were used, 1.0, 1.5 and 2.0 m, in order to compare test results with those obtained using the kapton cable. It was found that the use of these cables does not affect the programming and reading of the pixels in one module, so the micro cables are viable to be used in place of the kapton cables.

  6. Coronal plasma development in wire-array z-pinches made of twisted-pairs

    NASA Astrophysics Data System (ADS)

    Hoyt, C. L.; Greenly, J. B.; Gourdain, P. A.; Knapp, P. F.; Pikuz, S. A.; Shelkovenko, T. A.; Hammer, D. A.; Kusse, B. R.

    2009-11-01

    We have investigated coronal and core plasma development in wire array z-pinches in which single fine wires are replaced by twisted-pairs (``cable'') on the 1 MA, 100 ns rise time COBRA pulsed power generator. X-ray radiography, employed to investigate dense wire core expansion, showed periodic axial nonuniformity and evidence for shock waves developing where the individual wire plasmas collide. Laser shadowgraphy images indicated that the axial instability properties of the coronal plasma are substantially modified from ordinary wire arrays. Cable mass per unit length, material and the twist wavelength were varied in order to study their effects upon the instability wavelength. Implosion uniformity and bright-spot formation, as well as magnetic topology evolution, have also been investigated using self-emission imaging, x-ray diagnostics and small B-dot probes, respectively. Results from the cable-array z-pinches will be compared with results from ordinary wire-array z-pinches. This research was supported by the SSAA program of the National Nuclear Security Administration under DOE Cooperative agreement DE-FC03-02NA00057.

  7. High Speed Network Access to the Last-Mile Using Fixed Broadband Wireless

    DTIC Science & Technology

    2004-03-01

    could download the 3¼-hour movie Titanic in 7 minutes and 23 seconds while a 56K modem on the other hand would need almost 22 hours”. The MMDS band...9 a. Twisted Copper Pair (xDSL).....................................................9 b. Cable Modem ...of dial-up modems over twisted copper pair1. Copper wire provided the link in the local loop between the telephone subscriber and the local

  8. Woven ribbon cable for cryogenic instruments

    NASA Astrophysics Data System (ADS)

    Cunningham, C. R.; Hastings, P. R.; Strachan, J. M. D.

    Robust woven ribbon cables are described for connecting sensors at low temperatures to higher temperature systems. Woven cables have several advantages over conventional wiring or flat ribbon cables in cryostats: heat sinking is easier; twisted pairs may be used; and miniature multi-way connectors are easily incorporated. Their use is demonstrated in making connections from 131 bolometers in two arrays mounted in a dilution refrigerator at 100 mK. Thermal and electrical properties are discussed, as are other possible applications in cryogenic instruments.

  9. Structural modeling of HTS tapes and cables

    NASA Astrophysics Data System (ADS)

    Allen, N. C.; Chiesa, L.; Takayasu, M.

    2016-12-01

    Structural finite element analysis (FEA) has been used as an insightful tool to investigate the electromechanical behavior of HTS REBCO tapes and twisted stacked-tape cables under tension, torsion, bending and combined loads. A novel technique was developed for modeling the layered composite structure of the 2G tapes with structural solid-shell elements in ANSYS®. The FEA models produced detailed strain information for the REBCO superconducting layer which was then paired with an analytical model to predict the critical current performance of the 2G HTS tapes under various loads. Two commercially available HTS tapes (SuperPower and SuNAM) under tension, torsion and combined tension-torsion were first analyzed with FEA and compared with available experimental results at 77 K. A sharp critical current degradation was experienced at the yield strength of the tapes under tension and below a 100 mm twist-pitch under torsion. Combined tension-torsion loads had a more gradual degradation of critical current for twist-pitches of 115 mm or shorter but had a negligible difference compared to pure tension for longer twist-pitches. Using the structural solid-shell technique for modeling 2G tapes in ANSYS®, an FEA methodology for simulating full scale three-dimensional HTS stacked-tape cables under pure bending was created. A model of a Twisted-Stacked Tape Cable (TSTC), a configuration first proposed at MIT, was initially developed and then adapted to the slotted-core HTS Cable-In-Conduit Conductor produced by the ENEA laboratory in Italy. The numerical axial strain of the HTS REBCO tapes within the cables as calculated by FEA were found to agree with an analytical model for two cases: perfect-slip (frictionless) and no-slip (bonded). The ENEA CICC model was also compared with recent experimental critical current data at 77 K and was found to match best using a low friction coefficient of 0.02 indicating that the tapes within the cable freely slide with respect to each other helping to reduce the axial strain during bending.

  10. Test report for twinax cable (Rockwell type MB0150-051). [effects of mismatched termination

    NASA Technical Reports Server (NTRS)

    Doland, G. D.

    1978-01-01

    A controlled impedance twisted pair shielded cable was tested to determine the frequency response and effects of mismatched termination. It was found that a long length of this cable, about 100 feet, exhibited a frequency sensitive attenuation roll-off greater than 1.5 db down at 5 MHz. It was also determined that improper termination resulted in losses of 1/2 to 1 db within the frequency range of 200 KHz to greater than 1-1/2 MHz. The test results indicate a possible problem where mismatched connectors are used in video signal cables.

  11. Superconducting flat tape cable magnet

    DOEpatents

    Takayasu, Makoto

    2015-08-11

    A method for winding a coil magnet with the stacked tape cables, and a coil so wound. The winding process is controlled and various shape coils can be wound by twisting about the longitudinal axis of the cable and bending following the easy bend direction during winding, so that sharp local bending can be obtained by adjusting the twist pitch. Stack-tape cable is twisted while being wound, instead of being twisted in a straight configuration and then wound. In certain embodiments, the straight length should be half of the cable twist-pitch or a multiple of it.

  12. Integrated Networks.

    ERIC Educational Resources Information Center

    Robinovitz, Stewart

    1987-01-01

    A strategy for integrated data and voice networks implemented at the University of Michigan is described. These networks often use multi-technologies, multi-vendors, and multi-transmission media that will be fused into a single integrated network. Transmission media include twisted-pair wire, coaxial cable, fiber optics, and microwave. (Author/MLW)

  13. Copper link evaluations/solutions for fiber channel, SSA, SONET, ATM, and other services through 4 Gb/sec: basic information, test results, and evaluation

    NASA Astrophysics Data System (ADS)

    Leib, Michael J.

    1995-10-01

    Technitrol, the original designer of MIL-STD-1553 transformers, the original military 1Mb/s LAN, has advanced the state of the art one further notch, introducing a series of transceivers that allow high speed (through 1 Gb/s) data transmission over copper wire instead of fiber optic cable. One such device can be employed to implement the Fiber Channel Interface as defined by hte X3T11 ANSI Fibre Channel Committee using either mini coax, Type 1 shielded twisted pair, twinax or video cable. The technology now exists to upgrade data transmission rates on current physical media to speeds formerly only available with fiber optic cabling. Copper transceiver technology provides a cost effective alternative for dealing with demanding high speed applications such as high speed serial data transfer, high speed disk and tape storage transfer, imaging telemetry, radar, and other avionics applications. Eye diagrams will be presented to show that excellent data transmission at rates of 1 gigabit/sec with low jitter is capable over mini coax at distances to approximately 50 meters, shielded twisted pair and twinax cable to distances of 105 meters, and video cable to distances of 175 meters. Distances are further at lower data rates. As a member of the X3T11 ANSI Fiber Channel Committee, Technitrol has developed a Physical Media (copper wire) Dependant (PMD) transceiver not only compliant with the Fibre Channel Specifications but exceeding the specifications by a factor greater than four. Conceivably, this opens high speed interconnections for today's high data rate requirements to copper cabling systems. Fibre Optic problems need not be dealt with to obtain data transfers for high speed information transfers.

  14. Fiber optic data link for data acquisition and analysis

    NASA Astrophysics Data System (ADS)

    Saulsberry, Garen

    A data link has been designed and developed for use with fiber optics as a transmission medium, though coaxial and twisted pair cable might also be used. Multiple data types may be transferred at various rates up to 100 Mbits per second and data word width may be programmed to obtain the highest level of efficiency from the bit rate.

  15. Intra-building telecommunications cabling standards for Sandia National Laboratories, New Mexico

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adams, R.L.

    1993-08-01

    This document establishes a working standard for all telecommunications cable installations at Sandia National Laboratories, New Mexico. It is based on recent national commercial cabling standards. The topics addressed are Secure and Open/Restricted Access telecommunications environments and both twisted-pair and optical-fiber components of communications media. Some of the state-of-the-art technologies that will be supported by the intrabuilding cable infrastructure are Circuit and Packet Switched Networks (PBX/5ESS Voice and Low-Speed Data), Local Area Networks (Ethernet, Token Ring, Fiber and Copper Distributed Data Interface), and Wide Area Networks (Asynchronous Transfer Mode). These technologies can be delivered to every desk and can transportmore » data at rates sufficient to support all existing applications (such as Voice, Text and graphics, Still Images, Full-motion Video), as well as applications to be defined in the future.« less

  16. The influence of winding direction of two-layer HTS DC cable on the critical current

    NASA Astrophysics Data System (ADS)

    Vyatkin, V. S.; Kashiwagi, K.; Ivanov, Y. V.; Otabe, E. S.; Yamaguchi, S.

    2017-09-01

    The design of twist pitch and direction of winding in multilayer HTS coaxial cable is important. For HTS AC transmitting cables, the main condition of twist pitch is the balance of inductances of each layer for providing the current balance between layers. In this work, the finite element method analysis for the coaxial cables with both same and opposite directions winding is used to calculate magnetic field distribution, and critical current of the cable is estimated. It was found that the critical current of the cable with same direction winding is about 10 percent higher than that in the case of the cable with the opposite direction winding.

  17. Rotation analysis on large complex superconducting cables based on numerical modeling and experiments

    NASA Astrophysics Data System (ADS)

    Qin, Jinggang; Yue, Donghua; Zhang, Xingyi; Wu, Yu; Liu, Xiaochuan; Liu, Huajun; Jin, Huan; Dai, Chao; Nijhuis, Arend; Zhou, Chao; Devred, Arnaud

    2018-07-01

    The conductors used in large fusion reactors, e.g. ITER, CFETR and DEMO, are made of cable-in-conduit conductor (CICC) with large diameters up to about 50 mm. The superconducting and copper strands are cabled around a central spiral and then wrapped with stainless-steel tape of 0.1 mm thickness. The cable is then inserted into a jacket under tensile force that increases with the length of insertion. Because the cables are long and with a large diameter, the insertion force could reach values of about 40 kN. The large tensile force could lead to significant rotation forces. This may lead to an increase of the twist pitch, especially for the final one. Understanding the twist pitch variation is very important; in particular, the twist pitch of a cable inside a CICC strongly affects its properties, especially for Nb3Sn conductors. In this paper, a simplified numerical model was used to analyze the cable rotation, including material properties, cabling tension as well as wrap tension. Several rotation experiments with tensile force have been performed to verify the numerical results for CFETR CSMC cables. The results show that the numerical analysis is consistent with the experiments and provides the optimal cabling conditions for large superconducting cables.

  18. Processing mechanics of alternate twist ply (ATP) yarn technology

    NASA Astrophysics Data System (ADS)

    Elkhamy, Donia Said

    Ply yarns are important in many textile manufacturing processes and various applications. The primary process used for producing ply yarns is cabling. The speed of cabling is limited to about 35m/min. With the world's increasing demands of ply yarn supply, cabling is incompatible with today's demand activated manufacturing strategies. The Alternate Twist Ply (ATP) yarn technology is a relatively new process for producing ply yarns with improved productivity and flexibility. This technology involves self plying of twisted singles yarn to produce ply yarn. The ATP process can run more than ten times faster than cabling. To implement the ATP process to produce ply yarns there are major quality issues; uniform Twist Profile and yarn Twist Efficiency. The goal of this thesis is to improve these issues through process modeling based on understanding the physics and processing mechanics of the ATP yarn system. In our study we determine the main parameters that control the yarn twist profile. Process modeling of the yarn twist across different process zones was done. A computational model was designed to predict the process parameters required to achieve a square wave twist profile. Twist efficiency, a measure of yarn torsional stability and bulk, is determined by the ratio of ply yarn twist to singles yarn twist. Response Surface Methodology was used to develop the processing window that can reproduce ATP yarns with high twist efficiency. Equilibrium conditions of tensions and torques acting on the yarns at the self ply point were analyzed and determined the pathway for achieving higher twist efficiency. Mechanistic modeling relating equilibrium conditions to the twist efficiency was developed. A static tester was designed to zoom into the self ply zone of the ATP yarn. A computer controlled, prototypic ATP machine was constructed and confirmed the mechanistic model results. Optimum parameters achieving maximum twist efficiency were determined in this study. The successful results of this work have led to the filing of a US patent disclosing the method for producing ATP yarns with high yarn twist efficiency using a high convergence angle at the self ply point together with applying ply torque.

  19. Response of Nuclear Power Plant Instrumentation Cables Exposed to Fire Conditions.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muna, Alice Baca; LaFleur, Chris Bensdotter; Brooks, Dusty Marie

    This report presents the results of instrumentation cable tests sponsored by the US Nuclear Regulatory Commission (NRC) Office of Nuclear Regulatory Research and performed at Sandia National Laboratories (SNL). The goal of the tests was to assess thermal and electrical response behavior under fire-exposure conditions for instrumentation cables and circuits. The test objective was to assess how severe radiant heating conditions surrounding an instrumentation cable affect current or voltage signals in an instrumentation circuit. A total of thirty-nine small-scale tests were conducted. Ten different instrumentation cables were tested, ranging from one conductor to eight-twisted pairs. Because the focus of themore » tests was thermoset (TS) cables, only two of the ten cables had thermoplastic (TP) insulation and jacket material and the remaining eight cables were one of three different TS insulation and jacket material. Two instrumentation cables from previous cable fire testing were included, one TS and one TP. Three test circuits were used to simulate instrumentation circuits present in nuclear power plants: a 4–20 mA current loop, a 10–50 mA current loop and a 1–5 VDC voltage loop. A regression analysis was conducted to determine key variables affecting signal leakage time.« less

  20. Analytical investigation in bending characteristic of twisted stacked-tape cable conductor

    NASA Astrophysics Data System (ADS)

    Takayasu, Makoto; Chiesa, Luisa

    2015-12-01

    An analytical model to evaluate bending strains of a twisted stack-tape cable (TSTC) conductor has been developed. Through a comparison with experimental results obtained for a soldered 32-tape YBCO TSTC conductor, it has been found that a Perfect-Slip Model (PSM) taking into account the slipping between tapes in a stacked-tape cable during bending gives much better estimation of the bending performance compared to a No-Slip Model (NSM). In the PSM case the tapes can slip so that the internal longitudinal axial strain can be released. The longitudinal strains of compression and tension regions along the tape are balanced in one twist-pitch and cancel out evenly in a long cable. Therefore, in a cable the strains due to bending can be minimized. This is an important advantage of a TSTC conductor. The effect of the cable diameter size on the bending strain is also expected to be minor, and all tapes composing a TSTC conductor have the same strain response under bending, therefore the cable critical current can be characterized from a single tape behaviour.

  1. Modeling and testing of ethernet transformers

    NASA Astrophysics Data System (ADS)

    Bowen, David

    2011-12-01

    Twisted-pair Ethernet is now the standard home and office last-mile network technology. For decades, the IEEE standard that defines Ethernet has required electrical isolation between the twisted pair cable and the Ethernet device. So, for decades, every Ethernet interface has used magnetic core Ethernet transformers to isolate Ethernet devices and keep users safe in the event of a potentially dangerous fault on the network media. The current state-of-the-art Ethernet transformers are miniature (<5mm diameter) ferrite-core toroids wrapped with approximately 10 to 30 turns of wire. As small as current Ethernet transformers are, they still limit further Ethernet device miniaturization and require a separate bulky package or jack housing. New coupler designs must be explored which are capable of exceptional miniaturization or on-chip fabrication. This dissertation thoroughly explores the performance of the current commercial Ethernet transformers to both increase understanding of the device's behavior and outline performance parameters for replacement devices. Lumped element and distributed circuit models are derived; testing schemes are developed and used to extract model parameters from commercial Ethernet devices. Transfer relation measurements of the commercial Ethernet transformers are compared against the model's behavior and it is found that the tuned, distributed models produce the best transfer relation match to the measured data. Process descriptions and testing results on fabricated thin-film dielectric-core toroid transformers are presented. The best results were found for a 32-turn transformer loaded with 100Ω, the impedance of twisted pair cable. This transformer gave a flat response from about 10MHz to 40MHz with a height of approximately 0.45. For the fabricated transformer structures, theoretical methods to determine resistance, capacitance and inductance are presented. A special analytical and numerical analysis of the fabricated transformer inductance is presented. Planar cuts of magnetic slope fields around the dielectric-core toroid are shown that describe the effect of core height and winding density on flux uniformity without a magnetic core.

  2. Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: II. Significant reduction of strand movement and strand damage in short twist pitch CICCs

    DOE PAGES

    Sanabria, Charlos; Lee, Peter J.; Starch, William; ...

    2015-10-14

    Prototype cable in conduit conductors (CICCs) destined for use in the Toroidal Field (TF) and Central Solenoid (CS) coils of the ITER experimental fusion reactor underwent severe cyclic loading in the SULTAN facility. Their autopsies revealed significant and permanent transverse strand migration due to the large Lorentz forces of the SULTAN test. The movement resulted in a 3 7% void fraction increase on the Low Pressure (LP) side of the longer twist pitch CICCs. However, short twist pitch conductors exhibited less than 1% void fraction increase in the LP side, as well as a complete absence of the Nb 3Snmore » filament fractures observed in the longer twist pitch conductors. We report here a detailed strand to cable analysis of short and longer “baseline” twist pitch CICCs. It was found that the use of Internal Tin strands in the longer “baseline” twist pitch CICCs can be beneficial possibly because of their superior stiffness—which better resist strand movement—while the use of Bronze Process strands showed more movement and poorer cyclic test performance. This was not the case for the short twist pitch CICC. Such conductor design seems to work well with both strand types. But it was found that despite the absence of filament fractures, the short twist pitch CICC made from the Internal Tin strands studied here developed severe strand distortion during cabling which resulted in diffusion barrier breaks and Sn contamination of the Cu stabilizer during the heat treatment. Furthermore, the short twist pitch CICC made from Bronze Process strands preserved diffusion barrier integrity.« less

  3. Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: II. Significant reduction of strand movement and strand damage in short twist pitch CICCs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sanabria, Charlos; Lee, Peter J.; Starch, William

    Prototype cable in conduit conductors (CICCs) destined for use in the Toroidal Field (TF) and Central Solenoid (CS) coils of the ITER experimental fusion reactor underwent severe cyclic loading in the SULTAN facility. Their autopsies revealed significant and permanent transverse strand migration due to the large Lorentz forces of the SULTAN test. The movement resulted in a 3 7% void fraction increase on the Low Pressure (LP) side of the longer twist pitch CICCs. However, short twist pitch conductors exhibited less than 1% void fraction increase in the LP side, as well as a complete absence of the Nb 3Snmore » filament fractures observed in the longer twist pitch conductors. We report here a detailed strand to cable analysis of short and longer “baseline” twist pitch CICCs. It was found that the use of Internal Tin strands in the longer “baseline” twist pitch CICCs can be beneficial possibly because of their superior stiffness—which better resist strand movement—while the use of Bronze Process strands showed more movement and poorer cyclic test performance. This was not the case for the short twist pitch CICC. Such conductor design seems to work well with both strand types. But it was found that despite the absence of filament fractures, the short twist pitch CICC made from the Internal Tin strands studied here developed severe strand distortion during cabling which resulted in diffusion barrier breaks and Sn contamination of the Cu stabilizer during the heat treatment. Furthermore, the short twist pitch CICC made from Bronze Process strands preserved diffusion barrier integrity.« less

  4. A versatile small form factor twisted-pair TFC FMC for MTCA AMCs

    NASA Astrophysics Data System (ADS)

    Meder, L.; Lebedev, J.; Becker, J.

    2017-03-01

    In continuous readout systems of particle physics experiments, the provision of a common clock and time reference and the distribution of critical low latency messages to the processing and fronted layers of the readout are crucial tasks. In the context of the Compressed Baryonic Matter (CBM) experiment, a versatile small form factor Timing and Fast-Control (TFC) interfacing FPGA Mezzanine Card (FMC) was developed, offering bidirectional twisted-pair (TP) links for the communication between TFC nodes. Also a versatile clocking including voltage controlled oscillators and a connection to the telecommunication clock lines of mTCA crates are available. Being designed for both TFC Master and Slaves, the card allows rapid system developments without additional Slave hardware circuits. Measurements show that it is possible to transmit over cable lengths of 25 m at a rate of 240 Mbit/s for all data channels simultaneously. A TFC Master-Slave system using two of these cards can be synchronized with a precision of ±10 ps to an user-defined phase setpoint.

  5. Contact force and mechanical loss of multistage cable under tension and bending

    NASA Astrophysics Data System (ADS)

    Ru, Yanyun; Yong, Huadong; Zhou, Youhe

    2016-10-01

    A theoretical model for calculating the stress and strain states of cabling structures with different loadings has been developed in this paper. We solve the problem for the first- and second-stage cable with tensile or bending strain. The contact and friction forces between the strands are presented by two-dimensional contact model. Several theoretical models have been proposed to verify the results when the triplet subjected to the tensile strain, including contact force, contact stresses, and mechanical loss. It is found that loadings will affect the friction force and the mechanical loss of the triplet. The results show that the contact force and mechanical loss are dependent on the twist pitch. A shorter twist pitch can lead to higher contact force, while the trend of mechanical loss with twist pitch is complicated. The mechanical loss may be reduced by adjusting the twist pitch reasonably. The present model provides a simple analysis method to investigate the mechanical behaviors in multistage-structures under different loads.

  6. Reducing Magnetic Fields Around Power Cables

    NASA Technical Reports Server (NTRS)

    Sargent, Noel B.; Gitelman, Florida; Pongracz-Bartha, Edward; Spalding, John

    1993-01-01

    Four power conductors arranged symmetrically about fifth grounded conductor. Four current-carrying wires arranged symmetrically around central grounded wire that nominally carries no current. In comparison with other cable configurations, this one results in smaller magnetic fields around cable. Technique for use when size of wires in cable makes twisting impractical.

  7. Critical current degradation behaviour of GdBCO CC tapes in pure torsion and combined tension-torsion modes

    NASA Astrophysics Data System (ADS)

    Gorospe, Alking; Bautista, Zhierwinjay; Shin, Hyung-Seop

    2016-10-01

    Coated conductor (CC) tapes utilized in high-current-density superconducting cables are commonly subjected to different loading modes, primarily torsion and tension especially in the case of twisted stacked-tape cable. Torsion load can occur due to twisting along the length or when winding the CC tapes around a former, while tension load can occur due to pre-tension when coiled and as a hoop stress when the coil is energized. In this study, electromechanical properties of single CC tapes under torsion load were investigated using a new test apparatus. The results could provide basic information for cable designers to fully characterize stacked cables. Copper-electroplated and brass-laminated CC tapes fabricated with different deposition techniques were subjected to pure torsion and combined tension-torsion loading. The critical current, I c degradation behaviours of CC tapes under torsional deformation were examined. Also, the effect of further external lamination on the I c degradation behaviour of the CC tapes under such loading conditions was investigated. In the case of the combined tension-torsion test, short samples were subjected to twist pitches of 200 mm and 100 mm. Critical parameters including reversible axial stress and strain in such twist pitch conditions were also investigated.

  8. Wire harness twisting aid

    NASA Technical Reports Server (NTRS)

    Casey, E. J.; Commadore, C. C.; Ingles, M. E.

    1980-01-01

    Long wire bundles twist into uniform spiral harnesses with help of simple apparatus. Wires pass through spacers and through hand-held tool with hole for each wire. Ends are attached to low speed bench motor. As motor turns, operator moves hand tool away forming smooth twists in wires between motor and tool. Technique produces harnesses that generate less radio-frequency interference than do irregularly twisted cables.

  9. Cables and crosstalk

    NASA Astrophysics Data System (ADS)

    Paul, Clayton R.

    1991-06-01

    Crosstalk is the unintentional electromagnetic coupling between circuits which are connected by parallel conductors that lie in close proximity to each other. Some examples are wires in cable harnesses or metallic lands on printed-circuit boards (PCB's). This unintended interaction between two or more circuits via their electromagnetic fields can cause interference problems. Signals from one circuit that couple to another circuit appear at the terminals of the devices that are interconnected by the wires. If these signals are of sufficient magnitude or spectral content, they may cause unintended operation of the device or a degradation in its performance. A summary of the standard models used for predicting crosstalk in various types of configurations is presented. The discussion focusses on the relative accuracies, regions of applicability, and computational complexity of the models. A simple explanation of the ability (or inability) of shielded wires and twisted pairs of wires to reduce the crosstalk is also given.

  10. Comparison of split double and triple twists in pair figure skating.

    PubMed

    King, Deborah L; Smith, Sarah L; Brown, Michele R; McCrory, Jean L; Munkasy, Barry A; Scheirman, Gary I

    2008-05-01

    In this study, we compared the kinematic variables of the split triple twist with those of the split double twist to help coaches and scientists understand these landmark pair skating skills. High-speed video was taken during the pair short and free programmes at the 2002 Salt Lake City Winter Olympics and the 2003 International Skating Union Grand Prix Finals. Three-dimensional analyses of 14 split double twists and 15 split triple twists from eleven pairs were completed. In spite of considerable variability in the performance variables among the pairs, the main difference between the split double twists and split triple twists was an increase in rotational rate. While eight of the eleven pairs relied primarily on an increased rotational rate to complete the split triple twist, three pairs employed a combined strategy of increased rotational rate and increased flight time due predominantly to delayed or lower catches. These results were similar to observations of jumps in singles skating for which the extra rotation is typically due to an increase in rotational velocity; increases in flight time come primarily from delayed landings as opposed to additional height during flight. Combining an increase in flight time and rotational rate may be a good strategy for completing the split triple twist in pair skating.

  11. Rotating Connection for Electrical Cables

    NASA Technical Reports Server (NTRS)

    Manges, D. R.

    1986-01-01

    Cable reel provides electrical connections between fixed structure and rotating one. Reel carries power and signal lines while allowing rotating structure to turn up to 360 degrees with respect to fixed structure. Reel replaces sliprings. Can be used to electrically connect arm of robot with body. Reel releases cable to rotating part as it turns and takes up cable as rotating part comes back to its starting position, without tangling, twisting, or kinking.

  12. Optimization of ITER Nb3Sn CICCs for coupling loss, transverse electromagnetic load and axial thermal contraction

    NASA Astrophysics Data System (ADS)

    Nijhuis, A.; van Lanen, E. P. A.; Rolando, G.

    2012-01-01

    The ITER cable-in-conduit conductors (CICCs) are built up from sub-cable bundles, wound in different stages, which are twisted to counter coupling loss caused by time-changing external magnet fields. The selection of the twist pitch lengths has major implications for the performance of the cable in the case of strain-sensitive superconductors, i.e. Nb3Sn, as the electromagnetic and thermal contraction loads are large but also for the heat load from the AC coupling loss. At present, this is a great challenge for the ITER central solenoid (CS) CICCs and the solution presented here could be a breakthrough for not only the ITER CS but also for CICC applications in general. After proposing longer twist pitches in 2006 and successful confirmation by short sample tests later on, the ITER toroidal field (TF) conductor cable pattern was improved accordingly. As the restrictions for coupling loss are more demanding for the CS conductors than for the TF conductors, it was believed that longer pitches would not be applicable for the conductors in the CS coils. In this paper we explain how, with the use of the TEMLOP model and the newly developed models JackPot-ACDC and CORD, the design of a CICC can be improved appreciably, particularly for the CS conductor layout. For the first time a large improvement is predicted not only providing very low sensitivity to electromagnetic load and thermal axial cable stress variations but at the same time much lower AC coupling loss. Reduction of the transverse load and warm-up-cool-down degradation can be reached by applying longer twist pitches in a particular sequence for the sub-stages, offering a large cable transverse stiffness, adequate axial flexibility and maximum allowed lateral strand support. Analysis of short sample (TF conductor) data reveals that increasing the twist pitch can lead to a gain of the effective axial compressive strain of more than 0.3% with practically no degradation from bending. This is probably explained by the distinct difference in mechanical response of the cable during axial contraction for short and long pitches. For short pitches periodic bending in different directions with relatively short wavelength is imposed because of a lack of sufficient lateral restraint of radial pressure. This can lead to high bending strain and eventually buckling. Whereas for cables with long twist pitches, the strands are only able to react as coherent bundles, being tightly supported by the surrounding strands, providing sufficient lateral restraint of radial pressure in combination with enough slippage to avoid single strand bending along detrimental short wavelengths. Experimental evidence of good performance was already provided with the test of the long pitch TFPRO2-OST2, which is still until today, the best ITER-type cable to strand performance ever without any cyclic load (electromagnetic and thermal contraction) degradation. For reduction of the coupling loss, specific choices of the cabling twist sequence are needed to minimize the area of linked strands and bundles that are coupled and form loops with the applied changing magnetic field, instead of simply avoiding longer pitches. In addition we recommend increasing the wrap coverage of the CS conductor from 50% to at least 70%. A larger wrap coverage fraction enhances the overall strand bundle lateral restraint. The long pitch design seems the best solution to optimize the ITER CS conductor within the given restrictions of the present coil design envelope, only allowing marginal changes. The models predict significant improvement against strain sensitivity and substantial decrease of the AC coupling loss in Nb3Sn CICCs, but also for NbTi CICCs minimization of the coupling loss can obviously be achieved. Although the success of long pitches to transverse load degradation was already demonstrated, the prediction of the elegant innovative combination with low coupling loss needs to be validated by a short sample test.

  13. ATM over hybrid fiber-coaxial cable networks: practical issues in deploying residential ATM services

    NASA Astrophysics Data System (ADS)

    Laubach, Mark

    1996-11-01

    Residential broadband access network technology based on asynchronous transfer modem (ATM) will soon reach commercial availability. The capabilities provided by ATM access network promise integrated services bandwidth available in excess of those provided by traditional twisted pair copper wire public telephone networks. ATM to the side of the home placed need quality of service capability closest to the subscriber allowing immediate support for Internet services and traditional voice telephony. Other services such as desktop video teleconferencing and enhanced server-based application support can be added as part of future evolution of the network. Additionally, advanced subscriber home networks can be supported easily. This paper presents an updated summary of the standardization efforts for the ATM over HFC definition work currently taking place in the ATM forum's residential broadband working group and the standards progress in the IEEE 802.14 cable TV media access control and physical protocol working group. This update is fundamental for establishing the foundation for delivering ATM-based integrated services via a cable TV network. An economic model for deploying multi-tiered services is presenting showing that a single-tier service is insufficient for a viable cable operator business. Finally, the use of an ATM based system lends itself well to various deployment scenarios of synchronous optical networks (SONET).

  14. Cerclage handling for improved fracture treatment. A biomechanical study on the twisting procedure.

    PubMed

    Wähnert, D; Lenz, M; Schlegel, U; Perren, S; Windolf, M

    2011-01-01

    Twisting is clinically the most frequently applied method for tightening and maintaining cerclage fixation. The twisting procedure is controversially discussed. Several factors during twisting affect the mechanical behaviour of the cerclage. This in vitro study investigated the influence of different parameters of the twisting procedure on the fixation strength of the cerclage in an experimental setup with centripetal force application. Cortical half shells of the femoral shaft were mounted on a testing fixture. 1.0 mm, 1.25 mm and 1.5 mm stainless ste- el wire cerclages as well as a 1.0mm cable cerclage were applied to the bone. Pretension of the cerclage during the installation was measured during the locking procedure. Subsequently, cyclic testing was performed up to failure. Higher pretension could be achieved with increasing wire diameter. However, with larger wire diameter the drop of pre- tension due to the bending and cutting the twist also increased. The cable cerclage showed the highest pretension after locking. Cerclages twisted under traction revealed significantly higher initial cerclage tension. Plastically deformed twists offered higher cerclage pretension compared to twists which were deformed in the elastic region of the material. Cutting the wire within the twist caused the highest loss of cerclage tension (44% initial tension) whereas only 11 % was lost when cutting the wire ends separately. The bending direction of the twist significantly influenced the cerclage pretension. 45% pretension was lost in forward bending of the twist, 53% in perpendicular bending and 90% in backward bending. Several parameters affect the quality of a cerclage fixation. Adequate installation of cerclage wires could markedly improve the clinical outcome of cerclage.

  15. Wire in the Cable-Driven System of Surgical Robot

    NASA Astrophysics Data System (ADS)

    Wang, X. F.; Lv, N.; Mu, H. Z.; Xue, L. J.

    2017-07-01

    During the evolution of the surgical robot, cable plays an important role. It translates motion and force precisely from surgeon’s hand to the tool’s tips. In the paper, the vertical wires, the composition of cable, are mathematically modeled from a geometric point of view. The cable structure and tension are analyzed according to the characteristics of wire screw twist. The structural equations of the wires in different positions are derived for both non-bent cable and bent cable, respectively. The bending moment formula of bent cable is also obtained. This will help researchers find suitable cable and design more matched pulley.

  16. Interstrand contact resistances of Bi-2212 Rutherford cables for SMES

    NASA Astrophysics Data System (ADS)

    Kawagoe, A.; Kawabata, Y.; Sumiyoshi, F.; Nagaya, S.; Hirano, N.

    2006-10-01

    Interstrand contact resistances of Bi-2212 Rutherford cables for SMES coils were evaluated from a comparison between measured data and 2D-FEM analyses on interstrand coupling losses in these cables. The cables were composed of 30 non-twisted Bi-2212 strands with a diameter of 0.81 mm and a cable twist pitch of 90 mm. Three samples were measured; one of them had NiCr cores and the others had no cores. One of the latter two samples repeatedly experienced bending. The interstrand coupling losses were measured in liquid helium for the straight samples under transverse ac ripple magnetic fields superposed on dc bias magnetic fields. The transverse magnetic field was applied to the samples in directions both perpendicular and parallel to the flat face of the cable. The effect of the bending on the interstrand coupling losses could be neglected for the non-cored samples. The interstrand coupling losses of NiCr cored sample decreased by about 30% compared with the non-cored samples, in case the direction of the transverse magnetic fields applied to the cable is perpendicular to the flat face of the cable. Using these results and 2D-FEM analyses, taking into account that interstrand contact conditions vary from the center to the edge in the cross-section of cables, gave us the conclusion that the between side-by-side strands contact with metallurgical bond only in both edges of the cables.

  17. Rotary-To-Axial Motion Converter For Valve

    NASA Technical Reports Server (NTRS)

    Reinicke, Robert H.; Mohtar, Rafic

    1991-01-01

    Nearly frictionless mechanism converts rotary motion into axial motion. Designed for use in electronically variable pressure-regulator valve. Changes rotary motion imparted by motor into translation that opens and closes valve poppet. Cables spaced equidistantly around edge of fixed disk support movable disk. As movable disk rotated, cables twist, lifting it. When rotated in opposite direction, cables untwist, lowering it. Spider disk helps to prevent cables from tangling. Requires no lubrication and insensitive to contamination in fluid flowing through valve.

  18. New design of cable-in-conduit conductor for application in future fusion reactors

    NASA Astrophysics Data System (ADS)

    Qin, Jinggang; Wu, Yu; Li, Jiangang; Liu, Fang; Dai, Chao; Shi, Yi; Liu, Huajun; Mao, Zhehua; Nijhuis, Arend; Zhou, Chao; Yagotintsev, Konstantin A.; Lubkemann, Ruben; Anvar, V. A.; Devred, Arnaud

    2017-11-01

    The China Fusion Engineering Test Reactor (CFETR) is a new tokamak device whose magnet system includes toroidal field, central solenoid (CS) and poloidal field coils. The main goal is to build a fusion engineering tokamak reactor with about 1 GW fusion power and self-sufficiency by blanket. In order to reach this high performance, the magnet field target is 15 T. However, the huge electromagnetic load caused by high field and current is a threat for conductor degradation under cycling. The conductor with a short-twist-pitch (STP) design has large stiffness, which enables a significant performance improvement in view of load and thermal cycling. But the conductor with STP design has a remarkable disadvantage: it can easily cause severe strand indentation during cabling. The indentation can reduce the strand performance, especially under high load cycling. In order to overcome this disadvantage, a new design is proposed. The main characteristic of this new design is an updated layout in the triplet. The triplet is made of two Nb3Sn strands and one soft copper strand. The twist pitch of the two Nb3Sn strands is large and cabled first. The copper strand is then wound around the two superconducting strands (CWS) with a shorter twist pitch. The following cable stages layout and twist pitches are similar to the ITER CS conductor with STP design. One short conductor sample with a similar scale to the ITER CS was manufactured and tested with the Twente Cable Press to investigate the mechanical properties, AC loss and internal inspection by destructive examination. The results are compared to the STP conductor (ITER CS and CFETR CSMC) tests. The results show that the new conductor design has similar stiffness, but much lower strand indentation than the STP design. The new design shows potential for application in future fusion reactors.

  19. Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: III. The importance of strand surface roughness in long twist pitch conductors

    DOE PAGES

    Sanabria, Charlie; Lee, Peter J.; Starch, William; ...

    2016-05-31

    As part of the ITER conductor qualification process, 3 m long Cable-in-Conduit Conductors (CICCs) were tested at the SULTAN facility under conditions simulating ITER operation so as to establish the current sharing temperature, T cs, as a function of multiple full Lorentz force loading cycles. After a comprehensive evaluation of both the Toroidal Field (TF) and the Central Solenoid (CS) conductors, it was found that T cs degradation was common in long twist pitch TF conductors while short twist pitch CS conductors showed some T cs increase. However, one kind of TF conductors containing superconducting strand fabricated by the Bochvarmore » Institute of Inorganic Materials (VNIINM) avoided T cs degradation despite having long twist pitch. In our earlier metallographic autopsies of long and short twist pitch CS conductors, we observed a substantially greater transverse strand movement under Lorentz force loading for long twist pitch conductors, while short twist pitch conductors had negligible transverse movement. With help from the literature, we concluded that the transverse movement was not the source of T cs degradation but rather an increase of the compressive strain in the Nb 3Sn filaments possibly induced by longitudinal movement of the wires. Like all TF conductors this TF VNIINM conductor showed large transverse motions under Lorentz force loading, but Tcs actually increased, as in all short twist pitch CS conductors. We here propose that the high surface roughness of the VNIINM strand may be responsible for the suppression of the compressive strain enhancement (characteristic of long twist pitch conductors). Furthermore, it appears that increasing strand surface roughness could improve the performance of long twist pitch CICCs.« less

  20. Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: III. The importance of strand surface roughness in long twist pitch conductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sanabria, Charlie; Lee, Peter J.; Starch, William

    As part of the ITER conductor qualification process, 3 m long Cable-in-Conduit Conductors (CICCs) were tested at the SULTAN facility under conditions simulating ITER operation so as to establish the current sharing temperature, T cs, as a function of multiple full Lorentz force loading cycles. After a comprehensive evaluation of both the Toroidal Field (TF) and the Central Solenoid (CS) conductors, it was found that T cs degradation was common in long twist pitch TF conductors while short twist pitch CS conductors showed some T cs increase. However, one kind of TF conductors containing superconducting strand fabricated by the Bochvarmore » Institute of Inorganic Materials (VNIINM) avoided T cs degradation despite having long twist pitch. In our earlier metallographic autopsies of long and short twist pitch CS conductors, we observed a substantially greater transverse strand movement under Lorentz force loading for long twist pitch conductors, while short twist pitch conductors had negligible transverse movement. With help from the literature, we concluded that the transverse movement was not the source of T cs degradation but rather an increase of the compressive strain in the Nb 3Sn filaments possibly induced by longitudinal movement of the wires. Like all TF conductors this TF VNIINM conductor showed large transverse motions under Lorentz force loading, but Tcs actually increased, as in all short twist pitch CS conductors. We here propose that the high surface roughness of the VNIINM strand may be responsible for the suppression of the compressive strain enhancement (characteristic of long twist pitch conductors). Furthermore, it appears that increasing strand surface roughness could improve the performance of long twist pitch CICCs.« less

  1. Analysis of current distribution in a large superconductor

    NASA Astrophysics Data System (ADS)

    Hamajima, Takataro; Alamgir, A. K. M.; Harada, Naoyuki; Tsuda, Makoto; Ono, Michitaka; Takano, Hirohisa

    An imbalanced current distribution which is often observed in cable-in-conduit (CIC) superconductors composed of multistaged, triplet type sub-cables, can deteriorate the performance of the coils. It is, hence very important to analyze the current distribution in a superconductor and find out methods to realize a homogeneous current distribution in the conductor. We apply magnetic flux conservation in a loop contoured by electric center lines of filaments in two arbitrary strands located on adjacent layers in a coaxial multilayer superconductor, and thereby analyze the current distribution in the conductor. A generalized formula governing the current distribution can be described as explicit functions of the superconductor construction parameters, such as twist pitch, twist direction and radius of individual layer. We numerically analyze a homogeneous current distribution as a function of the twist pitches of layers, using the fundamental formula. Moreover, it is demonstrated that we can control current distribution in the coaxial superconductor.

  2. Development and preclinical testing of a new tension-band device for the spine: the Loop system.

    PubMed

    Garner, Matthew D; Wolfe, Steven J; Kuslich, Stephen D

    2002-10-01

    Wire sutures, cerclage constructs, and tension bands have been used for many years in orthopedic surgery. Spinous process and sublaminar wires and other strands or cables are used in the spine to re-establish stability of the posterior spinal ligament complex. Rigid monofilament wires often fail due to weakening created during twisting or wrapping. Stronger metal cables do not conform well to bony surfaces. Polyethylene cables have higher fatigue strength than metal cables. The Loop cable is a pliable, radiolucent, polyethylene braid. Creep of the Loop/locking clip construct is similar to metal cable constructs using crimps. Both systems have less creep than knotted polyethylene cable constructs.

  3. Optical Access Networks

    NASA Astrophysics Data System (ADS)

    Zheng, Jun; Ansari, Nirwan

    2005-02-01

    Call for Papers: Optical Access Networks With the wide deployment of fiber-optic technology over the past two decades, we have witnessed a tremendous growth of bandwidth capacity in the backbone networks of today's telecommunications infrastructure. However, access networks, which cover the "last-mile" areas and serve numerous residential and small business users, have not been scaled up commensurately. The local subscriber lines for telephone and cable television are still using twisted pairs and coaxial cables. Most residential connections to the Internet are still through dial-up modems operating at a low speed on twisted pairs. As the demand for access bandwidth increases with emerging high-bandwidth applications, such as distance learning, high-definition television (HDTV), and video on demand (VoD), the last-mile access networks have become a bandwidth bottleneck in today's telecommunications infrastructure. To ease this bottleneck, it is imperative to provide sufficient bandwidth capacity in the access networks to open the bottleneck and thus present more opportunities for the provisioning of multiservices. Optical access solutions promise huge bandwidth to service providers and low-cost high-bandwidth services to end users and are therefore widely considered the technology of choice for next-generation access networks. To realize the vision of optical access networks, however, many key issues still need to be addressed, such as network architectures, signaling protocols, and implementation standards. The major challenges lie in the fact that an optical solution must be not only robust, scalable, and flexible, but also implemented at a low cost comparable to that of existing access solutions in order to increase the economic viability of many potential high-bandwidth applications. In recent years, optical access networks have been receiving tremendous attention from both academia and industry. A large number of research activities have been carried out or are now underway this hot area. The purpose of this feature issue is to expose the networking community to the latest research breakthroughs and progresses in the area of optical access networks.

  4. 7 CFR 1755.200 - RUS standard for splicing copper and fiber optic cables.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...) Color coded plastic tie wraps shall be placed loosely around each binder group of cables before splicing... conform to the same color designations as the binder ribbons. Twisted wire pigtails shall not be used to identify binder groups due to potential transmission degradation. (ii) The standard insulation color code...

  5. Twisted complex superfluids in optical lattices

    PubMed Central

    Jürgensen, Ole; Sengstock, Klaus; Lühmann, Dirk-Sören

    2015-01-01

    We show that correlated pair tunneling drives a phase transition to a twisted superfluid with a complex order parameter. This unconventional superfluid phase spontaneously breaks the time-reversal symmetry and is characterized by a twisting of the complex phase angle between adjacent lattice sites. We discuss the entire phase diagram of the extended Bose—Hubbard model for a honeycomb optical lattice showing a multitude of quantum phases including twisted superfluids, pair superfluids, supersolids and twisted supersolids. Furthermore, we show that the nearest-neighbor interactions lead to a spontaneous breaking of the inversion symmetry of the lattice and give rise to dimerized density-wave insulators, where particles are delocalized on dimers. For two components, we find twisted superfluid phases with strong correlations between the species already for surprisingly small pair-tunneling amplitudes. Interestingly, this ground state shows an infinite degeneracy ranging continuously from a supersolid to a twisted superfluid. PMID:26345721

  6. Roebel assembled coated conductor cables (RACC): Ac-Losses and current carrying potential

    NASA Astrophysics Data System (ADS)

    Frank, A.; Heller, R.; Goldacker, W.; Kling, A.; Schmidt, C.

    2008-02-01

    Low ac-loss HTS cables for transport currents well above 1 kA are required for application in transformers and generators and are taken into consideration for future generations of fusion reactor coils. Coated conductors (CC) are suitable candidates for high field application at an operation temperature in the range 50-77 K. Ac-field applications require cables with low ac-losses and hence twisting of the individual strands. We solved this problem using the Roebel technique. Short lengths of Roebel bar cables were prepared from industrial DyBCO and YBCO-CC. Meander shaped tapes of 4 or 5 mm width with twist pitches of 123 or 127 mm were cut from the 10 or 12 mm wide CC tapes using a specially designed tool. Eleven or twelve of these strands were assembled to a cable. The electrical and mechanical connection of the tapes was achieved using a silver powder filled conductive epoxy resin. Ac-losses of a short sample in an external ac-field were measured as a function of frequency and field amplitude as well as the coupling current decay time constant. We discuss the results in terms of available theories and compare measured time constants in transverse field with measured coupling losses. Finally the potential of this cable type for ac-use is discussed with respect to ac-losses and current carrying capability.

  7. Verification of Small Hole Theory for Application to Wire Chaffing Resulting in Shield Faults

    NASA Technical Reports Server (NTRS)

    Schuet, Stefan R.; Timucin, Dogan A.; Wheeler, Kevin R.

    2011-01-01

    Our work is focused upon developing methods for wire chafe fault detection through the use of reflectometry to assess shield integrity. When shielded electrical aircraft wiring first begins to chafe typically the resulting evidence is small hole(s) in the shielding. We are focused upon developing algorithms and the signal processing necessary to first detect these small holes prior to incurring damage to the inner conductors. Our approach has been to develop a first principles physics model combined with probabilistic inference, and to verify this model with laboratory experiments as well as through simulation. Previously we have presented the electromagnetic small-hole theory and how it might be applied to coaxial cable. In this presentation, we present our efforts to verify this theoretical approach with high-fidelity electromagnetic simulations (COMSOL). Laboratory observations are used to parameterize the computationally efficient theoretical model with probabilistic inference resulting in quantification of hole size and location. Our efforts in characterizing faults in coaxial cable are subsequently leading to fault detection in shielded twisted pair as well as analysis of intermittent faulty connectors using similar techniques.

  8. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  9. Debris protection cover assembly for cable connectors

    NASA Technical Reports Server (NTRS)

    Yovan, Roger D. (Inventor)

    1999-01-01

    A protective cover assembly for an end of a cable connector having a cable housing that encloses a plurality of connective pins or sockets and that satisfies all requirements for space applications. A connector body flange is formed at the extremity of a cable and is positioned so that it may register with a corresponding connector body flange on the end of a companion cable to which a connection is to be made, one cable end having cable lead pins and the companion cable end having lead sockets with which the pins register. A latch mechanism having a latch housing is received in the connector body flange and a crank connected to a manually rotatable cap actuates a spring-loaded latch element that is engageable with a connector body flange to secure or to release the cover assembly with the simple twisting motion of the cap, thereby simplifying the task of effecting coupling and decoupling of the cable ends.

  10. A microcomputer network for control of a continuous mining machine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schiffbauer, W.H.

    1993-12-31

    This report details a microcomputer-based control and monitoring network that was developed in-house by the U.S. Bureau of Mines and installed on a continuous mining machine. The network consists of microcomputers that are connected together via a single twisted-pair cable. Each microcomputer was developed to provide a particular function in the control process. Machine-mounted microcomputers, in conjunction with the appropriate sensors, provide closed-loop control of the machine, navigation, and environmental monitoring. Off-the-machine microcomputers provide remote control of the machine, sensor status, and a connection to the network so that external computers can access network data and control the continuous miningmore » machine. Because of the network`s generic structure, it can be installed on most mining machines.« less

  11. Wide tracking range, auto ranging, low jitter phase lock loop for swept and fixed frequency systems

    DOEpatents

    Kerner, Thomas M.

    2001-01-01

    The present invention provides a wide tracking range phase locked loop (PLL) circuit that achieves minimal jitter in a recovered clock signal, regardless of the source of the jitter (i.e. whether it is in the source or the transmission media). The present invention PLL has automatic harmonic lockout detection circuitry via a novel lock and seek control logic in electrical communication with a programmable frequency discriminator and a code balance detector. (The frequency discriminator enables preset of a frequency window of upper and lower frequency limits to derive a programmable range within which signal acquisition is effected. The discriminator works in combination with the code balance detector circuit to minimize the sensitivity of the PLL circuit to random data in the data stream). In addition, the combination of a differential loop integrator with the lock and seek control logic obviates a code preamble and guarantees signal acquisition without harmonic lockup. An adaptive cable equalizer is desirably used in combination with the present invention PLL to recover encoded transmissions containing a clock and/or data. The equalizer automatically adapts to equalize short haul cable lengths of coaxial and twisted pair cables or wires and provides superior jitter performance itself. The combination of the equalizer with the present invention PLL is desirable in that such combination permits the use of short haul wires without significant jitter.

  12. Theoretical analysis for the mechanical behavior caused by an electromagnetic cycle in ITER Nb3Sn cable-in-conduit conductors

    NASA Astrophysics Data System (ADS)

    Yue, Donghua; Zhang, Xingyi; Zhou, You-He

    2018-02-01

    The central solenoid (CS) is one of the key components of the International Thermonuclear Experimental Reactor (ITER) tokamak and which is often considered as the heart of this fusion reactor. This solenoid will be built by using Nb3Sn cable-in-conduit conductors (CICC), capable of generating a 13 T magnetic field. In order to assess the performance of the Nb3Sn CICC in nearly the ITER condition, many short samples have been evaluated at the SULTAN test facility (the background magnetic field is of 10.85 T with the uniform length of 400 mm at 1% homogeneity) in Centre de Recherches en Physique des Plasma (CRPP). It is found that the samples with pseudo-long twist pitch (including baseline specimens) show a significant degradation in the current-sharing temperature (Tcs), while the qualification tests of all short twist pitch (STP) samples, which show no degradation versus electromagnetic cycling, even exhibits an increase of Tcs. This behavior was perfectly reproduced in the coil experiments at the central solenoid model coil (CSMC) facility last year. In this paper, the complex structure of the Nb3Sn CICC would be simplified into a wire rope consisting of six petals and a cooling spiral. An analytical formula for the Tcs behavior as a function of the axial strain of the cable is presented. Based on this, the effects of twist pitch, axial and transverse stiffness, thermal mismatch, cycling number, magnetic distribution, etc., on the axial strain are discussed systematically. The calculated Tcs behavior with cycle number show consistency with the previous experimental results qualitatively and quantitatively. Lastly, we focus on the relationship between Tcs and axial strain of the cable, and we conclude that the Tcs behavior caused by electromagnetic cycles is determined by the cable axial strain. Once the cable is in a compression situation, this compression strain and its accumulation would lead to the Tcs degradation. The experimental observation of the Tcs enhancement in the CS STP samples should be considered as a contribution of the shorter length of the high field zone in SULTAN and CSMC devices, as well as the tight cable structure.

  13. Design and fabrication of the 20 km/10 kV electromechanical tether for TSS-1 using high impact conductor (Hiwire)

    NASA Technical Reports Server (NTRS)

    Scala, E.; Bentley, D. P.; Marshall, L. S.

    1986-01-01

    The development of a 20-km electromechanical tether for the tethered satellite system (TSS) is described. The basic design requirements for electromagnetic cables and for conductors in cables subject to stresses and cyclic loading are discussed. The tether fabricatioon procedures involve: (1) conductor twisting around the core, (2) insulation extrusion, (3) strength member braiding, and (4) protective jacket braiding.

  14. Fundamental Design based on Current Distribution in Coaxial Multi-Layer Cable-in-Conduit Conductor

    NASA Astrophysics Data System (ADS)

    Hamajima, Takataro; Tsuda, Makoto; Yagai, Tsuyoshi; Takahata, Kazuya; Imagawa, Shinsaku

    An imbalanced current distribution is often observed in cable-in-conduit (CIC) superconductors which are composed of multi-staged, triplet type sub-cables, and hence deteriorates the performance of the coils. Therefore, since it is very important to obtain a homogeneous current distribution in the superconducting strands, we propose a coaxial multi-layer type CIC conductor. We use a circuit model for all layers in the coaxial multi-layer CIC conductor, and derive a generalized formula governing the current distribution as explicit functions of the superconductor construction parameters, such as twist pitch, twist direction, radius of each layer, and number of superconducting (SC) strands and copper (Cu) strands. We apply the formula to design the coaxial multi-layer CIC which has the same number of SC strands and Cu strands of the CIC for Central Solenoid of ITER. We can design three kinds of the coaxial multi-layer CIC depending on distribution of SC and Cu strands on all layers. It is shown that the SC strand volume should be optimized as a function of SC and Cu strand distribution on the layers.

  15. Robotic Joints Support Horses and Humans

    NASA Technical Reports Server (NTRS)

    2008-01-01

    A rehabilitative device first featured in Spinoff 2003 is not only helping human patients regain the ability to walk, but is now helping our four-legged friends as well. The late James Kerley, a prominent Goddard Space Flight Center researcher, developed cable-compliant mechanisms in the 1980s to enable sounding rocket assemblies and robots to grip or join objects. In cable-compliant joints (CCJs), short segments of cable connect structural elements, allowing for six directions of movement, twisting, alignment, and energy damping. Kerley later worked with Goddard s Wayne Eklund and Allen Crane to incorporate the cable-compliant mechanisms into a walker for human patients to support the pelvis and imitate hip joint movement.

  16. Fluid flow rate control device

    NASA Technical Reports Server (NTRS)

    Reinicke, Robert H. (Inventor); Mohtar, Rafic (Inventor); Nelson, Richard O. (Inventor)

    1991-01-01

    A poppet is modulated between closed and full open positions by a brushless DC motor operating magnetically through a housing to drive a permanent magnet rotor which carries the poppet. The rotor is supported on several parallel cables which are stationarily fixed at one end and attached to the rotor at the other end, whereby rotation of the rotor twists the cables, causing axial foreshortening and axial translation of rotor and poppet. Axial translation is enhanced by placing a spacer between the cables, intermediate their ends. A permanent magnet ring is disposed around the valve seat directly axially attracting the rotor to a valve closed position.

  17. Biomechanical performance of different cable and wire cerclage configurations.

    PubMed

    Lenz, Mark; Perren, Stephan Marcel; Richards, Robert Geoff; Mückley, Thomas; Hofmann, Gunther Olaf; Gueorguiev, Boyko; Windolf, Markus

    2013-01-01

    Cerclage technology is regaining interest due to the increasing number of periprosthetic fractures. Different wiring techniques have been formerly proposed and have hibernated over years. Hereby, they are compared to current cerclage technology. Seven groups (n = 6) of different cable cerclage (Ø1.7 mm, crimp closure) configurations (one single cerclage looped once around the shells, one single cerclage looped twice, two cerclages each looped once) and solid wire cerclages (Ø1.5 mm, twist closure) (same configurations as cable cerclages, and two braided wires, twisted around each other looped once) fixed two cortical half shells of human femoral shaft mounted on a testing jig. Sinusoidal cyclic loading with constantly increasing force (0.1 N/cycle) was applied starting at 50 N peak load. Cerclage pretension (P), load leading to onset of plastic deformation (D) and load at total failure (T) were identified. Statistical differences between the groups were detected by univariate ANOVA. Double looped cables (P442N ± 129; D1334N ± 319; T2734N ± 330) performed significantly better (p < 0.05) than single looped cables (P292N ± 56; D646N ± 108; T1622N ± 171) and were comparable to two single cables (P392N ± 154; D1191N ± 334; T2675N ± 361). Double looped wires (P335N ± 49; D752N ± 119; T1359N ± 80) were significantly better (p < 0.05) than single looped wires (P181N ± 16; D343N ± 33; T606N ± 109) and performed similarly to single looped cables. Braided wires (P119N ± 26; D225N ± 55; T919N ± 197) exhibited early loss of pretension and plastic deformation. Double looped cerclages provided a better fixation stability compared to a single looped cerclage. Double looped wires were comparable to a single looped cable. The use of braided wires could not be recommended mechanically.

  18. Comparison study of cable geometries and superconducting tape layouts for high-temperature superconductor cables

    NASA Astrophysics Data System (ADS)

    Ta, Wurui; Shao, Tianchong; Gao, Yuanwen

    2018-04-01

    High-temperature superconductor (HTS) rare-earth-barium-copper-oxide (REBCO) tapes are very promising for use in high-current cables. The cable geometry and the layout of the superconducting tapes are directly related to the performance of the HTS cable. In this paper, we use numerical methods to perform a comparison study of multiple-stage twisted stacked-tape cable (TSTC) conductors to find better cable structures that can both improve the critical current and minimize the alternating current (AC) losses of the cable. The sub-cable geometry is designed to have a stair-step shape. Three superconducting tape layouts are chosen and their transport performance and AC losses are evaluated. The magnetic field and current density profiles of the cables are obtained. The results show that arrangement of the superconducting tapes from the interior towards the exterior of the cable based on their critical current values in descending order can enhance the cable's transport capacity while significantly reducing the AC losses. These results imply that cable transport capacity improvements can be achieved by arranging the superconducting tapes in a manner consistent with the electromagnetic field distribution. Through comparison of the critical currents and AC losses of four types of HTS cables, we determine the best structural choice among these cables.

  19. Distributed torsion sensor based on cascaded coaxial cable Fabry-Perot interferometers

    NASA Astrophysics Data System (ADS)

    Cheng, Baokai; Zhu, Wenge; Hua, Liwei; Liu, Jie; Li, Yurong; Nygaard, Runar; Xiao, Hai

    2016-07-01

    Cascaded coaxial cable Fabry-Perot interferometers (FPI) are studied and demonstrated for distributed torsion measurement. Multiple weak reflectors are implemented on a coaxial cable so that any two consecutive reflectors can form a Fabry-Perot cavity. By fixing the cable sensor in a helical form on a shaft, the distributed torsion of the shaft can be measured by the cascaded Fabry-Perot cavities. A test on a single section shows that the sensor has a linear response with a sensitivity of 1.834 MHz (rad/m)-1 in the range of twisted rate from 0 to 8.726 rad m-1. The distributed torsion sensing capability is useful in drilling process monitoring, structure health monitoring and machine failure detection.

  20. Prototype of a gigabit data transmitter in 65 nm CMOS for DEPFET pixel detectors at Belle-II

    NASA Astrophysics Data System (ADS)

    Kishishita, T.; Krüger, H.; Hemperek, T.; Lemarenko, M.; Koch, M.; Gronewald, M.; Wermes, N.

    2013-08-01

    This paper describes the recent development of a gigabit data transmitter for the Belle-II pixel detector (PXD). The PXD is an innermost detector currently under development for the upgraded KEK-B factory in Japan. The PXD consists of two layers of DEPFET sensor modules located at 1.8 and 2.2 cm radii. Each module is equipped with three different ASIC types mounted on the detector substrate with a flip-chip technique: (a) SWITCHER for generating steering signals for the DEPFET sensors, (b) DCD for digitizing the signal currents, and (c) DHP for performing data processing and sending the data off the module to the back-end data handling hybrid via ∼ 40 cm Kapton flex and 12-15 m twisted pair (TWP) cables. To meet the requirements of the PXD data transmission, a prototype of the DHP data transmitter has been developed in a 65-nm standard CMOS technology. The transmitter test chip consists of current-mode logic (CML) drivers and a phase-locked loop (PLL) which generates a clock signal for a 1.6 Gbit/s output data stream from an 80 cm reference clock. A programmable pre-emphasis circuit is also implemented in the CML driver to compensate signal losses in the long cable by shaping the transmitted pulse response. The jitter performance was measured as 25 ps (1 σ distribution) by connecting the chip with 38 cm flex and 10 m TWP cables.

  1. Humidity effects on wire insulation breakdown strength.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Appelhans, Leah

    2013-08-01

    Methods for the testing of the dielectric breakdown strength of insulation on metal wires under variable humidity conditions were developed. Two methods, an ASTM method and the twisted pair method, were compared to determine if the twisted pair method could be used for determination of breakdown strength under variable humidity conditions. It was concluded that, although there were small differences in outcomes between the two testing methods, the non-standard method (twisted pair) would be appropriate to use for further testing of the effects of humidity on breakdown performance. The dielectric breakdown strength of 34G copper wire insulated with double layermore » Poly-Thermaleze/Polyamide-imide insulation was measured using the twisted pair method under a variety of relative humidity (RH) conditions and exposure times. Humidity at 50% RH and below was not found to affect the dielectric breakdown strength. At 80% RH the dielectric breakdown strength was significantly diminished. No effect for exposure time up to 140 hours was observed at 50 or 80%RH.« less

  2. Transfer impedances of balanced shielded cables

    NASA Astrophysics Data System (ADS)

    Hardiguian, M.

    1982-07-01

    The transfer impedance concept is extended to balanced shielded cables, e.g., shielded pairs and twinax in which the actual voltage developed at the load, between the two wires of a pair is emphasized. This parameter can be computed by a separate knowledge of the shield, and the shield-to-pair coupling (i.e., the pair unbalance ratio). Thus, a unique parameter called shield coupling evolves which relates directly the shield current to the differential output voltage. Conditions of cable pair and harness shielding and the impact of grounding at one or both ends are discussed.

  3. Microcomputer network for control of a continuous mining machine. Information circular/1993

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schiffbauer, W.H.

    1993-01-01

    The paper details a microcomputer-based control and monitoring network that was developed in-house by the U.S. Bureau of Mines, and installed on a Joy 14 continuous mining machine. The network consists of microcomputers that are connected together via a single twisted pair cable. Each microcomputer was developed to provide a particular function in the control process. Machine-mounted microcomputers in conjunction with the appropriate sensors provide closed-loop control of the machine, navigation, and environmental monitoring. Off-the-machine microcomputers provide remote control of the machine, sensor status, and a connection to the network so that external computers can access network data and controlmore » the continuous mining machine. Although the network was installed on a Joy 14 continuous mining machine, its use extends beyond it. Its generic structure lends itself to installation onto most mining machine types.« less

  4. Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

    DOE PAGES

    Zhang, Yan; Inouye, Hideyo; Crowley, Michael; ...

    2016-10-14

    Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. As a result, this algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

  5. Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yan; Inouye, Hideyo; Crowley, Michael

    Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. This algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

  6. Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yan; Inouye, Hideyo; Crowley, Michael

    Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. As a result, this algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

  7. The effective resistance between twisted superconducting filaments in tapes

    NASA Astrophysics Data System (ADS)

    Takács, S.; Iwakuma, M.; Funaki, K.

    2001-05-01

    We consider two mechanisms, which influence the effective resistance between crossing strands on flat cables or filaments in twisted tapes. The one-layer classical Rutherford-type cable and the tapes with twisted BSCCO filaments in silver matrix are taken as analogous cases. The amount of the matrix between strands or filaments increases the effective conductance compared with the direct current paths (determined by the touching area of the filaments). The increase factor is about two and can easily be suppressed by other effects, like the contact resistance between the superconductor and the matrix. The second mechanism is due to the existence of induced voltage between any points of crossing filaments. This leads to an additional effective conductance, proportional to the square of the total number of filaments. Both effects are not very important for isotropic superconductors, but due to the strong anisotropy of critical parameters they can dominate for high temperature superconductors. The first one may partially compensate the influence of the usually weaker critical current density perpendicular to the tape. The contribution due to the second effect can explain the higher resistivity of the matrix in BSCCO tapes compared with pure silver. It seems that to obtain low AC coupling losses in BSCCO tapes, structures with small filament number are required.

  8. Optical Access Networks

    NASA Astrophysics Data System (ADS)

    Zheng, Jun; Ansari, Nirwan

    2005-03-01

    Call for Papers: Optical Access Networks With the wide deployment of fiber-optic technology over the past two decades, we have witnessed a tremendous growth of bandwidth capacity in the backbone networks of today's telecommunications infrastructure. However, access networks, which cover the "last-mile" areas and serve numerous residential and small business users, have not been scaled up commensurately. The local subscriber lines for telephone and cable television are still using twisted pairs and coaxial cables. Most residential connections to the Internet are still through dial-up modems operating at a low speed on twisted pairs. As the demand for access bandwidth increases with emerging high-bandwidth applications, such as distance learning, high-definition television (HDTV), and video on demand (VoD), the last-mile access networks have become a bandwidth bottleneck in today's telecommunications infrastructure. To ease this bottleneck, it is imperative to provide sufficient bandwidth capacity in the access networks to open the bottleneck and thus present more opportunities for the provisioning of multiservices. Optical access solutions promise huge bandwidth to service providers and low-cost high-bandwidth services to end users and are therefore widely considered the technology of choice for next-generation access networks. To realize the vision of optical access networks, however, many key issues still need to be addressed, such as network architectures, signaling protocols, and implementation standards. The major challenges lie in the fact that an optical solution must be not only robust, scalable, and flexible, but also implemented at a low cost comparable to that of existing access solutions in order to increase the economic viability of many potential high-bandwidth applications. In recent years, optical access networks have been receiving tremendous attention from both academia and industry. A large number of research activities have been carried out or are now underway this hot area. The purpose of this feature issue is to expose the networking community to the latest research breakthroughs and progresses in the area of optical access networks. This feature issue aims to present a collection of papers that focus on the state-of-the-art research in various networking aspects of optical access networks. Original papers are solicited from all researchers involved in area of optical access networks. Topics of interest include but not limited to:

  9. Twisted Pair Of Insulated Wires Senses Moisture

    NASA Technical Reports Server (NTRS)

    Laue, Eric G.; Stephens, James B.

    1989-01-01

    Sensitivity of electronic moisture sensor to low levels of moisture increased by new electrode configuration. Moisture-sensing circuit described in "Low-Cost Humidity Sensor" (NPO-16544). New twisted pair of wires takes place of flat-plate capacitor in circuit. Configuration allows for thermal expansion and contraction of polymer while maintaining nearly constant area of contact between polymer and wires.

  10. Twisted rogue-wave pairs in the Sasa-Satsuma equation.

    PubMed

    Chen, Shihua

    2013-08-01

    Exact explicit rogue wave solutions of the Sasa-Satsuma equation are obtained by use of a Darboux transformation. In addition to the double-peak structure and an analog of the Peregrine soliton, the rogue wave can exhibit an intriguing twisted rogue-wave pair that involves four well-defined zero-amplitude points. This exotic structure may enrich our understanding on the nature of rogue waves.

  11. Optical Intrabuilding and Interbuilding Distribution Networks.

    ERIC Educational Resources Information Center

    Hull, Joseph A.

    Fiber optics communication technology is a potential competitive alternative to coaxial cable and shielded twisted pairlines as a wide-band communications medium. Pilot demonstrations by public institutions such as the health care delivery system can test the application of this new technology. Fiber optic networks may have the potential to be…

  12. Emergency escape system uses self-braking mechanism on fixed cable

    NASA Technical Reports Server (NTRS)

    Billings, C. R.; Mc Daris, R. A.; Mc Gough, J. T.; Neal, P. F.

    1966-01-01

    Slide-wire system with a twist level slide device incorporates automatic descent and braking for the safe and rapid evacuation of personnel from tall structures. This device is used on any tall structure that might require emergency evacuation. It is also used to transfer materials and equipment.

  13. Multiconductor Short/Open Cable Tester

    NASA Technical Reports Server (NTRS)

    Eichenberg, Dennis

    1994-01-01

    Frequent or regular testing of multiconductor cables terminated in multipin conductors tedious, if not impossible, task. This inexpensive circuit simplifies open/short testing and is amenable to automation. In operation, pair of connectors selected to match pair of connectors installed on each of cables to be tested. As many connectors accommodated as required, and each can have as many conductors as required. Testing technique implemented with this circuit automated easily with electronic controls and computer interface. Printout provides status of each conductor in cable, indicating which, if any, of conductors has open or short circuit.

  14. Investigation of nanoyarn preparation by modified electrospinning setup.

    PubMed

    Levitt, Ariana S; Knittel, Chelsea E; Vallett, Richard; Koerner, Michael; Dion, Genevieve; Schauer, Caroline L

    2017-05-15

    Higher ordered structures of nanofibers, including nanofiber-based yarns and cables, have a variety of potential applications, including wearable health monitoring systems, artificial tendons, and medical sutures. In this study, twisted assemblies of polyacrylonitrile (PAN), polyvinylidene fluoride trifluoroethylene (PVDF-TrFE), and polycaprolactone (PCL) nanofibers were fabricated via a modified electrospinning setup, consisting of a rotating cone-shaped copper collector, two syringe pumps, and two high voltage power supplies. The fiber diameters and twist angles varied as a function of the rotary speed of the collector. Mechanical testing of the yarns revealed that PVDF-TrFe and PCL yarns have a higher strain-to-failure than PAN yarns, reaching 307% for PCL nanoyarns. For the first time, the porosity of nanofiber yarns was studied as a function of twist angle, showing that PAN nanoyarns are more porous than PCL yarns.

  15. Evaluation of wireless Local Area Networks

    NASA Astrophysics Data System (ADS)

    McBee, Charles L.

    1993-09-01

    This thesis is an in-depth evaluation of the current wireless Local Area Network (LAN) technologies. Wireless LAN's consist of three technologies: they are infrared light, microwave, and spread spectrum. When the first wireless LAN's were introduced, they were unfavorably labeled slow, expensive, and unreliable. The wireless LAN's of today are competitively priced, more secure, easier to install, and provide equal to or greater than the data throughput of unshielded twisted pair cable. Wireless LAN's are best suited for organizations that move office staff frequently, buildings that have historical significance, or buildings that have asbestos. Additionally, an organization may realize a cost savings of between $300 to $1,200 each time a node is moved. Current wireless LAN technologies have a positive effect on LAN standards being developed by the Defense Information System Agency (DISA). DoD as a whole is beginning to focus on wireless LAN's and mobile communications. If system managers want to remain successful, they need to stay abreast of this technology.

  16. Basic EMC (Electromagnetic compatibility) technology advancement for C3 systems. Volume 4D: Modeling crosstalk in balanced twisted pairs

    NASA Astrophysics Data System (ADS)

    Koopman, D. A.; Paul, C. R.

    1984-08-01

    Electrical devices (computers, radar systems, communication radios, etc.) are interconnected by wires on most present systems. Electromagnetic fields produced by the excitation of these wires will cause unintentional coupling of signals onto nearby wires. This undesired electromagnetic coupling is termed crosstalk. It is important to be able to determine whether these crosstalk signals will cause the devices at the ends of the wires to malfunction. Wires are often grouped together in cable bundles or harnesses. The close proximity of wires in these bundles enhances the possibility that the crosstalk levels will be sufficiently large to cause malfunctions. The ability to predict crosstalk levels and the means to control crosstalk when it causes a problem are important to optimum system design. It interference of this type is allowed to surface during final system tests, a costly and time consuming retrofit of the wiring or the addition of filters and other interference control measures may be required.

  17. Temperature-and field dependent characterization of a twisted stacked-tape cable

    NASA Astrophysics Data System (ADS)

    Barth, C.; Takayasu, M.; Bagrets, N.; Bayer, C. M.; Weiss, K.-P.; Lange, C.

    2015-04-01

    The twisted stacked-tape cable (TSTC) is one of the major high temperature superconductor cable concepts combining scalability, ease of fabrication and high current density making it a possible candidate as conductor for large scale magnets. To simulate the boundary conditions of such a magnets as well as the temperature dependence of TSTCs a 1.16 m long sample consisting of 40, 4 mm wide SuperPower REBCO tapes is characterized using the ‘FBI’ (force-field-current) superconductor test facility of the Institute for Technical Physics of the Karlsruhe Institute of Technology. In a first step, the magnetic background field is cycled while measuring the current carrying capabilities to determine the impact of Lorentz forces on the TSTC sample performance. In the first field cycle, the critical current of the TSTC sample is tested up to 12 T. A significant Lorentz force of up to 65.6 kN m-1 at the maximal magnetic background field of 12 T result in a 11.8% irreversible degradation of the current carrying capabilities. The degradation saturates (critical cable current of 5.46 kA at 4.2 K and 12 T background field) and does not increase in following field cycles. In a second step, the sample is characterized at different background fields (4-12 T) and surface temperatures (4.2-37.8 K) utilizing the variable temperature insert of the ‘FBI’ test facility. In a third step, the performance along the length of the sample is determined at 77 K, self-field. A 15% degradation is obtained for the central part of the sample which was within the high field region of the magnet during the in-field measurements.

  18. Optical Access Networks

    NASA Astrophysics Data System (ADS)

    Zheng, Jun; Ansari, Nirwan

    2005-06-01

    Call for Papers: Optical Access Networks With the wide deployment of fiber-optic technology over the past two decades, we have witnessed a tremendous growth of bandwidth capacity in the backbone networks of today's telecommunications infrastructure. However, access networks, which cover the "last-mile" areas and serve numerous residential and small business users, have not been scaled up commensurately. The local subscriber lines for telephone and cable television are still using twisted pairs and coaxial cables. Most residential connections to the Internet are still through dial-up modems operating at a low speed on twisted pairs. As the demand for access bandwidth increases with emerging high-bandwidth applications, such as distance learning, high-definition television (HDTV), and video on demand (VoD), the last-mile access networks have become a bandwidth bottleneck in today's telecommunications infrastructure. To ease this bottleneck, it is imperative to provide sufficient bandwidth capacity in the access networks to open the bottleneck and thus present more opportunities for the provisioning of multiservices. Optical access solutions promise huge bandwidth to service providers and low-cost high-bandwidth services to end users and are therefore widely considered the technology of choice for next-generation access networks. To realize the vision of optical access networks, however, many key issues still need to be addressed, such as network architectures, signaling protocols, and implementation standards. The major challenges lie in the fact that an optical solution must be not only robust, scalable, and flexible, but also implemented at a low cost comparable to that of existing access solutions in order to increase the economic viability of many potential high-bandwidth applications. In recent years, optical access networks have been receiving tremendous attention from both academia and industry. A large number of research activities have been carried out or are now underway this hot area. The purpose of this feature issue is to expose the networking community to the latest research breakthroughs and progresses in the area of optical access networks. This feature issue aims to present a collection of papers that focus on the state-of-the-art research in various networking aspects of optical access networks. Original papers are solicited from all researchers involved in area of optical access networks. Topics of interest include but not limited to: Optical access network architectures and protocols Passive optical networks (BPON, EPON, GPON, etc.) Active optical networks Multiple access control Multiservices and QoS provisioning Network survivability Field trials and standards Performance modeling and analysis

  19. Optical Access Networks

    NASA Astrophysics Data System (ADS)

    Zheng, Jun; Ansari, Nirwan; Jersey Inst Ansari, New; Jersey Inst, New

    2005-04-01

    Call for Papers: Optical Access Networks With the wide deployment of fiber-optic technology over the past two decades, we have witnessed a tremendous growth of bandwidth capacity in the backbone networks of today's telecommunications infrastructure. However, access networks, which cover the "last-mile" areas and serve numerous residential and small business users, have not been scaled up commensurately. The local subscriber lines for telephone and cable television are still using twisted pairs and coaxial cables. Most residential connections to the Internet are still through dial-up modems operating at a low speed on twisted pairs. As the demand for access bandwidth increases with emerging high-bandwidth applications, such as distance learning, high-definition television (HDTV), and video on demand (VoD), the last-mile access networks have become a bandwidth bottleneck in today's telecommunications infrastructure. To ease this bottleneck, it is imperative to provide sufficient bandwidth capacity in the access networks to open the bottleneck and thus present more opportunities for the provisioning of multiservices. Optical access solutions promise huge bandwidth to service providers and low-cost high-bandwidth services to end users and are therefore widely considered the technology of choice for next-generation access networks. To realize the vision of optical access networks, however, many key issues still need to be addressed, such as network architectures, signaling protocols, and implementation standards. The major challenges lie in the fact that an optical solution must be not only robust, scalable, and flexible, but also implemented at a low cost comparable to that of existing access solutions in order to increase the economic viability of many potential high-bandwidth applications. In recent years, optical access networks have been receiving tremendous attention from both academia and industry. A large number of research activities have been carried out or are now underway this hot area. The purpose of this feature issue is to expose the networking community to the latest research breakthroughs and progresses in the area of optical access networks. This feature issue aims to present a collection of papers that focus on the state-of-the-art research in various networking aspects of optical access networks. Original papers are solicited from all researchers involved in area of optical access networks. Topics of interest include but not limited to: Optical access network architectures and protocols Passive optical networks (BPON, EPON, GPON, etc.) Active optical networks Multiple access control Multiservices and QoS provisioning Network survivability Field trials and standards Performance modeling and analysis

  20. Optical Access Networks

    NASA Astrophysics Data System (ADS)

    Zheng, Jun; Ansari, Nirwan

    2005-05-01

    Call for Papers: Optical Access Networks With the wide deployment of fiber-optic technology over the past two decades, we have witnessed a tremendous growth of bandwidth capacity in the backbone networks of today's telecommunications infrastructure. However, access networks, which cover the "last-mile" areas and serve numerous residential and small business users, have not been scaled up commensurately. The local subscriber lines for telephone and cable television are still using twisted pairs and coaxial cables. Most residential connections to the Internet are still through dial-up modems operating at a low speed on twisted pairs. As the demand for access bandwidth increases with emerging high-bandwidth applications, such as distance learning, high-definition television (HDTV), and video on demand (VoD), the last-mile access networks have become a bandwidth bottleneck in today's telecommunications infrastructure. To ease this bottleneck, it is imperative to provide sufficient bandwidth capacity in the access networks to open the bottleneck and thus present more opportunities for the provisioning of multiservices. Optical access solutions promise huge bandwidth to service providers and low-cost high-bandwidth services to end users and are therefore widely considered the technology of choice for next-generation access networks. To realize the vision of optical access networks, however, many key issues still need to be addressed, such as network architectures, signaling protocols, and implementation standards. The major challenges lie in the fact that an optical solution must be not only robust, scalable, and flexible, but also implemented at a low cost comparable to that of existing access solutions in order to increase the economic viability of many potential high-bandwidth applications. In recent years, optical access networks have been receiving tremendous attention from both academia and industry. A large number of research activities have been carried out or are now underway this hot area. The purpose of this feature issue is to expose the networking community to the latest research breakthroughs and progresses in the area of optical access networks. This feature issue aims to present a collection of papers that focus on the state-of-the-art research in various networking aspects of optical access networks. Original papers are solicited from all researchers involved in area of optical access networks. Topics of interest include but not limited to: Optical access network architectures and protocols Passive optical networks (BPON, EPON, GPON, etc.) Active optical networks Multiple access control Multiservices and QoS provisioning Network survivability Field trials and standards Performance modeling and analysis

  1. Stacking interactions and DNA intercalation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dr. Shen; Cooper, Valentino R; Thonhauser, Prof. Timo

    2009-01-01

    The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observedmore » proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.« less

  2. TEM Cell Testing of Cable Noise Reduction Techniques from 2 MHz to 200 MHz -- Part 2

    NASA Technical Reports Server (NTRS)

    Bradley, Arthur T.; Evans, William C.; Reed, Joshua L.; Shimp, Samuel K., III; Fitzpatrick, Fred D.

    2008-01-01

    This paper presents empirical results of cable noise reduction techniques as demonstrated in a TEM cell operating with radiated fields from 2 - 200 MHz. It is the second part of a two-paper series. The first paper discussed cable types and shield connections. In this second paper, the effects of load and source resistances and chassis connections are examined. For each topic, well established theories are compared to data from a real-world physical system. Finally, recommendations for minimizing cable susceptibility (and thus cable emissions) are presented. There are numerous papers and textbooks that present theoretical analyses of cable noise reduction techniques. However, empirical data is often targeted to low frequencies (e.g. <50 KHz) or high frequencies (>100 MHz). Additionally, a comprehensive study showing the relative effects of various noise reduction techniques is needed. These include the use of dedicated return wires, twisted wiring, cable shielding, shield connections, changing load or source impedances, and implementing load- or source-to-chassis isolation. We have created an experimental setup that emulates a real-world electrical system, while still allowing us to independently vary a host of parameters. The goal of the experiment was to determine the relative effectiveness of various noise reduction techniques when the cable is in the presence of radiated emissions from 2 MHz to 200 MHz.

  3. A Prestressed Cable Network Model of the Adherent Cell Cytoskeleton

    PubMed Central

    Coughlin, Mark F.; Stamenović, Dimitrije

    2003-01-01

    A prestressed cable network is used to model the deformability of the adherent cell actin cytoskeleton. The overall and microstructural model geometries and cable mechanical properties were assigned values based on observations from living cells and mechanical measurements on isolated actin filaments, respectively. The models were deformed to mimic cell poking (CP), magnetic twisting cytometry (MTC) and magnetic bead microrheometry (MBM) measurements on living adherent cells. The models qualitatively and quantitatively captured the fibroblast cell response to the deformation imposed by CP while exhibiting only some qualitative features of the cell response to MTC and MBM. The model for CP revealed that the tensed peripheral actin filaments provide the key resistance to indentation. The actin filament tension that provides mechanical integrity to the network was estimated at ∼158 pN, and the nonlinear mechanical response during CP originates from filament kinematics. The MTC and MBM simulations revealed that the model is incomplete, however, these simulations show cable tension as a key determinant of the model response. PMID:12547813

  4. A prestressed cable network model of the adherent cell cytoskeleton.

    PubMed

    Coughlin, Mark F; Stamenović, Dimitrije

    2003-02-01

    A prestressed cable network is used to model the deformability of the adherent cell actin cytoskeleton. The overall and microstructural model geometries and cable mechanical properties were assigned values based on observations from living cells and mechanical measurements on isolated actin filaments, respectively. The models were deformed to mimic cell poking (CP), magnetic twisting cytometry (MTC) and magnetic bead microrheometry (MBM) measurements on living adherent cells. The models qualitatively and quantitatively captured the fibroblast cell response to the deformation imposed by CP while exhibiting only some qualitative features of the cell response to MTC and MBM. The model for CP revealed that the tensed peripheral actin filaments provide the key resistance to indentation. The actin filament tension that provides mechanical integrity to the network was estimated at approximately 158 pN, and the nonlinear mechanical response during CP originates from filament kinematics. The MTC and MBM simulations revealed that the model is incomplete, however, these simulations show cable tension as a key determinant of the model response.

  5. Comparison of Commercial Electromagnetic Interface Test Techniques to NASA Electromagnetic Interference Test Techniques

    NASA Astrophysics Data System (ADS)

    Smith, V.

    2000-11-01

    This report documents the development of analytical techniques required for interpreting and comparing space systems electromagnetic interference test data with commercial electromagnetic interference test data using NASA Specification SSP 30237A "Space Systems Electromagnetic Emission and Susceptibility Requirements for Electromagnetic Compatibility." The PSpice computer simulation results and the laboratory measurements for the test setups under study compare well. The study results, however, indicate that the transfer function required to translate test results of one setup to another is highly dependent on cables and their actual layout in the test setup. Since cables are equipment specific and are not specified in the test standards, developing a transfer function that would cover all cable types (random, twisted, or coaxial), sizes (gauge number and length), and layouts (distance from the ground plane) is not practical.

  6. Comparison of Commercial Electromagnetic Interface Test Techniques to NASA Electromagnetic Interference Test Techniques

    NASA Technical Reports Server (NTRS)

    Smith, V.; Minor, J. L. (Technical Monitor)

    2000-01-01

    This report documents the development of analytical techniques required for interpreting and comparing space systems electromagnetic interference test data with commercial electromagnetic interference test data using NASA Specification SSP 30237A "Space Systems Electromagnetic Emission and Susceptibility Requirements for Electromagnetic Compatibility." The PSpice computer simulation results and the laboratory measurements for the test setups under study compare well. The study results, however, indicate that the transfer function required to translate test results of one setup to another is highly dependent on cables and their actual layout in the test setup. Since cables are equipment specific and are not specified in the test standards, developing a transfer function that would cover all cable types (random, twisted, or coaxial), sizes (gauge number and length), and layouts (distance from the ground plane) is not practical.

  7. Twirling and Whirling: Viscous Dynamics of Rotating Elastica

    NASA Astrophysics Data System (ADS)

    Wolgemuth, Charles; Powers, Thomas; Goldstein, Raymond

    1999-10-01

    The stability of forced elastic filaments arise in several important biological settings involving bend and twist elasticity at low Reynolds number. Examples include DNA transcription and replication and bacterial flagellar motion. In order to elucidate fundamental processes common to these systems, we consider the model problem of a rotationally forced filament with twist and bend elasticity. Competition between twist injection, twist diffusion, and writhing instabilities is described by a novel pair of PDEs for twist and bend evolution. Analytical and numerical methods elucidate the twist/bend coupling and reveal two dynamical regimes seperated by a Hopf bifurcation: (i) diffusion-dominated axial rotation, or twirling, and (ii) steady-state crankshafting motion, or whirling. Experiments are proposed to examine these phenomena and the consequences for swimming investigated.

  8. Some factors determining the effective resistance between strands in flat cables (or superconducting filaments in tapes)

    NASA Astrophysics Data System (ADS)

    Takács, S.; Iwakuma, M.; Funaki, K.

    2000-04-01

    Two effects are considered which can influence the effective resistance between crossing strands on flat cables or filaments in twisted tapes. As analogous cases, the one-layer Rutherford-type cable with classical superconductors and the tapes with twisted BSCCO filaments in a silver matrix in perpendicular magnetic fields are considered as a model. At first, the amount of the central core between the strands and the silver matrix between the filaments increases the effective conductance compared with the direct current paths, which is supposed to be proportional to the touching area of filaments. The increase factor is about two and can be easily suppressed by other effects, such as the contact resistance between the superconductor and the matrix. However, due to the strong anisotropy of critical parameters for high temperature superconductors, this effect can partially compensate the influence of the usually weaker critical current density perpendicular to the tape. The second effect is connected with the existence of the induced voltage between any points of crossing filaments. This leads to an additional effective conductance, proportional to the square of the total number of the filaments. This contribution is prevailing for the anisotropic superconductors. Therefore, to obtain low ac coupling losses in BSCCO tapes, structures with smaller filament number are required. This case is analogous to round structures, leading to ac losses proportional to the square of the layer number in the field direction.

  9. FOCCoS for Subaru PFS

    NASA Astrophysics Data System (ADS)

    Cesar de Oliveira, Antonio; Souza de Oliveira, Ligia; de Arruda, Marcio V.; Bispo dos Santos, Jesulino; Souza Marrara, Lucas; Bawden de Paula Macanhan, Vanessa; Batista de Carvalho Oliveira, João.; de Paiva Vilaça, Rodrigo; Dominici, Tania P.; Sodré, Laerte; Mendes de Oliveira, Claudia; Karoji, Hiroshi; Sugai, Hajime; Shimono, Atsushi; Tamura, Naoyuki; Takato, Naruhisa; Ueda, Akitoshi

    2012-09-01

    The Fiber Optical Cable and Connector System (FOCCoS), provides optical connection between 2400 positioners and a set of spectrographs by an optical fibers cable as part of Subaru PFS instrument. Each positioner retains one fiber entrance attached at a microlens, which is responsible for the F-ratio transformation into a larger one so that difficulties of spectrograph design are eased. The optical fibers cable will be segmented in 3 parts at long of the way, cable A, cable B and cable C, connected by a set of multi-fibers connectors. Cable B will be permanently attached at the Subaru telescope. The first set of multi-fibers connectors will connect the cable A to the cable C from the spectrograph system at the Nasmith platform. The cable A, is an extension of a pseudo-slit device obtained with the linear disposition of the extremities of the optical fibers and fixed by epoxy at a base of composite substrate. The second set of multi-fibers connectors will connect the other extremity of cable A to the cable B, which is part of the positioner's device structure. The optical fiber under study for this project is the Polymicro FBP120170190, which has shown very encouraging results. The kind of test involves FRD measurements caused by stress induced by rotation and twist of the fiber extremity, similar conditions to those produced by positioners of the PFS instrument. The multi-fibers connector under study is produced by USCONEC Company and may connect 32 optical fibers. The tests involve throughput of light and stability after many connections and disconnections. This paper will review the general design of the FOCCoS subsystem, methods used to fabricate the devices involved and the tests results necessary to evaluate the total efficiency of the set.

  10. Twisted injectivity in projected entangled pair states and the classification of quantum phases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buerschaper, Oliver, E-mail: obuerschaper@perimeterinstitute.ca

    We introduce a class of projected entangled pair states (PEPS) which is based on a group symmetry twisted by a 3-cocycle of the group. This twisted symmetry is expressed as a matrix product operator (MPO) with bond dimension greater than 1 and acts on the virtual boundary of a PEPS tensor. We show that it gives rise to a new standard form for PEPS from which we construct a family of local Hamiltonians which are gapped, frustration-free and include fixed points of the renormalization group flow. Based on this insight, we advance the classification of 2D gapped quantum spin systems bymore » showing how this new standard form for PEPS determines the emergent topological order of these local Hamiltonians. Specifically, we identify their universality class as DIJKGRAAF–WITTEN topological quantum field theory (TQFT). - Highlights: • We introduce a new standard form for projected entangled pair states via a twisted group symmetry which is given by nontrivial matrix product operators. • We construct a large family of gapped, frustration-free Hamiltonians in two dimensions from this new standard form. • We rigorously show how this new standard form for low energy states determines the emergent topological order.« less

  11. Wind turbine generator with improved operating subassemblies

    DOEpatents

    Cheney, Jr., Marvin C.

    1985-01-01

    A wind turbine includes a yaw spring return assembly to return the nacelle from a position to which it has been rotated by yawing forces, thus preventing excessive twisting of the power cables and control cables. It also includes negative coning restrainers to limit the bending of the flexible arms of the rotor towards the tower, and stop means on the rotor shaft to orient the blades in a vertical position during periods when the unit is upwind when the wind commences. A pendulum pitch control mechanism is improved by orienting the pivot axis for the pendulum arm at an angle to the longitudinal axis of its support arm, and excessive creep is of the synthetic resin flexible beam support for the blades is prevented by a restraining cable which limits the extent of pivoting of the pendulum during normal operation but which will permit further pivoting under abnormal conditions to cause the rotor to stall.

  12. Twirling and Whirling: Viscous Dynamics of Rotating Elastica

    NASA Astrophysics Data System (ADS)

    Powers, Thomas R.; Wolgemuth, Charles W.; Goldstein, Raymond E.

    1999-11-01

    Motivated by diverse phenomena in cellular biophysics, including bacterial flagellar motion and DNA transcription and replication, we study the overdamped nonlinear dynamics of a rotationally forced filament with twist and bend elasticity. The competition between twist diffusion and writhing instabilities is described by a novel pair of coupled PDEs for twist and bend evolution. Analytical and numerical methods elucidate the twist-bend coupling and reveal two dynamical regimes separated by a Hopf bifurcation: (i) diffusion-dominated axial rotation, or twirling, and (ii) steady-state crankshafting motion, or whirling. The consequences of these phenomena for self-propulsion are investigated, and experimental tests proposed.

  13. Reversing Spoken Items--Mind Twisting Not Tongue Twisting

    ERIC Educational Resources Information Center

    Rudner, Mary; Ronnberg, Jerker; Hugdahl, Kenneth

    2005-01-01

    Using 12 participants we conducted an fMRI study involving two tasks, word reversal and rhyme judgment, based on pairs of natural speech stimuli, to study the neural correlates of manipulating auditory imagery under taxing conditions. Both tasks engaged the left anterior superior temporal gyrus, reflecting previously established perceptual…

  14. Ac-loss measurement of a DyBCO-Roebel assembled coated conductor cable (RACC)

    NASA Astrophysics Data System (ADS)

    Schuller, S.; Goldacker, W.; Kling, A.; Krempasky, L.; Schmidt, C.

    2007-10-01

    Low ac-loss HTS cables for transport currents well above 1 kA are required for application in transformers and generators and are taken into consideration for future generations of fusion reactor coils. Coated conductors (CC) are suitable candidates for high field application at an operation temperature around 50-77 K, which is a crucial precondition for economical cooling costs. We prepared a short length of a Roebel bar cable made of industrial DyBCO coated conductor (Theva Company, Germany). Meander shaped tapes of 4 mm width with a twist pitch of 122 mm were cut from 10 mm wide CC tapes using a specially designed tool. Eleven of these strands were assembled to a cable. The electrical and mechanical connection of the tapes was achieved using a silver powder filled conductive epoxy resin. Ac-losses of a short sample in an external ac field were measured as a function of frequency and field amplitude in transverse and parallel field orientations. In addition, the coupling current time constant of the sample was directly measured.

  15. Twist functions in vertebral column formation in medaka, Oryzias latipes.

    PubMed

    Yasutake, Junichi; Inohaya, Keiji; Kudo, Akira

    2004-07-01

    Medaka twist, a basic helix-loop-helix (bHLH) transcription factor, is expressed in the sclerotome during embryogenesis. We previously established a line of twist-EGFP transgenic medaka, whose EGFP expression is regulated by the twist promoter; therefore, we could observe the behavior of sclerotomal cells in vivo. In the transgenic medaka embryos, EGFP-positive sclerotomal cells migrated dorsally around the notochord and the neural tube, where at a later stage the vertebral column would be formed. This finding strongly suggests that twist-expressing sclerotomal cells participate in vertebral column formation in medaka. To clarify the function of twist gene in the sclerotome, we performed knockdown analysis of twist by using two kinds of morpholino antisense oligonucleotides targeted against twist (MO1 and MO2). Both the MO1 and MO2 morphants exhibited absence of neural arches, which are bilaterally paired, dorsomedially oriented bones on the dorsal aspect of the centrum. In addition, MO2, which blocks translation of only endogenous twist mRNA in the twist-EGFP transgenic medaka, did not affect the migration pattern of EGFP-positive cells, revealing that the migration of sclerotome-derived cells were normal in the absence of twist gene function. These results demonstrate that medaka twist functions in vertebral column formation by regulating the sclerotomal cell differentiation.

  16. Twisted ribbon structure of paired helical filaments revealed by atomic force microscopy.

    PubMed Central

    Pollanen, M. S.; Markiewicz, P.; Bergeron, C.; Goh, M. C.

    1994-01-01

    Progressive deposition of phosphorylated tau into the paired helical filaments (PHF) that compose neurofibrillary tangles, dystrophic neurites, and neuropil threads is an obligate feature of Alzheimer's disease. The standard model of PHF structure, derived from electron microscopic studies, suggests that two 8- to 10-nm filaments each composed of three to four protofilaments are wound into a helix with a maximal diameter of -20 nm and a half period of 65 to 80 nm. However, recent vertical platinum-carbon replicas of PHF more closely resemble a thin helical ribbon without constitutive protofilaments. Here we report that native PHF imaged with an atomic force microscope appear as twisted ribbons rather than the generally accepted structure derived from electron microscopic studies. These data imply that the assembly of PHF is not due to the twisting of pair-wise filaments but rather the helical winding of self-associated tau molecules arranged into a flattened structure. Future structural models of PHF should be based on quantitative data obtained from imaging techniques, such as scanning probe microscopy, which do not require harsh specimen preparation procedures. Images Figure 1 PMID:8178938

  17. Twisted ribbon structure of paired helical filaments revealed by atomic force microscopy.

    PubMed

    Pollanen, M S; Markiewicz, P; Bergeron, C; Goh, M C

    1994-05-01

    Progressive deposition of phosphorylated tau into the paired helical filaments (PHF) that compose neurofibrillary tangles, dystrophic neurites, and neuropil threads is an obligate feature of Alzheimer's disease. The standard model of PHF structure, derived from electron microscopic studies, suggests that two 8- to 10-nm filaments each composed of three to four protofilaments are wound into a helix with a maximal diameter of -20 nm and a half period of 65 to 80 nm. However, recent vertical platinum-carbon replicas of PHF more closely resemble a thin helical ribbon without constitutive protofilaments. Here we report that native PHF imaged with an atomic force microscope appear as twisted ribbons rather than the generally accepted structure derived from electron microscopic studies. These data imply that the assembly of PHF is not due to the twisting of pair-wise filaments but rather the helical winding of self-associated tau molecules arranged into a flattened structure. Future structural models of PHF should be based on quantitative data obtained from imaging techniques, such as scanning probe microscopy, which do not require harsh specimen preparation procedures.

  18. Controlling coupled bending-twisting vibrations of anisotropic composite wing

    NASA Astrophysics Data System (ADS)

    Ryabov, Victor; Yartsev, Boris

    2018-05-01

    The paper discusses the possibility to control coupled bending-twisting vibrations of anisotropic composite wing by means of the monoclinic structures in the reinforcement of the plating. Decomposing the potential straining energy and kinetic energy of natural vibration modes into interacting and non-interacting parts, it became possible to introduce the two coefficients that integrally consider the effect of geometry and reinforcement structure upon the dynamic response parameters of the wing. The first of these coefficients describes the elastic coupling of the natural vibration modes, the second coefficient describes the inertial one. The paper describes the numerical studies showing how the orientation of considerably anisotropic CRP layers in the plating affects natural frequencies, loss factors, coefficients of elastic and inertial coupling for several lower tones of natural bending-twisting vibrations of the wing. Besides, for each vibration mode, partial values of the above mentioned dynamic response parameters were determined by means of the relationships for orthotropic structures where instead of "free" shearing modulus in the reinforcement plant, "pure" shearing modulus is used. Joint analysis of the obtained results has shown that each pair of bending-twisting vibration modes has its orientation angle ranges of the reinforcing layers where the inertial coupling caused by asymmetry of the cross-section profile with respect to the main axes of inertia decreases, down to the complete extinction, due to the generation of the elastic coupling in the plating material. These ranges are characterized by the two main features: 1) the difference in the natural frequencies of the investigated pair of bending-twisting vibration modes is the minimum and 2) natural frequencies of bending-twisting vibrations belong to a stretch restricted by corresponding partial natural frequencies of the investigated pair of vibration modes. This result is of practical importance because it enables approximate analysis of real composite wings with complex geometry in the existing commercial software packages.

  19. Operation REDWING, Report of the Manager Albuquerque Operations

    DTIC Science & Technology

    1983-01-31

    on their experience in three previous operations (IVY, GREENHOUSE , and CASTLE) AEC authorized, and Holmes & Narver pur chased and shipped to the...Operation GREENHOUSE and one 51-pair cable installed prior to REDWING. One of the 16-pair cables developed shorted and opened pairs. When an...refrigerators, dehumidification units, 20’ ■.r.. i..jjj||.t.^. .M , ., ». i .. —■■■"■= •>•■•— :- •’ ■’ ■■-■■ ■- ’■ • APPENDIX lII-3.10-l

  20. Photoinduced intramolecular charge transfer (ICT) reaction in trans-methyl p-(dimethylamino) cinnamate: A combined fluorescence measurement and quantum chemical calculations

    NASA Astrophysics Data System (ADS)

    Chakraborty, Amrita; Kar, Samiran; Guchhait, Nikhil

    2006-01-01

    The photophysical behaviour of trans-methyl p-(dimethylamino) cinnamate ( t-MDMAC) donor-acceptor system has been investigated by steady-state absorption and emission spectroscopy and quantum chemical calculations. The molecule t-MDMAC shows an emission from the locally excited state in non-polar solvents. In addition to weak local emission, a strong solvent dependent red shifted fluorescence in polar aprotic solvents is attributed to highly polar intramolecular charge transfer state. However, the formation of hydrogen-bonded clusters with polar protic solvents has been suggested from a linear correlation between the observed red shifted fluorescence band maxima with hydrogen bonding parameters ( α). Calculations by ab initio and density functional theory show that the lone pair electron at nitrogen center is out of plane of the benzene ring in the global minimum ground state structure. In the gas phase, a potential energy surface along the twist coordinate at the donor (-NMe 2) and acceptor (-CH = CHCOOMe) sites shows stabilization of S 1 state and destabilization S 2 and S 0 states. A similar potential energy calculation along the twist coordinate in acetonitrile solvent using non-equilibrium polarized continuum model also shows more stabilization of S 1 state relative to other states and supports solvent dependent red shifted emission properties. In all types of calculations it is found that the nitrogen lone pair is delocalized over the benzene ring in the global minimum ground state and is localized on the nitrogen centre at the 90° twisted configuration. The S 1 energy state stabilization along the twist coordinate at the donor site and localized nitrogen lone pair at the perpendicular configuration support well the observed dual fluorescence in terms of proposed twisted intramolecular charge transfer (TICT) model.

  1. Device for testing continuity and/or short circuits in a cable

    NASA Technical Reports Server (NTRS)

    Hayhurst, Arthur R. (Inventor)

    1995-01-01

    A device for testing current paths is attachable to a conductor. The device automatically checks the current paths of the conductor for continuity of a center conductor, continuity of a shield and a short circuit between the shield and the center conductor. The device includes a pair of connectors and a circuit to provide for testing of the conductive paths of the cable. The pair of connectors electrically connects the conductive paths of a cable to be tested with the circuit paths of the circuit. The circuit paths in the circuit include indicators to simultaneously indicate the results of the testing.

  2. Monopole-antimonopole interaction potential

    NASA Astrophysics Data System (ADS)

    Saurabh, Ayush; Vachaspati, Tanmay

    2017-11-01

    We numerically study the interactions of twisted monopole-antimonopole pairs in the 't Hooft-Polyakov model for a range of values of the scalar to vector mass ratio. We also recover the sphaleron solution at maximum twist discovered by Taubes [Commun. Math. Phys. 86, 257 (1982), 10.1007/BF01206014] and map out its energy and size as functions of parameters.

  3. ImNet: a fiber optic network with multistar topology for high-speed data transmission

    NASA Astrophysics Data System (ADS)

    Vossebuerger, F.; Keizers, Andreas; Soederman, N.; Meyer-Ebrecht, Dietrich

    1993-10-01

    ImNet is a fiber-optic local area network, which has been developed for high speed image communication in Picture Archiving and Communication Systems (PACS). A comprehensive analysis of image communication requirements in hospitals led to the conclusion that there is a need for networks which are optimized for the transmission of large datafiles. ImNet is optimized for this application in contrast to current-state LANs. ImNet consists of two elements: a link module and a switch module. The point-to-point link module can be up to 4 km by using fiber optic cable. For short distances up to 100 m a cheaper module using shielded twisted pair cable is available. The link module works bi-directionally and handles all protocols up to OSI-Level 3. The data rate per link is up to 140 MBit/s (clock rate 175 MHz). The switch module consists of the control unit and the cross-point-switch array. The array has up to fourteen interfaces for link modules. Up to fourteen data transfers each with a maximal transfer rate of 400 MBit/s can be handled at the same time. Thereby the maximal throughput of a switch module is 5.6 GBit/s. Out of these modules a multi-star network can be built i.e., an arbitrary tree structure of stars. This topology allows multiple transmissions at the same time as long as they do not require identical links. Therefore the overall throughput of ImNet can be a multiple of the datarate per link.

  4. Fiber optic submarine cables cuts cost modeling and cable protection aspects

    NASA Astrophysics Data System (ADS)

    Al-Lawati, Ali

    2015-03-01

    This work presents a model to calculate costs associated with submarine fiber optic cable cuts. It accounts for both fixed and variable factors determining cost of fixing cables and restoring data transmission. It considers duration of a cut, capacity of fibers, number of fiber pairs and expected number of cuts during cable life time. Moreover, it provides templates for initial feasibility assessments by comparing cut costs to cost of different cable protection schemes. It offers a needed tool to assist in guiding decision makers in selecting type of cable, length and depth of cable burial in terms of increase in initial investment due to adapting such protection methods, and compare it to cost of cuts repair and alternative restoration paths for data.

  5. Monitoring transients in low inductance circuits

    DOEpatents

    Guilford, R.P.; Rosborough, J.R.

    1985-10-21

    The instant invention relates to methods of and apparatus for monitoring transients in low inductance circuits and to a probe utilized to practice said method and apparatus. More particularly, the instant invention relates to methods of and apparatus for monitoring low inductance circuits, wherein the low inductance circuits include a pair of flat cable transmission lines. The instant invention is further directed to a probe for use in monitoring pairs of flat cable transmission lines.

  6. Electro-mechanical characterization of MgB2 wires for the Superconducting Link Project at CERN

    NASA Astrophysics Data System (ADS)

    Konstantopoulou, K.; Ballarino, A.; Gharib, A.; Stimac, A.; Garcia Gonzalez, M.; Perez Fontenla, A. T.; Sugano, M.

    2016-08-01

    In previous years, the R & D program between CERN and Columbus Superconductors SpA led to the development of several configurations of MgB2 wires. The aim was to achieve excellent superconducting properties in high-current MgB2 cables for the HL-LHC upgrade. In addition to good electrical performance, the superconductor shall have good mechanical strength in view of the stresses during operation (Lorenz forces and thermal contraction) and handling (tension and bending) during cabling and installation at room temperature. Thus, the study of the mechanical properties of MgB2 wires is crucial for the cable design and its functional use. In the present work we report on the electro-mechanical characterization of ex situ processed composite MgB2 wires. Tensile tests (critical current versus strain) were carried out at 4.2 K and in a 3 T external field by means of a purpose-built bespoke device to determine the irreversible strain limit of the wire. The minimum bending radius of the wire was calculated taking into account the dependence of the critical current with the strain and it was then used to obtain the minimum twist pitch of MgB2 wires in the cable. Strands extracted from cables having different configurations were tested to quantify the critical current degradation. The Young’s modulus of the composite wire was measured at room temperature. Finally, all measured mechanical parameters will be used to optimize an 18-strand MgB2 cable configuration.

  7. Experimentally determined transport and magnetization ac losses of small cable models constructed from YBCO coated conductors

    NASA Astrophysics Data System (ADS)

    Šouc, J.; Vojenčiak, M.; Gömöry, F.

    2010-04-01

    Several short cable models were constructed from YBCO coated conductor (YBCO CC) to study their basic dc and ac electrical properties. They were prepared using superconducting tapes helically wound on fiberglass former of different diameter (5, 8 and 10 mm) with different twist pitch (from 1.7 up to 2.4 cm). The number of parallel-connected tapes ranged from 1 up to 6. The standard length of the models was 11 cm. In one case a 35 cm long model has been manufactured in order to perform a bending test. We observed that the critical currents of the models were proportional to the number of tapes used for their construction. Transport and magnetization ac loss were measured at 36 and 72 Hz.

  8. New dualities and misleading anomaly matchings from outer-automorphism twists

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pal, Sridip; Song, Jaewon

    We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

  9. New dualities and misleading anomaly matchings from outer-automorphism twists

    DOE PAGES

    Pal, Sridip; Song, Jaewon

    2017-03-29

    We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

  10. A Timing Synchronizer System for Beam Test Setups Requiring Galvanic Isolation

    NASA Astrophysics Data System (ADS)

    Meder, Lukas Dominik; Emschermann, David; Frühauf, Jochen; Müller, Walter F. J.; Becker, Jürgen

    2017-07-01

    In beam test setups detector elements together with a readout composed of frontend electronics (FEE) and usually a layer of field-programmable gate arrays (FPGAs) are being analyzed. The FEE is in this scenario often directly connected to both the detector and the FPGA layer what in many cases requires sharing the ground potentials of these layers. This setup can become problematic if parts of the detector need to be operated at different high-voltage potentials, since all of the FPGA boards need to receive a common clock and timing reference for getting the readout synchronized. Thus, for the context of the compressed baryonic matter experiment a versatile timing synchronizer (TS) system was designed providing galvanically isolated timing distribution links over twisted-pair cables. As an electrical interface the so-called timing data processing board FPGA mezzanine card was created for being mounted onto FPGA-based advanced mezzanine cards for mTCA.4 crates. The FPGA logic of the TS system connects to this card and can be monitored and controlled through IPBus slow-control links. Evaluations show that the system is capable of stably synchronizing the FPGA boards of a beam test setup being integrated into a hierarchical TS network.

  11. Transmission of FDDI signals over low-frequency media

    NASA Astrophysics Data System (ADS)

    Ater, Dan

    1992-03-01

    The `FDDI' designation is gaining an increasing place in the local area network (LAN) jargon along with the `Ethernet' and `Token Ring.' The four letters stand for fiber-optic distributed data interface, but as in the case of other LANs the meaning of the name looses its importance as the properties of the network become familiar to the community of the users, implementors, and designers. Further, more new properties are added to the original set, sometimes beyond the boundaries hinted by the name. This paper presents the actual stage of an attempt to change the `F' (fiber-optic) to `M' (metal) specifically to unshielded twisted pair (UTP). The sense in doing so is the fact that a huge installed basis of metallic wires for telephone and data transmission already exists, and reaches an immense number of desktops. This paper describes: (1) An hierarchical network architecture emphasizing the segment to be implemented over UTP. (2) A systemic approach to the definition of the parameters for the physical medium dependent (PMD) module that should interface the MDDI (FDDI over metallic media) to the UTP cable plant. (3) Measurement results available at the time of the presentation.

  12. Persistence and Lifelong Fidelity of Phase Singularities in Optical Random Waves.

    PubMed

    De Angelis, L; Alpeggiani, F; Di Falco, A; Kuipers, L

    2017-11-17

    Phase singularities are locations where light is twisted like a corkscrew, with positive or negative topological charge depending on the twisting direction. Among the multitude of singularities arising in random wave fields, some can be found at the same location, but only when they exhibit opposite topological charge, which results in their mutual annihilation. New pairs can be created as well. With near-field experiments supported by theory and numerical simulations, we study the persistence and pairing statistics of phase singularities in random optical fields as a function of the excitation wavelength. We demonstrate how such entities can encrypt fundamental properties of the random fields in which they arise.

  13. Persistence and Lifelong Fidelity of Phase Singularities in Optical Random Waves

    NASA Astrophysics Data System (ADS)

    De Angelis, L.; Alpeggiani, F.; Di Falco, A.; Kuipers, L.

    2017-11-01

    Phase singularities are locations where light is twisted like a corkscrew, with positive or negative topological charge depending on the twisting direction. Among the multitude of singularities arising in random wave fields, some can be found at the same location, but only when they exhibit opposite topological charge, which results in their mutual annihilation. New pairs can be created as well. With near-field experiments supported by theory and numerical simulations, we study the persistence and pairing statistics of phase singularities in random optical fields as a function of the excitation wavelength. We demonstrate how such entities can encrypt fundamental properties of the random fields in which they arise.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

    An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

  15. TEM Cell Testing of Cable Noise Reduction Techniques From 2 MHz to 200 MHz - Part 1

    NASA Technical Reports Server (NTRS)

    Bradley, Arthur T.; Evans, William C.; Reed, Joshua L.; Shimp, Samuel K.; Fitzpatrick, Fred D.

    2008-01-01

    This paper presents empirical results of cable noise reduction techniques as demonstrated in a TEM cell operating with radiated fields from 2 - 200 MHz. It is the first part of a two-paper series. This first paper discusses cable types and shield connections. In the second paper, the effects of load and source resistances and chassis connections are examined. For each topic, well established theories are compared to data from a real-world physical system. Finally, recommendations for minimizing cable susceptibility (and thus cable emissions) are presented. There are numerous papers and textbooks that present theoretical analyses of cable noise reduction techniques. However, empirical data is often targeted to low frequencies (e.g. <50 KHz) or high frequencies (>100 MHz). Additionally, a comprehensive study showing the relative effects of various noise reduction techniques is needed. These include the use of dedicated return wires, twisted wiring, cable shielding, shield connections, changing load or source impedances, and implementing load- or source-to-chassis isolation. We have created an experimental setup that emulates a real-world electrical system, while still allowing us to independently vary a host of parameters. The goal of the experiment was to determine the relative effectiveness of various noise reduction techniques when the cable is in the presence of radiated emissions from 2 MHz to 200 MHz. The electronic system (Fig. 1) consisted of two Hammond shielded electrical enclosures, one containing the source resistance, and the other containing the load resistance. The boxes were mounted on a large aluminium plate acting as the chassis. Cables connecting the two boxes measured 81 cm in length and were attached to the boxes using standard D38999 military-style connectors. The test setup is shown in Fig. 2. Electromagnetic fields were created using an HP8657B signal generator, MiniCircuits ZHL-42W-SMA amplifier, and an EMCO 5103 TEM cell. Measurements were taken using an Agilent E4401B spectrum analyzer and HP1141a differential probes.

  16. Effectiveness of cable barriers, guardrails, and concrete barrier walls in reducing the risk of injury.

    PubMed

    Zou, Yaotian; Tarko, Andrew P; Chen, Erdong; Romero, Mario A

    2014-11-01

    Roadway departure crashes tend to be severe, especially when the roadside exposes the occupants of errant vehicles to excessive injury hazards. As a cost-effective method when the clear zone width is insufficient, road barriers are often installed to prevent errant vehicles from colliding with dangerous obstacles or traversing steep slopes. This paper focuses on the safety performance of road barriers in Indiana in reducing the risk of injury. The objective of the study presented here is to compare the risk of injury among different hazardous events faced by an occupant in a single-vehicle crash. The studied hazardous events include rolling over, striking three types of barriers (guardrails, concrete barrier walls, and cable barriers) with different barrier offsets to the edge of the travelled way, and striking various roadside objects. A total of 2124 single-vehicle crashes (3257 occupants) that occurred between 2008 and 2012 on 517 pair-matched homogeneous barrier and non-barrier segments were analyzed. A binary logistic regression model with mixed effects was estimated for vehicle occupants. The segment pairing process and the use of random effects were able to handle the commonality within the same segment pair as well as the heterogeneity across segment pairs. The modeling results revealed that hitting a barrier is associated with lower risk of injury than a high-hazard event (hitting a pole, rollover, etc.). The odds of injury are reduced by 39% for median concrete barrier walls offset 15-18ft from the travelled way, reduced by 65% for a guardrail face offset 5-55ft, reduced by 85% for near-side median cable barriers (offset between 10ft and 29ft), and reduced by 78% with far-side median cable barriers (offset at least 30ft). Comparing different types of barriers is useful where some types of barriers can be used alternatively. This study found that the odds of injury are 43% lower when striking a guardrail instead of a median concrete barrier offset 15-18ft and 65% lower when striking a median concrete barrier offset 7-14ft. The odds of injury when striking a near-side median cable barrier is 57% lower than the odds for a guardrail face. This reduction for a far side median cable barrier is 37%. Thus, a guardrail should be preferred over a concrete wall and a cable barrier should be preferred over a guardrail where the road and traffic conditions allow. In the light of the results, installing median cable barriers on both sides of the median to reduce their lateral offset is beneficial for safety. The study also found that the unexplained heterogeneity across vehicles is much larger than it was across matched segment pairs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Tracking system for solar collectors

    DOEpatents

    Butler, Barry L.

    1984-01-01

    A tracking system is provided for pivotally mounted spaced-apart solar collectors. A pair of cables is connected to spaced-apart portions of each collector, and a driver displaces the cables, thereby causing the collectors to pivot about their mounting, so as to assume the desired orientation. The collectors may be of the cylindrical type as well as the flat-plate type. Rigid spar-like linkages may be substituted for the cables. Releasable attachments of the cables to the collectors is also described, as is a fine tuning mechanism for precisely aligning each individual collector.

  18. Tracking system for solar collectors

    DOEpatents

    Butler, B.

    1980-10-01

    A tracking system is provided for pivotally mounted spaced-apart solar collectors. A pair of cables is connected to spaced-apart portions of each collector, and a driver displaces the cables, thereby causing the collectors to pivot about their mounting, so as to assume the desired orientation. The collectors may be of the cylindrical type as well as the flat-plate type. Rigid spar-like linkages may be substituted for the cables. Releasable attachments of the cables to the collectors is also described, as is a fine tuning mechanism for precisely aligning each individual collector.

  19. Torsional mechanics of DNA are regulated by small-molecule intercalation.

    PubMed

    Celedon, Alfredo; Wirtz, Denis; Sun, Sean

    2010-12-23

    Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

  20. Design and Preparation of Two ReBCO-CORC® Cable-In-Conduit Conductors for Fusion and Detector Magnets

    NASA Astrophysics Data System (ADS)

    Mulder, T.; van der Laan, D.; Weiss, J. D.; Dudarev, A.; Dhallé, M.; ten Kate, H. H. J.

    2017-12-01

    Two new ReBCO-CORC® based cable-in-conduit conductors (CICC) are developed by CERN in collaboration with ACT-Boulder. Both conductors feature a critical current of about 80 kA at 4.5 K and 12 T. One conductor is designed for operation in large detector magnets, while the other is aimed for application in fusion type magnets. The conductors use a six-around-one cable geometry with six flexible ReBCO CORC® strands twisted around a central tube. The fusion CICC is designed to be cooled by the internal forced flow of either helium gas or supercritical helium to cope with high heat loads in superconducting magnets in large fusion experimental reactors. In addition, the cable is enclosed by a stainless steel jacket to accommodate with the high level of Lorentz forces present in such magnets. Detector type magnets require stable, high-current conductors. Therefore, the detector CORC® CICC comprises an OFHC copper jacket with external conduction cooling, which is advantageous due to its simplicity. A 2.8 m long sample of each conductor is manufactured and prepared for testing in the Sultan facility at PSI Villigen. In the paper, the conductor design and assembly steps for both CORC® CICCs are highlighted.

  1. Investigation of the interwire energy transfer of elastic guided waves inside prestressed cables.

    PubMed

    Treyssède, Fabien

    2016-07-01

    Elastic guided waves are of interest for the non-destructive evaluation of cables. Cables are most often multi-wire structures, and understanding wave propagation requires numerical models accounting for the helical geometry of individual wires, the interwire contact mechanisms and the effects of prestress. In this paper, a modal approach based on a so-called semi-analytical finite element method and taking advantage of a biorthogonality relation is proposed in order to calculate the forced response under excitation of a cable, multi-wired, twisted, and prestressed. The main goal of this paper is to investigate how the energy transfers from a given wire, directly excited, to the other wires in order to identify some localization of energy inside the active wire as the waves propagate along the waveguide. The power flow of the excited field is theoretically derived and an energy transfer parameter is proposed to evaluate the level of energy localization inside a given wire. Numerical results obtained for different polarizations of excitation, central and peripheral, highlight how the energy may localize, spread, or strongly change in the cross-section as waves travel along the axis. In particular, a compressional mode localized inside the central wire is found, with little dispersion and significant excitability.

  2. Development of Metal-Ceramic Coaxial Cable Fabry-Pérot Interferometric Sensors for High Temperature Monitoring

    PubMed Central

    Trontz, Adam; Cheng, Baokai; Zeng, Shixuan; Xiao, Hai; Dong, Junhang

    2015-01-01

    Metal-ceramic coaxial cable Fabry-Pérot interferometric (MCCC-FPI) sensors have been developed using a stainless steel tube and a stainless steel wire as the outer and inner conductors, respectively; a tubular α-alumina insulator; and a pair of air gaps created in the insulator along the cable to serve as weak reflectors for the transmitting microwave (MW) signal. The MCCC-FPI sensors have been demonstrated for high temperature measurements using MW signals in a frequency range of 2–8 GHz. The temperature measurement is achieved by monitoring the frequency shift (Δƒ) of the MW interferogram reflected from the pair of weak reflectors. The MW sensor exhibited excellent linear dependence of Δƒ on temperature; small measurement deviations (±2.7%); and fast response in a tested range of 200–500 °C. The MCCC has the potential for further developing multipoint FPI sensors in a single-cable to achieve in situ and continuous measurement of spatially distributed temperature in harsh environments. PMID:26404280

  3. Development of Metal-Ceramic Coaxial Cable Fabry-Pérot Interferometric Sensors for High Temperature Monitoring.

    PubMed

    Trontz, Adam; Cheng, Baokai; Zeng, Shixuan; Xiao, Hai; Dong, Junhang

    2015-09-25

    Metal-ceramic coaxial cable Fabry-Pérot interferometric (MCCC-FPI) sensors have been developed using a stainless steel tube and a stainless steel wire as the outer and inner conductors, respectively; a tubular α-alumina insulator; and a pair of air gaps created in the insulator along the cable to serve as weak reflectors for the transmitting microwave (MW) signal. The MCCC-FPI sensors have been demonstrated for high temperature measurements using MW signals in a frequency range of 2-8 GHz. The temperature measurement is achieved by monitoring the frequency shift (Δƒ) of the MW interferogram reflected from the pair of weak reflectors. The MW sensor exhibited excellent linear dependence of Δƒ on temperature; small measurement deviations (±2.7%); and fast response in a tested range of 200-500 °C. The MCCC has the potential for further developing multipoint FPI sensors in a single-cable to achieve in situ and continuous measurement of spatially distributed temperature in harsh environments.

  4. Overview of hybrid fiber-coaxial network deployment in the deregulated UK environment

    NASA Astrophysics Data System (ADS)

    Cox, Alan L.

    1995-11-01

    Cable operators in the U.K. enjoy unprecedented license to construct networks and operate cable TV and telecommunications services within their franchise areas. In general, operators have built hybrid-fiber-coax (HFC) networks for cable TV in parallel with fiber-copper-pair networks for telephony. The commonly used network architectures are reviewed, together with their present and future capacities. Despite this dual-technology approach, there is considerable interest in the integration of telephony services onto the HFC network and the development of new interactive services for which HFC may be more suitable than copper pairs. Certain technological and commercial developments may have considerable significance for HFC networks and their operators. These include the digitalization of TV distribution and the rising demand for high-rate digital access lines. Possible scenarios are discussed.

  5. Biomechanical comparison of fixation methods in transverse patella fractures.

    PubMed

    Scilaris, T A; Grantham, J L; Prayson, M J; Marshall, M P; Hamilton, J J; Williams, J L

    1998-01-01

    To compare monofilament wire versus braided cable for stabilizing transverse patella fractures using the modified AO tension band technique. A randomized blocked (paired) study comparing two fixation methods. Statistical analysis was performed using a nested repeated measures analysis, followed by Bonferroni post hoc testing. Seven paired embalmed knees (mean age 71.8 years, SD 14.6 years) were dissected, and transverse fractures were simulated. The knees were reduced and randomly fixed by either two parallel 0.062-inch Kirschner wires with a 1.0-millimeter-diameter 316L stainless steel monofilament wire tension loop or two Kirschner wires with a 1.0-millimeter-diameter 316L stainless steel braided cable tension loop. Knees were tested by applying a cyclic load through the suprapatellar tendon between twenty and 300 newtons for thirty cycles. The maximum fracture displacement increased with each cycle of loading for both the braided cable and monofilament wire tension loop configurations (p = 0.0001). The average peak displacement at the thirtieth cycle was 2.25 millimeters for monofilament wire and 0.73 millimeters for the cable. When comparing both methods for all cycles, the braided cable allowed less fracture displacement than did the monofilament wire (p = 0.002), and the rate of increase per cycle of maximum fracture displacement was less for the cable than for the wire (p = 0.0001). In transverse, noncomminuted patella fractures, fixation with two Kirschner wires and a 1.0-millimeter braided cable tension loop was superior to the monofilament wire tension loop. Most importantly, the braided cable afforded more predictable results during cyclic loading.

  6. The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix H. Evaluation of Existing Projects. Volume 1.

    DTIC Science & Technology

    1981-12-01

    and cables with two strands of twisted No. 12 galvanized-steel wire. The base of the fence was buried to a depth of 1 ft, leaving 5 ft above the...Cnied DD 1473 emlooNriNo si OI VoSIsoLaTit Unclassified *9CUmhTV CLAMWIFCATSOW OF THIS PAQ E (Mbeft Dots Entered) 0 0 0 0 0 0 ~0 0 0 0 0 0 0 0

  7. Splice connector with internal heat transfer jacket

    DOEpatents

    Silva, Frank A.; Mayer, Robert W.

    1977-01-01

    A heat transfer jacket is placed over the terminal portions of the conductors of a pair of high voltage cables which are connected in a splice connection wherein a housing surrounds the connected conductor portions, the heat transfer jacket extending longitudinally between the confronting ends of a pair of adaptor sleeves placed upon the insulation of the cables to engage and locate the adaptor sleeves relative to one another, and laterally between the conductors and the housing to provide a path of relatively high thermal conductivity between the connected conductor portions and the housing.

  8. Influence of field penetration ratios and filamentation on end-effect related hysteretic loss reductions for superconducting strips

    NASA Astrophysics Data System (ADS)

    Dong, K.; Sumption, M.; Collings, E. W.; Majoros, M.; Yu, H.; Hu, M.

    2017-12-01

    There are a few key conductor-specific factors which influence the power loss of superconductors; these include critical current, geometry, and normal metal resistivity. This paper focuses on the influence of sample geometry on the power loss of superconducting strips and the effect of filamentation and sample length as a function of the field penetration state of the superconductor. We start with the analytical equations for infinite slabs and strips and then consider the influence of end effects for both unstriated and striated conductor. The loss is then calculated and compared as a function of applied field for striated and unstriated conductors. These results are much more general than they might seem at first glance, since they will be important building blocks for analytic loss calculations for twisted geometries for coated conductors, including helical (Conductor on Round Core, CORC), and twisted (e.g., twist stack cables) geometries. We show that for relatively low field penetration, end effects and reduced field penetration both reduce loss. In addition, for filamentary samples the relevant ratio of length scales becomes the filament width to sample length, thus modifying the loss ratios.

  9. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  10. Unraveling cellulose microfibrils: a twisted tale.

    PubMed

    Hadden, Jodi A; French, Alfred D; Woods, Robert J

    2013-10-01

    Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. Copyright © 2013 Wiley Periodicals, Inc.

  11. Unraveling Cellulose Microfibrils: A Twisted Tale

    PubMed Central

    Hadden, Jodi A.; French, Alfred D.; Woods, Robert J.

    2014-01-01

    Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. PMID:23681971

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gabuda, S. P.; Kozlova, S. G.; Novosibirsk State University, 2, Pirogova Str., Novosibirsk 630090

    We report an abnormal difference of low-temperature mobility of left-twisted and right-twisted conformations of roto symmetric molecules C{sub 6}H{sub 12}N{sub 2} (dabco) located in the same positions in crystal Zn{sub 2}(C{sub 8}H{sub 4}O{sub 4}){sub 2}⋅C{sub 6}H{sub 12}N{sub 2}. The difference between {sup 1}H NMR (Nuclear Magnetic Resonance) spin-relaxation data for left-twisted and right-twisted molecules reaches ∼3 × 10{sup 3} times at 8 K and tends to grow at lower temperatures. We argue that taking into account four-component relativistic Dirac wave functions in the vicinity of the nodal plane of dabco molecules and vacuum fluctuations due to virtual particle-antiparticle pairs canmore » explain the changes which C{sub 6}H{sub 12}N{sub 2} conformations undergo at low temperatures.« less

  13. Self-equilibrated Tapered Three-stage Tensegrity Mast

    NASA Astrophysics Data System (ADS)

    Oh, C. L.; Choong, K. K.; Nishimura, T.; Lee, S. W.

    2018-04-01

    Investigation of tensegrity structures for the space application is ongoing owing to the characteristics of being lightweight and flexible. Tensegrity structures consist of struts and cables are self-stressed and stable under gravitational loading. Form-finding is an important process to obtain the configuration of tensegrity structures that are in self-equilibrated state. Form-finding of tensegrity structures involves a complex computational strategy in solving the geometrical and forces of the structures. This paper aims to form-finding for a tapered three-stage tensegrity mast. The form-finding strategy involves the assemblage of the tensegrity mast, establishment of equilibrium equations and determination of one possible set of coefficient beta. Several cases of configurations with various twist angles with range of 20°-40° are investigated. A configuration with 9 struts and 42 cables satisfying the material elastic conditions was successfully found. The scalable self-equilibrated tensegrity mast is recommended for space applications.

  14. Mechanical behaviors of multi-filament twist superconducting strand under tensile and cyclic loading

    NASA Astrophysics Data System (ADS)

    Wang, Xu; Li, Yingxu; Gao, Yuanwen

    2016-01-01

    The superconducting strand, serving as the basic unit cell of the cable-in-conduit-conductors (CICCs), is a typical multi-filament twist composite which is always subjected to a cyclic loading under the operating condition. Meanwhile, the superconducting material Nb3Sn in the strand is sensitive to strain frequently relating to the performance degradation of the superconductivity. Therefore, a comprehensive study on the mechanical behavior of the strand helps understanding the superconducting performance of the strained Nb3Sn strands. To address this issue, taking the LMI (internal tin) strand as an example, a three-dimensional structural finite element model, named as the Multi-filament twist model, of the strand with the real configuration of the LMI strand is built to study the influences of the plasticity of the component materials, the twist of the filament bundle, the initial thermal residual stress and the breakage and its evolution of the filaments on the mechanical behaviors of the strand. The effective properties of superconducting filament bundle with random filament breakage and its evolution versus strain are obtained based on the damage theory of fiber-reinforced composite materials proposed by Curtin and Zhou. From the calculation results of this model, we find that the occurrence of the hysteresis loop in the cyclic loading curve is determined by the reverse yielding of the elastic-plastic materials in the strand. Both the initial thermal residual stress in the strand and the pitch length of the filaments have significant impacts on the axial and hysteretic behaviors of the strand. The damage of the filaments also affects the axial mechanical behavior of the strand remarkably at large axial strain. The critical current of the strand is calculated by the scaling law with the results of the Multi-filament twist model. The predicted results of the Multi-filament twist model show an acceptable agreement with the experiment.

  15. Development of metal-ceramic coaxial cable Fabry-Pérot interferometric sensors for high temperature monitoring

    DOE PAGES

    Trontz, Adam; Cheng, Baokai; Zeng, Shixuan; ...

    2015-09-25

    Metal-ceramic coaxial cable Fabry-Pérot interferometric (MCCC-FPI) sensors have been developed using a stainless steel tube and a stainless steel wire as the outer and inner conductors, respectively; a tubular α-alumina insulator; and a pair of air gaps created in the insulator along the cable to serve as weak reflectors for the transmitting microwave (MW) signal. The MCCC-FPI sensors have been demonstrated for high temperature measurements using MW signals in a frequency range of 2–8 GHz. The temperature measurement is achieved by monitoring the frequency shift (Δƒ) of the MW interferogram reflected from the pair of weak reflectors. The MW sensormore » exhibited excellent linear dependence of Δƒ on temperature; small measurement deviations (±2.7%); and fast response in a tested range of 200–500 °C. The MCCC has the potential for further developing multipoint FPI sensors in a single-cable to achieve in situ and continuous measurement of spatially distributed temperature in harsh environments.« less

  16. Thermo-Mechanical Behavior and Shakedown of Shape Memory Alloy Cable Structures

    NASA Astrophysics Data System (ADS)

    Biggs, Daniel B.

    Shape memory alloys (SMAs) are a versatile class of smart materials that exhibit adaptive properties which have been applied to solve engineering problems in wide-ranging fields from aerospace to biomedical engineering. Yet there is a lack of understanding of the fundamental nature of SMAs in order to effectively apply them to challenging problems within these engineering fields. Stranding fine NiTi wires into a cable form satisfies the demands of many aerospace and civil engineering applications which require actuators to withstand large tensile loads. The impact of increased bending and twisting in stranded NiTi wire structures, as well as introducing contact mechanics to the unstable phase transformation is not well understood, and this work aims to fill that void. To study the scalability of NiTi cables, thermo-mechanical characterization tests are conducted on cables much larger than those previously tested. These cables are found to have good superelastic properties and repeatable cyclic behavior with minimal induced plasticity. The behavior of additional cables, which have higher transition temperatures that can be used in a shape memory mode as thermo-responsive, high force actuator elements, are explored. These cables are found to scale up the performance of straight wire by maintaining an equivalent work output. Moreover, this work investigates the degradation of the thermal actuation of SMA wires through novel stress-temperature paths, discovering several path dependent behaviors of transformation-induced plasticity. The local mechanics of NiTi cable structures are explored through experiments utilizing digital image correlation, revealing new periodic transformation instabilities. Finite element simulations are presented, which indicate that the instabilities are caused by friction and relative sliding between wires in a cable. Finally, a study of the convective heat transfer of helical wire involving a suite of wind tunnel experiments, numerical analyses, and an empirical correlation is presented. This provides a method to better model the thermal behavior of helical SMA actuators and highlights the non-monotonic dependence of the convective heat transfer coefficient of helical wire with respect to the angle of the flow.

  17. Inter-strand current sharing and ac loss measurements in superconducting YBCO Roebel cables

    DOE PAGES

    Majoros, M.; Sumption, M. D.; Collings, E. W.; ...

    2015-04-08

    A Roebel cable, one twist pitch long, was modified from its as-received state by soldering copper strips between the strands to provide inter-strand connections enabling current sharing. Various DC transport currents (representing different percentages of its critical current) were applied to a single strand of such a modified cable at 77 K in a liquid nitrogen bath. Simultaneous monitoring of I–V curves in different parts of the strand as well as in its interconnections with other strands was made using a number of sensitive Keithley nanovoltmeters in combination with a multichannel high-speed data acquisition card, all controlled via LabView software.more » Current sharing onset was observed at about 1.02 of strand I c. At a strand current of 1.3I c about 5% of the current was shared through the copper strip interconnections. A finite element method modeling was performed to estimate the inter-strand resistivities required to enable different levels of current sharing. The relative contributions of coupling and hysteretic magnetization (and loss) were compared, and for our cable and tape geometry, and at dB/dt=1 T s -1, and our inter-strand resistance of 0.77 mΩ, (enabling a current sharing of 5% at 1.3I c) the coupling component was 0.32% of the hysteretic component. However, inter-strand contact resistance values of 100–1000 times smaller (close to those of NbTi and Nb 3Sn based accelerator cables) would make the coupling components comparable in size to the hysteretic components.« less

  18. Inter-strand current sharing and ac loss measurements in superconducting YBCO Roebel cables

    DOE PAGES

    sumption, Mike; Majoros, Milan; Collings, E. W.; ...

    2014-11-07

    A Roebel cable, one twist pitch long, was modified from its as-received state by soldering copper strips between the strands to provide inter-strand connections enabling current sharing. Various DC transport currents (representing different percentages of its critical current) were applied to a single strand of such a modified cable at 77 K in a liquid nitrogen bath. Simultaneous monitoring of I–V curves in different parts of the strand as well as in its interconnections with other strands was made using a number of sensitive Keithley nanovoltmeters in combination with a multichannel high-speed data acquisition card, all controlled via LabView software.more » Current sharing onset was observed at about 1.02 of strand I c. At a strand current of 1.3I c about 5% of the current was shared through the copper strip interconnections. A finite element method modeling was performed to estimate the inter-strand resistivities required to enable different levels of current sharing. The relative contributions of coupling and hysteretic magnetization (and loss) were compared, and for our cable and tape geometry, and at dB/dt=1 T s -1, and our inter-strand resistance of 0.77 mΩ, (enabling a current sharing of 5% at 1.3I c ) the coupling component was 0.32% of the hysteretic component. However, inter-strand contact resistance values of 100–1000 times smaller (close to those of NbTi and Nb 3Sn based accelerator cables) would make the coupling components comparable in size to the hysteretic components.« less

  19. Inter-strand current sharing and ac loss measurements in superconducting YBCO Roebel cables

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Majoros, M.; Sumption, M. D.; Collings, E. W.

    A Roebel cable, one twist pitch long, was modified from its as-received state by soldering copper strips between the strands to provide inter-strand connections enabling current sharing. Various DC transport currents (representing different percentages of its critical current) were applied to a single strand of such a modified cable at 77 K in a liquid nitrogen bath. Simultaneous monitoring of I–V curves in different parts of the strand as well as in its interconnections with other strands was made using a number of sensitive Keithley nanovoltmeters in combination with a multichannel high-speed data acquisition card, all controlled via LabView software.more » Current sharing onset was observed at about 1.02 of strand I c. At a strand current of 1.3I c about 5% of the current was shared through the copper strip interconnections. A finite element method modeling was performed to estimate the inter-strand resistivities required to enable different levels of current sharing. The relative contributions of coupling and hysteretic magnetization (and loss) were compared, and for our cable and tape geometry, and at dB/dt=1 T s -1, and our inter-strand resistance of 0.77 mΩ, (enabling a current sharing of 5% at 1.3I c) the coupling component was 0.32% of the hysteretic component. However, inter-strand contact resistance values of 100–1000 times smaller (close to those of NbTi and Nb 3Sn based accelerator cables) would make the coupling components comparable in size to the hysteretic components.« less

  20. Inter-strand current sharing and ac loss measurements in superconducting YBCO Roebel cables

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    sumption, Mike; Majoros, Milan; Collings, E. W.

    A Roebel cable, one twist pitch long, was modified from its as-received state by soldering copper strips between the strands to provide inter-strand connections enabling current sharing. Various DC transport currents (representing different percentages of its critical current) were applied to a single strand of such a modified cable at 77 K in a liquid nitrogen bath. Simultaneous monitoring of I–V curves in different parts of the strand as well as in its interconnections with other strands was made using a number of sensitive Keithley nanovoltmeters in combination with a multichannel high-speed data acquisition card, all controlled via LabView software.more » Current sharing onset was observed at about 1.02 of strand I c. At a strand current of 1.3I c about 5% of the current was shared through the copper strip interconnections. A finite element method modeling was performed to estimate the inter-strand resistivities required to enable different levels of current sharing. The relative contributions of coupling and hysteretic magnetization (and loss) were compared, and for our cable and tape geometry, and at dB/dt=1 T s -1, and our inter-strand resistance of 0.77 mΩ, (enabling a current sharing of 5% at 1.3I c ) the coupling component was 0.32% of the hysteretic component. However, inter-strand contact resistance values of 100–1000 times smaller (close to those of NbTi and Nb 3Sn based accelerator cables) would make the coupling components comparable in size to the hysteretic components.« less

  1. Unraveling the sequence-dependent polymorphic behavior of d(CpG) steps in B-DNA.

    PubMed

    Dans, Pablo Daniel; Faustino, Ignacio; Battistini, Federica; Zakrzewska, Krystyna; Lavery, Richard; Orozco, Modesto

    2014-10-01

    We have made a detailed study of one of the most surprising sources of polymorphism in B-DNA: the high twist/low twist (HT/LT) conformational change in the d(CpG) base pair step. Using extensive computations, complemented with database analysis, we were able to characterize the twist polymorphism in the d(CpG) step in all the possible tetranucleotide environment. We found that twist polymorphism is coupled with BI/BII transitions, and, quite surprisingly, with slide polymorphism in the neighboring step. Unexpectedly, the penetration of cations into the minor groove of the d(CpG) step seems to be the key element in promoting twist transitions. The tetranucleotide environment also plays an important role in the sequence-dependent d(CpG) polymorphism. In this connection, we have detected a previously unexplored intramolecular C-H···O hydrogen bond interaction that stabilizes the low twist state when 3'-purines flank the d(CpG) step. This work explains a coupled mechanism involving several apparently uncorrelated conformational transitions that has only been partially inferred by earlier experimental or theoretical studies. Our results provide a complete description of twist polymorphism in d(CpG) steps and a detailed picture of the molecular choreography associated with this conformational change. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Twisting short dsDNA with applied tension

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-02-01

    The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.

  3. Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.

    PubMed

    Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut

    2004-11-12

    Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.

  4. DSL for traffic video

    DOT National Transportation Integrated Search

    1999-07-01

    Many traffic operations use twisted pair wiring, either owned by the public or leased from a local provider, to control field devices such as traffic signals or ramp meters. There are now commercially available communications technologies that ...

  5. Conformations of 1,3,3,5,7,7-Hexamethyl-1,5-diazacyclooctane and Its Bis-BH(3) Adduct. Mono- and Bis-BH(3) Adducts of Di-Tertiary Amines.

    PubMed

    Livant, P.; Majors, A. W.; Webb, T. R.

    1996-05-03

    A variable-temperature (1)H- and (13)C-NMR study revealed a conformational equilibrium for 1,3,3,5,7,7-hexamethyl-1,5-diazacyclooctane (4) having DeltaG() = 8.8 +/- 0.6 kcal/mol at 184 K. This activation barrier connects a major and a minor form of 4. Molecular mechanics calculations on 4 led to the conclusion that the major form is a set of twist-chair-chairs interconverting rapidly via the chair-chair and that the minor form is most likely a set of twist-boat-boats interconverting rapidly via the boat-boat. The proximity of the two nitrogen lone pairs in the major form of 4 made plausible the expectation that 4, as well as a related diamine with apposed nitrogens, 3,7-dimethyl-3,7-diazabicyclo[3.3.1]nonane (3), might bind a Lewis acid, namely BH(3), using both lone pairs simultaneously and equally. This proved not to be the case: for 3 only the bis-BH(3) adduct was found and for 4 the mono-BH(3) adduct utilized only one nitrogen lone pair. The structure of the bis-BH(3) adduct of 4 (12) was determined by X-ray crystallography to be a twist-boat-boat with BH(3)s cis. Molecular mechanics calculations on 12 were consistent with the solid state conformation found.

  6. Reducing Actuator Requirements in Continuum Robots Through Optimized Cable Routing.

    PubMed

    Case, Jennifer C; White, Edward L; SunSpiral, Vytas; Kramer-Bottiglio, Rebecca

    2018-02-01

    Continuum manipulators offer many advantages compared to their rigid-linked counterparts, such as increased degrees of freedom and workspace volume. Inspired by biological systems, such as elephant trunks and octopus tentacles, many continuum manipulators are made of multiple segments that allow large-scale deformations to be distributed throughout the body. Most continuum manipulators currently control each segment individually. For example, a planar cable-driven system is typically controlled by a pair of cables for each segment, which implies two actuators per segment. In this article, we demonstrate how highly coupled crossing cable configurations can reduce both actuator count and actuator torque requirements in a planar continuum manipulator, while maintaining workspace reachability and manipulability. We achieve highly coupled actuation by allowing cables to cross through the manipulator to create new cable configurations. We further derive an analytical model to predict the underactuated manipulator workspace and experimentally verify the model accuracy with a physical system. We use this model to compare crossing cable configurations to the traditional cable configuration using workspace performance metrics. Our work here focuses on a simplified planar robot, both in simulation and in hardware, with the goal of extending this to spiraling-cable configurations on full 3D continuum robots in future work.

  7. Towards generalized mirror symmetry for twisted connected sum G 2 manifolds

    NASA Astrophysics Data System (ADS)

    Braun, Andreas P.; Del Zotto, Michele

    2018-03-01

    We revisit our construction of mirror symmetries for compactifications of Type II superstrings on twisted connected sum G 2 manifolds. For a given G 2 manifold, we discuss evidence for the existence of mirror symmetries of two kinds: one is an autoequivalence for a given Type II superstring on a mirror pair of G 2 manifolds, the other is a duality between Type II strings with different chiralities for another pair of mirror manifolds. We clarify the role of the B-field in the construction, and check that the corresponding massless spectra are respected by the generalized mirror maps. We discuss hints towards a homological version based on BPS spectroscopy. We provide several novel examples of smooth, as well as singular, mirror G 2 backgrounds via pairs of dual projecting tops. We test our conjectures against a Joyce orbifold example, where we reproduce, using our geometrical methods, the known mirror maps that arise from the SCFT worldsheet perspective. Along the way, we discuss non-Abelian gauge symmetries, and argue for the generation of the Affleck-Harvey-Witten superpotential in the pure SYM case.

  8. Resonance coupling and polarization conversion in terahertz metasurfaces with twisted split-ring resonator pairs

    DOE PAGES

    Li, Chenyu; Chang, Chun-Chieh; Zhou, Qingli; ...

    2017-10-10

    Here, we investigate edge-coupling of twisted split-ring resonator (SRR) pairs in the terahertz (THz) frequency range. By using a simple coupled-resonator model we show that such a system exhibits resonance splitting and cross-polarization conversion. Numerical simulations and experimental measurements agree well with theoretical calculations, verifying the resonance splitting as a function of the coupling strength given by the SRR separation. We further show that a metal ground plane can be integrated to significantly enhance the resonance coupling, which enables the effective control of resonance splitting and the efficiency and bandwidth of the cross-polarization conversion. Our findings improve the fundamental understandingmore » of metamaterials with a view of accomplishing metamaterial functionalities with enhanced performance, which is of great interest in realizing THz functional devices required in a variety of applications.« less

  9. Power saver circuit for audio/visual signal unit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Right, R. W.

    1985-02-12

    A combined audio and visual signal unit with the audio and visual components actuated alternately and powered over a single cable pair in such a manner that only one of the audio and visual components is drawing power from the power supply at any given instant. Thus, the power supply is never called upon to provide more energy than that drawn by the one of the components having the greater power requirement. This is particularly advantageous when several combined audio and visual signal units are coupled in parallel on one cable pair. Typically, the signal unit may comprise a hornmore » and a strobe light for a fire alarm signalling system.« less

  10. Critical Current of Superconducting Rutherford Cable in High Magnetic Fields with Transverse Pressure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dietderich, D.R.; Scanlan, R.M.; Walsh, R.P.

    For high energy physics applications superconducting cables are subjected to large stresses and high magnetic fields during service. It is essential to know how these cables perform in these operating conditions. A loading fixture capable of applying loads of up to 700 kN has been developed by NHMFL for LBNL. This fixture permits uniform loading of straight cables over a 122 mm length in a split-pair solenoid in fields up to 12 T at 4.2 K. The first results from this system for Rutherford cables of internal-tin and modified jelly roll strand of Nb{sub 3}Sn produced by IGC and TWCmore » showed that little permanent degradation occurs up to 210 MPa. However, the cable made from internal-tin strand showed a 40% reduction in K{sub c} at 11T and 210 MPa while a dable made from modified jelly roll material showed only a 15% reduction in I{sub c} at 11T and 185 MPa.« less

  11. Quantum-mechanical analysis of the energetic contributions to π stacking in nucleic acids versus rise, twist, and slide.

    PubMed

    Parker, Trent M; Hohenstein, Edward G; Parrish, Robert M; Hud, Nicholas V; Sherrill, C David

    2013-01-30

    Symmetry-adapted perturbation theory (SAPT) is applied to pairs of hydrogen-bonded nucleobases to obtain the energetic components of base stacking (electrostatic, exchange-repulsion, induction/polarization, and London dispersion interactions) and how they vary as a function of the helical parameters Rise, Twist, and Slide. Computed average values of Rise and Twist agree well with experimental data for B-form DNA from the Nucleic Acids Database, even though the model computations omitted the backbone atoms (suggesting that the backbone in B-form DNA is compatible with having the bases adopt their ideal stacking geometries). London dispersion forces are the most important attractive component in base stacking, followed by electrostatic interactions. At values of Rise typical of those in DNA (3.36 Å), the electrostatic contribution is nearly always attractive, providing further evidence for the importance of charge-penetration effects in π-π interactions (a term neglected in classical force fields). Comparison of the computed stacking energies with those from model complexes made of the "parent" nucleobases purine and 2-pyrimidone indicates that chemical substituents in DNA and RNA account for 20-40% of the base-stacking energy. A lack of correspondence between the SAPT results and experiment for Slide in RNA base-pair steps suggests that the backbone plays a larger role in determining stacking geometries in RNA than in B-form DNA. In comparisons of base-pair steps with thymine versus uracil, the thymine methyl group tends to enhance the strength of the stacking interaction through a combination of dispersion and electrosatic interactions.

  12. Visualization of drug-nucleic acid interactions at atomic resolution v. structure of two aminoacridine/dinucleoside monophosphate crystalline complexes, proflavine: 5-iodocytidylyl(3'-5') guanosine and acridine orange: 5-iodocytidylyl(3'-5') guanosine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reddy, B.S.; Seshadri, T.P.; Sakore, T.D.

    1979-01-01

    Acridine orange and proflavine form complexes with the dinucleoside monophosphate, 5-iodocytidylyl(3'-5') guanosine (iodoCpG). The acridine orange-iodoCpG crystals are monoclinic, space group P2/sub 1/, with unit cell dimensions a = 14.36 A, b = 19.64 A, c = 20.67 A, ..beta.. = 102.5. The proflavine-iodoCpG crystals are monoclinic, space group C2, with unit cell dimensions a = 32.14 A, b = 22.23 A, c = 18.42 A, ..beta.. = 123.3. Both structures have been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least squares. Acridine orange forms an intercalative structure with iodoCpG but the acridinemore » nucleus lies asymmetrically in the intercalation site. This asymmetric intercalation is accompanied by a sliding of base-pairs upon the acridine nucleus. Base-pairs above and below the drug are separated by about 6.8 A and are twisted about 10/sup 0/. Proflavine demonstrates symmetric intercalation with iodoCpG. Hydrogen bonds connect amino- groups on proflavine with phosphate oxygen atoms on the dinucleotide. Base-pairs above and below the intercalative proflavine molecule are twisted about 36/sup 0/. The altered magnitude of this angular twist reflects the sugar puckering pattern that is observed. We propose a proflavine-DNA and an acridine orange-DNA binding model. We will describe these models in detail in this paper.« less

  13. High-performance superconductors for Fusion Nuclear Science Facility

    DOE PAGES

    Zhai, Yuhu; Kessel, Chuck; Barth, Christian; ...

    2016-11-09

    High-performance superconducting magnets play an important role in the design of the next step large-scale, high-field fusion reactors such as the fusion nuclear science facility (FNSF) and the spherical tokamak (ST) pilot plant beyond ITER. Here, Princeton Plasma Physics Laboratory is currently leading the design studies of the FNSF and the ST pilot plant study. ITER, which is under construction in the south of France, utilizes the state-of-the-art low temperature superconducting magnet technology based on the cable-in-conduit conductor design, where over a thousand multifilament Nb 3Sn superconducting strands are twisted together to form a high-current-carrying cable inserted into a steelmore » jacket for coil windings. We present design options of the high-performance superconductors in the winding pack for the FNSF toroidal field magnet system based on the toroidal field radial build from the system code. For the low temperature superconductor options, the advanced J cNb 3Sn RRP strands (J c > 1000 A/mm 2 at 16 T, 4 K) from Oxford Superconducting Technology are under consideration. For the high-temperature superconductor options, the rectangular-shaped high-current HTS cable made of stacked YBCO tapes will be considered to validate feasibility of TF coil winding pack design for the ST-FNSF magnets.« less

  14. High-performance superconductors for Fusion Nuclear Science Facility

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhai, Yuhu; Kessel, Chuck; Barth, Christian

    High-performance superconducting magnets play an important role in the design of the next step large-scale, high-field fusion reactors such as the fusion nuclear science facility (FNSF) and the spherical tokamak (ST) pilot plant beyond ITER. Here, Princeton Plasma Physics Laboratory is currently leading the design studies of the FNSF and the ST pilot plant study. ITER, which is under construction in the south of France, utilizes the state-of-the-art low temperature superconducting magnet technology based on the cable-in-conduit conductor design, where over a thousand multifilament Nb 3Sn superconducting strands are twisted together to form a high-current-carrying cable inserted into a steelmore » jacket for coil windings. We present design options of the high-performance superconductors in the winding pack for the FNSF toroidal field magnet system based on the toroidal field radial build from the system code. For the low temperature superconductor options, the advanced J cNb 3Sn RRP strands (J c > 1000 A/mm 2 at 16 T, 4 K) from Oxford Superconducting Technology are under consideration. For the high-temperature superconductor options, the rectangular-shaped high-current HTS cable made of stacked YBCO tapes will be considered to validate feasibility of TF coil winding pack design for the ST-FNSF magnets.« less

  15. Test of 60 kA coated conductor cable prototypes for fusion magnets

    NASA Astrophysics Data System (ADS)

    Uglietti, D.; Bykovsky, N.; Sedlak, K.; Stepanov, B.; Wesche, R.; Bruzzone, P.

    2015-12-01

    Coated conductors could be promising materials for the fabrication of the large magnet systems of future fusion devices. Two prototype conductors (flat cables in steel conduits), each about 2 m long, were manufactured using coated conductor tapes (4 mm wide) from Super Power and SuperOx, with a total tape length of 1.6 km. Each flat cable is assembled from 20 strands, each strand consisting of a stack of 16 tapes surrounded by two half circular copper profiles, twisted and soldered. The tapes were measured at 12 T and 4.2 K and the results of the measurements were used for the assessment of the conductor electromagnetic properties at low temperature and high field. The two conductors were assembled together in a sample that was tested in the European Dipole (EDIPO) facility. The current sharing temperatures of the two conductors were measured at background fields from 8 T up to 12 T and for currents from 30 kA up to 70 kA: the measured values are within a few percent of the values expected from the measurements on tapes (short samples). After electromagnetic cycling, T cs at 12 T and 50 kA decreased from about 12 K to 11 K (about 10%), corresponding to less than 3% of I c.

  16. Exact special twist method for quantum Monte Carlo simulations

    NASA Astrophysics Data System (ADS)

    Dagrada, Mario; Karakuzu, Seher; Vildosola, Verónica Laura; Casula, Michele; Sorella, Sandro

    2016-12-01

    We present a systematic investigation of the special twist method introduced by Rajagopal et al. [Phys. Rev. B 51, 10591 (1995), 10.1103/PhysRevB.51.10591] for reducing finite-size effects in correlated calculations of periodic extended systems with Coulomb interactions and Fermi statistics. We propose a procedure for finding special twist values which, at variance with previous applications of this method, reproduce the energy of the mean-field infinite-size limit solution within an adjustable (arbitrarily small) numerical error. This choice of the special twist is shown to be the most accurate single-twist solution for curing one-body finite-size effects in correlated calculations. For these reasons we dubbed our procedure "exact special twist" (EST). EST only needs a fully converged independent-particles or mean-field calculation within the primitive cell and a simple fit to find the special twist along a specific direction in the Brillouin zone. We first assess the performances of EST in a simple correlated model such as the three-dimensional electron gas. Afterwards, we test its efficiency within ab initio quantum Monte Carlo simulations of metallic elements of increasing complexity. We show that EST displays an overall good performance in reducing finite-size errors comparable to the widely used twist average technique but at a much lower computational cost since it involves the evaluation of just one wave function. We also demonstrate that the EST method shows similar performances in the calculation of correlation functions, such as the ionic forces for structural relaxation and the pair radial distribution function in liquid hydrogen. Our conclusions point to the usefulness of EST for correlated supercell calculations; our method will be particularly relevant when the physical problem under consideration requires large periodic cells.

  17. Development and evaluation of TWIST Dixon for dynamic contrast-enhanced (DCE) MRI with improved acquisition efficiency and fat suppression.

    PubMed

    Le, Yuan; Kroeker, Randall; Kipfer, Hal D; Lin, Chen

    2012-08-01

    To develop a new pulse sequence called time-resolved angiography with stochastic trajectories (TWIST) Dixon for dynamic contrast enhanced magnetic resonance imaging (DCE-MRI). The method combines dual-echo Dixon to generate separated water and fat images with a k-space view-sharing scheme developed for 3D TWIST. The performance of TWIST Dixon was compared with a volume interpolated breathhold examination (VIBE) sequence paired with spectrally selective adiabatic inversion Recovery (SPAIR) and quick fat-sat (QFS) fat-suppression techniques at 3.0T using quantitative measurements of fat-suppression accuracy and signal-to-noise ratio (SNR) efficiency, as well as qualitative breast image evaluations. The water fraction of a uniform phantom was calculated from the following images: 0.66 ± 0.03 for TWIST Dixon; 0.56 ± 0.23 for VIBE-SPAIR, and 0.53 ± 0.14 for VIBE-QFS, while the reference value is 0.70 measured by spectroscopy. For phantoms with contrast (Gd-BOPTA) concentration ranging from 0-6 mM, TWIST Dixon also provides consistently higher SNR efficiency (3.2-18.9) compared with VIBE-SPAIR (2.8-16.8) and VIBE-QFS (2.4-12.5). Breast images acquired with TWIST Dixon at 3.0T show more robust and uniform fat suppression and superior overall image quality compared with VIBE-SPAIR. The results from phantom and volunteer evaluation suggest that TWIST Dixon outperforms conventional methods in almost every aspect and it is a promising method for DCE-MRI and contrast-enhanced perfusion MRI, especially at higher field strength where fat suppression is challenging. Copyright © 2012 Wiley Periodicals, Inc.

  18. USSR Report Electronics and Electrical Engineering.

    DTIC Science & Technology

    1986-11-07

    Porous Glass (I.K. Meshkovskiy, S.S. Solovyev, et al.; OPTIKO- MEKHANICHESKAYA PROMYSHLENNOST, No 12, Dec 85) 93 Aperture Synthesis of...by means of shifting the separate chrominance images and viewing them separately through color glasses with the left and right eyes. Of the pairs of...operation of glass -fiber optical cables and operation of copper-conductor electrical cables is drawn on the basis of that between conduction current in a

  19. Particle-in-Cell Simulations of the Twisted Magnetospheres of Magnetars. I.

    NASA Astrophysics Data System (ADS)

    Chen, Alexander Y.; Beloborodov, Andrei M.

    2017-08-01

    The magnetospheres of magnetars are believed to be filled with electron-positron plasma generated by electric discharge. We present a first numerical experiment demonstrating this process in an axisymmetric magnetosphere with a simple threshold prescription for pair creation, which is applicable to the inner magnetosphere with an ultrastrong field. The {e}+/- discharge occurs in response to the twisting of the closed magnetic field lines by a shear deformation of the magnetar surface, which launches electric currents into the magnetosphere. The simulation shows the formation of an electric “gap” with an unscreened electric field ({\\boldsymbol{E}}\\cdot {\\boldsymbol{B}}\

  20. Proposal for massively parallel data storage system

    NASA Technical Reports Server (NTRS)

    Mansuripur, M.

    1992-01-01

    An architecture for integrating large numbers of data storage units (drives) to form a distributed mass storage system is proposed. The network of interconnected units consists of nodes and links. At each node there resides a controller board, a data storage unit and, possibly, a local/remote user-terminal. The links (twisted-pair wires, coax cables, or fiber-optic channels) provide the communications backbone of the network. There is no central controller for the system as a whole; all decisions regarding allocation of resources, routing of messages and data-blocks, creation and distribution of redundant data-blocks throughout the system (for protection against possible failures), frequency of backup operations, etc., are made locally at individual nodes. The system can handle as many user-terminals as there are nodes in the network. Various users compete for resources by sending their requests to the local controller-board and receiving allocations of time and storage space. In principle, each user can have access to the entire system, and all drives can be running in parallel to service the requests for one or more users. The system is expandable up to a maximum number of nodes, determined by the number of routing-buffers built into the controller boards. Additional drives, controller-boards, user-terminals, and links can be simply plugged into an existing system in order to expand its capacity.

  1. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  2. CSSC Fish Barrier Simulated Rescuer Touch Point Results, Operating Guidance, and Recommendations for Rescuer Safety

    DTIC Science & Technology

    2011-09-01

    Testing Input electrodes consisting of 1/2” diameter, 6” long copper rods were wired to separate conductors of a shielded, commercially available...underwater-rated electrical cable (three-conductor, shielded, shipboard cable (TSS-2), 18 American Wire Gauge (AWG) stranded copper ). Electrode pairs...sandpaper prior to use to ensure the best electrical continuity between the water and electrode by removing any copper oxide. This electrode

  3. Application of Advanced Concepts and Techniques in Electromagnetic Topology Based Simulations: CRIPTE and Related Codes

    DTIC Science & Technology

    2008-12-01

    multiconductor transmission line theory. The per-unit capacitance, inductance , and characteristic impedance matrices generated from the companion LAPLACE...code based on the Method of Moments application, by meshing different sections of the multiconductor cable for capacitance and inductance matrices [21...conductors held together in four pairs and resided in the cable jacket. Each of eight conductors was also designed with the per unit length resistance

  4. Optical Access Networks

    NASA Astrophysics Data System (ADS)

    Zheng, Jun; Ansari, Nirwan

    2005-01-01

    Call for Papers: Optical Access Networks

    Guest Editors Jun Zheng, University of Ottawa Nirwan Ansari, New Jersey Institute of Technology

    Submission Deadline: 1 June 2005

    Background

    With the wide deployment of fiber-optic technology over the past two decades, we have witnessed a tremendous growth of bandwidth capacity in the backbone networks of today's telecommunications infrastructure. However, access networks, which cover the "last-mile" areas and serve numerous residential and small business users, have not been scaled up commensurately. The local subscriber lines for telephone and cable television are still using twisted pairs and coaxial cables. Most residential connections to the Internet are still through dial-up modems operating at a low speed on twisted pairs. As the demand for access bandwidth increases with emerging high-bandwidth applications, such as distance learning, high-definition television (HDTV), and video on demand (VoD), the last-mile access networks have become a bandwidth bottleneck in today's telecommunications infrastructure. To ease this bottleneck, it is imperative to provide sufficient bandwidth capacity in the access networks to open the bottleneck and thus present more opportunities for the provisioning of multiservices. Optical access solutions promise huge bandwidth to service providers and low-cost high-bandwidth services to end users and are therefore widely considered the technology of choice for next-generation access networks. To realize the vision of optical access networks, however, many key issues still need to be addressed, such as network architectures, signaling protocols, and implementation standards. The major challenges lie in the fact that an optical solution must be not only robust, scalable, and flexible, but also implemented at a low cost comparable to that of existing access solutions in order to increase the economic viability of many potential high-bandwidth applications. In recent years, optical access networks have been receiving tremendous attention from both academia and industry. A large number of research activities have been carried out or are now underway this hot area. The purpose of this feature issue is to expose the networking community to the latest research breakthroughs and progresses in the area of optical access networks.

    Scope of Contributions

    This feature issue aims to present a collection of papers that focus on the state-of-the-art research in various networking aspects of optical access networks. Original papers are solicited from all researchers involved in area of optical access networks. Topics of interest include but not limited to:
    • Optical access network architectures and protocols
    • Passive optical networks (BPON, EPON, GPON, etc.)
    • Active optical networks
    • Multiple access control
    • Multiservices and QoS provisioning
    • Network survivability
    • Field trials and standards
    • Performance modeling and analysis

    Manuscript Submission

    To submit to this special issue, follow the normal procedure for submission to JON, indicating ``Optical Access Networks feature' in the ``Comments' field of the online submission form. For all other questions relating to this feature issue, please send an e-mail to jon@osa.org, subject line ``Optical Access Networks' Additional information can be found on the JON website: http://www.osa-jon.org/submission/. Submission Deadline: 1 June 2005

  5. Frequency domain reflectometry NDE for aging cables in nuclear power plants

    NASA Astrophysics Data System (ADS)

    Glass, S. W.; Jones, A. M.; Fifield, L. S.; Hartman, T. S.

    2017-02-01

    Degradation of the cable jacket, electrical insulation, and other cable components of installed cables within nuclear power plants (NPPs) is known to occur as a function of age, temperature, radiation, and other environmental factors. Although system tests verify cable function under normal loads, demonstration of some cable's ability to perform under exceptional loads associated with design-basis events is essential to assuring plant integrity. The cable's ability to perform safely over the initial 40-year planned and licensed life has generally been demonstrated and there have been very few age-related cable failures. With greater than 1000 km of power, control, instrumentation, and other cables typically found in an NPP, replacing all the cables would be a severe cost burden. Justification for life extension to 60 and 80 years requires a cable aging management program that includes condition monitoring to justify cable performance under normal operation as well as accident conditions. A variety of tests are available to assess various aspects of electrical and mechanical cable performance, but none are suitable for all cable configurations nor does any single test confirm all features of interest. One particularly promising test that is beginning to be used more and more by utilities is frequency domain reflectometry (FDR). FDR is a nondestructive electrical inspection technique used to detect and localize faults in power and communication system conductors along the length of a cable from a single connection point. FDR detects discontinuities in the electrical impedance that arise due to cable splices or similar changes along the path of the conductor pair. In addition, FDR has the potential to provide sensitivity to insulation degradation by detecting small changes in impedance between the cable conductors being examined. The technique is also sensitive to cable bends, the particular lay of the cable in tray, proximity to other cable, and other factors that bear consideration when interpreting the test results. This paper examines various influences on the FDR approach and compares results of three different instruments to assess accelerated aging damage among several NPP representative cables.

  6. Light intensity compressor

    DOEpatents

    Rushford, Michael C.

    1990-02-06

    In a system for recording images having vastly differing light intensities over the face of the image, a light intensity compressor is provided that utilizes the properties of twisted nematic liquid crystals to compress the image intensity. A photoconductor or photodiode material that is responsive to the wavelength of radiation being recorded is placed adjacent a layer of twisted nematic liquid crystal material. An electric potential applied to a pair of electrodes that are disposed outside of the liquid crystal/photoconductor arrangement to provide an electric field in the vicinity of the liquid crystal material. The electrodes are substantially transparent to the form of radiation being recorded. A pair of crossed polarizers are provided on opposite sides of the liquid crystal. The front polarizer linearly polarizes the light, while the back polarizer cooperates with the front polarizer and the liquid crystal material to compress the intensity of a viewed scene. Light incident upon the intensity compressor activates the photoconductor in proportion to the intensity of the light, thereby varying the field applied to the liquid crystal. The increased field causes the liquid crystal to have less of a twisting effect on the incident linearly polarized light, which will cause an increased percentage of the light to be absorbed by the back polarizer. The intensity of an image may be compressed by forming an image on the light intensity compressor.

  7. Light intensity compressor

    DOEpatents

    Rushford, Michael C.

    1990-01-01

    In a system for recording images having vastly differing light intensities over the face of the image, a light intensity compressor is provided that utilizes the properties of twisted nematic liquid crystals to compress the image intensity. A photoconductor or photodiode material that is responsive to the wavelength of radiation being recorded is placed adjacent a layer of twisted nematic liquid crystal material. An electric potential applied to a pair of electrodes that are disposed outside of the liquid crystal/photoconductor arrangement to provide an electric field in the vicinity of the liquid crystal material. The electrodes are substantially transparent to the form of radiation being recorded. A pair of crossed polarizers are provided on opposite sides of the liquid crystal. The front polarizer linearly polarizes the light, while the back polarizer cooperates with the front polarizer and the liquid crystal material to compress the intensity of a viewed scene. Light incident upon the intensity compressor activates the photoconductor in proportion to the intensity of the light, thereby varying the field applied to the liquid crystal. The increased field causes the liquid crystal to have less of a twisting effect on the incident linearly polarized light, which will cause an increased percentage of the light to be absorbed by the back polarizer. The intensity of an image may be compressed by forming an image on the light intensity compressor.

  8. Characteristics of Partial Discharge and Ozone Generation for Twisted-pair of Enameled Wires under High-repetitive Impulse Voltage Application

    NASA Astrophysics Data System (ADS)

    Kanazawa, Seiji; Enokizono, Masato; Shibakita, Toshihide; Umehara, Eiji; Toshimitsu, Jun; Ninomiya, Shinji; Taniguchi, Hideki; Abe, Yukari

    In recent years, inverter drive machines such as a hybrid vehicle and an electric vehicle are operated under high voltage pulse with high repetition rate. In this case, inverter surge is generated and affected the machine operation. Especially, the enameled wire of a motor is deteriorated due to the partial discharge (PD) and finally breakdown of the wire will occur. In order to investigate a PD on a resistant enameled wire, characteristics of PD in the twisted pair sample under bipolar repetitive impulse voltages are investigated experimentally. The relationship between the applied voltage and discharge current was measured at PD inception and extinction, and we estimated the repetitive PD inception and extinction voltages experimentally. The corresponding optical emission of the discharge was also observed by using an ICCD camera. Furthermore, ozone concentration due to the discharge was measured during the life-time test of the resistant enameled wires from a working environmental point of view.

  9. Liquid droplet sensing using twisted optical fiber couplers fabricated by hydrofluoric acid flow etching

    NASA Astrophysics Data System (ADS)

    Son, Gyeongho; Jung, Youngho; Yu, Kyoungsik

    2017-04-01

    We report a directional-coupler-based refractive index sensor and its cost-effective fabrication method using hydrofluoric acid droplet wet-etching and surface-tension-driven liquid flows. The proposed fiber sensor consists of a pair of twisted tapered optical fibers with low excess losses. The fiber cores in the etched microfiber region are exposed to the surrounding medium for efficient interaction with the guided light. We observe that the etching-based low-loss fiber-optic sensors can measure the water droplet volume by detecting the refractive index changes of the surrounding medium around the etched fiber core region.

  10. A miniature cable-driven robot for crawling on the heart.

    PubMed

    Patronik, N A; Zenati, M A; Riviere, C N

    2005-01-01

    This document describes the design and preliminary testing of a cable-driven robot for the purpose of traveling on the surface of the beating heart to administer therapy. This methodology obviates mechanical stabilization and lung deflation, which are typically required during minimally invasive cardiac surgery. Previous versions of the robot have been remotely actuated through push-pull wires, while visual feedback was provided by fiber optic transmission. Although these early models were able to perform locomotion in vivo on porcine hearts, the stiffness of the wire-driven transmission and fiber optic camera limited the mobility of the robots. The new prototype described in this document is actuated by two antagonistic cable pairs, and contains a color CCD camera located in the front section of the device. These modifications have resulted in superior mobility and visual feedback. The cable-driven prototype has successfully demonstrated prehension, locomotion, and tissue dye injection during in vitro testing with a poultry model.

  11. Myosin II dynamics are regulated by tension in intercalating cells.

    PubMed

    Fernandez-Gonzalez, Rodrigo; Simoes, Sérgio de Matos; Röper, Jens-Christian; Eaton, Suzanne; Zallen, Jennifer A

    2009-11-01

    Axis elongation in Drosophila occurs through polarized cell rearrangements driven by actomyosin contractility. Myosin II promotes neighbor exchange through the contraction of single cell boundaries, while the contraction of myosin II structures spanning multiple pairs of cells leads to rosette formation. Here we show that multicellular actomyosin cables form at a higher frequency than expected by chance, indicating that cable assembly is an active process. Multicellular cables are sites of increased mechanical tension as measured by laser ablation. Fluorescence recovery after photobleaching experiments show that myosin II is stabilized at the cortex in regions of increased tension. Myosin II is recruited in response to an ectopic force and relieving tension leads to a rapid loss of myosin, indicating that tension is necessary and sufficient for cortical myosin localization. These results demonstrate that myosin II dynamics are regulated by tension in a positive feedback loop that leads to multicellular actomyosin cable formation and efficient tissue elongation.

  12. A device for testing cables

    NASA Technical Reports Server (NTRS)

    Hayhurst, Arthur Ray (Inventor)

    1993-01-01

    A device for testing current paths is attachable to a conductor. The device automatically checks the current paths of the conductor for continuity of a center conductor, continuity of a shield, and a short circuit between the shield and the center conductor. The device includes a pair of connectors and a circuit to provide for testing of the conductive paths of a cable to be tested with the circuit paths of the circuit. The circuit paths in the circuit include indicators to simultaneously indicate the results of the testing.

  13. Translations on Telecommunications Policy, Research and Development, Number 54

    DTIC Science & Technology

    1978-09-22

    parts of Argentina, Uruguay, Chile, Ecuador, Colombia and Venezuela, and all of Paraguay, Bolivia, Peru, Surinam and Guyana. Argentina, in turn, is...between Rome and Palermo , by way of a cable contain- ing eight 2.6/9.5 mm (0.104/0.375") coaxial pairs, equipped with 12 MHz systems, and that of a...circuit by way of a 3600-channel sub- marine cable abaut of 500 km lenght, the distance by sea between Rome and Palermo . On the basis of these

  14. Electrically Controlled Valve With Small Motor

    NASA Technical Reports Server (NTRS)

    Reinicke, Robert H.; Mohtar, Rafic; Nelson, Richard O.

    1992-01-01

    Design of electrically controlled valve exploits force-multiplying principle to overcome large back-pressure force resisting initial opening. Design makes possible to open valve by use of relatively small motor adequate for rest of valve motion, but otherwise not large enough to open valve. In simple linear lifting, small horizontal forces applied to pair of taut cables to lift large weight through short distance. In rotary lifting, similar effect achieved by rotating, about an axis, disk to which initially axial cables attached.

  15. Implications of the dependence of the elastic properties of DNA on nucleotide sequence.

    PubMed

    Olson, Wilma K; Swigon, David; Coleman, Bernard D

    2004-07-15

    Recent advances in structural biochemistry have provided evidence that not only the geometric properties but also the elastic moduli of duplex DNA are strongly dependent on nucleotide sequence in a way that is not accounted for by classical rod models of the Kirchhoff type. A theory of sequence-dependent DNA elasticity is employed here to calculate the dependence of the equilibrium configurations of circular DNA on the binding of ligands that can induce changes in intrinsic twist at a single base-pair step. Calculations are presented of the influence on configurations of the assumed values and distribution along the DNA of intrinsic roll and twist and a modulus coupling roll to twist. Among the results obtained are the following. For minicircles formed from intrinsically straight DNA, the distribution of roll-twist coupling strongly affects the dependence of the total elastic energy Psi on the amount alpha of imposed untwisting, and that dependence can be far from quadratic. (In fact, for a periodic distribution of roll-twist coupling with a period equal to the intrinsic helical repeat length, Psi can be essentially independent of alpha for -90 degrees < alpha <90 degrees.) When the minicircle is homogeneous and without roll-twist coupling, but with uniform positive intrinsic roll, the point at which Psi attains its minimum value shifts towards negative values of alpha. It is remarked that there are cases in which one can relate graphs of Psi versus alpha to the 'effective values' of bending and twisting moduli and helical repeat length obtained from measurements of equilibrium distributions of topoisomers and probabilities of ring closure. For a minicircle formed from DNA that has an 'S' shape when stress-free, the graphs of Psi versus alpha have maxima at alpha = 0. As the binding of a twisting agent to such a minicircle results in a net decrease in Psi, the affinity of the twisting agent for binding to the minicircle is greater than its affinity for binding to unconstrained DNA with the same sequence.

  16. 7 CFR 1755.505 - Buried services.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... water pipes, heating ducts, and other heat sources. (9) Wire and cable attachments to buildings for... Pair Tip Color of insulation Color of marking Ring Color of insulation Color of marking 1 White Blue...

  17. Monitoring transients in low inductance circuits

    DOEpatents

    Guilford, Richard P.; Rosborough, John R.

    1987-01-01

    A pair of flat cable transmission lines are monitored for transient current spikes by using a probe connected to a current transformer by a pickup loop and monitoring the output of the current transformer. The approach utilizes a U-shaped pickup probe wherein the pair of flat cable transmission lines are received between the legs of the U-shaped probe. The U-shaped probe is preferably formed of a flat coil conductor adhered to one side of a flexible substrate. On the other side of the flexible substrate there is a copper foil shield. The copper foil shield is connected to one end of the flat conductor coil and connected to one leg of the pickup loop which passes through the current transformer. The other end of the flat conductor coil is connected to the other leg of the pickup loop.

  18. Preliminary photovoltaic arc-fault prognostic tests using sacrificial fiber optic cabling.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, Jay Dean; Blemel, Kenneth D.; Peter, Francis

    2013-02-01

    Through the New Mexico Small Business Assistance Program, Sandia National Laboratories worked with Sentient Business Systems, Inc. to develop and test a novel photovoltaic (PV) arc-fault detection system. The system operates by pairing translucent polymeric fiber optic sensors with electrical circuitry so that any external abrasion to the system or internal heating causes the fiber optic connection to fail or detectably degrade. A periodic pulse of light is sent through the optical path using a transmitter-receiver pair. If the receiver does not detect the pulse, an alarm is sounded and the PV system can be de-energized. This technology has themore » unique ability to prognostically determine impending failures to the electrical system in two ways: (a) the optical connection is severed prior to physical abrasion or cutting of PV DC electrical conductors, and (b) the polymeric fiber optic cable melts via Joule heating before an arc-fault is established through corrosion. Three arc-faults were created in different configurations found in PV systems with the integrated fiber optic system to determine the feasibility of the technology. In each case, the fiber optic cable was broken and the system annunciated the fault.« less

  19. Loop Group Parakeet Virtual Cable Concept Demonstrator

    NASA Astrophysics Data System (ADS)

    Dowsett, T.; McNeill, T. C.; Reynolds, A. B.; Blair, W. D.

    2002-07-01

    The Parakeet Virtual Cable (PVC) concept demonstrator uses the Ethernet Local Area Network (LAN) laid for the Battle Command Support System (BCSS) to connect the Parakeet DVT(DA) (voice terminal) to the Parakeet multiplexer. This currently requires pairs of PVC interface units to be installed for each DVT(DA) . To reduce the cost of a PVC installation, the concept of a Loop Group Parakeet Virtual Cable (LGPVC) was proposed. This device was designed to replace the up to 30 PVC boxes and the multiplexer at the multiplexer side of a PVC installation. While the demonstrator is largely complete, testing has revealed an incomplete understanding of how to emulate the proprietary handshaking occurring between the circuit switch and the multiplexer. The LGPVC concept cannot yet be demonstrated.

  20. Thickness-shear and thickness-twist modes in an AT-cut quartz acoustic wave filter.

    PubMed

    Zhao, Zinan; Qian, Zhenghua; Wang, Bin; Yang, Jiashi

    2015-04-01

    We studied thickness-shear and thickness-twist vibrations of a monolithic, two-pole crystal filter made from a plate of AT-cut quartz. The scalar differential equations derived by Tiersten and Smythe for electroded and unelectroded quartz plates were employed which are valid for both the fundamental and the overtone modes. Exact solutions for the free vibration resonant frequencies and modes were obtained from the equations. For a structurally symmetric filter, the modes can be separated into symmetric and antisymmetric ones. Trapped modes with vibrations mainly under the electrodes were found. The effect of the distance between the two pairs of electrodes was examined. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Di-hadron production at Jefferson Laboratory

    NASA Astrophysics Data System (ADS)

    Anefalos Pereira, Sergio; CLAS Collaboration

    2015-04-01

    Semi-inclusive deep inelastic scattering (SIDIS) has been used extensively in recent years as an important testing ground for QCD. Studies so far have concentrated on better determination of parton distribution functions, distinguishing between the quark and antiquark contributions, and understanding the fragmentation of quarks into hadrons. Pair of hadrons (di-hadron) SIDIS provides information on the nucleon structure and hadronization dynamics that complements single-hadron SIDIS. The study of di-hadrons allow us to study higher twist distribution functions and Dihadron Fragmentation Functions (DiFF). Together with the twist-2 PDFs (f 1, g 1, h 1), the Higher Twist (HT) e and hL functions are very interesting because they offer insights into the physics of the largely unexplored quark-gluon correlations which provide direct and unique insights into the dynamics inside hadrons. The CLAS spectrometer, installed in Hall-B at Jefferson Lab, has collected data using the CEBAF 6 GeV longitudinally polarized electron beam on longitudinally polarized solid NH3 targets. Preliminary results on beam-, target- and double-spin asymmetries will be presented.

  2. 76 FR 38710 - Self-Regulatory Organizations; NASDAQ OMX BX, Inc.; Notice of Filing and Immediate Effectiveness...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-01

    ... receptacles (60 amps 208 volts), which would provide enough power for a high density cabinet. The proposed fee for installation of the pair of the 60 amp 208 volt power receptacles is $3,000. There are ten other... case of the proposed fees for a pair of the 60 amp power receptacles and the Twinax cables, the...

  3. A Miniaturized, Programmable Deep-Brain Stimulator for Group-Housing and Water Maze Use

    PubMed Central

    Pinnell, Richard C.; Pereira de Vasconcelos, Anne; Cassel, Jean C.; Hofmann, Ulrich G.

    2018-01-01

    Pre-clinical deep-brain stimulation (DBS) research has observed a growing interest in the use of portable stimulation devices that can be carried by animals. Not only can such devices overcome many issues inherent with a cable tether, such as twisting or snagging, they can also be utilized in a greater variety of arenas, including enclosed or large mazes. However, these devices are not inherently designed for water-maze environments, and their use has been restricted to individually-housed rats in order to avoid damage from various social activities such as grooming, playing, or fighting. By taking advantage of 3D-printing techniques, this study demonstrates an ultra-small portable stimulator with an environmentally-protective device housing, that is suitable for both social-housing and water-maze environments. The miniature device offers 2 channels of charge-balanced biphasic pulses with a high compliance voltage (12 V), a magnetic switch, and a diverse range of programmable stimulus parameters and pulse modes. The device's capabilities have been verified in both chronic pair-housing and water-maze experiments that asses the effects of nucleus reuniens DBS. Theta-burst stimulation delivered during a reference-memory water-maze task (but not before) had induced performance deficits during both the acquisition and probe trials of a reference memory task. The results highlight a successful application of 3D-printing for expanding on the range of measurement modalities capable in DBS research. PMID:29706862

  4. Multi-fibers connectors systems for FOCCoS-PFS-Subaru

    NASA Astrophysics Data System (ADS)

    de Oliveira, Antonio Cesar; de Oliveira, Ligia Souza; Souza Marrara, Lucas; dos Santos, Leandro Henrique; Vital de Arruda, Marcio; dos Santos, Jesulino Bispo; Ferreira, Décio; Rosa, Josimar Aparecido; de Paiva Vilaça, Rodrigo; Sodré, Laerte; de Oliveira, Claudia Mendes; Gunn, James E.

    2014-07-01

    The Fiber Optical Cable and Connector System (FOCCoS), provides optical connection between 2400 positioners and a set of spectrographs through optical fibers cables as part of PFS instrument for Subaru telescope. The optical fiber cable will be segmented in 3 parts along the route, cable A, cable B and cable C, connected by a set of multi-fiber connectors. The company USCONEC produces the multi-fiber connector under study. The USCONEC 32F model can connect 32 optical fibers in a 4 x 8 matrix arrangement. The ferrules are made of a durable composite, Polyphenylene Sulfide (PPS) based thermoplastic. The connections are held in place by a push-on/pull-off latch, and the connector can also be distinguished by a pair of metal guide pins that protrude from the front of the connector. Two fibers per connector will be used for monitoring the connection procedure. It was found to be easy to polish and it is small enough to be mounted in groups. Highly multiplexed instruments like PFS require a fiber connector system that can deliver excellent optical performance and reliability. PFS requires two different types of structures to organize the connectors. The Tower Connector system, with 80 multi-fiber connectors, will be a group of connectors for connecting cable B (Telescope Structure) with cable C (Positioners Plate). The Gang Connector system is a group of 8 gang connectors, each one with 12 multi-fibers connectors, for connecting cable B (Telescope Structure) with cable A (Spectrograph). The bench tests with these connector systems and the chosen fibers should measure the throughput of light and the stability after many connections and disconnections. In this paper we describe tests and procedures to evaluate the throughput and FRD increment. The lifetime of the ferrules is also in evaluation.

  5. Unconventional superconductivity in magic-angle graphene superlattices.

    PubMed

    Cao, Yuan; Fatemi, Valla; Fang, Shiang; Watanabe, Kenji; Taniguchi, Takashi; Kaxiras, Efthimios; Jarillo-Herrero, Pablo

    2018-04-05

    The behaviour of strongly correlated materials, and in particular unconventional superconductors, has been studied extensively for decades, but is still not well understood. This lack of theoretical understanding has motivated the development of experimental techniques for studying such behaviour, such as using ultracold atom lattices to simulate quantum materials. Here we report the realization of intrinsic unconventional superconductivity-which cannot be explained by weak electron-phonon interactions-in a two-dimensional superlattice created by stacking two sheets of graphene that are twisted relative to each other by a small angle. For twist angles of about 1.1°-the first 'magic' angle-the electronic band structure of this 'twisted bilayer graphene' exhibits flat bands near zero Fermi energy, resulting in correlated insulating states at half-filling. Upon electrostatic doping of the material away from these correlated insulating states, we observe tunable zero-resistance states with a critical temperature of up to 1.7 kelvin. The temperature-carrier-density phase diagram of twisted bilayer graphene is similar to that of copper oxides (or cuprates), and includes dome-shaped regions that correspond to superconductivity. Moreover, quantum oscillations in the longitudinal resistance of the material indicate the presence of small Fermi surfaces near the correlated insulating states, in analogy with underdoped cuprates. The relatively high superconducting critical temperature of twisted bilayer graphene, given such a small Fermi surface (which corresponds to a carrier density of about 10 11 per square centimetre), puts it among the superconductors with the strongest pairing strength between electrons. Twisted bilayer graphene is a precisely tunable, purely carbon-based, two-dimensional superconductor. It is therefore an ideal material for investigations of strongly correlated phenomena, which could lead to insights into the physics of high-critical-temperature superconductors and quantum spin liquids.

  6. Unconventional superconductivity in magic-angle graphene superlattices

    NASA Astrophysics Data System (ADS)

    Cao, Yuan; Fatemi, Valla; Fang, Shiang; Watanabe, Kenji; Taniguchi, Takashi; Kaxiras, Efthimios; Jarillo-Herrero, Pablo

    2018-04-01

    The behaviour of strongly correlated materials, and in particular unconventional superconductors, has been studied extensively for decades, but is still not well understood. This lack of theoretical understanding has motivated the development of experimental techniques for studying such behaviour, such as using ultracold atom lattices to simulate quantum materials. Here we report the realization of intrinsic unconventional superconductivity—which cannot be explained by weak electron–phonon interactions—in a two-dimensional superlattice created by stacking two sheets of graphene that are twisted relative to each other by a small angle. For twist angles of about 1.1°—the first ‘magic’ angle—the electronic band structure of this ‘twisted bilayer graphene’ exhibits flat bands near zero Fermi energy, resulting in correlated insulating states at half-filling. Upon electrostatic doping of the material away from these correlated insulating states, we observe tunable zero-resistance states with a critical temperature of up to 1.7 kelvin. The temperature–carrier-density phase diagram of twisted bilayer graphene is similar to that of copper oxides (or cuprates), and includes dome-shaped regions that correspond to superconductivity. Moreover, quantum oscillations in the longitudinal resistance of the material indicate the presence of small Fermi surfaces near the correlated insulating states, in analogy with underdoped cuprates. The relatively high superconducting critical temperature of twisted bilayer graphene, given such a small Fermi surface (which corresponds to a carrier density of about 1011 per square centimetre), puts it among the superconductors with the strongest pairing strength between electrons. Twisted bilayer graphene is a precisely tunable, purely carbon-based, two-dimensional superconductor. It is therefore an ideal material for investigations of strongly correlated phenomena, which could lead to insights into the physics of high-critical-temperature superconductors and quantum spin liquids.

  7. Here's Looking at You, Kid.

    ERIC Educational Resources Information Center

    Milshtein, Amy

    1997-01-01

    The University of Maryland at College Park installed 25 surveillance cameras to combat crime. A minimum of disruption occurred because unused twisted pair wires left in place when the conversion to a fiber optic telephone system was made could be used for the camera installations. The campus is safer, and its budget is intact. (RE)

  8. 4-twist helix snake to maintain polarization in multi-GeV proton rings

    DOE PAGES

    Antoulinakis, F.; Chen, Y.; Dutton, A.; ...

    2017-09-27

    Solenoid Siberian snakes have successfully maintained polarization in particle rings below 1 GeV, but never in multi-GeV rings, because the spin rotation by a solenoid is inversely proportional to the beam momentum. High energy rings, such as Brookhaven’s 255 GeV Relativistic Heavy Ion Collider (RHIC), use only odd multiples of pairs of transverse B-field Siberian snakes directly opposite each other. When it became impractical to use a pair of Siberian Snakes in Fermilab’s 120 GeV/c Main Injector, we searched for a new type of single Siberian snake that could overcome all depolarizing resonances in the 8.9–120 GeV/c range. We foundmore » that a snake made of one 4-twist helix and 2 dipoles could maintain the polarization. Here, this snake design could solve the long-standing problem of significant polarization loss during acceleration of polarized protons from a few GeV to tens of GeV, such as in the AGS, before injecting them into multi-hundred GeV rings, such as RHIC.« less

  9. 4-twist helix snake to maintain polarization in multi-GeV proton rings

    NASA Astrophysics Data System (ADS)

    Antoulinakis, F.; Chen, Y.; Dutton, A.; Rossi De La Fuente, E.; Haupert, S.; Ljungman, E. A.; Myers, P. D.; Thompson, J. K.; Tai, A.; Aidala, C. A.; Courant, E. D.; Krisch, A. D.; Leonova, M. A.; Lorenzon, W.; Raymond, R. S.; Sivers, D. W.; Wong, V. K.; Yang, T.; Derbenev, Y. S.; Morozov, V. S.; Kondratenko, A. M.

    2017-09-01

    Solenoid Siberian snakes have successfully maintained polarization in particle rings below 1 GeV, but never in multi-GeV rings, because the spin rotation by a solenoid is inversely proportional to the beam momentum. High energy rings, such as Brookhaven's 255 GeV Relativistic Heavy Ion Collider (RHIC), use only odd multiples of pairs of transverse B-field Siberian snakes directly opposite each other. When it became impractical to use a pair of Siberian Snakes in Fermilab's 120 GeV /c Main Injector, we searched for a new type of single Siberian snake that could overcome all depolarizing resonances in the 8.9 - 120 GeV /c range. We found that a snake made of one 4-twist helix and 2 dipoles could maintain the polarization. This snake design could solve the long-standing problem of significant polarization loss during acceleration of polarized protons from a few GeV to tens of GeV, such as in the AGS, before injecting them into multi-hundred GeV rings, such as RHIC.

  10. 4-twist helix snake to maintain polarization in multi-GeV proton rings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Antoulinakis, F.; Chen, Y.; Dutton, A.

    Solenoid Siberian snakes have successfully maintained polarization in particle rings below 1 GeV, but never in multi-GeV rings, because the spin rotation by a solenoid is inversely proportional to the beam momentum. High energy rings, such as Brookhaven’s 255 GeV Relativistic Heavy Ion Collider (RHIC), use only odd multiples of pairs of transverse B-field Siberian snakes directly opposite each other. When it became impractical to use a pair of Siberian Snakes in Fermilab’s 120 GeV/c Main Injector, we searched for a new type of single Siberian snake that could overcome all depolarizing resonances in the 8.9–120 GeV/c range. We foundmore » that a snake made of one 4-twist helix and 2 dipoles could maintain the polarization. Here, this snake design could solve the long-standing problem of significant polarization loss during acceleration of polarized protons from a few GeV to tens of GeV, such as in the AGS, before injecting them into multi-hundred GeV rings, such as RHIC.« less

  11. A Study of Dean Vortex Development and Structure in a Curved Rectangular Channel with Aspect Ratio of 40 at Dean Numbers up to 430

    NASA Technical Reports Server (NTRS)

    Ligrani, Phillip M.

    1994-01-01

    Flow in a curved channel with mild curvature, an aspect ratio of 40 to 1, and an inner to outer radius ratio of 0.979 is studied at Dean numbers De ranging from 35 to 430. For positions from the start of curvature ranging from 85 to 145 degrees, the sequence of transition events begins with curved channel Poiseuille flow at De less than 40-64. As the Dean number increases, observations show initial development of Dean vortex pairs, followed by symmetric vortex pairs which, when viewed in spanwise/radial planes, cover the entire channel height (De=90-100). At De from 40 to 125-130, the vortex pairs often develop intermittent waviness in the form of vortex undulations. Splitting and merging of vortex pairs is also observed over the same experimental conditions as well as at higher De. When Dean numbers range from 130 to 185-200, the undulating wavy mode is replaced by a twisting mode with higher amplitudes of oscillation and shorter wavelengths. The twisting wavy mode results in the development of regions where turbulence intensity is locally augmented at Dean numbers from 150 to 185-200, principally in the upwash regions between the two individual vortices which make up each vortex pair. These turbulent regions eventually increase in intensity and spatial extent as the Dean number increases further, until individual regions merge together so that the entire cross section of the channel contains chaotic turbulent motions. When Dean numbers then reach 400-435, spectra of velocity fluctuations then evidence fully turbulent flow.

  12. Report on twisted nematic and supertwisted nematic device characterization program

    NASA Technical Reports Server (NTRS)

    1995-01-01

    In this study we measured the optical characteristics of normally white twisted nematic (NWTN) and super twisted nematic (STN ) cells. Though no dynamic computer model was available, the static observations were compared with computer simulated behavior. The measurements were taken as a function of both viewing angle and applied voltage and included in the static case not only luminance but also contrast ratio and chromaticity . We employed the computer model Twist Cell Optics, developed at Kent State in conjunction with this study, and whose optical modeling foundation, Iike the ViDEOS program, is the 4 x 4 matrix method of Berreman. In order to resolve discrepancies between the experimental and modeled data the optical parameters of the individual cell components, where not known, were determined using refractometry, profilometry, and various forms of ellipsometry. The resulting agreement between experiment and model is quite good due primarily to a better understanding of the structure and optics of dichroic sheet polarizers. A description of the model and test cells employed are given in section 2. Section 3 contains the experimental data gathered and section 4 gives examples of the fit between model and experiment. Also included with this report are a pair of papers which resulted from the research and which detail the polarizer properties and some of the cell characterization methods.

  13. New tension band material for fixation of transverse olecranon fractures: a biomechanical study.

    PubMed

    Lalonde, James Allen; Rabalais, R David; Mansour, Alfred; Burger, Evalina L; Riemer, Barry L; Lu, Yun; Baratta, Richard V

    2005-10-01

    This study tested the use of braided polyethylene cable as an option for repairing transverse olecranon fractures. Six cadaveric elbows underwent a transverse olecranon osteotomy followed by fixation with tension band constructs using 18-gauge wire and Secure-Strand (U.S. Surgical, North Haven, Conn). Distraction forces up to 450 N were applied to the triceps tendon while measuring fracture displacement with an extensometer. The average maximal fracture gap with the standard AO tension band technique using stainless steel wire was 0.66 +/- 0.43 mm, as opposed to 0.68 +/- 0.45 mm with braided polyethylene cable. A paired t test indicated no significant difference between the two materials. These results support the feasibility of braided polyethylene cable as an alternative to the standard steel-wire tension band.

  14. Oblique abdominal muscle activity in response to external perturbations when pushing a cart.

    PubMed

    Lee, Yun-Ju; Hoozemans, Marco J M; van Dieën, Jaap H

    2010-05-07

    Cyclic activation of the external and internal oblique muscles contributes to twisting moments during normal gait. During pushing while walking, it is not well understood how these muscles respond to presence of predictable (cyclic push-off forces) and unpredictable (external) perturbations that occur in pushing tasks. We hypothesized that the predictable perturbations due to the cyclic push-off forces would be associated with cyclic muscle activity, while external perturbations would be counteracted by cocontraction of the oblique abdominal muscles. Eight healthy male subjects pushed at two target forces and two handle heights in a static condition and while walking without and with external perturbations. For all pushing tasks, the median, the static (10th percentile) and the peak levels (90th percentile) of the electromyographic amplitudes were determined. Linear models with oblique abdominal EMGs and trunk angles as input were fit to the twisting moments, to estimate trunk stiffness. There was no significant difference between the static EMG levels in pushing while walking compared to the peak levels in pushing while standing. When pushing while walking, the additional dynamic activity was associated with the twisting moments, which were actively modulated by the pairs of oblique muscles as in normal gait. The median and static levels of trunk muscle activity and estimated trunk stiffness were significantly higher when perturbations occurred than without perturbations. The increase baseline of muscle activity indicated cocontraction of the antagonistic muscle pairs. Furthermore, this cocontraction resulted in an increased trunk stiffness around the longitudinal axis. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Persistent-current magnetizations of Nb3Sn Rutherford cables and extracted strands

    NASA Astrophysics Data System (ADS)

    Collings, E. W.; Sumption, M. D.; Myers, C. S.; Wang, X.; Dietderich, D. R.; Yagotyntsev, K.; Nijhuis, A.

    2017-12-01

    The magnetizations of eight high-gradient quadrupole cables designated HQ and QXF and a pair of strands, identical in architecture but with different effective strand diameters extracted from an HQ and a related QXF cable, were measured. In the service of field quality assessment, the cable magnetizations and losses were measured by pickup coil magnetometry at 4.2 K in face-on fields, B m , of ± 400 mT at frequencies, f, of up to 60 mHz. Based on the coupling component of loss, Q coup , the coupling magnetization M coup = Q coup /4B m was derived for a ramp rate of 7.5 mT/s. Persistent current (shielding) magnetization and loss (M sh and Q h,strand ) were measured on short pieces of extracted strand by vibrating sample magnetometry at 4.2 K. Unpenetrated M-B loops to ± 400 mT and fully penetrated loops to ± 14 T were obtained. M coup can be easily controlled and reduced to relatively small values by introducing cores and adjusting the preparation conditions. But in low fields near injection Nb3Sn’s high J c and correspondingly high M sh,cable may call for magnetic compensation to preserve field quality. The suitably adjusted cable and strand fully penetrated M-B loops were in reasonable accord leading to the conclusion that strand magnetization is a useful measure of cable magnetization, and that when suitably manipulated can provide input to magnet field error calculations.

  16. High strength kiloampere Bi 2Sr 2CaCu 2O x cables for high-field magnet applications

    DOE PAGES

    Shen, Tengming; Li, Pei; Jiang, Jianyi; ...

    2015-04-17

    Multifilamentary Ag-sheathed Bi 2Sr 2CaCu 2O x (Bi-2212) wire can carry sufficient critical current density J c for the development of powerful superconducting magnets. But, the range of its applications is limited by the low mechanical strength of the Ag/Bi-2212 strand. A potential solution is to cable Ag/Bi-2212 wire with high-strength materials that are compatible with the Bi-2212 heat treatment in an oxygen atmosphere. Past attempts have not always been successful, because the high-strength materials reacted with Bi-2212 wires, significantly reducing their J c. We examined the nature of reactions occurring when Ag/Bi-2212 wires are heat-treated in direct contact withmore » several commonly used high-strength alloys and a new Fe-Cr-Al alloy. INCONEL X750 and INCONEL 600 resulted in significant J c loss, whereas Ni80-Cr caused little or no J c loss; however, all of them formed chromium oxide that subsequently reacted with silver, creating cracks in the silver sheath. We found that Fe-Cr-Al did not show significant reactions with Ag/Bi-2212 strands. Scanning electron microscopy (SEM) and energy dispersive x-ray (EDS) examinations revealed that the Fe-Cr-Al alloy benefits from the formation of a uniform, crack-free, continuous alumina layer on its surface that does not react with Ag and that helps minimize the Cu loss found with INCONEL X750 and INCONEL 600. We then fabricated prototype 6-around-1 cables with six Bi-2212 strands twisted and transposed around an Fe-Cr-Al alloy core coated with TiO 2. After standard 1 bar melt processing, the cable retained 100% of the total current-carrying capability of its strands, and, after a 10 bar overpressure processing, the cable reached a total current of 1025 A at 4.2 K and 10 T. Tensile tests showed that Fe-Cr-Al becomes brittle after being cooled to 4.2 K, whereas INCONEL X750 remains ductile and retains a modulus of 183 GPa. Finally. we proposed new cable designs that take advantage of the chemical compatibility of Fe-Cr-Al and high strength of INCONEL X750 for various high-field magnet applications.« less

  17. Di-hadron production at Jefferson Lab

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anefalos Pereira, Sergio; et. al.,

    Semi-inclusive deep inelastic scattering (SIDIS) has been used extensively in recent years as an important testing ground for QCD. Studies so far have concentrated on better determination of parton distribution functions, distinguishing between the quark and antiquark contributions, and understanding the fragmentation of quarks into hadrons. Hadron pair (di-hadron) SIDIS provides information on the nucleon structure and hadronization dynamics that complement single hadron SIDIS. Di-hadrons allow the study of low- and high-twist distribution functions and Dihadron Fragmentation Functions (DiFF). Together with the twist-2 PDFs ( f1, g1, h1), the Higher Twist (HT) e and hL functions are very interesting becausemore » they offer insights into the physics of the largely unexplored quark-gluon correlations, which provide access into the dynamics inside hadrons. The CLAS spectrometer, installed in Hall-B at Jefferson Lab, has collected data using the CEBAF 6 GeV longitudinally polarized electron beam on longitudinally polarized solid NH3 targets. Preliminary results on di-hadron beam-, target- and double-spin asymmetries will be presented.« less

  18. Geometrical correlations in the nucleosomal DNA conformation and the role of the covalent bonds rigidity

    PubMed Central

    Ghorbani, Maryam; Mohammad-Rafiee, Farshid

    2011-01-01

    We develop a simple elastic model to study the conformation of DNA in the nucleosome core particle. In this model, the changes in the energy of the covalent bonds that connect the base pairs of each strand of the DNA double helix, as well as the lateral displacements and the rotation of adjacent base pairs are considered. We show that because of the rigidity of the covalent bonds in the sugar-phosphate backbones, the base pair parameters are highly correlated, especially, strong twist-roll-slide correlation in the conformation of the nucleosomal DNA is vividly observed in the calculated results. This simple model succeeds to account for the detailed features of the structure of the nucleosomal DNA, particularly, its more important base pair parameters, roll and slide, in good agreement with the experimental results. PMID:20972223

  19. Crystal structure of a four-stranded intercalated DNA: d(C4)

    NASA Technical Reports Server (NTRS)

    Chen, L.; Cai, L.; Zhang, X.; Rich, A.

    1994-01-01

    The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.

  20. High-resolution inchworm linear motor based on electrostatic twisting microactuators

    NASA Astrophysics Data System (ADS)

    Kim, Sang-Ho; Hwang, Il-Han; Jo, Kyoung-Woo; Yoon, Eui-Sung; Lee, Jong-Hyun

    2005-09-01

    A new inchworm micromotor using new electrostatic in-plane twisting microactuators has been designed, fabricated and characterized for nano-resolution manipulators. The proposed twisting mechanism was implemented employing a pair of differential electrostatic actuators with a high stiffness in the driving direction for stable positioning. The electromechanically coupled motion of the voltage-displacement relation was analyzed using a finite element method (FEM), confirming that the twisting actuator makes a tiny step movement efficiently. The proposed actuator was fabricated on a silicon-on-insulator (SOI) wafer with the device footprint of 2.2 × 2.8 mm2, and its nano-stepping characteristics were measured by an optical interferometer consisting of an integrated micromirror and optical fiber. The fabricated inchworm motor showed a minimum step displacement of 5.2 ± 3.8 nm (2σ) and 4.1 ± 2.9 nm (2σ) for cyclic motion in the +y- and the -y-directions, respectively, with the gripping voltage of 15 V and differential voltage of 1 V. As a result, the proposed inchworm micromotor could operate with a stroke of 3 µm and a bi-directional step displacement of less than 10 nm. The step displacement is the smallest value of in-plane-type micromotors so far, and its magnitude was controllable up to 120 nm/cycle by changing the differential voltage.

  1. Inclinometer - Time Domain Reflectometry Comparative Study

    DOT National Transportation Integrated Search

    2004-12-01

    Four pairs of inclinometers and time domain reflectometry (TDR) cables were set up to make a side-by-side : comparison of the performance of these systems in detecting slippage of soils in the shoulders of State Route 124 : and State Route 338 in Mei...

  2. Inclinometer--time-domain reflectometry comparative study.

    DOT National Transportation Integrated Search

    2004-12-01

    Four pairs of inclinometers and time domain reflectometry (TDR) cables were set up to make a side-by-side : comparison of the performance of these systems in detecting slippage of soils in the shoulders of State Route 124 : and State Route 338 in Mei...

  3. Cabled-observatory Regional Circulation Moorings on the Endeavour segment of the Juan de Fuca Ridge

    NASA Astrophysics Data System (ADS)

    Mihaly, S. F.

    2011-12-01

    In September of 2010, one of four moorings was deployed on the Endeavour node of the NEPTUNE Canada cabled-observatory network. The installation included the laying of a 7km cable from the node to the mooring site in the axial valley about 3km north of the Main Endeavour Vent Field over extraordinary bathymetry. This September, three more cables and secondary junction boxes will be deployed to support the three additional moorings that complete the regional circulation array. The cable-laying is facilitated by the Canadian Scientific Submersible Facility's ROV ROPOS and a remotely operated cable-laying system, whereas the actual deployment of the moorings is a two ship operation. The CCGS John P. Tully lowers the mooring anchor first, while the RV Thomas G. Thompson supports the ROV operations which navigate the mooring to underwater mateable cable end. Precise navigation is needed because there are few areas suitable for placement of the junction boxes. Scientifically, the moorings are designed and located to best constrain the hydrothermally driven circulation within the rift valley, the regional circulation can then be used as a proxy measurement for hydrothermal fluxes. Each mooring carries a current meter/ ctd pair at 4, 50, 125, and 200m, with an upward looking ADCP at 250m. The northern moorings are located between the Hi-Rise and Salty Dawg fields about 700m apart in the ~1km wide rift valley and the southern moorings are located south of the Mothra vent field. Here we present initial results from the four mooring array.

  4. Probes for measuring noise current in an electronic cable

    NASA Technical Reports Server (NTRS)

    Lundy, C. C.

    1974-01-01

    Electromagnetic interference in deep-space network receiver is often caused by stray coupling from power lines. These stray signals create potential differences between ground terminals, which leads to excessive noise in receiver circuits. Pair of probes detect and measure noise currents in conductors.

  5. Lunar crane hook

    NASA Technical Reports Server (NTRS)

    Cash, John Wilson, III; Cone, Alan E.; Garolera, Frank J.; German, David; Lindabury, David Peter; Luckado, Marshall Cleveland; Murphey, Craig; Rowell, John Bryan; Wilkinson, Brad

    1988-01-01

    The base and ball hook system is an attachment that is designed to be used on the lunar surface as an improved alternative to the common crane hook and eye system. The design proposed uses an omni-directional ball hook and base to overcome the design problems associated with a conventional crane hook. The base and ball hook is not sensitive to cable twist which would render a robotic lunar crane useless since there is little atmospheric resistance to dampen the motion of an oscillating member. The symmetric characteristics of the ball hook and base eliminates manual placement of the ball hook into the base; commonly associated with the typical hook and eye stem. The major advantage of the base and ball hook system is it's ease of couple and uncouple modes that are advantages during unmanned robotic lunar missions.

  6. Active Regions Blossoming

    NASA Image and Video Library

    2015-10-28

    As a pair of active regions began to rotate into view, their towering magnetic field lines above them bloomed into a dazzling display of twisting arches (Oct. 27-28, 2015). Some of the lines reached over and connected with the neighboring active region. Active regions are usually the source of solar storms. The images were taken in a wavelength of extreme ultraviolet light. http://photojournal.jpl.nasa.gov/catalog/PIA20048

  7. Monte Carlo simulations of nematic and chiral nematic shells

    NASA Astrophysics Data System (ADS)

    Wand, Charlie R.; Bates, Martin A.

    2015-01-01

    We present a systematic Monte Carlo simulation study of thin nematic and cholesteric shells with planar anchoring using an off-lattice model. The results obtained using the simple model correspond with previously published results for lattice-based systems, with the number, type, and position of defects observed dependent on the shell thickness with four half-strength defects in a tetrahedral arrangement found in very thin shells and a pair of defects in a bipolar (boojum) configuration observed in thicker shells. A third intermediate defect configuration is occasionally observed for intermediate thickness shells, which is stabilized in noncentrosymmetric shells of nonuniform thickness. Chiral nematic (cholesteric) shells are investigated by including a chiral term in the potential. Decreasing the pitch of the chiral nematic leads to a twisted bipolar (chiral boojum) configuration with the director twist increasing from the inner to the outer surface.

  8. Folded supersymmetry with a twist

    DOE PAGES

    Cohen, Timothy; Craig, Nathaniel; Lou, Hou Keong; ...

    2016-03-30

    Folded supersymmetry (f-SUSY) stabilizes the weak scale against radiative corrections from the top sector via scalar partners whose gauge quantum numbers differ from their Standard Model counterparts. This non-trivial pairing of states can be realized in extra-dimensional theories with appropriate supersymmetry-breaking boundary conditions. We present a class of calculable f-SUSY models that are parametrized by a non-trivial twist in 5D boundary conditions and can accommodate the observed Higgs mass and couplings. Although the distinctive phenomenology associated with the novel folded states should provide strong evidence for this mechanism, the most stringent constraints are currently placed by conventional supersymmetry searches. Asmore » a result, these models remain minimally fine-tuned in light of LHC8 data and provide a range of both standard and exotic signatures accessible at LHC13.« less

  9. The energy of naturally curved elastic rods with an application to the stretching and contraction of a free helical spring as a model for DNA

    NASA Astrophysics Data System (ADS)

    Manning, Gerald S.

    2015-09-01

    We give a contemporary and direct derivation of a classical, but insufficiently familiar, result in the theory of linear elasticity—a representation for the energy of a stressed elastic rod with central axis that intrinsically takes the shape of a general space curve. We show that the geometric torsion of the space curve, while playing a crucial role in the bending energy, is physically unrelated to the elastic twist. We prove that the twist energy vanishes in the lowest-energy states of a rod subject to constraints that do not restrict the twist. The stretching and contraction energies of a free helical spring are computed. There are local high-energy minima. We show the possibility of using the spring to model the chirality of DNA. We then compare our results with an available atomic level energy simulation that was performed on DNA unconstrained in the same sense as the free spring. We find some possible reflections of springlike behavior in the mechanics of DNA, but, unsurprisingly, the base pairs lend a material substance to the core of DNA that a spring does not capture.

  10. The energy of naturally curved elastic rods with an application to the stretching and contraction of a free helical spring as a model for DNA.

    PubMed

    Manning, Gerald S

    2015-09-14

    We give a contemporary and direct derivation of a classical, but insufficiently familiar, result in the theory of linear elasticity-a representation for the energy of a stressed elastic rod with central axis that intrinsically takes the shape of a general space curve. We show that the geometric torsion of the space curve, while playing a crucial role in the bending energy, is physically unrelated to the elastic twist. We prove that the twist energy vanishes in the lowest-energy states of a rod subject to constraints that do not restrict the twist. The stretching and contraction energies of a free helical spring are computed. There are local high-energy minima. We show the possibility of using the spring to model the chirality of DNA. We then compare our results with an available atomic level energy simulation that was performed on DNA unconstrained in the same sense as the free spring. We find some possible reflections of springlike behavior in the mechanics of DNA, but, unsurprisingly, the base pairs lend a material substance to the core of DNA that a spring does not capture.

  11. Three-dimensional doubly diffusive convectons: instability and transition to complex dynamics

    NASA Astrophysics Data System (ADS)

    Knobloch, Edgar; Beaume, Cedric; Bergeon, Alain

    2017-11-01

    Doubly diffusive convection in a closed vertically extended 3D container driven by competing horizontal temperature and concentration gradients is studied. No-slip boundary conditions are imposed. The buoyancy number N = - 1 to ensure the presence of a conduction state. The primary instability is subcritical and generates two families of spatially localised steady states known as convectons. The convectons bifurcate directly from the conduction state and are organized in a pair of primary branches that snake within a well-defined range of Rayleigh numbers as the convectons grow in length. Secondary instabilities generating twist result in secondary snaking branches of twisted convectons. These destabilize the primary convectons and are responsible for the absence of stable steady states, localized or otherwise, in the subcritical regime. As a result, once the Rayleigh number for the primary instability of the conduction state is exceeded, the system exhibits an abrupt transition to large amplitude spatio-temporal chaos that arises whenever the twist instability leading to collapse is faster than the nucleation time for new rolls. These numerical results are confirmed by determining the stability properties of all convecton states as well as spatially extended convection. Supported in part by the National Science Foundation under Grant DMS-1613132.

  12. The energy of naturally curved elastic rods with an application to the stretching and contraction of a free helical spring as a model for DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Manning, Gerald S., E-mail: jerrymanning@rcn.com

    We give a contemporary and direct derivation of a classical, but insufficiently familiar, result in the theory of linear elasticity—a representation for the energy of a stressed elastic rod with central axis that intrinsically takes the shape of a general space curve. We show that the geometric torsion of the space curve, while playing a crucial role in the bending energy, is physically unrelated to the elastic twist. We prove that the twist energy vanishes in the lowest-energy states of a rod subject to constraints that do not restrict the twist. The stretching and contraction energies of a free helicalmore » spring are computed. There are local high-energy minima. We show the possibility of using the spring to model the chirality of DNA. We then compare our results with an available atomic level energy simulation that was performed on DNA unconstrained in the same sense as the free spring. We find some possible reflections of springlike behavior in the mechanics of DNA, but, unsurprisingly, the base pairs lend a material substance to the core of DNA that a spring does not capture.« less

  13. Stripping the Sheath From Stranded Cables

    NASA Technical Reports Server (NTRS)

    Prisk, A. L.; Rotta, J. W.

    1985-01-01

    Device similar to tubing cutter removes tough plastic cover. Insulation stripper is 3 in. (7.6 cm) long and 1.5 (3.8 cm) in diameter. Two rollers are small-diameter bearings. Cutter blade journaled for rotation between pair of similar bearings. Bearings either pin or ball types of suitable dimensions.

  14. Multifilament Cable Wire versus Conventional Wire for Sternal Closure in Patients Undergoing Major Cardiac Surgery.

    PubMed

    Oh, You Na; Ha, Keong Jun; Kim, Joon Bum; Jung, Sung-Ho; Choo, Suk Jung; Chung, Cheol Hyun; Lee, Jae Won

    2015-08-01

    Stainless steel wiring remains the most popular technique for primary sternal closure. Recently, a multifilament cable wiring system (Pioneer Surgical Technology Inc., Marquette, MI, USA) was introduced for sternal closure and has gained wide acceptance due to its superior resistance to tension. We aimed to compare conventional steel wiring to multifilament cable fixation for sternal closure in patients undergoing major cardiac surgery. Data were collected retrospectively on 1,354 patients who underwent sternal closure after major cardiac surgery, using either the multifilament cable wiring system or conventional steel wires between January 2009 and October 2010. The surgical outcomes of these two groups of patients were compared using propensity score matching based on 18 baseline patient characteristics. Propensity score matching yielded 392 pairs of patients in the two groups whose baseline profiles showed no significant differences. No significant differences between the two groups were observed in the rates of early mortality (2.0% vs. 1.3%, p=0.578), major wound complications requiring reconstruction (1.3% vs. 1.3%, p>0.99), minor wound complications (3.6% vs. 2.0%, p=0.279), or mediastinitis (0.8% vs. 1.0%, p=1.00). Patients in the multifilament cable group had fewer sternal bleeding events than those in the conventional wire group, but this tendency was not statistically significant (4.3% vs. 7.4%, p=0.068). The surgical outcomes of sternal closure using multifilament cable wires were comparable to those observed when conventional steel wires were used. Therefore, the multifilament cable wiring system may be considered a viable option for sternal closure in patients undergoing major cardiac surgery.

  15. Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.

    PubMed

    Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K

    2018-06-04

    The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.

  16. 4-Bromo-N-(di-n-propyl-carbamothioyl)-benzamide.

    PubMed

    Binzet, Gün; Flörke, Ulrich; Külcü, Nevzat; Arslan, Hakan

    2009-02-04

    The synthesis of the title compound, C(14)H(19)BrN(2)OS, involves the reaction of 4-bromo-benzoyl chloride with potassium thio-cyanate in acetone followed by condensation of the resulting 4-bromo-benzoyl isothio-cyanate with di-n-propyl-amine. Typical thio-urea carbonyl and thio-carbonyl double bonds, as well as shortened C-N bonds, are observed in the title compound. The short C-N bond lengths in the centre of the mol-ecule reveal the effects of resonance in this part of the mol-ecule. The asymmetric unit of the title compound contains two crystallographically independent mol-ecules, A and B. There is very little difference between the bond lengths and angles of these mol-ecules. In mol-ecule B, one di-n-propyl group is twisted in a -anti-periplanar conformation with C-C-C-H = -179.1 (3)° and the other adopts a -synclinal conformation with C-C-C-H = -56.7 (4)°; in mol-ecule A the two di-n-propyl groups are twisted in + and -anti-periplanar conformations, with C-C-C-H = -179.9 (3) and 178.2 (3)°, respectively. In the crystal, the mol-ecules are linked into dimeric pairs via pairs of N-H⋯S hydrogen bonds.

  17. Design and Optimization of a Hybrid-Driven Waist Rehabilitation Robot

    PubMed Central

    Zi, Bin; Yin, Guangcai; Zhang, Dan

    2016-01-01

    In this paper a waist rehabilitation robot driven by cables and pneumatic artificial muscles (PAMs) has been conceptualized and designed. In the process of mechanism design, the human body structure, the waist movement characteristics, and the actuators’ driving characteristics are the main considerable factors to make the hybrid-driven waist rehabilitation robot (HWRR) cost-effective, safe, flexible, and well-adapted. A variety of sensors are chosen to measure the position and orientation of the recovery patient to ensure patient safety at the same time as the structure design. According to the structure specialty and function, the HWRR is divided into two independent parallel robots: the waist twist device and the lower limb traction device. Then these two devices are analyzed and evaluated, respectively. Considering the characters of the human body in the HWRR, the inverse kinematics and statics are studied when the waist and the lower limb are considered as a spring and link, respectively. Based on the inverse kinematics and statics, the effect of the contraction parameter of the PAM is considered in the optimization of the waist twist device, and the lower limb traction device is optimized using particle swarm optimization (PSO) to minimize the global conditioning number over the feasible workspace. As a result of the optimization, an optimal rehabilitation robot design is obtained and the condition number of the Jacobian matrix over the feasible workspace is also calculated. PMID:27983626

  18. Design and Optimization of a Hybrid-Driven Waist Rehabilitation Robot.

    PubMed

    Zi, Bin; Yin, Guangcai; Zhang, Dan

    2016-12-14

    In this paper a waist rehabilitation robot driven by cables and pneumatic artificial muscles (PAMs) has been conceptualized and designed. In the process of mechanism design, the human body structure, the waist movement characteristics, and the actuators' driving characteristics are the main considerable factors to make the hybrid-driven waist rehabilitation robot (HWRR) cost-effective, safe, flexible, and well-adapted. A variety of sensors are chosen to measure the position and orientation of the recovery patient to ensure patient safety at the same time as the structure design. According to the structure specialty and function, the HWRR is divided into two independent parallel robots: the waist twist device and the lower limb traction device. Then these two devices are analyzed and evaluated, respectively. Considering the characters of the human body in the HWRR, the inverse kinematics and statics are studied when the waist and the lower limb are considered as a spring and link, respectively. Based on the inverse kinematics and statics, the effect of the contraction parameter of the PAM is considered in the optimization of the waist twist device, and the lower limb traction device is optimized using particle swarm optimization (PSO) to minimize the global conditioning number over the feasible workspace. As a result of the optimization, an optimal rehabilitation robot design is obtained and the condition number of the Jacobian matrix over the feasible workspace is also calculated.

  19. 47 CFR Appendix to Part 36 - Glossary

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... such terms in the separation procedures. Terms which are defined in the text of this part are not.... Complement (of cable) A group of conductors of the same general type (e.g., quadded, paired) within a single... unit which is normally dependent upon the central processor of the host office for call processing...

  20. Handbook of Oceanographic Winch, Wire, and Cable Technology.

    DTIC Science & Technology

    1982-10-18

    Strength Members (Figure 2-3), involve a center arrangement of electrical conductors Tone, coax, tristed, pair, triad, etc.) with the braided metal or...8217. .. . . . .-.. . . . . .. - . . . C. Robert Shaw, Chief Engineer Union Metal Manufacturing...2-4 1.1 COINCIDENCE............................ 2-4 *1 .2 CEN4TER STRENGTH MEMBER.................. 2-4 *1.3 BRAIDED OUTER STRENGTH MIBER

  1. Lessons learned from twenty-year operation of the Large Helical Device poloidal coils made from cable-in-conduit conductors

    NASA Astrophysics Data System (ADS)

    Takahata, Kazuya; Moriuchi, Sadatomo; Ooba, Kouki; Takami, Shigeyuki; Iwamoto, Akifumi; Mito, Toshiyuki; Imagawa, Shinsaku

    2018-04-01

    The Large Helical Device (LHD) superconducting magnet system consists of two pairs of helical coils and three pairs of poloidal coils. The poloidal coils use cable-in-conduit (CIC) conductors, which have now been adopted in many fusion devices, with forced cooling by supercritical helium. The poloidal coils were first energized with the helical coils on March 27, 1998. Since that time, the coils have experienced 54,600 h of steady cooling, 10,600 h of excitation operation, and nineteen thermal cycles for twenty years. During this period, no superconducting-to-normal transition of the conductors has been observed. The stable operation of the poloidal coils demonstrates that a CIC conductor is suited to large-scale superconducting magnets. The AC loss has remained constant, even though a slight decrease was observed in the early phase of operation. The hydraulic characteristics have been maintained without obstruction over the entire period of steady cooling. The experience gained from twenty years of operation has also provided lessons regarding malfunctions of peripheral equipment.

  2. Differential Models for B-Type Open-Closed Topological Landau-Ginzburg Theories

    NASA Astrophysics Data System (ADS)

    Babalic, Elena Mirela; Doryn, Dmitry; Lazaroiu, Calin Iuliu; Tavakol, Mehdi

    2018-05-01

    We propose a family of differential models for B-type open-closed topological Landau-Ginzburg theories defined by a pair (X,W), where X is any non-compact Calabi-Yau manifold and W is any holomorphic complex-valued function defined on X whose critical set is compact. The models are constructed at cochain level using smooth data, including the twisted Dolbeault algebra of polyvector-valued forms and a twisted Dolbeault category of holomorphic factorizations of W. We give explicit proposals for cochain level versions of the bulk and boundary traces and for the bulk-boundary and boundary-bulk maps of the Landau-Ginzburg theory. We prove that most of the axioms of an open-closed TFT (topological field theory) are satisfied on cohomology and conjecture that the remaining two axioms (namely non-degeneracy of bulk and boundary traces and the topological Cardy constraint) are also satisfied.

  3. High field superconductors for superconducting machines

    NASA Astrophysics Data System (ADS)

    Rupp, G.; Wilhelm, M.; Wohlleben, K.; Ziegler, G.; Springer, E.

    1980-11-01

    High current capacity Nb3Sn multifilament conductors were fabricated. A solid state diffusion process was used. The number of conductor filaments approaches 70,000 with filament diameters being approximately 1.5 microns. Effective current densities reach 86,000 A/sq cm at a magnetic flux density of 10 T and operating temperature of 4.2 K. Calibrated flattened cables of twisted strands were fabricated for higher currents (up to 1000 A at 10 T). Generally, quantitative relations can be given for the rise in the critical current of Nb3Sn multifilament conductors, observed under the influence of mechanical stresses. Long lengths (km) of these conductors were used to manufacture superconducting solenoids two different ways. These rise to the short sample current, usually without conditioning, and deliver magnetic flux densities up to 14 T with an 8.5 T NbTi background field.

  4. STS-43 MS Adamson checks OCTW experiment on OV-104's aft flight deck

    NASA Image and Video Library

    1991-08-11

    STS043-04-038 (2-11 Aug 1991) --- Astronaut James C. Adamson, STS-43 mission specialist, checks on an experiment on Atlantis? flight deck. Part of the experiment, Optical Communications Through the Shuttle Window (OCTW), can be seen mounted in upper right. The OCTW system consists of two modules, one inside the orbiter crew cabin (as pictured here) and one in the payload bay. The crew compartment version houses an optoelectronic transmitter/receiver pair for video and digital subsystems, test circuitry and interface circuitry. The payload bay module serves as a repeater station. During operation a signal is transmitted through the shuttle window to a bundle of optical fiber cables mounted in the payload bay near an aft window. The cables carry optical signals from the crew compartment equipment to the OCTW payload bay module. The signals are returned via optical fiber cable to the aft flight deck window, retransmitted through the window, and received by the crew compartment equipment.

  5. High temperature liquid level sensor

    DOEpatents

    Tokarz, Richard D.

    1983-01-01

    A length of metal sheathed metal oxide cable is perforated to permit liquid access to the insulation about a pair of conductors spaced close to one another. Changes in resistance across the conductors will be a function of liquid level, since the wetted insulation will have greater electrical conductivity than that of the dry insulation above the liquid elevation.

  6. Auto-Gopher: A Wireline Deep Sampler Driven by Piezoelectric Percussive Actuator and EM Rotary Motor

    NASA Technical Reports Server (NTRS)

    Badescu, Mircea; Ressa, Aaron; Jae Lee, Hyeong; Bar-Cohen, Yoseph; Sherrit, Stewart; Zacny, Kris; Paulsen, Gale L.; Beegle, Luther; Bao, Xiaoqi

    2013-01-01

    The ability to penetrate subsurfaces and perform sample acquisition at depth of meters may be critical for future NASA in-situ exploration missions to bodies in the solar system, including Mars and Europa. A corer/sampler was developed with the goal of enabling acquisition of samples from depths of several meters where if used on Mars would be beyond the oxidized and sterilized zone. For this purpose, we developed a rotary-hammering coring drill, called Auto-Gopher, which employs a piezoelectric actuated percussive mechanism for breaking formations and an electric motor that rotates the bit to remove the powdered cuttings. This sampler is a wireline mechanism that can be fed into and retrieved from the drilled hole using a winch and a cable. It includes an inchworm anchoring mechanism allowing the drill advancement and weight on bit control without twisting the reeling and power cables. The penetration rate is being optimized by simultaneously activating the percussive and rotary motions of the Auto-Gopher. The percussive mechanism is based on the Ultrasonic/Sonic Drill/Corer (USDC) mechanism that is driven by piezoelectric stack and that was demonstrated to require low axial preload. The design and fabrication of this device were presented in previous publications. This paper presents the results of laboratory and field tests and lessons learned from this development.

  7. End-to-end distance and contour length distribution functions of DNA helices

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-06-01

    I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

  8. Integrable aspects and rogue wave solution of Sasa-Satsuma equation with variable coefficients in the inhomogeneous fiber

    NASA Astrophysics Data System (ADS)

    Zhang, Yu-Ping; Yu, Lan; Wei, Guang-Mei

    2018-02-01

    Under investigation with symbolic computation in this paper, is a variable-coefficient Sasa-Satsuma equation (SSE) which can describe the ultra short pulses in optical fiber communications and propagation of deep ocean waves. By virtue of the extended Ablowitz-Kaup-Newell-Segur system, Lax pair for the model is directly constructed. Based on the obtained Lax pair, an auto-Bäcklund transformation is provided, then the explicit one-soliton solution is obtained. Meanwhile, an infinite number of conservation laws in explicit recursion forms are derived to indicate its integrability in the Liouville sense. Furthermore, exact explicit rogue wave (RW) solution is presented by use of a Darboux transformation. In addition to the double-peak structure and an analog of the Peregrine soliton, the RW can exhibit graphically an intriguing twisted rogue-wave (TRW) pair that involve four well-defined zero-amplitude points.

  9. Laser Safety Method For Duplex Open Loop Parallel Optical Link

    DOEpatents

    Baumgartner, Steven John; Hedin, Daniel Scott; Paschal, Matthew James

    2003-12-02

    A method and apparatus are provided to ensure that laser optical power does not exceed a "safe" level in an open loop parallel optical link in the event that a fiber optic ribbon cable is broken or otherwise severed. A duplex parallel optical link includes a transmitter and receiver pair and a fiber optic ribbon that includes a designated number of channels that cannot be split. The duplex transceiver includes a corresponding transmitter and receiver that are physically attached to each other and cannot be detached therefrom, so as to ensure safe, laser optical power in the event that the fiber optic ribbon cable is broken or severed. Safe optical power is ensured by redundant current and voltage safety checks.

  10. Analysis of a monolithic crystal plate acoustic wave filter.

    PubMed

    He, Huijing; Liu, Jinxi; Yang, Jiashi

    2011-12-01

    We study thickness-shear and thickness-twist vibrations of a finite, monolithic, AT-cut quartz plate crystal filter with two pairs of electrodes. The equations of anisotropic elasticity are used with the omission of the small elastic constant c(56). An analytical solution is obtained using Fourier series from which the resonant frequencies, mode shapes, and the vibration confinement due to the electrode inertia are calculated and examined. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Human Tau Isoforms Assemble into Ribbon-like Fibrils That Display Polymorphic Structure and Stability*

    PubMed Central

    Wegmann, Susanne; Jung, Yu Jin; Chinnathambi, Subashchandrabose; Mandelkow, Eva-Maria; Mandelkow, Eckhard; Muller, Daniel J.

    2010-01-01

    Fibrous aggregates of Tau protein are characteristic features of Alzheimer disease. We applied high resolution atomic force and EM microscopy to study fibrils assembled from different human Tau isoforms and domains. All fibrils reveal structural polymorphism; the “thin twisted” and “thin smooth” fibrils resemble flat ribbons (cross-section ∼10 × 15 nm) with diverse twist periodicities. “Thick fibrils” show periodicities of ∼65–70 nm and thicknesses of ∼9–18 nm such as routinely reported for “paired helical filaments” but structurally resemble heavily twisted ribbons. Therefore, thin and thick fibrils assembled from different human Tau isoforms challenge current structural models of paired helical filaments. Furthermore, all Tau fibrils reveal axial subperiodicities of ∼17–19 nm and, upon exposure to mechanical stress or hydrophobic surfaces, disassemble into uniform fragments that remain connected by thin thread-like structures (∼2 nm). This hydrophobically induced disassembly is inhibited at enhanced electrolyte concentrations, indicating that the fragments resemble structural building blocks and the fibril integrity depends largely on hydrophobic and electrostatic interactions. Because full-length Tau and repeat domain constructs assemble into fibrils of similar thickness, the “fuzzy coat” of Tau protein termini surrounding the fibril axis is nearly invisible for atomic force microscopy and EM, presumably because of its high flexibility. PMID:20566652

  12. Mechanical Description of the Mars Climate Sounder Instrument

    NASA Technical Reports Server (NTRS)

    Jau, Bruno M.

    2008-01-01

    This paper introduces the Mars Climate Sounder (MCS) Instrument of the Mars Reconnaissance Orbiter (MRO) spacecraft. The instrument scans the Martian atmosphere almost continuously to systematically acquire weather and climate observations over time. Its primary components are an optical bench that houses dual telescopes with a total of nine channels for visible and infrared sensing, and a two axis gimbal that provides pointing capabilities. Both rotating joints consist of an integrated actuator with a hybrid planetary/harmonic transmission and a twist cap section that enables the electrical wiring to pass through the rotating joint. Micro stepping is used to reduce spacecraft disturbance torques to acceptable levels while driving the stepper motors. To ensure survivability over its four year life span, suitable mechanical components, lubrication, and an active temperature control system were incorporated. Some life test results and lessons learned are provided to serve as design guidelines for actuator parts and flex cables.

  13. Gradient-Type Magnetoelectric Current Sensor with Strong Multisource Noise Suppression.

    PubMed

    Zhang, Mingji; Or, Siu Wing

    2018-02-14

    A novel gradient-type magnetoelectric (ME) current sensor operating in magnetic field gradient (MFG) detection and conversion mode is developed based on a pair of ME composites that have a back-to-back capacitor configuration under a baseline separation and a magnetic biasing in an electrically-shielded and mechanically-enclosed housing. The physics behind the current sensing process is the product effect of the current-induced MFG effect associated with vortex magnetic fields of current-carrying cables (i.e., MFG detection) and the MFG-induced ME effect in the ME composite pair (i.e., MFG conversion). The sensor output voltage is directly obtained from the gradient ME voltage of the ME composite pair and is calibrated against cable current to give the current sensitivity. The current sensing performance of the sensor is evaluated, both theoretically and experimentally, under multisource noises of electric fields, magnetic fields, vibrations, and thermals. The sensor combines the merits of small nonlinearity in the current-induced MFG effect with those of high sensitivity and high common-mode noise rejection rate in the MFG-induced ME effect to achieve a high current sensitivity of 0.65-12.55 mV/A in the frequency range of 10 Hz-170 kHz, a small input-output nonlinearity of <500 ppm, a small thermal drift of <0.2%/℃ in the current range of 0-20 A, and a high common-mode noise rejection rate of 17-28 dB from multisource noises.

  14. Gradient-Type Magnetoelectric Current Sensor with Strong Multisource Noise Suppression

    PubMed Central

    2018-01-01

    A novel gradient-type magnetoelectric (ME) current sensor operating in magnetic field gradient (MFG) detection and conversion mode is developed based on a pair of ME composites that have a back-to-back capacitor configuration under a baseline separation and a magnetic biasing in an electrically-shielded and mechanically-enclosed housing. The physics behind the current sensing process is the product effect of the current-induced MFG effect associated with vortex magnetic fields of current-carrying cables (i.e., MFG detection) and the MFG-induced ME effect in the ME composite pair (i.e., MFG conversion). The sensor output voltage is directly obtained from the gradient ME voltage of the ME composite pair and is calibrated against cable current to give the current sensitivity. The current sensing performance of the sensor is evaluated, both theoretically and experimentally, under multisource noises of electric fields, magnetic fields, vibrations, and thermals. The sensor combines the merits of small nonlinearity in the current-induced MFG effect with those of high sensitivity and high common-mode noise rejection rate in the MFG-induced ME effect to achieve a high current sensitivity of 0.65–12.55 mV/A in the frequency range of 10 Hz–170 kHz, a small input-output nonlinearity of <500 ppm, a small thermal drift of <0.2%/℃ in the current range of 0–20 A, and a high common-mode noise rejection rate of 17–28 dB from multisource noises. PMID:29443920

  15. Inclusive Prompt Photons from the Color Glass Condensate at NLO

    NASA Astrophysics Data System (ADS)

    Benić, Sanjin; Fukushima, Kenji; Garcia-Montero, Oscar; Venugopalan, Raju

    2018-05-01

    The cross-section for photons radiated by quarks in proton-nucleus collisions at collider energies was obtained using the Color Glass Condensate framework, in the dense-dilute kinematics regime. We observe that the inclusive photon cross-section is proportional to all-twist Wilson line correlators in the nucleus. These correlators also appear in quark-pair production; unlike the latter, photon production is insensitive to hadronization uncertainties and therefore more sensitive to multi-parton correlations in the gluon saturation regime of QCD.

  16. Modeling magnetic fields from a DC power cable buried beneath San Francisco Bay based on empirical measurements

    DOE PAGES

    Kavet, Robert; Wyman, Megan T.; Klimley, A. Peter; ...

    2016-02-25

    Here, the Trans Bay Cable (TBC) is a ±200-kilovolt (kV), 400 MW 85-km long High Voltage Direct Current (DC) buried transmission line linking Pittsburg, CA with San Francisco, CA (SF) beneath the San Francisco Estuary. The TBC runs parallel to the migratory route of various marine species, including green sturgeon, Chinook salmon, and steelhead trout. In July and August 2014, an extensive series of magnetic field measurements were taken using a pair of submerged Geometrics magnetometers towed behind a survey vessel in four locations in the San Francisco estuary along profiles that cross the cable’s path; these included the Sanmore » Francisco-Oakland Bay Bridge (BB), the Richmond-San Rafael Bridge (RSR), the Benicia- Martinez Bridge (Ben) and an area in San Pablo Bay (SP) in which a bridge is not present. In this paper, we apply basic formulas that ideally describe the magnetic field from a DC cable summed vectorially with the background geomagnetic field (in the absence of other sources that would perturb the ambient field) to derive characteristics of the cable that are otherwise not immediately observable. Magnetic field profiles from measurements taken along 170 survey lines were inspected visually for evidence of a distinct pattern representing the presence of the cable. Many profiles were dominated by field distortions unrelated to the cable caused by bridge structures or other submerged objects, and the cable’s contribution to the field was not detectable. BB, with 40 of the survey lines, did not yield usable data for these reasons. The unrelated anomalies could be up to 100 times greater than those from the cable. In total, discernible magnetic field profiles measured from 76 survey lines were regressed against the equations, representing eight days of measurement. The modeled field anomalies due to the cable (the difference between the maximum and minimum field along the survey line at the cable crossing) were virtually identical to the measured values. The modeling yielded a pooled cable depth below the bay floor of 2.06 m (±1.46 std dev), and estimated the angle to the horizontal of the imaginary line connecting the crosssectional center of the cable’s two conductors (0.1143 m apart) as 178.9° ±61.9° (std dev) for Ben, 78.6°±37.0° (std dev) for RSR, and 139.9°±27.4° (std dev) for SP. The mean of the eight daily average currents derived from the regressions was 986 ±185 amperes (A) (std dev), as compared to 722 ±95 A (std dev) provided by Trans Bay Cable LLC. Overall, the regressions based on fundamental principles (Biot Savart law) and the vectorial summation of cable and geomagnetic fields provide estimates of cable characteristics consistent with plausible expectations.« less

  17. Modeling magnetic fields from a DC power cable buried beneath San Francisco Bay based on empirical measurements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kavet, Robert; Wyman, Megan T.; Klimley, A. Peter

    Here, the Trans Bay Cable (TBC) is a ±200-kilovolt (kV), 400 MW 85-km long High Voltage Direct Current (DC) buried transmission line linking Pittsburg, CA with San Francisco, CA (SF) beneath the San Francisco Estuary. The TBC runs parallel to the migratory route of various marine species, including green sturgeon, Chinook salmon, and steelhead trout. In July and August 2014, an extensive series of magnetic field measurements were taken using a pair of submerged Geometrics magnetometers towed behind a survey vessel in four locations in the San Francisco estuary along profiles that cross the cable’s path; these included the Sanmore » Francisco-Oakland Bay Bridge (BB), the Richmond-San Rafael Bridge (RSR), the Benicia- Martinez Bridge (Ben) and an area in San Pablo Bay (SP) in which a bridge is not present. In this paper, we apply basic formulas that ideally describe the magnetic field from a DC cable summed vectorially with the background geomagnetic field (in the absence of other sources that would perturb the ambient field) to derive characteristics of the cable that are otherwise not immediately observable. Magnetic field profiles from measurements taken along 170 survey lines were inspected visually for evidence of a distinct pattern representing the presence of the cable. Many profiles were dominated by field distortions unrelated to the cable caused by bridge structures or other submerged objects, and the cable’s contribution to the field was not detectable. BB, with 40 of the survey lines, did not yield usable data for these reasons. The unrelated anomalies could be up to 100 times greater than those from the cable. In total, discernible magnetic field profiles measured from 76 survey lines were regressed against the equations, representing eight days of measurement. The modeled field anomalies due to the cable (the difference between the maximum and minimum field along the survey line at the cable crossing) were virtually identical to the measured values. The modeling yielded a pooled cable depth below the bay floor of 2.06 m (±1.46 std dev), and estimated the angle to the horizontal of the imaginary line connecting the crosssectional center of the cable’s two conductors (0.1143 m apart) as 178.9° ±61.9° (std dev) for Ben, 78.6°±37.0° (std dev) for RSR, and 139.9°±27.4° (std dev) for SP. The mean of the eight daily average currents derived from the regressions was 986 ±185 amperes (A) (std dev), as compared to 722 ±95 A (std dev) provided by Trans Bay Cable LLC. Overall, the regressions based on fundamental principles (Biot Savart law) and the vectorial summation of cable and geomagnetic fields provide estimates of cable characteristics consistent with plausible expectations.« less

  18. Photoinduced Charge Shifts and Electron Transfer in Viologen-Tetraphenylborate Complexes: Push-Pull Character of the Exciplex.

    PubMed

    Santos, Willy G; Budkina, Darya S; Deflon, Victor M; Tarnovsky, Alexander N; Cardoso, Daniel R; Forbes, Malcolm D E

    2017-06-14

    Viologen-tetraarylborate ion-pair complexes were prepared and investigated by steady-state and time-resolved spectroscopic techniques such as fluorescence and femtosecond transient absorption. The results highlight a charge transfer transition that leads to changes in the viologen structure in the excited singlet state. Femtosecond transient absorption reveals the formation of excited-state absorption and stimulated emission bands assigned to the planar (k obs < 10 12 s -1 ) and twisted (k obs ∼ 10 10 s -1 ) structures between two pyridinium groups in the viologen ion. An efficient photoinduced electron transfer from the tetraphenylborate anionic moiety to the viologen dication was observed less than 1 μs after excitation. This is a consequence of the push-pull character of the electron donor twisted viologen structure, which helps formation of the borate triplet state. The borate triplet state is deactivated further via a second electron transfer process, generating viologen cation radical (V •+ ).

  19. Spin Physics Experiments at NICA-SPD

    NASA Astrophysics Data System (ADS)

    Kouznetsov, O.; Savin, I.

    2017-01-01

    Nuclotron based Ion Collider fAcility (NICA) is a flagship project of the Joint Institute for Nuclear Research which is expected to be operational by 2021. Main tasks of ;NICA Facility; are study of hot and dense baryonic matter, investigation the polarisation phenomena and the nucleon spin structure. The material presented here based on the Letter of Intent (LoI) dedicated to nucleon spin structure studies at NICA. Measurements of asymmetries in the lepton pair (Drell-Yan) production in collisions of non-polarised, longitudinally and transversely polarised proton and deuteron beams to be performed using the specialized Spin Physics Detector (SPD). These measurements can provide an access to all leading twist collinear and Transverse Momentum Dependent Parton Distribution Functions (TMD PDFs) in nucleons. The measurements of asymmetries in production of J/ψ and direct photons, which supply complimentary information on the nucleon structure, will be performed simultaneously. The set of these measurements permits to tests the quark-parton model of nucleons at the QCD twist-2 level with minimal systematic errors.

  20. High-Power Actuation from Molecular Photoswitches in Enantiomerically Paired Soft Springs.

    PubMed

    Aßhoff, Sarah J; Lancia, Federico; Iamsaard, Supitchaya; Matt, Benjamin; Kudernac, Tibor; Fletcher, Stephen P; Katsonis, Nathalie

    2017-03-13

    Motion in plants often relies on dynamic helical systems as seen in coiling tendrils, spasmoneme springs, and the opening of chiral seedpods. Developing nanotechnology that would allow molecular-level phenomena to drive such movements in artificial systems remains a scientific challenge. Herein, we describe a soft device that uses nanoscale information to mimic seedpod opening. The system exploits a fundamental mechanism of stimuli-responsive deformation in plants, namely that inflexible elements with specific orientations are integrated into a stimuli-responsive matrix. The device is operated by isomerization of a light-responsive molecular switch that drives the twisting of strips of liquid-crystal elastomers. The strips twist in opposite directions and work against each other until the pod pops open from stress. This mechanism allows the photoisomerization of molecular switches to stimulate rapid shape changes at the macroscale and thus to maximize actuation power. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  1. Prisoner's Dilemma Applied and in the Classroom: The TV Game Show "Friend or Foe"

    ERIC Educational Resources Information Center

    Coe, Paul R.; Alonzi, Loreto Peter; Condon, Daniel; Butterworth, William T.

    2007-01-01

    Prisoner's Dilemma is a common game theory scenario in which two players must choose between acting cooperatively or out of pure self-interest. What a player decides affects not only his own outcome but also that of the other player. "Friend or Foe," a TV game show that has appeared on the cable Game Show Network (GSN), places pairs of contestants…

  2. A fully relativistic twisted disc around a slowly rotating Kerr black hole: derivation of dynamical equations and the shape of stationary configurations

    NASA Astrophysics Data System (ADS)

    Zhuravlev, V. V.; Ivanov, P. B.

    2011-08-01

    In this paper we derive equations describing the dynamics and stationary configurations of a twisted fully relativistic thin accretion disc around a slowly rotating black hole. We assume that the inclination angle of the disc is small and that the standard relativistic generalization of the α model of accretion discs is valid when the disc is flat. We find that similar to the case of non-relativistic twisted discs the disc dynamics and stationary shapes can be determined by a pair of equations formulated for two complex variables describing the orientation of the disc rings and velocity perturbations induced by the twist. We analyse analytically and numerically the shapes of stationary twisted configurations of accretion discs having non-zero inclinations with respect to the black hole equatorial plane at large distances r from the black hole. It is shown that the stationary configurations depend on two parameters - the viscosity parameter α and the parameter ?, where δ* is the opening angle (δ*˜h/r, where h is the disc half-thickness and r is large) of a flat disc and a is the black hole rotational parameter. When a > 0 and ? the shapes depend drastically on the value of α. When α is small the disc inclination angle oscillates with radius with amplitude and radial frequency of the oscillations dramatically increasing towards the last stable orbit, Rms. When α has a moderately small value the oscillations do not take place but the disc does not align with the equatorial plane at small radii. The disc inclination angle either is increasing towards Rms or exhibits a non-monotonic dependence on the radial coordinate. Finally, when α is sufficiently large the disc aligns with the equatorial plane at small radii. When a < 0 the disc aligns with the equatorial plane for all values of α. The results reported here may have implications for determining the structure and variability of accretion discs close to Rms as well as for modelling of emission spectra coming from different sources, which are supposed to contain black holes.

  3. Local area network with fault-checking, priorities, and redundant backup

    NASA Technical Reports Server (NTRS)

    Morales, Sergio (Inventor); Friedman, Gary L. (Inventor)

    1989-01-01

    This invention is a redundant error detecting and correcting local area networked computer system having a plurality of nodes each including a network connector board within the node for connecting to an interfacing transceiver operably attached to a network cable. There is a first network cable disposed along a path to interconnect the nodes. The first network cable includes a plurality of first interfacing transceivers attached thereto. A second network cable is disposed in parallel with the first cable and, in like manner, includes a plurality of second interfacing transceivers attached thereto. There are a plurality of three position switches each having a signal input, three outputs for individual selective connection to the input, and a control input for receiving signals designating which of the outputs is to be connected to the signal input. Each of the switches includes means for designating a response address for responding to addressed signals appearing at the control input and each of the switches further has its signal input connected to a respective one of the input/output lines from the nodes. Also, one of the three outputs is connected to a repective one of the plurality of first interfacing transceivers. There is master switch control means having an output connected to the control inputs of the plurality of three position switches and an input for receiving directive signals for outputting addressed switch position signals to the three position switches as well as monitor and control computer means having a pair of network connector boards therein connected to respective ones of one of the first interfacing transceivers and one of the second interfacing transceivers and an output connected to the input of the master switch means for monitoring the status of the networked computer system by sending messages to the nodes and receiving and verifying messages therefrom and for sending control signals to the master switch to cause the master switch to cause respective ones of the nodes to use a desired one of the first and second cables for transmitting and receiving messages and for disconnecting desired ones of the nodes from both cables.

  4. Microinterferometer transducer

    DOEpatents

    Corey, III, Harry S.

    1979-01-01

    An air-bearing microinterferometer transducer is provided for increased accuracy, range and linearity over conventional displacement transducers. A microinterferometer system is housed within a small compartment of an air-bearing displacement transducer housing. A movable cube corner reflector of the interferometer is mounted to move with the displacement gauging probe of the transducer. The probe is disposed for axial displacement by means of an air-bearing. Light from a single frequency laser is directed into an interferometer system within the transducer housing by means of a self-focusing fiber optic cable to maintain light coherency. Separate fringe patterns are monitored by a pair of fiber optic cables which transmit the patterns to a detecting system. The detecting system includes a bidirectional counter which counts the light pattern fringes according to the direction of movement of the probe during a displacement gauging operation.

  5. High-Density Terminal Box for Testing Wire Harness

    NASA Technical Reports Server (NTRS)

    Pierce, W. B.; Collins, W. G.

    1982-01-01

    Compact terminal box provides access to complex wiring harnesses for testing. Box accommodates more than twice as many wires as previous boxes. Box takes in wires via cable connectors and distributes them to contacts on box face. Instead of separate insulated jacks in metal face panel, box uses pairs of small military-standard metal sockets in precision-drilled plastic panel. Shorting plug provides continuity for wires when not being tested.

  6. 12. DETAIL VIEW OF BRIDGE, SHOWING SPRING LINE OF SPANS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. DETAIL VIEW OF BRIDGE, SHOWING SPRING LINE OF SPANS FROM CROWN OF MID-CHANNEL PIER, PAIRED COLUMNS SUPPORTING DECK, ARCHED WINDOW RAILING, LOOKING WEST-NORTHWEST FROM EUREKA SOUTHERN RAILROAD BRIDGE. CABLES VISIBLE IN BACKGROUND ARE EARTHQUAKE RESTRAINERS RETROFITTED TO 1952 HIGHWAY BRIDGE, WHICH FUNCTIONED AS DESIGNED IN APRIL 1992 TEMBLOR - Van Duzen River Bridge, Spanning Van Duzen River at CA State Highway 101, Alton, Humboldt County, CA

  7. Crystal structure of methyl 3'-benzamido-4'-(4-meth-oxy-phen-yl)-1'-methyl-spiro-[indeno-[1,2-b]quinoxaline-11,2'-pyrrolidine]-3'-carboxyl-ate.

    PubMed

    Chandralekha, Kuppan; Sureshbabu, Adukamparai Rajukrishnan; Gavaskar, Deivasigamani; Lakshmi, Srinivasakannan

    2016-09-01

    In the title compound, C 35 H 30 N 4 O 3 , the spiro C atom connects the five-membered pyrrolidine ring and the indeno-quinoxaline ring system. The pyrrolidine ring adopts a twist conformation. An intra-molecular N-H⋯N inter-action between the amino group and the pyrazine ring is observed. In the crystal, mol-ecules are linked by a pairs of C-H⋯O hydrogen bonds, forming inversion dimers.

  8. Network Implementation Trade-Offs in Existing Homes

    NASA Astrophysics Data System (ADS)

    Keiser, Gerd

    2013-03-01

    The ever-increasing demand for networking of high-bandwidth services in existing homes has resulted in several options for implementing an in-home network. Among the options are power-line communication techniques, twisted-pair copper wires, wireless links, and plastic or glass optical fibers. Whereas it is easy to install high-bandwidth optical fibers during the construction of new living units, retrofitting of existing homes with networking capabilities requires some technology innovations. This article addresses some trade-offs that need to be made on what transmission media can be retrofitted most effectively in existing homes.

  9. Shaft transducer having dc output proportional to angular velocity

    NASA Technical Reports Server (NTRS)

    Handlykken, M. B. (Inventor)

    1984-01-01

    A brushless dc tachometer is disclosed that includes a high strength toroidal permanent magnet for providing a uniform magnetic field in an air gap, an annular pole piece opposite the magnet, and a pickup coil wound around the pole piece and adapted to rotate about the axis of the pole piece. The pickup coil is rotated by an input shaft to which the coil is coupled with the friction clip. The output of the coil is conducted to circuitry by a twisted wire pair. The input shaft also activates a position transducing potentiometer.

  10. Functional asymmetry of posture and body system regulation

    NASA Technical Reports Server (NTRS)

    Boloban, V. N.; Otsupok, A. P.

    1980-01-01

    The manifestation of functional asymmetry during the regulation of an athlete's posture and a system of bodies and its effect on the execution of individual and group acrobatic exercises were studied. Functional asymmetry of posture regulation was recorded in acrobats during the execution of individual and group exercises. It was shown that stability is maintained at the expense of bending and twisting motions. It is important to consider whether the functional asymmetry of posture regulation is left or right sided in making up pairs and groups of acrobats.

  11. Evaluation of surface characteristics of rotary nickel-titanium instruments produced by different manufacturing methods.

    PubMed

    Inan, U; Gurel, M

    2017-02-01

    Instrument fracture is a serious concern in endodontic practice. The aim of this study was to investigate the surface quality of new and used rotary nickel-titanium (NiTi) instruments manufactured by the traditional grinding process and twisting methods. Total 16 instruments of two rotary NiTi systems were used in this study. Eight Twisted Files (TF) (SybronEndo, Orange, CA, USA) and 8 Mtwo (VDW, Munich, Germany) instruments were evaluated. New and used of 4 experimental groups were evaluated using an atomic force microscopy (AFM). New and used instruments were analyzed on 3 points along a 3 mm. section at the tip of the instrument. Quantitative measurements according to the topographical deviations were recorded. The data were statistically analyzed with paired samples t-test and independent samples t-test. Mean root mean square (RMS) values for new and used TF 25.06 files were 10.70 ± 2.80 nm and 21.58 ± 6.42 nm, respectively, and the difference between them was statistically significant (P < 0.05). Mean RMS values for new and used Mtwo 25.06 files were 24.16 ± 9.30 nm and 39.15 ± 16.20 nm respectively, the difference between them also was statistically significant (P < 0.05). According to the AFM analysis, instruments produced by twisting method (TF 25.06) had better surface quality than the instruments produced by traditional grinding process (Mtwo 25.06 files).

  12. Structure and Mobility of Dissociated Vacancies at Twist Grain Boundaries and Screw Dislocations in Ionic Rocksalt Compounds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kolluri, Kedarnath; Martinez Saez, Enrique; Uberuaga, Blas Pedro

    Interfaces, grain boundaries, and dislocations are known to have significant impact on the transport properties of materials. Even so, it is still not clear how the structure of interfaces influences the mobility and concentration of carriers that are responsible for transport. Using low angle twist grain boundaries in MgO as a model system, we examine the structural and kinetic properties of vacancies. These boundaries are characterized by a network of screw dislocations. Vacancies of both types, Mg and O, are strongly attracted to the dislocation network, residing preferentially at the misfit dislocation intersections (MDIs). However, the vacancies can lower theirmore » energy by splitting into two parts, which then repel each other along the dislocation line between two MDIs, further lowering their energy. This dissociated structure has important consequences for transport, as the free energy of the dissociated vacancies decreases with decreasing twist angle, leading to an increase in the net migration barrier for diffusion as revealed by molecular dynamics simulations. Similar behavior is observed in BaO and NaCl, highlighting the generality of the behavior. Finally, we analyze the structure of the dissociated vacancies as a pair of jogs on the dislocation and construct a model containing electrostatic and elastic contributions that qualitatively describe the energetics of the dissociated vacancy. Our results represent the first validation of a mechanism for vacancy dissociation on screw dislocations in ionic materials first discussed by Thomson and Balluffi in 1962.« less

  13. Structure and Mobility of Dissociated Vacancies at Twist Grain Boundaries and Screw Dislocations in Ionic Rocksalt Compounds

    DOE PAGES

    Kolluri, Kedarnath; Martinez Saez, Enrique; Uberuaga, Blas Pedro

    2018-03-05

    Interfaces, grain boundaries, and dislocations are known to have significant impact on the transport properties of materials. Even so, it is still not clear how the structure of interfaces influences the mobility and concentration of carriers that are responsible for transport. Using low angle twist grain boundaries in MgO as a model system, we examine the structural and kinetic properties of vacancies. These boundaries are characterized by a network of screw dislocations. Vacancies of both types, Mg and O, are strongly attracted to the dislocation network, residing preferentially at the misfit dislocation intersections (MDIs). However, the vacancies can lower theirmore » energy by splitting into two parts, which then repel each other along the dislocation line between two MDIs, further lowering their energy. This dissociated structure has important consequences for transport, as the free energy of the dissociated vacancies decreases with decreasing twist angle, leading to an increase in the net migration barrier for diffusion as revealed by molecular dynamics simulations. Similar behavior is observed in BaO and NaCl, highlighting the generality of the behavior. Finally, we analyze the structure of the dissociated vacancies as a pair of jogs on the dislocation and construct a model containing electrostatic and elastic contributions that qualitatively describe the energetics of the dissociated vacancy. Our results represent the first validation of a mechanism for vacancy dissociation on screw dislocations in ionic materials first discussed by Thomson and Balluffi in 1962.« less

  14. X-ray-structure of a cytidylyl-3',5'-adenosine-proflavine complex: a self-paired parallel-chain double helical dimer with an intercalated acridine dye.

    PubMed Central

    Westhof, E; Sundaralingam, M

    1980-01-01

    The non-self-complementary dinucleoside monophosphate cytidylyl-3',5'-adenosine (CpA) forms a base-paired parallel-chain dimer with an intercalated proflavine. The dimer complex possesses a right-handed helical twist. The dimer helix has an irregular girth with a neutral adenine-adenine (A-A) pair, hydrogen-bonded through the N6 and N7 sites (C1'...C1' separation of 10.97 A), and a triply hydrogen-bonded protonated cytosine-cytosine (C-C) pair with a proton shared between the base N3 sites (Cl'...Cl' separation of 9.59 A). The torsion angles of the sugar-phosphate backbone are within their most preferred ranges and the sugar puckering sequence (5' leads to 3') is C3'-endo, C2'-endo. There is also a second proflavine molecule sandwiched between CpA dimers on the 21-axis. Both proflavines are necessarily disordered, being on dyad axis, and this suggests possible insights into the dynamics of intercalation of planar drugs. This structure shows that intercalation of planar drugs in nucleic acids may not be restricted to antiparallel complementary Watson-Crick pairing regions and provides additional mechanisms for acridine mutagenesis. PMID:6929524

  15. Sequence-dependent effects in drug-DNA interaction: the crystal structure of Hoechst 33258 bound to the d(CGCAAATTTGCG)2 duplex.

    PubMed Central

    Spink, N; Brown, D G; Skelly, J V; Neidle, S

    1994-01-01

    The bis-benzimidazole drug Hoechst 33258 has been co-crystallized with the dodecanucleotide sequence d(CGCAAATTTGCG)2. The structure has been solved by molecular replacement and refined to an R factor of 18.5% for 2125 reflections collected on a Xentronics area detector. The drug is bound in the minor groove, at the five base-pair site 5'-ATTTG and is in a unique orientation. This is displaced by one base pair in the 5' direction compared to previously-determined structures of this drug with the sequence d(CGCGAATTCGCG)2. Reasons for this difference in behaviour are discussed in terms of several sequence-dependent structural features of the DNA, with particular reference to differences in propeller twist and minor-groove width. Images PMID:7515488

  16. α-Synuclein Amyloid Fibrils with Two Entwined, Asymmetrically Associated Protofibrils*

    PubMed Central

    Dearborn, Altaira D.; Wall, Joseph S.; Cheng, Naiqian; Heymann, J. Bernard; Kajava, Andrey V.; Varkey, Jobin; Langen, Ralf; Steven, Alasdair C.

    2016-01-01

    Parkinson disease and other progressive neurodegenerative conditions are characterized by the intracerebral presence of Lewy bodies, containing amyloid fibrils of α-synuclein. We used cryo-electron microscopy and scanning transmission electron microscopy (STEM) to study in vitro-assembled fibrils. These fibrils are highly polymorphic. Focusing on twisting fibrils with an inter-crossover spacing of 77 nm, our reconstructions showed them to consist of paired protofibrils. STEM mass per length data gave one subunit per 0.47 nm axial rise per protofibril, consistent with a superpleated β-structure. The STEM images show two thread-like densities running along each of these fibrils, which we interpret as ladders of metal ions. These threads confirmed the two-protofibril architecture of the 77-nm twisting fibrils and allowed us to identify this morphotype in STEM micrographs. Some other, but not all, fibril morphotypes also exhibit dense threads, implying that they also present a putative metal binding site. We propose a molecular model for the protofibril and suggest that polymorphic variant fibrils have different numbers of protofibrils that are associated differently. PMID:26644467

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Benic, Sanjin; Fukushima, Kenji; Garcia-Montero, Oscar

    Here, we compute the cross section for photons emitted from sea quarks in proton-nucleus collisions at collider energies. The computation is performed within the dilute-dense kinematics of the Color Glass Condensate (CGC) effective field theory. Albeit the result obtained is formally at next-to-leading order in the CGC power counting, it provides the dominant contribution for central rapidities. We observe that the inclusive photon cross section is proportional to all-twist Wilson line correlators in the nucleus. These correlators also appear in quark-pair production; unlike the latter, photon production is insensitive to hadronization uncertainties and therefore more sensitive to multi-parton correlations inmore » the gluon saturation regime of QCD. We demonstrate that k ⊥ and collinear factorized expressions for inclusive photon production are obtained as leading twist approximations to our result. In particular, the collinearly factorized expression is directly sensitive to the nuclear gluon distribution at small x. Other results of interest include the realization of the Low-Burnett-Kroll soft photon theorem in the CGC framework and a comparative study of how the photon amplitude is obtained in Lorenz and light-cone gauges.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dearborn, Altaira D.; Wall, Joseph S.; Cheng, Naiqian

    Parkinson disease and other progressive neurodegenerative conditions are characterized by the intracerebral presence of Lewy bodies, containing amyloid fibrils of α-synuclein. We used cryo-electron microscopy and scanning transmission electron microscopy (STEM) to study in vitro-assembled fibrils. These fibrils are highly polymorphic. Focusing on twisting fibrils with an inter-crossover spacing of 77 nm, our reconstructions showed them to consist of paired protofibrils. STEM mass per length data gave one subunit per 0.47 nm axial rise per protofibril, consistent with a superpleated β-structure. The STEM images show two thread-like densities running along each of these fibrils, which we interpret as ladders ofmore » metal ions. These threads confirmed the two-protofibril architecture of the 77-nm twisting fibrils and allowed us to identify this morphotype in STEM micrographs. Some other, but not all, fibril morphotypes also exhibit dense threads, implying that they also present a putative metal binding site. As a result, we propose a molecular model for the protofibril and suggest that polymorphic variant fibrils have different numbers of protofibrils that are associated differently.« less

  19. Numerical and Experimental Investigation of the Electromechanical Behavior of REBCO Tapes

    NASA Astrophysics Data System (ADS)

    Allen, N. C.; Chiesa, L.; Takayasu, M.

    2015-12-01

    To fully characterize the electromechanical behavior of a Twisted Stacked-Tape Cable (TSTC) it is important to understand the performance of the individual REBCO tapes under various loading conditions. Numerical modeling and experimentation have been used to investigate the electromechanical characteristics of two commercially available REBCO tapes (SuperPower and SuNAM). Tension and combined tension-torsion experiments on single tapes have been continued, from prior preliminary studies, to characterize their critical current behavior and mechanical strength. Additionally, structural finite element analysis was performed on single tapes under tension and combined tension-torsion to investigate the strain dependence of the critical current. The numerical results were compared to the experimental findings for validation. The SuNAM experimental data matched the numerical model very well while the SuperPower tape experienced degradation at lower stress and strain than predicted in the model. The Superpower tape also displayed greater variability in critical current between different samples as compared with the SuNAM tape.

  20. Space experiment using large-sized fish: in case of carp in Spacelab-J mission.

    PubMed

    Mori, S; Mitarai, G; Takagi, S; Takabayashi, A; Usui, S; Nakamura, T; Sakakibara, M; Nagatomo, M; von Baumgarten, R J

    1994-07-01

    Two carp of 26 cm in size, intact and otolith-removed (LB), were flown on the Spacelab-J for 8 days in September 12-20, 1992. Light-dependent reaction to alternating direction of illumination was recorded for 10 min twice a day together with the cerebellar EEG activity, on 2 days before the launch, during the flight and for 4 days after the landing, in same fish chamber. Reproducing the video image, it was revealed that both carp were healthy during the mission, but the LB fish was almost immobilized from the 3rd test session (48 hours in flight) by tight twisting of the EEG cable. Both fish after landing tended to stay still on the bottom of the fish chamber. Findings that the body weight reduced remarkably in both fish and that nitrite and nitrate levels of the fish water were usually high, suggested that the fish metabolism might have been enhanced during the flight.

  1. Development of a collapsible reinforced cylindrical space observation window

    NASA Technical Reports Server (NTRS)

    Khan, A. Q.

    1971-01-01

    Existing material technology was applied to the development of a collapsible transparent window suitable for manned spacecraft structures. The effort reported encompasses the evaluation of flame retardants intended for use in the window matrix polymer, evaluation of reinforcement angle which would allow for a twisting pantographing motion as the cylindrical window is mechanically collapsed upon itself, and evaluation of several reinforcement embedment methods. A fabrication technique was developed to produce a reinforced cylindrical space window of 45.7 cm diameter and 61.0 cm length. The basic technique involved the application of a clear film on a male-section mold; winding axial and girth reinforcements and vacuum casting the outer layer. The high-strength transparent window composite consisted of a polyether urethane matrix reinforced with an orthogonal pattern of black-coated carbon steel wire cable. A thin film of RTV silicone rubber was applied to both surfaces of the urethane. The flexibility, retraction system, and installation system are described.

  2. The Twist Box Domain is Required for Twist1-induced Prostate Cancer Metastasis

    PubMed Central

    Gajula, Rajendra P.; Chettiar, Sivarajan T.; Williams, Russell D.; Thiyagarajan, Saravanan; Kato, Yoshinori; Aziz, Khaled; Wang, Ruoqi; Gandhi, Nishant; Wild, Aaron T.; Vesuna, Farhad; Ma, Jinfang; Salih, Tarek; Cades, Jessica; Fertig, Elana; Biswal, Shyam; Burns, Timothy F.; Chung, Christine H.; Rudin, Charles M.; Herman, Joseph M.; Hales, Russell K.; Raman, Venu; An, Steven S.; Tran, Phuoc T.

    2013-01-01

    Twist1, a basic helix-loop-helix transcription factor, plays a key role during development and is a master regulator of the epithelial-mesenchymal transition (EMT) that promotes cancer metastasis. Structure-function relationships of Twist1 to cancer-related phenotypes are underappreciated, so we studied the requirement of the conserved Twist box domain for metastatic phenotypes in prostate cancer (PCa). Evidence suggests that Twist1 is overexpressed in clinical specimens and correlated with aggressive/metastatic disease. Therefore, we examined a transactivation mutant, Twist1-F191G, in PCa cells using in vitro assays which mimic various stages of metastasis. Twist1 overexpression led to elevated cytoskeletal stiffness and cell traction forces at the migratory edge of cells based on biophysical single-cell measurements. Twist1 conferred additional cellular properties associated with cancer cell metastasis including increased migration, invasion, anoikis resistance, and anchorage-independent growth. The Twist box mutant was defective for these Twist1 phenotypes in vitro. Importantly, we observed a high frequency of Twist1-induced metastatic lung tumors and extra-thoracic metastases in vivo using the experimental lung metastasis assay. The Twist box was required for PCa cells to colonize metastatic lung lesions and extra-thoracic metastases. Comparative genomic profiling revealed transcriptional programs directed by the Twist box that were associated with cancer progression, such as Hoxa9. Mechanistically, Twist1 bound to the Hoxa9 promoter and positively regulated Hoxa9 expression in PCa cells. Finally, Hoxa9 was important for Twist1-induced cellular phenotypes associated with metastasis. These data suggest that the Twist box domain is required for Twist1 transcriptional programs and PCa metastasis. PMID:23982216

  3. Russian EVA 34

    NASA Image and Video Library

    2013-08-16

    ISS036-E-033400 (16 Aug. 2013) --- Russian cosmonaut Alexander Misurkin (lower left), Expedition 36 flight engineer, attired in a Russian Orlan spacesuit, participates in a session of extravehicular activity (EVA) to continue outfitting the International Space Station. During the seven-hour, 29-minute spacewalk ? the longest ever conducted by a pair of Russian cosmonauts ? Misurkin and Fyodor Yurchikhin (out of frame) rigged cables for the future arrival of a Russian laboratory module and installed an experiment panel.

  4. Russian EVA 34

    NASA Image and Video Library

    2013-08-16

    ISS036-E-033402 (16 Aug. 2013) --- Russian cosmonaut Alexander Misurkin (lower left), Expedition 36 flight engineer, attired in a Russian Orlan spacesuit, participates in a session of extravehicular activity (EVA) to continue outfitting the International Space Station. During the seven-hour, 29-minute spacewalk ? the longest ever conducted by a pair of Russian cosmonauts ? Misurkin and Fyodor Yurchikhin (out of frame) rigged cables for the future arrival of a Russian laboratory module and installed an experiment panel.

  5. DDN (Defense Data Network) Protocol Implementations and Vendors Guide

    DTIC Science & Technology

    1987-08-01

    length. Lower rates can be selected or determined by attached modem types 303, 209, V.35, or 188-114. Units are in pairs, one at each end of the...ECUs communicate with the IMP via direct cable or modems . DOCUMENTATION: Fully documented vendor product; descriptive literature available...terminals, PCs and modems to an Ethernet. The device can support up to 80 lines and 2 parallel printers. Full domain naming is supported as well as

  6. The Morphogenesis of Cranial Sutures in Zebrafish

    PubMed Central

    Topczewska, Jolanta M.; Shoela, Ramy A.; Tomaszewski, Joanna P.; Mirmira, Rupa B.; Gosain, Arun K.

    2016-01-01

    Using morphological, histological, and TEM analyses of the cranium, we provide a detailed description of bone and suture growth in zebrafish. Based on expression patterns and localization, we identified osteoblasts at different degrees of maturation. Our data confirm that, unlike in humans, zebrafish cranial sutures maintain lifelong patency to sustain skull growth. The cranial vault develops in a coordinated manner resulting in a structure that protects the brain. The zebrafish cranial roof parallels that of higher vertebrates and contains five major bones: one pair of frontal bones, one pair of parietal bones, and the supraoccipital bone. Parietal and frontal bones are formed by intramembranous ossification within a layer of mesenchyme positioned between the dermal mesenchyme and meninges surrounding the brain. The supraoccipital bone has an endochondral origin. Cranial bones are separated by connective tissue with a distinctive architecture of osteogenic cells and collagen fibrils. Here we show RNA in situ hybridization for col1a1a, col2a1a, col10a1, bglap/osteocalcin, fgfr1a, fgfr1b, fgfr2, fgfr3, foxq1, twist2, twist3, runx2a, runx2b, sp7/osterix, and spp1/ osteopontin, indicating that the expression of genes involved in suture development in mammals is preserved in zebrafish. We also present methods for examining the cranium and its sutures, which permit the study of the mechanisms involved in suture patency as well as their pathological obliteration. The model we develop has implications for the study of human disorders, including craniosynostosis, which affects 1 in 2,500 live births. PMID:27829009

  7. Three-Dimensional MHD Simulation of FTEs Produced by Merging at an Isolated Point in a Sheared Magnetic Field Configuration

    NASA Technical Reports Server (NTRS)

    Santos, J. C.; Sibeck, D. G.; Buchner, J.; Gonzalez, W. D.; Ferreira, J. L.

    2014-01-01

    We present predictions for the evolution of FTEs generated by localized bursts of reconnection on a planar magnetopause that separates a magnetosheath region of high densities and weak magnetic field from a magnetospheric region of low densities and strong magnetic field. The magnetic fields present a shear angle of 105 degrees. Reconnection forms a pair of FTEs each crossing the magnetopause in the field reversal region and bulging into the magnetosphere and magnetosheath. At their initial stage they can be characterized as flux tubes since the newly reconnected magnetic field lines are not twisted. Reconnection launches Alfvenic perturbations that propagate along the FTEs generating high-speed jets, which move the pair of FTEs in opposite directions. As the FTE moves, it displaces the ambient magnetic field and plasma producing bipolar magnetic field and plasma velocity signatures normal to the nominal magnetopause in the regions surrounding the FTE. The combination of the ambient plasma with the FTE flows generates a vortical velocity pattern around the reconnected field lines. During its evolution the FTE evolves to a flux rope configuration due to the twist of the magnetic field lines. The alfvenic perturbations propagate faster along the part of the FTE bulging into the magnetosphere than in the magnetosheath, and due to the differences between the plasma and magnetic field properties the perturbations have slightly different signatures in the two regions. As a consequence, the FTEs have different signatures depending on whether the satellite encounters the part bulging into the magnetosphere or into the magnetosheath.

  8. Using Variable-Length Aligned Fragment Pairs and an Improved Transition Function for Flexible Protein Structure Alignment.

    PubMed

    Cao, Hu; Lu, Yonggang

    2017-01-01

    With the rapid growth of known protein 3D structures in number, how to efficiently compare protein structures becomes an essential and challenging problem in computational structural biology. At present, many protein structure alignment methods have been developed. Among all these methods, flexible structure alignment methods are shown to be superior to rigid structure alignment methods in identifying structure similarities between proteins, which have gone through conformational changes. It is also found that the methods based on aligned fragment pairs (AFPs) have a special advantage over other approaches in balancing global structure similarities and local structure similarities. Accordingly, we propose a new flexible protein structure alignment method based on variable-length AFPs. Compared with other methods, the proposed method possesses three main advantages. First, it is based on variable-length AFPs. The length of each AFP is separately determined to maximally represent a local similar structure fragment, which reduces the number of AFPs. Second, it uses local coordinate systems, which simplify the computation at each step of the expansion of AFPs during the AFP identification. Third, it decreases the number of twists by rewarding the situation where nonconsecutive AFPs share the same transformation in the alignment, which is realized by dynamic programming with an improved transition function. The experimental data show that compared with FlexProt, FATCAT, and FlexSnap, the proposed method can achieve comparable results by introducing fewer twists. Meanwhile, it can generate results similar to those of the FATCAT method in much less running time due to the reduced number of AFPs.

  9. Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism.

    PubMed

    Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

    2018-02-28

    Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.

  10. Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism

    PubMed Central

    Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

    2018-01-01

    Abstract Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure. PMID:29267977

  11. Single-handed helical carbonaceous nanotubes prepared using a pair of cationic low molecular weight gelators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Huayan; Wang, Qing; Guo, Yongmin

    Highlights: • 3-aminophenol-formaldeyde resins were prepared through a templating method. • A pair of cationic gelators have been used as the templates. • Single-handed helical carbonaceous nanotubes were obtained after carbonization. • The carbonaceous nanotubes showed optical activity. - Abstract: We design a facile route to obtain enantiopure carbonaceous nanostructures, which have potential application as chiral sensors, electromagnetic wave absorbers, and asymmetric catalysts. A pair of cationic low molecular weight gelators was synthesized, which were able to self-assemble into twisted nanoribbons in ethanol at a concentration of 20 g L{sup −1} at 25 °C. Single-handed helical 3-aminophenol-formaldehyde resin nanotubes withmore » optical activity were prepared using the self-assembly of the low molecular weight gelators as templates. After carbonization, single-handed helical carbonaceous nanotubes were obtained and characterized using circular dichroism, wide-angle X-ray diffraction, field-emission scanning electron microscopy, transmission electron microscopy, and Raman spectroscopy. The results indicate that the walls of the nanotubes are amorphous carbon. Moreover, the left- and right-handed helical nanotubes exhibit opposite optical activity.« less

  12. A possible regulatory link between Twist 1 and PPARγ gene regulation in 3T3-L1 adipocytes.

    PubMed

    Ren, Rui; Chen, Zhufeng; Zhao, Xia; Sun, Tao; Zhang, Yuchao; Chen, Jie; Lu, Sumei; Ma, Wanshan

    2016-11-08

    Peroxisome proliferator-activated receptor γ (PPARγ) is a critical gene that regulates the function of adipocytes. Therefore, studies on the molecular regulation mechanism of PPARγ are important to understand the function of adipose tissue. Twist 1 is another important functional gene in adipose tissue, and hundreds of genes are regulated by Twist 1. The aim of this study was to investigate the regulation of Twist 1 and PPARγ expression in 3T3-L1 mature adipocytes. We induced differentiation in 3T3-L1 preadipocytes and examined alterations in Twist 1 and PPARγ expression. We used the PPARγ agonist pioglitazone and the PPARγ antagonist T0070907 to investigate the effect of PPARγ on Twist 1 expression. In addition, we utilized retroviral interference and overexpression of Twist 1 to determine the effects of Twist 1 on PPARγ expression. The expression levels of Twist 1 and PPARγ were induced during differentiation in 3T3-L1 adipocytes. Application of either a PPARγ agonist (pioglitazone) or antagonist (T0070907) influenced Twist 1 expression, with up-regulation of Twist 1 under pioglitazone (1 μM, 24 h) and down-regulation of Twist 1 under T0070907 (100 μM, 24 h) exposure. Furthermore, the retroviral interference of Twist 1 decreased the protein and mRNA expression of PPARγ, while Twist 1 overexpression had the opposite effect. There was a possible regulatory link between Twist 1 and PPARγ in 3T3-L1 mature adipocytes. This regulatory link enhanced the regulation of PPARγ and may be a functional mechanism of Twist 1 regulation of adipocyte physiology and pathology.

  13. Cooling arrangement for a tapered turbine blade

    DOEpatents

    Liang, George

    2010-07-27

    A cooling arrangement (11) for a highly tapered gas turbine blade (10). The cooling arrangement (11) includes a pair of parallel triple-pass serpentine cooling circuits (80,82) formed in an inner radial portion (50) of the blade, and a respective pair of single radial channel cooling circuits (84,86) formed in an outer radial portion (52) of the blade (10), with each single radial channel receiving the cooling fluid discharged from a respective one of the triple-pass serpentine cooling circuit. The cooling arrangement advantageously provides a higher degree of cooling to the most highly stressed radially inner portion of the blade, while providing a lower degree of cooling to the less highly stressed radially outer portion of the blade. The cooling arrangement can be implemented with known casting techniques, thereby facilitating its use on highly tapered, highly twisted Row 4 industrial gas turbine blades that could not be cooled with prior art cooling arrangements.

  14. A braided monoidal category for free super-bosons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Runkel, Ingo, E-mail: ingo.runkel@uni-hamburg.de

    The chiral conformal field theory of free super-bosons is generated by weight one currents whose mode algebra is the affinisation of an abelian Lie super-algebra h with non-degenerate super-symmetric pairing. The mode algebras of a single free boson and of a single pair of symplectic fermions arise for even|odd dimension 1|0 and 0|2 of h, respectively. In this paper, the representations of the untwisted mode algebra of free super-bosons are equipped with a tensor product, a braiding, and an associator. In the symplectic fermion case, i.e., if h is purely odd, the braided monoidal structure is extended to representations ofmore » the Z/2Z-twisted mode algebra. The tensor product is obtained by computing spaces of vertex operators. The braiding and associator are determined by explicit calculations from three- and four-point conformal blocks.« less

  15. Annual-ring-type quasi-phase-matching crystal for generation of narrowband high-dimensional entanglement

    NASA Astrophysics Data System (ADS)

    Hua, Yi-Lin; Zhou, Zong-Quan; Liu, Xiao; Yang, Tian-Shu; Li, Zong-Feng; Li, Pei-Yun; Chen, Geng; Xu, Xiao-Ye; Tang, Jian-Shun; Xu, Jin-Shi; Li, Chuan-Feng; Guo, Guang-Can

    2018-01-01

    A photon pair can be entangled in many degrees of freedom such as polarization, time bins, and orbital angular momentum (OAM). Among them, the OAM of photons can be entangled in an infinite-dimensional Hilbert space which enhances the channel capacity of sharing information in a network. Twisted photons generated by spontaneous parametric down-conversion offer an opportunity to create this high-dimensional entanglement, but a photon pair generated by this process is typically wideband, which makes it difficult to interface with the quantum memories in a network. Here we propose an annual-ring-type quasi-phase-matching (QPM) crystal for generation of the narrowband high-dimensional entanglement. The structure of the QPM crystal is designed by tracking the geometric divergences of the OAM modes that comprise the entangled state. The dimensionality and the quality of the entanglement can be greatly enhanced with the annual-ring-type QPM crystal.

  16. Standard interface: Twin-coaxial converter

    NASA Technical Reports Server (NTRS)

    Lushbaugh, W. A.

    1976-01-01

    The network operations control center standard interface has been adopted as a standard computer interface for all future minicomputer based subsystem development for the Deep Space Network. Discussed is an intercomputer communications link using a pair of coaxial cables. This unit is capable of transmitting and receiving digital information at distances up to 600 m with complete ground isolation between the communicating devices. A converter is described that allows a computer equipped with the standard interface to use the twin coaxial link.

  17. Deployment Completion Report.

    DTIC Science & Technology

    1983-02-24

    LEI’I’EMOF C4KDATION IN PRCESS / AWWRED BY HIGHER AUTHORTIY: 25 COMAND LEPI!ERS OF CMNTION: 20 -.ERITORIOS MAST: 0 EEPI F PUBLIC AEAI S N RELEASES: 45...for the work re-U maining. A decision was made to concentrate work on the telephone, public address, and fire alarm connections of the 200 pair cable...the battalion finished the work at NAS. Rather than initiate work in NAVCAMS, the decision was made to shut down the project until turnover thereby

  18. DDN (Defense Data Network) Protocol Implementations and Vendors Guide,

    DTIC Science & Technology

    1986-08-01

    3000 feet) in length. Lower rates can be selected or determined by attached modem types 303, 209, V.35, or 188-114. Units are in pairs, one at each...each direction. ECUs communicate with the IMP via direct cable or modems . DOCUMENTATION: Fully documented vendor product; descriptive literature...application is the attachment of terminals, PCs and modems to an Ethernet. The device can support up to 80 lines and 2 parallel printers. Full domain naming

  19. Numerical Modeling of Artificial Recharge: Determining Spatial/Temporal Sampling Resolution to Quantify Infiltration Rates and Effective Hydraulic Conductivity

    NASA Astrophysics Data System (ADS)

    Glose, T. J.; Hausner, M. B.; Lowry, C.

    2016-12-01

    The accurate, fine scale quantification of groundwater-surface water (GW-SW) interactions over large expanses in hydrologic systems is a fundamental need in order to accurately characterize critical zones of biogeochemical transformation and fluxes, as well as to provide insight into near-surface geologic heterogeneity. Paired fiber-optic distributed temperature sensing (FO-DTS) is a tool that is capable of synoptically sampling hydrologic systems, allowing GW-SW interactions to be examined at a fine scale over large distances. Within managed aquifer recharge (MAR) sites, differential recharge dynamics controlled by bed clogging and subsurface heterogeneity dictate the effectiveness of these sites at infiltrating water. Numerical modeling indicates that the use of paired FO-DTS in an MAR site can provide accurate quantification of flux at the GW-SW interface, as well as provide insight to the areal extent of geologic heterogeneity in the subsurface. However, the lateral and vertical separation of the fiber-optic cables is of vital importance. Here we present a 2-D, fully coupled groundwater flow and heat transport model with prescribed heterogeneity. Following a forward modeling approach, realizations simulating varying fiber-optic cable positioning, differential bed clogging, and hydraulic conductivity variability were analyzed over a suite of scenarios. The results from the model were then used as observations to calculate groundwater recharge rates and calibration targets for an inverse model to estimate subsurface heterogeneity.

  20. Capability and Cost of COTS Networking Components

    NASA Astrophysics Data System (ADS)

    Hinteregger, Hans

    In this talk we will emphasize first the ease with which dedicated 'dark' fiber can today be 'lit' at one or more gigE-bandwidth wavelengths with low-cost switches, optical transceivers with up to 100 Km reach, and passive mux/demux's. The chief expense for dedicated links today is that of leasing a fiber pair, especially in a city like Wash. DC. But, at least in the US, the intercity cable overbuild of the telecom boom has now, in the bust, made in-the-ground dark fiber pairs buyable for <$1000/km. Hence there are now business interests in COTS networking components,with corresponding opportunities for e-VLBI. We will outline the fairly clear and certain road from gigE in SFP to 10gigE in XFP commodity pluggable packages. The timing of cost/bandwidth crossover is less so - due to current uncertainty in the telecom business climate. A 2006 budget for LOFAR networking requirements, assumed here to be built from scratch in the WA desert where the dominant cable laying costs are minimized, is considered in some detail. The cost of fibers and the cost lighting them (one-way) to 200 Gb/s per station is judged to be affordable. A further projection to SKA's COFON in 2009 will be made. Denser CWDM and/or cheaper DWDM may be developed and mature by that time.

  1. Fiber optics spectrochemical emission sensors

    DOEpatents

    Griffin, Jeffrey W.; Olsen, Khris B.

    1992-01-01

    A method of in situ monitoring of a body of a fluid stored in a tank or groundwater or vadose zone gases in a well for the presence of selected chemical species uses a probe insertable into the well or tank via a cable and having electrical apparatus for exciting selected chemical species in the body of fluid. The probe can have a pair of electrodes for initiating a spark or a plasma cell for maintaining a plasma to excite the selected chemical species. The probe also has optical apparatus for receiving optical emissions emitted by the excited species and optically transmitting the emissions via the cable to an analysis location outside the well. The analysis includes detecting a selected wavelength in the emissions indicative of the presence of the selected chemical species. A plurality of probes can be suspended at an end of a respective cable, with the transmitting and analyzing steps for each probe being synchronized sequentially for one set of support equipment and instrumentation to monitor at multiple test points. The optical apparatus is arranged about the light guide axis so that the selected chemical species are excited the fluid in alignment with the light guide axis and optical emissions are received from the excited chemical species along such axis.

  2. Fiber optics spectrochemical emission sensors

    DOEpatents

    Griffin, J.W.; Olsen, K.B.

    1992-02-04

    A method is described of in situ monitoring of a body of a fluid stored in a tank or groundwater or vadose zone gases in a well for the presence of selected chemical species. The method uses a probe insertable into the well or tank via a cable and having an electrical apparatus for exciting selected chemical species in the body of fluid. The probe can have a pair of electrodes for initiating a spark or a plasma cell for maintaining a plasma to excite the selected chemical species. The probe also has an optical apparatus for receiving optical emissions emitted by the excited species and optically transmitting the emissions via the cable to an analysis location outside the well. The analysis includes detecting a selected wavelength in the emissions indicative of the presence of the selected chemical species. A plurality of probes can be suspended at an end of a respective cable, with the transmitting and analyzing steps for each probe being synchronized sequentially for one set of support equipment and instrumentation to monitor at multiple test points. The optical apparatus is arranged about the light guide axis so that the selected chemical species are excited in the fluid in alignment with the light guide axis. Optical emissions are received from the excited chemical species along such axis. 18 figs.

  3. Comparison of Analysis, Simulation, and Measurement of Wire-to-Wire Crosstalk. Part 2

    NASA Technical Reports Server (NTRS)

    Bradley, Arthur T.; Yavoich, Brian James; Hodson, Shane M.; Godley, Franklin

    2010-01-01

    In this investigation, we compare crosstalk analysis, simulation, and measurement results for electrically short configurations. Methods include hand calculations, PSPICE simulations, Microstripes transient field solver, and empirical measurement. In total, four representative physical configurations are examined, including a single wire over a ground plane, a twisted pair over a ground plane, generator plus receptor wires inside a cylindrical conduit, and a single receptor wire inside a cylindrical conduit. Part 1 addresses the first two cases, and Part 2 addresses the final two. Agreement between the analysis methods and test data is shown to be very good.

  4. Comparison of Analysis, Simulation, and Measurement of Wire-to-Wire Crosstalk. Part 1

    NASA Technical Reports Server (NTRS)

    Bradley, Arthur T.; Yavoich, Brian James; Hodson, Shame M.; Godley, Richard Franklin

    2010-01-01

    In this investigation, we compare crosstalk analysis, simulation, and measurement results for electrically short configurations. Methods include hand calculations, PSPICE simulations, Microstripes transient field solver, and empirical measurement. In total, four representative physical configurations are examined, including a single wire over a ground plane, a twisted pair over a ground plane, generator plus receptor wires inside a cylindrical conduit, and a single receptor wire inside a cylindrical conduit. Part 1 addresses the first two cases, and Part 2 addresses the final two. Agreement between the analysis, simulation, and test data is shown to be very good.

  5. Endothelial TWIST1 Promotes Pathological Ocular Angiogenesis

    PubMed Central

    Li, Jie; Liu, Chi-Hsiu; Sun, Ye; Gong, Yan; Fu, Zhongjie; Evans, Lucy P.; Tian, Katherine T.; Juan, Aimee M.; Hurst, Christian G.; Mammoto, Akiko; Chen, Jing

    2014-01-01

    Purpose. Pathological neovessel formation impacts many blinding vascular eye diseases. Identification of molecular signatures distinguishing pathological neovascularization from normal quiescent vessels is critical for developing new interventions. Twist-related protein 1 (TWIST1) is a transcription factor important in tumor and pulmonary angiogenesis. This study investigated the potential role of TWIST1 in modulating pathological ocular angiogenesis in mice. Methods. Twist1 expression and localization were analyzed in a mouse model of oxygen-induced retinopathy (OIR). Pathological ocular angiogenesis in Tie2-driven conditional Twist1 knockout mice were evaluated in both OIR and laser-induced choroidal neovascularization models. In addition, the effects of TWIST1 on angiogenesis and endothelial cell function were analyzed in sprouting assays of aortic rings and choroidal explants isolated from Twist1 knockout mice, and in human retinal microvascular endothelial cells treated with TWIST1 small interfering RNA (siRNA). Results. TWIST1 is highly enriched in pathological neovessels in OIR retinas. Conditional Tie2-driven depletion of Twist1 significantly suppressed pathological neovessels in OIR without impacting developmental retinal angiogenesis. In a laser-induced choroidal neovascularization model, Twist1 deficiency also resulted in significantly smaller lesions with decreased vascular leakage. In addition, loss of Twist1 significantly decreased vascular sprouting in both aortic ring and choroid explants. Knockdown of TWIST1 in endothelial cells led to dampened expression of vascular endothelial growth factor receptor 2 (VEGFR2) and decreased endothelial cell proliferation. Conclusions. Our study suggests that TWIST1 is a novel regulator of pathologic ocular angiogenesis and may represent a new molecular target for developing potential therapeutic treatments to suppress pathological neovascularization in vascular eye diseases. PMID:25414194

  6. Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease.

    PubMed

    Xue, Gongda; Hemmings, Brian A

    2012-02-01

    The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.

  7. Modified Penning-Malmberg Trap for Storing Antiprotons

    NASA Technical Reports Server (NTRS)

    Sims, William H.; Martin, James; Lewis, Raymond

    2005-01-01

    A modified Penning-Malmberg trap that could store a small cloud of antiprotons for a relatively long time (weeks) has been developed. This trap is intended for use in research on the feasibility of contemplated future matter/antimatter-annihilation systems as propulsion sources for spacecraft on long missions. This trap is also of interest in its own right as a means of storing and manipulating antiprotons for terrestrial scientific experimentation. The use of Penning-Malmberg traps to store antiprotons is not new. What is new here is the modified trap design, which utilizes state-of-the-art radiofrequency (RF) techniques, including ones that, heretofore, have been used in radio-communication applications but not in iontrap applications. A basic Penning-Malmberg trap includes an evacuated round tube that contains or is surrounded by three or more collinear tube electrodes. A steady axial magnetic field that reaches a maximum at the geometric center of the tube is applied by an external source, and DC bias voltages that give rise to an electrostatic potential that reaches a minimum at the center are applied to the electrodes. The combination of electric and magnetic fields confines the charged particles (ions or electrons) for which it was designed to a prolate spheroidal central region. However, geometric misalignments and the diffusive cooling process prevent the steady fields of a basic Penning- Malmberg trap from confining the particles indefinitely. In the modified Penning-Malmberg trap, the loss of antiprotons is reduced or eliminated by use of a "rotating-wall" RF stabilization scheme that also heats the antiproton cloud to minimize loss by matter/antimatter annihilation. The scheme involves the superposition of a quadrupole electric field that rotates about the cylindrical axis at a suitably chosen radio frequency. The modified Penning-Malmberg trap (see Figure 1) includes several collinear sets of electrodes inside a tubular vacuum chamber. Each set comprises either a single metal tube or else a tube that is segmented into four electrodes that subtend equal angles about the cylindrical axis. The output of an RF signal generator is fed through a 90 hybrid coupler and then through two baluns to generate four replicas of the signal at relative phase shifts of 0 , 90 , 180 , and 270 (see Figure 2). These signal replicas are fed through 6-dB directional couplers, then via coaxial cables to the vacuum chamber. The signal is then routed to a phase cancellation network, which filters out the drive signal with the difference representing the plasma interaction. Inside the vacuum chamber, twisted-pair wires feed the signals from the coaxial cables to the four electrodes of each segmented electrode tube.

  8. Role of left ventricular twist mechanics in cardiomyopathies, dance of the helices

    PubMed Central

    Kauer, Floris; Geleijnse, Marcel Leonard; van Dalen, Bastiaan Martijn

    2015-01-01

    Left ventricular twist is an essential part of left ventricular function. Nevertheless, knowledge is limited in “the cardiology community” as it comes to twist mechanics. Fortunately the development of speckle tracking echocardiography, allowing accurate, reproducible and rapid bedside assessment of left ventricular twist, has boosted the interest in this important mechanical aspect of left ventricular deformation. Although the fundamental physiological role of left ventricular twist is undisputable, the clinical relevance of assessment of left ventricular twist in cardiomyopathies still needs to be established. The fact remains; analysis of left ventricular twist mechanics has already provided substantial pathophysiological understanding on a comprehensive variety of cardiomyopathies. It has become clear that increased left ventricular twist in for example hypertrophic cardiomyopathy may be an early sign of subendocardial (microvascular) dysfunction. Furthermore, decreased left ventricular twist may be caused by left ventricular dilatation or an extensive myocardial scar. Finally, the detection of left ventricular rigid body rotation in noncompaction cardiomyopathy may provide an indispensible method to objectively confirm this difficult diagnosis. All this endorses the value of left ventricular twist in the field of cardiomyopathies and may further encourage the implementation of left ventricular twist parameters in the “diagnostic toolbox” for cardiomyopathies. PMID:26322187

  9. FY92 Progress Report for the Gyrotron Backward-Wave-Oscillator Experiment

    DTIC Science & Technology

    1993-07-01

    C. SAMPLE CABLE CALIBRATION 23 D. ASYST CHANNEL SETUPS 26 E. SAMPLE MAGNET INPUT DATA DECK FOR THE GYRO-BWO 32 F. SAMPLE EGUN INPUT DATA DECK FOR THE...of the first coil of the Helmholtz pair; zero also corresponds to the diode end of the experiment). Another computer code used was the EGUN code (Ref...a short computer program was written to superimpose the two magnetic fields; DC and Helmholtz). An example of an EGUN input data file is included in

  10. Demonstration of a Wire Suspension for Virtual Flight Testing in a Wind Tunnel

    DTIC Science & Technology

    2009-02-01

    They were connected by the roll shaft, which rotates in a pair of bearings. These bearings supported both radial and axial loads . Loads were...an axial load , and a radial ball bearing to support the radial loads . To determine whether the anticipated bearing friction is acceptable, we modeled... axial load due to cable pre-tension. Analysis showed that the best choice of pitch bearings is a combin- ation of a ball thrust bearing, which will carry

  11. Feature extraction using molecular planes for fuzzy relational clustering of a flexible dopamine reuptake inhibitor.

    PubMed

    Banerjee, Amit; Misra, Milind; Pai, Deepa; Shih, Liang-Yu; Woodley, Rohan; Lu, Xiang-Jun; Srinivasan, A R; Olson, Wilma K; Davé, Rajesh N; Venanzi, Carol A

    2007-01-01

    Six rigid-body parameters (Shift, Slide, Rise, Tilt, Roll, Twist) are commonly used to describe the relative displacement and orientation of successive base pairs in a nucleic acid structure. The present work adapts this approach to describe the relative displacement and orientation of any two planes in an arbitrary molecule-specifically, planes which contain important pharmacophore elements. Relevant code from the 3DNA software package (Nucleic Acids Res. 2003, 31, 5108-5121) was generalized to treat molecular fragments other than DNA bases as input for the calculation of the corresponding rigid-body (or "planes") parameters. These parameters were used to construct feature vectors for a fuzzy relational clustering study of over 700 conformations of a flexible analogue of the dopamine reuptake inhibitor, GBR 12909. Several cluster validity measures were used to determine the optimal number of clusters. Translational (Shift, Slide, Rise) rather than rotational (Tilt, Roll, Twist) features dominate clustering based on planes that are relatively far apart, whereas both types of features are important to clustering when the pair of planes are close by. This approach was able to classify the data set of molecular conformations into groups and to identify representative conformers for use as template conformers in future Comparative Molecular Field Analysis studies of GBR 12909 analogues. The advantage of using the planes parameters, rather than the combination of atomic coordinates and angles between molecular planes used in our previous fuzzy relational clustering of the same data set (J. Chem. Inf. Model. 2005, 45, 610-623), is that the present clustering results are independent of molecular superposition and the technique is able to identify clusters in the molecule considered as a whole. This approach is easily generalizable to any two planes in any molecule.

  12. Extension-twist coupling of composite circular tubes with application to tilt rotor blade design

    NASA Technical Reports Server (NTRS)

    Nixon, Mark W.

    1987-01-01

    This investigation was conducted to determine if twist deformation required for the design of full-scale extension-twist-coupled tilt-rotor blades can be achieved within material design limit loads, and to demonstrate the accuracy of a coupled-beam analysis in predicting twist deformations. Two extension-twist-coupled tilt-rotor blade designs were developed based on theoretically optimum aerodynamic twist distributions. The designs indicated a twist rate requirement of between .216 and .333 deg/in. Agreement between axial tests and analytical predictions was within 10 percent at design limit loads. Agreement between the torsion tests and predictions was within 11 percent.

  13. The Twist Limit for Bipolar Active Regions

    NASA Technical Reports Server (NTRS)

    Moore, Ron; Falconer, David; Gary, Allen

    2008-01-01

    We present new evidence that further supports the standard idea that active regions are emerged magnetic-flux-rope omega loops. When the axial magnetic twist of a cylindrical flux rope exceeds a critical amount, the flux rope becomes unstable to kinking, and the excess axial twist is converted into writhe twist by the kinking. This suggests that, if active regions are emerged omega loops, then (1) no active region should have magnetic twist much above the limit set by kinking, (2) active regions having twist near the limit should often arise from kinked omega loops, and (3) since active regions having large delta sunspots are outstandingly twisted, these arise from kinked omega loops and should have twist near the limit for kinking. From each of 36 vector magnetograms of bipolar active regions, we have measured (1) the total flux of the vertical field above 100 G, (2) the area covered by this flux, and (3) the net electric current that arches over the polarity inversion line. These three quantities yield an estimate of the axial magnetic twist in a simple model cylindrical flux rope that corresponds to the top of the active region s hypothetical omega loop prior to emergence. In all 36 cases, the estimated twist is below the critical limit for kinking. The 11 most twisted active regions (1) have estimated twist within a factor of approx.3 of the limit, and (2) include all of our 6 active regions having large delta sunspots. Thus, our observed twist limit for bipolar active regions is in good accord with active regions being emerged omega loops.

  14. Twisted intramolecular charge transfer investigation of semi organic L-Glutamic acid hydrochloride single crystal for organic light-emitting and optical limiting applications

    NASA Astrophysics Data System (ADS)

    Joy, Lija K.; George, Merin; Alex, Javeesh; Aravind, Arun; Sajan, D.; Vinitha, G.

    2018-03-01

    Single crystals of L-Glutamic acid hydrochloride (LGHCl) were grown by slow evaporation solution technique and good crystalline perfection was confirmed by Powder X-ray diffraction studies. The complete vibrational studies of the compound were analyzed by FT-IR, FT-Raman and UV-visible spectra combined with Normal Coordinate Analysis (NCA) following the scaled quantum mechanical force field methodology and density functional theory (DFT). Twisted Intramolecular Charge Transfer (ICT) occurs due to the presence of strong ionic intra-molecular Nsbnd H⋯O hydrogen bonding was confirmed by Hirshfeld Surface analysis. The existence of intermolecular Nsbnd H⋯Cl hydrogen bonds due to the interaction between the lone pair of oxygen with the antibonding orbital was established by NBO analysis. The Z-scan result indicated that the title molecule exhibits saturable absorption behavior. The attractive third-order nonlinear properties suggest that LGHCl can be a promising candidate for the design and development devices for optical limiting applications. LGHCL exhibits distinct emission in the blue region of the fluorescence lifetime which proves to be a potential candidate for blue- Organic light-emitting diodes (OLEDs) fabrication.

  15. α-Synuclein amyloid fibrils with two entwined, asymmetrically associated protofibrils [α-Synuclein amyloid fibrils with two entwined, asymmetrically associated, protofibrils and axially stacked metal binding sites

    DOE PAGES

    Dearborn, Altaira D.; Wall, Joseph S.; Cheng, Naiqian; ...

    2015-12-07

    Parkinson disease and other progressive neurodegenerative conditions are characterized by the intracerebral presence of Lewy bodies, containing amyloid fibrils of α-synuclein. We used cryo-electron microscopy and scanning transmission electron microscopy (STEM) to study in vitro-assembled fibrils. These fibrils are highly polymorphic. Focusing on twisting fibrils with an inter-crossover spacing of 77 nm, our reconstructions showed them to consist of paired protofibrils. STEM mass per length data gave one subunit per 0.47 nm axial rise per protofibril, consistent with a superpleated β-structure. The STEM images show two thread-like densities running along each of these fibrils, which we interpret as ladders ofmore » metal ions. These threads confirmed the two-protofibril architecture of the 77-nm twisting fibrils and allowed us to identify this morphotype in STEM micrographs. Some other, but not all, fibril morphotypes also exhibit dense threads, implying that they also present a putative metal binding site. As a result, we propose a molecular model for the protofibril and suggest that polymorphic variant fibrils have different numbers of protofibrils that are associated differently.« less

  16. A dual-satellite study of the spatial properties of FTEs. [flux transfer events

    NASA Technical Reports Server (NTRS)

    Saunders, M. A.; Russell, C. T.; Sckopke, N.

    1984-01-01

    Reconnection at the earth's dayside magnetopause may manifest itself primarily as a localized and transient process called a flux-transfer event (FTE). The spatial properties of FTEs are investigated directly by examining data from the ISEE satellite pair when the satellites were separated by more than 1000 km in the vicinity of the magnetopause. Examples of magnetosheath and boundary layer FTEs, each having a dimension normal to the magnetopause of order an earth radius, R(E), are shown, and this scale-size result is substantiated statistically for magnetosheath FTEs. When combined with other information, a 1-R(E) normal dimension implies that the voltage associated with the FTE process at one magnetopause location is at least 10 kV. These findings strengthen the view that the magnetic field comprising an FTE is twisted, this twisting appearing to be continuous in sense across the magnetopause and corresponding to a core field-aligned current of magnitude a few hundred kA. Changes in plasma flow speed and direction are found to be associated with FTEs. The transverse field and flow perturbations accompanying the three magnetosheath FTEs studied here satisfy approximately the Walen relation, the relation which describes a propagating Alfven wave.

  17. Probing gluon saturation with next-to-leading order photon production at central rapidities in proton-nucleus collisions

    DOE PAGES

    Benic, Sanjin; Fukushima, Kenji; Garcia-Montero, Oscar; ...

    2017-01-26

    Here, we compute the cross section for photons emitted from sea quarks in proton-nucleus collisions at collider energies. The computation is performed within the dilute-dense kinematics of the Color Glass Condensate (CGC) effective field theory. Albeit the result obtained is formally at next-to-leading order in the CGC power counting, it provides the dominant contribution for central rapidities. We observe that the inclusive photon cross section is proportional to all-twist Wilson line correlators in the nucleus. These correlators also appear in quark-pair production; unlike the latter, photon production is insensitive to hadronization uncertainties and therefore more sensitive to multi-parton correlations inmore » the gluon saturation regime of QCD. We demonstrate that k ⊥ and collinear factorized expressions for inclusive photon production are obtained as leading twist approximations to our result. In particular, the collinearly factorized expression is directly sensitive to the nuclear gluon distribution at small x. Other results of interest include the realization of the Low-Burnett-Kroll soft photon theorem in the CGC framework and a comparative study of how the photon amplitude is obtained in Lorenz and light-cone gauges.« less

  18. Genomic pathways modulated by Twist in breast cancer.

    PubMed

    Vesuna, Farhad; Bergman, Yehudit; Raman, Venu

    2017-01-13

    The basic helix-loop-helix transcription factor TWIST1 (Twist) is involved in embryonic cell lineage determination and mesodermal differentiation. There is evidence to indicate that Twist expression plays a role in breast tumor formation and metastasis, but the role of Twist in dysregulating pathways that drive the metastatic cascade is unclear. Moreover, many of the genes and pathways dysregulated by Twist in cell lines and mouse models have not been validated against data obtained from larger, independant datasets of breast cancer patients. We over-expressed the human Twist gene in non-metastatic MCF-7 breast cancer cells to generate the estrogen-independent metastatic breast cancer cell line MCF-7/Twist. These cells were inoculated in the mammary fat pad of female severe compromised immunodeficient mice, which subsequently formed xenograft tumors that metastasized to the lungs. Microarray data was collected from both in vitro (MCF-7 and MCF-7/Twist cell lines) and in vivo (primary tumors and lung metastases) models of Twist expression. Our data was compared to several gene datasets of various subtypes, classes, and grades of human breast cancers. Our data establishes a Twist over-expressing mouse model of breast cancer, which metastasizes to the lung and replicates some of the ontogeny of human breast cancer progression. Gene profiling data, following Twist expression, exhibited novel metastasis driver genes as well as cellular maintenance genes that were synonymous with the metastatic process. We demonstrated that the genes and pathways altered in the transgenic cell line and metastatic animal models parallel many of the dysregulated gene pathways observed in human breast cancers. Analogous gene expression patterns were observed in both in vitro and in vivo Twist preclinical models of breast cancer metastasis and breast cancer patient datasets supporting the functional role of Twist in promoting breast cancer metastasis. The data suggests that genetic dysregulation of Twist at the cellular level drives alterations in gene pathways in the Twist metastatic mouse model which are comparable to changes seen in human breast cancers. Lastly, we have identified novel genes and pathways that could be further investigated as targets for drugs to treat metastatic breast cancer.

  19. Characterization of sequences in human TWIST required for nuclear localization

    PubMed Central

    Singh, Shalini; Gramolini, Anthony O

    2009-01-01

    Background Twist is a transcription factor that plays an important role in proliferation and tumorigenesis. Twist is a nuclear protein that regulates a variety of cellular functions controlled by protein-protein interactions and gene transcription events. The focus of this study was to characterize putative nuclear localization signals (NLSs) 37RKRR40 and 73KRGKK77 in the human TWIST (H-TWIST) protein. Results Using site-specific mutagenesis and immunofluorescences, we observed that altered TWISTNLS1 K38R, TWISTNLS2 K73R and K77R constructs inhibit nuclear accumulation of H-TWIST in mammalian cells, while TWISTNLS2 K76R expression was un-affected and retained to the nucleus. Subsequently, co-transfection of TWIST mutants K38R, K73R and K77R with E12 formed heterodimers and restored nuclear localization despite the NLSs mutations. Using a yeast-two-hybrid assay, we identified a novel TWIST-interacting candidate TCF-4, a basic helix-loop-helix transcription factor. The interaction of TWIST with TCF-4 confirmed using NLS rescue assays, where nuclear expression of mutant TWISTNLS1 with co-transfixed TCF-4 was observed. The interaction of TWIST with TCF-4 was also seen using standard immunoprecipitation assays. Conclusion Our study demonstrates the presence of two putative NLS motifs in H-TWIST and suggests that these NLS sequences are functional. Furthermore, we identified and confirmed the interaction of TWIST with a novel protein candidate TCF-4. PMID:19534813

  20. The climbing crawling robot (a unique cable robot for space and Earth)

    NASA Technical Reports Server (NTRS)

    Kerley, James J.; May, Edward; Eklund, Wayne

    1991-01-01

    Some of the greatest concerns in robotic designs have been the high center of gravity of the robot, the irregular or flat surface that the robot has to work on, the weight of the robot that has to handle heavy weights or use heavy forces, and the ability of the robot to climb straight up in the air. This climbing crawling robot handles these problems well with magnets, suction cups, or actuators. The cables give body to the robot and it performs very similar to a caterpillar. The computer program is simple and inexpensive as is the robot. One of the important features of this system is that the robot can work in pairs or triplets to handle jobs that would be extremely difficult for single robots. The light weight of the robot allows it to handle quite heavy weights. The number of feet give the robot many roots where a simple set of feet would give it trouble.

  1. Solid state safety jumper cables

    DOEpatents

    Kronberg, James W.

    1993-01-01

    Solid state jumper cables for connecting two batteries in parallel, having two bridge rectifiers for developing a reference voltage, a four-input decoder for determining which terminals are to be connected based on a comparison of the voltage at each of the four terminals to the reference voltage, and a pair of relays for effecting the correct connection depending on the determination of the decoder. No connection will be made unless only one terminal of each battery has a higher voltage than the reference voltage, indicating "positive" terminals, and one has a lower voltage than the reference voltage, indicating "negative" terminals, and that, therefore, the two high voltage terminals may be connected and the two lower voltage terminals may be connected. Current flows once the appropriate relay device is closed. The relay device is preferably a MOSFET (metal oxide semiconductor field effect transistor) combined with a series array of photodiodes that develop MOSFET gate-closing potential when the decoder output causes an LED to light.

  2. Solid state safety jumper cables

    DOEpatents

    Kronberg, J.W.

    1993-02-23

    Solid state jumper cables for connecting two batteries in parallel, having two bridge rectifiers for developing a reference voltage, a four-input decoder for determining which terminals are to be connected based on a comparison of the voltage at each of the four terminals to the reference voltage, and a pair of relays for effecting the correct connection depending on the determination of the decoder. No connection will be made unless only one terminal of each battery has a higher voltage than the reference voltage, indicating positive'' terminals, and one has a lower voltage than the reference voltage, indicating negative'' terminals, and that, therefore, the two high voltage terminals may be connected and the two lower voltage terminals may be connected. Current flows once the appropriate relay device is closed. The relay device is preferably a MOSFET (metal oxide semiconductor field effect transistor) combined with a series array of photodiodes that develop MOSFET gate-closing potential when the decoder output causes an LED to light.

  3. Teaching Spatial Awareness for Better Twisting Somersaults.

    ERIC Educational Resources Information Center

    Hennessy, Jeff T.

    1985-01-01

    The barani (front somersault with one-half twist) and the back somersault with one twist are basic foundation skills necessary for more advanced twisting maneuvers. Descriptions of these movements on a trampoline surface are offered. (DF)

  4. miR-300 inhibits epithelial to mesenchymal transition and metastasis by targeting Twist in human epithelial cancer

    PubMed Central

    2014-01-01

    Background Epithelial-to-mesenchymal transition (EMT) is a key step of the progression of tumor cell metastasis. Recent work has demonstrated some miRNAs play critical roles in EMT. In this study, we focused on the roles of miR-300 in regulating EMT. Methods The expression levels of miR-300 were examined in epithelial carcinoma cells that underwent an EMT using quantitative reverse transcription-PCR. The role of miR-300 in EMT was investigated by transfection of the miR-300 mimic or inhibitor in natural epithelial-mesenchymal phenotype cell line pairs and in transforming growth factor (TGF) beta-induced EMT cell models. A luciferase reporter assay and a rescue experiment were conducted to confirm the target gene of miR-300. The efficacy of miR-300 against tumor invasion and metastasis was evaluated both in vitro and in vivo. Correlation analysis between miR-300 expression and the expression levels of its target gene, as well as tumor metastasis was performed in specimens from patients with head and neck squamous cell carcinoma (HNSCC). Results MiR-300 was found down-regulated in the HNSCC cells and breast cancer cells that underwent EMT. Ectopic expression of miR-300 effectively blocked TGF-beta-induced EMT and reversed the phenotype of EMT in HN-12 and MDA-MB-231 cells, but inhibition of miR-300 in the epithelial phenotype cells, HN-4 and MCF-7 cells, could induce EMT. The luciferase reporter assay and the rescue assay results showed that miR-300 directly targets the 3′UTR of Twist. Enforced miR-300 expression suppressed cell invasion in vitro and experimental metastasis in vivo. Clinically, miR-300 expression was found inversely correlated with Twist expression and reduced miR-300 was associated with metastasis in patient specimens. Conclusions Down-regulation of miR-300 is required for EMT initiation and maintenance. MiR-300 may negatively regulate EMT by direct targeting Twist and therefore inhibit cancer cell invasion and metastasis, which implicates miR-300 as an attractive candidate for cancer therapy. PMID:24885626

  5. miR-300 inhibits epithelial to mesenchymal transition and metastasis by targeting Twist in human epithelial cancer.

    PubMed

    Yu, Jingshuang; Xie, Furong; Bao, Xin; Chen, Wantao; Xu, Qin

    2014-05-24

    Epithelial-to-mesenchymal transition (EMT) is a key step of the progression of tumor cell metastasis. Recent work has demonstrated some miRNAs play critical roles in EMT. In this study, we focused on the roles of miR-300 in regulating EMT. The expression levels of miR-300 were examined in epithelial carcinoma cells that underwent an EMT using quantitative reverse transcription-PCR. The role of miR-300 in EMT was investigated by transfection of the miR-300 mimic or inhibitor in natural epithelial-mesenchymal phenotype cell line pairs and in transforming growth factor (TGF) beta-induced EMT cell models. A luciferase reporter assay and a rescue experiment were conducted to confirm the target gene of miR-300. The efficacy of miR-300 against tumor invasion and metastasis was evaluated both in vitro and in vivo. Correlation analysis between miR-300 expression and the expression levels of its target gene, as well as tumor metastasis was performed in specimens from patients with head and neck squamous cell carcinoma (HNSCC). MiR-300 was found down-regulated in the HNSCC cells and breast cancer cells that underwent EMT. Ectopic expression of miR-300 effectively blocked TGF-beta-induced EMT and reversed the phenotype of EMT in HN-12 and MDA-MB-231 cells, but inhibition of miR-300 in the epithelial phenotype cells, HN-4 and MCF-7 cells, could induce EMT. The luciferase reporter assay and the rescue assay results showed that miR-300 directly targets the 3'UTR of Twist. Enforced miR-300 expression suppressed cell invasion in vitro and experimental metastasis in vivo. Clinically, miR-300 expression was found inversely correlated with Twist expression and reduced miR-300 was associated with metastasis in patient specimens. Down-regulation of miR-300 is required for EMT initiation and maintenance. MiR-300 may negatively regulate EMT by direct targeting Twist and therefore inhibit cancer cell invasion and metastasis, which implicates miR-300 as an attractive candidate for cancer therapy.

  6. Metastasis-associated in colon cancer-1 promotes vasculogenic mimicry in gastric cancer by upregulating TWIST1/2

    PubMed Central

    Wang, Lin; Lin, Li; Chen, Xi; Sun, Li; Liao, Yulin; Huang, Na; Liao, Wangjun

    2015-01-01

    Vasculogenic mimicry (VM) is a blood supply modality that is strongly associated with the epithelial-mesenchymal transition (EMT), TWIST1 activation and tumor progression. We previously reported that metastasis-associated in colon cancer-1 (MACC1) induced the EMT and was associated with a poor prognosis of patients with gastric cancer (GC), but it remains unknown whether MACC1 promotes VM and regulates the TWIST signaling pathway in GC. In this study, we investigated MACC1 expression and VM by immunohistochemistry in 88 patients with stage IV GC, and also investigated the role of TWIST1 and TWIST2 in MACC1-induced VM by using nude mice with GC xenografts and GC cell lines. We found that the VM density was significantly increased in the tumors of patients who died of GC and was positively correlated with MACC1 immunoreactivity (p < 0.05). The 3-year survival rate was only 8.6% in patients whose tumors showed double positive staining for MACC1 and VM, whereas it was 41.7% in patients whose tumors were negative for both MACC1 and VM. Moreover, nuclear expression of MACC1, TWIST1, and TWIST2 was upregulated in GC tissues compared with matched adjacent non-tumorous tissues (p < 0.05). Overexpression of MACC1 increased TWIST1/2 expression and induced typical VM in the GC xenografts of nude mice and in GC cell lines. MACC1 enhanced TWIST1/2 promoter activity and facilitated VM, while silencing of TWIST1 or TWIST2 inhibited VM. Hepatocyte growth factor (HGF) increased the nuclear translocation of MACC1, TWIST1, and TWIST2, while a c-Met inhibitor reduced these effects. These findings indicate that MACC1 promotes VM in GC by regulating the HGF/c-Met-TWIST1/2 signaling pathway, which means that MACC1 and this pathway are potential new therapeutic targets for GC. PMID:25895023

  7. Numerical investigation of heat transfer and friction factor characteristics in a circular tube fitted with V-cut twisted tape inserts.

    PubMed

    Salman, Sami D; Kadhum, Abdul Amir H; Takriff, Mohd S; Mohamad, Abu Bakar

    2013-01-01

    Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration.

  8. Numerical Investigation of Heat Transfer and Friction Factor Characteristics in a Circular Tube Fitted with V-Cut Twisted Tape Inserts

    PubMed Central

    Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

    2013-01-01

    Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration. PMID:24078795

  9. Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

    NASA Astrophysics Data System (ADS)

    Hu, F.; Das, Suprem R.; Luan, Y.; Chung, T.-F.; Chen, Y. P.; Fei, Z.

    2017-12-01

    We report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly due to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.

  10. Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, F.; Das, Suprem R.; Luan, Y.

    Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

  11. Hydrogen bonds and twist in cellulose microfibrils.

    PubMed

    Kannam, Sridhar Kumar; Oehme, Daniel P; Doblin, Monika S; Gidley, Michael J; Bacic, Antony; Downton, Matthew T

    2017-11-01

    There is increasing experimental and computational evidence that cellulose microfibrils can exist in a stable twisted form. In this study, atomistic molecular dynamics (MD) simulations are performed to investigate the importance of intrachain hydrogen bonds on the twist in cellulose microfibrils. We systematically enforce or block the formation of these intrachain hydrogen bonds by either constraining dihedral angles or manipulating charges. For the majority of simulations a consistent right handed twist is observed. The exceptions are two sets of simulations that block the O2-O6' intrachain hydrogen bond, where no consistent twist is observed in multiple independent simulations suggesting that the O2-O6' hydrogen bond can drive twist. However, in a further simulation where exocyclic group rotation is also blocked, right-handed twist still develops suggesting that intrachain hydrogen bonds are not necessary to drive twist in cellulose microfibrils. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

    DOE PAGES

    Hu, F.; Das, Suprem R.; Luan, Y.; ...

    2017-12-13

    Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

  13. Gauge transformations for twisted spectral triples

    NASA Astrophysics Data System (ADS)

    Landi, Giovanni; Martinetti, Pierre

    2018-05-01

    It is extended to twisted spectral triples the fluctuations of the metric as bounded perturbations of the Dirac operator that arises when a spectral triple is exported between Morita equivalent algebras, as well as gauge transformations which are obtained by the action of the unitary endomorphisms of the module implementing the Morita equivalence. It is firstly shown that the twisted-gauged Dirac operators, previously introduced to generate an extra scalar field in the spectral description of the standard model of elementary particles, in fact follow from Morita equivalence between twisted spectral triples. The law of transformation of the gauge potentials turns out to be twisted in a natural way. In contrast with the non-twisted case, twisted fluctuations do not necessarily preserve the self-adjointness of the Dirac operator. For a self-Morita equivalence, conditions are obtained in order to maintain self-adjointness that are solved explicitly for the minimal twist of a Riemannian manifold.

  14. Random waves in the brain: Symmetries and defect generation in the visual cortex

    NASA Astrophysics Data System (ADS)

    Schnabel, M.; Kaschube, M.; Löwel, S.; Wolf, F.

    2007-06-01

    How orientation maps in the visual cortex of the brain develop is a matter of long standing debate. Experimental and theoretical evidence suggests that their development represents an activity-dependent self-organization process. Theoretical analysis [1] exploring this hypothesis predicted that maps at an early developmental stage are realizations of Gaussian random fields exhibiting a rigorous lower bound for their densities of topological defects, called pinwheels. As a consequence, lower pinwheel densities, if observed in adult animals, are predicted to develop through the motion and annihilation of pinwheel pairs. Despite of being valid for a large class of developmental models this result depends on the symmetries of the models and thus of the predicted random field ensembles. In [1] invariance of the orientation map's statistical properties under independent space rotations and orientation shifts was assumed. However, full rotation symmetry appears to be broken by interactions of cortical neurons, e.g. selective couplings between groups of neurons with collinear orientation preferences [2]. A recently proposed new symmetry, called shift-twist symmetry [3], stating that spatial rotations have to occur together with orientation shifts in order to be an appropriate symmetry transformation, is more consistent with this organization. Here we generalize our random field approach to this important symmetry class. We propose a new class of shift-twist symmetric Gaussian random fields and derive the general correlation functions of this ensemble. It turns out that despite strong effects of the shift-twist symmetry on the structure of the correlation functions and on the map layout the lower bound on the pinwheel densities remains unaffected, predicting pinwheel annihilation in systems with low pinwheel densities.

  15. Arm position influences the activation patterns of trunk muscles during trunk range-of-motion movements.

    PubMed

    Siu, Aaron; Schinkel-Ivy, Alison; Drake, Janessa Dm

    2016-10-01

    To understand the activation patterns of the trunk musculature, it is also important to consider the implications of adjacent structures such as the upper limbs, and the muscles that act to move the arms. This study investigated the effects of arm positions on the activation patterns and co-activation of the trunk musculature and muscles that move the arm during trunk range-of-motion movements (maximum trunk axial twist, flexion, and lateral bend). Fifteen males and fifteen females, asymptomatic for low back pain, performed maximum trunk range-of-motion movements, with three arm positions for axial twist (loose, crossed, abducted) and two positions for flexion and lateral bend (loose, crossed). Electromyographical data were collected for eight muscles bilaterally, and activation signals were cross-correlated between trunk muscles and the muscles that move the arms (upper trapezius, latissimus dorsi). Results revealed consistently greater muscle co-activation (higher cross-correlation coefficients) between the trunk muscles and upper trapezius for the abducted arm position during maximum trunk axial twist, while results for the latissimus dorsi-trunk pairings were more dependent on the specific trunk muscles (either abdominal or back) and latissimus dorsi muscle (either right or left side), as well as the range-of-motion movement. The findings of this study contribute to the understanding of interactions between the upper limbs and trunk, and highlight the influence of arm positions on the trunk musculature. In addition, the comparison of the present results to those of individuals with back or shoulder conditions may ultimately aid in elucidating underlying mechanisms or contributing factors to those conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Discrete and continuum modeling of solvent effects in a twisted intramolecular charge transfer system: The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule.

    PubMed

    Modesto-Costa, Lucas; Borges, Itamar

    2018-08-05

    The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Downhole transmission system

    DOEpatents

    Hall, David R [Provo, UT; Fox, Joe [Spanish Fork, UT

    2008-01-15

    A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. An electrical conductor connects both the transmission elements. The electrical conductor comprises at least three electrically conductive elements insulated from each other. In the preferred embodiment the electrical conductor comprises an electrically conducting outer shield, an electrically conducting inner shield and an electrical conducting core. In some embodiments of the present invention, the electrical conductor comprises an electrically insulating jacket. In other embodiments, the electrical conductor comprises a pair of twisted wires. In some embodiments, the electrical conductor comprises semi-conductive material.

  18. [Ankle arthrodesis using the cable technique].

    PubMed

    Labitzke, Reiner

    2005-10-01

    Arthrodesis of the ankle with a cable technique for restitution of pain-free gait with the foot in functional alignment. Painful osteoarthritis of the ankle unresponsive to conservative and surgical treatment or in instances where these treatments do not seem sensible. Osteomyelitis, acute arthritis, neuropathic arthropathy. Exposure of the ankle through bilateral longitudinal incisions. Resection of malleoli and of articular surfaces of tibia and talus correcting at the same time any malalignment. Insertion of two cortical screws into the lateral aspect of the tibia and one each into talar body and neck. All four screws must protrude the opposite cortex. Around the neck of each anterior and posterior pair of screws as well as around the tips of the protruding screws cables are placed, tensioned, and tightened in a crimp. An arthrodesis of the ankle was performed in 25 patients (25 ankles). The goal of surgery was reached in 21 patients at 6-8 weeks postoperatively. Two patients had to undergo a revision using the same method to secure a bony fusion. In another two the failure was due to a wrong indication; in both a bony fusion occurred after external fixation. Using the Mazur Score the patients reached an average of 74 points and with the MHH Score ("Medizinische Hochschule Hannover" [Hanover Medical School]) an average of 78 points, both attesting to a good result.

  19. Study of nonlinear MHD equations governing the wave propagation in twisted coronal loops

    NASA Technical Reports Server (NTRS)

    Parhi, S.; DeBruyne, P.; Goossens, M.; Zhelyazkov, I.

    1995-01-01

    The solar corona, modelled by a low beta, resistive plasma slab, sustains MHD wave propagations due to shearing footpoint motions in the photosphere. By using a numerical algorithm the excitation and nonlinear development of MHD waves in twisted coronal loops are studied. The plasma responds to the footpoint motion by sausage waves if there is no twist. The twist in the magnetic field of the loop destroys initially developed sausage-like wave modes and they become kinks. The transition from sausage to kink modes is analyzed. The twist brings about mode degradation producing high harmonics and this generates more complex fine structures. This can be attributed to several local extrema in the perturbed velocity profiles. The Alfven wave produces remnants of the ideal 1/x singularity both for zero and non-zero twist and this pseudo-singularity becomes less pronounced for larger twist. The effect of nonlinearity is clearly observed by changing the amplitude of the driver by one order of magnitude. The magnetosonic waves also exhibit smoothed remnants of ideal logarithmic singularities when the frequency of the driver is correctly chosen. This pseudo-singularity for fast waves is absent when the coronal loop does not undergo any twist but becomes pronounced when twist is included. On the contrary, it is observed for slow waves even if there is no twist. Increasing the twist leads to a higher heating rate of the loop. The larger twist shifts somewhat uniformly distributed heating to layers inside the slab corresponding to peaks in the magnetic field strength.

  20. Twist promotes tumor metastasis in basal-like breast cancer by transcriptionally upregulating ROR1.

    PubMed

    Cao, Jingying; Wang, Xin; Dai, Tao; Wu, Yuanzhong; Zhang, Meifang; Cao, Renxian; Zhang, Ruhua; Wang, Gang; Jiang, Rou; Zhou, Binhua P; Shi, Jian; Kang, Tiebang

    2018-01-01

    Rationale: Twist is a key transcription factor for induction of epithelial-mesenchymal transition (EMT), which promotes cell migration, invasion, and cancer metastasis, confers cancer cells with stem cell-like characteristics, and provides therapeutic resistance. However, the functional roles and targeted genes of Twist in EMT and cancer progression remain elusive. Methods: The potential targeted genes of Twist were identified from the global transcriptomes of T47D/Twist cells by microarray analysis. EMT phenotype was detected by western blotting and immunofluorescence of marker proteins. The dual-luciferase reporter and chromatin immunoprecipitation assays were employed to observe the direct transcriptional induction of ROR1 by Twist. A lung metastasis model was used to study the pro-metastatic role of Twist and ROR1 by injecting MDA-MB-231 cells into tail vein of nude mice. Bio-informatics analysis was utilized to measure the metastasis-free survival of breast cancer patients. Results: Twist protein was proved to directly activate the transcription of ROR1 gene, a receptor of Wnt5a in non-canonical WNT signaling pathway. Silencing of ROR1 inhibited EMT process, cell migration, invasion, and cancer metastasis of basal-like breast cancer (BLBC) cells. Knockdown of ROR1 also ameliorated the pro-metastatic effect of Twist. Furthermore, analyses of clinical specimens indicated that high expression of both ROR1 and Twist tightly correlates with poor metastasis-free survival of breast cancer patients. Conclusion: ROR1 is a targeted gene of Twist. Twist/ROR1 signaling is critical for invasion and metastasis of BLBC cells.

  1. Controllable helical deformations on printed anisotropic composite soft actuators

    NASA Astrophysics Data System (ADS)

    Wang, Dong; Li, Ling; Serjouei, Ahmad; Dong, Longteng; Weeger, Oliver; Gu, Guoying; Ge, Qi

    2018-04-01

    Helical shapes are ubiquitous in both nature and engineering. However, the development of soft actuators and robots that mimic helical motions has been hindered primarily due to the lack of efficient modeling approaches that take into account the material anisotropy and the directional change of the external loading point. In this work, we present a theoretical framework for modeling controllable helical deformations of cable-driven, anisotropic, soft composite actuators. The framework is based on the minimum potential energy method, and its model predictions are validated by experiments, where the microarchitectures of the soft composite actuators can be precisely defined by 3D printing. We use the developed framework to investigate the effects of material and geometric parameters on helical deformations. The results show that material stiffness, volume fraction, layer thickness, and fiber orientation can be used to control the helical deformation of a soft actuator. In particular, we found that a critical fiber orientation angle exists at which the twist of the actuator changes the direction. Thus, this work can be of great importance for the design and fabrication of soft actuators with tailored deformation behavior.

  2. Twist for Snyder space

    NASA Astrophysics Data System (ADS)

    Meljanac, Daniel; Meljanac, Stjepan; Mignemi, Salvatore; Pikutić, Danijel; Štrajn, Rina

    2018-03-01

    We construct the twist operator for the Snyder space. Our starting point is a non-associative star product related to a Hermitian realisation of the noncommutative coordinates originally introduced by Snyder. The corresponding coproduct of momenta is non-coassociative. The twist is constructed using a general definition of the star product in terms of a bi-differential operator in the Hopf algebroid approach. The result is given by a closed analytical expression. We prove that this twist reproduces the correct coproducts of the momenta and the Lorentz generators. The twisted Poincaré symmetry is described by a non-associative Hopf algebra, while the twisted Lorentz symmetry is described by the undeformed Hopf algebra. This new twist might be important in the construction of different types of field theories on Snyder space.

  3. Effect of twist on single-mode fiber-optic 3 × 3 couplers

    NASA Astrophysics Data System (ADS)

    Chen, Dandan; Ji, Minning; Peng, Lei

    2018-01-01

    In the fabricating process of a 3 × 3 fused tapered coupler, the three fibers are usually twisted to be close-contact. The effect of twist on 3 × 3 fused tapered couplers is investigated in this paper. It is found that though a linear 3 × 3 coupler may realize equal power splitting ratio theoretically by twisting a special angle, it is hard to be fabricated actually because the twist angle and the coupler's length must be determined in advance. While an equilateral 3 × 3 coupler can not only realize approximate equal power splitting ratio theoretically but can also be fabricated just by controlling the elongation length. The effect of twist on the equilateral 3 × 3 coupler lies in the relationship between the equal ratio error and the twist angle. The more the twist angle is, the larger the equal ratio error may be. The twist angle usually should be no larger than 90° on one coupling period length in order to keep the equal ratio error small enough. The simulation results agree well with the experimental data.

  4. Evidence for conformational capture mechanism for damage recognition by NER protein XPC/Rad4.

    NASA Astrophysics Data System (ADS)

    Chakraborty, Sagnik; Steinbach, Peter J.; Paul, Debamita; Min, Jung-Hyun; Ansari, Anjum

    Altered flexibility of damaged DNA sites is considered to play an important role in damage recognition by DNA repair proteins. Characterizing lesion-induced DNA dynamics has remained a challenge. We have combined ps-resolved fluorescence lifetime measurements with cytosine analog FRET pair uniquely sensitive to local unwinding/twisting to analyze DNA conformational distributions. This innovative approach maps out with unprecedented sensitivity the alternative conformations accessible to a series of DNA constructs containing 3-base-pair mismatch, suitable model lesions for the DNA repair protein xeroderma pigmentosum C (XPC) complex. XPC initiates eukaryotic nucleotide excision repair by recognizing various DNA lesions primarily through DNA deformability. Structural studies show that Rad4 (yeast ortholog of XPC) unwinds DNA at the lesion site and flips out two nucleotide pairs. Our results elucidate a broad range of conformations accessible to mismatched DNA even in the absence of the protein. Notably, the most severely distorted conformations share remarkable resemblance to the deformed conformation seen in the crystal structure of the Rad4-bound ``recognition'' complex supporting for the first time a possible ``conformational capture'' mechanism for damage recognition by XPC/Rad4. NSF Univ of Illinois-Chicago.

  5. Twisted supersymmetry: Twisted symmetry versus renormalizability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dimitrijevic, Marija; Nikolic, Biljana; Radovanovic, Voja

    We discuss a deformation of superspace based on a Hermitian twist. The twist implies a *-product that is noncommutative, Hermitian and finite when expanded in a power series of the deformation parameter. The Leibniz rule for the twisted supersymmetry transformations is deformed. A minimal deformation of the Wess-Zumino action is proposed and its renormalizability properties are discussed. There is no tadpole contribution, but the two-point function diverges. We speculate that the deformed Leibniz rule, or more generally the twisted symmetry, interferes with renormalizability properties of the model. We discuss different possibilities to render a renormalizable model.

  6. Twist limits for late twisting double somersaults on trampoline.

    PubMed

    Yeadon, M R; Hiley, M J

    2017-06-14

    An angle-driven computer simulation model of aerial movement was used to determine the maximum amount of twist that could be produced in the second somersault of a double somersault on trampoline using asymmetrical movements of the arms and hips. Lower bounds were placed on the durations of arm and hip angle changes based on performances of a world trampoline champion whose inertia parameters were used in the simulations. The limiting movements were identified as the largest possible odd number of half twists for forward somersaulting takeoffs and even number of half twists for backward takeoffs. Simulations of these two limiting movements were found using simulated annealing optimisation to produce the required amounts of somersault, tilt and twist at landing after a flight time of 2.0s. Additional optimisations were then run to seek solutions with the arms less adducted during the twisting phase. It was found that 3½ twists could be produced in the second somersault of a forward piked double somersault with arms abducted 8° from full adduction during the twisting phase and that three twists could be produced in the second somersault of a backward straight double somersault with arms fully adducted to the body. These two movements are at the limits of performance for elite trampolinists. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Knockdown of TWIST1 enhances arsenic trioxide- and ionizing radiation-induced cell death in lung cancer cells by promoting mitochondrial dysfunction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seo, Sung-Keum; Kim, Jae-Hee; Choi, Ha-Na

    Highlights: • Knockdown of TWIST1 enhanced ATO- and IR-induced cell death in NSCLCs. • Intracellular ROS levels were increased in cells treated with TWIST1 siRNA. • TWIST1 siRNA induced MMP loss and mitochondrial fragmentation. • TWIST1 siRNA upregulated the fission-related proteins FIS1 and DRP1. - Abstract: TWIST1 is implicated in the process of epithelial mesenchymal transition, metastasis, stemness, and drug resistance in cancer cells, and therefore is a potential target for cancer therapy. In the present study, we found that knockdown of TWIST1 by small interfering RNA (siRNA) enhanced arsenic trioxide (ATO)- and ionizing radiation (IR)-induced cell death in non-small-cellmore » lung cancer cells. Interestingly, intracellular reactive oxygen species levels were increased in cells treated with TWIST1 siRNA and further increased by co-treatment with ATO or IR. Pretreatment of lung cancer cells with the antioxidant N-acetyl-cysteine markedly suppressed the cell death induced by combined treatment with TWIST1 siRNA and ATO or IR. Moreover, treatment of cells with TWIST1 siRNA induced mitochondrial membrane depolarization and significantly increased mitochondrial fragmentation (fission) and upregulated the fission-related proteins FIS1 and DRP1. Collectively, our results demonstrate that siRNA-mediated TWIST1 knockdown induces mitochondrial dysfunction and enhances IR- and ATO-induced cell death in lung cancer cells.« less

  8. TWIST1-WDR5-Hottip regulates Hoxa9 chromatin to facilitate prostate cancer metastasis

    PubMed Central

    Malek, Reem; Gajula, Rajendra P.; Williams, Russell D.; Nghiem, Belinda; Simons, Brian W.; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R.; True, Lawrence; An, Steven S.; DeWeese, Theodore L.; Ross, Ashley E.; Schaeffer, Edward M.; Pienta, Kenneth J.; Hurley, Paula J.; Morrissey, Colm; Tran, Phuoc T.

    2017-01-01

    TWIST1 is a transcription factor critical for development which can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are co-expressed in mouse prostate and then silenced post-natally. Here we report that TWIST1 and HOXA9 co-expression are re-activated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to co-enrichment of TWIST1 and WDR5 as well increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacological inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo. This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. PMID:28484075

  9. Twist1 Suppresses Senescence Programs and Thereby Accelerates and Maintains Mutant Kras-Induced Lung Tumorigenesis

    PubMed Central

    Thiyagarajan, Saravanan; Das, Sandhya T.; Zabuawala, Tahera; Chen, Joy; Cho, Yoon-Jae; Luong, Richard; Tamayo, Pablo; Salih, Tarek; Aziz, Khaled; Adam, Stacey J.; Vicent, Silvestre; Nielsen, Carsten H.; Withofs, Nadia; Sweet-Cordero, Alejandro; Gambhir, Sanjiv S.; Rudin, Charles M.; Felsher, Dean W.

    2012-01-01

    KRAS mutant lung cancers are generally refractory to chemotherapy as well targeted agents. To date, the identification of drugs to therapeutically inhibit K-RAS have been unsuccessful, suggesting that other approaches are required. We demonstrate in both a novel transgenic mutant Kras lung cancer mouse model and in human lung tumors that the inhibition of Twist1 restores a senescence program inducing the loss of a neoplastic phenotype. The Twist1 gene encodes for a transcription factor that is essential during embryogenesis. Twist1 has been suggested to play an important role during tumor progression. However, there is no in vivo evidence that Twist1 plays a role in autochthonous tumorigenesis. Through two novel transgenic mouse models, we show that Twist1 cooperates with KrasG12D to markedly accelerate lung tumorigenesis by abrogating cellular senescence programs and promoting the progression from benign adenomas to adenocarcinomas. Moreover, the suppression of Twist1 to physiological levels is sufficient to cause Kras mutant lung tumors to undergo senescence and lose their neoplastic features. Finally, we analyzed more than 500 human tumors to demonstrate that TWIST1 is frequently overexpressed in primary human lung tumors. The suppression of TWIST1 in human lung cancer cells also induced cellular senescence. Hence, TWIST1 is a critical regulator of cellular senescence programs, and the suppression of TWIST1 in human tumors may be an effective example of pro-senescence therapy. PMID:22654667

  10. Transverse kink oscillations in the presence of twist

    NASA Astrophysics Data System (ADS)

    Terradas, J.; Goossens, M.

    2012-12-01

    Context. Magnetic twist is thought to play an important role in coronal loops. The effects of magnetic twist on stable magnetohydrodynamic (MHD) waves is poorly understood because they are seldom studied for relevant cases. Aims: The goal of this work is to study the fingerprints of magnetic twist on stable transverse kink oscillations. Methods: We numerically calculated the eigenmodes of propagating and standing MHD waves for a model of a loop with magnetic twist. The azimuthal component of the magnetic field was assumed to be small in comparison to the longitudinal component. We did not consider resonantly damped modes or kink instabilities in our analysis. Results: For a nonconstant twist the frequencies of the MHD wave modes are split, which has important consequences for standing waves. This is different from the degenerated situation for equilibrium models with constant twist, which are characterised by an azimuthal component of the magnetic field that linearly increases with the radial coordinate. Conclusions: In the presence of twist standing kink solutions are characterised by a change in polarisation of the transverse displacement along the tube. For weak twist, and in the thin tube approximation, the frequency of standing modes is unaltered and the tube oscillates at the kink speed of the corresponding straight tube. The change in polarisation is linearly proportional to the degree of twist. This has implications with regard to observations of kink modes, since the detection of this variation in polarisation can be used as an indirect method to estimate the twist in oscillating loops.

  11. Modeling and control of active twist aircraft

    NASA Astrophysics Data System (ADS)

    Cramer, Nicholas Bryan

    The Wright Brothers marked the beginning of powered flight in 1903 using an active twist mechanism as their means of controlling roll. As time passed due to advances in other technologies that transformed aviation the active twist mechanism was no longer used. With the recent advances in material science and manufacturability, the possibility of the practical use of active twist technologies has emerged. In this dissertation, the advantages and disadvantages of active twist techniques are investigated through the development of an aeroelastic modeling method intended for informing the designs of such technologies and wind tunnel testing to confirm the capabilities of the active twist technologies and validate the model. Control principles for the enabling structural technologies are also proposed while the potential gains of dynamic, active twist are analyzed.

  12. Anderson transition in a multiply-twisted helix.

    PubMed

    Ugajin, R

    2001-06-01

    We investigated the Anderson transition in a multiply-twisted helix in which a helical chain of components, i.e., atoms or nanoclusters, is twisted to produce a doubly-twisted helix, which itself can be twisted to produce a triply-twisted helix, and so on, in which there are couplings between adjacent rounds of helices. As the strength of the on-site random potentials increases, an Anderson transition occurs, suggesting that the number of dimensions is 3 for electrons running along the multiply-twisted helix when the couplings between adjacent rounds are strong enough. If the couplings are weakened, the dimensionality becomes less, resulting in localization of electrons. The effect of random connections between adjacent rounds of helices and random magnetic fields that thread the structure is analyzed using the spectral statistics of a quantum particle.

  13. Association between Twist and multidrug resistance gene-associated proteins in Taxol®-resistant MCF-7 cells and a 293 cell model of Twist overexpression.

    PubMed

    Wang, Li; Tan, Rui-Zhi; Zhang, Zhi-Xia; Yin, Rui; Zhang, Yong-Liang; Cui, Wei-Jia; He, Tao

    2018-01-01

    Multidrug resistance (MDR) severely limits the effectiveness of chemotherapy. Previous studies have identified Twist as a key factor of acquired MDR in breast, gastric and prostate cancer. However, the underlying mechanisms of action of Twist in MDR remain unclear. In the present study, the expression levels of MDR-associated proteins, including lung resistance-related protein (LRP), topoisomerase IIα (TOPO IIα), MDR-associated protein (MRP) and P-glycoprotein (P-gp), and the expression of Twist in cancerous tissues and pericancerous tissues of human breast cancer, were examined. In order to simulate Taxol ® resistance in cells, a Taxol ® -resistant human mammary adenocarcinoma cell subline (MCF-7/Taxol ® ) was established by repeatedly exposing MCF-7 cells to high concentrations of Taxol ® (up to 15 µg/ml). Twist was also overexpressed in 293 cells by transfecting this cell line with pcDNA5/FRT/TO vector containing full-length hTwist cDNA to explore the dynamic association between Twist and MDR gene-associated proteins. It was identified that the expression levels of Twist, TOPO IIα, MRP and P-gp were upregulated and LRP was downregulated in human breast cancer tissues, which was consistent with the expression of these proteins in the Taxol ® -resistant MCF-7 cell model. Notably, the overexpression of Twist in 293 cells increased the resistance to Taxol ® , Trichostatin A and 5-fluorouracil, and also upregulated the expression of MRP and P-gp. Taken together, these data demonstrated that Twist may promote drug resistance in cells and cancer tissues through regulating the expression of MDR gene-associated proteins, which may assist in understanding the mechanisms of action of Twist in drug resistance.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Shyy Woei; Yang, Tsun Lirng; Liou, Jin Shuen

    An experimental study measuring the axial heat transfer distributions and the pressure drop coefficients of the tube fitted with a broken twisted tape of twist ratio 1, 1.5, 2, 2.5 or {infinity} is performed in the Re range of 1000-40,000. This type of broken twisted tape is newly invented without previous investigations available. Local Nusselt numbers and mean Fanning friction factors in the tube fitted with the broken twisted tape increase as the twist ratio decreases. Heat transfer coefficients, mean Fanning friction factors and thermal performance factors in the tube fitted with the broken twisted tape are, respectively, augmented tomore » 1.28-2.4, 2-4.7 and 0.99-1.8 times of those in the tube fitted with the smooth twisted tape. Empirical heat transfer and pressure drop correlations which evaluate the local Nusselt number and the mean Fanning friction factor for the tube with the broken twisted tape insert are generated to assist the industrial applications. (author)« less

  15. Conical twist fields and null polygonal Wilson loops

    NASA Astrophysics Data System (ADS)

    Castro-Alvaredo, Olalla A.; Doyon, Benjamin; Fioravanti, Davide

    2018-06-01

    Using an extension of the concept of twist field in QFT to space-time (external) symmetries, we study conical twist fields in two-dimensional integrable QFT. These create conical singularities of arbitrary excess angle. We show that, upon appropriate identification between the excess angle and the number of sheets, they have the same conformal dimension as branch-point twist fields commonly used to represent partition functions on Riemann surfaces, and that both fields have closely related form factors. However, we show that conical twist fields are truly different from branch-point twist fields. They generate different operator product expansions (short distance expansions) and form factor expansions (large distance expansions). In fact, we verify in free field theories, by re-summing form factors, that the conical twist fields operator product expansions are correctly reproduced. We propose that conical twist fields are the correct fields in order to understand null polygonal Wilson loops/gluon scattering amplitudes of planar maximally supersymmetric Yang-Mills theory.

  16. The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis.

    PubMed

    Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

    2011-02-01

    The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis.

  17. In Silico Measurements of Twist and Bend Moduli for β-Solenoid Protein Self-Assembly Units.

    PubMed

    Heinz, Leonard P; Ravikumar, Krishnakumar M; Cox, Daniel L

    2015-05-13

    We compute potentials of mean force for bend and twist deformations via force pulling and umbrella sampling experiments for four β-solenoid proteins (BSPs) that show promise in nanotechnology applications. In all cases, we find quasi-Hooke's law behavior until the point of rupture. Bending moduli show modest anisotropy for two-sided and three-sided BSPs, and little anisotropy for a four-sided BSP. There is a slight clockwise/counterclockwise asymmetry in the twist potential of mean force, showing greater stiffness when the applied twist follows the intrinsic twist. When we extrapolate to beam theory appropriate for amyloid fibrils of the BSPs, we find bend/twist moduli which are somewhat smaller than those in the literature for other amyloid fibrils. Twist persistence lengths are on the order of a micron, and bend persistence lengths are several microns. Provided the intrinsic twist can be reversed, these results support the usage of BSPs in biomaterials applications.

  18. Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.

    PubMed

    Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F

    2016-05-01

    Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.

  19. Analysis of lead twist in modern high-performance grinding methods

    NASA Astrophysics Data System (ADS)

    Kundrák, J.; Gyáni, K.; Felhő, C.; Markopoulos, AP; Deszpoth, I.

    2016-11-01

    According to quality requirements of road vehicles shafts, which bear dynamic seals, twisted-pattern micro-geometrical topography is not allowed. It is a question whether newer modern grinding methods - such as quick-point grinding and peel grinding - could provide twist- free topography. According to industrial experience, twist-free surfaces can be made, however with certain settings, same twist occurs. In this paper it is proved by detailed chip-geometrical analysis that the topography generated by the new procedures is theoretically twist-patterned because of the feeding motion of the CBN tool. The presented investigation was carried out by a single-grain wheel model and computer simulation.

  20. Highly sensitive torsion sensor based on long period fiber grating fabricated by femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Dong, Xinran; Xie, Zheng; Song, Yuxin; Yin, Kai; Luo, Zhi; Duan, Ji'an; Wang, Cong

    2017-12-01

    A highly sensitive torsion sensor based on long period fiber grating (LPFG) fabricated by 800 nm femtosecond laser pulses is proposed and demonstrated. LPFG with an attenuation depth of ∼14 dB is achieved within the wavelength range of 1425-1575 nm. The experiment results show that the LP02 and LP03 resonant wavelengths experience red-shift when the twist direction is clockwise while they occur blue-shift in the twist counterclockwise direction as the twist rate increases. However, the LP04 resonant wavelength is always shifted toward shorter wavelength independently of the twist directions and higher twist sensitivity is observed. In addition, the loss peak amplitude of LPFG shows a tendency to decrease with the twist rate increases whether the LPFG is twisted clockwise or counterclockwise. Meanwhile, the resonant wavelength occurs splitting phenomenon in the case of higher twist rate as well as the high order resonant wavelength performs more significantly. Additionally, the sensor shows a twist sensitivity as high as 118.7 pm/(rad/m) in the range of -105 to -52.5 rad/m and that of 181.7 pm/(rad/m) in the range of 52.5-105 rad/m.

  1. Experimental Analysis of the Thermo-Hydraulic Performance on a Cylindrical Parabolic Concentrating Solar Water Heater with Twisted Tape Inserts in an Absorber Tube

    NASA Astrophysics Data System (ADS)

    Kumar, Birendra; Nayak, Rajen Kumar; Singh, S. N.

    2018-05-01

    A twisted tape inserted in an absorber tube may be an excellent option to enhance the performance of a cylindrical parabolic concentrating solar collector (CPC). The present work is an experimental study of the flow and heat transfer with and without twisted tape inserts in the absorber tube of a CPC. Results are presented for mass flow rates of water, ṁ=0.0198-0.0525 kg/s, twist ratio, y=5-10 and Reynolds number, Re=2577.46-6785.55. In the present study, we found that the outlet water temperature, collector efficiency and Nusselt number (Nu) are higher in the twisted tapes as compared to those without the twisted tape inserts in the absorber tube of the CPC. For fixed mass flow rate of water ṁ, the To and η increased with the decrease in twist ratio, y, and is higher in lower twist ratio, y=5, of the twisted tapes. The whole experiment was performed at the Indian Institute of Technology (ISM) in Dhanbad, India during the months of March-April 2017. Based on the experimental data, the correlations for the Nu and friction factor were also developed.

  2. Electronic and Optical Properties of Twisted Bilayer Graphene

    NASA Astrophysics Data System (ADS)

    Huang, Shengqiang

    The ability to isolate single atomic layers of van der Waals materials has led to renewed interest in the electronic and optical properties of these materials as they can be fundamentally different at the monolayer limit. Moreover, these 2D crystals can be assembled together layer by layer, with controllable sequence and orientation, to form artificial materials that exhibit new features that are not found in monolayers nor bulk. Twisted bilayer graphene is one such prototype system formed by two monolayer graphene layers placed on top of each other with a twist angle between their lattices, whose electronic band structure depends on the twist angle. This thesis presents the efforts to explore the electronic and optical properties of twisted bilayer graphene by Raman spectroscopy and scanning tunneling microscopy measurements. We first synthesize twisted bilayer graphene with various twist angles via chemical vapor deposition. Using a combination of scanning tunneling microscopy and Raman spectroscopy, the twist angles are determined. The strength of the Raman G peak is sensitive to the electronic band structure of twisted bilayer graphene and therefore we use this peak to monitor changes upon doping. Our results demonstrate the ability to modify the electronic and optical properties of twisted bilayer graphene with doping. We also fabricate twisted bilayer graphene by controllable stacking of two graphene monolayers with a dry transfer technique. For twist angles smaller than one degree, many body interactions play an important role. It requires eight electrons per moire unit cell to fill up each band instead of four electrons in the case of a larger twist angle. For twist angles smaller than 0.4 degree, a network of domain walls separating AB and BA stacking regions forms, which are predicted to host topologically protected helical states. Using scanning tunneling microscopy and spectroscopy, these states are confirmed to appear on the domain walls when inversion symmetry is broken with an external electric field. We observe a double-line profile of these states on the domain walls, only occurring when the AB and BA regions are gaped. These states give rise to channels that could transport charge in a dissipationless manner making twisted bilayer graphene a promising platform to realize controllable topological networks for future applications.

  3. Loss of Twist1 in the Mesenchymal Compartment Promotes Increased Fibrosis in Experimental Lung Injury by Enhanced Expression of CXCL12

    PubMed Central

    Tan, Jiangning; Tedrow, John R.; Nouraie, Mehdi; Dutta, Justin A.; Miller, David T.; Li, Xiaoyun; Yu, Shibing; Chu, Yanxia; Juan-Guardela, Brenda; Kaminski, Naftali; Ramani, Kritika; Biswas, Partha S.; Zhang, Yingze

    2017-01-01

    Idiopathic pulmonary fibrosis (IPF) is a disease characterized by the accumulation of apoptosis-resistant fibroblasts in the lung. We have previously shown that high expression of the transcription factor Twist1 may explain this prosurvival phenotype in vitro. However, this observation has never been tested in vivo. We found that loss of Twist1 in COL1A2+ cells led to increased fibrosis characterized by very significant accumulation of T cells and bone marrow–derived matrix-producing cells. We found that Twist1-null cells expressed high levels of the T cell chemoattractant CXCL12. In vitro, we found that the loss of Twist1 in IPF lung fibroblasts increased expression of CXCL12 downstream of increased expression of the noncanonical NF-κB transcription factor RelB. Finally, blockade of CXCL12 with AMD3100 attenuated the exaggerated fibrosis observed in Twist1-null mice. Transcriptomic analysis of 134 IPF patients revealed that low expression of Twist1 was characterized by enrichment of T cell pathways. In conclusion, loss of Twist1 in collagen-producing cells led to increased bleomycin-induced pulmonary fibrosis, which is mediated by increased expression of CXCL12. Twist1 expression is associated with dysregulation of T cells in IPF patients. Twist1 may shape the IPF phenotype and regulate inflammation in fibrotic lung injury. PMID:28179498

  4. Tight Placement of Erich Arch Bar While Avoiding Wire Fatigue Failure.

    PubMed

    Kirk, Daniel; Whitney, Joseph; Shafer, David; Song, Liansheng

    2016-03-01

    To determine the number of wire twists needed to acquire ideal Erich arch bar tightness before wire fatigue failure (fracture) in relation to different distances and angles at which different gauge wires are grasped to provide information to improve the efficiency of arch bar application. This study mimicked surgical placement of arch bars with 24- and 26-gauge wires. The number of twists to tightness and failure was evaluated when the wire distance between the arch bar and wire holder tip changed (5 vs 10 mm) and when the degree at which the wire was held relative to the tooth axis was changed (45° vs 90°). A wire shearing test also was used to investigate the fatigability of wires tightened under these same conditions. Wires twisted to tightness, past tightness, and after shearing test movements were visualized with electron microscopy. For 24-gauge wire held at 5 mm, 2.6 to 2.8 twists were needed for wire tightness, with failure after 1.7 to 1.9 twists past tightness; for 24-gauge wire held at 10 mm, 4.4 to 4.9 twists produced tightness, with failure after 2.3 to 2.9 twists past tightness. For 26-gauge wire held at 5 mm, 3.3 to 3.5 twists provided tightness, with 1.6 to 1.8 twists past tightness causing failure; for 26-gauge wire held at 10 mm, 5.1 to 5.5 twists produced tightness, with 3.1 to 3.7 twists past tightness causing failure. At a 45° angle, the wire tightened with fewer twists and showed more resistance to failure with twists past tightness compared with 90° using 24- and 26-gauge wires. In contrast, 24-gauge wire held at a 5-mm distance showed the opposite result, with decreased resistance to failure at the 45° angle. However, the differences were not statistically meaningful. Scanning election microscopy showed no wire fatigue for either angle for 26-gauge wire held at a 5-mm distance and twisted to tightness. After overtightening and oscillation, the 90° angle trials showed fatigue, whereas the 45° angle trials did not. Holding a 24-gauge wire at 45° to the tooth axis is recommended owing to fewer twists to tightness and more resistance to failure. A 5-mm grasping distance is recommended for experienced surgeons owing to fewer twists to tightness, whereas a 10-mm grasping distance is recommended for novice surgeons owing to a greater tolerance for over-twisting before failure. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  5. TWIST1-WDR5-Hottip Regulates Hoxa9 Chromatin to Facilitate Prostate Cancer Metastasis.

    PubMed

    Malek, Reem; Gajula, Rajendra P; Williams, Russell D; Nghiem, Belinda; Simons, Brian W; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R; True, Lawrence; An, Steven S; DeWeese, Theodore L; Ross, Ashley E; Schaeffer, Edward M; Pienta, Kenneth J; Hurley, Paula J; Morrissey, Colm; Tran, Phuoc T

    2017-06-15

    TWIST1 is a transcription factor critical for development that can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are coexpressed in mouse prostate and then silenced postnatally. Here we report that TWIST1 and HOXA9 coexpression are reactivated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to coenrichment of TWIST1 and WDR5 as well as increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter, which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacologic inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. Cancer Res; 77(12); 3181-93. ©2017 AACR . ©2017 American Association for Cancer Research.

  6. Nano Sensors for Gas Detection in Space and Ground Support Applications

    NASA Technical Reports Server (NTRS)

    Medelius, Pedro J.

    2006-01-01

    Personnel living in a space environment as well as technicians and engineers preparing spacecraft for launch can potentially be exposed to small amounts of hazardous gases. It is therefore important to be able to detect, identify and quantify the presence of a gas especially when its presence could lead to a fatal situation. The use of small and sensitive sensors can allow for the placement of these devices over a large area, thus allowing for a more precise and timely determination of a gas leak. ASRC Aerospace and its research partners are developing nano sensors for detection of various gases, including but not limited to: H2, NH3, N2O4, hydrazine and others. Initial laboratory testing has demonstrated the capability to detect the gases in concentrations lower than parts per million. Testing and development is continuing to improve the response and recovery times, to increase the sensitivity of the devices. Different coatings and electrodes are currently being evaluated to determine the optimum configuration of a variety of gases. The small footprint of the Nano sensors allows for several devices, each responsive in a different way to different gases, to be placed into a single substrate. Multiple devices embedded into a single substrate results in increased reliability and in a decrease for periodic calibrations. The use of different coatings will result in a small electronic nose capable of distinguishing between different gases. A multi-channel signal conditioner amplifier built on a small multi chip module is used to process the output of the sensors and to deliver a signal that can be remotely monitored. All the data is digitized and transmitted over the same cable pair used to power the amplifier. Multiple outputs can be connected to a single cable pair in order to minimize the added weight and expense associated with cabling in a spacecraft. The sensors will be run through a qualification process to evaluate their suitability for space applications we are expecting to have fully functional sensors available for initial field deployment and testing by the end of the year 2006.

  7. Define the Twist ATX LPAR1 Signaling Axis in Promoting Obesity Associated Triple Negative Breast Cancer

    DTIC Science & Technology

    2017-05-01

    developed CRISPR technology to examine if Twist enhances ATX and LPAR1 expression. Specifically, we performed lentiviral transduction of Twist...targeting gRNA into breast cancer cells MDA-MB-578 and SUM-1315, and selected single cell colony with Twist knockout. We chose CRISPR -gRNA over the...shRNA system which was originally proposed, as CRISPR provides higher specificity and fewer off-target effects. To verify knockout of Twist, we first

  8. Highly sensitive twist sensor based on tilted fiber Bragg grating of polarization-dependent properties

    NASA Astrophysics Data System (ADS)

    Lu, Yanfang; Shen, Changyu; Chen, Debao; Chu, Jinlei; Wang, Qiang; Dong, Xinyong

    2014-10-01

    The transmission intensity of the tilted fiber Bragg grating (TFBG) is strongly dependent on the polarization properties of the TFBG. The polarization characteristic of the cladding modes can be used for twist measuring. In this paper, a highly sensitive fiber twist sensor is proposed. The transmission intensity on the strong loss wavelength showed a quasi-sin θ changing with the twist angle ranging from 0° to 180° for S- or P-polarized input. A high sensitivity of 0.299 dB/° is achieved, which is almost 17.9 times higher than that of the current similar existing twist sensor. The twist angle can be measured precisely with the matrix.

  9. Au-coated tilted fiber Bragg grating twist sensor based on surface plasmon resonance

    NASA Astrophysics Data System (ADS)

    Shen, Changyu; Zhang, Yang; Zhou, Wenjun; Albert, Jacques

    2014-02-01

    A fiber twist sensor based on the surface plasmon resonance (SPR) effect of an Au-coated tilted fiber Bragg grating (TFBG) is proposed. The SPR response to the twist effect on an Au-coated TFBG (immersing in distilled water) is studied theoretically and experimentally. The results show that the transmission power around the wavelength of SPR changes with the twist angle. For the twist ranging from 0° to 180° in clockwise or anti-clockwise directions, the proposed sensor shows sensitivities of 0.037 dBm/° (S-polarized) and 0.039 dBm/° (P-polarized), which are almost 7.5 times higher than that of the current similar existing twist sensor.

  10. The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis

    PubMed Central

    Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

    2011-01-01

    The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis. PMID:20714342

  11. The Effect of a Twisted Magnetic Field on the Phase Mixing of the Kink Magnetohydrodynamic Waves in Coronal Loops

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ebrahimi, Zanyar; Karami, Kayoomars; Soler, Roberto, E-mail: z.ebrahimi@uok.ac.ir

    There is observational evidence for the existence of a twisted magnetic field in the solar corona. This inspires us to investigate the effect of a twisted magnetic field on the evolution of magnetohydrodynamic (MHD) kink waves in coronal loops. With this aim, we solve the incompressible linearized MHD equations in a magnetically twisted nonuniform coronal flux tube in the limit of long wavelengths. Our results show that a twisted magnetic field can enhance or diminish the rate of phase mixing of the Alfvén continuum modes and the decay rate of the global kink oscillation depending on the twist model andmore » the sign of the longitudinal ( k{sub z} ) and azimuthal ( m ) wavenumbers. Also, our results confirm that in the presence of a twisted magnetic field, when the sign of one of the two wavenumbers m and k {sub z} is changed, the symmetry with respect to the propagation direction is broken. Even a small amount of twist can have an important impact on the process of energy cascading to small scales.« less

  12. Heat Transfer Enhancement of Laminar Nanofluids Flow in a Circular Tube Fitted with Parabolic-Cut Twisted Tape Inserts

    PubMed Central

    Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

    2014-01-01

    Numerical investigation has been carried out on heat transfer and friction factor characteristics of copper-water nanofluid flow in a constant heat-fluxed tube with the existence of new configuration of vortex generator using Computational Fluid Dynamics (CFD) simulation. Two types of swirl flow generator: Classical twisted tape (CTT) and Parabolic-cut twisted tape (PCT) with a different twist ratio (y = 2.93, 3.91 and 4.89) and different cut depth (w = 0.5, 1.0 and 1.5 cm) with 2% and 4% volume concentration of CuO nanofluid were used for simulation. The effect of different parameters such as flow Reynolds number, twist ratio, cut depth and nanofluid were considered. The results show that the enhancement of heat transfer rate and the friction factor induced by the Classical (CTT) and Parabolic-cut (PCT) inserts increases with twist ratio and cut depth decreases. The results also revealed that the heat transfer enhancement increases with an increase in the volume fraction of the CuO nanoparticle. Furthermore, the twisted tape with twist ratio (y = 2.93) and cut depth w = 0.5 cm offered 10% enhancement of the average Nusselt number with significant increases in friction factor than those of Classical twisted tape. PMID:24605055

  13. Insulin-like growth factor-I induces CLU expression through Twist1 to promote prostate cancer growth.

    PubMed

    Takeuchi, Ario; Shiota, Masaki; Beraldi, Eliana; Thaper, Daksh; Takahara, Kiyoshi; Ibuki, Naokazu; Pollak, Michael; Cox, Michael E; Naito, Seiji; Gleave, Martin E; Zoubeidi, Amina

    2014-03-25

    Clusterin (CLU) is cytoprotective molecular chaperone that is highly expressed in castrate-resistant prostate cancer (CRPC). CRPC is also characterized by increased insulin-like growth factor (IGF)-I responsiveness which induces prostate cancer survival and CLU expression. However, how IGF-I induces CLU expression and whether CLU is required for IGF-mediated growth signaling remain unknown. Here we show that IGF-I induced CLU via STAT3-Twist1 signaling pathway. In response to IGF-I, STAT3 was phosphorylated, translocated to the nucleus and bound to the Twist1 promoter to activate Twist1 transcription. In turn, Twist1 bound to E-boxes on the CLU promoter and activated CLU transcription. Inversely, we demonstrated that knocking down Twist1 abrogated IGF-I induced CLU expression, indicating that Twist1 mediated IGF-I-induced CLU expression. When PTEN knockout mice were crossed with lit/lit mice, the resultant IGF-I deficiency suppressed Twist1 as well as CLU gene expression in mouse prostate glands. Moreover, both Twist1 and CLU knockdown suppressed prostate cancer growth accelerated by IGF-I, suggesting the relevance of this signaling not only in an in vitro, but also in an in vivo. Collectively, this study indicates that IGF-I induces CLU expression through sequential activation of STAT3 and Twist1, and suggests that this signaling cascade plays a critical role in prostate cancer pathogenesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  14. Twist number and order properties of periodic orbits

    NASA Astrophysics Data System (ADS)

    Petrisor, Emilia

    2013-11-01

    A less studied numerical characteristic of periodic orbits of area preserving twist maps of the annulus is the twist or torsion number, called initially the amount of rotation Mather (1984) [2]. It measures the average rotation of tangent vectors under the action of the derivative of the map along that orbit, and characterizes the degree of complexity of the dynamics. The aim of this paper is to give new insights into the definition and properties of the twist number and to relate its range to the order properties of periodic orbits. We derive an algorithm to deduce the exact value or a demi-unit interval containing the exact value of the twist number. We prove that at a period-doubling bifurcation threshold of a mini-maximizing periodic orbit, the new born doubly periodic orbit has the absolute twist number larger than the absolute twist of the original orbit after bifurcation. We give examples of periodic orbits having large absolute twist number, that are badly ordered, and illustrate how characterization of these orbits only by their residue can lead to incorrect results. In connection to the study of the twist number of periodic orbits of standard-like maps we introduce a new tool, called 1-cone function. We prove that the location of minima of this function with respect to the vertical symmetry lines of a standard-like map encodes a valuable information on the symmetric periodic orbits and their twist number.

  15. How is the relationship between TWIST-1 and BCR-ABL1 gene expressions in chronic myeloid leukaemia patients?

    PubMed

    Heidari, Nazanin; Vosoughi, Tina; Mohammadi Asl, Javad; Saki Malehi, Amal; Saki, Najmaldin

    2018-01-12

    The activation and increased expression of BCR-ABL1 lead to malignant chronic myelogenous leukaemia (CML) cells, as well as the resistance to antitumour agents and apoptosis inducers. Moreover, TWIST-1 protein is a prognostic factor of leukemogenesis, and its level is raised in CML patients with cytogenetic resistance to imatinib. So, there is a likely relationship between BCR-ABL1 and TWIST-1 genes. The aim of the study was to assess the relationship between TWIST-1 and BCR-ABL1 expressions. Peripheral blood samples were obtained from 44 CML patients under treatment and also from ten healthy subjects as normal controls. The expression of TWIST-1 and BCR-ABL1 genes was measured using real-time PCR, and ABL1 was used as the reference gene. The gene expression was evaluated by REST software. The expression levels of TWIST-1 and BCR-ABL1 genes in CML patients was changed 40.23 ± 177.75-fold and 6 ± 18-fold, respectively. No significant relationship was observed between the expressions of TWIST-1 and BCR-ABL1 genes. All patients with TWIST-1 expression levels ≥100-fold had failure of response to treatment. The probability of the relationship between BCR-ABL1 and TWIST-1 is still debatable, and the average of TWIST-1 expression has been higher in patients without response to treatment. Definitive conclusion needs further investigations.

  16. Optimal flapping wing for maximum vertical aerodynamic force in hover: twisted or flat?

    PubMed

    Phan, Hoang Vu; Truong, Quang Tri; Au, Thi Kim Loan; Park, Hoon Cheol

    2016-07-08

    This work presents a parametric study, using the unsteady blade element theory, to investigate the role of twist in a hovering flapping wing. For the investigation, a flapping-wing system was developed to create a wing motion of large flapping amplitude. Three-dimensional kinematics of a passively twisted wing, which is capable of creating a linearly variable geometric angle of attack (AoA) along the wingspan, was measured during the flapping motion and used for the analysis. Several negative twist or wash-out configurations with different values of twist angle, which is defined as the difference in the average geometric AoAs at the wing root and the wing tip, were obtained from the measured wing kinematics through linear interpolation and extrapolation. The aerodynamic force generation and aerodynamic power consumption of these twisted wings were obtained and compared with those of flat wings. For the same aerodynamic power consumption, the vertical aerodynamic forces produced by the negatively twisted wings are approximately 10%-20% less than those produced by the flat wings. However, these twisted wings require approximately 1%-6% more power than flat wings to produce the same vertical force. In addition, the maximum-force-producing twisted wing, which was found to be the positive twist or wash-in configuration, was used for comparison with the maximum-force-producing flat wing. The results revealed that the vertical aerodynamic force and aerodynamic power consumption of the two types of wings are almost identical for the hovering condition. The power loading of the positively twisted wing is only approximately 2% higher than that of the maximum-force-producing flat wing. Thus, the flat wing with proper wing kinematics (or wing rotation) can be regarded as a simple and efficient candidate for the development of hovering flapping-wing micro air vehicle.

  17. Epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia modulates proliferation, cell survival and chemosensitivity

    PubMed Central

    Thathia, Shabnam H.; Ferguson, Stuart; Gautrey, Hannah E.; van Otterdijk, Sanne D.; Hili, Michela; Rand, Vikki; Moorman, Anthony V.; Meyer, Stefan; Brown, Robert; Strathdee, Gordon

    2012-01-01

    Background Altered regulation of many transcription factors has been shown to be important in the development of leukemia. TWIST2 modulates the activity of a number of important transcription factors and is known to be a regulator of hematopoietic differentiation. Here, we investigated the significance of epigenetic regulation of TWIST2 in the control of cell growth and survival and in response to cytotoxic agents in acute lymphoblastic leukemia. Design and Methods TWIST2 promoter methylation status was assessed quantitatively, by combined bisulfite and restriction analysis (COBRA) and pyrosequencing assays, in multiple types of leukemia and TWIST2 expression was determined by quantitative reverse transcriptase polymerase chain reaction analysis. The functional role of TWIST2 in cell proliferation, survival and response to chemotherapy was assessed in transient and stable expression systems. Results We found that TWIST2 was inactivated in more than 50% of cases of childhood and adult acute lymphoblastic leukemia through promoter hypermethylation and that this epigenetic regulation was especially prevalent in RUNX1-ETV6-driven cases. Re-expression of TWIST2 in cell lines resulted in a dramatic reduction in cell growth and induction of apoptosis in the Reh cell line. Furthermore, re-expression of TWIST2 resulted in increased sensitivity to the chemotherapeutic agents etoposide, daunorubicin and dexamethasone and TWIST2 hypermethylation was almost invariably found in relapsed adult acute lymphoblastic leukemia (91% of samples hypermethylated). Conclusions This study suggests a dual role for epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia, initially through altering cell growth and survival properties and subsequently by increasing resistance to chemotherapy. PMID:22058208

  18. The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise

    PubMed Central

    Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J.

    2016-01-01

    Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, V˙O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32–69% of V˙O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results. PMID:27100099

  19. The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise.

    PubMed

    Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J

    2016-01-01

    Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, [Formula: see text]O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32-69% of [Formula: see text]O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results.

  20. Tyrosine kinase receptor c-ros-oncogene 1 inhibition alleviates aberrant bone formation of TWIST-1 haploinsufficient calvarial cells from Saethre-Chotzen syndrome patients.

    PubMed

    Camp, Esther; Anderson, Peter J; Zannettino, Andrew C W; Glackin, Carlotta A; Gronthos, Stan

    2018-09-01

    Saethre-Chotzen syndrome (SCS), associated with TWIST-1 mutations, is characterized by premature fusion of cranial sutures. TWIST-1 haploinsufficiency, leads to alterations in suture mesenchyme cellular gene expression patterns, resulting in aberrant osteogenesis and craniosynostosis. We analyzed the expression of the TWIST-1 target, Tyrosine kinase receptor c-ros-oncogene 1 (C-ROS-1) in TWIST-1 haploinsufficient calvarial cells derived from SCS patients and calvaria of Twist-1 del/+ mutant mice and found it to be highly expressed when compared to TWIST-1 wild-type controls. Knock-down of C-ROS-1 expression in TWIST-1 haploinsufficient calvarial cells derived from SCS patients was associated with decreased capacity for osteogenic differentiation in vitro. Furthermore, treatment of human SCS calvarial cells with the tyrosine kinase chemical inhibitor, Crizotinib, resulted in reduced C-ROS-1 activity and the osteogenic potential of human SCS calvarial cells with minor effects on cell viability or proliferation. Cultured human SCS calvarial cells treated with Crizotinib exhibited a dose-dependent decrease in alkaline phosphatase activity and mineral deposition, with an associated decrease in expression levels of Runt-related transcription factor 2 and OSTEOPONTIN, with reduced PI3K/Akt signalling in vitro. Furthermore, Crizotinib treatment resulted in reduced BMP-2 mediated bone formation potential of whole Twist-1 del/+ mutant mouse calvaria organotypic cultures. Collectively, these results suggest that C-ROS-1 promotes osteogenic differentiation of TWIST-1 haploinsufficient calvarial osteogenic progenitor cells. Furthermore, the aberrant osteogenic potential of these cells is inhibited by the reduction of C-ROS-1. Therefore, targeting C-ROS-1 with a pharmacological agent, such as Crizotinib, may serve as a novel therapeutic strategy to alleviate craniosynostosis associated with aberrant TWIST-1 function. © 2018 Wiley Periodicals, Inc.

  1. On structural transitions, thermodynamic equilibrium, and the phase diagram of DNA and RNA duplexes under torque and tension.

    PubMed

    Wereszczynski, Jeff; Andricioaei, Ioan

    2006-10-31

    A precise understanding of the flexibility of double stranded nucleic acids and the nature of their deformed conformations induced by external forces is important for a wide range of biological processes including transcriptional regulation, supercoil and catenane removal, and site-specific recombination. We present, at atomic resolution, a simulation of the dynamics involved in the transitions from B-DNA and A-RNA to Pauling (P) forms and to denatured states driven by application of external torque and tension. We then calculate the free energy profile along a B- to P-transition coordinate and from it, compute a reversible pathway, i.e., an isotherm of tension and torque pairs required to maintain P-DNA in equilibrium. The reversible isotherm maps correctly onto a phase diagram derived from single molecule experiments, and yields values of elongation, twist, and twist-stretch coupling in agreement with measured values. We also show that configurational entropy compensates significantly for the large electrostatic energy increase due to closer-packed P backbones. A similar set of simulations applied to RNA are used to predict a novel structure, P-RNA, with its associated free energy, equilibrium tension, torque and structural parameters, and to assign the location, on the phase-diagram, of a putative force-torque-dependent RNA "triple point."

  2. Chirality of Single-Handed Twisted Titania Tubular Nanoribbons Prepared Through Sol-gel Transcription.

    PubMed

    Wang, Sibing; Zhang, Chuanyong; Li, Yi; Li, Baozong; Yang, Yonggang

    2015-08-01

    Single-handed twisted titania tubular nanoribbons were prepared through sol-gel transcription using a pair of enantiomers. Handedness was controlled by that of the template. The obtained samples were characterized using field-emission electron microscopy, transmission electron microscopy, diffuse reflectance circular dichroism (DRCD), and X-ray diffraction. The DRCD spectra indicated that the titania nanotubes exhibit optical activity. Although the tubular structure was destroyed after being calcined at 700 °C for 2.0 h, DRCD signals were still identified. However, the DRCD signals disappeared after being calcined at 1000 °C for 2.0 h. The optical activity of titania was proposed to be due to chiral defects. Previous results showed that straight titania tubes could be used as asymmetric autocatalysts, indicating that titania exhibit chirality at the angstrom level. Herein, it was found that they also exhibit DRCD signals, indicating that there are no obvious relationships between morphology at the nano level and chirality at the angstrom level. The nanotube chirality should originate from the chiral defects on the nanotube inner surface. The Fourier transform infrared spectra indicated that the chirality of the titania was transferred from the gelators through the hydrogen bonding between N-H and Ti-OH. © 2015 Wiley Periodicals, Inc.

  3. Predicting conformational ensembles and genome-wide transcription factor binding sites from DNA sequences.

    PubMed

    Andrabi, Munazah; Hutchins, Andrew Paul; Miranda-Saavedra, Diego; Kono, Hidetoshi; Nussinov, Ruth; Mizuguchi, Kenji; Ahmad, Shandar

    2017-06-22

    DNA shape is emerging as an important determinant of transcription factor binding beyond just the DNA sequence. The only tool for large scale DNA shape estimates, DNAshape was derived from Monte-Carlo simulations and predicts four broad and static DNA shape features, Propeller twist, Helical twist, Minor groove width and Roll. The contributions of other shape features e.g. Shift, Slide and Opening cannot be evaluated using DNAshape. Here, we report a novel method DynaSeq, which predicts molecular dynamics-derived ensembles of a more exhaustive set of DNA shape features. We compared the DNAshape and DynaSeq predictions for the common features and applied both to predict the genome-wide binding sites of 1312 TFs available from protein interaction quantification (PIQ) data. The results indicate a good agreement between the two methods for the common shape features and point to advantages in using DynaSeq. Predictive models employing ensembles from individual conformational parameters revealed that base-pair opening - known to be important in strand separation - was the best predictor of transcription factor-binding sites (TFBS) followed by features employed by DNAshape. Of note, TFBS could be predicted not only from the features at the target motif sites, but also from those as far as 200 nucleotides away from the motif.

  4. The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

    PubMed Central

    Mooers, Blaine H.M.; Singh, Amritanshu

    2011-01-01

    Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

  5. Twist-induced tuning in tapered fiber couplers.

    PubMed

    Birks, T A

    1989-10-01

    The power-splitting ratio of fused tapered single-mode fiber couplers can be reversibly tuned by axial twisting without affecting loss. The twist-tuning behavior of a range of different tapered couplers is described. A simple expression for twist-tuning can be derived by representing the effects of twist by a change in the refractive index profile. Good agreement between this expression and experimental results is demonstrated. Repeated tuning over tens of thousands of cycles is found not to degrade coupler performance, and a number of practical applications, including a freely tunable tapered coupler, are described.

  6. 30 CFR 77.605 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Breaking trailing cable and power cable... OF UNDERGROUND COAL MINES Trailing Cables § 77.605 Breaking trailing cable and power cable connections. Trailing cable and power cable connections between cables and to power sources shall not be made...

  7. 30 CFR 77.605 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Breaking trailing cable and power cable... OF UNDERGROUND COAL MINES Trailing Cables § 77.605 Breaking trailing cable and power cable connections. Trailing cable and power cable connections between cables and to power sources shall not be made...

  8. 30 CFR 77.605 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Breaking trailing cable and power cable... OF UNDERGROUND COAL MINES Trailing Cables § 77.605 Breaking trailing cable and power cable connections. Trailing cable and power cable connections between cables and to power sources shall not be made...

  9. 30 CFR 77.605 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Breaking trailing cable and power cable... OF UNDERGROUND COAL MINES Trailing Cables § 77.605 Breaking trailing cable and power cable connections. Trailing cable and power cable connections between cables and to power sources shall not be made...

  10. 30 CFR 77.605 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Breaking trailing cable and power cable... OF UNDERGROUND COAL MINES Trailing Cables § 77.605 Breaking trailing cable and power cable connections. Trailing cable and power cable connections between cables and to power sources shall not be made...

  11. Effect of Magnetic Twist on Nonlinear Transverse Kink Oscillations of Line-tied Magnetic Flux Tubes

    NASA Astrophysics Data System (ADS)

    Terradas, J.; Magyar, N.; Van Doorsselaere, T.

    2018-01-01

    Magnetic twist is thought to play an important role in many structures of the solar atmosphere. One of the effects of twist is to modify the properties of the eigenmodes of magnetic tubes. In the linear regime standing kink solutions are characterized by a change in polarization of the transverse displacement along the twisted tube. In the nonlinear regime, magnetic twist affects the development of shear instabilities that appear at the tube boundary when it is oscillating laterally. These Kelvin–Helmholtz instabilities (KHI) are produced either by the jump in the azimuthal component of the velocity at the edge of the sharp boundary between the internal and external part of the tube or by the continuous small length scales produced by phase mixing when there is a smooth inhomogeneous layer. In this work the effect of twist is consistently investigated by solving the time-dependent problem including the process of energy transfer to the inhomogeneous layer. It is found that twist always delays the appearance of the shear instability, but for tubes with thin inhomogeneous layers the effect is relatively small for moderate values of twist. On the contrary, for tubes with thick layers, the effect of twist is much stronger. This can have some important implications regarding observations of transverse kink modes and the KHI itself.

  12. Sox5 induces epithelial to mesenchymal transition by transactivation of Twist1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pei, Xin-Hong; Department of Pathology, The Basic Medical College of Zhengzhou University, Zhengzhou, Henan; Lv, Xin-Quan

    2014-03-28

    Highlights: • Depletion of Sox5 inhibits breast cancer proliferation, migration, and invasion. • Sox5 transactivates Twist1 expression. • Sox5 induces epithelial to mesenchymal transition through transactivation of Twist1 expression. - Abstract: The epithelial to mesenchymal transition (EMT), a highly conserved cellular program, plays an important role in normal embryogenesis and cancer metastasis. Twist1, a master regulator of embryonic morphogenesis, is overexpressed in breast cancer and contributes to metastasis by promoting EMT. In exploring the mechanism underlying the increased Twist1 in breast cancer cells, we found that the transcription factor SRY (sex-determining region Y)-box 5(Sox5) is up-regulation in breast cancer cellsmore » and depletion of Sox5 inhibits breast cancer cell proliferation, migration, and invasion. Furthermore, depletion of Sox5 in breast cancer cells caused a dramatic decrease in Twist1 and chromosome immunoprecipitation assay showed that Sox5 can bind directly to the Twist1 promoter, suggesting that Sox5 transactivates Twist1 expression. We further demonstrated that knockdown of Sox5 up-regulated epithelial phenotype cell biomarker (E-cadherin) and down-regulated mesenchymal phenotype cell biomarkers (N-cadherin, Vimentin, and Fibronectin 1), resulting in suppression of EMT. Our study suggests that Sox5 transactivates Twist1 expression and plays an important role in the regulation of breast cancer progression.« less

  13. Drive system for the retraction/extension of variable diameter rotor systems

    NASA Technical Reports Server (NTRS)

    Gmirya, Yuriy (Inventor)

    2003-01-01

    A drive system for a variable diameter rotor (VDR) system includes a plurality of rotor blade assemblies with inner and outer rotor blade segments. The outer blade segment being telescopically mounted to the inner blade segment. The VDR retraction/extension system includes a drive housing mounted at the root of each blade. The housing supports a spool assembly, a harmonic gear set and an electric motor. The spool assembly includes a pair of counter rotating spools each of which drive a respective cable which extends through the interior of the inboard rotor blade section and around a pulley mounted to the outboard rotor blade section. In operation, the electric motor drives the harmonic gear set which rotates the counter rotating spools. Rotation of the spools causes the cables to be wound onto or off their respective spool consequently effecting retraction/extension of the pulley and the attached outboard rotor blade section relative the inboard rotor blade section. As each blade drive system is independently driven by a separate electrical motor, each independent VDR blade assembly is independently positionable.

  14. Twist Model Development and Results from the Active Aeroelastic Wing F/A-18 Aircraft

    NASA Technical Reports Server (NTRS)

    Lizotte, Andrew M.; Allen, Michael J.

    2007-01-01

    Understanding the wing twist of the active aeroelastic wing (AAW) F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption. This technique produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

  15. Twist Model Development and Results From the Active Aeroelastic Wing F/A-18 Aircraft

    NASA Technical Reports Server (NTRS)

    Lizotte, Andrew; Allen, Michael J.

    2005-01-01

    Understanding the wing twist of the active aeroelastic wing F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption and by using neural networks. These techniques produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

  16. Coexistence of twisted and untwisted crystals: An impurity/structural order model with implications for agate patterns

    USGS Publications Warehouse

    Comer, J.; Ortoleva, P.

    2007-01-01

    Coexistence of twisted and untwisted crystals is explained via a model that accounts for the coupling of the entropic and energetic effects of impurities and a supra-lattice-scale structural order parameter. It is shown that twisted impure crystals can be in equilibrium with untwisted purer ones. The model explains how coexistence can occur in agates and other systems under hydrostatic stress. The model implies that untwisted crystals grown under one set of conditions could undergo a phase separation that, when accompanied by an imposed compositional gradient, leads to commonly observed, alternating bands of twisted and untwisted crystals and, when occurring in the absence of an external gradient, mossy patterns of crystal texture can emerge. This phenomenon is not related to anisotropic applied stress. Rather coexistence is a consequence of a compositional segregation/twist phase transition. Since twist coexistence is a compositional equilibrium, it arises from the exchange between bulk phases; hence, the detailed nature of the atomic structure within an interface between twisted and untwisted zones is not relevant. The approach places crystal-twist phenomena within the theory of order/disorder phase transitions.

  17. Operator constraints for twist-3 functions and Lorentz invariance properties of twist-3 observables

    DOE PAGES

    Kanazawa, Koichi; Pitonyak, Daniel; Koike, Yuji; ...

    2016-03-14

    We investigate the behavior under Lorentz transformations of perturbative coefficient functions in a collinear twist-3 formalism relevant for high-energy observables including transverse polarization of hadrons. We argue that those perturbative coefficient functions can, a priori, acquire quite different yet Lorentz-invariant forms in various frames. This somewhat surprising difference can be traced back to a general dependence of the perturbative coefficient functions on light cone vectors which are introduced by the twist-3 factorization formulas and which are frame-dependent. One can remove this spurious frame dependence by invoking so-called Lorentz invariance relations (LIRs) between twist-3 parton correlation functions. Some of those relationsmore » for twist-3 distribution functions were discussed in the literature before. In this paper we derive the corresponding LIRs for twist-3 fragmentation functions. We explicitly demonstrate that these LIRs remove the light cone vector dependence by considering transverse spin observables in the single-inclusive production of hadrons in lepton-nucleon collisions, ℓN→hX. Furthermore, with the LIRs in hand, we also show that twist-3 observables in general can be written solely in terms of three-parton correlation functions.« less

  18. Experimental Investigation of the Electronic Properties of Twisted Bilayer Graphene by STM and STS

    NASA Astrophysics Data System (ADS)

    Yin, Longjing; Qiao, Jiabin; Wang, Wenxiao; Zuo, Weijie; He, Lin

    The electronic properties of graphene multilayers depend sensitively on their stacking order. A twisted angle is treated as a unique degree of freedom to tune the electronic properties of graphene system. Here we study electronic structures of the twisted bilayers by scanning tunneling microscopy (STM) and spectroscopy (STS). We demonstrate that the interlayer coupling strength affects both the Van Hove singularities and the Fermi velocity of twisted bilayers dramatically. This removes the discrepancy about the Fermi velocity renormalization in the twisted bilayers and provides a consistent interpretation of all current data. Moreover, we report the experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers by STM and STS. At a magic twisted angle, about 1.11°, a pronounced sharp peak is observed in the tunnelling spectra due to the action of the non-Abelian gauge fields. Because of the effective non-Abelian gauge fields, the rotation angle could transfer the charge carriers in the twisted bilayers from massless Dirac fermions into well localized electrons, or vice versa, efficiently. This provides a new route to tune the electronic properties of graphene systems, which will be essential in future graphene nanoelectronics.

  19. An analysis of rotor blade twist variables associated with different Euler sequences and pretwist treatments

    NASA Technical Reports Server (NTRS)

    Alkire, K.

    1984-01-01

    A nonlinear analysis which is necessary to adequately model elastic helicopter rotor blades experiencing moderately large deformations was examined. The analysis must be based on an appropriate description of the blade's deformation geometry including elastic bending and twist. Built-in pretwist angles complicate the deformation process ant its definition. Relationships between the twist variables associated with different rotation sequences and corresponding forms of the transformation matrix are lasted. Relationships between the twist variables associated with first, the pretwist combined with the deformation twist are included. Many of the corresponding forms of the transformation matrix for the two cases are listed. It is shown that twist variables connected with the combined twist treatment are related to those where the pretwist is applied initially. A method to determine the relationships and some results are outlined. A procedure to evaluate the transformation matrix that eliminates the Eulerlike sequence altogether is demonstrated. The resulting form of the transformation matrix is unaffected by rotation sequence or pretwist treatment.

  20. Aeroelastic Analysis of Helicopter Rotor Blades Incorporating Anisotropic Piezoelectric Twist Actuation

    NASA Technical Reports Server (NTRS)

    Wilkie, W. Keats; Belvin, W. Keith; Park, K. C.

    1996-01-01

    A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consists of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for dynamics simulation using numerical integration. The twist actuation responses for three conceptual fullscale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

  1. An aeroelastic analysis of helicopter rotor blades incorporating piezoelectric fiber composite twist actuation

    NASA Technical Reports Server (NTRS)

    Wilkie, W. Keats; Park, K. C.

    1996-01-01

    A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consist of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for numerical integration. The twist actuation responses for three conceptual full-scale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

  2. Electrostatic contribution to twist rigidity of DNA.

    PubMed

    Mohammad-Rafiee, Farshid; Golestanian, Ramin

    2004-06-01

    The electrostatic contribution to the twist rigidity of DNA is studied, and it is shown that the Coulomb self-energy of the double-helical sugar-phosphate backbone makes a considerable contribution-the electrostatic twist rigidity of DNA is found to be C(elec) approximately 5 nm, which makes up about 7% of its total twist rigidity ( C(DNA) approximately 75 nm). The electrostatic twist rigidity is found, however, to depend only weakly on the salt concentration, because of a competition between two different screening mechanisms: (1) Debye screening by the salt ions in the bulk, and (2) structural screening by the periodic charge distribution along the backbone of the helical polyelectrolyte. It is found that, depending on the parameters, the electrostatic contribution to the twist rigidity could stabilize or destabilize the structure of a helical polyelectrolyte.

  3. On periodic motions of an orbital dumbbell-shaped body with a cabin-elevator

    NASA Astrophysics Data System (ADS)

    Burov, A. A.; Kosenko, I. I.; Troger, H.

    2012-05-01

    The motion of a dumbbell-shaped body (a pair of massive points connected with each other by a weightless rod along which the elevator, i.e., a third point, is moving according to a given law) in an attractive Newtonian central field is considered. In particular, such a mechanical system can be considered as a simplified model of an orbital cable system equipped with an elevator. The practically most interesting case where the cabin performs periodic "shuttle"motions is studied. Under the assumption that the elevator mass is small compared with the dumbbell mass, the Poincaré theory is used to determine the conditions for the existence of families of system periodic motions analytically depending on the arising small parameter and passing into some stable radial steady-state motion of the unperturbed problem as the small parameter tends to zero. It is also proved that, for sufficiently small parameter values, each of the radial relative equilibria generates exactly one family of such periodic motions. The stability of the obtained periodic solutions is studied in the linear approximation, and these solutions themselves are calculated up to terms of the firstorder in the small parameter. The contemporary studies of the motion of orbital dumbbell systems apparently originated in Okunev's papers [1, 2]. These studies were continued in [3], where plane motions of an orbit tether (represented as a dumbbell-shaped satellite) in a circular orbit were considered in the satellite approximation. In [4], in the case of equal masses and in the unbounded statement, the energy-momentum method was used to perform the dynamic reduction of the problem and analyze the stability of relative equilibria. A similar technique was used in [5], where, in contrast to the above-mentioned problems, the massive points were connected by an elastic spring resisting to compression and forming a dumbbell with elastic properties. Under such assumptions, the stability of radial configurations was investigated in that paper. The bifurcations and stability of steady-state configurations of a deformable elastic dumbbell were also studied in [6]. Various obstacles arising in the construction of orbital cable systems, in particular, the strong deformability of known materials, were discussed in [7]. In [8], the problem of orbital motion of a pair of massive points connected by an inextensible weightless cable was considered in the exact statement. In other words, it was assumed that a unilateral constraint is imposed on themassive points. The conditions of stability of vertical positions of the relative equilibria of the cable system, which were obtained in [8], can be used for any ratio of the subsatellite and station masses. In turn, these results agree well with the results obtained earlier in the studies of stability of vertical configurations in the case of equal masses of the system end bodies [3, 4]. One of the basic papers in the dynamics of three-body orbital cable systems is the paper [9]. The steady-state motions and their bifurcations and stability were studied depending on the elevator cabin position in [10].

  4. Effect of twist on transverse impact response of ballistic fiber yarns

    DOE PAGES

    Song, Bo; Lu, Wei -Yang

    2015-06-15

    A Hopkinson bar was employed to conduct transverse impact testing of twisted Kevlar KM2 fiber yarns at the same impact speed. The speed of Euler transverse wave generated by the impact was measured utilizing a high speed digital camera. The study included fiber yarns twisted by different amounts. The Euler transverse wave speed was observed to increase with increasing amount of twist of the fiber yarn, within the range of this investigation. As a result, the higher transverse wave speeds in the more twisted fiber yarns indicate better ballistic performance in soft body armors for personal protection.

  5. Static and Dynamic Characteristics of a Long-Span Cable-Stayed Bridge with CFRP Cables

    PubMed Central

    Xie, Xu; Li, Xiaozhang; Shen, Yonggang

    2014-01-01

    In this study, the scope of CFRP cables in cable-stayed bridges is studied by establishing a numerical model of a 1400-m span of the same. The mechanical properties and characteristics of CFRP stay cables and of a cable-stayed bridge with CFRP cables are here subjected to comprehensive analysis. The anomalies in the damping properties of free vibration, nonlinear parametric vibration and wind fluctuating vibration between steel cables and CFRP cables are determined. The structural stiffness, wind resistance and traffic vibration of the cable-stayed bridge with CFRP cables are also analyzed. It was found that the static performances of a cable-stayed bridge with CFRP cables and steel cables are basically the same. The natural frequencies of CFRP cables do not coincide with the major natural frequencies of the cable-stayed bridge, so the likelihood of CFRP cable-bridge coupling vibration is minuscule. For CFRP cables, the response amplitudes of both parametric vibration and wind fluctuating vibration are smaller than those of steel cables. It can be concluded from the research that the use of CFRP cables does not change the dynamic characteristics of the vehicle-bridge coupling vibration. Therefore, they can be used in long-span cable-stayed bridges with an excellent mechanical performance. PMID:28788710

  6. Static and Dynamic Characteristics of a Long-Span Cable-Stayed Bridge with CFRP Cables.

    PubMed

    Xie, Xu; Li, Xiaozhang; Shen, Yonggang

    2014-06-23

    In this study, the scope of CFRP cables in cable-stayed bridges is studied by establishing a numerical model of a 1400-m span of the same. The mechanical properties and characteristics of CFRP stay cables and of a cable-stayed bridge with CFRP cables are here subjected to comprehensive analysis. The anomalies in the damping properties of free vibration, nonlinear parametric vibration and wind fluctuating vibration between steel cables and CFRP cables are determined. The structural stiffness, wind resistance and traffic vibration of the cable-stayed bridge with CFRP cables are also analyzed. It was found that the static performances of a cable-stayed bridge with CFRP cables and steel cables are basically the same. The natural frequencies of CFRP cables do not coincide with the major natural frequencies of the cable-stayed bridge, so the likelihood of CFRP cable-bridge coupling vibration is minuscule. For CFRP cables, the response amplitudes of both parametric vibration and wind fluctuating vibration are smaller than those of steel cables. It can be concluded from the research that the use of CFRP cables does not change the dynamic characteristics of the vehicle-bridge coupling vibration. Therefore, they can be used in long-span cable-stayed bridges with an excellent mechanical performance.

  7. Combined detection of Twist1, Snail1 and squamous cell carcinoma antigen for the prognostic evaluation of invasion and metastasis in cervical squamous cell carcinoma.

    PubMed

    Yang, Huilun; Hu, Haiyang; Gou, Yanling; Hu, Yuhong; Li, Hui; Zhao, Hongwei; Wang, Beidi; Li, Peiling; Zhang, Zongfeng

    2018-04-01

    Cervical cancer is one of the most common malignant tumours of the female reproductive system, ranking second only to breast cancer in morbidity worldwide. Essential features of the progression of cervical cancer are invasion and metastasis, which are closely related to disease prognosis and mortality rate. At the present time there is no effective method to evaluate cancer invasion and metastasis before surgery. Here we report our study on molecular changes in biopsy tissue for the prognostic evaluation of cancer invasion and metastasis. Expression of the epithelial-mesenchymal transition-inducing transcription factors Twist1 and Snail1 was detected by immunohistochemistry in 32 normal, 36 low-grade squamous intraepithelial neoplasia (LSIL), 54 high-grade squamous intraepithelial neoplasia (HSIL) and 320 cervical squamous cell carcinoma (CSCC) samples. The correlation between the expression of Twist1, Snail1 and squamous cell carcinoma antigen (SCCA) in CSCC tissues and clinical pathology results was evaluated. A transwell migration and invasion assay was used to explore the roles of Twist1 and Snail1 in the invasion of cancer cells. Lymph node metastasis and lymphovascular space invasion (LVSI) rates for the following groups were analysed: SCCA(+) group, Twist1(+) group, Snail1(+) group, Twist1(+)Snail1(+)group, Twist1(+)SCCA(+)group, Snail1(+)SCCA(+)group and Twist1(+)Snail1(+)SCCA(+) group. The expression of Twist1 and Snail1 was significantly upregulated in HSIL and CSCC (p < 0.05). Twist1 and Snail1 expression levels were associated with LVSI, lymph node metastasis and histological grade (p < 0.05) but not with age or FIGO stage (p > 0.05). The expression of SCCA was associated with LVSI, lymph node metastasis, FIGO stage and histological grade (p < 0.05) but not with age (p > 0.05). Twist1 was an independent factor contributing to the invasion ability of cervical cancer cells. In addition, the positive rate of lymph node metastasis and LVSI was higher in the Twist1(+)Snail1(+)SCCA(+) group than in the SCCA(+) group, Twist1(+) group and Snail1(+) group, respectively (p < 0.05). Combined detection of Twist1 and Snail1 in SCCA-positive biopsy specimens may be a potential method for evaluating the invasion and metastasis of CSCC prior to surgery.

  8. Anisotropic piezoelectric twist actuation of helicopter rotor blades: Aeroelastic analysis and design optimization

    NASA Astrophysics Data System (ADS)

    Wilkie, William Keats

    1997-12-01

    An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain a soluti An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain amited additional piezoelectric material mass, it is shown that blade twist actuation approaches which exploit in-plane piezoelectric free-stain anisotropies are capable of producing amplitudes of oscillatory blade twisting sufficient for rotor vibration reduction applications. The second study examines the effectiveness of using embedded piezoelectric actuator laminae to alleviate vibratory loads due to retreating blade stall. A 10 to 15 percent improvement in dynamic stall limited forward flight speed, and a 5 percent improvement in stall limited rotor thrust were numerically demonstrated for the active twist rotor blade relative to a conventional blade design. The active twist blades are also demonstrated to be more susceptible than the conventional blades to dynamic stall induced vibratory loads when not operating with twist actuation. This is the result of designing the active twist blades with low torsional stiffness in order to maximize piezoelectric twist authority. Determining the optimum tradeoff between blade torsional stiffness and piezoelectric twist actuation authority is the subject of the third study. For this investigation, a linearized hovering-flight eigenvalue analysis is developed. Linear optimal control theory is then utilized to develop an optimum active twist blade design in terms of reducing structural energy and control effort cost. The forward flight vibratory loads characteristics of the torsional stiffness optimized active twist blade are then examined using the nonlinear, forward flight aeroelastic analysis. The optimized active twist rotor blade is shown to have improved passive and active vibratory loads characteristics relative to the baseline active twist blades.

  9. A high current pulsed power generator CQ-3-MMAF with co-axial cable transmitting energy for material dynamics experiments

    NASA Astrophysics Data System (ADS)

    Wang, Guiji; Chen, Xuemiao; Cai, Jintao; Zhang, Xuping; Chong, Tao; Luo, Binqiang; Zhao, Jianheng; Sun, Chengwei; Tan, Fuli; Liu, Cangli; Wu, Gang

    2016-06-01

    A high current pulsed power generator CQ-3-MMAF (Multi-Modules Assembly Facility, MMAF) was developed for material dynamics experiments under ramp wave and shock loadings at the Institute of Fluid Physics (IFP), which can deliver 3 MA peak current to a strip-line load. The rise time of the current is 470 ns (10%-90%). Different from the previous CQ-4 at IFP, the CQ-3-MMAF energy is transmitted by hundreds of co-axial high voltage cables with a low impedance of 18.6 mΩ and low loss, and then hundreds of cables are reduced and converted to tens of cables into a vacuum chamber by a cable connector, and connected with a pair of parallel metallic plates insulated by Kapton films. It is composed of 32 capacitor and switch modules in parallel. The electrical parameters in short circuit are with a capacitance of 19.2 μF, an inductance of 11.7 nH, a resistance of 4.3 mΩ, and working charging voltage of 60 kV-90 kV. It can be run safely and stable when charged from 60 kV to 90 kV. The vacuum of loading chamber can be up to 10-2 Pa, and the current waveforms can be shaped by discharging in time sequences of four groups of capacitor and switch modules. CQ-3-MMAF is an adaptive machine with lower maintenance because of its modularization design. The COMSOL Multi-physics® code is used to optimize the structure of some key components and calculate their structural inductance for designs, such as gas switches and cable connectors. Some ramp wave loading experiments were conducted to check and examine the performances of CQ-3-MMAF. Two copper flyer plates were accelerated to about 3.5 km/s in one shot when the working voltage was charged to 70 kV. The velocity histories agree very well. The dynamic experiments of some polymer bonded explosives and phase transition of tin under ramp wave loadings were also conducted. The experimental data show that CQ-3-MMAF can be used to do material dynamics experiments in high rate and low cost shots. Based on this design concept, the peak current of new generators can be increased to 5-6 MA and about 100 GPa ramp stress can be produced on the metallic samples for high pressure physics, and a conceptual design of CQ-5-MMAF was given.

  10. A high current pulsed power generator CQ-3-MMAF with co-axial cable transmitting energy for material dynamics experiments.

    PubMed

    Wang, Guiji; Chen, Xuemiao; Cai, Jintao; Zhang, Xuping; Chong, Tao; Luo, Binqiang; Zhao, Jianheng; Sun, Chengwei; Tan, Fuli; Liu, Cangli; Wu, Gang

    2016-06-01

    A high current pulsed power generator CQ-3-MMAF (Multi-Modules Assembly Facility, MMAF) was developed for material dynamics experiments under ramp wave and shock loadings at the Institute of Fluid Physics (IFP), which can deliver 3 MA peak current to a strip-line load. The rise time of the current is 470 ns (10%-90%). Different from the previous CQ-4 at IFP, the CQ-3-MMAF energy is transmitted by hundreds of co-axial high voltage cables with a low impedance of 18.6 mΩ and low loss, and then hundreds of cables are reduced and converted to tens of cables into a vacuum chamber by a cable connector, and connected with a pair of parallel metallic plates insulated by Kapton films. It is composed of 32 capacitor and switch modules in parallel. The electrical parameters in short circuit are with a capacitance of 19.2 μF, an inductance of 11.7 nH, a resistance of 4.3 mΩ, and working charging voltage of 60 kV-90 kV. It can be run safely and stable when charged from 60 kV to 90 kV. The vacuum of loading chamber can be up to 10(-2) Pa, and the current waveforms can be shaped by discharging in time sequences of four groups of capacitor and switch modules. CQ-3-MMAF is an adaptive machine with lower maintenance because of its modularization design. The COMSOL Multi-physics® code is used to optimize the structure of some key components and calculate their structural inductance for designs, such as gas switches and cable connectors. Some ramp wave loading experiments were conducted to check and examine the performances of CQ-3-MMAF. Two copper flyer plates were accelerated to about 3.5 km/s in one shot when the working voltage was charged to 70 kV. The velocity histories agree very well. The dynamic experiments of some polymer bonded explosives and phase transition of tin under ramp wave loadings were also conducted. The experimental data show that CQ-3-MMAF can be used to do material dynamics experiments in high rate and low cost shots. Based on this design concept, the peak current of new generators can be increased to 5-6 MA and about 100 GPa ramp stress can be produced on the metallic samples for high pressure physics, and a conceptual design of CQ-5-MMAF was given.

  11. Twisting failure of centrally loaded open-section columns in the elastic range

    NASA Technical Reports Server (NTRS)

    Kappus, Robert

    1938-01-01

    In the following report a complete theory of twisting failure by the energy method is developed, based on substantially the same assumptions as those employed by Wagner and Bleich. Problems treated in detail are: the stress and strain condition under St. Venant twist and in twist with axial constraint; the concept of shear center and the energy method for problems of elastic stability.

  12. On the twists of interplanetary magnetic flux ropes observed at 1 AU

    NASA Astrophysics Data System (ADS)

    Wang, Yuming; Zhuang, Bin; Hu, Qiang; Liu, Rui; Shen, Chenglong; Chi, Yutian

    2016-10-01

    Magnetic flux ropes (MFRs) are one kind of fundamental structures in the solar/space physics and involved in various eruption phenomena. Twist, characterizing how the magnetic field lines wind around a main axis, is an intrinsic property of MFRs, closely related to the magnetic free energy and stableness. Although the effect of the twist on the behavior of MFRs had been widely studied in observations, theory, modeling, and numerical simulations, it is still unclear how much amount of twist is carried by MFRs in the solar atmosphere and in heliosphere and what role the twist played in the eruptions of MFRs. Contrasting to the solar MFRs, there are lots of in situ measurements of magnetic clouds (MCs), the large-scale MFRs in interplanetary space, providing some important information of the twist of MFRs. Thus, starting from MCs, we investigate the twist of interplanetary MFRs with the aid of a velocity-modified uniform-twist force-free flux rope model. It is found that most of MCs can be roughly fitted by the model and nearly half of them can be fitted fairly well though the derived twist is probably overestimated by a factor of 2.5. By applying the model to 115 MCs observed at 1 AU, we find that (1) the twist angles of interplanetary MFRs generally follow a trend of about 0.6l/R radians, where l/R is the aspect ratio of a MFR, with a cutoff at about 12π radians AU-1, (2) most of them are significantly larger than 2.5π radians but well bounded by 2l/R radians, (3) strongly twisted magnetic field lines probably limit the expansion and size of MFRs, and (4) the magnetic field lines in the legs wind more tightly than those in the leading part of MFRs. These results not only advance our understanding of the properties and behavior of interplanetary MFRs but also shed light on the formation and eruption of MFRs in the solar atmosphere. A discussion about the twist and stableness of solar MFRs are therefore given.

  13. 30 CFR 77.601 - Trailing cables or portable cables; temporary splices.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Trailing cables or portable cables; temporary... OF UNDERGROUND COAL MINES Trailing Cables § 77.601 Trailing cables or portable cables; temporary splices. Temporary splices in trailing cables or portable cables shall be made in a workmanlike manner and...

  14. Aeromechanical Evaluation of Smart-Twisting Active Rotor

    NASA Technical Reports Server (NTRS)

    Lim, Joon W.; Boyd, D. Douglas, Jr.; Hoffman, Frauke; van der Wall, Berend G.; Kim, Do-Hyung; Jung, Sung N.; You, Young H.; Tanabe, Yasutada; Bailly, Joelle; Lienard, Caroline; hide

    2014-01-01

    An investigation of Smart-Twisting Active Rotor (STAR) was made to assess potential benefits of the current active twist rotor concept for performance improvement, vibration reduction, and noise alleviation. The STAR rotor is a 40% Mach-scaled, Bo105 rotor with an articulated flap-lag hinge at 3.5%R and no pre-cone. The 0-5 per rev active twist harmonic inputs were applied for various flight conditions including hover, descent, moderate to high speed level flights, and slowed rotor high advance ratio. For the analysis, the STAR partners used multiple codes including CAMRAD II, S4, HOST, rFlow3D, elsA, and their associated software. At the high thrust level in hover, the 0 per rev active twist with 80% amplitude increased figure of merit (FM) by 0.01-0.02 relative to the baseline. In descent, the largest BVI noise reduction was on the order of 2 to 5 dB at the 3 per rev active twist. In the high speed case (mu = 0.35), the 2 per rev actuation was found to be the most effective in achieving a power reduction as well as a vibration reduction. At the 2 per rev active twist, total power was reduced by 0.65% at the 60 deg active twist phase, and vibration was reduced by 47.6% at the 45 deg active twist phase. The use of the 2 per rev active twist appears effective for vibration reduction. In the high advance ratio case (mu = 0.70), the 0 per rev actuation appeared to have negligible impact on performance improvement. In summary, computational simulations successfully demonstrated that the current active twist concept provided a significant reduction of the maximum BVI noise in descent, a significant reduction of the vibration in the high speed case, a small improvement on rotor performance in hover, and a negligible impact on rotor performance in forward flight.

  15. Solution structure of a DNA complex with the fluorescent bis-intercalator TOTO determined by NMR spectroscopy.

    PubMed

    Spielmann, H P; Wemmer, D E; Jacobsen, J P

    1995-07-11

    We have used two-dimensional 1H NMR spectroscopy to determine the solution structure of the DNA oligonucleotide d(5'-CGCTAGCG-3')2 complexed with the bis-intercalating dye 1,1'-(4,4,8,8-tetramethyl-4,8-diazaundecamethylene)bis[4-(3-methyl -2,3- dihydrobenzo-1,3-thiazolyl-2-methylidene)qui nolinium] tetraiodide (TOTO). The determination of the structure was based on total relaxation matrix analysis of the NOESY cross-peak intensities using the program MARDIGRAS. Improved procedures to consider the experimental "noise" in NOESY spectra during these calculations have been employed. The NOE-derived distance restraints were applied in restrained molecular dynamics calculations. Twenty final structures each were generated for the TOTO complex from both A-form and B-form dsDNA starting structures. The root-mean-square (rms) deviation of the coordinates for the 40 structures of the complex was 1.45 A. The local DNA structure is distorted in the complex. The helix is unwound by 60 degrees and has an overall helical repeat of 12 base pairs, caused by bis-intercalation of TOTO. The poly(propylenamine) linker chain is located in the minor groove of dsDNA. Calculations indicate that the benzothiazole ring system is twisted relative to the quinoline in the uncomplexed TOTO molecule. The site selectivity of TOTO for the CTAG-CTAG site is explained by its ability to adapt to the base pair propeller twist of dsDNA to optimize stacking and the hydrophobic interaction between the thymidine methyl group and the benzothiazole ring. There is a 3000-fold fluorescence enhancement upon binding of TOTO to dsDNA. Rotation about the cyanine methine bonds is possible in free TOTO, allowing relaxation nonradiatively. When bound to dsDNA, the benzothiazole ring and the quinolinium ring are clamped by the nucleobases preventing this rotation, and the chromophore loses excitation energy by fluorescence instead.

  16. 47 CFR 36.153 - Assignment of Cable and Wire Facilities (C&WF) to categories.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 2 2014-10-01 2014-10-01 false Assignment of Cable and Wire Facilities (C&WF... Telecommunications Property Cable and Wire Facilities § 36.153 Assignment of Cable and Wire Facilities (C&WF) to categories. (a) Cable consists of: Aerial cable, underground cable, buried cable, submarine cable, deep sea...

  17. 47 CFR 36.153 - Assignment of Cable and Wire Facilities (C&WF) to categories.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 2 2012-10-01 2012-10-01 false Assignment of Cable and Wire Facilities (C&WF... Telecommunications Property Cable and Wire Facilities § 36.153 Assignment of Cable and Wire Facilities (C&WF) to categories. (a) Cable consists of: Aerial cable, underground cable, buried cable, submarine cable, deep sea...

  18. 47 CFR 36.153 - Assignment of Cable and Wire Facilities (C&WF) to categories.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 2 2013-10-01 2013-10-01 false Assignment of Cable and Wire Facilities (C&WF... Telecommunications Property Cable and Wire Facilities § 36.153 Assignment of Cable and Wire Facilities (C&WF) to categories. (a) Cable consists of: Aerial cable, underground cable, buried cable, submarine cable, deep sea...

  19. Reliability and Characterization of High Voltage Power Capacitors

    DTIC Science & Technology

    2014-03-01

    Cable The HVPS cable is a specialized coaxial cable that utilizes a high voltage bayonet connector. The cable itself has a voltage rating in excess...the( LabVIEW(program( GPIB( CABLE ( HVPS( HVPS( COAXIAL ( CABLE ( BNC( COAXIAL ( CABLE ( BNC( COAXIAL ( CABLE ( CAPACITOR(‘C’(DATA( CAPACITOR(‘A’(DATA( Circuit...16   F.   CABLES AND CONNECTORS ...................................................................16

  20. Spectral determinants for twist field correlators

    NASA Astrophysics Data System (ADS)

    Belitsky, A. V.

    2018-04-01

    Twist fields were introduced a few decades ago as a quantum counterpart to classical kink configurations and disorder variables in low dimensional field theories. In recent years they received a new incarnation within the framework of geometric entropy and strong coupling limit of four-dimensional scattering amplitudes. In this paper, we study their two-point correlation functions in a free massless scalar theory, namely, twist-twist and twist-antitwist correlators. In spite of the simplicity of the model in question, the properties of the latter are far from being trivial. The problem is reduced, within the formalism of the path integral, to the study of spectral determinants on surfaces with conical points, which are then computed exactly making use of the zeta function regularization. We also provide an insight into twist correlators for a massive complex scalar by means of the Lifshitz-Krein trace formula.

  1. Strength of surgical wire fixation. A laboratory study.

    PubMed

    Guadagni, J R; Drummond, D S

    1986-08-01

    Because of the frequent use of stainless steel wire in spinal surgery and to augment fracture fixation, several methods of securing wire fixation were tested in the laboratory to determine the relative strength of fixation. Any method of fixation stronger than the yield strength of the wire is sufficient. Square knots, knot twists, symmetric twists, and the AO loop-tuck techniques afforded acceptable resistance against tension loads, but the wire wrap and AO loop technique were unacceptable. The double symmetric twist, which is frequently used for tension banding, was barely acceptable. The symmetric twist technique was the most practical because it is strong enough, efficient in maintaining tension applied during fixation, and least likely to cause damage to the wire. To optimize the fixation strength of the symmetrical twist, at least two twists are required at a reasonably tight pitch.

  2. THE EFFECT OF A TWISTED MAGNETIC FIELD ON THE PERIOD RATIO P{sub 1}/P{sub 2} OF NONAXISYMMETRIC MAGNETOHYDRODYNAMIC WAVES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karami, K.; Bahari, K., E-mail: KKarami@uok.ac.ir, E-mail: K.Bahari@razi.ac.ir

    2012-10-01

    We consider nonaxisymmetric magnetohydrodynamic (MHD) modes in a zero-beta cylindrical compressible thin magnetic flux tube modeled as a twisted core surrounded by a magnetically twisted annulus, with both embedded in a straight ambient external field. The dispersion relation is derived and solved analytically and numerically to obtain the frequencies of the nonaxisymmetric MHD waves. The main result is that the twisted magnetic annulus does affect the period ratio P{sub 1}/P{sub 2} of the kink modes. For the kink modes, the magnetic twist in the annulus region can achieve deviations from P{sub 1}/P{sub 2} = 2 of the same order ofmore » magnitude as in the observations. Furthermore, the effect of the internal twist on the fluting modes is investigated.« less

  3. To investigate the relation between pore size and twist angle in enhanced thermoelectric efficient porous armchair graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Kaur, Sukhdeep; Randhawa, Deep Kamal Kaur; Bindra Narang, Sukhleen

    2018-05-01

    Based on Non-Equilibrium Green’s function method, we demonstrate that the twisted deformation is an efficient method to improve the figure of merit ZT of porous armchair graphene nanoribbons AGNRs. The peak value of ZT can be obtained for a certain tunable twist angle. Further analysis shows that the tunable twist angle exhibits an inverse relationship with the pore size laying forth the designers a choice for the larger twists to be replaced by smaller ones simply by increasing the size of the pore. Ballistic transport regime and semi-empirical method using Huckel basis set is used to obtain the electrical properties while the Tersoff potential is employed for the phononic system. These interesting findings indicate that the twisted porous AGNRs can be utilized as designing materials for potential thermoelectric applications.

  4. Mesoporous Silica Nanoparticle Delivery of Chemically Modified siRNA Against TWIST1 Leads to Reduced Tumor Burden

    PubMed Central

    Finlay, James; Roberts, Cai M.; Dong, Juyao; Zink, Jeffrey I.; Tamanoi, Fuyuhiko; Glackin, Carlotta A.

    2015-01-01

    Growth and progression of solid tumors depends on the integration of multiple pro-growth and survival signals, including the induction of angiogenesis. TWIST1 is a transcription factor whose reactivation in tumors leads to epithelial to mesenchymal transition (EMT), including increased cancer cell stemness, survival, and invasiveness. Additionally, TWIST1 drives angiogenesis via activation of IL-8 and CCL2, independent of VEGF signaling. In this work, results suggest that chemically modified siRNA against TWIST1 reverses EMT both in vitro and in vivo. siRNA delivery with a polyethyleneimine-coated mesoporous silica nanoparticle (MSN) led to reduction of TWIST1 target genes and migratory potential in vitro. In mice bearing xenograft tumors, weekly intravenous injections of the siRNA-nanoparticle complexes resulted in decreased tumor burden together with a loss of CCL2 suggesting a possible anti-angiogenic response. Therapeutic use of TWIST1 siRNA delivered via MSNs has the potential to inhibit tumor growth and progression in many solid tumor types. Chemically modified siRNA against TWIST1 was complexed to cation-coated mesoporous silica nanoparticles and tested in vitro and in vivo. In cell culture experiments, siRNA reduced expression of TWIST1 and its target genes, and reduced cell migration. In mice, injections of the siRNA-nanoparticle complex led to reduced tumor weight. Data suggest that diminished tumor burden was the result of reduced CCL2 expression and angiogenesis following TWIST1 knockdown. PMID:26115637

  5. iss050e059576

    NASA Image and Video Library

    2017-03-24

    iss050e059576 (03/24/2017) --- Russian cosmonaut Oleg Novitskiy (middle) poses with Expedition 50 Commander Shane Kimbrough of NASA (left) and Flight Engineer Thomas Pesquet of ESA (European Space Agency) (right) prior to their spacewalk. The pair conducted a six hour and 34 minute spacewalk on March 24, 2017. The two astronauts successfully disconnected cables and electrical connections on the Pressurized Mating Adapter-3 to prepare for its robotic move, lubricated the latching end effector on the Special Purpose Dexterous Manipulator “extension” for the Canadarm2 robotic arm, inspected a radiator valve and replaced cameras on the Japanese segment of the outpost.

  6. iss050e059579

    NASA Image and Video Library

    2017-03-24

    iss050e059579 (03/24/2017) --- NASA astronaut Peggy Whitson (middle) poses with Expedition 50 Commander Shane Kimbrough of NASA (left) and Flight Engineer Thomas Pesquet of ESA (European Space Agency) (right) prior to their spacewalk. The pair conducted a six hour and 34 minute spacewalk on March 24, 2017. The two astronauts successfully disconnected cables and electrical connections on the Pressurized Mating Adapter-3 to prepare for its robotic move, lubricated the latching end effector on the Special Purpose Dexterous Manipulator “extension” for the Canadarm2 robotic arm, inspected a radiator valve and replaced cameras on the Japanese segment of the outpost.

  7. Twisted surfaces with vanishing curvature in Galilean 3-space

    NASA Astrophysics Data System (ADS)

    Dede, Mustafa; Ekici, Cumali; Goemans, Wendy; Ünlütürk, Yasin

    In this work, we define twisted surfaces in Galilean 3-space. In order to construct these surfaces, a planar curve is subjected to two simultaneous rotations, possibly with different rotation speeds. The existence of Euclidean rotations and isotropic rotations leads to three distinct types of twisted surfaces in Galilean 3-space. Then we classify twisted surfaces in Galilean 3-space with zero Gaussian curvature or zero mean curvature.

  8. Twisting integrin receptors increases endothelin-1 gene expression in endothelial cells

    NASA Technical Reports Server (NTRS)

    Chen, J.; Fabry, B.; Schiffrin, E. L.; Wang, N.; Ingber, D. E. (Principal Investigator)

    2001-01-01

    A magnetic twisting stimulator was developed based on the previously published technique of magnetic twisting cytometry. Using ligand-coated ferromagnetic microbeads, this device can apply mechanical stresses with varying amplitudes, duration, frequencies, and waveforms to specific cell surface receptors. Biochemical and biological responses of the cells to the mechanical stimulation can be assayed. Twisting integrin receptors with RGD (Arg-Gly-Asp)-containing peptide-coated beads increased endothelin-1 (ET-1) gene expression by >100%. In contrast, twisting scavenger receptors with acetylated low-density lipoprotein-coated beads or twisting HLA antigen with anti-HLA antibody-coated beads did not lead to alterations in ET-1 gene expression. In situ hybridization showed that the increase in ET-1 mRNA was localized in the cells that were stressed with the RGD-coated beads. Blocking stretch-activated ion channels with gadolinium, chelating Ca2+ with EGTA, or inhibiting tyrosine phosphorylation with genistein abolished twist-induced ET-1 mRNA elevation. Abolishing cytoskeletal tension with an inhibitor of the myosin ATPase, with an inhibitor of myosin light chain kinase, or with an actin microfilament disrupter blocked twisted-induced increases in ET-1 expression. Our results are consistent with the hypothesis that the molecular structural linkage of integrin-cytoskeleton is an important pathway for stress-induced ET-1 gene expression.

  9. TiO2/water Nanofluid Heat Transfer in Heat Exchanger Equipped with Double Twisted-Tape Inserts

    NASA Astrophysics Data System (ADS)

    Eiamsa-ard, S.; Ketrain, R.; Chuwattanakul, V.

    2018-05-01

    Nowadays, heat transfer enhancement plays an important role in improving efficiency of heat transfer and thermal systems for numerous areas such as heat recovery processes, chemical reactors, air-conditioning/refrigeration system, food engineering, solar air/water heater, cooling of high power electronics etc. The present work presents the experimental results of the heat transfer enhancement of TiO2/water nanofluid in a heat exchanger tube fitted with double twisted tapes. The study covered twist ratios of twisted tapes (y/w) of 1.5, 2.0, and 2.5) while the concentration of the nanofluid was kept constant at 0.05% by volume. Observations show that heat transfer, friction loss and thermal performance increase as twist ratio (y/w) decreases. The use of the nanofluid in the tube equipped with the double twisted-tapes with the smallest twist ratio (y/w = 1.5) results in the increases of heat transfer rates and friction factor up to 224.8% and 8.98 times, respectively as compared to those of water. In addition, the experimental results performed that double twisted tapes induced dual swirling-flows which played an important role in improving fluid mixing and heat transfer enhancement. It is also observed that the TiO2/water nanofluid was responsible for low pressure loss behaviors.

  10. Structural and electron diffraction scaling of twisted graphene bilayers

    NASA Astrophysics Data System (ADS)

    Zhang, Kuan; Tadmor, Ellad B.

    2018-03-01

    Multiscale simulations are used to study the structural relaxation in twisted graphene bilayers and the associated electron diffraction patterns. The initial twist forms an incommensurate moiré pattern that relaxes to a commensurate microstructure comprised of a repeating pattern of alternating low-energy AB and BA domains surrounding a high-energy AA domain. The simulations show that the relaxation mechanism involves a localized rotation and shrinking of the AA domains that scales in two regimes with the imposed twist. For small twisting angles, the localized rotation tends to a constant; for large twist, the rotation scales linearly with it. This behavior is tied to the inverse scaling of the moiré pattern size with twist angle and is explained theoretically using a linear elasticity model. The results are validated experimentally through a simulated electron diffraction analysis of the relaxed structures. A complex electron diffraction pattern involving the appearance of weak satellite peaks is predicted for the small twist regime. This new diffraction pattern is explained using an analytical model in which the relaxation kinematics are described as an exponentially-decaying (Gaussian) rotation field centered on the AA domains. Both the angle-dependent scaling and diffraction patterns are in quantitative agreement with experimental observations. A Matlab program for extracting the Gaussian model parameters accompanies this paper.

  11. Modeling vibration response and damping of cables and cabled structures

    NASA Astrophysics Data System (ADS)

    Spak, Kaitlin S.; Agnes, Gregory S.; Inman, Daniel J.

    2015-02-01

    In an effort to model the vibration response of cabled structures, the distributed transfer function method is developed to model cables and a simple cabled structure. The model includes shear effects, tension, and hysteretic damping for modeling of helical stranded cables, and includes a method for modeling cable attachment points using both linear and rotational damping and stiffness. The damped cable model shows agreement with experimental data for four types of stranded cables, and the damped cabled beam model shows agreement with experimental data for the cables attached to a beam structure, as well as improvement over the distributed mass method for cabled structure modeling.

  12. Twisted sigma-model solitons on the quantum projective line

    NASA Astrophysics Data System (ADS)

    Landi, Giovanni

    2018-04-01

    On the configuration space of projections in a noncommutative algebra, and for an automorphism of the algebra, we use a twisted Hochschild cocycle for an action functional and a twisted cyclic cocycle for a topological term. The latter is Hochschild-cohomologous to the former and positivity in twisted Hochschild cohomology results into a lower bound for the action functional. While the equations for the critical points are rather involved, the use of the positivity and the bound by the topological term lead to self-duality equations (thus yielding twisted noncommutative sigma-model solitons, or instantons). We present explicit nontrivial solutions on the quantum projective line.

  13. 30 CFR 75.607 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Breaking trailing cable and power cable....607 Breaking trailing cable and power cable connections. [Statutory Provisions] Trailing cable and power cable connections to junction boxes shall not be made or broken under load. ...

  14. 30 CFR 75.607 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Breaking trailing cable and power cable....607 Breaking trailing cable and power cable connections. [Statutory Provisions] Trailing cable and power cable connections to junction boxes shall not be made or broken under load. ...

  15. 30 CFR 75.607 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Breaking trailing cable and power cable....607 Breaking trailing cable and power cable connections. [Statutory Provisions] Trailing cable and power cable connections to junction boxes shall not be made or broken under load. ...

  16. 30 CFR 75.607 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Breaking trailing cable and power cable....607 Breaking trailing cable and power cable connections. [Statutory Provisions] Trailing cable and power cable connections to junction boxes shall not be made or broken under load. ...

  17. Explicit formulae for Chern-Simons invariants of the twist-knot orbifolds and edge polynomials of twist knots

    NASA Astrophysics Data System (ADS)

    Ham, J.-Y.; Lee, J.

    2016-09-01

    We calculate the Chern-Simons invariants of twist-knot orbifolds using the Schläfli formula for the generalized Chern-Simons function on the family of twist knot cone-manifold structures. Following the general instruction of Hilden, Lozano, and Montesinos-Amilibia, we here present concrete formulae and calculations. We use the Pythagorean Theorem, which was used by Ham, Mednykh and Petrov, to relate the complex length of the longitude and the complex distance between the two axes fixed by two generators. As an application, we calculate the Chern-Simons invariants of cyclic coverings of the hyperbolic twist-knot orbifolds. We also derive some interesting results. The explicit formulae of the A-polynomials of twist knots are obtained from the complex distance polynomials. Hence the edge polynomials corresponding to the edges of the Newton polygons of the A-polynomials of twist knots can be obtained. In particular, the number of boundary components of every incompressible surface corresponding to slope -4n+2 turns out to be 2. Bibliography: 39 titles.

  18. Scanning tunneling microscopy and spectroscopy of twisted trilayer graphene

    NASA Astrophysics Data System (ADS)

    Zuo, Wei-Jie; Qiao, Jia-Bin; Ma, Dong-Lin; Yin, Long-Jing; Sun, Gan; Zhang, Jun-Yang; Guan, Li-Yang; He, Lin

    2018-01-01

    Twist, as a simple and unique degree of freedom, could lead to enormous novel quantum phenomena in bilayer graphene. A small rotation angle introduces low-energy van Hove singularities (VHSs) approaching the Fermi level, which result in unusual correlated states in the bilayer graphene. It is reasonable to expect that the twist could also affect the electronic properties of few-layer graphene dramatically. However, such an issue has remained experimentally elusive. Here, by using scanning tunneling microscopy/spectroscopy (STM/STS), we systematically studied a twisted trilayer graphene (TTG) with two different small twist angles between adjacent layers. Two sets of VHSs, originating from the two twist angles, were observed in the TTG, indicating that the TTG could be simply regarded as a combination of two different twisted bilayers of graphene. By using high-resolution STS, we observed a split of the VHSs and directly imaged the spatial symmetry breaking of electronic states around the VHSs. These results suggest that electron-electron interactions play an important role in affecting the electronic properties of graphene systems with low-energy VHSs.

  19. 30 CFR 75.607 - Breaking trailing cable and power cable connections.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Breaking trailing cable and power cable... LABOR COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Trailing Cables § 75.607 Breaking trailing cable and power cable connections. [Statutory Provisions] Trailing cable and...

  20. Spontaneous formation of non-uniform double helices for elastic rods under torsion

    NASA Astrophysics Data System (ADS)

    Li, Hongyuan; Zhao, Shumin; Xia, Minggang; He, Siyu; Yang, Qifan; Yan, Yuming; Zhao, Hanqiao

    2017-02-01

    The spontaneous formation of double helices for filaments under torsion is common and significant. For example, the research on the supercoiling of DNA is helpful for understanding the replication and transcription of DNA. Similar double helices can appear in carbon nanotube yarns, cables, telephone wires and so forth. We noticed that non-uniform double helices can be produced due to the surface friction induced by the self-contact. Therefore an ideal model was presented to investigate the formation of double helices for elastic rods under torque. A general equilibrium condition which is valid for both the smooth surface and the rough surface situations is derived by using the variational method. By adding further constraints, the smooth and rough surface situations are investigated in detail respectively. Additionally, the model showed that the specific process of how to twist and slack the rod can determine the surface friction and hence influence the configuration of the double helix formed by rods with rough surfaces. Based on this principle, a method of manufacturing double helices with designed configurations was proposed and demonstrated. Finally, experiments were performed to verify the model and the results agreed well with the theory.

  1. Experimental and theoretical study of the in- fiber twist sensor based on quasi-fan Solc structure filter.

    PubMed

    Sun, Chunran; Wang, Muguang; Jian, Shuisheng

    2017-08-21

    In this paper, a novel quasi-fan Solc structure filter based on elliptical-core spun fiber for twist sensing has been experimentally investigated and theoretically analyzed. The discrete model of spun fiber has been built to analyze the transmission characteristics of proposed sensor. Both experimental and simulated results indicate that the extinction ratio of the comb spectrum based on quasi-fan Solc birefringent fiber filter varies with twist angle and agrees well with each other. Based on the intensity modulation, the proposed twist sensor exhibits a high sensitivity of 0.02219 dB/(°/m). Moreover, thanks to the invariability of the fiber birefringence and the state of polarization of the input light, the proposed twist sensor has a very low temperature and strain sensitivity, which can avoid the cross-sensitivity problem existing in most twist sensors.

  2. Two-pseudoscalar-meson decay of {chi}{sub cJ} with twist-3 corrections

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou Mingzhen; Zhou Haiqing; Department of Physics, Southeast University, Nanjing 211189

    2009-11-01

    The decays of {chi}{sub cJ}{yields}{pi}{sup +}{pi}{sup -}, K{sup +}K{sup -} (J=0,2) are discussed within the standard and modified hard-scattering approach when including the contributions from twist-3 distribution amplitudes and wave functions of the light pseudoscalar meson. A model for twist-2 and twist-3 distribution amplitudes and wave functions of the pion and kaon with BHL prescription are proposed as the solution to the end-point singularities. The results show that the contributions from twist-3 parts are actually not power suppressed comparing with the leading-twist contribution. After including the effects from the transverse momentum of light meson valence-quark state and Sudakov factors, themore » decay widths of the {chi}{sub cJ} into pions or kaons are comparable with the their experimental data.« less

  3. Raman spectroscopy measurement of bilayer graphene's twist angle to boron nitride

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, Bin; Wang, Peng; Pan, Cheng

    2015-07-20

    When graphene is placed on hexagonal boron nitride with a twist angle, new properties develop due to the resulting moiré superlattice. Here, we report a method using Raman spectroscopy to make rapid, non-destructive measurements of the twist angle between bilayer graphene and hexagonal boron nitride. The lattice orientation is determined by using flakes with both bilayer and monolayer regions, and using the known Raman signature for the monolayer to measure the twist angle of the entire flake. The widths of the second order Raman peaks are found to vary linearly in the superlattice period and are used to determine themore » twist angle. The results are confirmed by using transport measurements to infer the superlattice period by the charge density required to reach the secondary resistance peaks. Small twist angles are also found to produce a significant modification of the first order Raman G band peak.« less

  4. Landau damping of Langmuir twisted waves with kappa distributed electrons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arshad, Kashif, E-mail: kashif.arshad.butt@gmail.com; Aman-ur-Rehman; Mahmood, Shahzad

    2015-11-15

    The kinetic theory of Landau damping of Langmuir twisted modes is investigated in the presence of orbital angular momentum of the helical (twisted) electric field in plasmas with kappa distributed electrons. The perturbed distribution function and helical electric field are considered to be decomposed by Laguerre-Gaussian mode function defined in cylindrical geometry. The Vlasov-Poisson equation is obtained and solved analytically to obtain the weak damping rates of the Langmuir twisted waves in a nonthermal plasma. The strong damping effects of the Langmuir twisted waves at wavelengths approaching Debye length are also obtained by using an exact numerical method and aremore » illustrated graphically. The damping rates of the planar Langmuir waves are found to be larger than the twisted Langmuir waves in plasmas which shows opposite behavior as depicted in Fig. 3 by J. T. Mendoça [Phys. Plasmas 19, 112113 (2012)].« less

  5. Acoustic Aspects of Active-Twist Rotor Control

    NASA Technical Reports Server (NTRS)

    Booth, Earl R., Jr.; Wilbur, Matthew L.

    2002-01-01

    The use of an Active Twist Rotor system to provide both vibration reduction and performance enhancement has been explored in recent analytical and experimental studies. Effects of active-twist control on rotor noise, however, had not been determined. During a recent wind tunnel test of an active-twist rotor system, a set of acoustic measurements were obtained to assess the effects of active-twist control on noise produced by the rotor, especially blade-vortex interaction (BVI) noise. It was found that for rotor operating conditions where BVI noise is dominant, active-twist control provided a reduction in BVI noise level. This BVI noise reduction was almost, but not quite, as large as that obtained in a similar test using HHC. However, vibration levels were usually adversely affected at operating conditions favoring minimum BVI noise. Conversely, operating conditions favoring minimum vibration levels affected BVI noise levels, but not always adversely.

  6. Spectroscopic and Ab Initio Determination of the Ring-Twisting Potential Energy Function for 1,3-Cyclohexadiene

    NASA Astrophysics Data System (ADS)

    Autrey, Daniel; Choo, Jaebum; Laane, Jaan

    2000-10-01

    The ring-twisting vibration of 1,3-cyclohexadiene has been studied using Raman and infrared spectroscopy of the molecule in the vapor phase. The Raman spectrum shows five ring-twisting transitions in the 150 - 200 cm-1 region. The far-infrared spectrum shows only two transitions for this vibration, which is infrared forbidden in the C_2v (planar) approximation. Three ring-twisting combination bands were also observed off a fundamental vibration at 926.1 cm-1. A coordinate dependent kinetic energy expansion for the ring-twisting motion was calculated, and this was used to determine the ring-twisting potential function. Ab initio calculations were performed using Moller-Plesset perturbation theory (MP2) using different basis sets. The barrier to planarity of 1150 cm-1 was determined from the spectroscopic data. The various ab initio calculations gave barriers to planarity in the 1197 - 1593 cm-1 range.

  7. The analysis of cable forces based on natural frequency

    NASA Astrophysics Data System (ADS)

    Suangga, Made; Hidayat, Irpan; Juliastuti; Bontan, Darwin Julius

    2017-12-01

    A cable is a flexible structural member that is effective at resisting tensile forces. Cables are used in a variety of structures that employ their unique characteristics to create efficient design tension members. The condition of the cable forces in the cable supported structure is an important indication of judging whether the structure is in good condition. Several methods have been developed to measure on site cable forces. Vibration technique using correlation between natural frequency and cable forces is a simple method to determine in situ cable forces, however the method need accurate information on the boundary condition, cable mass, and cable length. The natural frequency of the cable is determined using FFT (Fast Fourier Transform) Technique to the acceleration record of the cable. Based on the natural frequency obtained, the cable forces then can be determine by analytical or by finite element program. This research is focus on the vibration techniques to determine the cable forces, to understand the physical parameter effect of the cable and also modelling techniques to the natural frequency and cable forces.

  8. Geometric Constraints and the Anatomical Interpretation of Twisted Plant Organ Phenotypes

    PubMed Central

    Weizbauer, Renate; Peters, Winfried S.; Schulz, Burkhard

    2011-01-01

    The study of plant mutants with twisting growth in axial organs, which normally grow straight in the wild-type, is expected to improve our understanding of the interplay among microtubules, cellulose biosynthesis, cell wall structure, and organ biomechanics that control organ growth and morphogenesis. However, geometric constraints based on symplastic growth and the consequences of these geometric constraints concerning interpretations of twisted-organ phenotypes are currently underestimated. Symplastic growth, a fundamental concept in plant developmental biology, is characterized by coordinated growth of adjacent cells based on their connectivity through cell walls. This growth behavior implies that in twisting axial organs, all cell files rotate in phase around the organ axis, as has been illustrated for the Arabidopsis spr1 and twd1 mutants in this work. Evaluating the geometry of such organs, we demonstrate that a radial gradient in cell elongation and changes in cellular growth anisotropy must occur in twisting organs out of geometric necessity alone. In-phase rotation of the different cell layers results in a decrease of length and angle toward organ axis from the outer cell layers inward. Additionally, the circumference of each cell layer increases in twisting organs, which requires compensation through radial expansion or an adjustment of cell number. Therefore, differential cell elongation and growth anisotropy cannot serve as arguments for or against specific hypotheses regarding the molecular cause of twisting growth. We suggest instead, that based on mathematical modeling, geometric constraints in twisting organs are indispensable for the explanation of the causal connection of molecular and biomechanical processes in twisting as well as normal organs. PMID:22645544

  9. Characterization of paired helical filaments by scanning transmission electron microscopy.

    PubMed

    Ksiezak-Reding, Hanna; Wall, Joseph S

    2005-07-01

    Paired helical filaments (PHFs) are abnormal twisted filaments composed of hyperphosphorylated tau protein. They are found in Alzheimer's disease and other neurodegenerative disorders designated as tauopathies. They are a major component of intracellular inclusions known as neurofibrillary tangles (NFTs). The objective of this review is to summarize various structural studies of PHFs in which using scanning transmission electron microscopy (STEM) has been particularly informative. STEM provides shape and mass per unit length measurements important for studying ultrastructural aspects of filaments. These include quantitative comparisons between dispersed and aggregated populations of PHFs as well as comparative studies of PHFs in Alzheimer's disease and other neurodegenerative disorders. Other approaches are also discussed if relevant or complementary to studies using STEM, e.g., application of a novel staining reagent, Nanovan. Our understanding of the PHF structure and the development of PHFs into NFTs is presented from a historical perspective. Others goals are to describe the biochemical and ultrastructural complexity of authentic PHFs, to assess similarities between authentic and synthetic PHFs, and to discuss recent advances in PHF modeling.

  10. Paired quantum Hall states on noncommutative two-tori

    NASA Astrophysics Data System (ADS)

    Marotta, Vincenzo; Naddeo, Adele

    2010-08-01

    By exploiting the notion of Morita equivalence for field theories on noncommutative tori and choosing rational values of the noncommutativity parameter θ (in appropriate units), a one-to-one correspondence between an Abelian noncommutative field theory (NCFT) and a non-Abelian theory of twisted fields on ordinary space can be established. Starting from this general result, we focus on the conformal field theory (CFT) describing a quantum Hall fluid (QHF) at paired states fillings ν=mp/m+2 Cristofano et al. (2000) [1], recently obtained by means of m-reduction procedure, and show that it is the Morita equivalent of a NCFT. In this way we extend the construction proposed in Marotta and Naddeo (2008) [2] for the Jain series ν=>m2p/m+1. The case m=2 is explicitly discussed and the role of noncommutativity in the physics of quantum Hall bilayers is emphasized. Our results represent a step forward the construction of a new effective low energy description of certain condensed matter phenomena and help to clarify the relationship between noncommutativity and quantum Hall fluids.

  11. DNA denaturation bubbles: free-energy landscape and nucleation/closure rates.

    PubMed

    Sicard, François; Destainville, Nicolas; Manghi, Manoel

    2015-01-21

    The issue of the nucleation and slow closure mechanisms of non-superhelical stress-induced denaturation bubbles in DNA is tackled using coarse-grained MetaDynamics and Brownian simulations. A minimal mesoscopic model is used where the double helix is made of two interacting bead-spring rotating strands with a prescribed torsional modulus in the duplex state. We demonstrate that timescales for the nucleation (respectively, closure) of an approximately 10 base-pair bubble, in agreement with experiments, are associated with the crossing of a free-energy barrier of 22 kBT (respectively, 13 kBT) at room temperature T. MetaDynamics allows us to reconstruct accurately the free-energy landscape, to show that the free-energy barriers come from the difference in torsional energy between the bubble and duplex states, and thus to highlight the limiting step, a collective twisting, that controls the nucleation/closure mechanism, and to access opening time scales on the millisecond range. Contrary to small breathing bubbles, those more than 4 base-pair bubbles are of biological relevance, for example, when a pre-existing state of denaturation is required by specific DNA-binding proteins.

  12. Far infrared promotes wound healing through activation of Notch1 signaling.

    PubMed

    Hsu, Yung-Ho; Lin, Yuan-Feng; Chen, Cheng-Hsien; Chiu, Yu-Jhe; Chiu, Hui-Wen

    2017-11-01

    The Notch signaling pathway is critically involved in cell proliferation, differentiation, development, and homeostasis. Far infrared (FIR) has an effect that promotes wound healing. However, the underlying molecular mechanisms are unclear. In the present study, we employed in vivo and HaCaT (a human skin keratinocyte cell line) models to elucidate the role of Notch1 signaling in FIR-promoted wound healing. We found that FIR enhanced keratinocyte migration and proliferation. FIR induced the Notch1 signaling pathway in HaCaT cells and in a microarray dataset from the Gene Expression Omnibus database. We next determined the mRNA levels of NOTCH1 in paired normal and wound skin tissues derived from clinical patients using the microarray dataset and Ingenuity Pathway Analysis software. The result indicated that the Notch1/Twist1 axis plays important roles in wound healing and tissue repair. In addition, inhibiting Notch1 signaling decreased the FIR-enhanced proliferation and migration. In a full-thickness wound model in rats, the wounds healed more rapidly and the scar size was smaller in the FIR group than in the light group. Moreover, FIR could increase Notch1 and Delta1 in skin tissues. The activation of Notch1 signaling may be considered as a possible mechanism for the promoting effect of FIR on wound healing. FIR stimulates keratinocyte migration and proliferation. Notch1 in keratinocytes has an essential role in FIR-induced migration and proliferation. NOTCH1 promotes TWIST1-mediated gene expression to assist wound healing. FIR might promote skin wound healing in a rat model. FIR stimulates keratinocyte migration and proliferation. Notch1 in keratinocytes has an essential role in FIR-induced migration and proliferation. NOTCH1 promotes TWIST1-mediated gene expression to assist wound healing. FIR might promote skin wound healing in a rat model.

  13. Enhanced epithelial to mesenchymal transition (EMT) and upregulated MYC in ectopic lesions contribute independently to endometriosis.

    PubMed

    Proestling, Katharina; Birner, Peter; Gamperl, Susanne; Nirtl, Nadine; Marton, Erika; Yerlikaya, Gülen; Wenzl, Rene; Streubel, Berthold; Husslein, Heinrich

    2015-07-22

    Epithelial to mesenchymal transition (EMT) is a process in which epithelial cells lose polarity and cell-to-cell contacts and acquire the migratory and invasive abilities of mesenchymal cells. These abilities are thought to be prerequisites for the establishment of endometriotic lesions. A hallmark of EMT is the functional loss of E-cadherin (CDH1) expression in epithelial cells. TWIST1, a transcription factor that represses E-cadherin transcription, is among the EMT inducers. SNAIL, a zinc-finger transcription factor, and its close relative SLUG have similar properties to TWIST1 and are thus also EMT inducers. MYC, which is upregulated by estrogens in the uterus by an estrogen response cis-acting element (ERE) in its promoter, is associated with proliferation in endometriosis. The role of EMT and proliferation in the pathogenesis of endometriosis was evaluated by analyzing TWIST1, CDH1 and MYC expression. CDH1, TWIST1, SNAIL and SLUG mRNA expression was analyzed by qRT-PCR from 47 controls and 74 patients with endometriosis. Approximately 42 ectopic and 62 eutopic endometrial tissues, of which 30 were matched samples, were collected during the same surgical procedure. We evaluated TWIST1 and MYC protein expression by immunohistochemistry (IHC) in the epithelial and stromal tissue of 69 eutopic and 90 ectopic endometrium samples, of which 49 matched samples were analyzed from the same patient. Concordant expression of TWIST1/SNAIL/SLUG and CDH1 but also of TWIST1 and MYC was analyzed. We found that TWIST1, SNAIL and SLUG are overexpressed (p < 0.001, p = 0.016 and p < 0.001) in endometriosis, while CDH1 expression was concordantly reduced in these samples (p < 0.001). Similar to TWIST1, the epithelial expression of MYC was also significantly enhanced in ectopic endometrium compared to eutopic tissues (p = 0.008). We found exclusive expression of either TWIST1 or MYC in the same samples (p = 0.003). Epithelial TWIST1 is overexpressed in endometriosis and may contribute to the formation of endometriotic lesions by inducing epithelial to mesenchymal transition, as CDH1 was reduced in ectopic lesions. We found exclusive expression of either TWIST1 or MYC in the same samples, indicating that EMT and proliferation contribute independently of each other to the formation of endometriotic lesions.

  14. Description of the HiMAT Tailored composite structure and laboratory measured vehicle shape under load

    NASA Technical Reports Server (NTRS)

    Monaghan, R. C.

    1981-01-01

    The aeroelastically tailored outer wing and canard of the highly maneuverable aircraft technology (HiMAT) vehicle are closely examined and a general description of the overall structure of the vehicle is provided. Test data in the form of laboratory measured twist under load and predicted twist from the HiMAT NASTRAN structural design program are compared. The results of this comparison indicate that the measured twist is generally less than the NASTRAN predicted twist. These discrepancies in twist predictions are attributed, at least in part, to the inability of current analytical composite materials programs to provide sufficiently accurate properties of matrix dominated laminates for input into structural programs such as NASTRAN.

  15. Demonstration of an elastically coupled twist control concept for tilt rotor blade application

    NASA Technical Reports Server (NTRS)

    Lake, R. C.; Nixon, M. W.; Wilbur, M. L.; Singleton, J. D.; Mirick, P. H.

    1994-01-01

    The purpose of this Note is to present results from an analytic/experimental study that investigated the potential for passively changing blade twist through the use of extension-twist coupling. A set of composite model rotor blades was manufactured from existing blade molds for a low-twist metal helicopter rotor blade, with a view toward establishing a preliminary proof concept for extension-twist-coupled rotor blades. Data were obtained in hover for both a ballasted and unballasted blade configuration in sea-level atmospheric conditions. Test data were compared with results obtained from a geometrically nonlinear analysis of a detailed finite element model of the rotor blade developed in MSC/NASTRAN.

  16. A photometric determination of twists in early-type galaxies. II

    NASA Technical Reports Server (NTRS)

    Williams, T. B.; Schwarzschild, M.

    1979-01-01

    In continuation of previous work, detailed photometric data have been obtained for two elliptical galaxies by using the Mount Lemmon 1.5-m telescope and a large SEC television camera. As before, the aim of this photometry is to gain additional information on the occurrence of twists in such galaxies; i.e., on the change of the position angle of the major axes of the isophotes from the center outward. No significant twist was found in NGC 1052. However, NGC 584 was found to have a securely observed twist of about 10 deg within 10 kpc from its center. These data strengthen previous indications that many ellipticals contain twists in their inner, bright portions.

  17. Lifshits Tails for Randomly Twisted Quantum Waveguides

    NASA Astrophysics Data System (ADS)

    Kirsch, Werner; Krejčiřík, David; Raikov, Georgi

    2018-03-01

    We consider the Dirichlet Laplacian H_γ on a 3D twisted waveguide with random Anderson-type twisting γ . We introduce the integrated density of states N_γ for the operator H_γ , and investigate the Lifshits tails of N_γ , i.e. the asymptotic behavior of N_γ (E) as E \\downarrow \\inf supp dN_γ . In particular, we study the dependence of the Lifshits exponent on the decay rate of the single-site twisting at infinity.

  18. Twisted Vanes Would Enhance Fuel/Air Mixing In Turbines

    NASA Technical Reports Server (NTRS)

    Nguyen, H. Lee; Micklow, Gerald J.; Dogra, Anju S.

    1994-01-01

    Computations of flow show performance of high-shear airblast fuel injector in gas-turbine engine enhanced by use of appropriately proportioned twisted (instead of flat) dome swirl vanes. Resultant more nearly uniform fuel/air mixture burns more efficiently, emitting smaller amounts of nitrogen oxides. Twisted-vane high-shear airblast injectors also incorporated into paint sprayers, providing advantages of low pressure drop characteristic of airblast injectors in general and finer atomization of advanced twisted-blade design.

  19. Thymoquinone inhibits cancer metastasis by downregulating TWIST1 expression to reduce epithelial to mesenchymal transition.

    PubMed

    Khan, Md Asaduzzaman; Tania, Mousumi; Wei, Chunli; Mei, Zhiqiang; Fu, Shelly; Cheng, Jingliang; Xu, Jianming; Fu, Junjiang

    2015-08-14

    Proteins that promote epithelial to mesenchymal transition (EMT) are associated with cancer metastasis. Inhibition of EMT regulators may be a promising approach in cancer therapy. In this study, Thymoquinone (TQ) was used to treat cancer cell lines to investigate its effects on EMT-regulatory proteins and cancer metastasis. We show that TQ inhibited cancer cell growth, migration and invasion in a dose-dependent manner. At the molecular level, TQ treatment decreased the transcriptional activity of the TWIST1 promoter and the mRNA expression of TWIST1, an EMT-promoting transcription factor. Accordingly, TQ treatment also decreased the expression of TWIST1-upregulated genes such as N-Cadherin and increased the expression of TWIST1-repressed genes such as E-Cadherin, resulting in a reduction of cell migration and invasion. TQ treatment also inhibited the growth and metastasis of cancer cell-derived xenograft tumors in mice but partially attenuated the migration and invasion in TWIST1-overexpressed cell lines. Furthermore, we found that TQ treatment enhanced the promoter DNA methylation of the TWIST1 gene in BT 549 cells. Together, these results demonstrate that TQ treatment inhibits TWIST1 promoter activity and decreases its expression, leading to the inhibition of cancer cell migration, invasion and metastasis. These findings suggest TQ as a potential small molecular inhibitor of cancer growth and metastasis.

  20. Thymoquinone inhibits cancer metastasis by downregulating TWIST1 expression to reduce epithelial to mesenchymal transition

    PubMed Central

    Khan, Md. Asaduzzaman; Tania, Mousumi; Wei, Chunli; Mei, Zhiqiang; Fu, Shelly; Cheng, Jingliang; Xu, Jianming; Fu, Junjiang

    2015-01-01

    Proteins that promote epithelial to mesenchymal transition (EMT) are associated with cancer metastasis. Inhibition of EMT regulators may be a promising approach in cancer therapy. In this study, Thymoquinone (TQ) was used to treat cancer cell lines to investigate its effects on EMT-regulatory proteins and cancer metastasis. We show that TQ inhibited cancer cell growth, migration and invasion in a dose-dependent manner. At the molecular level, TQ treatment decreased the transcriptional activity of the TWIST1 promoter and the mRNA expression of TWIST1, an EMT-promoting transcription factor. Accordingly, TQ treatment also decreased the expression of TWIST1-upregulated genes such as N-Cadherin and increased the expression of TWIST1-repressed genes such as E-Cadherin, resulting in a reduction of cell migration and invasion. TQ treatment also inhibited the growth and metastasis of cancer cell-derived xenograft tumors in mice but partially attenuated the migration and invasion in TWIST1-overexpressed cell lines. Furthermore, we found that TQ treatment enhanced the promoter DNA methylation of the TWIST1 gene in BT 549 cells. Together, these results demonstrate that TQ treatment inhibits TWIST1 promoter activity and decreases its expression, leading to the inhibition of cancer cell migration, invasion and metastasis. These findings suggest TQ as a potential small molecular inhibitor of cancer growth and metastasis. PMID:26023736

  1. Projection Moire Interferometry for Rotorcraft Applications: Deformation Measurements of Active Twist Rotor Blades

    NASA Technical Reports Server (NTRS)

    Fleming, Gary A.; Soto, Hector L.; South, Bruce W.

    2002-01-01

    Projection Moire Interferometry (PMI) has been used during wind tunnel tests to obtain azimuthally dependent blade bending and twist measurements for a 4-bladed Active Twist Rotor (ATR) system in simulated forward flight. The ATR concept offers a means to reduce rotor vibratory loads and noise by using piezoelectric active fiber composite actuators embedded in the blade structure to twist each blade as they rotate throughout the rotor azimuth. The twist imparted on the blades for blade control causes significant changes in blade loading, resulting in complex blade deformation consisting of coupled bending and twist. Measurement of this blade deformation is critical in understanding the overall behavior of the ATR system and the physical mechanisms causing the reduction in rotor loads and noise. PMI is a non-contacting, video-based optical measurement technique capable of obtaining spatially continuous structural deformation measurements over the entire object surface within the PMI system field-of-view. When applied to rotorcraft testing, PMI can be used to measure the azimuth-dependent blade bending and twist along the full span of the rotor blade. This paper presents the PMI technique as applied to rotorcraft testing, and provides results obtained during the ATR tests demonstrating the PMI system performance. PMI measurements acquired at select blade actuation conditions generating minimum and maximum rotor loads are provided to explore the interrelationship between rotor loads, blade bending, and twist.

  2. Recurrent Mutations in the Basic Domain of TWIST2 Cause Ablepharon Macrostomia and Barber-Say Syndromes.

    PubMed

    Marchegiani, Shannon; Davis, Taylor; Tessadori, Federico; van Haaften, Gijs; Brancati, Francesco; Hoischen, Alexander; Huang, Haigen; Valkanas, Elise; Pusey, Barbara; Schanze, Denny; Venselaar, Hanka; Vulto-van Silfhout, Anneke T; Wolfe, Lynne A; Tifft, Cynthia J; Zerfas, Patricia M; Zambruno, Giovanna; Kariminejad, Ariana; Sabbagh-Kermani, Farahnaz; Lee, Janice; Tsokos, Maria G; Lee, Chyi-Chia R; Ferraz, Victor; da Silva, Eduarda Morgana; Stevens, Cathy A; Roche, Nathalie; Bartsch, Oliver; Farndon, Peter; Bermejo-Sanchez, Eva; Brooks, Brian P; Maduro, Valerie; Dallapiccola, Bruno; Ramos, Feliciano J; Chung, Hon-Yin Brian; Le Caignec, Cédric; Martins, Fabiana; Jacyk, Witold K; Mazzanti, Laura; Brunner, Han G; Bakkers, Jeroen; Lin, Shuo; Malicdan, May Christine V; Boerkoel, Cornelius F; Gahl, William A; de Vries, Bert B A; van Haelst, Mieke M; Zenker, Martin; Markello, Thomas C

    2015-07-02

    Ablepharon macrostomia syndrome (AMS) and Barber-Say syndrome (BSS) are rare congenital ectodermal dysplasias characterized by similar clinical features. To establish the genetic basis of AMS and BSS, we performed extensive clinical phenotyping, whole exome and candidate gene sequencing, and functional validations. We identified a recurrent de novo mutation in TWIST2 in seven independent AMS-affected families, as well as another recurrent de novo mutation affecting the same amino acid in ten independent BSS-affected families. Moreover, a genotype-phenotype correlation was observed, because the two syndromes differed based solely upon the nature of the substituting amino acid: a lysine at TWIST2 residue 75 resulted in AMS, whereas a glutamine or alanine yielded BSS. TWIST2 encodes a basic helix-loop-helix transcription factor that regulates the development of mesenchymal tissues. All identified mutations fell in the basic domain of TWIST2 and altered the DNA-binding pattern of Flag-TWIST2 in HeLa cells. Comparison of wild-type and mutant TWIST2 expressed in zebrafish identified abnormal developmental phenotypes and widespread transcriptome changes. Our results suggest that autosomal-dominant TWIST2 mutations cause AMS or BSS by inducing protean effects on the transcription factor's DNA binding. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  3. Cable equation for general geometry

    NASA Astrophysics Data System (ADS)

    López-Sánchez, Erick J.; Romero, Juan M.

    2017-02-01

    The cable equation describes the voltage in a straight cylindrical cable, and this model has been employed to model electrical potential in dendrites and axons. However, sometimes this equation might give incorrect predictions for some realistic geometries, in particular when the radius of the cable changes significantly. Cables with a nonconstant radius are important for some phenomena, for example, discrete swellings along the axons appear in neurodegenerative diseases such as Alzheimers, Parkinsons, human immunodeficiency virus associated dementia, and multiple sclerosis. In this paper, using the Frenet-Serret frame, we propose a generalized cable equation for a general cable geometry. This generalized equation depends on geometric quantities such as the curvature and torsion of the cable. We show that when the cable has a constant circular cross section, the first fundamental form of the cable can be simplified and the generalized cable equation depends on neither the curvature nor the torsion of the cable. Additionally, we find an exact solution for an ideal cable which has a particular variable circular cross section and zero curvature. For this case we show that when the cross section of the cable increases the voltage decreases. Inspired by this ideal case, we rewrite the generalized cable equation as a diffusion equation with a source term generated by the cable geometry. This source term depends on the cable cross-sectional area and its derivates. In addition, we study different cables with swelling and provide their numerical solutions. The numerical solutions show that when the cross section of the cable has abrupt changes, its voltage is smaller than the voltage in the cylindrical cable. Furthermore, these numerical solutions show that the voltage can be affected by geometrical inhomogeneities on the cable.

  4. Non-contact data access with direction identification for industrial differential serial bus

    NASA Astrophysics Data System (ADS)

    Xie, Kai; Li, Xiaoping; Zhang, Hanlu; Yang, Ming; Ye, Yinghao

    2013-06-01

    We propose a non-contact method for accessing data in industrial differential serial bus applications, which could serve as an effective and safe online testing and diagnosing tool. The data stream and the transmission direction are reconstructed simultaneously from the near-field emanations of a twisted pair, eliminating direct contact with the actual conductors, and avoiding damage to the insulation (only the outer sheathing is removed). A non-contact probe with the ability to sense electric and magnetic fields is presented, as are theories for data reconstruction, direction identification, and a circuit implementation. The prototype was built using inexpensive components and then tested on a standard RS-485 industrial serial bus. Experimental results verified the validity of the proposed scheme.

  5. Star-triangle and star-star relations in statistical mechanics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baxter, R.J.

    1997-01-20

    The homogeneous three-layer Zamolodchikov model is equivalent to a four-state model on the checkerboard lattice which closely resembles the four-state critical Potts model, but with some of its Boltzmann weights negated. Here the author shows that it satisfies a star-to-reverse-star (or simply star-star) relation, even though they know of no star-triangle relation for this model. For any nearest-neighbor checkerboard model, they show that this star-star relation is sufficient to ensure that the decimated model (where half the spins have been summed over) satisfies a twisted Yang-Baxter relation. This ensures that the transfer matrices of the original model commute in pairs,more » which is an adequate condition for solvability.« less

  6. Enhanced sampling simulations of DNA step parameters.

    PubMed

    Karolak, Aleksandra; van der Vaart, Arjan

    2014-12-15

    A novel approach for the selection of step parameters as reaction coordinates in enhanced sampling simulations of DNA is presented. The method uses three atoms per base and does not require coordinate overlays or idealized base pairs. This allowed for a highly efficient implementation of the calculation of all step parameters and their Cartesian derivatives in molecular dynamics simulations. Good correlation between the calculated and actual twist, roll, tilt, shift, and slide parameters is obtained, while the correlation with rise is modest. The method is illustrated by its application to the methylated and unmethylated 5'-CATGTGACGTCACATG-3' double stranded DNA sequence. One-dimensional umbrella simulations indicate that the flexibility of the central CG step is only marginally affected by methylation. © 2014 Wiley Periodicals, Inc.

  7. Multimedia article. The keys to the new laparoscopic world Thumbs up! knot and Tornado knot.

    PubMed

    Uchida, K; Haruta, N; Okajima, M; Matsuda, M; Yamamoto, M

    2005-06-01

    Most laparoscopic surgeons feel some anxiety when performing intracorporeal knotting with conventional techniques [1, 2]. Two factors contribute to this anxiety. The first is the necessity of recognizing three dimensions on a two-dimensional monitor. The conventional intracorporeal knotting techniques make loops by twisting the thread with a second pair of forceps. This necessitates cooperative movement of both hands, with the added difficulties of depth perception. Regular touch confirmations reduce problems with depth perception. However, touch confirmation is more complicated in laparoscopic surgery than in laparotomy. The second problem is that tied loops can come loose and escape the instruments, especially with hard thread. This is not only stressful but also increases operation time.

  8. Three-Dimensional Rotation, Twist and Torsion Analyses Using Real-Time 3D Speckle Tracking Imaging: Feasibility, Reproducibility, and Normal Ranges in Pediatric Population.

    PubMed

    Zhang, Li; Zhang, Jing; Han, Wei; Gao, Jun; He, Lin; Yang, Yali; Yin, Ping; Xie, Mingxing; Ge, Shuping

    2016-01-01

    The specific aim of this study was to evaluate the feasibility, reproducibility and maturational changes of LV rotation, twist and torsion variables by real-time 3D speckle-tracking echocardiography (RT3DSTE) in children. A prospective study was conducted in 347 consecutive healthy subjects (181 males/156 females, mean age 7.12 ± 5.3 years, and range from birth to 18-years) using RT 3D echocardiography (3DE). The LV rotation, twist and torsion measurements were made off-line using TomTec software. Manual landmark selection and endocardial border editing were performed in 3 planes (apical "2"-, "4"-, and "3"- chamber views) and semi-automated tracking yielded LV rotation, twist and torsion measurements. LV rotation, twist and torsion analysis by RT 3DSTE were feasible in 307 out of 347 subjects (88.5%). There was no correlation between rotation or twist and age, height, weight, BSA or heart rate, respectively. However, there was statistically significant, but very modest correlation between LV torsion and age (R2 = 0.036, P< 0.001). The normal ranges were defined for rotation and twist in this cohort, and for torsion for each age group. The intra-observer and inter-observer variabilities for apical and basal rotation, twist and torsion ranged from 7.3% ± 3.8% to 12.3% ± 8.8% and from 8.8% ± 4.6% to 15.7% ± 10.1%, respectively. We conclude that analysis of LV rotation, twist and torsion by this new RT3D STE is feasible and reproducible in pediatric population. There is no maturational change in rotation and twist, but torsion decreases with age in this cohort. Further refinement is warranted to validate the utility of this new methodology in more sensitive and quantitative evaluation of congenital and acquired heart diseases in children.

  9. Low-Frequency Interlayer Raman Modes to Probe Interface of Twisted Bilayer MoS 2

    DOE PAGES

    Huang, Shengxi; Liang, Liangbo; Ling, Xi; ...

    2016-02-21

    A variety of van der Waals homo- and hetero- structures assembled by stamping monolayers together present optoelectronic properties suitable for diverse applications. Understanding the details of the interlayer stacking and resulting coupling is crucial for tuning these properties. Twisted bilayer transition metal dichalcogenides offer a great platform for developing a precise understanding of the structure/property relationship. Here, we study the low-frequency interlayer shear and breathing Raman modes (<50 cm-1) in twisted bilayer MoS 2 by Raman spectroscopy and first-principles modeling. Twisting introduces both rotational and translational shifts and significantly alters the interlayer stacking and coupling, leading to notable frequency andmore » intensity changes of low-frequency modes. The frequency variation can be up to 8 cm-1 and the intensity can vary by a factor of ~5 for twisting near 0 and 60 , where the stacking is a mixture of multiple high-symmetry stacking patterns and is thus especially sensitive to twisting. Moreover, for twisting angles between 20 and 40 , the interlayer coupling is nearly constant since the stacking results in mismatched lattices over the entire sample. It follows that the Raman signature is relatively uniform. Interestingly, unlike the breathing mode, the shear mode is extremely sensitive to twisting: it disappears between 20 and 40 as its frequency drops to almost zero due to the stacking-induced mismatch. Note that for some samples, multiple breathing mode peaks appear, indicating non-uniform coupling across the interface. In contrast to the low-frequency interlayer modes, high-frequency intralayer Raman modes are much less sensitive to interlayer stacking and coupling, showing negligible changes upon twisting. Our research demonstrates the effectiveness of low-frequency Raman modes for probing the interfacial coupling and environment of twisted bilayer MoS2, and potentially other two-dimensional materials and heterostructures.« less

  10. Sunspot rotation. II. Effects of varying the field strength and twist of an emerging flux tube

    NASA Astrophysics Data System (ADS)

    Sturrock, Z.; Hood, A. W.

    2016-09-01

    Context. Observations of flux emergence indicate that rotational velocities may develop within sunspots. However, the dependence of this rotation on sub-photospheric field strength and twist remains largely unknown. Aims: We investigate the effects of varying the initial field strength and twist of an emerging sub-photospheric magnetic flux tube on the rotation of the sunspots at the photosphere. Methods: We consider a simple model of a stratified domain with a sub-photospheric interior layer and three overlying atmospheric layers. A twisted arched flux tube is inserted in the interior and is allowed to rise into the atmosphere. To achieve this, the magnetohydrodynamic equations are solved using the Lagrangian-remap code, Lare3d. We perform a parameter study by independently varying the sub-photospheric magnetic field strength and twist. Results: Altering the initial magnetic field strength and twist of the flux tube significantly affects the tube's evolution and the rotational motions that develop at the photosphere. The rotation angle, vorticity, and current show a direct dependence on the initial field strength. We find that an increase in field strength increases the angle through which the fieldlines rotate, the length of the fieldlines extending into the atmosphere, and the magnetic energy transported to the atmosphere. This also affects the amount of residual twist in the interior. The length of the fieldlines is crucial as we predict the twist per unit length equilibrates to a lower value on longer fieldlines. No such direct dependence is found when we modify the twist of the magnetic field owing to the complex effect this has on the tension force acting on the tube. However, there is still a clear ordering in quantities such as the rotation angle, helicity, and free energy with higher initial twist cases being related to sunspots that rotate more rapidly, transporting more helicity and magnetic energy to the atmosphere.

  11. Twist1 Transcriptional Targets in the Developing Atrio-Ventricular Canal of the Mouse

    PubMed Central

    Vrljicak, Pavle; Cullum, Rebecca; Xu, Eric; Chang, Alex C. Y.; Wederell, Elizabeth D.; Bilenky, Mikhail; Jones, Steven J. M.; Marra, Marco A.; Karsan, Aly; Hoodless, Pamela A.

    2012-01-01

    Malformations of the cardiovascular system are the most common type of birth defect in humans, frequently affecting the formation of valves and septa. During heart valve and septa formation, cells from the atrio-ventricular canal (AVC) and outflow tract (OFT) regions of the heart undergo an epithelial-to-mesenchymal transformation (EMT) and invade the underlying extracellular matrix to give rise to endocardial cushions. Subsequent maturation of newly formed mesenchyme cells leads to thin stress-resistant leaflets. TWIST1 is a basic helix-loop-helix transcription factor expressed in newly formed mesenchyme cells of the AVC and OFT that has been shown to play roles in cell survival, cell proliferation and differentiation. However, the downstream targets of TWIST1 during heart valve formation remain unclear. To identify genes important for heart valve development downstream of TWIST1, we performed global gene expression profiling of AVC, OFT, atria and ventricles of the embryonic day 10.5 mouse heart by tag-sequencing (Tag-seq). Using this resource we identified a novel set of 939 genes, including 123 regulators of transcription, enriched in the valve forming regions of the heart. We compared these genes to a Tag-seq library from the Twist1 null developing valves revealing significant gene expression changes. These changes were consistent with a role of TWIST1 in controlling differentiation of mesenchymal cells following their transformation from endothelium in the mouse. To study the role of TWIST1 at the DNA level we performed chromatin immunoprecipitation and identified novel direct targets of TWIST1 in the developing heart valves. Our findings support a role for TWIST1 in the differentiation of AVC mesenchyme post-EMT in the mouse, and suggest that TWIST1 can exert its function by direct DNA binding to activate valve specific gene expression. PMID:22815831

  12. Experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers

    NASA Astrophysics Data System (ADS)

    Yin, Long-Jing; Qiao, Jia-Bin; Zuo, Wei-Jie; Li, Wen-Tian; He, Lin

    2015-08-01

    Non-Abelian gauge potentials are quite relevant in subatomic physics, but they are relatively rare in a condensed matter context. Here we report the experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers by scanning tunneling microscopy and spectroscopy. At a magic twisted angle, θ ≈(1.11±0.05 ) ∘ , a pronounced sharp peak, which arises from the nondispersive flat bands at the charge neutrality point, is observed in the tunneling density of states due to the action of the non-Abelian gauge fields. Moreover, we observe confined electronic states in the twisted bilayer, as manifested by regularly spaced tunneling peaks with energy spacing δ E ≈vF/D ≈70 meV (here vF is the Fermi velocity of graphene and D is the period of the moiré patterns). This indicates that the non-Abelian gauge potentials in twisted graphene bilayers confine low-energy electrons into a triangular array of quantum dots following the modulation of the moiré patterns. Our results also directly demonstrate that the Fermi velocity in twisted bilayers can be tuned from about 106m /s to zero by simply reducing the twisted angle of about 2∘.

  13. Twist phase-induced characteristics changes of a radially polarized Gaussian Schell-Model beam in a uniaxial crystal orthogonal to the optical axis

    NASA Astrophysics Data System (ADS)

    Cao, Pengfei; Fu, Wenyu

    2017-10-01

    Based on the extended Huygens-Fresnel integral formula and unified theory of coherence and polarization, we obtained the cross-spectral density matrix elements for a radially polarized partially coherent twist (RPPCT) beam in a uniaxial crystal. Moreover, compared with free space, we explore numerically the evolution properties of a RPPCT beam in a uniaxial crystal. The calculation results show that the evolution properties of a RPPCT beam in crystals are substantially different from its properties in free space. These properties in crystals are mainly determined by the twist factor and the ratio of extraordinary index to ordinary refractive index. In a uniaxial crystal, the distribution of the intensity of a RPPCT beam all exhibits non-circular symmetry, and these distributions change with twist factor and the ratio of extraordinary index to ordinary refractive index. The twist factor affects their rotation orientation angles, and the ratio of extraordinary index to ordinary refractive index impacts their twisted levels. This novel characteristics can be used for free-space optical communications, particle manipulation and nonlinear optics, where partially coherent beam with controlled profile and twist factor are required.

  14. Cross-scale transport processes in the three-dimensional Kelvin-Helmholtz instability

    NASA Astrophysics Data System (ADS)

    Delamere, P. A.; Burkholder, B. L.; Ma, X.; Nykyri, K.

    2017-12-01

    The Kelvin-Helmholtz (KH) instability is a crucial aspect of the solar wind interaction with the giant magnetospheres. Rapid internal rotation of the magnetodisc produces conditions favorable for the growth of KH vortices along much of the equatorial magnetopause boundary. Pronounced dawn/dusk asymmetries at Jupiter and Saturn indicate a robust interaction with the solar wind. Using three-dimensional hybrid simulations we investigate the transport processes associated with the flow shear-driven KH instability. Of particular importance is small-scale and intermittent reconnection generated by the twisting of the magnetic field into configurations with antiparallel components. In three-dimensions strong guide field reconnection can occur even for initially parallel magnetic field configurations. Often the twisting motion leads to pairs of reconnection sites that can operate asynchronously, generating intermittent open flux and Maxwell stresses at the magnetopause boundary. We quantify the generation of open flux using field line tracing methods, determine the Reynolds and Maxwell stresses, and evaluate the mass transport as functions of magnetic shear, velocity shear, electron pressure and plasma beta. These results are compared with magnetohydrodynamic simulations (Ma et al., 2017). In addition, we present preliminary results for the role of cross-scale coupling processes, from fluid to ion scales. In particular, we characterize small-scale waves and the their role in mixing, diffusing and heating plasma at the magnetopause boundary.

  15. Scleraxis is a transcriptional activator that regulates the expression of Tenomodulin, a marker of mature tenocytes and ligamentocytes.

    PubMed

    Shukunami, Chisa; Takimoto, Aki; Nishizaki, Yuriko; Yoshimoto, Yuki; Tanaka, Seima; Miura, Shigenori; Watanabe, Hitomi; Sakuma, Tetsushi; Yamamoto, Takashi; Kondoh, Gen; Hiraki, Yuji

    2018-02-16

    Tenomodulin (Tnmd) is a type II transmembrane glycoprotein predominantly expressed in tendons and ligaments. We found that scleraxis (Scx), a member of the Twist-family of basic helix-loop-helix transcription factors, is a transcriptional activator of Tnmd expression in tenocytes. During embryonic development, Scx expression preceded that of Tnmd. Tnmd expression was nearly absent in tendons and ligaments of Scx-deficient mice generated by transcription activator-like effector nucleases-mediated gene disruption. Tnmd mRNA levels were dramatically decreased during serial passages of rat tenocytes. Scx silencing by small interfering RNA significantly suppressed endogenous Tnmd mRNA levels in tenocytes. Mouse Tnmd contains five E-box sites in the ~1-kb 5'-flanking region. A 174-base pair genomic fragment containing a TATA box drives transcription in tenocytes. Enhancer activity was increased in the upstream region (-1030 to -295) of Tnmd in tenocytes, but not in NIH3T3 and C3H10T1/2 cells. Preferential binding of both Scx and Twist1 as a heterodimer with E12 or E47 to CAGATG or CATCTG and transactivation of the 5'-flanking region were confirmed by electrophoresis mobility shift and dual luciferase assays, respectively. Scx directly transactivates Tnmd via these E-boxes to positively regulate tenocyte differentiation and maturation.

  16. Formation of Magnetic Flux Ropes during a Confined Flaring Well before the Onset of a Pair of Major Coronal Mass Ejections

    NASA Astrophysics Data System (ADS)

    Chintzoglou, Georgios; Patsourakos, Spiros; Vourlidas, Angelos

    2015-08-01

    NOAA active region (AR) 11429 was the source of twin super-fast coronal mass ejections (CMEs). The CMEs took place within an hour from each other, with the onset of the first taking place in the beginning of 2012 March 7. This AR fulfills all the requirements for a “super active region” namely, Hale's law incompatibility and a δ-spot magnetic configuration. One of the biggest storms of Solar Cycle 24 to date ({D}{st}=-143 nT) was associated with one of these events. Magnetic flux ropes (MFRs) are twisted magnetic structures in the corona, best seen in ˜10 MK hot plasma emission and are often considered the core of erupting structures. However, their “dormant” existence in the solar atmosphere (i.e., prior to eruptions), is an open question. Aided by multi-wavelength observations by the Solar Dynamics Observatory (SDO) and by the Solar Terrestrial Relations Observatory (STEREO) and a nonlinear force-free model for the coronal magnetic field, our work uncovers two separate, weakly twisted magnetic flux systems which suggest the existence of pre-eruption MFRs that eventually became the seeds of the two CMEs. The MFRs could have been formed during confined (i.e., not leading to major CMEs) flaring and sub-flaring events which took place the day before the two CMEs in the host AR 11429.

  17. Statistical mechanics of ribbons under bending and twisting torques.

    PubMed

    Sinha, Supurna; Samuel, Joseph

    2013-11-20

    We present an analytical study of ribbons subjected to an external torque. We first describe the elastic response of a ribbon within a purely mechanical framework. We then study the role of thermal fluctuations in modifying its elastic response. We predict the moment-angle relation of bent and twisted ribbons. Such a study is expected to shed light on the role of twist in DNA looping and on bending elasticity of twisted graphene ribbons. Our quantitative predictions can be tested against future single molecule experiments.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kleinert, J.; Haimberger, C.; Zabawa, P. J.

    We describe the realization of a dc electric-field trap for ultracold polar molecules, the thin-wire electrostatic trap (TWIST). The thin wires that form the electrodes of the TWIST allow us to superimpose the trap onto a magneto-optical trap (MOT). In our experiment, ultracold polar NaCs molecules in their electronic ground state are created in the MOT via photoassociation, achieving a continuous accumulation in the TWIST of molecules in low-field seeking states. Initial measurements show that the TWIST trap lifetime is limited only by the background pressure in the chamber.

  19. Morphing wing structure with controllable twist based on adaptive bending-twist coupling

    NASA Astrophysics Data System (ADS)

    Raither, Wolfram; Heymanns, Matthias; Bergamini, Andrea; Ermanni, Paolo

    2013-06-01

    A novel semi-passive morphing airfoil concept based on variable bending-twist coupling induced by adaptive shear center location and torsional stiffness is presented. Numerical parametric studies and upscaling show that the concept relying on smart materials permits effective twist control while offering the potential of being lightweight and energy efficient. By means of an experimental characterization of an adaptive beam and a scaled adaptive wing structure, effectiveness and producibility of the structural concept are demonstrated.

  20. Cable and Line Inspection Mechanism

    NASA Technical Reports Server (NTRS)

    Ross, Terence J. (Inventor)

    2003-01-01

    An automated cable and line inspection mechanism visually scans the entire surface of a cable as the mechanism travels along the cable=s length. The mechanism includes a drive system, a video camera, a mirror assembly for providing the camera with a 360 degree view of the cable, and a laser micrometer for measuring the cable=s diameter. The drive system includes an electric motor and a plurality of drive wheels and tension wheels for engaging the cable or line to be inspected, and driving the mechanism along the cable. The mirror assembly includes mirrors that are positioned to project multiple images of the cable on the camera lens, each of which is of a different portion of the cable. A data transceiver and a video transmitter are preferably employed for transmission of video images, data and commands between the mechanism and a remote control station.

  1. Cable and line inspection mechanism

    NASA Technical Reports Server (NTRS)

    Ross, Terence J. (Inventor)

    2003-01-01

    An automated cable and line inspection mechanism visually scans the entire surface of a cable as the mechanism travels along the cable=s length. The mechanism includes a drive system, a video camera, a mirror assembly for providing the camera with a 360 degree view of the cable, and a laser micrometer for measuring the cable=s diameter. The drive system includes an electric motor and a plurality of drive wheels and tension wheels for engaging the cable or line to be inspected, and driving the mechanism along the cable. The mirror assembly includes mirrors that are positioned to project multiple images of the cable on the camera lens, each of which is of a different portion of the cable. A data transceiver and a video transmitter are preferably employed for transmission of video images, data and commands between the mechanism and a remote control station.

  2. Mechanisms of Cables 1 gene inactivation in human ovarian cancer development.

    PubMed

    Sakamoto, Hideo; Friel, Anne M; Wood, Antony W; Guo, Lankai; Ilic, Ana; Seiden, Michael V; Chung, Daniel C; Lynch, Maureen P; Serikawa, Takehiro; Munro, Elizabeth; Oliva, Esther; Orsulic, Sandra; Kirley, Sandra D; Foster, Rosemary; Zukerberg, Lawrence R; Rueda, Bo R

    2008-02-01

    Cables 1, a cyclin-dependent kinase binding protein, is primarily involved in cell cycle regulation. Loss of nuclear Cables 1 expression is observed in human colon, lung and endometrial cancers. We previously reported that loss of nuclear Cables 1 expression was also observed with high frequency in a limited sample set of human ovarian carcinomas, although the mechanisms underlying loss of nuclear Cables 1 expression remained unknown. Our present objective was to examine Cables 1 expression in ovarian cancer in greater detail, and determine the predominant mechanisms of Cables 1 loss. We assessed potential genetic and epigenetic modifications of the Cables 1 locus through analyses of mutation, polymorphisms, loss of heterozygosity and DNA methylation. We observed a marked loss of nuclear Cables 1 expression in serous and endometrioid ovarian carcinomas that correlated with decreased Cables 1 mRNA levels. Although we detected no Cables 1 mutations, there was evidence of LOH at the Cables 1 locus and epigenetic modification of the Cables 1 promoter region in a subset of ovarian carcinomas and established cancer cell lines. From a functional perspective, over-expression of Cables 1 induced apoptosis, whereas, knockdown of Cables 1 negated this effect. Together these findings suggest that multiple mechanisms underlie the loss of Cables 1 expression in ovarian cancer cells, supporting the hypothesis that Cables 1 is a tumor suppressor in human ovarian cancer.

  3. Development of inspection robots for bridge cables.

    PubMed

    Yun, Hae-Bum; Kim, Se-Hoon; Wu, Liuliu; Lee, Jong-Jae

    2013-01-01

    This paper presents the bridge cable inspection robot developed in Korea. Two types of the cable inspection robots were developed for cable-suspension bridges and cable-stayed bridge. The design of the robot system and performance of the NDT techniques associated with the cable inspection robot are discussed. A review on recent advances in emerging robot-based inspection technologies for bridge cables and current bridge cable inspection methods is also presented.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eiamsa-ard, Smith; Seemawute, Panida; Wongcharee, Khwanchit

    Effects of peripherally-cut twisted tape insert on heat transfer, friction loss and thermal performance factor characteristics in a round tube were investigated. Nine different peripherally-cut twisted tapes with constant twist ratio (y/W = 3.0) and different three tape depth ratios (DR = d/W = 0.11, 0.22 and 0.33), each with three different tape width ratios (WR = w/W = 0.11, 0.22 and 0.33) were tested. Besides, one typical twisted tape was also tested for comparison. The measurement of heat transfer rate was conducted under uniform heat flux condition while that of friction factor was performed under isothermal condition. Tests weremore » performed with Reynolds number in a range from 1000 to 20,000, using water as a working fluid. The experimental results revealed that both heat transfer rate and friction factor in the tube equipped with the peripherally-cut twisted tapes were significantly higher than those in the tube fitted with the typical twisted tape and plain tube, especially in the laminar flow regime. The higher turbulence intensity of fluid in the vicinity of the tube wall generated by the peripherally-cut twisted tape compared to that induced by the typical twisted tape is referred as the main reason for achieved results. The obtained results also demonstrated that as the depth ratio increased and width ratio decreased, the heat transfer enhancement increased. Over the range investigated, the peripherally-cut twisted tape enhanced heat transfer rates in term of Nusselt numbers up to 2.6 times (turbulent regime) and 12.8 times (laminar regime) of that in the plain tube. These corresponded to the maximum performance factors of 1.29 (turbulent regime) and 4.88 (laminar regime). (author)« less

  5. Cytoplasmic expression of Twist1, an EMT-related transcription factor, is associated with higher grades renal cell carcinomas and worse progression-free survival in clear cell renal cell carcinoma.

    PubMed

    Rasti, Arezoo; Madjd, Zahra; Abolhasani, Maryam; Mehrazma, Mitra; Janani, Leila; Saeednejad Zanjani, Leili; Asgari, Mojgan

    2018-05-01

    Twist1 is a key transcription factor, which confers tumor cells with cancer stem cell (CSC)-like characteristics and enhances epithelial-mesenchymal transition in pathological conditions including tumor malignancy and metastasis. This study aimed to evaluate the expression patterns and clinical significance of Twist1 in renal cell carcinoma (RCC). The cytoplasmic and nuclear expression of Twist1 were examined in 252 well-defined renal tumor tissues, including 173 (68.7%) clear cell renal cell carcinomas (ccRCC), 45 (17.9%) papillary renal cell carcinomas (pRCC) and 34 (13.5%) chromophobe renal cell carcinoma, by immunohistochemistry on a tissue microarray. The association between expression of this marker and clinicopathologic parameters and survival outcomes were then analyzed. Twist1 was mainly localized to the cytoplasm of tumor cells (98.8%). Increased cytoplasmic expression of Twist1 was associated with higher grade tumors (P = 0.045), renal vein invasion (P = 0.031) and microvascular invasion (P = 0.044) in RCC. It was positively correlated with higher grade tumors (P = 0.026), shorter progression-free survival time (P = 0.027) in patients with ccRCC, and also with higher stage in pRCC patients (P = 0.036). Significantly higher cytoplasmic expression levels of Twist1 were found in ccRCC and pRCC subtypes, due to their more aggressive tumor behavior. Increased cytoplasmic expression of Twist1 had a critical role in worse prognosis in ccRCC. These findings suggest that cytoplasmic, rather than nuclear expression of Twist1 can be considered as a prognostic and therapeutic marker for targeted therapy of RCC, especially for ccRCC patients.

  6. Analysis of a Caenorhabditis elegans Twist homolog identifies conserved and divergent aspects of mesodermal patterning

    PubMed Central

    Harfe, Brian D.; Gomes, Ana Vaz; Kenyon, Cynthia; Liu, Jun; Krause, Michael; Fire, Andrew

    1998-01-01

    Mesodermal development is a multistep process in which cells become increasingly specialized to form specific tissue types. In Drosophila and mammals, proper segregation and patterning of the mesoderm involves the bHLH factor Twist. We investigated the activity of a Twist-related factor, CeTwist, during Caenorhabditis elegans mesoderm development. Embryonic mesoderm in C. elegans derives from a number of distinct founder cells that are specified during the early lineages; in contrast, a single blast cell (M) is responsible for all nongonadal mesoderm formation during postembryonic development. Using immunofluorescence and reporter fusions, we determined the activity pattern of the gene encoding CeTwist. No activity was observed during specification of mesodermal lineages in the early embryo; instead, the gene was active within the M lineage and in a number of mesodermal cells with nonstriated muscle fates. A role for CeTwist in postembryonic mesodermal cell fate specification was indicated by ectopic expression and genetic interference assays. These experiments showed that CeTwist was responsible for activating two target genes normally expressed in specific subsets of nonstriated muscles derived from the M lineage. In vitro and in vivo assays suggested that CeTwist cooperates with the C. elegans E/Daughterless homolog in directly activating these targets. The two target genes that we have studied, ceh-24 and egl-15, encode an NK-2 class homeodomain and an FGF receptor (FGFR) homolog, respectively. Twist activates FGFR and NK-homeodomain target genes during mesodermal patterning of Drosophila and similar target interactions have been proposed to modulate mesenchymal growth during closure of the vertebrate skull. These results suggest the possibility that a conserved pathway may be used for diverse functions in mesodermal specification. PMID:9716413

  7. Interaction between left ventricular twist mechanics and arterial haemodynamics during localised, non-metabolic hyperaemia with and without blood flow restriction.

    PubMed

    van Mil, Anke C C M; Pearson, James; Drane, Aimee L; Cockcroft, John R; McDonnell, Barry J; Stöhr, Eric J

    2016-04-01

    What is the central question of this study? Left ventricular (LV) twist is reduced when afterload is increased, but the meaning of this specific heart muscle response and its impact on cardiac output are not well understood. What is the main finding and its importance? This study shows that LV twist responds even when arterial haemodynamics are altered only locally, and without apparent change in metabolic (i.e. heat-induced) demand. The concurrent decline in cardiac output and LV twist during partial arterial occlusion despite the increased peripheral demand caused by heat stress suggests that LV twist may be involved in the protective sensing of heart muscle stress that can override the provision of the required cardiac output. Whether left ventricular (LV) twist and untwisting rate (LV twist mechanics) respond to localised, peripheral, non-metabolic changes in arterial haemodynamics within an individual's normal afterload range is presently unknown. Furthermore, previous studies indicate that LV twist mechanics may override the provision of cardiac output, but this hypothesis has not been examined purposefully. Therefore, we acutely altered local peripheral arterial haemodynamics in 11 healthy humans (women/men n = 3/8; age 26 ± 5 years) by bilateral arm heating (BAH). Ultrasonography was used to examine arterial haemodynamics, LV twist mechanics and the twist-to-shortening ratio (TSR). To determine the arterial function-dependent contribution of LV twist mechanics to cardiac output, partial blood flow restriction to the arms was applied during BAH (BAHBFR ). Bilateral arm heating increased arm skin temperatures [change (Δ) +6.4 ± 0.9°C, P < 0.0001] but not core temperature (Δ -0.0 ± 0.1°C, P > 0.05), concomitant to increases in brachial artery blood flow (Δ 212 ± 77 ml, P < 0.0001), cardiac output (Δ 495 ± 487 l min(-1) , P < 0.05), LV twist (Δ 3.0 ± 3.5 deg, P < 0.05) and TSR (Δ 3.3 ± 1.3, P < 0.05) but maintained carotid artery blood flow (Δ 18 ± 147 ml, P > 0.05). Subsequently, BAHBFR reduced all parameters to preheating levels, except for TSR and heart rate, which remained at BAH levels. In conclusion, LV twist mechanics responded to local peripheral arterial haemodynamics within the normal afterload range, in part independent of TSR and heart rate. The findings suggest that LV twist mechanics may be more closely associated with intrinsic sensing of excessive pressure stress rather than being associated with the delivery of adequate cardiac output. © 2016 The Authors. Experimental Physiology © 2016 The Physiological Society.

  8. Fermion number of twisted kinks in the NJL2 model revisited

    NASA Astrophysics Data System (ADS)

    Thies, Michael

    2018-03-01

    As a consequence of axial current conservation, fermions cannot be bound in localized lumps in the massless Nambu-Jona-Lasinio model. In the case of twisted kinks, this manifests itself in a cancellation between the valence fermion density and the fermion density induced in the Dirac sea. To attribute the correct fermion number to these bound states requires an infrared regularization. Recently, this has been achieved by introducing a bare fermion mass, at least in the nonrelativistic regime of small twist angles and fermion numbers. Here, we propose a simpler regularization using a finite box which preserves integrability and can be applied at any twist angle. A consistent and physically plausible assignment of fermion number to all twisted kinks emerges.

  9. An empirically-based model for the lift coefficients of twisted airfoils with leading-edge tubercles

    NASA Astrophysics Data System (ADS)

    Ni, Zao; Su, Tsung-chow; Dhanak, Manhar

    2018-04-01

    Experimental data for untwisted airfoils are utilized to propose a model for predicting the lift coefficients of twisted airfoils with leading-edge tubercles. The effectiveness of the empirical model is verified through comparison with results of a corresponding computational fluid-dynamic (CFD) study. The CFD study is carried out for both twisted and untwisted airfoils with tubercles, the latter shown to compare well with available experimental data. Lift coefficients of twisted airfoils predicted from the proposed empirically-based model match well with the corresponding coefficients determined using the verified CFD study. Flow details obtained from the latter provide better insight into the underlying mechanism and behavior at stall of twisted airfoils with leading edge tubercles.

  10. Environmental Impact of a Submarine Cable: Case Study of the Acoustic Thermometry of Ocean Climate (ATOC)/ Pioneer Seamount Cable

    NASA Astrophysics Data System (ADS)

    Kogan, I.; Paull, C. K.; Kuhnz, L.; von Thun, S.; Burton, E.; Greene, H. G.; Barry, J. P.

    2003-12-01

    To better understand the potential impacts of the presence of cables on the seabed, a topic of interest for which little data is published or publicly available, a study of the environmental impacts of the ATOC/Pioneer Seamount cable was conducted. The 95 km long, submarine, coaxial cable extends between Pioneer Seamount and the Pillar Point Air Force Station in Half Moon Bay, California. Approximately two thirds of the cable lies within the Monterey Bay National Marine Sanctuary. The cable is permitted to NOAA- Oceanic and Atmospheric Research for transmitting data from a hydrophone array on Pioneer Seamount to shore. The cable was installed unburied on the seafloor in 1995. The cable path crosses the continental shelf, descends to a maximum depth of 1,933 m, and climbs back upslope to 998 m depth near the crest of Pioneer Seamount. A total of 42 hours of video and 152 push cores were collected in 10 stations along cable and control transects using the ROVs Ventana and Tiburon equipped with cable-tracking tools. The condition of the cable, its effect on the seafloor, and distribution of benthic megafauna and infauna were determined. Video data indicated the nature of interaction between the cable and the seafloor. Rocky nearshore areas, where wave energies are greatest, showed the clearest evidence of impact. Here, evidence of abrasion included frayed and unraveling portions of the cable's armor and vertical grooves in the rock apparently cut by the cable. The greatest incision and armor damage occurred on ledges between spans in irregular rock outcrop areas. Unlike the nearshore rocky region, neither the rocks nor the cable appeared damaged along outcrops on Pioneer Seamount. Multiple loops of slack cable added during a 1997 cable repair operation were found lying flat on the seafloor. Several sharp kinks in the cable were seen at 240 m water depths in an area subjected to intense trawling activity. Most of the cable has become buried with time in sediment substrates on the continental shelf whereas much of the cable remains exposed in sediments at deeper depths. The cable is exposed in rocky environments of the nearshore region and on all of Pioneer Seamount. The main biological features associated with the cable were organisms utilizing the cable as substrate and occasionally as shelter. Considerable care was taken to count megafauna in video transects and macrofauna from the top 5 cm of push cores. Few differences were found between cable and control sites at the 95% confidence level. Anemones Metridium farcimen and Stomphia sp. colonized the cable and were more abundant in cable transects at most soft sediment sites. Coarse extrapolation of the transect data suggest that more than 5,000 M. farcimen may live on the continental shelf portion of the cable. Several other species of anemones living on the cable are common along deeper sections of the cable route. Where the cable was buried, the presence of linear rows of sea anemones proved to be a reliable indicator of the cable's position. Flatfish and rockfish apparently congregate near the cable and were as much as 1 order of magnitude more abundant near the cable at some sites.

  11. 30 CFR 75.827 - Guarding of trailing cables.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... grounded metal. (b) Suspended cables and cable crossovers. When equipment must cross any portion of the cable, the cable must be either: (1) Suspended from the mine roof; or (2) Protected by a cable crossover...

  12. 30 CFR 75.827 - Guarding of trailing cables.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... grounded metal. (b) Suspended cables and cable crossovers. When equipment must cross any portion of the cable, the cable must be either: (1) Suspended from the mine roof; or (2) Protected by a cable crossover...

  13. 30 CFR 75.827 - Guarding of trailing cables.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... grounded metal. (b) Suspended cables and cable crossovers. When equipment must cross any portion of the cable, the cable must be either: (1) Suspended from the mine roof; or (2) Protected by a cable crossover...

  14. 30 CFR 75.827 - Guarding of trailing cables.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... grounded metal. (b) Suspended cables and cable crossovers. When equipment must cross any portion of the cable, the cable must be either: (1) Suspended from the mine roof; or (2) Protected by a cable crossover...

  15. 47 CFR 76.802 - Disposition of cable home wiring.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 4 2013-10-01 2013-10-01 false Disposition of cable home wiring. 76.802... MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.802 Disposition of cable home wiring... cable operator shall not remove the cable home wiring unless it gives the subscriber the opportunity to...

  16. 47 CFR 76.802 - Disposition of cable home wiring.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 4 2014-10-01 2014-10-01 false Disposition of cable home wiring. 76.802... MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.802 Disposition of cable home wiring... cable operator shall not remove the cable home wiring unless it gives the subscriber the opportunity to...

  17. 47 CFR 76.802 - Disposition of cable home wiring.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 4 2011-10-01 2011-10-01 false Disposition of cable home wiring. 76.802... MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.802 Disposition of cable home wiring... cable operator shall not remove the cable home wiring unless it gives the subscriber the opportunity to...

  18. 47 CFR 76.802 - Disposition of cable home wiring.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 4 2012-10-01 2012-10-01 false Disposition of cable home wiring. 76.802... MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.802 Disposition of cable home wiring... cable operator shall not remove the cable home wiring unless it gives the subscriber the opportunity to...

  19. 47 CFR 27.1202 - Cable/BRS cross-ownership.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... portion of the franchise area actually served by the cable operator's cable system and the cable operator... franchise area actually served by the cable operator's cable system the cable operator will use the BRS... that no portion of the GSA of the BRS station is within the portion of the franchise area actually...

  20. 47 CFR 27.1202 - Cable/BRS cross-ownership.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... portion of the franchise area actually served by the cable operator's cable system and the cable operator... franchise area actually served by the cable operator's cable system the cable operator will use the BRS... that no portion of the GSA of the BRS station is within the portion of the franchise area actually...

  1. 47 CFR 27.1202 - Cable/BRS cross-ownership.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... portion of the franchise area actually served by the cable operator's cable system and the cable operator... franchise area actually served by the cable operator's cable system the cable operator will use the BRS... that no portion of the GSA of the BRS station is within the portion of the franchise area actually...

  2. 47 CFR 27.1202 - Cable/BRS cross-ownership.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... portion of the franchise area actually served by the cable operator's cable system and the cable operator... franchise area actually served by the cable operator's cable system the cable operator will use the BRS... that no portion of the GSA of the BRS station is within the portion of the franchise area actually...

  3. Experimental Measurements and Comparison of Cable Performance for Mine Hunting Applications

    NASA Astrophysics Data System (ADS)

    Mangum, Katherine

    2005-11-01

    The Naval Surface Warfare Center (NSWCCD) conducted testing of multiple faired synthetic cables in the High Speed Basin in April, 2005. The objective of the test was to determine the hydrodynamic characteristics of bare cables, ribbon faired cables, and cables with extruded plastic ``strakes.'' Faired cables are used to gain on-station time and improve performance of the MH-60 Helicopter when towing mine hunting vehicles. Drag and strum were compared for all cases. Strum was quantified by computing standard deviations of lateral cable acceleration amplitudes. Drag coefficients were calculated using cable tension and angle readings. While the straked cables strummed less than the bare synthetic cable, they did not reduce strum levels as well as ribbon fairing at steep cable angles for speeds of 10, 15, 20 and 25 knots. The drag coefficient of the straked cables was calculated to be higher than that of a bare cable, although further testing is needed to determine an exact number.

  4. "Twisted Beam" SEE Observations of Ionospheric Heating from HAARP

    NASA Astrophysics Data System (ADS)

    Briczinski, S. J.; Bernhardt, P. A.; Siefring, C. L.; Han, S.-M.; Pedersen, T. R.; Scales, W. A.

    2015-10-01

    Nonlinear interactions of high power HF radio waves in the ionosphere provide aeronomers with a unique space-based laboratory capability. The High-Frequency Active Auroral Research Program (HAARP) in Gakona, Alaska is the world's largest heating facility, yielding effective radiated powers in the gigawatt range. New results are present from HAARP experiments using a "twisted beam" excitation mode. Analysis of twisted beam heating shows that the SEE results obtained are identical to more traditional patterns. One difference in the twisted beam mode is the heating region produced is in the shape of a ring as opposed to the more traditional "solid spot" region from a pencil beam. The ring heating pattern may be more conducive to the creation of stable artificial airglow layers because of the horizontal structure of the ring. The results of these runs include artificial layer creation and evolution as pertaining to the twisted beam pattern. The SEE measurements aid the interpretation of the twisted beam interactions in the ionosphere.

  5. Structures of Highly Twisted Amides Relevant to Amide N-C Cross-Coupling: Evidence for Ground-State Amide Destabilization.

    PubMed

    Pace, Vittorio; Holzer, Wolfgang; Meng, Guangrong; Shi, Shicheng; Lalancette, Roger; Szostak, Roman; Szostak, Michal

    2016-10-04

    Herein, we show that acyclic amides that have recently enabled a series of elusive transition-metal-catalyzed N-C activation/cross-coupling reactions are highly twisted around the N-C(O) axis by a new destabilization mechanism of the amide bond. A unique effect of the N-glutarimide substituent, leading to uniformly high twist (ca. 90°) irrespective of the steric effect at the carbon side of the amide bond has been found. This represents the first example of a twisted amide that does not bear significant steric hindrance at the α-carbon atom. The (15) N NMR data show linear correlations between electron density at nitrogen and amide bond twist. This study strongly supports the concept of amide bond ground-state twist as a blueprint for activation of amides toward N-C bond cleavage. The new mechanism offers considerable opportunities for organic synthesis and biological processes involving non-planar amide bonds. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. The association between left ventricular twisting motion and mechanical dyssynchrony: a three-dimensional speckle tracking study.

    PubMed

    Fujiwara, Shohei; Komamura, Kazuo; Nakabo, Ayumi; Masaki, Mitsuru; Fukui, Miho; Sugahara, Masataka; Itohara, Kanako; Soyama, Yuko; Goda, Akiko; Hirotani, Shinichi; Mano, Toshiaki; Masuyama, Tohru

    2016-02-01

    Left ventricular (LV) dyssynchrony is a causal factor in LV dysfunction and thought to be associated with LV twisting motion. We tested whether three-dimensional speckle tracking (3DT) can be used to evaluate the relationship between LV twisting motion and dyssynchrony. We examined 25 patients with sick sinus syndrome who had received dual chamber pacemakers. The acute effects of ventricular pacing on LV wall motion after the switch from atrial to ventricular pacing were assessed. LV twisting motion and dyssynchrony during each pacing mode were measured using 3DT. LV dyssynchrony was calculated from the time to the minimum peak systolic area strain of 16 LV imaging segments. Ventricular pacing increased LV dyssynchrony and decreased twist and torsion. A significant correlation was observed between changes in LV dyssynchrony and changes in torsion (r = -0.65, p < 0.01). Evaluation of LV twisting motion can potentially be used for diagnosing LV dyssynchrony.

  7. Twisted electron-acoustic waves in plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aman-ur-Rehman, E-mail: amansadiq@gmail.com; Department of Physics and Applied Mathematics; Ali, S.

    2016-08-15

    In the paraxial limit, a twisted electron-acoustic (EA) wave is studied in a collisionless unmagnetized plasma, whose constituents are the dynamical cold electrons and Boltzmannian hot electrons in the background of static positive ions. The analytical and numerical solutions of the plasma kinetic equation suggest that EA waves with finite amount of orbital angular momentum exhibit a twist in its behavior. The twisted wave particle resonance is also taken into consideration that has been appeared through the effective wave number q{sub eff} accounting for Laguerre-Gaussian mode profiles attributed to helical phase structures. Consequently, the dispersion relation and the damping ratemore » of the EA waves are significantly modified with the twisted parameter η, and for η → ∞, the results coincide with the straight propagating plane EA waves. Numerically, new features of twisted EA waves are identified by considering various regimes of wavelength and the results might be useful for transport and trapping of plasma particles in a two-electron component plasma.« less

  8. Kinetic study of ion acoustic twisted waves with kappa distributed electrons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arshad, Kashif, E-mail: kashif.arshad.butt@gmail.com; Aman-ur-Rehman, E-mail: amansadiq@gmail.com; Mahmood, Shahzad, E-mail: shahzadm100@gmail.com

    2016-05-15

    The kinetic theory of Landau damping of ion acoustic twisted modes is developed in the presence of orbital angular momentum of the helical (twisted) electric field in plasmas with kappa distributed electrons and Maxwellian ions. The perturbed distribution function and helical electric field are considered to be decomposed by Laguerre-Gaussian mode function defined in cylindrical geometry. The Vlasov-Poisson equation is obtained and solved analytically to obtain the weak damping rates of the ion acoustic twisted waves in a non-thermal plasma. The strong damping effects of ion acoustic twisted waves at low values of temperature ratio of electrons and ions aremore » also obtained by using exact numerical method and illustrated graphically, where the weak damping wave theory fails to explain the phenomenon properly. The obtained results of Landau damping rates of the twisted ion acoustic wave are discussed at different values of azimuthal wave number and non-thermal parameter kappa for electrons.« less

  9. Modeling and development of a twisting wing using inductively heated shape memory alloy actuators

    NASA Astrophysics Data System (ADS)

    Saunders, Robert N.; Hartl, Darren J.; Boyd, James G.; Lagoudas, Dimitris C.

    2015-04-01

    Wing twisting has been shown to improve aircraft flight performance. The potential benefits of a twisting wing are often outweighed by the mass of the system required to twist the wing. Shape memory alloy (SMA) actuators repeatedly demonstrate abilities and properties that are ideal for aerospace actuation systems. Recent advances have shown an SMA torsional actuator that can be manufactured and trained with the ability to generate large twisting deformations under substantial loading. The primary disadvantage of implementing large SMA actuators has been their slow actuation time compared to conventional actuators. However, inductive heating of an SMA actuator allows it to generate a full actuation cycle in just seconds rather than minutes while still . The aim of this work is to demonstrate an experimental wing being twisted to approximately 10 degrees by using an inductively heated SMA torsional actuator. This study also considers a 3-D electromagnetic thermo-mechanical model of the SMA-wing system and compare these results to experiments to demonstrate modeling capabilities.

  10. Twisted ultrathin silicon nanowires: A possible torsion electromechanical nanodevice

    NASA Astrophysics Data System (ADS)

    Garcia, J. C.; Justo, J. F.

    2014-11-01

    Nanowires have been considered for a number of applications in nanometrology. In such a context, we have explored the possibility of using ultrathin twisted nanowires as torsion nanobalances to probe forces and torques at molecular level with high precision, a nanoscale system analogous to the Coulomb's torsion balance electrometer. In order to achieve this goal, we performed a first-principles investigation on the structural and electronic properties of twisted silicon nanowires, in their pristine and hydrogenated forms. The results indicated that wires with pentagonal and hexagonal cross-sections are the thinnest stable silicon nanostructures. Additionally, all wires followed a Hooke's law behavior for small twisting deformations. Hydrogenation leads to spontaneous twisting, but with angular spring constants considerably smaller than the ones for the respective pristine forms. We observed considerable changes on the nanowire electronic properties upon twisting, which allows to envision the possibility of correlating the torsional angular deformation with the nanowire electronic transport. This could ultimately allow a direct access to measurements on interatomic forces at molecular level.

  11. Hover Testing of the NASA/Army/MIT Active Twist Rotor Prototype Blade

    NASA Technical Reports Server (NTRS)

    Wilbur, Matthew L.; Yeager, William T., Jr.; Wilkie, W. Keats; Cesnik, Carlos E. S.; Shin, Sangloon

    2000-01-01

    Helicopter rotor individual blade control promises to provide a mechanism for increased rotor performance and reduced rotorcraft vibrations and noise. Active material methods, such as piezoelectrically actuated trailing-edge flaps and strain-induced rotor blade twisting, provide a means of accomplishing individual blade control without the need for hydraulic power in the rotating system. Recent studies have indicated that controlled strain induced blade twisting can be attained using piezoelectric active fiber composite technology. In order to validate these findings experimentally, a cooperative effort between NASA Langley Research Center, the Army Research Laboratory, and the MIT Active Materials and Structures Laboratory has been developed. As a result of this collaboration an aeroelastically-scaled active-twist model rotor blade has been designed and fabricated for testing in the heavy gas environment of the Langley Transonic Dynamics Tunnel (TDT). The results of hover tests of the active-twist prototype blade are presented in this paper. Comparisons with applicable analytical predictions of active-twist frequency response in hovering flight are also presented.

  12. Development of Inspection Robots for Bridge Cables

    PubMed Central

    Kim, Se-Hoon; Lee, Jong-Jae

    2013-01-01

    This paper presents the bridge cable inspection robot developed in Korea. Two types of the cable inspection robots were developed for cable-suspension bridges and cable-stayed bridge. The design of the robot system and performance of the NDT techniques associated with the cable inspection robot are discussed. A review on recent advances in emerging robot-based inspection technologies for bridge cables and current bridge cable inspection methods is also presented. PMID:24459453

  13. Reaction mechanism of the acidic hydrolysis of highly twisted amides: Rate acceleration caused by the twist of the amide bond.

    PubMed

    Mujika, Jon I; Formoso, Elena; Mercero, Jose M; Lopez, Xabier

    2006-08-03

    We present an ab initio study of the acid hydrolysis of a highly twisted amide and a planar amide analogue. The aim of these studies is to investigate the effect that the twist of the amide bond has on the reaction barriers and mechanism of acid hydrolysis. Concerted and stepwise mechanisms were investigated using density functional theory and polarizable continuum model calculations. Remarkable differences were observed between the mechanism of twisted and planar amide, due mainly to the preference for N-protonation of the former and O-protonation of the latter. In addition, we were also able to determine that the hydrolytic mechanism of the twisted amide will be pH dependent. Thus, there is a preference for a stepwise mechanism with formation of an intermediate in the acid hydrolysis, whereas the neutral hydrolysis undergoes a concerted-type mechanism. There is a nice agreement between the characterized intermediate and available X-ray data and a good agreement with the kinetically estimated rate acceleration of hydrolysis with respect to analogous undistorted amide compounds. This work, along with previous ab initio calculations, describes a complex and rich chemistry for the hydrolysis of highly twisted amides as a function of pH. The theoretical data provided will allow for a better understanding of the available kinetic data of the rate acceleration of amides upon twisting and the relation of the observed rate acceleration with intrinsic differential reactivity upon loss of amide bond resonance.

  14. Enhanced intersystem crossing in core-twisted aromatics.

    PubMed

    Nagarajan, Kalaivanan; Mallia, Ajith R; Muraleedharan, Keerthi; Hariharan, Mahesh

    2017-03-01

    We describe the design, bottom-up synthesis and X-ray single crystal structure of systematically twisted aromatics 1c and 2d for efficient intersystem crossing. Steric congestion at the cove region creates a nonplanar geometry that induces a significant yield of triplet excited states in the electron-poor core-twisted aromatics 1c and 2d . A systematic increase in the number of twisted regions in 1c and 2d results in a concomitant enhancement in the rate and yield of intersystem crossing, monitored using femtosecond and nanosecond transient absorption spectroscopy. Time-resolved absorption spectroscopic measurements display enhanced triplet quantum yields ( Φ T = 10 ± 1% for 1c and Φ T = 30 ± 2% for 2d ) in the twisted aromatics when compared to a negligible Φ T (<1%) in the planar analog 3c . Twist-induced spin-orbit coupling via activated out-of-plane C-H/C 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 C vibrations can facilitate the formation of triplet excited states in twisted aromatics 1c and 2d , in contrast to the negligible intersystem crossing in the planar analog 3c . The ease of synthesis, high solubility, access to triplet excited states and strong electron affinity make such imide functionalized core-twisted aromatics desirable materials for organic electronics such as solar cells.

  15. Chirality-controlled spontaneous twisting of crystals due to thermal topochemical reaction.

    PubMed

    Rai, Rishika; Krishnan, Baiju P; Sureshan, Kana M

    2018-03-20

    Crystals that show mechanical response against various stimuli are of great interest. These stimuli induce polymorphic transitions, isomerizations, or chemical reactions in the crystal and the strain generated between the daughter and parent domains is transcribed into mechanical response. We observed that the crystals of modified dipeptide LL (N 3 -l-Ala-l-Val-NHCH 2 C≡CH) undergo spontaneous twisting to form right-handed twisted crystals not only at room temperature but also at 0 °C over time. Using various spectroscopic techniques, we have established that the twisting is due to the spontaneous topochemical azide-alkyne cycloaddition (TAAC) reaction at room temperature or lower temperatures. The rate of twisting can be increased by heating, exploiting the faster kinetics of the TAAC reaction at higher temperatures. To address the role of molecular chirality in the direction of twisting the enantiomer of dipeptide LL, N 3 -d-Ala-d-Val-NHCH 2 C≡CH (DD), was synthesized and topochemical reactivity and mechanoresponse of its crystals were studied. We have found that dipeptide DD not only underwent TAAC reaction, giving 1,4-triazole-linked pseudopolypeptides of d-amino acids, but also underwent twisting with opposite handedness (left-handed twisting), establishing the role of molecular chirality in controlling the direction of mechanoresponse. This paper reports ( i ) a mechanical response due to a thermal reaction and ( ii ) a spontaneous mechanical response in crystals and ( iii ) explains the role of molecular chirality in the handedness of the macroscopic mechanical response.

  16. Design and analysis of variable-twist tiltrotor blades using shape memory alloy hybrid composites

    NASA Astrophysics Data System (ADS)

    Park, Jae-Sang; Kim, Seong-Hwan; Jung, Sung Nam; Lee, Myeong-Kyu

    2011-01-01

    The tiltrotor blade, or proprotor, acts as a rotor in the helicopter mode and as a propeller in the airplane mode. For a better performance, the proprotor should have different built-in twist distributions along the blade span, suitable for each operational mode. This paper proposes a new variable-twist proprotor concept that can adjust the built-in twist distribution for given flight modes. For a variable-twist control, the present proprotor adopts shape memory alloy hybrid composites (SMAHC) containing shape memory alloy (SMA) wires embedded in the composite matrix. The proprotor of the Korea Aerospace Research Institute (KARI) Smart Unmanned Aerial Vehicle (SUAV), which is based on the tiltrotor concept, is used as a baseline proprotor model. The cross-sectional properties of the variable-twist proprotor are designed to maintain the cross-sectional properties of the original proprotor as closely as possible. However, the torsion stiffness is significantly reduced to accommodate the variable-twist control. A nonlinear flexible multibody dynamic analysis is employed to investigate the dynamic characteristics of the proprotor such as natural frequency and damping in the whirl flutter mode, the blade structural loads in a transition flight and the rotor performance in hover. The numerical results show that the present proprotor is designed to have a strong similarity to the baseline proprotor in dynamic and load characteristics. It is demonstrated that the present proprotor concept could be used to improve the hover performance adaptively when the variable-twist control using the SMAHC is applied appropriately.

  17. 47 CFR 36.153 - Assignment of Cable and Wire Facilities (C&WF) to categories.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 2 2011-10-01 2011-10-01 false Assignment of Cable and Wire Facilities (C&WF... Telecommunications Property Cable and Wire Facilities § 36.153 Assignment of Cable and Wire Facilities (C&WF) to... cable and intrabuilding network cable. Where an entire cable or aerial wire is assignable to one...

  18. 47 CFR 36.153 - Assignment of Cable and Wire Facilities (C&WF) to categories.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Assignment of Cable and Wire Facilities (C&WF... Telecommunications Property Cable and Wire Facilities § 36.153 Assignment of Cable and Wire Facilities (C&WF) to... cable and intrabuilding network cable. Where an entire cable or aerial wire is assignable to one...

  19. Damping Estimation from Free Decay Responses of Cables with MR Dampers.

    PubMed

    Weber, Felix; Distl, Hans

    2015-01-01

    This paper discusses the damping measurements on cables with real-time controlled MR dampers that were performed on a laboratory scale single strand cable and on cables of the Sutong Bridge, China. The control approach aims at producing amplitude and frequency independent cable damping which is confirmed by the tests. The experimentally obtained cable damping in comparison to the theoretical value due to optimal linear viscous damping reveals that support conditions of the cable anchors, force tracking errors in the actual MR damper force, energy spillover to higher modes, and excitation and sensor cables hanging on the stay cable must be taken into consideration for the interpretation of the identified cable damping values.

  20. Damping Estimation from Free Decay Responses of Cables with MR Dampers

    PubMed Central

    Weber, Felix; Distl, Hans

    2015-01-01

    This paper discusses the damping measurements on cables with real-time controlled MR dampers that were performed on a laboratory scale single strand cable and on cables of the Sutong Bridge, China. The control approach aims at producing amplitude and frequency independent cable damping which is confirmed by the tests. The experimentally obtained cable damping in comparison to the theoretical value due to optimal linear viscous damping reveals that support conditions of the cable anchors, force tracking errors in the actual MR damper force, energy spillover to higher modes, and excitation and sensor cables hanging on the stay cable must be taken into consideration for the interpretation of the identified cable damping values. PMID:26167537

Top