Sample records for twisted pair wire

  1. Twisted Pair Of Insulated Wires Senses Moisture

    NASA Technical Reports Server (NTRS)

    Laue, Eric G.; Stephens, James B.

    1989-01-01

    Sensitivity of electronic moisture sensor to low levels of moisture increased by new electrode configuration. Moisture-sensing circuit described in "Low-Cost Humidity Sensor" (NPO-16544). New twisted pair of wires takes place of flat-plate capacitor in circuit. Configuration allows for thermal expansion and contraction of polymer while maintaining nearly constant area of contact between polymer and wires.

  2. Humidity effects on wire insulation breakdown strength.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Appelhans, Leah

    2013-08-01

    Methods for the testing of the dielectric breakdown strength of insulation on metal wires under variable humidity conditions were developed. Two methods, an ASTM method and the twisted pair method, were compared to determine if the twisted pair method could be used for determination of breakdown strength under variable humidity conditions. It was concluded that, although there were small differences in outcomes between the two testing methods, the non-standard method (twisted pair) would be appropriate to use for further testing of the effects of humidity on breakdown performance. The dielectric breakdown strength of 34G copper wire insulated with double layermore » Poly-Thermaleze/Polyamide-imide insulation was measured using the twisted pair method under a variety of relative humidity (RH) conditions and exposure times. Humidity at 50% RH and below was not found to affect the dielectric breakdown strength. At 80% RH the dielectric breakdown strength was significantly diminished. No effect for exposure time up to 140 hours was observed at 50 or 80%RH.« less

  3. Coronal plasma development in wire-array z-pinches made of twisted-pairs

    NASA Astrophysics Data System (ADS)

    Hoyt, C. L.; Greenly, J. B.; Gourdain, P. A.; Knapp, P. F.; Pikuz, S. A.; Shelkovenko, T. A.; Hammer, D. A.; Kusse, B. R.

    2009-11-01

    We have investigated coronal and core plasma development in wire array z-pinches in which single fine wires are replaced by twisted-pairs (``cable'') on the 1 MA, 100 ns rise time COBRA pulsed power generator. X-ray radiography, employed to investigate dense wire core expansion, showed periodic axial nonuniformity and evidence for shock waves developing where the individual wire plasmas collide. Laser shadowgraphy images indicated that the axial instability properties of the coronal plasma are substantially modified from ordinary wire arrays. Cable mass per unit length, material and the twist wavelength were varied in order to study their effects upon the instability wavelength. Implosion uniformity and bright-spot formation, as well as magnetic topology evolution, have also been investigated using self-emission imaging, x-ray diagnostics and small B-dot probes, respectively. Results from the cable-array z-pinches will be compared with results from ordinary wire-array z-pinches. This research was supported by the SSAA program of the National Nuclear Security Administration under DOE Cooperative agreement DE-FC03-02NA00057.

  4. Characteristics of Partial Discharge and Ozone Generation for Twisted-pair of Enameled Wires under High-repetitive Impulse Voltage Application

    NASA Astrophysics Data System (ADS)

    Kanazawa, Seiji; Enokizono, Masato; Shibakita, Toshihide; Umehara, Eiji; Toshimitsu, Jun; Ninomiya, Shinji; Taniguchi, Hideki; Abe, Yukari

    In recent years, inverter drive machines such as a hybrid vehicle and an electric vehicle are operated under high voltage pulse with high repetition rate. In this case, inverter surge is generated and affected the machine operation. Especially, the enameled wire of a motor is deteriorated due to the partial discharge (PD) and finally breakdown of the wire will occur. In order to investigate a PD on a resistant enameled wire, characteristics of PD in the twisted pair sample under bipolar repetitive impulse voltages are investigated experimentally. The relationship between the applied voltage and discharge current was measured at PD inception and extinction, and we estimated the repetitive PD inception and extinction voltages experimentally. The corresponding optical emission of the discharge was also observed by using an ICCD camera. Furthermore, ozone concentration due to the discharge was measured during the life-time test of the resistant enameled wires from a working environmental point of view.

  5. High Speed Network Access to the Last-Mile Using Fixed Broadband Wireless

    DTIC Science & Technology

    2004-03-01

    could download the 3¼-hour movie Titanic in 7 minutes and 23 seconds while a 56K modem on the other hand would need almost 22 hours”. The MMDS band...9 a. Twisted Copper Pair (xDSL).....................................................9 b. Cable Modem ...of dial-up modems over twisted copper pair1. Copper wire provided the link in the local loop between the telephone subscriber and the local

  6. Down hole transmission system

    DOEpatents

    Hall, David R [Provo, UT; Hall, Jr., H. Tracy

    2007-07-24

    A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. The electrically conducting coil comprises at least two generally fractional loops. In the preferred embodiment, the transmission elements are connected by an electrical conductor. Preferably, the electrical conductor is a coaxial cable. Preferably, the MCEI trough comprises ferrite. In the preferred embodiment, the fractional loops are connected by a connecting cable. In one aspect of the present invention, the connecting cable is a pair of twisted wires. In one embodiment the connecting cable is a shielded pair of twisted wires. In another aspect of the present invention, the connecting cable is a coaxial cable. The connecting cable may be disposed outside of the MCEI circular trough.

  7. DSL for traffic video

    DOT National Transportation Integrated Search

    1999-07-01

    Many traffic operations use twisted pair wiring, either owned by the public or leased from a local provider, to control field devices such as traffic signals or ramp meters. There are now commercially available communications technologies that ...

  8. Tight Placement of Erich Arch Bar While Avoiding Wire Fatigue Failure.

    PubMed

    Kirk, Daniel; Whitney, Joseph; Shafer, David; Song, Liansheng

    2016-03-01

    To determine the number of wire twists needed to acquire ideal Erich arch bar tightness before wire fatigue failure (fracture) in relation to different distances and angles at which different gauge wires are grasped to provide information to improve the efficiency of arch bar application. This study mimicked surgical placement of arch bars with 24- and 26-gauge wires. The number of twists to tightness and failure was evaluated when the wire distance between the arch bar and wire holder tip changed (5 vs 10 mm) and when the degree at which the wire was held relative to the tooth axis was changed (45° vs 90°). A wire shearing test also was used to investigate the fatigability of wires tightened under these same conditions. Wires twisted to tightness, past tightness, and after shearing test movements were visualized with electron microscopy. For 24-gauge wire held at 5 mm, 2.6 to 2.8 twists were needed for wire tightness, with failure after 1.7 to 1.9 twists past tightness; for 24-gauge wire held at 10 mm, 4.4 to 4.9 twists produced tightness, with failure after 2.3 to 2.9 twists past tightness. For 26-gauge wire held at 5 mm, 3.3 to 3.5 twists provided tightness, with 1.6 to 1.8 twists past tightness causing failure; for 26-gauge wire held at 10 mm, 5.1 to 5.5 twists produced tightness, with 3.1 to 3.7 twists past tightness causing failure. At a 45° angle, the wire tightened with fewer twists and showed more resistance to failure with twists past tightness compared with 90° using 24- and 26-gauge wires. In contrast, 24-gauge wire held at a 5-mm distance showed the opposite result, with decreased resistance to failure at the 45° angle. However, the differences were not statistically meaningful. Scanning election microscopy showed no wire fatigue for either angle for 26-gauge wire held at a 5-mm distance and twisted to tightness. After overtightening and oscillation, the 90° angle trials showed fatigue, whereas the 45° angle trials did not. Holding a 24-gauge wire at 45° to the tooth axis is recommended owing to fewer twists to tightness and more resistance to failure. A 5-mm grasping distance is recommended for experienced surgeons owing to fewer twists to tightness, whereas a 10-mm grasping distance is recommended for novice surgeons owing to a greater tolerance for over-twisting before failure. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  9. Comparison of Analysis, Simulation, and Measurement of Wire-to-Wire Crosstalk. Part 2

    NASA Technical Reports Server (NTRS)

    Bradley, Arthur T.; Yavoich, Brian James; Hodson, Shane M.; Godley, Franklin

    2010-01-01

    In this investigation, we compare crosstalk analysis, simulation, and measurement results for electrically short configurations. Methods include hand calculations, PSPICE simulations, Microstripes transient field solver, and empirical measurement. In total, four representative physical configurations are examined, including a single wire over a ground plane, a twisted pair over a ground plane, generator plus receptor wires inside a cylindrical conduit, and a single receptor wire inside a cylindrical conduit. Part 1 addresses the first two cases, and Part 2 addresses the final two. Agreement between the analysis methods and test data is shown to be very good.

  10. Comparison of Analysis, Simulation, and Measurement of Wire-to-Wire Crosstalk. Part 1

    NASA Technical Reports Server (NTRS)

    Bradley, Arthur T.; Yavoich, Brian James; Hodson, Shame M.; Godley, Richard Franklin

    2010-01-01

    In this investigation, we compare crosstalk analysis, simulation, and measurement results for electrically short configurations. Methods include hand calculations, PSPICE simulations, Microstripes transient field solver, and empirical measurement. In total, four representative physical configurations are examined, including a single wire over a ground plane, a twisted pair over a ground plane, generator plus receptor wires inside a cylindrical conduit, and a single receptor wire inside a cylindrical conduit. Part 1 addresses the first two cases, and Part 2 addresses the final two. Agreement between the analysis, simulation, and test data is shown to be very good.

  11. Wire harness twisting aid

    NASA Technical Reports Server (NTRS)

    Casey, E. J.; Commadore, C. C.; Ingles, M. E.

    1980-01-01

    Long wire bundles twist into uniform spiral harnesses with help of simple apparatus. Wires pass through spacers and through hand-held tool with hole for each wire. Ends are attached to low speed bench motor. As motor turns, operator moves hand tool away forming smooth twists in wires between motor and tool. Technique produces harnesses that generate less radio-frequency interference than do irregularly twisted cables.

  12. Integrated Networks.

    ERIC Educational Resources Information Center

    Robinovitz, Stewart

    1987-01-01

    A strategy for integrated data and voice networks implemented at the University of Michigan is described. These networks often use multi-technologies, multi-vendors, and multi-transmission media that will be fused into a single integrated network. Transmission media include twisted-pair wire, coaxial cable, fiber optics, and microwave. (Author/MLW)

  13. Strength of surgical wire fixation. A laboratory study.

    PubMed

    Guadagni, J R; Drummond, D S

    1986-08-01

    Because of the frequent use of stainless steel wire in spinal surgery and to augment fracture fixation, several methods of securing wire fixation were tested in the laboratory to determine the relative strength of fixation. Any method of fixation stronger than the yield strength of the wire is sufficient. Square knots, knot twists, symmetric twists, and the AO loop-tuck techniques afforded acceptable resistance against tension loads, but the wire wrap and AO loop technique were unacceptable. The double symmetric twist, which is frequently used for tension banding, was barely acceptable. The symmetric twist technique was the most practical because it is strong enough, efficient in maintaining tension applied during fixation, and least likely to cause damage to the wire. To optimize the fixation strength of the symmetrical twist, at least two twists are required at a reasonably tight pitch.

  14. Here's Looking at You, Kid.

    ERIC Educational Resources Information Center

    Milshtein, Amy

    1997-01-01

    The University of Maryland at College Park installed 25 surveillance cameras to combat crime. A minimum of disruption occurred because unused twisted pair wires left in place when the conversion to a fiber optic telephone system was made could be used for the camera installations. The campus is safer, and its budget is intact. (RE)

  15. Cerclage handling for improved fracture treatment. A biomechanical study on the twisting procedure.

    PubMed

    Wähnert, D; Lenz, M; Schlegel, U; Perren, S; Windolf, M

    2011-01-01

    Twisting is clinically the most frequently applied method for tightening and maintaining cerclage fixation. The twisting procedure is controversially discussed. Several factors during twisting affect the mechanical behaviour of the cerclage. This in vitro study investigated the influence of different parameters of the twisting procedure on the fixation strength of the cerclage in an experimental setup with centripetal force application. Cortical half shells of the femoral shaft were mounted on a testing fixture. 1.0 mm, 1.25 mm and 1.5 mm stainless ste- el wire cerclages as well as a 1.0mm cable cerclage were applied to the bone. Pretension of the cerclage during the installation was measured during the locking procedure. Subsequently, cyclic testing was performed up to failure. Higher pretension could be achieved with increasing wire diameter. However, with larger wire diameter the drop of pre- tension due to the bending and cutting the twist also increased. The cable cerclage showed the highest pretension after locking. Cerclages twisted under traction revealed significantly higher initial cerclage tension. Plastically deformed twists offered higher cerclage pretension compared to twists which were deformed in the elastic region of the material. Cutting the wire within the twist caused the highest loss of cerclage tension (44% initial tension) whereas only 11 % was lost when cutting the wire ends separately. The bending direction of the twist significantly influenced the cerclage pretension. 45% pretension was lost in forward bending of the twist, 53% in perpendicular bending and 90% in backward bending. Several parameters affect the quality of a cerclage fixation. Adequate installation of cerclage wires could markedly improve the clinical outcome of cerclage.

  16. Basic EMC (Electromagnetic compatibility) technology advancement for C3 systems. Volume 4D: Modeling crosstalk in balanced twisted pairs

    NASA Astrophysics Data System (ADS)

    Koopman, D. A.; Paul, C. R.

    1984-08-01

    Electrical devices (computers, radar systems, communication radios, etc.) are interconnected by wires on most present systems. Electromagnetic fields produced by the excitation of these wires will cause unintentional coupling of signals onto nearby wires. This undesired electromagnetic coupling is termed crosstalk. It is important to be able to determine whether these crosstalk signals will cause the devices at the ends of the wires to malfunction. Wires are often grouped together in cable bundles or harnesses. The close proximity of wires in these bundles enhances the possibility that the crosstalk levels will be sufficiently large to cause malfunctions. The ability to predict crosstalk levels and the means to control crosstalk when it causes a problem are important to optimum system design. It interference of this type is allowed to surface during final system tests, a costly and time consuming retrofit of the wiring or the addition of filters and other interference control measures may be required.

  17. Trapping of ultracold polar molecules with a thin-wire electrostatic trap.

    PubMed

    Kleinert, J; Haimberger, C; Zabawa, P J; Bigelow, N P

    2007-10-05

    We describe the realization of a dc electric-field trap for ultracold polar molecules, the thin-wire electrostatic trap (TWIST). The thin wires that form the electrodes of the TWIST allow us to superimpose the trap onto a magneto-optical trap (MOT). In our experiment, ultracold polar NaCs molecules in their electronic ground state are created in the MOT via photoassociation, achieving a continuous accumulation in the TWIST of molecules in low-field seeking states. Initial measurements show that the TWIST trap lifetime is limited only by the background pressure in the chamber.

  18. Tensile test and interface retention forces between wires and composites in lingual fixed retainers.

    PubMed

    Paolone, Maria Giacinta; Kaitsas, Roberto; Obach, Patricia; Kaitsas, Vasilios; Benedicenti, Stefano; Sorrenti, Eugenio; Barberi, Fabrizio

    2015-06-01

    In daily orthodontic clinical practice retention is very important, and lingual retainers are part of this challenge. The failure of lingual retainers may be due to many factors. The aim of this study was to assess the retention forces and mechanical behavior of different types of wires matched with different kinds of composites in lingual retainers. A tensile test was performed on cylindrical composite test specimens bonded to orthodontic wires. The specimens were constructed using four different wires: a straight wire (Remanium .016×.022″ Dentaurum), two round twisted wires (Penta One .0215″ Masel, Gold Penta Twisted .0215″ Gold N'braces) and a rectangular braided wire (D-Rect .016×.022″ Ormco); and three composites: two micro-hybrids (Micro-Hybrid Enamel Plus HFO Micerium, and Micro-Hybrid SDR U Dentsply) and a micro-nano-filled composite (Micro-Nano-Filled Transbond LR 3M). The test was performed at a speed of 10mm/min on an Inström device. The wire was fixed with a clamp. The results showed that the bonding between wires and composites in lingual fixed retainers seemed to be lowest for rectangular smooth wires and increased in round twisted and rectangular twisted wires where the bonding was so strong that the maximum tension/bond strength was greater than the ultimate tensile strength of the wire. The highest values were in rectangular twisted wires. Concerning the composites, hybrid composites had the lowest interface bonding values and broke very quickly, while the nano- and micro-composites tolerated stronger forces and displayed higher bonding values. The best results were observed with the golden twisted wire and reached 21.46 MPa with the Transbond composite. With the rectangular braided wire the retention forces were so high that the Enamel Plus composite fractured when the load exceeded 154.6 N/MPa. When the same wire was combined with the Transbond LR either the wire or the composite broke when the force exceeded 240 N. The results of this study show that, when selecting a lingual retainer in daily clinical practice, not only must the patient's compliance and dependability be considered but also the mechanical properties and composition of different combinations of composites and wires. Copyright © 2015 CEO. Published by Elsevier Masson SAS. All rights reserved.

  19. Mechanical characteristics and comparisons of cerclage wires: introduction of the double-wrap and loop/twist tying methods.

    PubMed

    Roe, S C

    1997-01-01

    Evaluate the mechanical properties of twist, loop, double loop, double-wrap and loop/twist cerclage. The initial tension generated by 18 cerclage of each type was determined using a materials testing machine after tying around a testing jig. Six wires from each type were distracted and the initial stiffness and yield load were determined. Yield behavior was further investigated in six wires of each type by determining the load required to reduce cerclage tension below 30 Newton (N) following and incremental (50 N) stepwise load and unload regimen. The amount of collapse of the simulated bone fragments that resulted in the reduction of initial tension to 30 N was measured for the final six wires of each group. Data were analyzed by analysis of variance and a multiple comparison test. Twist type cerclage generated less tension than loop-type cerclage. The yield load of these two types was similar. Double-loop and double-wrap cerclage generated superior tension and resisted a greater load before loosening. Loop/twist cerclage had an intermediate initial tension but had the greatest resistance to loading. In the collapse test, the greater the initial tension, the more collapse could occur before the wire was loose. For all types of cerclage wire fixation, a reduction of diameter of the testing jig of more than 1% caused loosening. Double-loop and double-wrap cerclage provide greater compression of fragments and resist loads associated with weight-bearing better than the twist and loop methods. Loop/twist cerclage may have advantages because of their superior resistance to loading. All cerclage will loosen if fracture fragments collapse.

  20. Cables and crosstalk

    NASA Astrophysics Data System (ADS)

    Paul, Clayton R.

    1991-06-01

    Crosstalk is the unintentional electromagnetic coupling between circuits which are connected by parallel conductors that lie in close proximity to each other. Some examples are wires in cable harnesses or metallic lands on printed-circuit boards (PCB's). This unintended interaction between two or more circuits via their electromagnetic fields can cause interference problems. Signals from one circuit that couple to another circuit appear at the terminals of the devices that are interconnected by the wires. If these signals are of sufficient magnitude or spectral content, they may cause unintended operation of the device or a degradation in its performance. A summary of the standard models used for predicting crosstalk in various types of configurations is presented. The discussion focusses on the relative accuracies, regions of applicability, and computational complexity of the models. A simple explanation of the ability (or inability) of shielded wires and twisted pairs of wires to reduce the crosstalk is also given.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kleinert, J.; Haimberger, C.; Zabawa, P. J.

    We describe the realization of a dc electric-field trap for ultracold polar molecules, the thin-wire electrostatic trap (TWIST). The thin wires that form the electrodes of the TWIST allow us to superimpose the trap onto a magneto-optical trap (MOT). In our experiment, ultracold polar NaCs molecules in their electronic ground state are created in the MOT via photoassociation, achieving a continuous accumulation in the TWIST of molecules in low-field seeking states. Initial measurements show that the TWIST trap lifetime is limited only by the background pressure in the chamber.

  2. Woven ribbon cable for cryogenic instruments

    NASA Astrophysics Data System (ADS)

    Cunningham, C. R.; Hastings, P. R.; Strachan, J. M. D.

    Robust woven ribbon cables are described for connecting sensors at low temperatures to higher temperature systems. Woven cables have several advantages over conventional wiring or flat ribbon cables in cryostats: heat sinking is easier; twisted pairs may be used; and miniature multi-way connectors are easily incorporated. Their use is demonstrated in making connections from 131 bolometers in two arrays mounted in a dilution refrigerator at 100 mK. Thermal and electrical properties are discussed, as are other possible applications in cryogenic instruments.

  3. Processing, Structural Characterization and Comparative Studies on Uniaxial Tensile Properties of a New Type of Porous Twisted Wire Material

    PubMed Central

    Wu, Fei; Zhou, Zhaoyao; Duan, Liuyang; Xiao, Zhiyu

    2015-01-01

    A self-developed rotary multi-cutter device cuts stainless steel wire ropes into segments to fabricate twisted wires. Stainless steel porous twisted wire materials (PTWMs) with a spatial composite intertexture structure are produced by the compaction and subsequent vacuum solid-phase sintering of twisted wires. The stainless steel PTWMs show two types of typical uniaxial tensile failure modes, i.e., a 45° angle fracture mode and an auxetic failure mode (the PTWMs expand along the direction perpendicular to the tension). The effects of the sintering parameters, porosities, wire diameters, and sampling direction on the tensile properties of the PTWMs are carefully investigated. By increasing the sintering temperature from 1130 °C to 1330 °C, the tensile strength of the PTWMs with 70% target porosity increased from 7.7 MPa to 28.6 MPa and the total failure goes down to 50%. When increasing the sintering time from 90 min to 150 min, the tensile strength increases from 12.4 MPa to 19.1 MPa and the total failure elongation drops to 78.6%. The tensile strength of the PTWMs increases from 28.9 MPa to 112.7 MPa with decreasing porosity from 69.5% to 46.0%, and the total failure elongation also increases from 14.8% to 40.7%. The tensile strength and the failure strain of the PTWMs with fine wires are higher than those of the PTWMs with coarse wires under the same porosity. Sampling direction has a small influence on the tensile properties of the PTWMs. PMID:28793526

  4. Processing, Structural Characterization and Comparative Studies on Uniaxial Tensile Properties of a New Type of Porous Twisted Wire Material.

    PubMed

    Wu, Fei; Zhou, Zhaoyao; Duan, Liuyang; Xiao, Zhiyu

    2015-08-27

    A self-developed rotary multi-cutter device cuts stainless steel wire ropes into segments to fabricate twisted wires. Stainless steel porous twisted wire materials (PTWMs) with a spatial composite intertexture structure are produced by the compaction and subsequent vacuum solid-phase sintering of twisted wires. The stainless steel PTWMs show two types of typical uniaxial tensile failure modes, i.e. , a 45° angle fracture mode and an auxetic failure mode (the PTWMs expand along the direction perpendicular to the tension). The effects of the sintering parameters, porosities, wire diameters, and sampling direction on the tensile properties of the PTWMs are carefully investigated. By increasing the sintering temperature from 1130 °C to 1330 °C, the tensile strength of the PTWMs with 70% target porosity increased from 7.7 MPa to 28.6 MPa and the total failure goes down to 50%. When increasing the sintering time from 90 min to 150 min, the tensile strength increases from 12.4 MPa to 19.1 MPa and the total failure elongation drops to 78.6%. The tensile strength of the PTWMs increases from 28.9 MPa to 112.7 MPa with decreasing porosity from 69.5% to 46.0%, and the total failure elongation also increases from 14.8% to 40.7%. The tensile strength and the failure strain of the PTWMs with fine wires are higher than those of the PTWMs with coarse wires under the same porosity. Sampling direction has a small influence on the tensile properties of the PTWMs.

  5. Comparison of split double and triple twists in pair figure skating.

    PubMed

    King, Deborah L; Smith, Sarah L; Brown, Michele R; McCrory, Jean L; Munkasy, Barry A; Scheirman, Gary I

    2008-05-01

    In this study, we compared the kinematic variables of the split triple twist with those of the split double twist to help coaches and scientists understand these landmark pair skating skills. High-speed video was taken during the pair short and free programmes at the 2002 Salt Lake City Winter Olympics and the 2003 International Skating Union Grand Prix Finals. Three-dimensional analyses of 14 split double twists and 15 split triple twists from eleven pairs were completed. In spite of considerable variability in the performance variables among the pairs, the main difference between the split double twists and split triple twists was an increase in rotational rate. While eight of the eleven pairs relied primarily on an increased rotational rate to complete the split triple twist, three pairs employed a combined strategy of increased rotational rate and increased flight time due predominantly to delayed or lower catches. These results were similar to observations of jumps in singles skating for which the extra rotation is typically due to an increase in rotational velocity; increases in flight time come primarily from delayed landings as opposed to additional height during flight. Combining an increase in flight time and rotational rate may be a good strategy for completing the split triple twist in pair skating.

  6. Network Implementation Trade-Offs in Existing Homes

    NASA Astrophysics Data System (ADS)

    Keiser, Gerd

    2013-03-01

    The ever-increasing demand for networking of high-bandwidth services in existing homes has resulted in several options for implementing an in-home network. Among the options are power-line communication techniques, twisted-pair copper wires, wireless links, and plastic or glass optical fibers. Whereas it is easy to install high-bandwidth optical fibers during the construction of new living units, retrofitting of existing homes with networking capabilities requires some technology innovations. This article addresses some trade-offs that need to be made on what transmission media can be retrofitted most effectively in existing homes.

  7. Shaft transducer having dc output proportional to angular velocity

    NASA Technical Reports Server (NTRS)

    Handlykken, M. B. (Inventor)

    1984-01-01

    A brushless dc tachometer is disclosed that includes a high strength toroidal permanent magnet for providing a uniform magnetic field in an air gap, an annular pole piece opposite the magnet, and a pickup coil wound around the pole piece and adapted to rotate about the axis of the pole piece. The pickup coil is rotated by an input shaft to which the coil is coupled with the friction clip. The output of the coil is conducted to circuitry by a twisted wire pair. The input shaft also activates a position transducing potentiometer.

  8. Needleless electrospinning with twisted wire spinneret

    NASA Astrophysics Data System (ADS)

    Holopainen, Jani; Penttinen, Toni; Santala, Eero; Ritala, Mikko

    2015-01-01

    A needleless electrospinning setup named ‘Needleless Twisted Wire Electrospinning’ was developed. The polymer solution is electrospun from the surface of a twisted wire set to a high voltage and collected on a cylindrical collector around the wire. Multiple Taylor cones are simultaneously self-formed on the downward flowing solution. The system is robust and simple with no moving parts aside from the syringe pump used to transport the solution to the top of the wire. The structure and process parameters of the setup and the results on the preparation of polyvinyl pyrrolidone (PVP), hydroxyapatite (HA) and bioglass fibers with the setup are presented. PVP fiber sheets with areas of 40 × 120 cm2 and masses up to 1.15 g were prepared. High production rates of 5.23 g h-1 and 1.40 g h-1 were achieved for PVP and HA respectively. The major limiting factor of the setup is drying of the polymer solution on the wire during the electrospinning process which will eventually force to interrupt the process for cleaning of the wire. Possible solutions to this problem and other ways to develop the setup are discussed. The presented system provides a simple way to increase the production rate and area of fiber sheet as compared with the conventional needle electrospinning.

  9. Single-wire dye-sensitized solar cells wrapped by carbon nanotube film electrodes.

    PubMed

    Zhang, Sen; Ji, Chunyan; Bian, Zhuqiang; Liu, Runhua; Xia, Xinyuan; Yun, Daqin; Zhang, Luhui; Huang, Chunhui; Cao, Anyuan

    2011-08-10

    Conventional fiber-shaped polymeric or dye-sensitized solar cells (DSSCs) are usually made into a double-wire structure, in which a secondary electrode wire (e.g., Pt) was twisted along the primary core wire consisting of active layers. Here, we report highly flexible DSSCs based on a single wire, by wrapping a carbon nanotube film around Ti wire-supported TiO(2) tube arrays as the transparent electrode. Unlike a twisted Pt electrode, the CNT film ensures full contact with the underlying active layer, as well as uniform illumination along circumference through the entire DSSC. The single-wire DSSC shows a power conversion efficiency of 1.6% under standard illumination (AM 1.5, 100 mW/cm(2)), which is further improved to more than 2.6% assisted by a second conventional metal wire (Ag or Cu). Our DSSC wires are stable and can be bent to large angles up to 90° reversibly without performance degradation.

  10. Manufacturing a thin wire electrostatic trap for ultracold polar molecules.

    PubMed

    Kleinert, J; Haimberger, C; Zabawa, P J; Bigelow, N P

    2007-11-01

    We present a detailed description on how to build a thin wire electrostatic trap (TWIST) for ultracold polar molecules. It is the first design of an electrostatic trap that can be superimposed directly onto a magneto-optical trap (MOT). We can thus continuously produce ultracold polar molecules via photoassociation from a two species MOT and instantaneously trap them in the TWIST without the need for complex transfer schemes. Despite the spatial overlap of the TWIST and the MOT, the two traps can be operated and optimized completely independently due to the complementary nature of the utilized trapping mechanisms.

  11. Horizontal versus vertical orientation of the loop for tension band wiring of transverse patella fractures.

    PubMed

    Lee, Sang Ki; Hwang, Yoon Sub; Choy, Won Sik

    2014-03-01

    Conventional operative treatments of patella fractures are frequently associated with implant failure or displacement. Recent biomechanical studies showed that the orientation of the wire loop and the site of the wire twist can affect the fixation strength. The purpose of this study was to compare the clinical outcome of the tension band technique with loops in different orientations and different knot positions. For this retrospective study, 72 patella fractures (71 patients) were fixed with figure-of-eight configurations in combination with 2 K-wires. Patients were divided into 3 groups according to the orientation of tension band construct. A total of 40 patella fractures were placed with figure-of-eight configurations in a vertical orientation either with 1 wire twist (group 1; 16 patella fractures) or with 2 wire twists at the adjacent corners (group 2; 24 patella fractures). Thirty-two patella fractures were placed with figure-of-eight configurations in a horizontal orientation with 2 wire twists at the adjacent corners (group 3). Range of motion, complication rates, and knee scoring scales (Hospital for Special Surgery and Lysholm) were assessed during serial follow-up. Satisfactory reductions were achieved in all groups, but functional results in the early stage were different. Group 3 had better Hospital for Special Surgery and Lysholm scores at 3 months postoperatively; however, at 6 months and 1 year postoperatively, all groups had similar scores. At the 1-year follow-up, all groups achieved acceptable flexion and range of motion. The overall complication rate was lower in the horizontal group (12.5%). Placing the figure-of-eight tension band construct in a horizontal orientation can provide functional benefits in the early stage after patella fractures. Copyright 2014, SLACK Incorporated.

  12. Twisted ultrathin silicon nanowires: A possible torsion electromechanical nanodevice

    NASA Astrophysics Data System (ADS)

    Garcia, J. C.; Justo, J. F.

    2014-11-01

    Nanowires have been considered for a number of applications in nanometrology. In such a context, we have explored the possibility of using ultrathin twisted nanowires as torsion nanobalances to probe forces and torques at molecular level with high precision, a nanoscale system analogous to the Coulomb's torsion balance electrometer. In order to achieve this goal, we performed a first-principles investigation on the structural and electronic properties of twisted silicon nanowires, in their pristine and hydrogenated forms. The results indicated that wires with pentagonal and hexagonal cross-sections are the thinnest stable silicon nanostructures. Additionally, all wires followed a Hooke's law behavior for small twisting deformations. Hydrogenation leads to spontaneous twisting, but with angular spring constants considerably smaller than the ones for the respective pristine forms. We observed considerable changes on the nanowire electronic properties upon twisting, which allows to envision the possibility of correlating the torsional angular deformation with the nanowire electronic transport. This could ultimately allow a direct access to measurements on interatomic forces at molecular level.

  13. Dissipative cryogenic filters with zero dc resistance.

    PubMed

    Bluhm, Hendrik; Moler, Kathryn A

    2008-01-01

    The authors designed, implemented, and tested cryogenic rf filters with zero dc resistance, based on wires with a superconducting core inside a resistive sheath. The superconducting core allows low frequency currents to pass with negligible dissipation. Signals above the cutoff frequency are dissipated in the resistive part due to their small skin depth. The filters consist of twisted wire pairs shielded with copper tape. Above approximately 1 GHz, the attenuation is exponential in omega, as typical for skin depth based rf filters. By using additional capacitors of 10 nF per line, an attenuation of at least 45 dB above 10 MHz can be obtained. Thus, one single filter stage kept at mixing chamber temperature in a dilution refrigerator is sufficient to attenuate room temperature black body radiation to levels corresponding to 10 mK above about 10 MHz.

  14. Copper link evaluations/solutions for fiber channel, SSA, SONET, ATM, and other services through 4 Gb/sec: basic information, test results, and evaluation

    NASA Astrophysics Data System (ADS)

    Leib, Michael J.

    1995-10-01

    Technitrol, the original designer of MIL-STD-1553 transformers, the original military 1Mb/s LAN, has advanced the state of the art one further notch, introducing a series of transceivers that allow high speed (through 1 Gb/s) data transmission over copper wire instead of fiber optic cable. One such device can be employed to implement the Fiber Channel Interface as defined by hte X3T11 ANSI Fibre Channel Committee using either mini coax, Type 1 shielded twisted pair, twinax or video cable. The technology now exists to upgrade data transmission rates on current physical media to speeds formerly only available with fiber optic cabling. Copper transceiver technology provides a cost effective alternative for dealing with demanding high speed applications such as high speed serial data transfer, high speed disk and tape storage transfer, imaging telemetry, radar, and other avionics applications. Eye diagrams will be presented to show that excellent data transmission at rates of 1 gigabit/sec with low jitter is capable over mini coax at distances to approximately 50 meters, shielded twisted pair and twinax cable to distances of 105 meters, and video cable to distances of 175 meters. Distances are further at lower data rates. As a member of the X3T11 ANSI Fiber Channel Committee, Technitrol has developed a Physical Media (copper wire) Dependant (PMD) transceiver not only compliant with the Fibre Channel Specifications but exceeding the specifications by a factor greater than four. Conceivably, this opens high speed interconnections for today's high data rate requirements to copper cabling systems. Fibre Optic problems need not be dealt with to obtain data transfers for high speed information transfers.

  15. Wire and Packing Tape Sandwiches

    ERIC Educational Resources Information Center

    Rabinowitz, Sandy

    2009-01-01

    In this article, the author describes how students can combine craft wire with clear packing tape to create a two-dimensional design that can be bent and twisted to create a three-dimensional form. Students sandwich wire designs between two layers of tape. (Contains 1 online resource.)

  16. Verification of Small Hole Theory for Application to Wire Chaffing Resulting in Shield Faults

    NASA Technical Reports Server (NTRS)

    Schuet, Stefan R.; Timucin, Dogan A.; Wheeler, Kevin R.

    2011-01-01

    Our work is focused upon developing methods for wire chafe fault detection through the use of reflectometry to assess shield integrity. When shielded electrical aircraft wiring first begins to chafe typically the resulting evidence is small hole(s) in the shielding. We are focused upon developing algorithms and the signal processing necessary to first detect these small holes prior to incurring damage to the inner conductors. Our approach has been to develop a first principles physics model combined with probabilistic inference, and to verify this model with laboratory experiments as well as through simulation. Previously we have presented the electromagnetic small-hole theory and how it might be applied to coaxial cable. In this presentation, we present our efforts to verify this theoretical approach with high-fidelity electromagnetic simulations (COMSOL). Laboratory observations are used to parameterize the computationally efficient theoretical model with probabilistic inference resulting in quantification of hole size and location. Our efforts in characterizing faults in coaxial cable are subsequently leading to fault detection in shielded twisted pair as well as analysis of intermittent faulty connectors using similar techniques.

  17. A turtle-like swimming robot using a smart soft composite (SSC) structure

    NASA Astrophysics Data System (ADS)

    Kim, Hyung-Jung; Song, Sung-Hyuk; Ahn, Sung-Hoon

    2013-01-01

    This paper describes the development of a biomimetic swimming robot based on the locomotion of a marine turtle. To realize the smooth, soft flapping motions of this type of turtle, a novel actuator was also developed, using a smart soft composite (SSC) structure that can generate bending and twisting motions in a simple, lightweight structure. The SSC structure is a composite consisting of an active component to generate the actuation force, a passive component to determine the twisting angle of the structure, and a matrix to combine the components. The motion of such a structure can be designed by specifying the angle between a filament of the scaffold structure and a shape-memory alloy (SMA) wire. The bending and twisting motion of the SSC structure is explained in terms of classical laminate theory, and cross-ply and angled-ply structures were fabricated to evaluate its motion. Finally, the turtle-like motion of a swimming robot was realized by employing a specially designed SSC structure. To mimic the posterior positive twisting angle of a turtle’s flipper during the upstroke, the SMA wire on the upper side was offset, and a positive ply-angled scaffold was used. Likewise, for the anterior negative twisting angle of the flipper during the downstroke, an offset SMA wire on the lower side and a positive ply-angled scaffold were also required. The fabricated flipper’s length is 64.3 mm and it realizes 55 mm bending and 24° twisting. The resulting robot achieved a swimming speed of 22.5 mm s-1.

  18. New twisted intermetallic compound superconductor: A concept

    NASA Technical Reports Server (NTRS)

    Coles, W. D.; Brown, G. V.; Laurence, J. C.

    1972-01-01

    Method for processing Nb3Sn and other intermetallic compound superconductors produces a twisted, stabilized wire or tube which can be used to wind electromagnetics, armatures, rotors, and field windings for motors and generators as well as other magnetic devices.

  19. Downhole transmission system

    DOEpatents

    Hall, David R [Provo, UT; Fox, Joe [Spanish Fork, UT

    2008-01-15

    A transmission system in a downhole component comprises a data transmission element in both ends of the downhole component. Each data transmission element houses an electrically conducting coil in a MCEI circular trough. An electrical conductor connects both the transmission elements. The electrical conductor comprises at least three electrically conductive elements insulated from each other. In the preferred embodiment the electrical conductor comprises an electrically conducting outer shield, an electrically conducting inner shield and an electrical conducting core. In some embodiments of the present invention, the electrical conductor comprises an electrically insulating jacket. In other embodiments, the electrical conductor comprises a pair of twisted wires. In some embodiments, the electrical conductor comprises semi-conductive material.

  20. Twisted complex superfluids in optical lattices

    PubMed Central

    Jürgensen, Ole; Sengstock, Klaus; Lühmann, Dirk-Sören

    2015-01-01

    We show that correlated pair tunneling drives a phase transition to a twisted superfluid with a complex order parameter. This unconventional superfluid phase spontaneously breaks the time-reversal symmetry and is characterized by a twisting of the complex phase angle between adjacent lattice sites. We discuss the entire phase diagram of the extended Bose—Hubbard model for a honeycomb optical lattice showing a multitude of quantum phases including twisted superfluids, pair superfluids, supersolids and twisted supersolids. Furthermore, we show that the nearest-neighbor interactions lead to a spontaneous breaking of the inversion symmetry of the lattice and give rise to dimerized density-wave insulators, where particles are delocalized on dimers. For two components, we find twisted superfluid phases with strong correlations between the species already for surprisingly small pair-tunneling amplitudes. Interestingly, this ground state shows an infinite degeneracy ranging continuously from a supersolid to a twisted superfluid. PMID:26345721

  1. Reducing Magnetic Fields Around Power Cables

    NASA Technical Reports Server (NTRS)

    Sargent, Noel B.; Gitelman, Florida; Pongracz-Bartha, Edward; Spalding, John

    1993-01-01

    Four power conductors arranged symmetrically about fifth grounded conductor. Four current-carrying wires arranged symmetrically around central grounded wire that nominally carries no current. In comparison with other cable configurations, this one results in smaller magnetic fields around cable. Technique for use when size of wires in cable makes twisting impractical.

  2. A comparison of torque expression between stainless steel, titanium molybdenum alloy, and copper nickel titanium wires in metallic self-ligating brackets.

    PubMed

    Archambault, Amy; Major, Thomas W; Carey, Jason P; Heo, Giseon; Badawi, Hisham; Major, Paul W

    2010-09-01

    The force moment providing rotation of the tooth around the x-axis (buccal-lingual) is referred to as torque expression in orthodontic literature. Many factors affect torque expression, including the wire material characteristics. This investigation aims to provide an experimental study into and comparison of the torque expression between wire types. With a worm-gear-driven torquing apparatus, wire was torqued while a bracket mounted on a six-axis load cell was engaged. Three 0.019 x 0.0195 inch wire (stainless steel, titanium molybdenum alloy [TMA], copper nickel titanium [CuNiTi]), and three 0.022 inch slot bracket combinations (Damon 3MX, In-Ovation-R, SPEED) were compared. At low twist angles (<12 degrees), the differences in torque expression between wires were not statistically significant. At twist angles over 24 degrees, stainless steel wire yielded 1.5 to 2 times the torque expression of TMA and 2.5 to 3 times that of nickel titanium (NiTi). At high angles of torsion (over 40 degrees) with a stiff wire material, loss of linear torque expression sometimes occurred. Stainless steel has the largest torque expression, followed by TMA and then NiTi.

  3. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  4. Modeling and testing of ethernet transformers

    NASA Astrophysics Data System (ADS)

    Bowen, David

    2011-12-01

    Twisted-pair Ethernet is now the standard home and office last-mile network technology. For decades, the IEEE standard that defines Ethernet has required electrical isolation between the twisted pair cable and the Ethernet device. So, for decades, every Ethernet interface has used magnetic core Ethernet transformers to isolate Ethernet devices and keep users safe in the event of a potentially dangerous fault on the network media. The current state-of-the-art Ethernet transformers are miniature (<5mm diameter) ferrite-core toroids wrapped with approximately 10 to 30 turns of wire. As small as current Ethernet transformers are, they still limit further Ethernet device miniaturization and require a separate bulky package or jack housing. New coupler designs must be explored which are capable of exceptional miniaturization or on-chip fabrication. This dissertation thoroughly explores the performance of the current commercial Ethernet transformers to both increase understanding of the device's behavior and outline performance parameters for replacement devices. Lumped element and distributed circuit models are derived; testing schemes are developed and used to extract model parameters from commercial Ethernet devices. Transfer relation measurements of the commercial Ethernet transformers are compared against the model's behavior and it is found that the tuned, distributed models produce the best transfer relation match to the measured data. Process descriptions and testing results on fabricated thin-film dielectric-core toroid transformers are presented. The best results were found for a 32-turn transformer loaded with 100Ω, the impedance of twisted pair cable. This transformer gave a flat response from about 10MHz to 40MHz with a height of approximately 0.45. For the fabricated transformer structures, theoretical methods to determine resistance, capacitance and inductance are presented. A special analytical and numerical analysis of the fabricated transformer inductance is presented. Planar cuts of magnetic slope fields around the dielectric-core toroid are shown that describe the effect of core height and winding density on flux uniformity without a magnetic core.

  5. Effects of Ionizing Radiation and Restraint Stress on Activity, Avoidance Conditioning, and Stomach Ulcers in Albino Rats.

    DTIC Science & Technology

    1984-03-01

    surrounded the rat. The ends of the screen wire tube were twisted and secured with galvanized wire. Care was taken to wrap the screen wire tight so that...function. In N. R. DiLuzio and R. Paoletti (eds.). The reticuloendothelial system and atherosclerosis : Advances in experimental medicine and biology, pp

  6. Fabrication of wrist-like SMA-based actuator by double smart soft composite casting

    NASA Astrophysics Data System (ADS)

    Rodrigue, Hugo; Wei, Wang; Bhandari, Binayak; Ahn, Sung-Hoon

    2015-12-01

    A new manufacturing method for smart soft composite (SSC) actuators that consists of double casting a SSC actuator to produce an actuator with non-linear shape memory alloy (SMA) wire positioning is proposed. This method is used to manufacture a tube-shaped SSC actuator in which the SMA wires follow the curvature of the tube and is capable of pure-twisting deformations while sustaining a cantilever load. The concept is tested by measuring the maximum twisting angle and a simple control method is proposed to control the twisting angle of the actuator. Then, a soft robotic wrist with a length of 18 cm is built, its load-carrying capability is tested by measuring the cantilever force required for deforming the actuator, and its load-carrying capability during actuation is tested by loading one end with different objects and actuating the actuator. This wrist actuator shows good repeatability, is capable of twisting deformations up to 25° while holding objects weighing 100 g, and can sustain loads above 2 N without undergoing buckling.

  7. Flexible and weaveable capacitor wire based on a carbon nanocomposite fiber.

    PubMed

    Ren, Jing; Bai, Wenyu; Guan, Guozhen; Zhang, Ye; Peng, Huisheng

    2013-11-06

    A flexible and weaveable electric double-layer capacitor wire is developed by twisting two aligned carbon nanotube/ordered mesoporous carbon composite fibers with remarkable mechanical and electronic properties as electrodes. This capacitor wire exhibits high specific capacitance and long life stability. Compared with the conventional planar structure, the capacitor wire is also lightweight and can be integrated into various textile structures that are particularly promising for portable and wearable electronic devices. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Advanced Twisted Pair Cables for Distributed Local Area Networks in Intelligent Structure Systems

    NASA Astrophysics Data System (ADS)

    Semenov, Andrey

    2018-03-01

    The possibility of a significant increase in the length of cable communication channels of local area networks of automation and engineering support systems of buildings in the case of their implementation on balanced twisted pair cables is shown. Assuming a direct connection scheme and an effective speed of 100 Mbit/s, analytical relationships are obtained for the calculation of the maximum communication distance. The necessity of using in the linear part of such systems of twisted pair cables with U/UTP structure and interference parameters at the level of category 5e is grounded.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kleinert, J.; Haimberger, C.; Zabawa, P. J.

    We present a detailed description on how to build a thin wire electrostatic trap (TWIST) for ultracold polar molecules. It is the first design of an electrostatic trap that can be superimposed directly onto a magneto-optical trap (MOT). We can thus continuously produce ultracold polar molecules via photoassociation from a two species MOT and instantaneously trap them in the TWIST without the need for complex transfer schemes. Despite the spatial overlap of the TWIST and the MOT, the two traps can be operated and optimized completely independently due to the complementary nature of the utilized trapping mechanisms.

  10. Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

    DOE PAGES

    Zhang, Yan; Inouye, Hideyo; Crowley, Michael; ...

    2016-10-14

    Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. As a result, this algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

  11. Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yan; Inouye, Hideyo; Crowley, Michael

    Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. This algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

  12. Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yan; Inouye, Hideyo; Crowley, Michael

    Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. As a result, this algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

  13. Hollow optical fiber induced solar cells with optical energy storage and conversion.

    PubMed

    Ding, Jie; Zhao, Yuanyuan; Duan, Jialong; Duan, Yanyan; Tang, Qunwei

    2017-11-09

    Hollow optical fiber induced dye-sensitized solar cells are made by twisting Ti wire/N719-TiO 2 nanotube photoanodes and Ti wire/Pt (CoSe, Pt 3 Ni) counter electrodes, yielding a maximized efficiency of 0.7% and good stability. Arising from optical energy storage ability, the solar cells can generate electricity without laser illumination.

  14. Rapid electron beam accelerator (REBA-tron)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kapetanakos, C.A.; Sprangle, P.A.; Dialetis, D.

    1986-03-05

    This invention comprises a particle accelerator with a toroidal vacuum chamber, an injector for injecting a charged-paticle beam into the chamber and an exit port to extract the accelerated particle beam. A toroidal magnetic field to confine the beam in the chamber is generated by a set of coils with their axis along the minor axis of the chamber and by two twisted wires that carry current in the same direction wrapped around the chamber. The two twisted wires also generate a torsatron magnetic field that controls the minor radius of the beam. A time-varying magnetic field is generated bymore » two concentric cylindrical plates surrounding the chamber. A convoluted transmission line generates a localized electric field in the chamber to accelerate the beam.« less

  15. Wire stripper

    NASA Technical Reports Server (NTRS)

    Economu, M. A. (Inventor)

    1978-01-01

    An insulation stripper is described which is especially useful for shielded wire, the stripper including a first pair of jaws with blades extending substantially perpendicular to the axis of the wire, and a second pair of jaws with blades extending substantially parallel to the axis of the wire. The first pair of jaws is pressed against the wire so the blades cut into the insulation, and the device is turned to form circumferential cuts in the insulation. Then the second pair of jaws is pressed against the wire so the blades cut into the insulation, and the wire is moved through the device to form longitudinal cuts that permit easy removal of the insulation. Each of the blades is located within the concave face of a V-block, to center the blades on the wire and to limit the depth of blade penetration.

  16. Wire in the Cable-Driven System of Surgical Robot

    NASA Astrophysics Data System (ADS)

    Wang, X. F.; Lv, N.; Mu, H. Z.; Xue, L. J.

    2017-07-01

    During the evolution of the surgical robot, cable plays an important role. It translates motion and force precisely from surgeon’s hand to the tool’s tips. In the paper, the vertical wires, the composition of cable, are mathematically modeled from a geometric point of view. The cable structure and tension are analyzed according to the characteristics of wire screw twist. The structural equations of the wires in different positions are derived for both non-bent cable and bent cable, respectively. The bending moment formula of bent cable is also obtained. This will help researchers find suitable cable and design more matched pulley.

  17. Twisted rogue-wave pairs in the Sasa-Satsuma equation.

    PubMed

    Chen, Shihua

    2013-08-01

    Exact explicit rogue wave solutions of the Sasa-Satsuma equation are obtained by use of a Darboux transformation. In addition to the double-peak structure and an analog of the Peregrine soliton, the rogue wave can exhibit an intriguing twisted rogue-wave pair that involves four well-defined zero-amplitude points. This exotic structure may enrich our understanding on the nature of rogue waves.

  18. Biomechanical performance of different cable and wire cerclage configurations.

    PubMed

    Lenz, Mark; Perren, Stephan Marcel; Richards, Robert Geoff; Mückley, Thomas; Hofmann, Gunther Olaf; Gueorguiev, Boyko; Windolf, Markus

    2013-01-01

    Cerclage technology is regaining interest due to the increasing number of periprosthetic fractures. Different wiring techniques have been formerly proposed and have hibernated over years. Hereby, they are compared to current cerclage technology. Seven groups (n = 6) of different cable cerclage (Ø1.7 mm, crimp closure) configurations (one single cerclage looped once around the shells, one single cerclage looped twice, two cerclages each looped once) and solid wire cerclages (Ø1.5 mm, twist closure) (same configurations as cable cerclages, and two braided wires, twisted around each other looped once) fixed two cortical half shells of human femoral shaft mounted on a testing jig. Sinusoidal cyclic loading with constantly increasing force (0.1 N/cycle) was applied starting at 50 N peak load. Cerclage pretension (P), load leading to onset of plastic deformation (D) and load at total failure (T) were identified. Statistical differences between the groups were detected by univariate ANOVA. Double looped cables (P442N ± 129; D1334N ± 319; T2734N ± 330) performed significantly better (p < 0.05) than single looped cables (P292N ± 56; D646N ± 108; T1622N ± 171) and were comparable to two single cables (P392N ± 154; D1191N ± 334; T2675N ± 361). Double looped wires (P335N ± 49; D752N ± 119; T1359N ± 80) were significantly better (p < 0.05) than single looped wires (P181N ± 16; D343N ± 33; T606N ± 109) and performed similarly to single looped cables. Braided wires (P119N ± 26; D225N ± 55; T919N ± 197) exhibited early loss of pretension and plastic deformation. Double looped cerclages provided a better fixation stability compared to a single looped cerclage. Double looped wires were comparable to a single looped cable. The use of braided wires could not be recommended mechanically.

  19. The chopstick-noodle twist: an easy technique of percutaneous patellar fixation in minimally displaced patellar fractures.

    PubMed

    Muzaffar, Nasir; Ahmad, Nawaz; Ahmad, Aejaz; Ahmad, Nissar

    2012-01-01

    We report six cases of minimally displaced two-part patellar fractures with skin injury over the patella that were treated with percutaneous K wire fixation and compression applied using stainless steel (SS) wire. This technique makes it possible to perform early operative treatment in cases where unhealthy skin is not amenable to conventional tension band wiring. The technique employs two K wires inserted through the two fracture fragments under local or regional anaesthesia. They are then compressed using simple SS wire knots at the two ends - making it look like noodles at the end of two chopsticks. The fixation is subsequently augmented with a cylindrical plaster-of-Paris cast. The technique is simple, cheap and does not cause soft tissue injury.

  20. Powerplexer

    NASA Technical Reports Server (NTRS)

    Woods, J. M. (Inventor)

    1973-01-01

    An electrical power distribution system is described for use in providing different dc voltage levels. A circuit is supplied with DC voltage levels and commutates pulses for timed intervals onto a pair of distribution wires. The circuit is driven by a command generator which places pulses on the wires in a timed sequence. The pair of wires extend to voltage strippers connected to the various loads. The voltage strippers each respond to the pulse dc levels on the pair of wires and form different output voltages communicated to each load.

  1. Stacking interactions and DNA intercalation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dr. Shen; Cooper, Valentino R; Thonhauser, Prof. Timo

    2009-01-01

    The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observedmore » proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.« less

  2. Structural-Phase States of Fe-Cu and Fe-Ag Bimetallic Particles Produced by Electric Explosion of Two Wires

    NASA Astrophysics Data System (ADS)

    Lerner, M. I.; Bakina, O. V.; Pervikov, A. V.; Glazkova, E. A.; Lozhkomoev, A. S.; Vorozhtsov, A. B.

    2018-05-01

    X-ray phase analysis, transmission electron microscopy, and X-ray microanalysis were used to examine the structural-phase states of Fe-Cu and Fe-Ag bimetallic nanoparticles. The nanoparticles were obtained by the electric explosion of two twisted metal wires in argon atmosphere. It was demonstrated that the nanoparticles have the structure of Janus particles. Presence of the Janus particle structure in the samples indicates formation of binary melt under conditions of combined electric explosion of two wires. Phases based on supersaturated solid solutions were not found in the examined samples. The data obtained allow arguing that it is possible to achieve uniform mixing of the two-wire explosion products under the described experiment conditions.

  3. Structural-Phase States of Fe–Cu and Fe–Ag Bimetallic Particles Produced by Electric Explosion of Two Wires

    NASA Astrophysics Data System (ADS)

    Lerner, M. I.; Bakina, O. V.; Pervikov, A. V.; Glazkova, E. A.; Lozhkomoev, A. S.; Vorozhtsov, A. B.

    2018-05-01

    X-ray phase analysis, transmission electron microscopy, and X-ray microanalysis were used to examine the structural-phase states of Fe-Cu and Fe-Ag bimetallic nanoparticles. The nanoparticles were obtained by the electric explosion of two twisted metal wires in argon atmosphere. It was demonstrated that the nanoparticles have the structure of Janus particles. Presence of the Janus particle structure in the samples indicates formation of binary melt under conditions of combined electric explosion of two wires. Phases based on supersaturated solid solutions were not found in the examined samples. The data obtained allow arguing that it is possible to achieve uniform mixing of the two-wire explosion products under the described experiment conditions.

  4. Advancements in Theoretical Models of Confined Vortex Flowfields

    DTIC Science & Technology

    2007-03-29

    blades, curved vanes, vortex generators, twisted tape inserts, triangular winglets , propellers, coiled wires, tangential injectors, and other...Corresponding boundary conditions consist of the no slip at the wall and blending with the composite inner solution in the outer domain. Following similar

  5. Heat accumulation during sequential cortical bone drilling.

    PubMed

    Palmisano, Andrew C; Tai, Bruce L; Belmont, Barry; Irwin, Todd A; Shih, Albert; Holmes, James R

    2016-03-01

    Significant research exists regarding heat production during single-hole bone drilling. No published data exist regarding repetitive sequential drilling. This study elucidates the phenomenon of heat accumulation for sequential drilling with both Kirschner wires (K wires) and standard two-flute twist drills. It was hypothesized that cumulative heat would result in a higher temperature with each subsequent drill pass. Nine holes in a 3 × 3 array were drilled sequentially on moistened cadaveric tibia bone kept at body temperature (about 37 °C). Four thermocouples were placed at the center of four adjacent holes and 2 mm below the surface. A battery-driven hand drill guided by a servo-controlled motion system was used. Six samples were drilled with each tool (2.0 mm K wire and 2.0 and 2.5 mm standard drills). K wire drilling increased temperature from 5 °C at the first hole to 20 °C at holes 6 through 9. A similar trend was found in standard drills with less significant increments. The maximum temperatures of both tools increased from <0.5 °C to nearly 13 °C. The difference between drill sizes was found to be insignificant (P > 0.05). In conclusion, heat accumulated during sequential drilling, with size difference being insignificant. K wire produced more heat than its twist-drill counterparts. This study has demonstrated the heat accumulation phenomenon and its significant effect on temperature. Maximizing the drilling field and reducing the number of drill passes may decrease bone injury. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  6. Twirling and Whirling: Viscous Dynamics of Rotating Elastica

    NASA Astrophysics Data System (ADS)

    Wolgemuth, Charles; Powers, Thomas; Goldstein, Raymond

    1999-10-01

    The stability of forced elastic filaments arise in several important biological settings involving bend and twist elasticity at low Reynolds number. Examples include DNA transcription and replication and bacterial flagellar motion. In order to elucidate fundamental processes common to these systems, we consider the model problem of a rotationally forced filament with twist and bend elasticity. Competition between twist injection, twist diffusion, and writhing instabilities is described by a novel pair of PDEs for twist and bend evolution. Analytical and numerical methods elucidate the twist/bend coupling and reveal two dynamical regimes seperated by a Hopf bifurcation: (i) diffusion-dominated axial rotation, or twirling, and (ii) steady-state crankshafting motion, or whirling. Experiments are proposed to examine these phenomena and the consequences for swimming investigated.

  7. Bound states and propagating modes in quantum wires with sharp bends and/or constrictions

    NASA Astrophysics Data System (ADS)

    Razavy, M.

    1997-06-01

    A number of interesting problems of quantum wires with different geometries can be studied with the help of conformal mapping. These include crossed wires, twisting wires, conductors with constrictions, and wires with a bend. Here the Helmholz equation with Dirichlet boundary condition on the surface of the wire is transformed to a Schröautdinger-like equation with an energy-dependent nonseparable potential but with boundary conditions given on two straight lines. By expanding the wave function in terms of the Fourier series of one of the variables one obtains an infinite set of coupled ordinary differential equations. Only the propagating modes plus a few of the localized modes contribute significantly to the total wave function. Once the problem is solved, one can express the results in terms of the original variables using the inverse conformal mapping. As an example, the total wave function, the components of the current density, and the bound-state energy for a Γ-shaped quantum wire is calculated in detail.

  8. Evaluation Of Risk And Possible Mitigation Schemes For Previously Unidentified Hazards

    NASA Technical Reports Server (NTRS)

    Linzey, William; McCutchan, Micah; Traskos, Michael; Gilbrech, Richard; Cherney, Robert; Slenski, George; Thomas, Walter, III

    2006-01-01

    This report presents the results of arc track testing conducted to determine if such a transfer of power to un-energized wires is possible and/or likely during an arcing event, and to evaluate an array of protection schemes that may significantly reduce the possibility of such a transfer. The results of these experiments may be useful for determining the level of protection necessary to guard against spurious voltage and current being applied to safety critical circuits. It was not the purpose of these experiments to determine the probability of the initiation of an arc track event only if an initiation did occur could it cause the undesired event: an inadvertent thruster firing. The primary wire insulation used in the Orbiter is aromatic polyimide, or Kapton , a construction known to arc track under certain conditions [3]. Previous Boeing testing has shown that arc tracks can initiate in aromatic polyimide insulated 28 volts direct current (VDC) power circuits using more realistic techniques such as chafing with an aluminum blade (simulating the corner of an avionics box or lip of a wire tray), or vibration of an aluminum plate against a wire bundle [4]. Therefore, an arc initiation technique was chosen that provided a reliable and consistent technique of starting the arc and not a realistic simulation of a scenario on the vehicle. Once an arc is initiated, the current, power and propagation characteristics of the arc depend on the power source, wire gauge and insulation type, circuit protection and series resistance rather than type of initiation. The initiation method employed for these tests was applying an oil and graphite mixture to the ends of a powered twisted pair wire. The flight configuration of the heater circuits, the fuel/oxider (or ox) wire, and the RCS jet solenoid were modeled in the test configuration so that the behavior of these components during an arcing event could be studied. To determine if coil activation would occur with various protection wire schemes, 145 tests were conducted using various fuel/ox wire alternatives (shielded and unshielded) and/or different combinations of polytetrafuloroethylene (PTFE), Mystik tape and convoluted wraps to prevent unwanted coil activation. Test results were evaluated along with other pertinent data and information to develop a mitigation strategy for an inadvertent RCS firing. The SSP evaluated civilian aircraft wiring failures to search for aging trends in assessing the wire-short hazard. Appendix 2 applies Weibull statistical methods to the same data with a similar purpose.

  9. Twisted injectivity in projected entangled pair states and the classification of quantum phases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buerschaper, Oliver, E-mail: obuerschaper@perimeterinstitute.ca

    We introduce a class of projected entangled pair states (PEPS) which is based on a group symmetry twisted by a 3-cocycle of the group. This twisted symmetry is expressed as a matrix product operator (MPO) with bond dimension greater than 1 and acts on the virtual boundary of a PEPS tensor. We show that it gives rise to a new standard form for PEPS from which we construct a family of local Hamiltonians which are gapped, frustration-free and include fixed points of the renormalization group flow. Based on this insight, we advance the classification of 2D gapped quantum spin systems bymore » showing how this new standard form for PEPS determines the emergent topological order of these local Hamiltonians. Specifically, we identify their universality class as DIJKGRAAF–WITTEN topological quantum field theory (TQFT). - Highlights: • We introduce a new standard form for projected entangled pair states via a twisted group symmetry which is given by nontrivial matrix product operators. • We construct a large family of gapped, frustration-free Hamiltonians in two dimensions from this new standard form. • We rigorously show how this new standard form for low energy states determines the emergent topological order.« less

  10. Twirling and Whirling: Viscous Dynamics of Rotating Elastica

    NASA Astrophysics Data System (ADS)

    Powers, Thomas R.; Wolgemuth, Charles W.; Goldstein, Raymond E.

    1999-11-01

    Motivated by diverse phenomena in cellular biophysics, including bacterial flagellar motion and DNA transcription and replication, we study the overdamped nonlinear dynamics of a rotationally forced filament with twist and bend elasticity. The competition between twist diffusion and writhing instabilities is described by a novel pair of coupled PDEs for twist and bend evolution. Analytical and numerical methods elucidate the twist-bend coupling and reveal two dynamical regimes separated by a Hopf bifurcation: (i) diffusion-dominated axial rotation, or twirling, and (ii) steady-state crankshafting motion, or whirling. The consequences of these phenomena for self-propulsion are investigated, and experimental tests proposed.

  11. Design and analysis of variable-twist tiltrotor blades using shape memory alloy hybrid composites

    NASA Astrophysics Data System (ADS)

    Park, Jae-Sang; Kim, Seong-Hwan; Jung, Sung Nam; Lee, Myeong-Kyu

    2011-01-01

    The tiltrotor blade, or proprotor, acts as a rotor in the helicopter mode and as a propeller in the airplane mode. For a better performance, the proprotor should have different built-in twist distributions along the blade span, suitable for each operational mode. This paper proposes a new variable-twist proprotor concept that can adjust the built-in twist distribution for given flight modes. For a variable-twist control, the present proprotor adopts shape memory alloy hybrid composites (SMAHC) containing shape memory alloy (SMA) wires embedded in the composite matrix. The proprotor of the Korea Aerospace Research Institute (KARI) Smart Unmanned Aerial Vehicle (SUAV), which is based on the tiltrotor concept, is used as a baseline proprotor model. The cross-sectional properties of the variable-twist proprotor are designed to maintain the cross-sectional properties of the original proprotor as closely as possible. However, the torsion stiffness is significantly reduced to accommodate the variable-twist control. A nonlinear flexible multibody dynamic analysis is employed to investigate the dynamic characteristics of the proprotor such as natural frequency and damping in the whirl flutter mode, the blade structural loads in a transition flight and the rotor performance in hover. The numerical results show that the present proprotor is designed to have a strong similarity to the baseline proprotor in dynamic and load characteristics. It is demonstrated that the present proprotor concept could be used to improve the hover performance adaptively when the variable-twist control using the SMAHC is applied appropriately.

  12. Development and preclinical testing of a new tension-band device for the spine: the Loop system.

    PubMed

    Garner, Matthew D; Wolfe, Steven J; Kuslich, Stephen D

    2002-10-01

    Wire sutures, cerclage constructs, and tension bands have been used for many years in orthopedic surgery. Spinous process and sublaminar wires and other strands or cables are used in the spine to re-establish stability of the posterior spinal ligament complex. Rigid monofilament wires often fail due to weakening created during twisting or wrapping. Stronger metal cables do not conform well to bony surfaces. Polyethylene cables have higher fatigue strength than metal cables. The Loop cable is a pliable, radiolucent, polyethylene braid. Creep of the Loop/locking clip construct is similar to metal cable constructs using crimps. Both systems have less creep than knotted polyethylene cable constructs.

  13. Polydimethylsiloxane pressure sensors for force analysis in tension band wiring of the olecranon.

    PubMed

    Zens, Martin; Goldschmidtboeing, Frank; Wagner, Ferdinand; Reising, Kilian; Südkamp, Norbert P; Woias, Peter

    2016-11-14

    Several different surgical techniques are used in the treatment of olecranon fractures. Tension band wiring is one of the most preferred options by surgeons worldwide. The concept of this technique is to transform a tensile force into a compression force that adjoins two surfaces of a fractured bone. Currently, little is known about the resulting compression force within a fracture. Sensor devices are needed that directly transduce the compression force into a measurement quality. This allows the comparison of different surgical techniques. Ideally the sensor devices ought to be placed in the gap between the fractured segments. The design, development and characterization of miniaturized pressure sensors fabricated entirely from polydimethylsiloxane (PDMS) for a placement within a fracture is presented. The pressure sensors presented in this work are tested, calibrated and used in an experimental in vitro study. The pressure sensors are highly sensitive with an accuracy of approximately 3 kPa. A flexible fabrication process for various possible applications is described. The first in vitro study shows that using a single-twist or double-twist technique in tension band wiring of the olecranon has no significant effect on the resulting compression forces. The in vitro study shows the feasibility of the proposed measurement technique and the results of a first exemplary study.

  14. Two-year survival analysis of twisted wire fixed retainer versus spiral wire and fiber-reinforced composite retainers: a preliminary explorative single-blind randomized clinical trial.

    PubMed

    Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali; Shariati, Mahsa

    2016-03-01

    Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results.

  15. Two-year survival analysis of twisted wire fixed retainer versus spiral wire and fiber-reinforced composite retainers: a preliminary explorative single-blind randomized clinical trial

    PubMed Central

    Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali

    2016-01-01

    Objective Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. Methods In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). Results In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Conclusions Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results. PMID:27019825

  16. Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: III. The importance of strand surface roughness in long twist pitch conductors

    DOE PAGES

    Sanabria, Charlie; Lee, Peter J.; Starch, William; ...

    2016-05-31

    As part of the ITER conductor qualification process, 3 m long Cable-in-Conduit Conductors (CICCs) were tested at the SULTAN facility under conditions simulating ITER operation so as to establish the current sharing temperature, T cs, as a function of multiple full Lorentz force loading cycles. After a comprehensive evaluation of both the Toroidal Field (TF) and the Central Solenoid (CS) conductors, it was found that T cs degradation was common in long twist pitch TF conductors while short twist pitch CS conductors showed some T cs increase. However, one kind of TF conductors containing superconducting strand fabricated by the Bochvarmore » Institute of Inorganic Materials (VNIINM) avoided T cs degradation despite having long twist pitch. In our earlier metallographic autopsies of long and short twist pitch CS conductors, we observed a substantially greater transverse strand movement under Lorentz force loading for long twist pitch conductors, while short twist pitch conductors had negligible transverse movement. With help from the literature, we concluded that the transverse movement was not the source of T cs degradation but rather an increase of the compressive strain in the Nb 3Sn filaments possibly induced by longitudinal movement of the wires. Like all TF conductors this TF VNIINM conductor showed large transverse motions under Lorentz force loading, but Tcs actually increased, as in all short twist pitch CS conductors. We here propose that the high surface roughness of the VNIINM strand may be responsible for the suppression of the compressive strain enhancement (characteristic of long twist pitch conductors). Furthermore, it appears that increasing strand surface roughness could improve the performance of long twist pitch CICCs.« less

  17. Metallographic autopsies of full-scale ITER prototype cable-in-conduit conductors after full cyclic testing in SULTAN: III. The importance of strand surface roughness in long twist pitch conductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sanabria, Charlie; Lee, Peter J.; Starch, William

    As part of the ITER conductor qualification process, 3 m long Cable-in-Conduit Conductors (CICCs) were tested at the SULTAN facility under conditions simulating ITER operation so as to establish the current sharing temperature, T cs, as a function of multiple full Lorentz force loading cycles. After a comprehensive evaluation of both the Toroidal Field (TF) and the Central Solenoid (CS) conductors, it was found that T cs degradation was common in long twist pitch TF conductors while short twist pitch CS conductors showed some T cs increase. However, one kind of TF conductors containing superconducting strand fabricated by the Bochvarmore » Institute of Inorganic Materials (VNIINM) avoided T cs degradation despite having long twist pitch. In our earlier metallographic autopsies of long and short twist pitch CS conductors, we observed a substantially greater transverse strand movement under Lorentz force loading for long twist pitch conductors, while short twist pitch conductors had negligible transverse movement. With help from the literature, we concluded that the transverse movement was not the source of T cs degradation but rather an increase of the compressive strain in the Nb 3Sn filaments possibly induced by longitudinal movement of the wires. Like all TF conductors this TF VNIINM conductor showed large transverse motions under Lorentz force loading, but Tcs actually increased, as in all short twist pitch CS conductors. We here propose that the high surface roughness of the VNIINM strand may be responsible for the suppression of the compressive strain enhancement (characteristic of long twist pitch conductors). Furthermore, it appears that increasing strand surface roughness could improve the performance of long twist pitch CICCs.« less

  18. Reversing Spoken Items--Mind Twisting Not Tongue Twisting

    ERIC Educational Resources Information Center

    Rudner, Mary; Ronnberg, Jerker; Hugdahl, Kenneth

    2005-01-01

    Using 12 participants we conducted an fMRI study involving two tasks, word reversal and rhyme judgment, based on pairs of natural speech stimuli, to study the neural correlates of manipulating auditory imagery under taxing conditions. Both tasks engaged the left anterior superior temporal gyrus, reflecting previously established perceptual…

  19. Repair of olecranon fractures using fiberWire without metallic implants: report of two cases.

    PubMed

    Nimura, Akimoto; Nakagawa, Teruhiko; Wakabayashi, Yoshiaki; Sekiya, Ichiro; Okawa, Atsushi; Muneta, Takeshi

    2010-10-12

    Olecranon fractures are a common injury in fractures. The tension band technique for olecranon fractures yields good clinical outcomes; however, it is associated with significant complications. In many patients, implants irritate overlying soft tissues and cause pain. This is mostly due to protrusion of the proximal ends of the K-wires or by the twisted knots of the metal wire tension band. Below we described 2 cases of olecranon fractures treated with a unique technique using FiberWire without any metallic implants. Technically, the fragment was reduced, and two K-wires were inserted from the dorsal cortex of the distal segment to the tip of the olecranon. K-wire was exchanged for a suture retriever, and 2 strands of FiberWire were retrieved twice. Each of the two FiberWires was manually tensioned and knotted on the posterior surface of the olecranon. Bony unions could be achieved, and patients had no complaint of pain and skin irritation. There was only a small loss of flexion and extension in comparison with that of the contralateral side, and the patient did not feel inconvenienced in his daily life. Using the method described, difficulty due to K-wire or other metallic implants was avoided.

  20. Injury to endoscopic personnel from tripping over exposed cords, wires, and tubing in the endoscopy suite: a preventable cause of potentially severe workplace injury.

    PubMed

    Cappell, Mitchell S

    2010-04-01

    BACKGROUND The endoscopy unit before remediation may be a high-risk area for slip and fall injuries due to a large number of exposed above-the-floor wires in the endoscopy rooms, dimmed lighting during endoscopic procedures, and staff inattention to obstacles due to preoccupation with the endoscopic patient. AIM To describe a novel, previously unappreciated workplace hazard to endoscopic personnel: Exposed wires in the endoscopy unit.METHODS This study is a retrospective review of 110,000 endoscopic procedures performed during the last 5 years at an academic, teaching hospital with a high-volume endoscopy unit. All significant orthopedic injuries to endoscopic personnel from slips, twists, and falls from tripping over exposed cords in the endoscopy unit were reviewed. The severity of injury was documented based on roentgenographic findings, number of days of missed work, number of days with a modified work schedule, and requirement for orthopedic surgery. The number of potentially exposed cords per endoscopy room was determined. RESULTS During the 5-year study period, three endoscopic personnel suffered significant orthopedic injuries from slips, twists, and falls from tripping over cords, wires, or tubing lying exposed over the floor in the endoscopy suite: The resulting injuries consisted of fourth and fifth metacarpal hand fractures due to a fall after tripping on oxygen tubing; a rib fracture due to tripping on electrical wires trailing from an endoscopy cart; and a grade II ankle sprain due to the foot becoming entangled in oxygen tubing. All injuries resulted in lost days of work [mean 9.3 +/- 11.0 (SD) days] and in additional days of restricted work (mean 41.7 +/- 31.8 days). One injury required orthopedic surgery. Hospital review revealed a mean of 35.3 +/- 7.5 cords, wires, or tubing per endoscopy procedure room, the majority of which were exposed above the floor before remediation (n = 10 rooms). Remediation of exposed wires included: bundling related wires together in a cable to reduce the number of independent wires, covering exposed wires on the floor with a nonslip heavy mat, and running wires from ceiling outlets to equipment high above ground (e.g. mounted endoscopy video monitors). CONCLUSIONS Tripping, slipping, and falling over exposed wires can cause significant injury to endoscopic personnel. This previously undescribed hazard should be preventable by simple remediation, and all endoscopic personnel, hospital architects, hospital administrators, and governmental regulators should be alerted to this potential hazard

  1. Measurement of plastic and elastic deformation due to third-order torque in self-ligated orthodontic brackets.

    PubMed

    Major, Thomas W; Carey, Jason P; Nobes, David S; Heo, Giseon; Major, Paul W

    2011-09-01

    Control of root torque is often achieved by introducing a twist in a rectangular archwire. The purpose of this study was to investigate third-order torque on different types of self-ligated brackets by analyzing the bracket's elastic and plastic deformations in conjunction with the expressed torque at varying angles of twist. An orthodontic bracket was mounted to a load cell that measured forces and moments in all directions. The wire was twisted in the bracket via a stepper motor, controlled by custom software. Overhead images were taken by a camera through a microscope and processed by using optical correlation to measure deformation. At the maximum torquing angle of 63° with 0.019 × 0.025-in stainless steel wire, the total elastic and plastic deformation values were 0.063, 0.033, and 0.137 mm for Damon Q (Ormco, Orange, Calif), In-Ovation R (GAC, Bohemia, NY), and Speed (Strite Industries, Cambridge, Ontario, Canada), respectively. The total plastic deformation values were 0.015, 0.006, and 0.086 mm, respectively, measured at 0° of unloading. In-Ovation R had the least deformation due to torquing of the 3 investigated bracket types. Damon Q and Speed on average had approximately 2.5 and 14 times greater maximum plastic deformation, respectively, than did In-Ovation R. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

  2. High-performance, stretchable, wire-shaped supercapacitors.

    PubMed

    Chen, Tao; Hao, Rui; Peng, Huisheng; Dai, Liming

    2015-01-07

    A general approach toward extremely stretchable and highly conductive electrodes was developed. The method involves wrapping a continuous carbon nanotube (CNT) thin film around pre-stretched elastic wires, from which high-performance, stretchable wire-shaped supercapacitors were fabricated. The supercapacitors were made by twisting two such CNT-wrapped elastic wires, pre-coated with poly(vinyl alcohol)/H3PO4 hydrogel, as the electrolyte and separator. The resultant wire-shaped supercapacitors exhibited an extremely high elasticity of up to 350% strain with a high device capacitance up to 30.7 F g(-1), which is two times that of the state-of-the-art stretchable supercapacitor under only 100% strain. The wire-shaped structure facilitated the integration of multiple supercapacitors into a single wire device to meet specific energy and power needs for various potential applications. These supercapacitors can be repeatedly stretched from 0 to 200% strain for hundreds of cycles with no change in performance, thus outperforming all the reported state-of-the-art stretchable electronics. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. The IceCube data acquisition system: Signal capture, digitization, and timestamping

    NASA Astrophysics Data System (ADS)

    Abbasi, R.; Ackermann, M.; Adams, J.; Ahlers, M.; Ahrens, J.; Andeen, K.; Auffenberg, J.; Bai, X.; Baker, M.; Barwick, S. W.; Bay, R.; Bazo Alba, J. L.; Beattie, K.; Becka, T.; Becker, J. K.; Becker, K.-H.; Berghaus, P.; Berley, D.; Bernardini, E.; Bertrand, D.; Besson, D. Z.; Bingham, B.; Blaufuss, E.; Boersma, D. J.; Bohm, C.; Bolmont, J.; Böser, S.; Botner, O.; Braun, J.; Breeder, D.; Burgess, T.; Carithers, W.; Castermans, T.; Chen, H.; Chirkin, D.; Christy, B.; Clem, J.; Cowen, D. F.; D'Agostino, M. V.; Danninger, M.; Davour, A.; Day, C. T.; Depaepe, O.; De Clercq, C.; Demirörs, L.; Descamps, F.; Desiati, P.; de Vries-Uiterweerd, G.; DeYoung, T.; Diaz-Velez, J. C.; Dreyer, J.; Dumm, J. P.; Duvoort, M. R.; Edwards, W. R.; Ehrlich, R.; Eisch, J.; Ellsworth, R. W.; Engdegård, O.; Euler, S.; Evenson, P. A.; Fadiran, O.; Fazely, A. R.; Feusels, T.; Filimonov, K.; Finley, C.; Foerster, M. M.; Fox, B. D.; Franckowiak, A.; Franke, R.; Gaisser, T. K.; Gallagher, J.; Ganugapati, R.; Gerhardt, L.; Gladstone, L.; Glowacki, D.; Goldschmidt, A.; Goodman, J. A.; Gozzini, R.; Grant, D.; Griesel, T.; Groß, A.; Grullon, S.; Gunasingha, R. M.; Gurtner, M.; Ha, C.; Hallgren, A.; Halzen, F.; Han, K.; Hanson, K.; Hardtke, R.; Hasegawa, Y.; Haugen, J.; Hays, D.; Heise, J.; Helbing, K.; Hellwig, M.; Herquet, P.; Hickford, S.; Hill, G. C.; Hodges, J.; Hoffman, K. D.; Hoshina, K.; Hubert, D.; Huelsnitz, W.; Hughey, B.; Hülß, J.-P.; Hulth, P. O.; Hultqvist, K.; Hussain, S.; Imlay, R. L.; Inaba, M.; Ishihara, A.; Jacobsen, J.; Japaridze, G. S.; Johansson, H.; Jones, A.; Joseph, J. M.; Kampert, K.-H.; Kappes, A.; Karg, T.; Karle, A.; Kawai, H.; Kelley, J. L.; Kiryluk, J.; Kislat, F.; Klein, S. R.; Kleinfelder, S.; Klepser, S.; Kohnen, G.; Kolanoski, H.; Köpke, L.; Kowalski, M.; Kowarik, T.; Krasberg, M.; Kuehn, K.; Kujawski, E.; Kuwabara, T.; Labare, M.; Laihem, K.; Landsman, H.; Lauer, R.; Laundrie, A.; Leich, H.; Leier, D.; Lewis, C.; Lucke, A.; Ludvig, J.; Lundberg, J.; Lünemann, J.; Madsen, J.; Maruyama, R.; Mase, K.; Matis, H. S.; McParland, C. P.; Meagher, K.; Meli, A.; Merck, M.; Messarius, T.; Mészáros, P.; Minor, R. H.; Miyamoto, H.; Mohr, A.; Mokhtarani, A.; Montaruli, T.; Morse, R.; Movit, S. M.; Münich, K.; Muratas, A.; Nahnhauer, R.; Nam, J. W.; Nießen, P.; Nygren, D. R.; Odrowski, S.; Olivas, A.; Olivo, M.; Ono, M.; Panknin, S.; Patton, S.; Pérez de los Heros, C.; Petrovic, J.; Piegsa, A.; Pieloth, D.; Pohl, A. C.; Porrata, R.; Potthoff, N.; Pretz, J.; Price, P. B.; Przybylski, G. T.; Rawlins, K.; Razzaque, S.; Redl, P.; Resconi, E.; Rhode, W.; Ribordy, M.; Rizzo, A.; Robbins, W. J.; Rodrigues, J. P.; Roth, P.; Rothmaier, F.; Rott, C.; Roucelle, C.; Rutledge, D.; Ryckbosch, D.; Sander, H.-G.; Sarkar, S.; Satalecka, K.; Sandstrom, P.; Schlenstedt, S.; Schmidt, T.; Schneider, D.; Schulz, O.; Seckel, D.; Semburg, B.; Seo, S. H.; Sestayo, Y.; Seunarine, S.; Silvestri, A.; Smith, A. J.; Song, C.; Sopher, J. E.; Spiczak, G. M.; Spiering, C.; Stanev, T.; Stezelberger, T.; Stokstad, R. G.; Stoufer, M. C.; Stoyanov, S.; Strahler, E. A.; Straszheim, T.; Sulanke, K.-H.; Sullivan, G. W.; Swillens, Q.; Taboada, I.; Tarasova, O.; Tepe, A.; Ter-Antonyan, S.; Tilav, S.; Tluczykont, M.; Toale, P. A.; Tosi, D.; Turčan, D.; van Eijndhoven, N.; Vandenbroucke, J.; Van Overloop, A.; Viscomi, V.; Vogt, C.; Voigt, B.; Vu, C. Q.; Wahl, D.; Walck, C.; Waldenmaier, T.; Waldmann, H.; Walter, M.; Wendt, C.; Westerhof, S.; Whitehorn, N.; Wharton, D.; Wiebusch, C. H.; Wiedemann, C.; Wikström, G.; Williams, D. R.; Wischnewski, R.; Wissing, H.; Woschnagg, K.; Xu, X. W.; Yodh, G.; Yoshida, S.; IceCube Collaboration

    2009-04-01

    IceCube is a km-scale neutrino observatory under construction at the South Pole with sensors both in the deep ice (InIce) and on the surface (IceTop). The sensors, called Digital Optical Modules (DOMs), detect, digitize and timestamp the signals from optical Cherenkov-radiation photons. The DOM Main Board (MB) data acquisition subsystem is connected to the central DAQ in the IceCube Laboratory (ICL) by a single twisted copper wire-pair and transmits packetized data on demand. Time calibration is maintained throughout the array by regular transmission to the DOMs of precisely timed analog signals, synchronized to a central GPS-disciplined clock. The design goals and consequent features, functional capabilities, and initial performance of the DOM MB, and the operation of a combined array of DOMs as a system, are described here. Experience with the first InIce strings and the IceTop stations indicates that the system design and performance goals have been achieved.

  4. Experimental study of a SINIS detector response time at 350 GHz signal frequency

    NASA Astrophysics Data System (ADS)

    Lemzyakov, S.; Tarasov, M.; Mahashabde, S.; Yusupov, R.; Kuzmin, L.; Edelman, V.

    2018-03-01

    Response time constant of a SINIS bolometer integrated in an annular ring antenna was measured at a bath temperature of 100 mK. Samples comprising superconducting aluminium electrodes and normal-metal Al/Fe strip connected to electrodes via tunnel junctions were fabricated on oxidized Si substrate using shadow evaporation. The bolometer was illuminated by a fast black-body radiation source through a band-pass filter centered at 350 GHz with a passband of 7 GHz. Radiation source is a thin NiCr film on sapphire substrate. For rectangular 10÷100 μs current pulse the radiation front edge was rather sharp due to low thermal capacitance of NiCr film and low thermal conductivity of substrate at temperatures in the range 1-4 K. The rise time of the response was ~1-10 μs. This time presumably is limited by technical reasons: high dynamic resistance of series array of bolometers and capacitance of a long twisted pair wiring from SINIS bolometer to a room-temperature amplifier.

  5. Emergency escape system uses self-braking mechanism on fixed cable

    NASA Technical Reports Server (NTRS)

    Billings, C. R.; Mc Daris, R. A.; Mc Gough, J. T.; Neal, P. F.

    1966-01-01

    Slide-wire system with a twist level slide device incorporates automatic descent and braking for the safe and rapid evacuation of personnel from tall structures. This device is used on any tall structure that might require emergency evacuation. It is also used to transfer materials and equipment.

  6. Twist functions in vertebral column formation in medaka, Oryzias latipes.

    PubMed

    Yasutake, Junichi; Inohaya, Keiji; Kudo, Akira

    2004-07-01

    Medaka twist, a basic helix-loop-helix (bHLH) transcription factor, is expressed in the sclerotome during embryogenesis. We previously established a line of twist-EGFP transgenic medaka, whose EGFP expression is regulated by the twist promoter; therefore, we could observe the behavior of sclerotomal cells in vivo. In the transgenic medaka embryos, EGFP-positive sclerotomal cells migrated dorsally around the notochord and the neural tube, where at a later stage the vertebral column would be formed. This finding strongly suggests that twist-expressing sclerotomal cells participate in vertebral column formation in medaka. To clarify the function of twist gene in the sclerotome, we performed knockdown analysis of twist by using two kinds of morpholino antisense oligonucleotides targeted against twist (MO1 and MO2). Both the MO1 and MO2 morphants exhibited absence of neural arches, which are bilaterally paired, dorsomedially oriented bones on the dorsal aspect of the centrum. In addition, MO2, which blocks translation of only endogenous twist mRNA in the twist-EGFP transgenic medaka, did not affect the migration pattern of EGFP-positive cells, revealing that the migration of sclerotome-derived cells were normal in the absence of twist gene function. These results demonstrate that medaka twist functions in vertebral column formation by regulating the sclerotomal cell differentiation.

  7. Twisted ribbon structure of paired helical filaments revealed by atomic force microscopy.

    PubMed Central

    Pollanen, M. S.; Markiewicz, P.; Bergeron, C.; Goh, M. C.

    1994-01-01

    Progressive deposition of phosphorylated tau into the paired helical filaments (PHF) that compose neurofibrillary tangles, dystrophic neurites, and neuropil threads is an obligate feature of Alzheimer's disease. The standard model of PHF structure, derived from electron microscopic studies, suggests that two 8- to 10-nm filaments each composed of three to four protofilaments are wound into a helix with a maximal diameter of -20 nm and a half period of 65 to 80 nm. However, recent vertical platinum-carbon replicas of PHF more closely resemble a thin helical ribbon without constitutive protofilaments. Here we report that native PHF imaged with an atomic force microscope appear as twisted ribbons rather than the generally accepted structure derived from electron microscopic studies. These data imply that the assembly of PHF is not due to the twisting of pair-wise filaments but rather the helical winding of self-associated tau molecules arranged into a flattened structure. Future structural models of PHF should be based on quantitative data obtained from imaging techniques, such as scanning probe microscopy, which do not require harsh specimen preparation procedures. Images Figure 1 PMID:8178938

  8. Twisted ribbon structure of paired helical filaments revealed by atomic force microscopy.

    PubMed

    Pollanen, M S; Markiewicz, P; Bergeron, C; Goh, M C

    1994-05-01

    Progressive deposition of phosphorylated tau into the paired helical filaments (PHF) that compose neurofibrillary tangles, dystrophic neurites, and neuropil threads is an obligate feature of Alzheimer's disease. The standard model of PHF structure, derived from electron microscopic studies, suggests that two 8- to 10-nm filaments each composed of three to four protofilaments are wound into a helix with a maximal diameter of -20 nm and a half period of 65 to 80 nm. However, recent vertical platinum-carbon replicas of PHF more closely resemble a thin helical ribbon without constitutive protofilaments. Here we report that native PHF imaged with an atomic force microscope appear as twisted ribbons rather than the generally accepted structure derived from electron microscopic studies. These data imply that the assembly of PHF is not due to the twisting of pair-wise filaments but rather the helical winding of self-associated tau molecules arranged into a flattened structure. Future structural models of PHF should be based on quantitative data obtained from imaging techniques, such as scanning probe microscopy, which do not require harsh specimen preparation procedures.

  9. Wide tracking range, auto ranging, low jitter phase lock loop for swept and fixed frequency systems

    DOEpatents

    Kerner, Thomas M.

    2001-01-01

    The present invention provides a wide tracking range phase locked loop (PLL) circuit that achieves minimal jitter in a recovered clock signal, regardless of the source of the jitter (i.e. whether it is in the source or the transmission media). The present invention PLL has automatic harmonic lockout detection circuitry via a novel lock and seek control logic in electrical communication with a programmable frequency discriminator and a code balance detector. (The frequency discriminator enables preset of a frequency window of upper and lower frequency limits to derive a programmable range within which signal acquisition is effected. The discriminator works in combination with the code balance detector circuit to minimize the sensitivity of the PLL circuit to random data in the data stream). In addition, the combination of a differential loop integrator with the lock and seek control logic obviates a code preamble and guarantees signal acquisition without harmonic lockup. An adaptive cable equalizer is desirably used in combination with the present invention PLL to recover encoded transmissions containing a clock and/or data. The equalizer automatically adapts to equalize short haul cable lengths of coaxial and twisted pair cables or wires and provides superior jitter performance itself. The combination of the equalizer with the present invention PLL is desirable in that such combination permits the use of short haul wires without significant jitter.

  10. Coordination of hand shape.

    PubMed

    Pesyna, Colin; Pundi, Krishna; Flanders, Martha

    2011-03-09

    The neural control of hand movement involves coordination of the sensory, motor, and memory systems. Recent studies have documented the motor coordinates for hand shape, but less is known about the corresponding patterns of somatosensory activity. To initiate this line of investigation, the present study characterized the sense of hand shape by evaluating the influence of differences in the amount of grasping or twisting force, and differences in forearm orientation. Human subjects were asked to use the left hand to report the perceived shape of the right hand. In the first experiment, six commonly grasped items were arranged on the table in front of the subject: bottle, doorknob, egg, notebook, carton, and pan. With eyes closed, subjects used the right hand to lightly touch, forcefully support, or imagine holding each object, while 15 joint angles were measured in each hand with a pair of wired gloves. The forces introduced by supporting or twisting did not influence the perceptual report of hand shape, but for most objects, the report was distorted in a consistent manner by differences in forearm orientation. Subjects appeared to adjust the intrinsic joint angles of the left hand, as well as the left wrist posture, so as to maintain the imagined object in its proper spatial orientation. In a second experiment, this result was largely replicated with unfamiliar objects. Thus, somatosensory and motor information appear to be coordinated in an object-based, spatial-coordinate system, sensitive to orientation relative to gravitational forces, but invariant to grasp forcefulness.

  11. Controlling coupled bending-twisting vibrations of anisotropic composite wing

    NASA Astrophysics Data System (ADS)

    Ryabov, Victor; Yartsev, Boris

    2018-05-01

    The paper discusses the possibility to control coupled bending-twisting vibrations of anisotropic composite wing by means of the monoclinic structures in the reinforcement of the plating. Decomposing the potential straining energy and kinetic energy of natural vibration modes into interacting and non-interacting parts, it became possible to introduce the two coefficients that integrally consider the effect of geometry and reinforcement structure upon the dynamic response parameters of the wing. The first of these coefficients describes the elastic coupling of the natural vibration modes, the second coefficient describes the inertial one. The paper describes the numerical studies showing how the orientation of considerably anisotropic CRP layers in the plating affects natural frequencies, loss factors, coefficients of elastic and inertial coupling for several lower tones of natural bending-twisting vibrations of the wing. Besides, for each vibration mode, partial values of the above mentioned dynamic response parameters were determined by means of the relationships for orthotropic structures where instead of "free" shearing modulus in the reinforcement plant, "pure" shearing modulus is used. Joint analysis of the obtained results has shown that each pair of bending-twisting vibration modes has its orientation angle ranges of the reinforcing layers where the inertial coupling caused by asymmetry of the cross-section profile with respect to the main axes of inertia decreases, down to the complete extinction, due to the generation of the elastic coupling in the plating material. These ranges are characterized by the two main features: 1) the difference in the natural frequencies of the investigated pair of bending-twisting vibration modes is the minimum and 2) natural frequencies of bending-twisting vibrations belong to a stretch restricted by corresponding partial natural frequencies of the investigated pair of vibration modes. This result is of practical importance because it enables approximate analysis of real composite wings with complex geometry in the existing commercial software packages.

  12. Left-handed transmission in a simple cut-wire pair structure

    NASA Astrophysics Data System (ADS)

    Tung, Nguyen Thanh; Thuy, Vu Tran Thanh; Park, Jin Woo; Rhee, Joo Yull; Lee, YoungPak

    2010-01-01

    It is well known that, together with the plasma behavior of continuous wires, the use of cut-wire pair as a metamagnetic component is to drive the negative permeability in the left-handed combined structure. In this study, we have investigated a strange left-handed transmission in a metamaterial consisting of only conventional cut-wire pair structure without additional adjustment. It is shown that the observed left-handed behavior, which occurs at a frequency three times higher than that for the combined structure, originates from the fundamental negative permittivity provided by the symmetric resonant mode and a negative permeability by the third-order asymmetric resonance. Our results would simplify extremely the fabricating procedure, especially, for terahertz regime as well as reveal many possibilities to design optical devices based on the electromagnetic responses of cut-wire structure.

  13. Photoinduced intramolecular charge transfer (ICT) reaction in trans-methyl p-(dimethylamino) cinnamate: A combined fluorescence measurement and quantum chemical calculations

    NASA Astrophysics Data System (ADS)

    Chakraborty, Amrita; Kar, Samiran; Guchhait, Nikhil

    2006-01-01

    The photophysical behaviour of trans-methyl p-(dimethylamino) cinnamate ( t-MDMAC) donor-acceptor system has been investigated by steady-state absorption and emission spectroscopy and quantum chemical calculations. The molecule t-MDMAC shows an emission from the locally excited state in non-polar solvents. In addition to weak local emission, a strong solvent dependent red shifted fluorescence in polar aprotic solvents is attributed to highly polar intramolecular charge transfer state. However, the formation of hydrogen-bonded clusters with polar protic solvents has been suggested from a linear correlation between the observed red shifted fluorescence band maxima with hydrogen bonding parameters ( α). Calculations by ab initio and density functional theory show that the lone pair electron at nitrogen center is out of plane of the benzene ring in the global minimum ground state structure. In the gas phase, a potential energy surface along the twist coordinate at the donor (-NMe 2) and acceptor (-CH = CHCOOMe) sites shows stabilization of S 1 state and destabilization S 2 and S 0 states. A similar potential energy calculation along the twist coordinate in acetonitrile solvent using non-equilibrium polarized continuum model also shows more stabilization of S 1 state relative to other states and supports solvent dependent red shifted emission properties. In all types of calculations it is found that the nitrogen lone pair is delocalized over the benzene ring in the global minimum ground state and is localized on the nitrogen centre at the 90° twisted configuration. The S 1 energy state stabilization along the twist coordinate at the donor site and localized nitrogen lone pair at the perpendicular configuration support well the observed dual fluorescence in terms of proposed twisted intramolecular charge transfer (TICT) model.

  14. Production of Oxidation-Resistant Cu-Based Nanoparticles by Wire Explosion

    PubMed Central

    Kawamura, Go; Alvarez, Samuel; Stewart, Ian E.; Catenacci, Matthew; Chen, Zuofeng; Ha, Yoon-Cheol

    2015-01-01

    The low performance or high cost of commercially available conductive inks limits the advancement of printed electronics. This article studies the explosion of metal wires in aqueous solutions as a simple, low-cost, and environmentally friendly method to prepare metallic nanoparticles consisting of Cu and Cu alloys for use in affordable, highly conductive inks. Addition of 0.2 M ascorbic acid to an aqueous explosion medium prevented the formation of Cu2O shells around Cu nanoparticles, and allowed for the printing of conductive lines directly from these nanoparticles with no post-treatment. Cu alloy nanoparticles were generated from metal wires that were alloyed as purchased, or from two wires of different metals that were twisted together. Cu nanoparticles alloyed with 1% Sn, 5% Ag, 5% Ni and 30% Ni had electrical conductivities similar to Cu but unlike Cu, remained conductive after 24 hrs at 85 °C and 85% RH. PMID:26669447

  15. Monopole-antimonopole interaction potential

    NASA Astrophysics Data System (ADS)

    Saurabh, Ayush; Vachaspati, Tanmay

    2017-11-01

    We numerically study the interactions of twisted monopole-antimonopole pairs in the 't Hooft-Polyakov model for a range of values of the scalar to vector mass ratio. We also recover the sphaleron solution at maximum twist discovered by Taubes [Commun. Math. Phys. 86, 257 (1982), 10.1007/BF01206014] and map out its energy and size as functions of parameters.

  16. 7 CFR 1755.200 - RUS standard for splicing copper and fiber optic cables.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...) Color coded plastic tie wraps shall be placed loosely around each binder group of cables before splicing... conform to the same color designations as the binder ribbons. Twisted wire pigtails shall not be used to identify binder groups due to potential transmission degradation. (ii) The standard insulation color code...

  17. Structures with negative index of refraction

    DOEpatents

    Soukoulis, Costas M [Ames, IA; Zhou, Jiangfeng [Ames, IA; Koschny, Thomas [Ames, IA; Zhang, Lei [Ames, IA; Tuttle, Gary [Ames, IA

    2011-11-08

    The invention provides simplified negative index materials (NIMs) using wire-pair structures, 4-gap single ring split-ring resonator (SRR), fishnet structures and overleaf capacitor SRR. In the wire-pair arrangement, a pair of short parallel wires and continuous wires are used. In the 4-gap single-ring SRR, the SRRs are centered on the faces of a cubic unit cell combined with a continuous wire type resonator. Combining both elements creates a frequency band where the metamaterial is transparent with simultaneously negative .di-elect cons. and .mu.. In the fishnet structure, a metallic mesh on both sides of the dielectric spacer is used. The overleaf capacitor SRR changes the gap capacities to small plate capacitors by making the sections of the SRR ring overlap at the gaps separated by a thin dielectric film. This technique is applicable to conventional SRR gaps but it best deploys for the 4-gap single-ring structures.

  18. Shielded-Twisted-Pair Cable Model for Chafe Fault Detection via Time-Domain Reflectometry

    NASA Technical Reports Server (NTRS)

    Schuet, Stefan R.; Timucin, Dogan A.; Wheeler, Kevin R.

    2012-01-01

    This report details the development, verification, and validation of an innovative physics-based model of electrical signal propagation through shielded-twisted-pair cable, which is commonly found on aircraft and offers an ideal proving ground for detection of small holes in a shield well before catastrophic damage occurs. The accuracy of this model is verified through numerical electromagnetic simulations using a commercially available software tool. The model is shown to be representative of more realistic (analytically intractable) cable configurations as well. A probabilistic framework is developed for validating the model accuracy with reflectometry data obtained from real aircraft-grade cables chafed in the laboratory.

  19. Investigation of the interwire energy transfer of elastic guided waves inside prestressed cables.

    PubMed

    Treyssède, Fabien

    2016-07-01

    Elastic guided waves are of interest for the non-destructive evaluation of cables. Cables are most often multi-wire structures, and understanding wave propagation requires numerical models accounting for the helical geometry of individual wires, the interwire contact mechanisms and the effects of prestress. In this paper, a modal approach based on a so-called semi-analytical finite element method and taking advantage of a biorthogonality relation is proposed in order to calculate the forced response under excitation of a cable, multi-wired, twisted, and prestressed. The main goal of this paper is to investigate how the energy transfers from a given wire, directly excited, to the other wires in order to identify some localization of energy inside the active wire as the waves propagate along the waveguide. The power flow of the excited field is theoretically derived and an energy transfer parameter is proposed to evaluate the level of energy localization inside a given wire. Numerical results obtained for different polarizations of excitation, central and peripheral, highlight how the energy may localize, spread, or strongly change in the cross-section as waves travel along the axis. In particular, a compressional mode localized inside the central wire is found, with little dispersion and significant excitability.

  20. [Treatment of ulnar collateral ligament avulsion fracture of thumb metacarpophalangeal joint using a combination of Kirschner wire and silk tension band].

    PubMed

    Gao, Shunhong; Feng, Shiming; Jiao, Cheng

    2012-12-01

    To investigate the effectiveness of Kirschner wire combined with silk tension band in the treatment of ulnar collateral ligament avulsion fracture of the thumb metacarpophalangeal joint. Between September 2008 and October 2011, 14 patients with ulnar collateral ligament avulsion fracture of the thumb metacarpophalangeal joint were treated using a combination of Kirschner wire and silk tension band. There were 8 males and 6 females, aged 23-55 years (mean, 40.8 years). The causes of injury were machinery twist injury in 5 cases, manual twist injury in 4 cases, falling in 4 cases, sports injury in 1 case. The time from injury to operation was 2 hours-14 days. All the patients presented pain over the ulnar aspect of the metacarpophalangeal joint of the thumb, limitation of motion, and joint instability with pinch and grip. The lateral stress testing of the metacarpophalangeal joint was positive. Function training was given at 2 weeks after operation. All incisions healed by first intention. The lateral stress testing of the metacarpophalangeal joint was negative. All the patients were followed up 6-18 months (mean, 13.1 months). The X-ray films showed good fracture reduction and healing with an average time of 7 weeks (range, 4-10 weeks). At last follow-up, the thumbs had stable flexion and extension of the metacarpophalangeal joint, normal opposition function and grip and pinch strengths. According to Saetta et al. criteria for functional assessment, the results were excellent in 11 cases and good in 3 cases; the excellent and good rate was 100%. It is an easy and simple method to treat ulnar collateral ligament avulsion fracture of the thumb metacarpophalangeal joint using Kirschner wire combined with silk tension band, which can meet the good finger function.

  1. New dualities and misleading anomaly matchings from outer-automorphism twists

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pal, Sridip; Song, Jaewon

    We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

  2. New dualities and misleading anomaly matchings from outer-automorphism twists

    DOE PAGES

    Pal, Sridip; Song, Jaewon

    2017-03-29

    We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

  3. Prevention of longitudinal crack propagation around a femoral prosthesis: a study of cerclage wire fixation.

    PubMed

    Difazio, F A; Incavo, S J; Howe, J D

    1993-09-01

    This study examined the effect of single versus triple-wrap cerclage fixation techniques in preventing propagation of a longitudinal fracture around a cementless femoral prosthesis. A proximal filling femoral component was implanted in 14 matched pairs of fresh-frozen bovine femora, following placement of a 45-mm longitudinal crack in the anteromedial cortical wall of the proximal femur. In one group of seven pairs, a single cerclage wire was applied to one specimen of each pair. A triple-wrap of a single cerclage wire was similarly placed in one specimen of each of the other seven pairs. All specimens were axially loaded on a materials testing system machine and the force required to propagate the fracture of the proximal femur was recorded. A triple-wrap cerclage technique required a significant increase in the force to propagate a proximal femur fracture around a non-cemented prosthesis when compared to a single cerclage wire. Copyright © 1993. Published by Elsevier Ltd.

  4. Cyclic Fatigue Resistance of Novel Rotary Files Manufactured from Different Thermal Treated Nickel-Titanium Wires in Artificial Canals.

    PubMed

    Karataşlıoglu, E; Aydın, U; Yıldırım, C

    2018-02-01

    The aim of this in vitro study was to compare the static cyclic fatigue resistance of thermal treated rotary files with a conventional nickel-titanium (NiTi) rotary file. Four groups of 60 rotary files with similar file dimensions, geometries, and motion were selected. Groups were set as HyFlex Group [controlled memory wire (CM-Wire)], ProfileVortex Group (M-Wire), Twisted File Group (R-Phase Wire), and OneShape Group (conventional NiTi wire)] and tested using a custom-made static cyclic fatigue testing apparatus. The fracture time and fragment length of the each file was also recorded. Statistical analysis was performed using one-way analysis of variance and Tukey's test at the 95% confidence level (P = 0.05). The HyFlex group had a significantly higher mean cyclic fatigue resistance than the other three groups (P < 0.001). The OneShape groups had the least fatigue resistance. CM-Wire alloy represented the best performance in cyclic fatigue resistance, and NiTi alloy in R-Phase had the second highest fatigue resistance. CM and R-Phase manufacturing technology processed to the conventional NiTi alloy enhance the cyclic fatigue resistance of files that have similar design and size. M-wire alloy did not show any superiority in cyclic fatigue resistance when compared with conventional NiTi wire.

  5. Micromagnetic simulations of anisotropies in coupled and uncoupled ferromagnetic nanowire systems.

    PubMed

    Blachowicz, T; Ehrmann, A

    2013-01-01

    The influence of a variation of spatial relative orientations onto the coupling dynamics and subsequent magnetic anisotropies was modeled in ferromagnetic nanowires. The wires were analyzed in the most elementary configurations, thus, arranged in pairs perpendicular to each other, leading to one-dimensional (linear) and zero-dimensional (point-like) coupling. Different distances within each elementary pair of wires and between the pairs give rise to varying interactions between parallel and perpendicular wires, respectively. Simulated coercivities show an exchange of easy and hard axes for systems with different couplings. Additionally, two of the systems exhibit a unique switching behavior which can be utilized for developing new functionalities.

  6. Multifilament Superconducting Wire Based on NbTi Alloy in a Combined Copper/Copper-Nickel Matrix

    NASA Astrophysics Data System (ADS)

    Vedernikov, G. P.; Shikov, A. K.; Potanina, L. V.; Gubkin, I. N.; Scherbakova, O. V.; Salunin, N. I.; Korpusov, V. U.; Novikov, S. I.; Novikov, M. S.

    2004-06-01

    Model fine filament superconducting 0.65 mm wire based on NbTi alloy, intended for operating in fields having sweep rate from 1 up to 4 T/s, has been developed and manufactured by Bochvar Institute (VNIINM). The wire was fabricated by a single stacking method. Each filament was surrounded by a matrix of commercial MN-5 alloy (Cu-5wt.%Ni). The effects of heat treatment regimes, and twist pitches within the range of 3.5 - 8 mm on Jc of the strand were investigated at fields of 2-8 T. The critical current density is more than 2700 A/mm2 at 5 T, 4.2 K. The magnetization of wire has been measured by a vibrating magnetometer at field amplitude up to ± 3 T. Hysteresis losses and effective diameter were calculated. Total and coupling losses have been determined by Fitz method on strand magnetization at fields, varying in trapezoidal mode. It was shown that the wire of this type is of potential application for the use in the magnets of the GSI-type accelerator to be constructed in Germany.

  7. Persistence and Lifelong Fidelity of Phase Singularities in Optical Random Waves.

    PubMed

    De Angelis, L; Alpeggiani, F; Di Falco, A; Kuipers, L

    2017-11-17

    Phase singularities are locations where light is twisted like a corkscrew, with positive or negative topological charge depending on the twisting direction. Among the multitude of singularities arising in random wave fields, some can be found at the same location, but only when they exhibit opposite topological charge, which results in their mutual annihilation. New pairs can be created as well. With near-field experiments supported by theory and numerical simulations, we study the persistence and pairing statistics of phase singularities in random optical fields as a function of the excitation wavelength. We demonstrate how such entities can encrypt fundamental properties of the random fields in which they arise.

  8. Persistence and Lifelong Fidelity of Phase Singularities in Optical Random Waves

    NASA Astrophysics Data System (ADS)

    De Angelis, L.; Alpeggiani, F.; Di Falco, A.; Kuipers, L.

    2017-11-01

    Phase singularities are locations where light is twisted like a corkscrew, with positive or negative topological charge depending on the twisting direction. Among the multitude of singularities arising in random wave fields, some can be found at the same location, but only when they exhibit opposite topological charge, which results in their mutual annihilation. New pairs can be created as well. With near-field experiments supported by theory and numerical simulations, we study the persistence and pairing statistics of phase singularities in random optical fields as a function of the excitation wavelength. We demonstrate how such entities can encrypt fundamental properties of the random fields in which they arise.

  9. Majorana edge States in atomic wires coupled by pair hopping.

    PubMed

    Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

    2013-10-25

    We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

    An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

  11. Uprighting Bilateral Impacted Mandibular Permanent Second Molars with the Brass Wire Technique: A Case Report.

    PubMed

    Perdigão, João Paulo Veloso; Lustosa, Romulo Maciel; Tolentino, Elen de Souza; Iwaki Filho, Liogi; Iwaki, Lilian Cristina Vessoni

    2016-01-01

    Revalence of impaction of mandibular permanent second molars is between 0.06 and 2.3 percent. In order to reduce treatment time and complications associated with tooth impaction, intervention should take place once the problem is detected. The usual treatment options consists of surgical exposure, luxation of the impacted tooth, extraction of adjacent third molar, orthodontic treatment, and uprighting with brass wires or mini-screws. The present paper reports a case of bilateral impaction of mandibular permanent second molars ' (MM2s) treated with extraction of the mandibular third molars (MM3s) and surgical-orthodontic uprighting with the brass wire technique. The MM3s were removed, and the impacted MM2s were surgically exposed. Brass wire was placed apicaly to the mesial of the MM2 from the lingual tissue out toward the buccal. The lingual end of the wire was bent over the area of contact and twisted with the buccal end Monthly wire tightening gradually moved the MM2s distally and towards the occlusal plane. Uprighting was achieved in 4-5 months, with discrete pain caused by activation of the wire. This technique proved to be a simple, low-cost, and quick treatment option for uprighting impacted mandibular permanent second molars.

  12. Transverse-Weld Tensile Properties of a New Al-4Cu-2Si Alloy as Filler Metal

    NASA Astrophysics Data System (ADS)

    Sampath, K.

    2009-12-01

    AA2195, an Al-Cu-Li alloy in the T8P4 age-hardened condition, is a candidate aluminum armor for future combat vehicles, as this material offers higher static strength and ballistic protection than current aluminum armor alloys. However, certification of AA2195 alloy for armor applications requires initial qualification based on the ballistic performance of welded panels in the as-welded condition. Currently, combat vehicle manufacturers primarily use gas metal arc welding (GMAW) process to meet their fabrication needs. Unfortunately, a matching GMAW consumable electrode is currently not commercially available to allow effective joining of AA2195 alloy. This initial effort focused on an innovative, low-cost, low-risk approach to identify an alloy composition suitable for effective joining of AA2195 alloy, and evaluated transverse-weld tensile properties of groove butt joints produced using the identified alloy. Selected commercial off-the-shelf (COTS) aluminum alloy filler wires were twisted to form candidate twisted filler rods. Representative test weldments were produced using AA2195 alloy, candidate twisted filler rods and gas tungsten arc welding (GTAW) process. Selected GTA weldments produced using Al-4wt.%Cu-2wt.%Si alloy as filler metal consistently provided transverse-weld tensile properties in excess of 275 MPa (40 ksi) UTS and 8% El (over 25 mm gage length), thereby showing potential for acceptable ballistic performance of as-welded panels. Further developmental work is required to evaluate in detail GMAW consumable wire electrodes based on the Al-Cu-Si system containing 4.2-5.0 wt.% Cu and 1.6-2.0 wt.% Si.

  13. Torsional mechanics of DNA are regulated by small-molecule intercalation.

    PubMed

    Celedon, Alfredo; Wirtz, Denis; Sun, Sean

    2010-12-23

    Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

  14. 7 CFR 1755.506 - Aerial wire services

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 11 2011-01-01 2011-01-01 false Aerial wire services 1755.506 Section 1755.506... § 1755.506 Aerial wire services (a) Aerial services of one through six pairs shall consist of Service...), Specifications and Drawings for Service Installations at Customer Access Locations. The wire used for aerial...

  15. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  16. Superconducting wire manufactured

    NASA Astrophysics Data System (ADS)

    Fu, Yuexian; Sun, Yue; Xu, Shiming; Peng, Ying

    1985-10-01

    The MF Nb/Cu Extrusion Tube Method was used to manufacture 3 kg of stable practical MF Nb2Sn composite superconducting wire containing pure Cu(RRR approx. 200)/Ta. The draw state composite wire diameter was 0.56 mm, it contained 11,448 x 2.6 micron Nb core, and the twist distance was 1.5 cm. The composite wire cross-section was pure Cu/Ta/11,448 Nb core/Cu/ 91Sn-Cu; containing 22.8 v. % pure Cu, 13.3 v. % Ta; within the Ta layer to prevent Sn diffusion. The wire was sheathed in nonalkaline glass fiber as an insulating layer. A section of wire weighing 160 g was cut off and coiled it into a small solenoid. After reaction diffusion processing at 675 C/30 and curing by vacuum dipping in paraffin, it was measured in a Nb-Ti backfield of 7.2 T intensity, a current of 129 A was passed through the Nb3Sn solenoid and produced a strength of 2.5 T, the overall magnetic field intensity of the composite magnet reached 9.7 T. At this time, the wire full current density J sub c.w. = 5.2 x 10 to the 4th power A/sq cm; the effective current density J sub c (Nb + Sn - Cu) = 8.2 x 10 to the 4th power A/sq cm.

  17. Structural Characterization of N-Alkylated Twisted Amides: Consequences for Amide Bond Resonance and N-C Cleavage.

    PubMed

    Hu, Feng; Lalancette, Roger; Szostak, Michal

    2016-04-11

    Herein, we describe the first structural characterization of N-alkylated twisted amides prepared directly by N-alkylation of the corresponding non-planar lactams. This study provides the first experimental evidence that N-alkylation results in a dramatic increase of non-planarity around the amide N-C(O) bond. Moreover, we report a rare example of a molecular wire supported by the same amide C=O-Ag bonds. Reactivity studies demonstrate rapid nucleophilic addition to the N-C(O) moiety of N-alkylated amides, indicating the lack of n(N) to π*(C=O) conjugation. Most crucially, we demonstrate that N-alkylation activates the otherwise unreactive amide bond towards σ N-C cleavage by switchable coordination. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Unraveling cellulose microfibrils: a twisted tale.

    PubMed

    Hadden, Jodi A; French, Alfred D; Woods, Robert J

    2013-10-01

    Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. Copyright © 2013 Wiley Periodicals, Inc.

  19. Unraveling Cellulose Microfibrils: A Twisted Tale

    PubMed Central

    Hadden, Jodi A.; French, Alfred D.; Woods, Robert J.

    2014-01-01

    Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. PMID:23681971

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gabuda, S. P.; Kozlova, S. G.; Novosibirsk State University, 2, Pirogova Str., Novosibirsk 630090

    We report an abnormal difference of low-temperature mobility of left-twisted and right-twisted conformations of roto symmetric molecules C{sub 6}H{sub 12}N{sub 2} (dabco) located in the same positions in crystal Zn{sub 2}(C{sub 8}H{sub 4}O{sub 4}){sub 2}⋅C{sub 6}H{sub 12}N{sub 2}. The difference between {sup 1}H NMR (Nuclear Magnetic Resonance) spin-relaxation data for left-twisted and right-twisted molecules reaches ∼3 × 10{sup 3} times at 8 K and tends to grow at lower temperatures. We argue that taking into account four-component relativistic Dirac wave functions in the vicinity of the nodal plane of dabco molecules and vacuum fluctuations due to virtual particle-antiparticle pairs canmore » explain the changes which C{sub 6}H{sub 12}N{sub 2} conformations undergo at low temperatures.« less

  1. Fiber and fabric solar cells by directly weaving carbon nanotube yarns with CdSe nanowire-based electrodes

    NASA Astrophysics Data System (ADS)

    Zhang, Luhui; Shi, Enzheng; Ji, Chunyan; Li, Zhen; Li, Peixu; Shang, Yuanyuan; Li, Yibin; Wei, Jinquan; Wang, Kunlin; Zhu, Hongwei; Wu, Dehai; Cao, Anyuan

    2012-07-01

    Electrode materials are key components for fiber solar cells, and when combined with active layers (for light absorption and charge generation) in appropriate ways, they enable design and fabrication of efficient and innovative device structures. Here, we apply carbon nanotube yarns as counter electrodes in combination with CdSe nanowire-grafted primary electrodes (Ti wire) for making fiber and fabric-shaped photoelectrochemical cells with power conversion efficiencies in the range 1% to 2.9%. The spun-twist long nanotube yarns possess both good electrical conductivity and mechanical flexibility compared to conventional metal wires or carbon fibers, which facilitate fabrication of solar cells with versatile configurations. A unique feature of our process is that instead of making individual fiber cells, we directly weave single or multiple nanotube yarns with primary electrodes into a functional fabric. Our results demonstrate promising applications of semiconducting nanowires and carbon nanotubes in woven photovoltaics.Electrode materials are key components for fiber solar cells, and when combined with active layers (for light absorption and charge generation) in appropriate ways, they enable design and fabrication of efficient and innovative device structures. Here, we apply carbon nanotube yarns as counter electrodes in combination with CdSe nanowire-grafted primary electrodes (Ti wire) for making fiber and fabric-shaped photoelectrochemical cells with power conversion efficiencies in the range 1% to 2.9%. The spun-twist long nanotube yarns possess both good electrical conductivity and mechanical flexibility compared to conventional metal wires or carbon fibers, which facilitate fabrication of solar cells with versatile configurations. A unique feature of our process is that instead of making individual fiber cells, we directly weave single or multiple nanotube yarns with primary electrodes into a functional fabric. Our results demonstrate promising applications of semiconducting nanowires and carbon nanotubes in woven photovoltaics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31440a

  2. High-Density Terminal Box for Testing Wire Harness

    NASA Technical Reports Server (NTRS)

    Pierce, W. B.; Collins, W. G.

    1982-01-01

    Compact terminal box provides access to complex wiring harnesses for testing. Box accommodates more than twice as many wires as previous boxes. Box takes in wires via cable connectors and distributes them to contacts on box face. Instead of separate insulated jacks in metal face panel, box uses pairs of small military-standard metal sockets in precision-drilled plastic panel. Shorting plug provides continuity for wires when not being tested.

  3. Electro-mechanical characterization of MgB2 wires for the Superconducting Link Project at CERN

    NASA Astrophysics Data System (ADS)

    Konstantopoulou, K.; Ballarino, A.; Gharib, A.; Stimac, A.; Garcia Gonzalez, M.; Perez Fontenla, A. T.; Sugano, M.

    2016-08-01

    In previous years, the R & D program between CERN and Columbus Superconductors SpA led to the development of several configurations of MgB2 wires. The aim was to achieve excellent superconducting properties in high-current MgB2 cables for the HL-LHC upgrade. In addition to good electrical performance, the superconductor shall have good mechanical strength in view of the stresses during operation (Lorenz forces and thermal contraction) and handling (tension and bending) during cabling and installation at room temperature. Thus, the study of the mechanical properties of MgB2 wires is crucial for the cable design and its functional use. In the present work we report on the electro-mechanical characterization of ex situ processed composite MgB2 wires. Tensile tests (critical current versus strain) were carried out at 4.2 K and in a 3 T external field by means of a purpose-built bespoke device to determine the irreversible strain limit of the wire. The minimum bending radius of the wire was calculated taking into account the dependence of the critical current with the strain and it was then used to obtain the minimum twist pitch of MgB2 wires in the cable. Strands extracted from cables having different configurations were tested to quantify the critical current degradation. The Young’s modulus of the composite wire was measured at room temperature. Finally, all measured mechanical parameters will be used to optimize an 18-strand MgB2 cable configuration.

  4. Superconducting magnet

    NASA Technical Reports Server (NTRS)

    1985-01-01

    Extensive computer based engineering design effort resulted in optimization of a superconducting magnet design with an average bulk current density of approximately 12KA/cm(2). Twisted, stranded 0.0045 inch diameter NbTi superconductor in a copper matrix was selected. Winding the coil from this bundle facilitated uniform winding of the small diameter wire. Test coils were wound using a first lot of the wire. The actual packing density was measured from these. Interwinding voltage break down tests on the test coils indicated the need for adjustment of the wire insulation on the lot of wire subsequently ordered for construction of the delivered superconducting magnet. Using the actual packing densities from the test coils, a final magnet design, with the required enhancement and field profile, was generated. All mechanical and thermal design parameters were then also fixed. The superconducting magnet was then fabricated and tested. The first test was made with the magnet immersed in liquid helium at 4.2K. The second test was conducted at 2K in vacuum. In the latter test, the magnet was conduction cooled from the mounting flange end.

  5. Optimum Construction of Heating Coil for Domestic Induction Cooker

    NASA Astrophysics Data System (ADS)

    Sinha, Dola; Bandyopadhyay, Atanu; Sadhu, Pradip Kumar; Pal, Nitai

    2010-10-01

    The design and optimization of the parameters of heating coil is very important for the analytical analysis of high frequency inverter fed induction cooker. Moreover, accurate prediction of high frequency winding loss (i.e., losses due to skin and proximity effects) is necessary as the induction cooker used in power electronics applications. At high frequency current penetration in the induction coil circuit is very difficult for conducting wire due to skin-effect. To eradicate the skin effect heating coil is made up of bundle conductor i.e., litz wire. In this paper inductances and AC resistances of a litz-wire are calculated and optimized by considering the input parameters like wire type, shape, number of strand, number of spiral turn, number of twist per feet of heating coil and operating frequency. A high frequency half bridge series resonant mirror inverter circuit is used in this paper and taking the optimum values of inductance and ac resistance the circuit is simulated through PSPICE simulations. It has been noticed that the results are feasible enough for real implementation.

  6. DARPA/AFRL/NASA Smart Wing Second Wind Tunnel Test Results

    NASA Technical Reports Server (NTRS)

    Scherer, L. B.; Martin, C. A.; West, M.; Florance, J. P.; Wieseman, C. D.; Burner, A. W.; Fleming, G. A.

    2001-01-01

    To quantify the benefits of smart materials and structures adaptive wing technology, Northrop Grumman Corp. (NGC) built and tested two 16% scale wind tunnel models (a conventional and a "smart" model) of a fighter/attack aircraft under the DARPA/AFRL/NASA Smart Materials and Structures Development - Smart Wing Phase 1. Performance gains quantified included increased pitching moment (C(sub M)), increased rolling moment (C(subl)) and improved pressure distribution. The benefits were obtained for hingeless, contoured trailing edge control surfaces with embedded shape memory alloy (SMA) wires and spanwise wing twist effected by SMA torque tube mechanisms, compared to conventional hinged control surfaces. This paper presents an overview of the results from the second wind tunnel test performed at the NASA Langley Research Center s (LaRC) 16ft Transonic Dynamic Tunnel (TDT) in June 1998. Successful results obtained were: 1) 5 degrees of spanwise twist and 8-12% increase in rolling moment utilizing a single SMA torque tube, 2) 12 degrees of deflection, and 10% increase in rolling moment due to hingeless, contoured aileron, and 3) demonstration of optical techniques for measuring spanwise twist and deflected shape.

  7. DARPA/ARFL/NASA Smart Wing second wind tunnel test results

    NASA Astrophysics Data System (ADS)

    Scherer, Lewis B.; Martin, Christopher A.; West, Mark N.; Florance, Jennifer P.; Wieseman, Carol D.; Burner, Alpheus W.; Fleming, Gary A.

    1999-07-01

    To quantify the benefits of smart materials and structures adaptive wing technology. Northrop Grumman Corp. built and tested two 16 percent scale wind tunnel models of a fighter/attach aircraft under the DARPA/AFRL/NASA Smart Materials and Structures Development - Smart Wing Phase 1. Performance gains quantified included increased pitching moment, increased rolling moment and improved pressure distribution. The benefits were obtained for hingeless, contoured trailing edge control surfaces with embedded shape memory alloy wires and spanwise wing twist effected by SMA torque tube mechanism, compared to convention hinged control surfaces. This paper presents an overview of the results from the second wind tunnel test performed at the NASA Langley Research Center's 16 ft Transonic Dynamic Tunnel in June 1998. Successful results obtained were: 1) 5 degrees of spanwise twist and 8-12 percent increase in rolling moment utilizing a single SMA torque tube, 2) 12 degrees of deflection, and 10 percent increase in rolling moment due to hingeless, contoured aileron, and 3) demonstration of optical techniques for measuring spanwise twist and deflected shape.

  8. Twiddler's syndrome in spinal cord stimulation.

    PubMed

    Al-Mahfoudh, Rafid; Chan, Yuen; Chong, Hsu Pheen; Farah, Jibril Osman

    2016-01-01

    The aims are to present a case series of Twiddler's syndrome in spinal cord stimulators with analysis of the possible mechanism of this syndrome and discuss how this phenomenon can be prevented. Data were collected retrospectively between 2007 and 2013 for all patients presenting with failure of spinal cord stimulators. The diagnostic criterion for Twiddler's syndrome is radiological evidence of twisting of wires in the presence of failure of spinal cord stimulation. Our unit implants on average 110 spinal cord stimulators a year. Over the 5-year study period, all consecutive cases of spinal cord stimulation failure were studied. Three patients with Twiddler's syndrome were identified. Presentation ranged from 4 to 228 weeks after implantation. Imaging revealed repeated rotations and twisting of the wires of the spinal cord stimulators leading to hardware failure. To the best of our knowledge this is the first reported series of Twiddler's syndrome with implantable pulse generators (IPGs) for spinal cord stimulation. Hardware failure is not uncommon in spinal cord stimulation. Awareness and identification of Twiddler's syndrome may help prevent its occurrence and further revisions. This may be achieved by implanting the IPG in the lumbar region subcutaneously above the belt line. Psychological intervention may have a preventative role for those who are deemed at high risk of Twiddler's syndrome from initial psychological screening.

  9. Study of left-handed materials

    NASA Astrophysics Data System (ADS)

    Zhou, Jiangfeng

    Left handed materials (LHMs) are artificial materials that have negative electrical permittivity, negative magnetic permeability, and negative index of refraction across a common frequency band. They possess electromagnetic (EM) properties not found in nature. LHMs have attracted tremendous attention because of their potential applications to build the perfect lens and cloaking devices. In the past few years there has been ample proof for the existence of LHMs in the microwave frequency range. Recently, researchers are trying hard to push the operating frequency of LHMs into terahertz and the optical regime. In this thesis, we start with the theoretical prediction of left handed materials made by Veselago 40 years ago, introducing the unique electromagnetic properties of the left handed materials. After discussing the realization of LHMs by the split ring resonators (SRRs) and wire designs, we briefly review the development of LHMs from microwave frequency to the optical regime. We discuss the chiral metamaterial, which provides an alternative approach to realize negative refractive index. In Chapter 2, we discuss the electromagnetic properties of the SRRs and the breakdown of linear scaling properties of SRRs at infrared and optical frequencies. By discussing the current modes, and the electric and magnetic moments, we study three resonance modes of SRR with respect to different polarizations of EM waves. Through numerical simulations, we find the breakdown of linear scaling, due to the free electron kinetic energy for frequencies above 100 THz. This result is important. It proves that researchers cannot push metamaterials into the optical regime by just scaling down the geometrical size of metamaterial designs used at low frequency. Due to the breakdown of the linear scaling property, a much smaller structure size of LHMs design is required in the optical regime, so new designs with simpler topology are needed. In Chapter 3, we discuss a short wire pair design, which has a distinct advantage over conventional SRRs. We systemically study the electromagnetic properties of the short wire pair design. We determine the criteria overlaps the electric and magnetic resonances of short wire pairs. Using an H-shaped short wire pairs design, we demonstrate negative refractive index experimentally. In Chapter 4, we introduce a LHM design using short wire pairs with long wires, which avoid the difficulty of overlapping the electric and magnetic resonances. We also discussed the relationship between three important LHM designs suitable for the optical regime: double gap SRRs, the short wire pairs, and the fishnet structure. Compared to LHMs at microwave frequencies, the current designs at optical frequencies suffer from high losses which limit their potential applications in the area requiring low losses, such as the perfect lens. In Chapter 5, we investigate the role of losses of the short wire pairs and the fishnet structures. We find the losses can be reduced substantially by increasing the effective inductance to capacitance ratio, L/C, especially at THz frequencies and in the optical regime.

  10. Welding fixture for joining bar-wound stator conductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Souza, Urban J.; Rhoads, Frederick W.; Hanson, Justin

    A fixture assembly for welding a plurality of stator wire end pairs may include an anvil, a movable clamp configured to translate between an unclamped state and a clamped state, a first grounding electrode, and a second grounding electrode. The movable clamp may be configured to urge the plurality of stator wire ends against the anvil when in the clamped state. The moveable clamp includes a separator feature that generally extends toward the anvil. Each of the first grounding electrode and second grounding electrodes may be configured to translate between a clamped state and an unclamped state. When in themore » clamped state, each of the first and second grounding electrodes is configured to urge a pair of the plurality of stator wire end pairs against the separator feature.« less

  11. Topological superconductivity and the fractional Josephson effect in quasi-one dimensional wires on a plane

    NASA Astrophysics Data System (ADS)

    Nakhmedov, E.; Mammadova, S.; Alekperov, O.

    2016-01-01

    A time-reversal invariant topological superconductivity is suggested to be realized in a quasi-one-dimensional structure on a plane, which is fabricated by filling the superconducting materials into the periodic channel of dielectric matrices like zeolite and asbestos under high pressure. The topological superconducting phase sets up in the presence of large spin-orbit interactions when intra-wire s-wave and inter-wire d-wave pairings take place. Kramers pairs of Majorana bound states emerge at the edges of each wire. We analyze effects of the Zeeman magnetic field on Majorana zero-energy states. In-plane magnetic field was shown to make asymmetric the energy dispersion, nevertheless Majorana fermions survive due to protection of a particle-hole symmetry. Tunneling of Majorana quasiparticle from the end of one wire to the nearest-neighboring one yields edge fractional Josephson current with 4π-periodicity.

  12. Torsional texturing of superconducting oxide composite articles

    DOEpatents

    Christopherson, Craig John; Riley, Jr., Gilbert N.; Scudiere, John

    2002-01-01

    A method of texturing a multifilamentary article having filaments comprising a desired oxide superconductor or its precursors by torsionally deforming the article is provided. The texturing is induced by applying a torsional strain which is at least about 0.3 and preferably at least about 0.6 at the surface of the article, but less than the strain which would cause failure of the composite. High performance multifilamentary superconducting composite articles having a plurality of low aspect ratio, twisted filaments with substantially uniform twist pitches in the range of about 1.00 inch to 0.01 inch (25 to 0.25 mm), each comprising a textured desired superconducting oxide material, may be obtained using this texturing method. If tighter twist pitches are desired, the article may be heat treated or annealed and the strain repeated as many times as necessary to obtain the desired twist pitch. It is preferred that the total strain applied per step should be sufficient to provide a twist pitch tighter than 5 times the diameter of the article, and twist pitches in the range of 1 to 5 times the diameter of the article are most preferred. The process may be used to make a high performance multifilamentary superconducting article, having a plurality of twisted filaments, wherein the degree of texturing varies substantially in proportion to the radial distance from the center of the article cross-section, and is substantially radially homogeneous at any given cross-section of the article. Round wires and other low aspect ratio multifilamentary articles are preferred forms. The invention is not dependent on the melting characteristics of the desired superconducting oxide. Desired oxide superconductors or precursors with micaceous or semi-micaceous structures are preferred. When used in connection with desired superconducting oxides which melt irreversibly, it provides multifilamentary articles that exhibit high DC performance characteristics and AC performance markedly superior to any currently available for these materials. In a preferred embodiment, the desired superconducting oxide material is BSCCO 2223.

  13. Basic study on hot-wire flow meter in forced flow of liquid hydrogen

    NASA Astrophysics Data System (ADS)

    Oura, Y.; Shirai, Y.; Shiotsu, M.; Murakami, K.; Tatsumoto, H.; Naruo, Y.; Nonaka, S.; Kobayashi, H.; Inatani, Y.; Narita, N.

    2014-01-01

    Liquid hydrogen (LH2) is a key issue in a carbon-free energy infrastructure at the energy storage and transportation stage. The typical features of LH2 are low viscosity, large latent heat and small density, compared with other general liquids. It is necessary to measure a mass flow of liquid hydrogen with a simple and compact method, especially in a two phase separate flow condition. We have proposed applying a hot-wire type flow meter, which is usually used a for gas flow meter, to LH2 flow due to the quite low viscosity and density. A test model of a compact LH2 hot-wire flow meter to measure local flow velocities near and around an inside perimeter of a horizontal tube by resistance thermometry was designed and made. The model flow meter consists of two thin heater wires made of manganin fixed in a 10 mm-diameter and 40 mm-length tube flow path made of GFRP. Each rigid heater wire was set twisted by 90 degrees from the inlet to the outlet along the inner wall. In other words, the wires were aslant with regard to the LH2 stream line. The heated wire was cooled by flowing LH2, and the flow velocity was obtained by means of the difference of the cooling characteristic in response to the flow velocity. In this report, we show results on the basic experiments with the model LH2 hot-wire flow meter. First, the heat transfer characteristics of the two heater wires for several LH2 flow velocities were measured. Second, the heating current was controlled to keep the wire temperature constant for various flow velocities. The relations between the flow velocity and the heating current were measured. The feasibility of the proposed model was confirmed.

  14. Unraveling the sequence-dependent polymorphic behavior of d(CpG) steps in B-DNA.

    PubMed

    Dans, Pablo Daniel; Faustino, Ignacio; Battistini, Federica; Zakrzewska, Krystyna; Lavery, Richard; Orozco, Modesto

    2014-10-01

    We have made a detailed study of one of the most surprising sources of polymorphism in B-DNA: the high twist/low twist (HT/LT) conformational change in the d(CpG) base pair step. Using extensive computations, complemented with database analysis, we were able to characterize the twist polymorphism in the d(CpG) step in all the possible tetranucleotide environment. We found that twist polymorphism is coupled with BI/BII transitions, and, quite surprisingly, with slide polymorphism in the neighboring step. Unexpectedly, the penetration of cations into the minor groove of the d(CpG) step seems to be the key element in promoting twist transitions. The tetranucleotide environment also plays an important role in the sequence-dependent d(CpG) polymorphism. In this connection, we have detected a previously unexplored intramolecular C-H···O hydrogen bond interaction that stabilizes the low twist state when 3'-purines flank the d(CpG) step. This work explains a coupled mechanism involving several apparently uncorrelated conformational transitions that has only been partially inferred by earlier experimental or theoretical studies. Our results provide a complete description of twist polymorphism in d(CpG) steps and a detailed picture of the molecular choreography associated with this conformational change. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Twisting short dsDNA with applied tension

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-02-01

    The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.

  16. Transmission of FDDI signals over low-frequency media

    NASA Astrophysics Data System (ADS)

    Ater, Dan

    1992-03-01

    The `FDDI' designation is gaining an increasing place in the local area network (LAN) jargon along with the `Ethernet' and `Token Ring.' The four letters stand for fiber-optic distributed data interface, but as in the case of other LANs the meaning of the name looses its importance as the properties of the network become familiar to the community of the users, implementors, and designers. Further, more new properties are added to the original set, sometimes beyond the boundaries hinted by the name. This paper presents the actual stage of an attempt to change the `F' (fiber-optic) to `M' (metal) specifically to unshielded twisted pair (UTP). The sense in doing so is the fact that a huge installed basis of metallic wires for telephone and data transmission already exists, and reaches an immense number of desktops. This paper describes: (1) An hierarchical network architecture emphasizing the segment to be implemented over UTP. (2) A systemic approach to the definition of the parameters for the physical medium dependent (PMD) module that should interface the MDDI (FDDI over metallic media) to the UTP cable plant. (3) Measurement results available at the time of the presentation.

  17. Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.

    PubMed

    Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut

    2004-11-12

    Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.

  18. Right/left assignment in drift chambers and proportional multiwire chambers (PWC's) using induced signals

    DOEpatents

    Walenta, Albert H.

    1979-01-01

    Improved multiwire chamber having means for resolving the left/right ambiguity in the location of an ionizing event. The chamber includes a plurality of spaced parallel anode wires positioned between spaced planar cathodes. Associated with each of the anode wires are a pair of localizing wires, one positioned on either side of the anode wire. The localizing wires are connected to a differential amplifier whose output polarity is determined by whether the ionizing event occurs to the right or left of the anode wire.

  19. Conformations of 1,3,3,5,7,7-Hexamethyl-1,5-diazacyclooctane and Its Bis-BH(3) Adduct. Mono- and Bis-BH(3) Adducts of Di-Tertiary Amines.

    PubMed

    Livant, P.; Majors, A. W.; Webb, T. R.

    1996-05-03

    A variable-temperature (1)H- and (13)C-NMR study revealed a conformational equilibrium for 1,3,3,5,7,7-hexamethyl-1,5-diazacyclooctane (4) having DeltaG() = 8.8 +/- 0.6 kcal/mol at 184 K. This activation barrier connects a major and a minor form of 4. Molecular mechanics calculations on 4 led to the conclusion that the major form is a set of twist-chair-chairs interconverting rapidly via the chair-chair and that the minor form is most likely a set of twist-boat-boats interconverting rapidly via the boat-boat. The proximity of the two nitrogen lone pairs in the major form of 4 made plausible the expectation that 4, as well as a related diamine with apposed nitrogens, 3,7-dimethyl-3,7-diazabicyclo[3.3.1]nonane (3), might bind a Lewis acid, namely BH(3), using both lone pairs simultaneously and equally. This proved not to be the case: for 3 only the bis-BH(3) adduct was found and for 4 the mono-BH(3) adduct utilized only one nitrogen lone pair. The structure of the bis-BH(3) adduct of 4 (12) was determined by X-ray crystallography to be a twist-boat-boat with BH(3)s cis. Molecular mechanics calculations on 12 were consistent with the solid state conformation found.

  20. Sensors for monitoring waste glass quality and method of using the same

    DOEpatents

    Bickford, Dennis F.

    1994-01-01

    A set of three electrical probes for monitoring alkali and oxygen activity of a glass melt. On-line, real time measurements of the potential difference among the probes when they are placed in electrical contact with the melt yield the activity information and can be used to adjust the composition of the melt in order to produce higher quality glass. The first two probes each has a reference gas and a reference electrolyte and a pair of wires in electrical connection with each other in the reference gas but having one of the wires extending further into the reference electrolyte. The reference gases both include a known concentration of oxygen. The third electrode has a pair of wires extending through an otherwise solid body to join electrically just past the body but having one of the wires extend past this junction. Measuring the potential difference between wires of the first and second probes provides the alkali activity; measurement of the potential difference between wires of the second and third probes provides the oxygen activity of the melt.

  1. Sensors for monitoring waste glass quality and method of using the same

    DOEpatents

    Bickford, D.F.

    1994-03-15

    A set of three electrical probes is described for monitoring alkali and oxygen activity of a glass melt. On-line, real time measurements of the potential difference among the probes when they are placed in electrical contact with the melt yield the activity information and can be used to adjust the composition of the melt in order to produce higher quality glass. The first two probes each has a reference gas and a reference electrolyte and a pair of wires in electrical connection with each other in the reference gas but having one of the wires extending further into the reference electrolyte. The reference gases both include a known concentration of oxygen. The third electrode has a pair of wires extending through an otherwise solid body to join electrically just past the body but having one of the wires extend past this junction. Measuring the potential difference between wires of the first and second probes provides the alkali activity; measurement of the potential difference between wires of the second and third probes provides the oxygen activity of the melt. 1 figure.

  2. Multi-pin chemiresistors for microchemical sensors

    DOEpatents

    Ho, Clifford K [Albuquerque, NM

    2007-02-20

    A multi-pin chemiresistor for use in microchemical sensors. A pair of free-standing, bare wires is supported by an electrically insulating support, and are oriented parallel to each other and spaced closely together. A free-standing film of a chemically sensitive polymer that swells when exposed to vapors of a volatile chemical is formed in-between the pair of closely-spaced wires by capillary action. Similar in construction to a thermocouple, this "chemicouple" is relatively inexpensive and easy to fabricate by dipping the pair of bare wires into a bath of well-mixed chemiresistor ink. Also, a chemiresistor "stick" is formed by dipping an electrically insulating rod with two or more linear or spiral-wrapped electrical traces into the bath of well-mixed chemiresistor ink, which deposits a uniform coating of the chemically sensitive polymer on the rod and the electrical traces. These "sticks" can be easily removed and replaced from a multi-chemiresistor plug.

  3. Simultaneous transmission of wired and wireless signals based on double sideband carrier suppression

    NASA Astrophysics Data System (ADS)

    Bitew, Mekuanint Agegnehu; Shiu, Run-Kai; Peng, Peng-Chun; Wang, Cheng-Hao; Chen, Yan-Ming

    2017-11-01

    In this paper, we proposed and experimentally demonstrated simultaneous transmission of wired and wireless signals based on double sideband optical carrier suppression. By properly adjusting the bias point of the dual-output mach-zehnder modulator (MZM), a central carrier in one output port and a pair of first-order sidebands in another output port are generated. The pair of first-order sidebands are fed into a second MZM to generate second-order order sidebands. A wired signal is embedded on the central carrier while a wireless signal is embedded on the second-order sidebands. Unlike other schemes, we did not use optical filter to separate the carrier from the optical sidebands. The measured bit error rate (BER) and eye-diagrams after a 25 km single-mode-fiber (SMF) transmission proved that the proposed scheme is successful for both wired and wireless signals transmission. Moreover, the power penalty at the BER of 10-9 is 0.3 and 0.7 dB for wired and wireless signals, respectively.

  4. Towards generalized mirror symmetry for twisted connected sum G 2 manifolds

    NASA Astrophysics Data System (ADS)

    Braun, Andreas P.; Del Zotto, Michele

    2018-03-01

    We revisit our construction of mirror symmetries for compactifications of Type II superstrings on twisted connected sum G 2 manifolds. For a given G 2 manifold, we discuss evidence for the existence of mirror symmetries of two kinds: one is an autoequivalence for a given Type II superstring on a mirror pair of G 2 manifolds, the other is a duality between Type II strings with different chiralities for another pair of mirror manifolds. We clarify the role of the B-field in the construction, and check that the corresponding massless spectra are respected by the generalized mirror maps. We discuss hints towards a homological version based on BPS spectroscopy. We provide several novel examples of smooth, as well as singular, mirror G 2 backgrounds via pairs of dual projecting tops. We test our conjectures against a Joyce orbifold example, where we reproduce, using our geometrical methods, the known mirror maps that arise from the SCFT worldsheet perspective. Along the way, we discuss non-Abelian gauge symmetries, and argue for the generation of the Affleck-Harvey-Witten superpotential in the pure SYM case.

  5. A Focus on Cryogenic Engineering for the Primordial Inflation Polarization Explorer (PIPER) Mission

    NASA Technical Reports Server (NTRS)

    Rosas, Rogelio; Weston, Amy

    2011-01-01

    Cryogenic engineering involves design and modification of equipment that is used under boiling point of nitrogen which is 77 K. The focus of this paper will be on the design of hardware for cryogenic use and a retrofit that was done to the main laboratory cryostat used to test flight components for the Primordial Inflation Polarization Explorer balloon-borne mission. Data from prior tests showed that there was a superfluid helium leak and a total disassemble of the cryostat was conducted in order to localize and fix the leak. To improve efficiency new fill tubes and clamps with modifications were added to the helium tank. Upon removal of the tank, corrosion was found on the flange face that connects to the helium cold plate and therefore had to be fully replaced and copper plated to prevent future corrosion. Indium seals were also replaced for the four fill tubes, a helium level sensor, and the nitrogen and helium tanks. Four additional shielded twisted pairs of cryogenic wire and a wire harness for the Superconducting Quantum Interference Devices (SQUIDs) were added. Finally, there was also design work done for multiple pieces that went inside the cryostat and a separate probe used to test the SQUIDs. Upon successful completion of the cryostat upgrade, tests were run to check the effectiveness and stability of the upgrades. The post-retrofit tests showed minor leaks were still present and due to this, superfluidity has still not been attained. As such there could still be a possibility of a superfluid leak appearing in the future. Regardless, the copper plating on the helium tank has elongated the need to service it by three to five years.

  6. Resonance coupling and polarization conversion in terahertz metasurfaces with twisted split-ring resonator pairs

    DOE PAGES

    Li, Chenyu; Chang, Chun-Chieh; Zhou, Qingli; ...

    2017-10-10

    Here, we investigate edge-coupling of twisted split-ring resonator (SRR) pairs in the terahertz (THz) frequency range. By using a simple coupled-resonator model we show that such a system exhibits resonance splitting and cross-polarization conversion. Numerical simulations and experimental measurements agree well with theoretical calculations, verifying the resonance splitting as a function of the coupling strength given by the SRR separation. We further show that a metal ground plane can be integrated to significantly enhance the resonance coupling, which enables the effective control of resonance splitting and the efficiency and bandwidth of the cross-polarization conversion. Our findings improve the fundamental understandingmore » of metamaterials with a view of accomplishing metamaterial functionalities with enhanced performance, which is of great interest in realizing THz functional devices required in a variety of applications.« less

  7. Distributed Sensor Networks

    DTIC Science & Technology

    1980-09-30

    the main Laboratory is provided by 9600-baud short-haul modems with unloaded lines. A new version of the real-time kernel (DAK) has been developed. It...and control computer have been in- vestigated, modems have been procured, and an initial 4-wire line with 9.6 kbits modem has been installed between the...telephone system or leased (unloaded) 4-wire private-line metallic circuits. To this end, two pairs of short-haul modems and a pair of long-haul modems have

  8. Analytical formulae for computing the critical current of an Nb3Sn strand under bending

    NASA Astrophysics Data System (ADS)

    Ciazynski, D.; Torre, A.

    2010-12-01

    Works on bending strain in Nb3Sn wires were initiated in support of the 'react-and-wind' technique used to manufacture superconducting coils. More recently, the bending strains of Nb3Sn strands in cable-in-conduit conductors (CICC) under high Lorentz forces have been thought to be partly responsible for the degradation of the conductor performance in terms of critical current and n index, particularly for the international thermonuclear experimental reactor (ITER) conductors. This has led to a new wave of experiments and modelling on this subject. The computation of the current transport capability in an Nb3Sn wire under uniform bending used to be carried out through the so-called Ekin's models, and more recently through numerical simulations with electric networks. The flaws of Ekin's models are that they consider only two extreme cases or limits, namely the so-called long twist pitch (LTP) or short twist pitch (STP) cases, and that these models only allow computation of a value for the critical current without reference to the n index of the superconducting filaments (i.e. this index is implicitly assumed to be infinite). Although the numerical models allow a fine description of the wire under operation and can take into account the filament's n index, they need a refined meshing to be accurate enough and their results may be sensitive to boundary conditions (i.e. current injection in the wire), also general intrinsic parameters cannot be easily identified. In this paper, we propose clearly to go further than Ekin's models by developing, from a homogeneous model and Maxwell's equations, an analytical model to establish the general equation governing the evolution of the electric field inside an Nb3Sn strand under uniform bending (with possible longitudinal strain). Within the usual strand fabrication limits, this equation allows the definition of one single parameter to discriminate the STP and LTP cases. It is also shown that whereas Ekin's LTP model corresponds well to a limiting solution of the problem when the transverse resistivity tends toward zero (or the twist pitch tends towards infinity), Ekin's STP model must be modified (improved) when the filament's n index is finite. Since the general equation cannot be solved analytically, we start from the LTP model and develop a first order correction to be applied when the transverse resistivity, the twist pitch and the filament's n index are finite. Using a simple but realistic law for depicting the strain dependence of the critical current density in the Nb3Sn filaments, we can fully compute the corrected expression and give the result under a general analytical formula for a strand submitted to both bending and compressive/tensile strains. The results are then compared in two different cases with those obtained with the numerical code CARMEN (based on an electrical network) developed at CEA. Last, a semi-empirical formula has been developed to evolve continuously from the LTP limit to the improved STP limit when the transverse resistivity evolves from zero to infinity. The results given by this formula are again compared with the numerical simulations in two different cases. Last, comparisons with experimental results are discussed.

  9. Quantum currents and pair correlation of electrons in a chain of localized dots

    NASA Astrophysics Data System (ADS)

    Morawetz, Klaus

    2017-03-01

    The quantum transport of electrons in a wire of localized dots by hopping, interaction and dissipation is calculated and a representation by an equivalent RCL circuit is found. The exact solution for the electric-field induced currents allows to discuss the role of virtual currents to decay initial correlations and Bloch oscillations. The dynamical response function in random phase approximation (RPA) is calculated analytically with the help of which the static structure function and pair correlation function are determined. The pair correlation function contains a form factor from the Brillouin zone and a structure factor caused by the localized dots in the wire.

  10. Quantum-mechanical analysis of the energetic contributions to π stacking in nucleic acids versus rise, twist, and slide.

    PubMed

    Parker, Trent M; Hohenstein, Edward G; Parrish, Robert M; Hud, Nicholas V; Sherrill, C David

    2013-01-30

    Symmetry-adapted perturbation theory (SAPT) is applied to pairs of hydrogen-bonded nucleobases to obtain the energetic components of base stacking (electrostatic, exchange-repulsion, induction/polarization, and London dispersion interactions) and how they vary as a function of the helical parameters Rise, Twist, and Slide. Computed average values of Rise and Twist agree well with experimental data for B-form DNA from the Nucleic Acids Database, even though the model computations omitted the backbone atoms (suggesting that the backbone in B-form DNA is compatible with having the bases adopt their ideal stacking geometries). London dispersion forces are the most important attractive component in base stacking, followed by electrostatic interactions. At values of Rise typical of those in DNA (3.36 Å), the electrostatic contribution is nearly always attractive, providing further evidence for the importance of charge-penetration effects in π-π interactions (a term neglected in classical force fields). Comparison of the computed stacking energies with those from model complexes made of the "parent" nucleobases purine and 2-pyrimidone indicates that chemical substituents in DNA and RNA account for 20-40% of the base-stacking energy. A lack of correspondence between the SAPT results and experiment for Slide in RNA base-pair steps suggests that the backbone plays a larger role in determining stacking geometries in RNA than in B-form DNA. In comparisons of base-pair steps with thymine versus uracil, the thymine methyl group tends to enhance the strength of the stacking interaction through a combination of dispersion and electrosatic interactions.

  11. Visualization of drug-nucleic acid interactions at atomic resolution v. structure of two aminoacridine/dinucleoside monophosphate crystalline complexes, proflavine: 5-iodocytidylyl(3'-5') guanosine and acridine orange: 5-iodocytidylyl(3'-5') guanosine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reddy, B.S.; Seshadri, T.P.; Sakore, T.D.

    1979-01-01

    Acridine orange and proflavine form complexes with the dinucleoside monophosphate, 5-iodocytidylyl(3'-5') guanosine (iodoCpG). The acridine orange-iodoCpG crystals are monoclinic, space group P2/sub 1/, with unit cell dimensions a = 14.36 A, b = 19.64 A, c = 20.67 A, ..beta.. = 102.5. The proflavine-iodoCpG crystals are monoclinic, space group C2, with unit cell dimensions a = 32.14 A, b = 22.23 A, c = 18.42 A, ..beta.. = 123.3. Both structures have been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least squares. Acridine orange forms an intercalative structure with iodoCpG but the acridinemore » nucleus lies asymmetrically in the intercalation site. This asymmetric intercalation is accompanied by a sliding of base-pairs upon the acridine nucleus. Base-pairs above and below the drug are separated by about 6.8 A and are twisted about 10/sup 0/. Proflavine demonstrates symmetric intercalation with iodoCpG. Hydrogen bonds connect amino- groups on proflavine with phosphate oxygen atoms on the dinucleotide. Base-pairs above and below the intercalative proflavine molecule are twisted about 36/sup 0/. The altered magnitude of this angular twist reflects the sugar puckering pattern that is observed. We propose a proflavine-DNA and an acridine orange-DNA binding model. We will describe these models in detail in this paper.« less

  12. Exact special twist method for quantum Monte Carlo simulations

    NASA Astrophysics Data System (ADS)

    Dagrada, Mario; Karakuzu, Seher; Vildosola, Verónica Laura; Casula, Michele; Sorella, Sandro

    2016-12-01

    We present a systematic investigation of the special twist method introduced by Rajagopal et al. [Phys. Rev. B 51, 10591 (1995), 10.1103/PhysRevB.51.10591] for reducing finite-size effects in correlated calculations of periodic extended systems with Coulomb interactions and Fermi statistics. We propose a procedure for finding special twist values which, at variance with previous applications of this method, reproduce the energy of the mean-field infinite-size limit solution within an adjustable (arbitrarily small) numerical error. This choice of the special twist is shown to be the most accurate single-twist solution for curing one-body finite-size effects in correlated calculations. For these reasons we dubbed our procedure "exact special twist" (EST). EST only needs a fully converged independent-particles or mean-field calculation within the primitive cell and a simple fit to find the special twist along a specific direction in the Brillouin zone. We first assess the performances of EST in a simple correlated model such as the three-dimensional electron gas. Afterwards, we test its efficiency within ab initio quantum Monte Carlo simulations of metallic elements of increasing complexity. We show that EST displays an overall good performance in reducing finite-size errors comparable to the widely used twist average technique but at a much lower computational cost since it involves the evaluation of just one wave function. We also demonstrate that the EST method shows similar performances in the calculation of correlation functions, such as the ionic forces for structural relaxation and the pair radial distribution function in liquid hydrogen. Our conclusions point to the usefulness of EST for correlated supercell calculations; our method will be particularly relevant when the physical problem under consideration requires large periodic cells.

  13. Development and evaluation of TWIST Dixon for dynamic contrast-enhanced (DCE) MRI with improved acquisition efficiency and fat suppression.

    PubMed

    Le, Yuan; Kroeker, Randall; Kipfer, Hal D; Lin, Chen

    2012-08-01

    To develop a new pulse sequence called time-resolved angiography with stochastic trajectories (TWIST) Dixon for dynamic contrast enhanced magnetic resonance imaging (DCE-MRI). The method combines dual-echo Dixon to generate separated water and fat images with a k-space view-sharing scheme developed for 3D TWIST. The performance of TWIST Dixon was compared with a volume interpolated breathhold examination (VIBE) sequence paired with spectrally selective adiabatic inversion Recovery (SPAIR) and quick fat-sat (QFS) fat-suppression techniques at 3.0T using quantitative measurements of fat-suppression accuracy and signal-to-noise ratio (SNR) efficiency, as well as qualitative breast image evaluations. The water fraction of a uniform phantom was calculated from the following images: 0.66 ± 0.03 for TWIST Dixon; 0.56 ± 0.23 for VIBE-SPAIR, and 0.53 ± 0.14 for VIBE-QFS, while the reference value is 0.70 measured by spectroscopy. For phantoms with contrast (Gd-BOPTA) concentration ranging from 0-6 mM, TWIST Dixon also provides consistently higher SNR efficiency (3.2-18.9) compared with VIBE-SPAIR (2.8-16.8) and VIBE-QFS (2.4-12.5). Breast images acquired with TWIST Dixon at 3.0T show more robust and uniform fat suppression and superior overall image quality compared with VIBE-SPAIR. The results from phantom and volunteer evaluation suggest that TWIST Dixon outperforms conventional methods in almost every aspect and it is a promising method for DCE-MRI and contrast-enhanced perfusion MRI, especially at higher field strength where fat suppression is challenging. Copyright © 2012 Wiley Periodicals, Inc.

  14. Biomechanical comparison of fixation methods in transverse patella fractures.

    PubMed

    Scilaris, T A; Grantham, J L; Prayson, M J; Marshall, M P; Hamilton, J J; Williams, J L

    1998-01-01

    To compare monofilament wire versus braided cable for stabilizing transverse patella fractures using the modified AO tension band technique. A randomized blocked (paired) study comparing two fixation methods. Statistical analysis was performed using a nested repeated measures analysis, followed by Bonferroni post hoc testing. Seven paired embalmed knees (mean age 71.8 years, SD 14.6 years) were dissected, and transverse fractures were simulated. The knees were reduced and randomly fixed by either two parallel 0.062-inch Kirschner wires with a 1.0-millimeter-diameter 316L stainless steel monofilament wire tension loop or two Kirschner wires with a 1.0-millimeter-diameter 316L stainless steel braided cable tension loop. Knees were tested by applying a cyclic load through the suprapatellar tendon between twenty and 300 newtons for thirty cycles. The maximum fracture displacement increased with each cycle of loading for both the braided cable and monofilament wire tension loop configurations (p = 0.0001). The average peak displacement at the thirtieth cycle was 2.25 millimeters for monofilament wire and 0.73 millimeters for the cable. When comparing both methods for all cycles, the braided cable allowed less fracture displacement than did the monofilament wire (p = 0.002), and the rate of increase per cycle of maximum fracture displacement was less for the cable than for the wire (p = 0.0001). In transverse, noncomminuted patella fractures, fixation with two Kirschner wires and a 1.0-millimeter braided cable tension loop was superior to the monofilament wire tension loop. Most importantly, the braided cable afforded more predictable results during cyclic loading.

  15. The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix H. Evaluation of Existing Projects. Volume 1.

    DTIC Science & Technology

    1981-12-01

    and cables with two strands of twisted No. 12 galvanized-steel wire. The base of the fence was buried to a depth of 1 ft, leaving 5 ft above the...Cnied DD 1473 emlooNriNo si OI VoSIsoLaTit Unclassified *9CUmhTV CLAMWIFCATSOW OF THIS PAQ E (Mbeft Dots Entered) 0 0 0 0 0 0 ~0 0 0 0 0 0 0 0

  16. Advanced signal processing methods applied to guided waves for wire rope defect detection

    NASA Astrophysics Data System (ADS)

    Tse, Peter W.; Rostami, Javad

    2016-02-01

    Steel wire ropes, which are usually composed of a polymer core and enclosed by twisted wires, are used to hoist heavy loads. These loads are different structures that can be clamshells, draglines, elevators, etc. Since the loading of these structures is dynamic, the ropes are working under fluctuating forces in a corrosive environment. This consequently leads to progressive loss of the metallic cross-section due to abrasion and corrosion. These defects can be seen in the forms of roughened and pitted surface of the ropes, reduction in diameter, and broken wires. Therefore, their deterioration must be monitored so that any unexpected damage or corrosion can be detected before it causes fatal accident. This is of vital importance in the case of passenger transportation, particularly in elevators in which any failure may cause a catastrophic disaster. At present, the widely used methods for thorough inspection of wire ropes include visual inspection and magnetic flux leakage (MFL). Reliability of the first method is questionable since it only depends on the operators' eyes that fails to determine the integrity of internal wires. The later method has the drawback of being a point by point and time-consuming inspection method. Ultrasonic guided wave (UGW) based inspection, which has proved its capability in inspecting plate like structures such as tubes and pipes, can monitor the cross-section of wire ropes in their entire length from a single point. However, UGW have drawn less attention for defect detection in wire ropes. This paper reports the condition monitoring of a steel wire rope from a hoisting elevator with broken wires as a result of corrosive environment and fatigue. Experiments were conducted to investigate the efficiency of using magnetostrictive based UGW for rope defect detection. The obtained signals were analyzed by two time-frequency representation (TFR) methods, namely the Short Time Fourier Transform (STFT) and the Wavelet analysis. The location of the defect and its severity were successfully identified and characterized.

  17. Particle-in-Cell Simulations of the Twisted Magnetospheres of Magnetars. I.

    NASA Astrophysics Data System (ADS)

    Chen, Alexander Y.; Beloborodov, Andrei M.

    2017-08-01

    The magnetospheres of magnetars are believed to be filled with electron-positron plasma generated by electric discharge. We present a first numerical experiment demonstrating this process in an axisymmetric magnetosphere with a simple threshold prescription for pair creation, which is applicable to the inner magnetosphere with an ultrastrong field. The {e}+/- discharge occurs in response to the twisting of the closed magnetic field lines by a shear deformation of the magnetar surface, which launches electric currents into the magnetosphere. The simulation shows the formation of an electric “gap” with an unscreened electric field ({\\boldsymbol{E}}\\cdot {\\boldsymbol{B}}\

  18. Prediction of Spin-Polarization Effects in Quantum Wire Transport

    NASA Astrophysics Data System (ADS)

    Fasol, Gerhard; Sakaki, Hiroyuki

    1994-01-01

    We predict a new effect for transport in quantum wires: spontaneous spin polarization. Most work on transport in mesoscopic devices has assumed a model of non interacting, spin-free electrons. We introduce spin, electron pair scattering and microscopic crystal properties into the design of mesoscopic devices. The new spin polarization effect results from the fact that in a single mode quantum wire, electron and hole bands still have two spin subbands. In general, these two spin subbands are expected to be split even in zero magnetic field. At sufficiently low temperatures the electron pair scattering rates for one spin subband ( e.g., the spin-down) can be much larger than for the other spin subband. This effect can be used for an active spin polarizer device: hot electrons in one subband ( e.g., `spin up') pass with weak pair scattering, while electrons in the opposite subband ( e.g., `spin down'), have high probability of scattering into the `spin-up' subband, resulting in spin polarization of a hot electron beam.

  19. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  20. ATM over hybrid fiber-coaxial cable networks: practical issues in deploying residential ATM services

    NASA Astrophysics Data System (ADS)

    Laubach, Mark

    1996-11-01

    Residential broadband access network technology based on asynchronous transfer modem (ATM) will soon reach commercial availability. The capabilities provided by ATM access network promise integrated services bandwidth available in excess of those provided by traditional twisted pair copper wire public telephone networks. ATM to the side of the home placed need quality of service capability closest to the subscriber allowing immediate support for Internet services and traditional voice telephony. Other services such as desktop video teleconferencing and enhanced server-based application support can be added as part of future evolution of the network. Additionally, advanced subscriber home networks can be supported easily. This paper presents an updated summary of the standardization efforts for the ATM over HFC definition work currently taking place in the ATM forum's residential broadband working group and the standards progress in the IEEE 802.14 cable TV media access control and physical protocol working group. This update is fundamental for establishing the foundation for delivering ATM-based integrated services via a cable TV network. An economic model for deploying multi-tiered services is presenting showing that a single-tier service is insufficient for a viable cable operator business. Finally, the use of an ATM based system lends itself well to various deployment scenarios of synchronous optical networks (SONET).

  1. Separate vertical wiring for the fixation of comminuted fractures of the inferior pole of the patella.

    PubMed

    Song, Hyung Keun; Yoo, Je Hyun; Byun, Young Soo; Yang, Kyu Hyun

    2014-05-01

    Among patients over 50 years of age, separate vertical wiring alone may be insufficient for fixation of fractures of the inferior pole of the patella. Therefore, mechanical and clinical studies were performed in patients over the age of 50 to test the strength of augmentation of separate vertical wiring with cerclage wire (i.e., combined technique). Multiple osteotomies were performed to create four-part fractures in the inferior poles of eight pairs of cadaveric patellae. One patella from each pair was fixed with the separate wiring technique, while the other patella was fixed with a combined technique. The ultimate load to failure and stiffness of the fixation were subsequently measured. In a clinical study of 21 patients (average age of 64 years), comminuted fractures of the inferior pole of the patellae were treated using the combined technique. Operative parameters were recorded from which post-operative outcomes were evaluated. For cadaveric patellae, whose mean age was 69 years, the mean ultimate loads to failure for the separate vertical wiring technique and the combined technique were 216.4±72.4 N and 324.9±50.6 N, respectively (p=0.012). The mean stiffness for the separate vertical wiring technique and the combined technique was 241.1±68.5 N/mm and 340.8±45.3 N/mm, respectively (p=0.012). In the clinical study, the mean clinical score at final follow-up was 28.1 points. Augmentation of separate vertical wiring with cerclage wire provides enough strength for protected early exercise of the knee joint and uneventful healing.

  2. Magnetoresistance and magnetization in submicron ferromagnetic gratings

    NASA Astrophysics Data System (ADS)

    Shearwood, C.; Blundell, S. J.; Baird, M. J.; Bland, J. A. C.; Gester, M.; Ahmed, H.; Hughes, H. P.

    1994-05-01

    A technique for engineering micron and submicron scale structures from magnetic films of transition metals has been developed using a combination of electron- and ion-beam lithography enabling high-quality arrays of submicron magnetic Fe wires to be fabricated. This process can be used to fabricate novel devices from a variety of metal combinations which would not be possible by the usual liftoff metallization method. The structure and magnetic properties are reported of an epitaxial 25 nm Fe(001)/GaAs(001) film and the wire gratings which are fabricated from it. The width of the wires in the grating is 0.5 μm for all structures studied, but the separation of each wire is varied in the range 0.5 to 16 μm. An artificially induced shape anisotropy field of around 1 kG, consistent with a magnetostatic calculation, was observed for all separations studied. The field dependence of the magneto-optic Kerr effect and magnetoresistance (MR) data is consistent with a twisted magnetization configuration across the width of the sample beneath saturation for transverse applied fields. In this case, the detailed form of the field dependence of the MR is strikingly modified from that observed in the continuous film and is consistent with coherent rotation of the magnetization.

  3. Light intensity compressor

    DOEpatents

    Rushford, Michael C.

    1990-02-06

    In a system for recording images having vastly differing light intensities over the face of the image, a light intensity compressor is provided that utilizes the properties of twisted nematic liquid crystals to compress the image intensity. A photoconductor or photodiode material that is responsive to the wavelength of radiation being recorded is placed adjacent a layer of twisted nematic liquid crystal material. An electric potential applied to a pair of electrodes that are disposed outside of the liquid crystal/photoconductor arrangement to provide an electric field in the vicinity of the liquid crystal material. The electrodes are substantially transparent to the form of radiation being recorded. A pair of crossed polarizers are provided on opposite sides of the liquid crystal. The front polarizer linearly polarizes the light, while the back polarizer cooperates with the front polarizer and the liquid crystal material to compress the intensity of a viewed scene. Light incident upon the intensity compressor activates the photoconductor in proportion to the intensity of the light, thereby varying the field applied to the liquid crystal. The increased field causes the liquid crystal to have less of a twisting effect on the incident linearly polarized light, which will cause an increased percentage of the light to be absorbed by the back polarizer. The intensity of an image may be compressed by forming an image on the light intensity compressor.

  4. Light intensity compressor

    DOEpatents

    Rushford, Michael C.

    1990-01-01

    In a system for recording images having vastly differing light intensities over the face of the image, a light intensity compressor is provided that utilizes the properties of twisted nematic liquid crystals to compress the image intensity. A photoconductor or photodiode material that is responsive to the wavelength of radiation being recorded is placed adjacent a layer of twisted nematic liquid crystal material. An electric potential applied to a pair of electrodes that are disposed outside of the liquid crystal/photoconductor arrangement to provide an electric field in the vicinity of the liquid crystal material. The electrodes are substantially transparent to the form of radiation being recorded. A pair of crossed polarizers are provided on opposite sides of the liquid crystal. The front polarizer linearly polarizes the light, while the back polarizer cooperates with the front polarizer and the liquid crystal material to compress the intensity of a viewed scene. Light incident upon the intensity compressor activates the photoconductor in proportion to the intensity of the light, thereby varying the field applied to the liquid crystal. The increased field causes the liquid crystal to have less of a twisting effect on the incident linearly polarized light, which will cause an increased percentage of the light to be absorbed by the back polarizer. The intensity of an image may be compressed by forming an image on the light intensity compressor.

  5. Local Area Networks.

    ERIC Educational Resources Information Center

    Marks, Kenneth E.; Nielsen, Steven

    1991-01-01

    Discusses cabling that is needed in local area networks (LANs). Types of cables that may be selected are described, including twisted pair, coaxial cables (or ethernet), and fiber optics; network topologies, the manner in which the cables are laid out, are considered; and cable installation issues are discussed. (LRW)

  6. A versatile small form factor twisted-pair TFC FMC for MTCA AMCs

    NASA Astrophysics Data System (ADS)

    Meder, L.; Lebedev, J.; Becker, J.

    2017-03-01

    In continuous readout systems of particle physics experiments, the provision of a common clock and time reference and the distribution of critical low latency messages to the processing and fronted layers of the readout are crucial tasks. In the context of the Compressed Baryonic Matter (CBM) experiment, a versatile small form factor Timing and Fast-Control (TFC) interfacing FPGA Mezzanine Card (FMC) was developed, offering bidirectional twisted-pair (TP) links for the communication between TFC nodes. Also a versatile clocking including voltage controlled oscillators and a connection to the telecommunication clock lines of mTCA crates are available. Being designed for both TFC Master and Slaves, the card allows rapid system developments without additional Slave hardware circuits. Measurements show that it is possible to transmit over cable lengths of 25 m at a rate of 240 Mbit/s for all data channels simultaneously. A TFC Master-Slave system using two of these cards can be synchronized with a precision of ±10 ps to an user-defined phase setpoint.

  7. Liquid droplet sensing using twisted optical fiber couplers fabricated by hydrofluoric acid flow etching

    NASA Astrophysics Data System (ADS)

    Son, Gyeongho; Jung, Youngho; Yu, Kyoungsik

    2017-04-01

    We report a directional-coupler-based refractive index sensor and its cost-effective fabrication method using hydrofluoric acid droplet wet-etching and surface-tension-driven liquid flows. The proposed fiber sensor consists of a pair of twisted tapered optical fibers with low excess losses. The fiber cores in the etched microfiber region are exposed to the surrounding medium for efficient interaction with the guided light. We observe that the etching-based low-loss fiber-optic sensors can measure the water droplet volume by detecting the refractive index changes of the surrounding medium around the etched fiber core region.

  8. Positive Noise Cross Correlation in a Copper Pair Splitter.

    NASA Astrophysics Data System (ADS)

    Das, Anindya; Ronen, Yuval; Heiblum, Moty; Shtrikman, Hadas; Mahalu, Diana

    2012-02-01

    Entanglement is in heart of the Einstein-Podolsky-Rosen (EPR) paradox, in which non-locality is a fundamental property. Up to date spin entanglement of electrons had not been demonstrated. Here, we provide direct evidence of such entanglement by measuring: non-local positive current correlation and positive cross correlation among current fluctuations, both of separated electrons born by a Cooper-pair-beam-splitter. The realization of the splitter is provided by injecting current from an Al superconductor contact into two, single channel, pure InAs nanowires - each intercepted by a Coulomb blockaded quantum dot (QD). The QDs impedes strongly the flow of Cooper pairs allowing easy single electron transport. The passage of electron in one wire enables the simultaneous passage of the other in the neighboring wire. The splitting efficiency of the Cooper pairs (relative to Cooper pairs actual current) was found to be ˜ 40%. The positive cross-correlations in the currents and their fluctuations (shot noise) are fully consistent with entangled electrons produced by the beam splitter.

  9. Separate Vertical Wiring for the Fixation of Comminuted Fractures of the Inferior Pole of the Patella

    PubMed Central

    Song, Hyung Keun; Yoo, Je Hyun; Byun, Young Soo

    2014-01-01

    Purpose Among patients over 50 years of age, separate vertical wiring alone may be insufficient for fixation of fractures of the inferior pole of the patella. Therefore, mechanical and clinical studies were performed in patients over the age of 50 to test the strength of augmentation of separate vertical wiring with cerclage wire (i.e., combined technique). Materials and Methods Multiple osteotomies were performed to create four-part fractures in the inferior poles of eight pairs of cadaveric patellae. One patella from each pair was fixed with the separate wiring technique, while the other patella was fixed with a combined technique. The ultimate load to failure and stiffness of the fixation were subsequently measured. In a clinical study of 21 patients (average age of 64 years), comminuted fractures of the inferior pole of the patellae were treated using the combined technique. Operative parameters were recorded from which post-operative outcomes were evaluated. Results For cadaveric patellae, whose mean age was 69 years, the mean ultimate loads to failure for the separate vertical wiring technique and the combined technique were 216.4±72.4 N and 324.9±50.6 N, respectively (p=0.012). The mean stiffness for the separate vertical wiring technique and the combined technique was 241.1±68.5 N/mm and 340.8±45.3 N/mm, respectively (p=0.012). In the clinical study, the mean clinical score at final follow-up was 28.1 points. Conclusion Augmentation of separate vertical wiring with cerclage wire provides enough strength for protected early exercise of the knee joint and uneventful healing. PMID:24719149

  10. Computational Nanotechnology of Materials, Devices, and Machines: Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Srivastava, Deepak; Kwak, Dolhan (Technical Monitor)

    2000-01-01

    The mechanics and chemistry of carbon nanotubes have relevance for their numerous electronic applications. Mechanical deformations such as bending and twisting affect the nanotube's conductive properties, and at the same time they possess high strength and elasticity. Two principal techniques were utilized including the analysis of large scale classical molecular dynamics on a shared memory architecture machine and a quantum molecular dynamics methodology. In carbon based electronics, nanotubes are used as molecular wires with topological defects which are mediated through various means. Nanotubes can be connected to form junctions.

  11. Experimental investigation of hydrodynamics and heat exchange in the ring channel with heat exchangers in the modes of single-phase convection and bubble boiling

    NASA Astrophysics Data System (ADS)

    Agishev, B. Y.; Boltenko, E. A.; Varava, A. N.; Dedov, A. V.; Zakharenkov, A. V.; Komov, A. T.; Smorchova, Y. V.

    2018-03-01

    The effectiveness of the heat exchange intensifier “rib-twisted wire” is considered in this paper. The main goal is to study the influence of the wire coiling step t on heat transfer and hydraulic resistance for different values Ḣ of the dimensionless height of the edge Ḣ, as well as some results on heat exchange during bubbly boiling in an annular channel. Show: • a brief description and an image of the heat exchange intensifier “rib-twisted wire” • generalized results of studies of heat exchange and hydraulic resistance in the annular channel in the single-phase convection with different geometric characteristics of the intensifier; • empirical correlations of the generalized experimental results that allow to calculating the coefficient of hydraulic resistance and heat transfer in the range of regime parameters in the single-phase convection that is being studied. • some results of experiments in bubbly boiling regimes and near-critical thermal loads.

  12. Page turning system

    NASA Technical Reports Server (NTRS)

    Kerley, James J. (Inventor); Eklund, Wayne D. (Inventor)

    1992-01-01

    A device for holding reading materials for use by readers without arm mobility is presented. The device is adapted to hold the reading materials in position for reading with the pages displayed to enable turning by use of a rubber tipped stick that is held in the mouth and has a pair of rectangular frames. The frames are for holding and positioning the reading materials opened in reading posture with the pages displayed at a substantially unobstructed sighting position for reading. The pair of rectangular frames are connected to one another by a hinge so the angle between the frames may be varied thereby varying the inclination of the reading material. A pair of bent spring mounted wires for holding opposing pages of the reading material open for reading without substantial visual interference of the pages is mounted to the base. The wires are also adjustable to the thickness of the reading material and have a variable friction adjustment. This enables the force of the wires against the pages to be varied and permits the reader to manipulate the pages with the stick.

  13. Textile inspired flexible metamaterial with negative refractive index

    NASA Astrophysics Data System (ADS)

    Burgnies, L.; Lheurette, É.; Lippens, D.

    2015-04-01

    This work introduces metallo-dielectric woven fabric as a metamaterial for phase-front manipulation. Dispersion diagram as well as effective medium parameters retrieved from reflection and transmission coefficients point out negative values of refractive index. By numerical simulations, it is evidenced that a pair of meandered metallic wires, arranged in a top to bottom configuration, can yield to a textile metamaterial with simultaneously negative permittivity and permeability. While the effective negative permittivity stems from the metallic grid arrangement, resonating current loop resulting from the top to bottom configuration of two meandered metallic wires in near proximity produces magnetic activity with negative permeability. By adjusting the distance between pairs of metallic wires, the electric plasma frequency can be shifted to overlap the magnetic resonance. Finally, it is shown that the woven metamaterial is insensitive to the incident angle up to around 60°.

  14. Electromagnetic connector

    NASA Technical Reports Server (NTRS)

    Gardner, W. C.

    1973-01-01

    Connector pair consists of two iron cores brought together a short distance from each other. Each core is wound with insulated wire. Ac signal is connected through the pair across the gap by magnetic induction. Device can be used underwater or in flammable atmosphere.

  15. Memory alloy heat engine and method of operation

    DOEpatents

    Johnson, Alfred Davis

    1977-01-01

    A heat engine and method of operation employing an alloy having a shape memory effect. A memory alloy element such as one or more wire loops are cyclically moved through a heat source, along a path toward a heat sink, through the heat sink and then along another path in counter-flow heat exchange relationship with the wire in the first path. The portion of the wire along the first path is caused to elongate to its trained length under minimum tension as it is cooled. The portion of the wire along the second path is caused to contract under maximum tension as it is heated. The resultant tension differential between the wires in the two paths is applied as a force through a distance to produce mechanical work. In one embodiment a first set of endless memory alloy wires are reeved in non-slip engagement between a pair of pulleys which are mounted for conjoint rotation within respective hot and cold reservoirs. Another set of endless memory alloy wires are reeved in non-slip engagement about another pair of pulleys which are mounted in the respective hot and cold reservoirs. The pulleys in the cold reservoir are of a larger diameter than those in the hot reservoir and the opposite reaches of the wires between the two sets of pulleys extend in closely spaced-apart relationship in counter-flow heat regenerator zones. The pulleys are turned to move the two sets of wires in opposite directions. The wires are stretched as they are cooled upon movement through the heat regenerator toward the cold reservoirs, and the wires contract as they are heated upon movement through the regenerator zones toward the hot reservoir. This contraction of wires exerts a larger torque on the greater diameter pulleys for turning the pulleys and supplying mechanical power. Means is provided for applying a variable tension to the wires. Phase change means is provided for controlling the angular phase of the pulleys of each set for purposes of start up procedure as well as for optimizing engine operation under varying conditions of load, speed and temperatures.

  16. Far infrared polarizing grids for use at cryogenic temperatures

    NASA Technical Reports Server (NTRS)

    Novak, Giles; Sundwall, Jeffrey L.; Pernic, Robert J.

    1989-01-01

    A technique is proposed for the construction of free-standing wire grids for use as far-IR polarizers. The method involves wrapping a strand of wire around a single cylinder rather than around a pair of parallel rods, thus simplifying the problem of maintaining constant wire tension. The cylinder is composed of three separate pieces which are disassembled at a later stage in the grid-making process. Grids have been constructed using 8-micron-diameter stainless steel wire and a grid spacing of 25 microns. The grids are shown to be reliable under repeated cycling between room temperature and 1.5 K.

  17. Implications of the dependence of the elastic properties of DNA on nucleotide sequence.

    PubMed

    Olson, Wilma K; Swigon, David; Coleman, Bernard D

    2004-07-15

    Recent advances in structural biochemistry have provided evidence that not only the geometric properties but also the elastic moduli of duplex DNA are strongly dependent on nucleotide sequence in a way that is not accounted for by classical rod models of the Kirchhoff type. A theory of sequence-dependent DNA elasticity is employed here to calculate the dependence of the equilibrium configurations of circular DNA on the binding of ligands that can induce changes in intrinsic twist at a single base-pair step. Calculations are presented of the influence on configurations of the assumed values and distribution along the DNA of intrinsic roll and twist and a modulus coupling roll to twist. Among the results obtained are the following. For minicircles formed from intrinsically straight DNA, the distribution of roll-twist coupling strongly affects the dependence of the total elastic energy Psi on the amount alpha of imposed untwisting, and that dependence can be far from quadratic. (In fact, for a periodic distribution of roll-twist coupling with a period equal to the intrinsic helical repeat length, Psi can be essentially independent of alpha for -90 degrees < alpha <90 degrees.) When the minicircle is homogeneous and without roll-twist coupling, but with uniform positive intrinsic roll, the point at which Psi attains its minimum value shifts towards negative values of alpha. It is remarked that there are cases in which one can relate graphs of Psi versus alpha to the 'effective values' of bending and twisting moduli and helical repeat length obtained from measurements of equilibrium distributions of topoisomers and probabilities of ring closure. For a minicircle formed from DNA that has an 'S' shape when stress-free, the graphs of Psi versus alpha have maxima at alpha = 0. As the binding of a twisting agent to such a minicircle results in a net decrease in Psi, the affinity of the twisting agent for binding to the minicircle is greater than its affinity for binding to unconstrained DNA with the same sequence.

  18. A wire-based dual-analyte sensor for glucose and lactate: in vitro and in vivo evaluation.

    PubMed

    Ward, W Kenneth; House, Jody L; Birck, Jonathan; Anderson, Ellen M; Jansen, Lawrence B

    2004-06-01

    Continuous measurement of lactate is potentially useful for detecting physical exhaustion and for monitoring critical care conditions characterized by hypoperfusion, such as heart failure. In some conditions, it may be desirable to monitor more than one metabolic parameter concurrently. For this reason, we designed and fabricated twisted wire-based microelectrodes that can measure both lactate and glucose. These dual-analyte sensors were characterized in vitro by measuring their response to the analyte of interest and to assess whether they were susceptible to interference from the other analyte. When measured in stirred aqueous buffer, lactate sensors detected a very small amount of crosstalk from glucose in vitro, although this signal was less than 3% of the response to lactate. Glucose sensors did not detect crosstalk from lactate. Sensors were implanted subcutaneously in rats and tested during infusions of lactate and glucose. Each sensing electrode responded rapidly to changes in its analyte concentration, and there was no evidence of in vivo crosstalk. This study constitutes proof of the concept that oxidase-based, amperometric wire microsensors can detect changes in glucose and lactate during subcutaneous implantation in rats.

  19. Thickness-shear and thickness-twist modes in an AT-cut quartz acoustic wave filter.

    PubMed

    Zhao, Zinan; Qian, Zhenghua; Wang, Bin; Yang, Jiashi

    2015-04-01

    We studied thickness-shear and thickness-twist vibrations of a monolithic, two-pole crystal filter made from a plate of AT-cut quartz. The scalar differential equations derived by Tiersten and Smythe for electroded and unelectroded quartz plates were employed which are valid for both the fundamental and the overtone modes. Exact solutions for the free vibration resonant frequencies and modes were obtained from the equations. For a structurally symmetric filter, the modes can be separated into symmetric and antisymmetric ones. Trapped modes with vibrations mainly under the electrodes were found. The effect of the distance between the two pairs of electrodes was examined. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Di-hadron production at Jefferson Laboratory

    NASA Astrophysics Data System (ADS)

    Anefalos Pereira, Sergio; CLAS Collaboration

    2015-04-01

    Semi-inclusive deep inelastic scattering (SIDIS) has been used extensively in recent years as an important testing ground for QCD. Studies so far have concentrated on better determination of parton distribution functions, distinguishing between the quark and antiquark contributions, and understanding the fragmentation of quarks into hadrons. Pair of hadrons (di-hadron) SIDIS provides information on the nucleon structure and hadronization dynamics that complements single-hadron SIDIS. The study of di-hadrons allow us to study higher twist distribution functions and Dihadron Fragmentation Functions (DiFF). Together with the twist-2 PDFs (f 1, g 1, h 1), the Higher Twist (HT) e and hL functions are very interesting because they offer insights into the physics of the largely unexplored quark-gluon correlations which provide direct and unique insights into the dynamics inside hadrons. The CLAS spectrometer, installed in Hall-B at Jefferson Lab, has collected data using the CEBAF 6 GeV longitudinally polarized electron beam on longitudinally polarized solid NH3 targets. Preliminary results on beam-, target- and double-spin asymmetries will be presented.

  1. Electrolytic Migration of Ag-Pd Alloy Wires with Various Pd Contents

    NASA Astrophysics Data System (ADS)

    Lin, Yan-Cheng; Chen, Chun-Hao; He, Yu-Zhen; Chen, Sheng-Chi; Chuang, Tung-Han

    2018-07-01

    During Ag ion migration in an aqueous water drop covering a pair of parallel Ag-Pd wires under current stressing, hydrogen bubbles form first from the cathode, followed by the appearance of pure Ag dendrites on the cathodic wire. In this study, Ag dendrites with a diameter of 0.2-0.4 μm grew toward the anodic wire. The growth rate ( v) of these dendrites decreased with the Pd content ( c) with a linear relationship of: v = 10.02 - 0.43 c . Accompanying the growth of pure Ag dendrites was the formation of a continuous layer of crystallographic Ag2O particles on the surface of the anodic wire. The deposition of such insulating Ag2O products did not prevent the contact of Ag dendrites with the anodic Ag-Pd wire or the short circuit of the wire couple.

  2. Electrolytic Migration of Ag-Pd Alloy Wires with Various Pd Contents

    NASA Astrophysics Data System (ADS)

    Lin, Yan-Cheng; Chen, Chun-Hao; He, Yu-Zhen; Chen, Sheng-Chi; Chuang, Tung-Han

    2018-03-01

    During Ag ion migration in an aqueous water drop covering a pair of parallel Ag-Pd wires under current stressing, hydrogen bubbles form first from the cathode, followed by the appearance of pure Ag dendrites on the cathodic wire. In this study, Ag dendrites with a diameter of 0.2-0.4 μm grew toward the anodic wire. The growth rate (v) of these dendrites decreased with the Pd content (c) with a linear relationship of: v = 10.02 - 0.43 c . Accompanying the growth of pure Ag dendrites was the formation of a continuous layer of crystallographic Ag2O particles on the surface of the anodic wire. The deposition of such insulating Ag2O products did not prevent the contact of Ag dendrites with the anodic Ag-Pd wire or the short circuit of the wire couple.

  3. Evaluation of a 6-wire thermocouple psychrometer for determination of in-situ water potentials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loskot, C.L.; Rousseau, J.P.; Kurzmack, M.A.

    1994-12-31

    A 6-wire, Peltier-type thermocouple psychrometer was designed and evaluated by the U.S. Geological Survey for monitoring in-situ water potentials in dry-drilled boreholes in the unsaturated zone at Yucca Mountain, Nye County, Nevada. The psychrometer consists of a wet-bulb, chromel-constantan, sensing junction and a separate dry-bulb, copper-constantan, reference junction. Two additional reference junctions are formed where the chromel and constantan wires of the wet-bulb sensing junction are soldered to separate, paired, copper, lead wires. In contrast, in the standard 3-wire thermocouple psychrometer, both the wet bulb and dry bulb share a common wire. The new design has resulted in a psychrometermore » that has an expanded range and greater reliability, sensitivity, and accuracy compared to the standard model.« less

  4. Unconventional superconductivity in magic-angle graphene superlattices.

    PubMed

    Cao, Yuan; Fatemi, Valla; Fang, Shiang; Watanabe, Kenji; Taniguchi, Takashi; Kaxiras, Efthimios; Jarillo-Herrero, Pablo

    2018-04-05

    The behaviour of strongly correlated materials, and in particular unconventional superconductors, has been studied extensively for decades, but is still not well understood. This lack of theoretical understanding has motivated the development of experimental techniques for studying such behaviour, such as using ultracold atom lattices to simulate quantum materials. Here we report the realization of intrinsic unconventional superconductivity-which cannot be explained by weak electron-phonon interactions-in a two-dimensional superlattice created by stacking two sheets of graphene that are twisted relative to each other by a small angle. For twist angles of about 1.1°-the first 'magic' angle-the electronic band structure of this 'twisted bilayer graphene' exhibits flat bands near zero Fermi energy, resulting in correlated insulating states at half-filling. Upon electrostatic doping of the material away from these correlated insulating states, we observe tunable zero-resistance states with a critical temperature of up to 1.7 kelvin. The temperature-carrier-density phase diagram of twisted bilayer graphene is similar to that of copper oxides (or cuprates), and includes dome-shaped regions that correspond to superconductivity. Moreover, quantum oscillations in the longitudinal resistance of the material indicate the presence of small Fermi surfaces near the correlated insulating states, in analogy with underdoped cuprates. The relatively high superconducting critical temperature of twisted bilayer graphene, given such a small Fermi surface (which corresponds to a carrier density of about 10 11 per square centimetre), puts it among the superconductors with the strongest pairing strength between electrons. Twisted bilayer graphene is a precisely tunable, purely carbon-based, two-dimensional superconductor. It is therefore an ideal material for investigations of strongly correlated phenomena, which could lead to insights into the physics of high-critical-temperature superconductors and quantum spin liquids.

  5. Unconventional superconductivity in magic-angle graphene superlattices

    NASA Astrophysics Data System (ADS)

    Cao, Yuan; Fatemi, Valla; Fang, Shiang; Watanabe, Kenji; Taniguchi, Takashi; Kaxiras, Efthimios; Jarillo-Herrero, Pablo

    2018-04-01

    The behaviour of strongly correlated materials, and in particular unconventional superconductors, has been studied extensively for decades, but is still not well understood. This lack of theoretical understanding has motivated the development of experimental techniques for studying such behaviour, such as using ultracold atom lattices to simulate quantum materials. Here we report the realization of intrinsic unconventional superconductivity—which cannot be explained by weak electron–phonon interactions—in a two-dimensional superlattice created by stacking two sheets of graphene that are twisted relative to each other by a small angle. For twist angles of about 1.1°—the first ‘magic’ angle—the electronic band structure of this ‘twisted bilayer graphene’ exhibits flat bands near zero Fermi energy, resulting in correlated insulating states at half-filling. Upon electrostatic doping of the material away from these correlated insulating states, we observe tunable zero-resistance states with a critical temperature of up to 1.7 kelvin. The temperature–carrier-density phase diagram of twisted bilayer graphene is similar to that of copper oxides (or cuprates), and includes dome-shaped regions that correspond to superconductivity. Moreover, quantum oscillations in the longitudinal resistance of the material indicate the presence of small Fermi surfaces near the correlated insulating states, in analogy with underdoped cuprates. The relatively high superconducting critical temperature of twisted bilayer graphene, given such a small Fermi surface (which corresponds to a carrier density of about 1011 per square centimetre), puts it among the superconductors with the strongest pairing strength between electrons. Twisted bilayer graphene is a precisely tunable, purely carbon-based, two-dimensional superconductor. It is therefore an ideal material for investigations of strongly correlated phenomena, which could lead to insights into the physics of high-critical-temperature superconductors and quantum spin liquids.

  6. Proposal for massively parallel data storage system

    NASA Technical Reports Server (NTRS)

    Mansuripur, M.

    1992-01-01

    An architecture for integrating large numbers of data storage units (drives) to form a distributed mass storage system is proposed. The network of interconnected units consists of nodes and links. At each node there resides a controller board, a data storage unit and, possibly, a local/remote user-terminal. The links (twisted-pair wires, coax cables, or fiber-optic channels) provide the communications backbone of the network. There is no central controller for the system as a whole; all decisions regarding allocation of resources, routing of messages and data-blocks, creation and distribution of redundant data-blocks throughout the system (for protection against possible failures), frequency of backup operations, etc., are made locally at individual nodes. The system can handle as many user-terminals as there are nodes in the network. Various users compete for resources by sending their requests to the local controller-board and receiving allocations of time and storage space. In principle, each user can have access to the entire system, and all drives can be running in parallel to service the requests for one or more users. The system is expandable up to a maximum number of nodes, determined by the number of routing-buffers built into the controller boards. Additional drives, controller-boards, user-terminals, and links can be simply plugged into an existing system in order to expand its capacity.

  7. Percutaneous direct mitral annuloplasty using the Mitralign Bident system: description of the method and a case report.

    PubMed

    Siminiak, Tomasz; Dankowski, Rafał; Baszko, Artur; Lee, Christopher; Firek, Ludwik; Kałmucki, Piotr; Szyszka, Andrzej; Groothuis, Adam

    2013-01-01

    Functional mitral regurgitation (FMR) is known to contribute to a poor prognosis in patients with heart failure (HF). Current guidelines do not recommend cardiac surgery in patients with FMR and impaired ejection fraction due to the high procedural risk. Percutaneous techniques aimed at mitral valve repair may constitute an alternative to currently used routine medical treatment. To provide a description of a novel percutaneous suture-based technique of direct mitral annuloplasty using the Mitralign Bident system, as well as report our first case successfully treated with this method. A deflectable guiding catheter is advanced via the femoral route across the aortic valve to the posterior wall of the ventricle. A nested deflectable catheter is advanced through the guide toward the mitral annulus that allows the advancement of an insulated radiofrequency wire to cross the annulus. The wire is directed across the annulus in a target area that is 2-5 mm from the base of the leaflet into the annulus, as assessed by real-time 3D transoesophageal echocardiography. After placement of the first wire, another wire is positioned using a duel lumen bident delivery catheter, which provides a predetermined separation between wires (i.e. 14, 17 or 21 mm). Each wire provides a guide rail for implantation of sutured pledget implants within the annulus. Two pairs of pledgets are implanted, one pair in each of the P1 and P3 scallop regions of the posterior mitral annulus. A dedicated plication lock device is used to provide a means for plication of the annulus within each pair of the pledgets, and to retain the plication by delivering a suture locking implant. The plications result in improved leaflet coaptation and a reduction of the regurgitant orifice area. A 60-year-old female with diagnosed dilated cardiomyopathy, concomitant FMR class III and congestive HF was successfully treated with the Mitralign Bident system. Two pairs of pledgets were implanted resulting in an improvement of transoesophageal echocardiographic parameters, including proximal isovelocity surface area radius (0.7 cm to 0.4 cm), effective regurgitant orfice area (0.3 cm² to 0.1 cm²) and mitral regurgitant volume (49 mL to 10 mL). Percutaneous mitral annuloplasty with the Mitralign Bident system is feasible. Future clinical trials are needed to assess its safety and efficacy.

  8. 4-twist helix snake to maintain polarization in multi-GeV proton rings

    DOE PAGES

    Antoulinakis, F.; Chen, Y.; Dutton, A.; ...

    2017-09-27

    Solenoid Siberian snakes have successfully maintained polarization in particle rings below 1 GeV, but never in multi-GeV rings, because the spin rotation by a solenoid is inversely proportional to the beam momentum. High energy rings, such as Brookhaven’s 255 GeV Relativistic Heavy Ion Collider (RHIC), use only odd multiples of pairs of transverse B-field Siberian snakes directly opposite each other. When it became impractical to use a pair of Siberian Snakes in Fermilab’s 120 GeV/c Main Injector, we searched for a new type of single Siberian snake that could overcome all depolarizing resonances in the 8.9–120 GeV/c range. We foundmore » that a snake made of one 4-twist helix and 2 dipoles could maintain the polarization. Here, this snake design could solve the long-standing problem of significant polarization loss during acceleration of polarized protons from a few GeV to tens of GeV, such as in the AGS, before injecting them into multi-hundred GeV rings, such as RHIC.« less

  9. 4-twist helix snake to maintain polarization in multi-GeV proton rings

    NASA Astrophysics Data System (ADS)

    Antoulinakis, F.; Chen, Y.; Dutton, A.; Rossi De La Fuente, E.; Haupert, S.; Ljungman, E. A.; Myers, P. D.; Thompson, J. K.; Tai, A.; Aidala, C. A.; Courant, E. D.; Krisch, A. D.; Leonova, M. A.; Lorenzon, W.; Raymond, R. S.; Sivers, D. W.; Wong, V. K.; Yang, T.; Derbenev, Y. S.; Morozov, V. S.; Kondratenko, A. M.

    2017-09-01

    Solenoid Siberian snakes have successfully maintained polarization in particle rings below 1 GeV, but never in multi-GeV rings, because the spin rotation by a solenoid is inversely proportional to the beam momentum. High energy rings, such as Brookhaven's 255 GeV Relativistic Heavy Ion Collider (RHIC), use only odd multiples of pairs of transverse B-field Siberian snakes directly opposite each other. When it became impractical to use a pair of Siberian Snakes in Fermilab's 120 GeV /c Main Injector, we searched for a new type of single Siberian snake that could overcome all depolarizing resonances in the 8.9 - 120 GeV /c range. We found that a snake made of one 4-twist helix and 2 dipoles could maintain the polarization. This snake design could solve the long-standing problem of significant polarization loss during acceleration of polarized protons from a few GeV to tens of GeV, such as in the AGS, before injecting them into multi-hundred GeV rings, such as RHIC.

  10. 4-twist helix snake to maintain polarization in multi-GeV proton rings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Antoulinakis, F.; Chen, Y.; Dutton, A.

    Solenoid Siberian snakes have successfully maintained polarization in particle rings below 1 GeV, but never in multi-GeV rings, because the spin rotation by a solenoid is inversely proportional to the beam momentum. High energy rings, such as Brookhaven’s 255 GeV Relativistic Heavy Ion Collider (RHIC), use only odd multiples of pairs of transverse B-field Siberian snakes directly opposite each other. When it became impractical to use a pair of Siberian Snakes in Fermilab’s 120 GeV/c Main Injector, we searched for a new type of single Siberian snake that could overcome all depolarizing resonances in the 8.9–120 GeV/c range. We foundmore » that a snake made of one 4-twist helix and 2 dipoles could maintain the polarization. Here, this snake design could solve the long-standing problem of significant polarization loss during acceleration of polarized protons from a few GeV to tens of GeV, such as in the AGS, before injecting them into multi-hundred GeV rings, such as RHIC.« less

  11. Method of making a catalytic reactor for automobile

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vroman, W.R.

    1976-09-07

    A catalytic reactor is made by providing a generally cylindrical catalytic substrate of oval transverse section and clamping the same between paired housing shells to form a housing of oval section spaced from the substrate by means of a pair of wire mesh ropes seated within a corresponding pair of grooves extending around the periphery of the substrate at axially spaced locations. Each rope is compacted from a matrix of multiple layers of resilient stainless steel knitted wire and is interlocked with the housing by means of a pair of inwardly opening channels of the housing spaced axially by anmore » inwardly projecting rib of the housing. The grooves in the substrate are pressed radially into the latter while the same is in a plastic uncured condition, thereby to compact and reinforce the grooves to withstand the localized compressional force of the ropes seated therein after the substrate is cured and hardened and clamped between the housing shells.« less

  12. A Study of Dean Vortex Development and Structure in a Curved Rectangular Channel with Aspect Ratio of 40 at Dean Numbers up to 430

    NASA Technical Reports Server (NTRS)

    Ligrani, Phillip M.

    1994-01-01

    Flow in a curved channel with mild curvature, an aspect ratio of 40 to 1, and an inner to outer radius ratio of 0.979 is studied at Dean numbers De ranging from 35 to 430. For positions from the start of curvature ranging from 85 to 145 degrees, the sequence of transition events begins with curved channel Poiseuille flow at De less than 40-64. As the Dean number increases, observations show initial development of Dean vortex pairs, followed by symmetric vortex pairs which, when viewed in spanwise/radial planes, cover the entire channel height (De=90-100). At De from 40 to 125-130, the vortex pairs often develop intermittent waviness in the form of vortex undulations. Splitting and merging of vortex pairs is also observed over the same experimental conditions as well as at higher De. When Dean numbers range from 130 to 185-200, the undulating wavy mode is replaced by a twisting mode with higher amplitudes of oscillation and shorter wavelengths. The twisting wavy mode results in the development of regions where turbulence intensity is locally augmented at Dean numbers from 150 to 185-200, principally in the upwash regions between the two individual vortices which make up each vortex pair. These turbulent regions eventually increase in intensity and spatial extent as the Dean number increases further, until individual regions merge together so that the entire cross section of the channel contains chaotic turbulent motions. When Dean numbers then reach 400-435, spectra of velocity fluctuations then evidence fully turbulent flow.

  13. Report on twisted nematic and supertwisted nematic device characterization program

    NASA Technical Reports Server (NTRS)

    1995-01-01

    In this study we measured the optical characteristics of normally white twisted nematic (NWTN) and super twisted nematic (STN ) cells. Though no dynamic computer model was available, the static observations were compared with computer simulated behavior. The measurements were taken as a function of both viewing angle and applied voltage and included in the static case not only luminance but also contrast ratio and chromaticity . We employed the computer model Twist Cell Optics, developed at Kent State in conjunction with this study, and whose optical modeling foundation, Iike the ViDEOS program, is the 4 x 4 matrix method of Berreman. In order to resolve discrepancies between the experimental and modeled data the optical parameters of the individual cell components, where not known, were determined using refractometry, profilometry, and various forms of ellipsometry. The resulting agreement between experiment and model is quite good due primarily to a better understanding of the structure and optics of dichroic sheet polarizers. A description of the model and test cells employed are given in section 2. Section 3 contains the experimental data gathered and section 4 gives examples of the fit between model and experiment. Also included with this report are a pair of papers which resulted from the research and which detail the polarizer properties and some of the cell characterization methods.

  14. Comparison of three different orthodontic wires for bonded lingual retainer fabrication

    PubMed Central

    Uysal, Tancan; Gul, Nisa; Alan, Melike Busra; Ramoglu, Sabri Ilhan

    2012-01-01

    Objective We evaluated the detachment force, amount of deformation, fracture mode, and pull-out force of 3 different wires used for bonded lingual retainer fabrication. Methods We tested 0.0215-inch five-stranded wire (PentaOne, Masel; group I), 0.016 × 0.022-inch dead-soft eight-braided wire (Bond-A-Braid, Reliance; group II), and 0.0195-inch dead-soft coaxial wire (Respond, Ormco; group III). To test detachment force, deformation, and fracture mode, we embedded 94 lower incisor teeth in acrylic blocks in pairs. Retainer wires were bonded to the teeth and vertically directed force was applied to the wire. To test pull-out force, wires were embedded in composite that was placed in a hole at the center of an acrylic block. Tensile force was applied along the long axis of the wire. Results Detachment force and mode of fracture were not different between groups. Deformation was significantly higher in groups II and III than in group I (p < 0.001). Mean pull-out force was significantly higher for group I compared to groups II and III (p < 0.001). Conclusions Detachment force and fracture mode were similar for all wires, but greater deformations were seen in dead-soft wires. Wire pull-out force was significantly higher for five-stranded coaxial wire than for the other wires tested. Five-stranded coaxial wires are suggested for use in bonded lingual retainers. PMID:23112930

  15. [Extramedullary fixation combined with intramedullary fixation in the surgical reduction of sagittal mandibular condylar fractures].

    PubMed

    Chuanjun, Chen; Xiaoyang, Chen; Jing, Chen

    2016-10-01

    This study aimed to evaluate the clinical effect of extramedullary fixation combined with intramedullary fixation during the surgical reduction of sagittal mandibular condylar fractures. Twenty-four sagittal fractures of the mandibular condyle in18 patients were fixed by two appliances: intramedullary with one long-screw osteosynthesis or Kirschner wire and extramedullary with one micro-plate. The radiologically-recorded post-operative stability-associated com-plications included the screw/micro-plate loosening, micro-plate twisting, micro-plate fractures, and fragment rotation. The occluding relations, the maximalinter-incisal distances upon mouth opening, and the mandibular deflection upon mouth opening were evaluated based on follow-up clinical examination. Postoperative panoramic X-ray and CT scans showed good repositioning of the fragment, with no redislocation or rotation, no screw/plate loosening, and no plate-twisting or fracture. Clinical examination showed that all patients regained normal mandibular movements, ideal occlusion, and normal maximal inter-incisal distances upon mouth opening. Extramedullary fixation combined with intramedullary fixation is highly recommended for sagittal condylar fractures because of the anti-rotation effect of the fragment and the reasonable place-ment of the fixation appliances.

  16. Smart wing wind tunnel test results

    NASA Astrophysics Data System (ADS)

    Scherer, Lewis B.; Martin, Christopher A.; Appa, Kari; Kudva, Jayanth N.; West, Mark N.

    1997-05-01

    The use of smart materials technologies can provide unique capabilities in improving aircraft aerodynamic performance. Northrop Grumman built and tested a 16% scale semi-span wind tunnel model of the F/A-18 E/F for the on-going DARPA/WL Smart Materials and Structures-Smart Wing Program. Aerodynamic performance gains to be validated included increase in the lift to drag ratio, increased pitching moment (Cm), increased rolling moment (Cl) and improved pressure distribution. These performance gains were obtained using hingeless, contoured trailing edge control surfaces with embedded shape memory alloy (SMA) wires and spanwise wing twist via a SMA torque tube and are compared to a conventional wind tunnel model with hinged control surfaces. This paper presents an overview of the results from the first wind tunnel test performed at the NASA Langley's 16 ft Transonic Dynamic Tunnel. Among the benefits demonstrated are 8 - 12% increase in rolling moment due to wing twist, a 10 - 15% increase in rolling moment due to contoured aileron, and approximately 8% increase in lift due to contoured flap, and improved pressure distribution due to trailing edge control surface contouring.

  17. Linear and nonlinear evolution of azimuthal clumping instabilities in a Z-pinch wire array

    DOE PAGES

    Tang, Wilkin; Strickler, T. S.; Lau, Y. Y.; ...

    2007-01-31

    This study presents an analytic theory on the linear and nonlinear evolution of the most unstable azimuthal clumping mode, known as the pi-mode, in a discrete wire array. In the pi-mode, neighboring wires of the array pair-up as a result of the mutual attraction of the wires which carry current in the same direction. The analytic solution displays two regimes, where the collective interactions of all wires dominate, versus where the interaction of the neighboring, single wire dominates. This solution was corroborated by two vastly different numerical codes which were used to simulate arrays with both high wire numbers (upmore » to 600) and low wire number (8). All solutions show that azimuthal clumping of discrete wires occurs before appreciable radial motion of the wires. Thus, absence of azimuthal clumping of wires in comparison with the wires’ radial motion may imply substantial lack of wire currents. Finally, while the present theory and simulations have ignored the plasma corona and axial variations, it is argued that their effects, and the complete account of the three-dimensional feature of the pi-mode, together with a scaling study of the wire number, may be expediently simulated by using only one single wire in an annular wedge with a reflection condition imposed on the wedge’s boundary.« less

  18. Transfer impedances of balanced shielded cables

    NASA Astrophysics Data System (ADS)

    Hardiguian, M.

    1982-07-01

    The transfer impedance concept is extended to balanced shielded cables, e.g., shielded pairs and twinax in which the actual voltage developed at the load, between the two wires of a pair is emphasized. This parameter can be computed by a separate knowledge of the shield, and the shield-to-pair coupling (i.e., the pair unbalance ratio). Thus, a unique parameter called shield coupling evolves which relates directly the shield current to the differential output voltage. Conditions of cable pair and harness shielding and the impact of grounding at one or both ends are discussed.

  19. Oblique abdominal muscle activity in response to external perturbations when pushing a cart.

    PubMed

    Lee, Yun-Ju; Hoozemans, Marco J M; van Dieën, Jaap H

    2010-05-07

    Cyclic activation of the external and internal oblique muscles contributes to twisting moments during normal gait. During pushing while walking, it is not well understood how these muscles respond to presence of predictable (cyclic push-off forces) and unpredictable (external) perturbations that occur in pushing tasks. We hypothesized that the predictable perturbations due to the cyclic push-off forces would be associated with cyclic muscle activity, while external perturbations would be counteracted by cocontraction of the oblique abdominal muscles. Eight healthy male subjects pushed at two target forces and two handle heights in a static condition and while walking without and with external perturbations. For all pushing tasks, the median, the static (10th percentile) and the peak levels (90th percentile) of the electromyographic amplitudes were determined. Linear models with oblique abdominal EMGs and trunk angles as input were fit to the twisting moments, to estimate trunk stiffness. There was no significant difference between the static EMG levels in pushing while walking compared to the peak levels in pushing while standing. When pushing while walking, the additional dynamic activity was associated with the twisting moments, which were actively modulated by the pairs of oblique muscles as in normal gait. The median and static levels of trunk muscle activity and estimated trunk stiffness were significantly higher when perturbations occurred than without perturbations. The increase baseline of muscle activity indicated cocontraction of the antagonistic muscle pairs. Furthermore, this cocontraction resulted in an increased trunk stiffness around the longitudinal axis. Copyright 2010 Elsevier Ltd. All rights reserved.

  20. Annihilation of Domain Walls in a Ferromagnetic Wire

    NASA Astrophysics Data System (ADS)

    Ghosh, Anirban; Huang, Kevin; Tchernyshyov, Oleg

    We study the annihilation of topological solitons in one of the simplest systems that support them: a one-dimensional ferromagnetic wire with an easy axis along its length. In the presence of energy dissipation due to viscous losses, two solitons (domain walls) on the wire, when released from afar, approach each other and eventually annihilate to create a uniformly magnetized state. Starting from a class of exact solutions for stationary two-domain-wall configurations in the absence of dissipation, we develop an effective theory that describes this annihilation in terms of four collective coordinates: a) the two zero modes corresponding to the location of the center and the average azimuthal angle of the full structure and b) their two conjugate momenta which describe the relative twist and the relative separation of the two domain walls respectively. Comparison with micromagnetic simulation on OOOMF confirms that this theory captures well the essential physics of the process. We believe this work will be a good starting point for studying the annihilation of more complicated topological solitons like vortices and skyrmions in ferromagnetic thin films. This work is supported by the U.S. Department of Energy, Office of Basic Energy Sciences, Division of Materials Sciences and Engineering under Award DE-FG02-08ER46544.

  1. Di-hadron production at Jefferson Lab

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anefalos Pereira, Sergio; et. al.,

    Semi-inclusive deep inelastic scattering (SIDIS) has been used extensively in recent years as an important testing ground for QCD. Studies so far have concentrated on better determination of parton distribution functions, distinguishing between the quark and antiquark contributions, and understanding the fragmentation of quarks into hadrons. Hadron pair (di-hadron) SIDIS provides information on the nucleon structure and hadronization dynamics that complement single hadron SIDIS. Di-hadrons allow the study of low- and high-twist distribution functions and Dihadron Fragmentation Functions (DiFF). Together with the twist-2 PDFs ( f1, g1, h1), the Higher Twist (HT) e and hL functions are very interesting becausemore » they offer insights into the physics of the largely unexplored quark-gluon correlations, which provide access into the dynamics inside hadrons. The CLAS spectrometer, installed in Hall-B at Jefferson Lab, has collected data using the CEBAF 6 GeV longitudinally polarized electron beam on longitudinally polarized solid NH3 targets. Preliminary results on di-hadron beam-, target- and double-spin asymmetries will be presented.« less

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Cun; Aoun, Bachir; Cui, Lishan

    Microstructure evolution of a cold-drawn NiTi shape memory alloy wire was investigated by means of in-situ synchrotron high-energy X-ray diffraction during continuous heating. The cold-drawn wire contained amorphous regions and nano-crystalline domains in its microstructure. Pair distribution function analysis revealed that the amorphous regions underwent structural relaxation via atomic rearrangement when heated above 100 °C. The nano-crystalline domains were found to exhibit a strong cold work induced lattice strain anisotropy having a preferential <111> fiber orientation along the wire axial direction. The lattice strain anisotropy systematically decreased upon heating above 200 °C, implying a structural recovery. A broad conical texturemore » was formed in the wire specimen after crystallization similar in detail to the initial <111> texture axial orientation of the nano-crystalline domains produced by the severe cold wire drawing deformation.« less

  3. Biomechanical evaluation of fixation of intra-articular fractures of the distal part of the radius in cadavera: Kirschner wires compared with calcium-phosphate bone cement.

    PubMed

    Yetkinler, D N; Ladd, A L; Poser, R D; Constantz, B R; Carter, D

    1999-03-01

    The purpose of this study was to compare the biomechanical efficacy of an injectable calcium-phosphate bone cement (Skeletal Repair System [SRS]) with that of Kirschner wires for the fixation of intraarticular fractures of the distal part of the radius. Colles fractures (AO pattern, C2.1) were produced in ten pairs of fresh-frozen human cadaveric radii. One radius from each pair was randomly chosen for stabilization with SRS bone cement. These ten radii were treated with open incision, impaction of loose cancellous bone with use of a Freer elevator, and placement of the SRS bone cement by injection. In the ten control specimens, the fracture was stabilized with use of two horizontal and two oblique Kirschner wires. The specimens were cyclically loaded to a peak load of 200 newtons for 2000 cycles to evaluate the amount of settling, or radial shortening, under conditions simulating postoperative loading with the limb in a cast. Each specimen then was loaded to failure to determine its ultimate strength. The amount of radial shortening was highly variable among the specimens, but it was consistently higher in the Kirschner-wire constructs than in the bone fixed with SRS bone cement within each pair of radii. The range of shortening for all twenty specimens was 0.18 to 4.51 millimeters. The average amount of shortening in the SRS constructs was 50 percent of that in the Kirschner-wire constructs (0.51+/-0.34 compared with 1.01+/-1.23 millimeters; p = 0.015). With the numbers available, no significant difference in ultimate strength was detected between the two fixation groups. This study showed that fixation of an intra-articular fracture of the distal part of a cadaveric radius with biocompatible calcium-phosphate bone cement produced results that were biomechanically comparable with those produced by fixation with Kirschner wires. However, the constructs that were fixed with calcium-phosphate bone cement demonstrated less shortening under simulated cyclic load-bearing.

  4. Geometrical correlations in the nucleosomal DNA conformation and the role of the covalent bonds rigidity

    PubMed Central

    Ghorbani, Maryam; Mohammad-Rafiee, Farshid

    2011-01-01

    We develop a simple elastic model to study the conformation of DNA in the nucleosome core particle. In this model, the changes in the energy of the covalent bonds that connect the base pairs of each strand of the DNA double helix, as well as the lateral displacements and the rotation of adjacent base pairs are considered. We show that because of the rigidity of the covalent bonds in the sugar-phosphate backbones, the base pair parameters are highly correlated, especially, strong twist-roll-slide correlation in the conformation of the nucleosomal DNA is vividly observed in the calculated results. This simple model succeeds to account for the detailed features of the structure of the nucleosomal DNA, particularly, its more important base pair parameters, roll and slide, in good agreement with the experimental results. PMID:20972223

  5. Crystal structure of a four-stranded intercalated DNA: d(C4)

    NASA Technical Reports Server (NTRS)

    Chen, L.; Cai, L.; Zhang, X.; Rich, A.

    1994-01-01

    The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.

  6. High-resolution inchworm linear motor based on electrostatic twisting microactuators

    NASA Astrophysics Data System (ADS)

    Kim, Sang-Ho; Hwang, Il-Han; Jo, Kyoung-Woo; Yoon, Eui-Sung; Lee, Jong-Hyun

    2005-09-01

    A new inchworm micromotor using new electrostatic in-plane twisting microactuators has been designed, fabricated and characterized for nano-resolution manipulators. The proposed twisting mechanism was implemented employing a pair of differential electrostatic actuators with a high stiffness in the driving direction for stable positioning. The electromechanically coupled motion of the voltage-displacement relation was analyzed using a finite element method (FEM), confirming that the twisting actuator makes a tiny step movement efficiently. The proposed actuator was fabricated on a silicon-on-insulator (SOI) wafer with the device footprint of 2.2 × 2.8 mm2, and its nano-stepping characteristics were measured by an optical interferometer consisting of an integrated micromirror and optical fiber. The fabricated inchworm motor showed a minimum step displacement of 5.2 ± 3.8 nm (2σ) and 4.1 ± 2.9 nm (2σ) for cyclic motion in the +y- and the -y-directions, respectively, with the gripping voltage of 15 V and differential voltage of 1 V. As a result, the proposed inchworm micromotor could operate with a stroke of 3 µm and a bi-directional step displacement of less than 10 nm. The step displacement is the smallest value of in-plane-type micromotors so far, and its magnitude was controllable up to 120 nm/cycle by changing the differential voltage.

  7. Stability mechanical considerations, and AC loss in HTSC monoliths, coils, and wires

    NASA Technical Reports Server (NTRS)

    Sumption, M. D.; Collings, E. W.

    1995-01-01

    For monolithic high-T(sub c) superconductors (HTSC's) calculations are presented of: (1) the initial flux jump field, H(sub fj), in melt-processed YBCO based on a field and temperature dependent J(sub c), and (2) the radial and circumferential stresses in solid and hollow cylinders containing trapped magnetic flux. For model multi filamentary (MF) HTSC/Ag strands calculations are presented of: (1) the limiting filament diameters for adiabatic and dynamic stability, and (2) the hysteretic and eddy current components of AC loss. Again for MF HTSC/Ag composite strands the need for filamentary subdivision and twisting is discussed.

  8. Effect of electrical spot welding on load deflection rate of orthodontic wires.

    PubMed

    Alavi, Shiva; Abrishami, Arezoo

    2015-01-01

    One of the methods used for joining metals together is welding, which can be carried out using different techniques such as electric spot welding. This study evaluated the effect of electric spot welding on the load deflection rate of stainless steel and chromium-cobalt orthodontic wires. In this experimental-laboratory study, load deflection rate of 0.016 × 0.022 inch stainless steel and chromium cobalt wires were evaluated in five groups (n =18): group one: Stainless steel wires, group two: chromium-cobalt wires, group three: stainless steel wires welded to stainless steel wires, group four: Stainless steel wires welded to chromium-cobalt wires, group five: chromium-cobalt wire welded to chromium-cobalt wires. Afterward, the forces induced by the samples in 0.5 mm, 1 mm, 1.5 mm deflection were measured using a universal testing machine. Then mean force measured for each group was compared with other groups. The data were analyzed using repeated measure analysis of variance (ANOVA), one-way ANOVA, and paired t-test by the SPSS software. The significance level was set as 0.05. The Tukey test showed that there were significant differences between the load deflection rates of welded groups compared to control ones (P < 0.001). Considering the limitation of this study, the electric spot welding process performed on stainless steel and chromium-cobalt wires increased their load deflection rates.

  9. Fiber optic data link for data acquisition and analysis

    NASA Astrophysics Data System (ADS)

    Saulsberry, Garen

    A data link has been designed and developed for use with fiber optics as a transmission medium, though coaxial and twisted pair cable might also be used. Multiple data types may be transferred at various rates up to 100 Mbits per second and data word width may be programmed to obtain the highest level of efficiency from the bit rate.

  10. Bacterial colonization on coated and uncoated orthodontic wires: A prospective clinical trial.

    PubMed

    Raji, Seyed Hamid; Shojaei, Hasan; Ghorani, Parinaz Saeidi; Rafiei, Elahe

    2014-11-01

    The advantages of coated orthodontic wires such as esthetic and their effects on reduced friction, corrosion and allergic reaction and the significant consequences of plaque accumulation on oral health encouraged us to assess bacterial colonization on these wires. A total of 18 (9 upper and 9 lower) epoxy resin coated 16 × 22 nickel-titanium wires (Spectra, GAC, USA) and 18 (9 upper and 9 lower) non-coated 16 × 22 nickel-titanium wires (Sentalloy, GAC, USA) with isolated packages were selected and sterilized before application. The samples were divided randomly between upper and lower arches in 18 patients and hence that every patient received one coated and one uncoated wire at the same time. Samples were removed and cut in equal lengths after 3 weeks and placed in phosphate buffered saline buffer. After separation of bacteria in trypsin and ethylenediaminetetraacetic acid solution, the diluted solution was cultured in blood agar and bacterial colony forming units were counted. Finally, the data was analyzed using the paired t-test and the significance was set at 0.05. Mean of bacterial colonization on uncoated wires was more than that of coated wires (P < 0.001). Bacterial plaque accumulation on epoxy resin coated nickel-titanium orthodontic wires is significantly lower than uncoated nickel-titanium wires.

  11. Strength of fixation constructs for basilar osteotomies of the first metatarsal.

    PubMed

    Lian, G J; Markolf, K; Cracchiolo, A

    1992-01-01

    Twenty-four pairs of fresh-frozen human feet had a proximal osteotomy of the first metatarsal that was fixed using either screws, staples, or K wires. Each metatarsal was excised and the specimen was loaded to failure in a cantilever beam configuration by applying a superiorly directed force to the metatarsal head using an MTS servohydraulic test machine. Specimens with a crescentic osteotomy that were fixed using a single screw demonstrated higher mean failure moments than pairs that were fixed with four staples or two K wires; staples were the weakest construct. All specimens fixed with staples failed by bending of the staples without bony fracture; all K wire constructs but one failed by wire bending. Chevron and crescentic osteotomies fixed with a single screw demonstrated equal bending strengths; the bending strength of an oblique osteotomy fixed with two screws was 82% greater than for a crescentic osteotomy fixed with a single screw. Basilar osteotomies of the first metatarsal are useful in correcting metatarsus primus varus often associated with hallux valgus pathology. Fixation strength is an important consideration since weightbearing forces on the head of the first metatarsal acting at a distance from the osteotomy site subject the construct to a dorsiflexion bending moment, as simulated in our tests. Our results show that screw fixation is the strongest method for stabilizing a basilar osteotomy. Based upon the relatively low bending strengths of the staple and K wire constructs, we would not recommend these forms of fixation.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. A global interaction network maps a wiring diagram of cellular function

    PubMed Central

    Costanzo, Michael; VanderSluis, Benjamin; Koch, Elizabeth N.; Baryshnikova, Anastasia; Pons, Carles; Tan, Guihong; Wang, Wen; Usaj, Matej; Hanchard, Julia; Lee, Susan D.; Pelechano, Vicent; Styles, Erin B.; Billmann, Maximilian; van Leeuwen, Jolanda; van Dyk, Nydia; Lin, Zhen-Yuan; Kuzmin, Elena; Nelson, Justin; Piotrowski, Jeff S.; Srikumar, Tharan; Bahr, Sondra; Chen, Yiqun; Deshpande, Raamesh; Kurat, Christoph F.; Li, Sheena C.; Li, Zhijian; Usaj, Mojca Mattiazzi; Okada, Hiroki; Pascoe, Natasha; Luis, Bryan-Joseph San; Sharifpoor, Sara; Shuteriqi, Emira; Simpkins, Scott W.; Snider, Jamie; Suresh, Harsha Garadi; Tan, Yizhao; Zhu, Hongwei; Malod-Dognin, Noel; Janjic, Vuk; Przulj, Natasa; Troyanskaya, Olga G.; Stagljar, Igor; Xia, Tian; Ohya, Yoshikazu; Gingras, Anne-Claude; Raught, Brian; Boutros, Michael; Steinmetz, Lars M.; Moore, Claire L.; Rosebrock, Adam P.; Caudy, Amy A.; Myers, Chad L.; Andrews, Brenda; Boone, Charles

    2017-01-01

    We generated a global genetic interaction network for Saccharomyces cerevisiae, constructing over 23 million double mutants, identifying ~550,000 negative and ~350,000 positive genetic interactions. This comprehensive network maps genetic interactions for essential gene pairs, highlighting essential genes as densely connected hubs. Genetic interaction profiles enabled assembly of a hierarchical model of cell function, including modules corresponding to protein complexes and pathways, biological processes, and cellular compartments. Negative interactions connected functionally related genes, mapped core bioprocesses, and identified pleiotropic genes, whereas positive interactions often mapped general regulatory connections among gene pairs, rather than shared functionality. The global network illustrates how coherent sets of genetic interactions connect protein complex and pathway modules to map a functional wiring diagram of the cell. PMID:27708008

  13. Evaluation of Kapton pyrolysis, arc tracking, and flashover on SiO(x)-coated polyimide insulated samples of flat flexible current carriers for Space Station Freedom

    NASA Technical Reports Server (NTRS)

    Stueber, Thomas J.; Mundson, Chris

    1993-01-01

    Kapton polyimide wiring insulation was found to be vulnerable to pyrolization, arc tracking, and flashover when momentary short-circuit arcs have occurred on aircraft power systems. Short-circuit arcs between wire pairs can pyrolize the polyimide resulting in a conductive char between conductors that may sustain the arc (arc tracking). Furthermore, the arc tracking may spread (flashover) to other wire pairs within a wire bundle. Polyimide Kapton will also be used as the insulating material for the flexible current carrier (FCC) of Space Station Freedom (SSF). The FCC, with conductors in a planar type geometric layout as opposed to bundles, is known to sustain arc tracking at proposed SSF power levels. Tests were conducted in a vacuum bell jar that was designed to conduct polyimide pyrolysis, arc tracking, and flashover studies on samples of SSF's FCC. Test results will be reported concerning the minimal power level needed to sustain arc tracking and the FCC susceptibility to flashover. Results of the FCC arc tracking tests indicate that only 22 volt amps were necessary to sustain arc tracking (proposed SSF power level is 400 watts). FCC flashover studies indicate that the flashover event is highly unlikely.

  14. Multi-service small-cell cloud wired/wireless access network based on tunable optical frequency comb

    NASA Astrophysics Data System (ADS)

    Xiang, Yu; Zhou, Kun; Yang, Liu; Pan, Lei; Liao, Zhen-wan; Zhang, Qiang

    2015-11-01

    In this paper, we demonstrate a novel multi-service wired/wireless integrated access architecture of cloud radio access network (C-RAN) based on radio-over-fiber passive optical network (RoF-PON) system, which utilizes scalable multiple- frequency millimeter-wave (MF-MMW) generation based on tunable optical frequency comb (TOFC). In the baseband unit (BBU) pool, the generated optical comb lines are modulated into wired, RoF and WiFi/WiMAX signals, respectively. The multi-frequency RoF signals are generated by beating the optical comb line pairs in the small cell. The WiFi/WiMAX signals are demodulated after passing through the band pass filter (BPF) and band stop filter (BSF), respectively, whereas the wired signal can be received directly. The feasibility and scalability of the proposed multi-service wired/wireless integrated C-RAN are confirmed by the simulations.

  15. Printed wiring board system programmer's manual

    NASA Technical Reports Server (NTRS)

    Brinkerhoff, C. D.

    1973-01-01

    The printed wiring board system provides automated techniques for the design of printed circuit boards and hybrid circuit boards. The system consists of four programs: (1) the preprocessor program combines user supplied data and pre-defined library data to produce the detailed circuit description data; (2) the placement program assigns circuit components to specific areas of the board in a manner that optimizes the total interconnection length of the circuit; (3) the organizer program assigns pin interconnections to specific board levels and determines the optimal order in which the router program should attempt to layout the paths connecting the pins; and (4) the router program determines the wire paths which are to be used to connect each input pin pair on the circuit board. This document is intended to serve as a programmer's reference manual for the printed wiring board system. A detailed description of the internal logic and flow of the printed wiring board programs is included.

  16. Early feasibility evaluation of thoracoscopically assisted transcatheter ventricular reconstruction in an experimental model of ischaemic heart failure with left anteroapical aneurysm.

    PubMed

    Cheng, Yanping; Yi, Geng-Hua; Annest, Lon S; Van Bladel, Kevin; Brown, Ryan; Wechsler, Andrew; Shibuya, Masahiko; Conditt, Gerard B; Peppas, Athanasios; Kaluza, Greg L; Granada, Juan F

    2015-04-01

    To test the feasibility of a thoracoscopically assisted, off-pump, transcatheter ventricular reconstruction (TCVR) approach in an ovine model of left ventricular (LV) anteroapical aneurysm. Myocardial infarction (MI) was induced by coil occlusion of the middle left anterior descending artery and diagonals. Two months after MI creation, TCVR was performed via a minimal thoracotomy in eight sheep. Under endoscopic and fluoroscopic guidance, trans-interventricular septal puncture was performed from the LV epicardial scar. A guidewire was externalised via a snare placed in the right ventricle from the external jugular vein. An internal anchor was inserted over the wire and positioned on the right ventricular septum and an external anchor was deployed on the LV anterior epicardium. Serial pairs of anchors were placed and plicated together to exclude the scar completely. Immediately after TCVR, echocardiography showed LV end-systolic volume decreased from pre-procedure 58.8±16.6 ml to 25.1±7.6 ml (p<0.01) and the ejection fraction increased from 32.0±7.3% to 52.0±7.5% (p<0.01). LV twist significantly improved (3.83±2.21 vs. pre-procedure -0.41±0.94, p=0.01) and the global peak-systolic longitudinal strain increased from -5.64% to -10.77% (p<0.05). TCVR using minimally invasive access techniques on the off-pump beating heart is feasible and resulted in significant improvement in LV performance.

  17. Thermo-Mechanical Behavior and Shakedown of Shape Memory Alloy Cable Structures

    NASA Astrophysics Data System (ADS)

    Biggs, Daniel B.

    Shape memory alloys (SMAs) are a versatile class of smart materials that exhibit adaptive properties which have been applied to solve engineering problems in wide-ranging fields from aerospace to biomedical engineering. Yet there is a lack of understanding of the fundamental nature of SMAs in order to effectively apply them to challenging problems within these engineering fields. Stranding fine NiTi wires into a cable form satisfies the demands of many aerospace and civil engineering applications which require actuators to withstand large tensile loads. The impact of increased bending and twisting in stranded NiTi wire structures, as well as introducing contact mechanics to the unstable phase transformation is not well understood, and this work aims to fill that void. To study the scalability of NiTi cables, thermo-mechanical characterization tests are conducted on cables much larger than those previously tested. These cables are found to have good superelastic properties and repeatable cyclic behavior with minimal induced plasticity. The behavior of additional cables, which have higher transition temperatures that can be used in a shape memory mode as thermo-responsive, high force actuator elements, are explored. These cables are found to scale up the performance of straight wire by maintaining an equivalent work output. Moreover, this work investigates the degradation of the thermal actuation of SMA wires through novel stress-temperature paths, discovering several path dependent behaviors of transformation-induced plasticity. The local mechanics of NiTi cable structures are explored through experiments utilizing digital image correlation, revealing new periodic transformation instabilities. Finite element simulations are presented, which indicate that the instabilities are caused by friction and relative sliding between wires in a cable. Finally, a study of the convective heat transfer of helical wire involving a suite of wind tunnel experiments, numerical analyses, and an empirical correlation is presented. This provides a method to better model the thermal behavior of helical SMA actuators and highlights the non-monotonic dependence of the convective heat transfer coefficient of helical wire with respect to the angle of the flow.

  18. Modern techniques and technologies for unbundled access in the local loop

    NASA Astrophysics Data System (ADS)

    Bacis Vasile, Irina Bristena; Schiopu, Paul; Marghescu, Cristina

    2015-02-01

    The efficient and unbundled use of the existing telecommunications infrastructure represents a major goal for the development of the services offered by telecommunications providers. A major telecommunications operator can provide services to a subscriber using a copper wire pair or part of the frequency spectrum of a copper wire pair, together with other operators, through a process of unbundling access in the local loop. Since access to the vocal band is an already solved problem, concerns turn to the broadband access with xDSL service delivery on ungrouped subscriber loops; besides the legal and economic aspects involved this has become an engineering problem also. The local loop unbundling methods have a substantial technical impact. This impact should be taken into account right from the design stage and then in the standardization stage of broadband systems intended to operate on copper wire pairs in the local loop. These systems are known under the generic term of xDSL and began to be analyzed in the late 90s. xDSL became the dominant solution for providing Internet at a reasonable price for both residential and business subscribers. In this massive development scenario, certain problems will arise from the early stages of deployment, and another type of problems will occur later on when a large number of systems will be installed in a single beam.

  19. Active Regions Blossoming

    NASA Image and Video Library

    2015-10-28

    As a pair of active regions began to rotate into view, their towering magnetic field lines above them bloomed into a dazzling display of twisting arches (Oct. 27-28, 2015). Some of the lines reached over and connected with the neighboring active region. Active regions are usually the source of solar storms. The images were taken in a wavelength of extreme ultraviolet light. http://photojournal.jpl.nasa.gov/catalog/PIA20048

  20. CSSC Fish Barrier Simulated Rescuer Touch Point Results, Operating Guidance, and Recommendations for Rescuer Safety

    DTIC Science & Technology

    2011-09-01

    Testing Input electrodes consisting of 1/2” diameter, 6” long copper rods were wired to separate conductors of a shielded, commercially available...underwater-rated electrical cable (three-conductor, shielded, shipboard cable (TSS-2), 18 American Wire Gauge (AWG) stranded copper ). Electrode pairs...sandpaper prior to use to ensure the best electrical continuity between the water and electrode by removing any copper oxide. This electrode

  1. Computer simulation of flagellar movement VIII: coordination of dynein by local curvature control can generate helical bending waves.

    PubMed

    Brokaw, Charles J

    2002-10-01

    Computer simulations have been carried out with a model flagellum that can bend in three dimensions. A pattern of dynein activation in which regions of dynein activity propagate along each doublet, with a phase shift of approximately 1/9 wavelength between adjacent doublets, will produce a helical bending wave. This pattern can be termed "doublet metachronism." The simulations show that doublet metachronism can arise spontaneously in a model axoneme in which activation of dyneins is controlled locally by the curvature of each outer doublet microtubule. In this model, dyneins operate both as sensors of curvature and as motors. Doublet metachronism and the chirality of the resulting helical bending pattern are regulated by the angular difference between the direction of the moment and sliding produced by dyneins on a doublet and the direction of the controlling curvature for that doublet. A flagellum that is generating a helical bending wave experiences twisting moments when it moves against external viscous resistance. At high viscosities, helical bending will be significantly modified by twist unless the twist resistance is greater than previously estimated. Spontaneous doublet metachronism must be modified or overridden in order for a flagellum to generate the planar bending waves that are required for efficient propulsion of spermatozoa. Planar bending can be achieved with the three-dimensional flagellar model by appropriate specification of the direction of the controlling curvature for each doublet. However, experimental observations indicate that this "hard-wired" solution is not appropriate for real flagella. Copyright 2002 Wiley-Liss, Inc.

  2. Monte Carlo simulations of nematic and chiral nematic shells

    NASA Astrophysics Data System (ADS)

    Wand, Charlie R.; Bates, Martin A.

    2015-01-01

    We present a systematic Monte Carlo simulation study of thin nematic and cholesteric shells with planar anchoring using an off-lattice model. The results obtained using the simple model correspond with previously published results for lattice-based systems, with the number, type, and position of defects observed dependent on the shell thickness with four half-strength defects in a tetrahedral arrangement found in very thin shells and a pair of defects in a bipolar (boojum) configuration observed in thicker shells. A third intermediate defect configuration is occasionally observed for intermediate thickness shells, which is stabilized in noncentrosymmetric shells of nonuniform thickness. Chiral nematic (cholesteric) shells are investigated by including a chiral term in the potential. Decreasing the pitch of the chiral nematic leads to a twisted bipolar (chiral boojum) configuration with the director twist increasing from the inner to the outer surface.

  3. Folded supersymmetry with a twist

    DOE PAGES

    Cohen, Timothy; Craig, Nathaniel; Lou, Hou Keong; ...

    2016-03-30

    Folded supersymmetry (f-SUSY) stabilizes the weak scale against radiative corrections from the top sector via scalar partners whose gauge quantum numbers differ from their Standard Model counterparts. This non-trivial pairing of states can be realized in extra-dimensional theories with appropriate supersymmetry-breaking boundary conditions. We present a class of calculable f-SUSY models that are parametrized by a non-trivial twist in 5D boundary conditions and can accommodate the observed Higgs mass and couplings. Although the distinctive phenomenology associated with the novel folded states should provide strong evidence for this mechanism, the most stringent constraints are currently placed by conventional supersymmetry searches. Asmore » a result, these models remain minimally fine-tuned in light of LHC8 data and provide a range of both standard and exotic signatures accessible at LHC13.« less

  4. Cassini UVIS Auroral Observations in 2016 and 2017

    NASA Astrophysics Data System (ADS)

    Pryor, Wayne R.; Esposito, Larry W.; Jouchoux, Alain; Radioti, Aikaterini; Grodent, Denis; Gustin, Jacques; Gerard, Jean-Claude; Lamy, Laurent; Badman, Sarah; Dyudina, Ulyana A.; Cassini UVIS Team, Cassini VIMS Team, Cassini ISS Team, HST Saturn Auroral Team

    2017-10-01

    In 2016 and 2017, the Cassini Saturn orbiter executed a final series of high-inclination, low-periapsis orbits ideal for studies of Saturn's polar regions. The Cassini Ultraviolet Imaging Spectrograph (UVIS) obtained an extensive set of auroral images, some at the highest spatial resolution obtained during Cassini's long orbital mission (2004-2017). In some cases, two or three spacecraft slews at right angles to the long slit of the spectrograph were required to cover the entire auroral region to form auroral images. We will present selected images from this set showing narrow arcs of emission, more diffuse auroral emissions, multiple auroral arcs in a single image, discrete spots of emission, small scale vortices, large-scale spiral forms, and parallel linear features that appear to cross in places like twisted wires. Some shorter features are transverse to the main auroral arcs, like barbs on a wire. UVIS observations were in some cases simultaneous with auroral observations from the Cassini Imaging Science Subsystem (ISS) the Cassini Visual and Infrared Mapping Spectrometer (VIMS), and the Hubble Space Telescope Space Telescope Imaging Spectrograph (STIS) that will also be presented.

  5. The energy of naturally curved elastic rods with an application to the stretching and contraction of a free helical spring as a model for DNA

    NASA Astrophysics Data System (ADS)

    Manning, Gerald S.

    2015-09-01

    We give a contemporary and direct derivation of a classical, but insufficiently familiar, result in the theory of linear elasticity—a representation for the energy of a stressed elastic rod with central axis that intrinsically takes the shape of a general space curve. We show that the geometric torsion of the space curve, while playing a crucial role in the bending energy, is physically unrelated to the elastic twist. We prove that the twist energy vanishes in the lowest-energy states of a rod subject to constraints that do not restrict the twist. The stretching and contraction energies of a free helical spring are computed. There are local high-energy minima. We show the possibility of using the spring to model the chirality of DNA. We then compare our results with an available atomic level energy simulation that was performed on DNA unconstrained in the same sense as the free spring. We find some possible reflections of springlike behavior in the mechanics of DNA, but, unsurprisingly, the base pairs lend a material substance to the core of DNA that a spring does not capture.

  6. The energy of naturally curved elastic rods with an application to the stretching and contraction of a free helical spring as a model for DNA.

    PubMed

    Manning, Gerald S

    2015-09-14

    We give a contemporary and direct derivation of a classical, but insufficiently familiar, result in the theory of linear elasticity-a representation for the energy of a stressed elastic rod with central axis that intrinsically takes the shape of a general space curve. We show that the geometric torsion of the space curve, while playing a crucial role in the bending energy, is physically unrelated to the elastic twist. We prove that the twist energy vanishes in the lowest-energy states of a rod subject to constraints that do not restrict the twist. The stretching and contraction energies of a free helical spring are computed. There are local high-energy minima. We show the possibility of using the spring to model the chirality of DNA. We then compare our results with an available atomic level energy simulation that was performed on DNA unconstrained in the same sense as the free spring. We find some possible reflections of springlike behavior in the mechanics of DNA, but, unsurprisingly, the base pairs lend a material substance to the core of DNA that a spring does not capture.

  7. Three-dimensional doubly diffusive convectons: instability and transition to complex dynamics

    NASA Astrophysics Data System (ADS)

    Knobloch, Edgar; Beaume, Cedric; Bergeon, Alain

    2017-11-01

    Doubly diffusive convection in a closed vertically extended 3D container driven by competing horizontal temperature and concentration gradients is studied. No-slip boundary conditions are imposed. The buoyancy number N = - 1 to ensure the presence of a conduction state. The primary instability is subcritical and generates two families of spatially localised steady states known as convectons. The convectons bifurcate directly from the conduction state and are organized in a pair of primary branches that snake within a well-defined range of Rayleigh numbers as the convectons grow in length. Secondary instabilities generating twist result in secondary snaking branches of twisted convectons. These destabilize the primary convectons and are responsible for the absence of stable steady states, localized or otherwise, in the subcritical regime. As a result, once the Rayleigh number for the primary instability of the conduction state is exceeded, the system exhibits an abrupt transition to large amplitude spatio-temporal chaos that arises whenever the twist instability leading to collapse is faster than the nucleation time for new rolls. These numerical results are confirmed by determining the stability properties of all convecton states as well as spatially extended convection. Supported in part by the National Science Foundation under Grant DMS-1613132.

  8. The energy of naturally curved elastic rods with an application to the stretching and contraction of a free helical spring as a model for DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Manning, Gerald S., E-mail: jerrymanning@rcn.com

    We give a contemporary and direct derivation of a classical, but insufficiently familiar, result in the theory of linear elasticity—a representation for the energy of a stressed elastic rod with central axis that intrinsically takes the shape of a general space curve. We show that the geometric torsion of the space curve, while playing a crucial role in the bending energy, is physically unrelated to the elastic twist. We prove that the twist energy vanishes in the lowest-energy states of a rod subject to constraints that do not restrict the twist. The stretching and contraction energies of a free helicalmore » spring are computed. There are local high-energy minima. We show the possibility of using the spring to model the chirality of DNA. We then compare our results with an available atomic level energy simulation that was performed on DNA unconstrained in the same sense as the free spring. We find some possible reflections of springlike behavior in the mechanics of DNA, but, unsurprisingly, the base pairs lend a material substance to the core of DNA that a spring does not capture.« less

  9. Prognostic monitoring of aircraft wiring using electrical capacitive tomography

    NASA Astrophysics Data System (ADS)

    McKenzie, G.; Record, P.

    2011-12-01

    Electrical capacitive tomography (ECT) has been used to monitor sections of aircraft wiring, as a tool for prognostic analysis. To apply the principles of ECT across a cross section of only 4 mm, modification of the basic circuit was required. Additionally, a more novel method of placing the necessary electrodes was needed, this being accomplished by etching them from flexible copper sheeting and wrapping them inside the perimeter of an enclosure. Results showed that at this small scale, it was possible to determine the position of a wire-under-test inside the 4 mm diameter enclosure to about 0.1 mm, and that by measuring capacitance between pairs, it was also possible to determine whether or not the insulation of wire passed between the electrodes was damaged. With more than one wire-under-test present, it was possible to determine whether or not damage was present, and if so, which wire was damaged. By detecting insulation damage in this way, ECT has proven to be a useful tool in prognostic monitoring, helping faults to be found before they become safety-critical onboard an aircraft.

  10. Prognostic monitoring of aircraft wiring using electrical capacitive tomography.

    PubMed

    McKenzie, G; Record, P

    2011-12-01

    Electrical capacitive tomography (ECT) has been used to monitor sections of aircraft wiring, as a tool for prognostic analysis. To apply the principles of ECT across a cross section of only 4 mm, modification of the basic circuit was required. Additionally, a more novel method of placing the necessary electrodes was needed, this being accomplished by etching them from flexible copper sheeting and wrapping them inside the perimeter of an enclosure. Results showed that at this small scale, it was possible to determine the position of a wire-under-test inside the 4 mm diameter enclosure to about 0.1 mm, and that by measuring capacitance between pairs, it was also possible to determine whether or not the insulation of wire passed between the electrodes was damaged. With more than one wire-under-test present, it was possible to determine whether or not damage was present, and if so, which wire was damaged. By detecting insulation damage in this way, ECT has proven to be a useful tool in prognostic monitoring, helping faults to be found before they become safety-critical onboard an aircraft.

  11. Development of a 3-wire probe for the simultaneous measurement of turbulent velocity, concentration and temperature fields

    NASA Astrophysics Data System (ADS)

    Hewes, Alaïs; Mydlarski, Laurent

    2015-11-01

    The present work focuses on the design and optimization of a probe used to simultaneously measure the velocity, concentration and temperature fields in a turbulent jet. The underlying principles of this sensor are based in thermal-anemometry techniques, and the design of this 3-wire probe builds off the previous work of Sirivat and Warhaft, J. Fluid Mech., 1982. In the first part of this study, the effect of different overheat ratios in the first two wires (called the ``interference'' or ``Way-Libby'' probe - used to infer velocity and concentration) are investigated. Of particular interest is their effect on the quality of the resulting calibration, as well as the measured velocity and concentration data. Four different overheat ratio pairs for the two wires comprising the interference probe are studied. In the second part of this work, a third wire, capable of detecting temperature fluctuations, is added to the 3-wire probe. The optimal configuration of this probe, including wire type and overheat ratio for the third wire, is studied and the simultaneously-measured velocity, concentration, and temperature data (e.g. spectra, PDFs) for different probe configurations are presented. Supported by the Natural Sciences and Engineering Research Council of Canada (Grant 217184).

  12. Estudio de un microcable de par trenzado para la comunicacion y lectura del modulo de pixeles del experimento CMS

    NASA Astrophysics Data System (ADS)

    Oliveros Tautiva, Sandra Jimena

    The Compact Muon Solenoid (CMS) is one of the two most important experiments at the Large Hadron Collider (LHC). The pixel detector is the component closest to the collision in CMS and it receives large doses of radiation which will affect its performance. The pixel detector will be replaced by a new one after four years. The aim is to reduce material in the sensitive zone of the new pixel detector, which leads to the implementation of a type of micro twisted pair cable that will replace the existing kapton cables and some connections will be eliminated. The purpose of this work was to study the viability of using these micro twisted pair cables in the existing 40 MHz analog readout. The electrical parameters of micro cables were determined, and operational tests were performed in a module using these cables for communicating and reading. Three different lengths of micro cables were used, 1.0, 1.5 and 2.0 m, in order to compare test results with those obtained using the kapton cable. It was found that the use of these cables does not affect the programming and reading of the pixels in one module, so the micro cables are viable to be used in place of the kapton cables.

  13. Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.

    PubMed

    Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K

    2018-06-04

    The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.

  14. 4-Bromo-N-(di-n-propyl-carbamothioyl)-benzamide.

    PubMed

    Binzet, Gün; Flörke, Ulrich; Külcü, Nevzat; Arslan, Hakan

    2009-02-04

    The synthesis of the title compound, C(14)H(19)BrN(2)OS, involves the reaction of 4-bromo-benzoyl chloride with potassium thio-cyanate in acetone followed by condensation of the resulting 4-bromo-benzoyl isothio-cyanate with di-n-propyl-amine. Typical thio-urea carbonyl and thio-carbonyl double bonds, as well as shortened C-N bonds, are observed in the title compound. The short C-N bond lengths in the centre of the mol-ecule reveal the effects of resonance in this part of the mol-ecule. The asymmetric unit of the title compound contains two crystallographically independent mol-ecules, A and B. There is very little difference between the bond lengths and angles of these mol-ecules. In mol-ecule B, one di-n-propyl group is twisted in a -anti-periplanar conformation with C-C-C-H = -179.1 (3)° and the other adopts a -synclinal conformation with C-C-C-H = -56.7 (4)°; in mol-ecule A the two di-n-propyl groups are twisted in + and -anti-periplanar conformations, with C-C-C-H = -179.9 (3) and 178.2 (3)°, respectively. In the crystal, the mol-ecules are linked into dimeric pairs via pairs of N-H⋯S hydrogen bonds.

  15. Ferroelectric and photocatalytic behavior of bismuth ferrite nano wire

    NASA Astrophysics Data System (ADS)

    William, R. V.; Marikani, A.; Madhavan, D.

    2016-05-01

    Multiferroic bismuth ferrite nanowires are prepared through polyol method with an average diameter of 35 nm with a narrow size distribution. The band gap was determined to be 2.10 eV, indicating their potential application as visible-light-response photo catalyst. The magnificent photocatalytic behaviors of BiFeO3 nanowires are understood from the methyl violet degradation under visible light irradiation. Moreover, the nano-wire takes only a lesser time for the diffusion of electron-hole pair from the surface of the sample. Further the BiFeO3 nano-wire was characterized using XRD, SEM, and U-V. The ferroelectric studies of BiFeO3 nano-wire show a frequency dependent property and maximum coercivity of 2.7 V/cm were achieved with a remanent polarization at 0.5 µC/cm2 at the frequency 4 kHz. The coercivity of BiFeO3 nano wire changes with variation of frequency from 1 kHz to 4 kHz.

  16. Organized motions in a jet in crossflow

    NASA Astrophysics Data System (ADS)

    Rivero, A.; Ferré, J. A.; Giralt, Francesc

    2001-10-01

    An experimental study to identify the structures present in a jet in crossflow has been carried out at a jet-to-crossflow velocity ratio U/Ucf = 3.8 and Reynolds number Re = UcfD/v = 6600. The hot-wire velocity data measured with a rake of eight X-wires at x/D = 5 and 15 and flow visualizations using planar laser-induced fluorescence (PLIF) confirm that the well-established pair of counter-rotating vortices is a feature of the mean field and that the upright, tornado-like or Fric's vortices that are shed to the leeward side of the jet are connected to the jet flow at the core. The counter-rotating vortex pair is strongly modulated by a coherent velocity field that, in fact, is as important as the mean velocity field. Three different structures folded vortex rings, horseshoe vortices and handle-type structures contribute to this coherent field. The new handle-like structures identified in the current study link the boundary layer vorticity with the counter-rotating vortex pair through the upright tornado-like vortices. They are responsible for the modulation and meandering of the counter-rotating vortex pair observed both in video recordings of visualizations and in the instantaneous velocity field. These results corroborate that the genesis of the dominant counter-rotating vortex pair strongly depends on the high pressure gradients that develop in the region near the jet exit, both inside and outside the nozzle.

  17. Nucleic acid nanomaterials: Silver-wired DNA

    NASA Astrophysics Data System (ADS)

    Auffinger, Pascal; Ennifar, Eric

    2017-10-01

    DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.

  18. 7 CFR 1755.505 - Buried services.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... water pipes, heating ducts, and other heat sources. (9) Wire and cable attachments to buildings for... Pair Tip Color of insulation Color of marking Ring Color of insulation Color of marking 1 White Blue...

  19. Proposal to probe quantum nonlocality of Majorana fermions in tunneling experiments

    NASA Astrophysics Data System (ADS)

    Sau, Jay D.; Swingle, Brian; Tewari, Sumanta

    2015-07-01

    Topological Majorana fermion (MF) quasiparticles have been recently suggested to exist in semiconductor quantum wires with proximity induced superconductivity and a Zeeman field. Although the experimentally observed zero bias tunneling peak and a fractional ac-Josephson effect can be taken as necessary signatures of MFs, neither of them constitutes a sufficient "smoking gun" experiment. Since one pair of Majorana fermions share a single conventional fermionic degree of freedom, MFs are in a sense fractionalized excitations. Based on this fractionalization we propose a tunneling experiment that furnishes a nearly unique signature of end state MFs in semiconductor quantum wires. In particular, we show that a "teleportation"-like experiment is not enough to distinguish MFs from pairs of MFs, which are equivalent to conventional zero energy states, but our proposed tunneling experiment, in principle, can make this distinction.

  20. Metallurgical characterization of controlled memory wire nickel-titanium rotary instruments.

    PubMed

    Shen, Ya; Zhou, Hui-Min; Zheng, Yu-Feng; Campbell, Les; Peng, Bin; Haapasalo, Markus

    2011-11-01

    To improve the fracture resistance of nickel-titanium (NiTi) files, manufacturers have introduced new alloys and developed new manufacturing processes for the fabrication of NiTi files. This study aimed to examine the phase transformation behavior and microstructure of NiTi instruments from a novel controlled memory NiTi wire (CM wire). Instruments of EndoSequence (ES), ProFile (PF), ProFile Vortex (Vortex), Twisted Files (TF), Typhoon (TYP), and Typhoon™ CM (TYP CM), all size 25/.04, were examined by differential scanning calorimetry (DSC) and x-ray diffraction (XRD). Microstructures of etched instruments were observed by optical microscopy and scanning electron microscopy with x-ray energy-dispersive spectrometric (EDS) analyses. The DSC analyses showed that each segment of the TYP CM and Vortex instruments had an austenite transformation completion or austenite-finish (A(f)) temperature exceeding 37°C, whereas the NiTi instruments made from conventional superelastic NiTi wire (ES, PF, and TYP) and TF had A(f) temperatures substantially below mouth temperature. The higher A(f) temperature of TYP CM instruments was consistent with a mixture of austenite and martensite structure, which was observed at room temperature with XRD. All NiTi instruments had room temperature martensite microstructures consisting of colonies of lenticular features with substantial twinning. EDS analysis indicated that the precipitates in all NiTi instruments were titanium-rich, with an approximate composition of Ti(2)Ni. The TYP CM and Vortex instruments with heat treatment contribute to increase austenite transformation temperature. The CM instrument has significant changes in the phase transformation behavior, compared with conventional superelastic NiTi instruments. Copyright © 2011 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  1. CSSC Fish Barrier Simulated Rescuer Touch Point Results, Operating Guidance, and Recommendations for Rescuer Safety

    DTIC Science & Technology

    2011-03-01

    Mile per hour ms Millisecond NEDU Navy Experimental Diving Unit PFD Personal flotation device PIW Person in the water PVC Polyvinyl chloride RDC...electrically resistive, yet conductive, clay. We then encapsulated the clay around a 1/2” diameter, 6-inch long copper rod, and then tightly wrapped it with...short length of 12 American Wire Gauge (AWG) stranded copper wire to the copper rod within each electrode. For each electrode pair, we joined

  2. Sensor for detecting changes in magnetic fields

    DOEpatents

    Praeg, Walter F.

    1981-01-01

    A sensor for detecting changes in the magnetic field of the equilibrium-field coil of a Tokamak plasma device comprises a pair of bifilar wires disposed circumferentially, one inside and one outside the equilibrium-field coil. Each is shorted at one end. The difference between the voltages detected at the other ends of the bifilar wires provides a measure of changing flux in the equilibrium-field coil. This difference can be used to detect faults in the coil in time to take action to protect the coil.

  3. Differential Models for B-Type Open-Closed Topological Landau-Ginzburg Theories

    NASA Astrophysics Data System (ADS)

    Babalic, Elena Mirela; Doryn, Dmitry; Lazaroiu, Calin Iuliu; Tavakol, Mehdi

    2018-05-01

    We propose a family of differential models for B-type open-closed topological Landau-Ginzburg theories defined by a pair (X,W), where X is any non-compact Calabi-Yau manifold and W is any holomorphic complex-valued function defined on X whose critical set is compact. The models are constructed at cochain level using smooth data, including the twisted Dolbeault algebra of polyvector-valued forms and a twisted Dolbeault category of holomorphic factorizations of W. We give explicit proposals for cochain level versions of the bulk and boundary traces and for the bulk-boundary and boundary-bulk maps of the Landau-Ginzburg theory. We prove that most of the axioms of an open-closed TFT (topological field theory) are satisfied on cohomology and conjecture that the remaining two axioms (namely non-degeneracy of bulk and boundary traces and the topological Cardy constraint) are also satisfied.

  4. Morphological Control of GaN and Its Effect within Electrochemical Heterojunctions

    DOE PAGES

    Parameshwaran, Vijay; Clemens, Bruce

    2016-08-17

    With morphological control through a solid source chemical vapor deposition process, GaN polycrystalline films, single-crystal nanowires, and mixed film/wires are grown on silicon to form a heterojunction that is a basis for III-V nitride device development. By contacting the GaN/Si structure to the CoCp 2 0/ + redox pair and performing impedance spectroscopy measurements, the band diagram of this junction is built for these three configurations. This serves as a basis for understanding the electrical nature of III-V nitride/Si interfaces that exist in several photonic device technologies, especially in context of using GaN nanomaterials grown on silicon for various applications.more » When these junctions are exposed to low-power UV illumination in contact with the Fc/Fc + redox pair, photocurrents of 18, 110, and 482 nA/cm 2 are generated for the nanowires, mixed film/wires, and films respectively. These currents, along with the electrostatics investigated through the impedance spectroscopy, show the trends of photoconversion with GaN morphology in this junction. Furthermore, they suggest that the mixed film/wires are a promising design for solar-based applications such as photovoltaics and water splitting electrodes.« less

  5. Morphological Control of GaN and Its Effect within Electrochemical Heterojunctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parameshwaran, Vijay; Clemens, Bruce

    With morphological control through a solid source chemical vapor deposition process, GaN polycrystalline films, single-crystal nanowires, and mixed film/wires are grown on silicon to form a heterojunction that is a basis for III-V nitride device development. By contacting the GaN/Si structure to the CoCp 2 0/ + redox pair and performing impedance spectroscopy measurements, the band diagram of this junction is built for these three configurations. This serves as a basis for understanding the electrical nature of III-V nitride/Si interfaces that exist in several photonic device technologies, especially in context of using GaN nanomaterials grown on silicon for various applications.more » When these junctions are exposed to low-power UV illumination in contact with the Fc/Fc + redox pair, photocurrents of 18, 110, and 482 nA/cm 2 are generated for the nanowires, mixed film/wires, and films respectively. These currents, along with the electrostatics investigated through the impedance spectroscopy, show the trends of photoconversion with GaN morphology in this junction. Furthermore, they suggest that the mixed film/wires are a promising design for solar-based applications such as photovoltaics and water splitting electrodes.« less

  6. A space release/deployment system actuated by shape memory wires

    NASA Astrophysics Data System (ADS)

    Fragnito, Marino; Vetrella and, Sergio

    2002-11-01

    In this paper, the design of an innovative hold down/release and deployment device actuated by shape memory wires, to be used for the first time for the S MA RT microsatellite solar wings is shown. The release and deployment mechanisms are actuated by a Shape Memory wire (Nitinol), which allows a complete symmetrical and synchronous release, in a very short time, of the four wings in pairs. The hold down kinematic mechanism is preloaded to avoid vibration nonlinearities and unwanted deployment at launch. The deployment mechanism is a simple pulley system. The stiffness of the deployed panel-hinge system needs to be dimensioned in order to meet the on-orbit requirement for attitude control. One-way roller clutches are used to keep the panel at the desired angle during the mission. An ad hoc software has been developed to simulate both the release and deployment operations, coupling the SMA wire behavior with the system mechanics.

  7. Structural modeling of HTS tapes and cables

    NASA Astrophysics Data System (ADS)

    Allen, N. C.; Chiesa, L.; Takayasu, M.

    2016-12-01

    Structural finite element analysis (FEA) has been used as an insightful tool to investigate the electromechanical behavior of HTS REBCO tapes and twisted stacked-tape cables under tension, torsion, bending and combined loads. A novel technique was developed for modeling the layered composite structure of the 2G tapes with structural solid-shell elements in ANSYS®. The FEA models produced detailed strain information for the REBCO superconducting layer which was then paired with an analytical model to predict the critical current performance of the 2G HTS tapes under various loads. Two commercially available HTS tapes (SuperPower and SuNAM) under tension, torsion and combined tension-torsion were first analyzed with FEA and compared with available experimental results at 77 K. A sharp critical current degradation was experienced at the yield strength of the tapes under tension and below a 100 mm twist-pitch under torsion. Combined tension-torsion loads had a more gradual degradation of critical current for twist-pitches of 115 mm or shorter but had a negligible difference compared to pure tension for longer twist-pitches. Using the structural solid-shell technique for modeling 2G tapes in ANSYS®, an FEA methodology for simulating full scale three-dimensional HTS stacked-tape cables under pure bending was created. A model of a Twisted-Stacked Tape Cable (TSTC), a configuration first proposed at MIT, was initially developed and then adapted to the slotted-core HTS Cable-In-Conduit Conductor produced by the ENEA laboratory in Italy. The numerical axial strain of the HTS REBCO tapes within the cables as calculated by FEA were found to agree with an analytical model for two cases: perfect-slip (frictionless) and no-slip (bonded). The ENEA CICC model was also compared with recent experimental critical current data at 77 K and was found to match best using a low friction coefficient of 0.02 indicating that the tapes within the cable freely slide with respect to each other helping to reduce the axial strain during bending.

  8. Critical Decay Index at the Onset of Solar Eruptions

    NASA Astrophysics Data System (ADS)

    Zuccarello, F. P.; Aulanier, G.; Gilchrist, S. A.

    2015-12-01

    Magnetic flux ropes are topological structures consisting of twisted magnetic field lines that globally wrap around an axis. The torus instability model predicts that a magnetic flux rope of major radius R undergoes an eruption when its axis reaches a location where the decay index -d({ln}{B}{ex})/d({ln}R) of the ambient magnetic field Bex is larger than a critical value. In the current-wire model, the critical value depends on the thickness and time evolution of the current channel. We use magnetohydrodynamic simulations to investigate whether the critical value of the decay index at the onset of the eruption is affected by the magnetic flux rope’s internal current profile and/or by the particular pre-eruptive photospheric dynamics. The evolution of an asymmetric, bipolar active region is driven by applying different classes of photospheric motions. We find that the critical value of the decay index at the onset of the eruption is not significantly affected by either the pre-erupitve photospheric evolution of the active region or the resulting different magnetic flux ropes. As in the case of the current-wire model, we find that there is a “critical range” [1.3-1.5], rather than a “critical value” for the onset of the torus instability. This range is in good agreement with the predictions of the current-wire model, despite the inclusion of line-tying effects and the occurrence of tether-cutting magnetic reconnection.

  9. Glucose biosensors with enzyme entrapped in polymer coating.

    PubMed

    Yang, S; Atanasov, P; Wilkins, E

    1995-01-01

    The pursuit of reliable biosensors for measuring glucose levels has been ongoing for decades. Their importance lies partly in the development of the implantable artificial pancrease, which can be used to deliver insulin to diabetics without the need to test glucose levels externally, with automatic delivery based on physiologic demand. Glucose sensors can also be used in short-term monitoring of glucose levels in hospitals and clinical laboratories. Three types of glucose biosensors were studied. All were based on a two-electrode system: an insulated platinum wire as a hydrogen peroxide electrode, and a silver wire twisted around the platinum wire as both a reference and a counter electrode. Each was coated with the enzyme glucose oxidase entrapped in a polymer matrix of cellulose acetate (CA) or poly 2-hydroxyethyl methacrylate (HEMA), then dip-coated by an additional polymer coating of polyvinylchloride (PVC), polyurethane (PU), or HEMA. The experiments were designed mainly to study the effectiveness of polymer coatings as diffusion-limiting membranes. The effect of each coating on the linear response to glucose concentration was examined. It was shown that additional (multiple) coatings can increase the linearity of the sensor response. The best results were obtained when the sensor was PVC-dip-coated three times. This preparation had a linear response up to 600 mg/DL glucose concentration. The sensors coated with PU and HEMA have linearity up to 280 and 240 mg/DL glucose concentrations, respectively. It was also shown that the coatings reduce interference from certain body chemicals.

  10. 35 Hz shape memory alloy actuator with bending-twisting mode.

    PubMed

    Song, Sung-Hyuk; Lee, Jang-Yeob; Rodrigue, Hugo; Choi, Ik-Seong; Kang, Yeon June; Ahn, Sung-Hoon

    2016-02-19

    Shape Memory Alloy (SMA) materials are widely used as an actuating source for bending actuators due to their high power density. However, due to the slow actuation speed of SMAs, there are limitations in their range of possible applications. This paper proposes a smart soft composite (SSC) actuator capable of fast bending actuation with large deformations. To increase the actuation speed of SMA actuator, multiple thin SMA wires are used to increase the heat dissipation for faster cooling. The actuation characteristics of the actuator at different frequencies are measured with different actuator lengths and results show that resonance can be used to realize large deformations up to 35 Hz. The actuation characteristics of the actuator can be modified by changing the design of the layered reinforcement structure embedded in the actuator, thus the natural frequency and length of an actuator can be optimized for a specific actuation speed. A model is used to compare with the experimental results of actuators with different layered reinforcement structure designs. Also, a bend-twist coupled motion using an anisotropic layered reinforcement structure at a speed of 10 Hz is also realized. By increasing their range of actuation characteristics, the proposed actuator extends the range of application of SMA bending actuators.

  11. 35 Hz shape memory alloy actuator with bending-twisting mode

    PubMed Central

    Song, Sung-Hyuk; Lee, Jang-Yeob; Rodrigue, Hugo; Choi, Ik-Seong; Kang, Yeon June; Ahn, Sung-Hoon

    2016-01-01

    Shape Memory Alloy (SMA) materials are widely used as an actuating source for bending actuators due to their high power density. However, due to the slow actuation speed of SMAs, there are limitations in their range of possible applications. This paper proposes a smart soft composite (SSC) actuator capable of fast bending actuation with large deformations. To increase the actuation speed of SMA actuator, multiple thin SMA wires are used to increase the heat dissipation for faster cooling. The actuation characteristics of the actuator at different frequencies are measured with different actuator lengths and results show that resonance can be used to realize large deformations up to 35 Hz. The actuation characteristics of the actuator can be modified by changing the design of the layered reinforcement structure embedded in the actuator, thus the natural frequency and length of an actuator can be optimized for a specific actuation speed. A model is used to compare with the experimental results of actuators with different layered reinforcement structure designs. Also, a bend-twist coupled motion using an anisotropic layered reinforcement structure at a speed of 10 Hz is also realized. By increasing their range of actuation characteristics, the proposed actuator extends the range of application of SMA bending actuators. PMID:26892438

  12. A Log-Euclidean polyaffine registration for articulated structures in medical images.

    PubMed

    Martín-Fernández, Miguel Angel; Martín-Fernández, Marcos; Alberola-López, Carlos

    2009-01-01

    In this paper we generalize the Log-Euclidean polyaffine registration framework of Arsigny et al. to deal with articulated structures. This framework has very useful properties as it guarantees the invertibility of smooth geometric transformations. In articulated registration a skeleton model is defined for rigid structures such as bones. The final transformation is affine for the bones and elastic for other tissues in the image. We extend the Arsigny el al.'s method to deal with locally-affine registration of pairs of wires. This enables the possibility of using this registration framework to deal with articulated structures. In this context, the design of the weighting functions, which merge the affine transformations defined for each pair of wires, has a great impact not only on the final result of the registration algorithm, but also on the invertibility of the global elastic transformation. Several experiments, using both synthetic images and hand radiographs, are also presented.

  13. Mesoscopic pairing without superconductivity

    NASA Astrophysics Data System (ADS)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  14. End-to-end distance and contour length distribution functions of DNA helices

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-06-01

    I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

  15. Integrable aspects and rogue wave solution of Sasa-Satsuma equation with variable coefficients in the inhomogeneous fiber

    NASA Astrophysics Data System (ADS)

    Zhang, Yu-Ping; Yu, Lan; Wei, Guang-Mei

    2018-02-01

    Under investigation with symbolic computation in this paper, is a variable-coefficient Sasa-Satsuma equation (SSE) which can describe the ultra short pulses in optical fiber communications and propagation of deep ocean waves. By virtue of the extended Ablowitz-Kaup-Newell-Segur system, Lax pair for the model is directly constructed. Based on the obtained Lax pair, an auto-Bäcklund transformation is provided, then the explicit one-soliton solution is obtained. Meanwhile, an infinite number of conservation laws in explicit recursion forms are derived to indicate its integrability in the Liouville sense. Furthermore, exact explicit rogue wave (RW) solution is presented by use of a Darboux transformation. In addition to the double-peak structure and an analog of the Peregrine soliton, the RW can exhibit graphically an intriguing twisted rogue-wave (TRW) pair that involve four well-defined zero-amplitude points.

  16. Less-invasive stabilization of rib fractures by intramedullary fixation: a biomechanical evaluation.

    PubMed

    Bottlang, Michael; Helzel, Inga; Long, William; Fitzpatrick, Daniel; Madey, Steven

    2010-05-01

    This study evaluated intramedullary fixation of rib fractures with Kirschner wires and novel ribs splints. We hypothesized that rib splints can provide equivalent fixation strength while avoiding complications associated with Kirschner wires, namely wire migration and cutout. The durability, strength, and failure modes of rib fracture fixation with Kirschner wires and rib splints were evaluated in 22 paired human ribs. First, intact ribs were loaded to failure to determine their strength. After fracture fixation with Kirschner wires and rib splints, fixation constructs were dynamically loaded to 360,000 cycles at five times the respiratory load to determine their durability. Finally, constructs were loaded to failure to determine residual strength and failure modes. All constructs sustained dynamic loading without failure. Dynamic loading caused three times more subsidence in Kirschner wire constructs (1.2 mm +/- 1.4 mm) than in rib splint constructs (0.4 mm +/- 0.2 mm, p = 0.09). After dynamic loading, rib splint constructs remained 48% stronger than Kirschner wire constructs (p = 0.001). Five of 11 Kirschner wire constructs failed catastrophically by cutting through the medial cortex, leading to complete loss of stability and wire migration through the lateral cortex. The remaining six constructs failed by wire bending. Rib splint constructs failed by development of fracture lines along the superior and interior cortices. No splint construct failed catastrophically, and all splint constructs retained functional reduction and fixation. Because of their superior strength and absence of catastrophic failure mode, rib splints can serve as an attractive alternative to Kirschner wires for intramedullary stabilization of rib fractures, especially in the case of posterior rib fractures where access for plating is limited.

  17. Multifilament Cable Wire versus Conventional Wire for Sternal Closure in Patients Undergoing Major Cardiac Surgery.

    PubMed

    Oh, You Na; Ha, Keong Jun; Kim, Joon Bum; Jung, Sung-Ho; Choo, Suk Jung; Chung, Cheol Hyun; Lee, Jae Won

    2015-08-01

    Stainless steel wiring remains the most popular technique for primary sternal closure. Recently, a multifilament cable wiring system (Pioneer Surgical Technology Inc., Marquette, MI, USA) was introduced for sternal closure and has gained wide acceptance due to its superior resistance to tension. We aimed to compare conventional steel wiring to multifilament cable fixation for sternal closure in patients undergoing major cardiac surgery. Data were collected retrospectively on 1,354 patients who underwent sternal closure after major cardiac surgery, using either the multifilament cable wiring system or conventional steel wires between January 2009 and October 2010. The surgical outcomes of these two groups of patients were compared using propensity score matching based on 18 baseline patient characteristics. Propensity score matching yielded 392 pairs of patients in the two groups whose baseline profiles showed no significant differences. No significant differences between the two groups were observed in the rates of early mortality (2.0% vs. 1.3%, p=0.578), major wound complications requiring reconstruction (1.3% vs. 1.3%, p>0.99), minor wound complications (3.6% vs. 2.0%, p=0.279), or mediastinitis (0.8% vs. 1.0%, p=1.00). Patients in the multifilament cable group had fewer sternal bleeding events than those in the conventional wire group, but this tendency was not statistically significant (4.3% vs. 7.4%, p=0.068). The surgical outcomes of sternal closure using multifilament cable wires were comparable to those observed when conventional steel wires were used. Therefore, the multifilament cable wiring system may be considered a viable option for sternal closure in patients undergoing major cardiac surgery.

  18. Inspection of anode and field wires for the COMPASS drift chamber, DC5, with Environmental Scanning Electron Microscope

    NASA Astrophysics Data System (ADS)

    Cyuzuzo, Sonia

    2014-09-01

    The COMPASS experiment at CERN uses a secondary pion beam from the Super Proton Synchrotron (SPS) at CERN to explore the spin structure of nucleons. A new drift chamber, DC5, will be integrated into the COMPASS spectrometer to replace an aging straw tube detector. DC5 will detect muon pairs from Drell-Yan scattering of a pion-beam off a transversely polarized proton target. This data will be used to determine the correlation between transverse proton spin and the intrinsic transverse momentum of up-quarks inside the proton, the Sivers effect. DC5 is a large area planar drift chamber with 8 layers of anode-frames made of G10 fiberglass-epoxy. The G10 frames support printed circuit boards for soldering 20 μm diameter anode and 100 μm diameter field wires. The anode planes are sandwiched by 13 graphite coated Mylar cathode planes. To ensure a well-functioning of DC5, the wires were carefully tested. An optical inspection and a spectral analysis was performed with an Environmental Scanning Electron Microscope (ESEM) to verify the composition and dimensions and the integrity of the gold plating on the surface of these wires. The spectra of the wires were studied at 10 and 30 keV. The COMPASS experiment at CERN uses a secondary pion beam from the Super Proton Synchrotron (SPS) at CERN to explore the spin structure of nucleons. A new drift chamber, DC5, will be integrated into the COMPASS spectrometer to replace an aging straw tube detector. DC5 will detect muon pairs from Drell-Yan scattering of a pion-beam off a transversely polarized proton target. This data will be used to determine the correlation between transverse proton spin and the intrinsic transverse momentum of up-quarks inside the proton, the Sivers effect. DC5 is a large area planar drift chamber with 8 layers of anode-frames made of G10 fiberglass-epoxy. The G10 frames support printed circuit boards for soldering 20 μm diameter anode and 100 μm diameter field wires. The anode planes are sandwiched by 13 graphite coated Mylar cathode planes. To ensure a well-functioning of DC5, the wires were carefully tested. An optical inspection and a spectral analysis was performed with an Environmental Scanning Electron Microscope (ESEM) to verify the composition and dimensions and the integrity of the gold plating on the surface of these wires. The spectra of the wires were studied at 10 and 30 keV. Acknowledging NSF and UIUC.

  19. Miniaturization of a Combination Langmuir/Mach Probe

    NASA Astrophysics Data System (ADS)

    Melnik, P. A.; Dehart, T.; Lotz, D.

    2009-11-01

    A combination Langmuir/Mach probe has been developed to measure electron temperature and density as well as ion flow speed in TCSU. The probe is fully translatable allowing it to diagnose all radial locations of the FRC at either the mid-plane, end section, or in the exhaust jets. The 1/4'' probe stalk consists of interlocking boron nitride cylinders which encompass a 1/8'' diameter stainless steel tube that houses the probe wires. In addition to the stainless steel jacket the probe wires are twisted to minimize electromagnetic noise pickup. The tip of this combo probe is composed of a boron nitride housing and eight .020'' diameter tungsten collection leads. In TCSU, the RMF used to form and sustain the FRC makes Langmuir probe measurements difficult. To this end we have developed a drive circuit that will generate the bias voltages necessary for Langmuir probe operation. This bipolar power supply can produce steady voltages up to 200 volts at loads over 1 amp and can be swept at any frequency up to 1.5 MHz. The probe current and bias voltage will be recorded with an amplifier and transmitted via fiber optic to a receiver allowing the signals to be digitized.

  20. Installation of a reactive site for covalent wiring onto an intrinsically conductive poly(ionic liquid)

    DOE PAGES

    Brombosz, Scott M.; Lee, Sungwon; Firestone, Millicent A.

    2014-11-04

    We describe post-polymerization radical bromination of a nanostructured poly(ionic liquid) that selectively introduces a reactive bromo-group onto the polyalkylthiophene backbone. Raman and FT-IR spectroscopy proves that the bromine is successfully introduced at the 3-methyl position of the thiophene and that the molecular structure of the polymer remains largely intact with only minimal chain scission detected. FT-IR and Vis-NIR spectroscopy indicates that incorporation of the bromine induces twisting (loss of co-planarity) of the polythiophene backbone. WAXS confirms retention of an ordered lamellar structure with minor lattice spacing contraction. Cyclic voltammetry confirms spectroscopic findings that the bromination reaction yields a stable p-dopedmore » polymer. The installed bromine is susceptible to nucleophilic displacement permitting the covalent attachment of other functional molecules, such as a dialkylphosphonate. Elemental analysis of such a transformation established that 100 % functionalization can be achieved. These results collectively demonstrate that post-modification of a π-conjugated polymer can be used to both tune electronic and photonic properties, as well as install a chemoselective attachment point for the covalent wiring of other molecules.« less

  1. Structure and Growth of Quasi One-Dimensional YSi2 Nanophases on Si(100)

    PubMed Central

    Iancu, V.; Kent, P.R.C.; Hus, S.; Hu, H.; Zeng, C.G.; Weitering, H.H.

    2013-01-01

    Quasi one-dimensional YSi2 nanostructures are formed via self-assembly on the Si(100) surface. These epitaxial nanowires are metastable and their formation strongly depends on the growth parameters. Here, we explore the various stages of yttrium silicide formation over a range of metal coverages and growth temperatures, and establish a rudimentary phase diagram for these novel and often coexisting nanophases. In addition to previously identified stoichiometric wires, we identify several new nanowire systems. These nanowires exhibit a variety of surface reconstructions, which sometimes coexist on a single wire. From a comparison of scanning tunneling microcopy images, tunneling spectra, and first-principles density functional theory calculations, we determine that these surface reconstructions arise from local orderings of yttrium vacancies. Nanowires often agglomerate into nanowire bundles, the thinnest of which are formed by single wire pairs. The calculations show that such bundles are energetically favored compared to well-separated single wires. Thicker bundles are formed at slightly higher temperature. They extend over several microns, forming a robust network of conducting wires that could possibly be employed in nanodevice applications. PMID:23221350

  2. Parametric analysis of a shape memory alloy actuated arm

    NASA Astrophysics Data System (ADS)

    Wright, Cody; Bilgen, Onur

    2016-04-01

    Using a pair of antagonistic Shape Memory Allow (SMA) wires, it may be possible to produce a mechanism that replicates human musculoskeletal movement. The movement of interest is the articulation of the elbow joint actuated by the biceps brachii muscle. In an effort to understand the bio-mechanics of the arm, a single degree of freedom crankslider mechanism is used to model the movement of the arm induced by the biceps brachii muscle. First, a purely kinematical analysis is performed on a rigid body crank-slider. Force analysis is also done modeling the muscle as a simple linear spring. Torque, rocking angle, and energy are calculated for a range of crank-slider geometries. The SMA wire characteristics are experimentally determined for the martensite detwinned and full austenite phases. Using the experimental data, an idealized actuator characteristic curve is produced for the SMA wire. Kinematic and force analyses are performed on the nonlinear wire characteristic curve and a linearized wire curve; both cases are applied to the crankslider mechanism. Performance metrics for both cases are compared, followed by discussion.

  3. Shear bond strength of different retainer wires and bonding adhesives in consideration of the pretreatment process.

    PubMed

    Reicheneder, Claudia; Hofrichter, Bernd; Faltermeier, Andreas; Proff, Peter; Lippold, Carsten; Kirschneck, Christian

    2014-11-28

    We aimed to compare the shear bond strength (SBS) of three different retainer wires and three different bonding adhesives in consideration of the pretreatment process of enamel surface sandblasting. 400 extracted bovine incisors were divided into 10 groups of 20 paired specimens each. 10 specimens of each group were pretreated by enamel sandblasting. The retainer wires Bond-A-Braid™, GAC-Wildcat®-Twistflex and everStick®ORTHO were bonded to the teeth with the adhesives Transbond™-LR, Tetric-EvoFlow™ and Stick®FLOW and then debonded measuring the SBS. While sandblasting generally increased SBS for all tested combinations, the retainer wires bonded with Transbond™-LR showed the highest SBS both with and without prior sandblasting. Significantly lower SBS were found for Tetric-EvoFlow™ that were comparable to those for everStick®ORTHO. Pretreatment of enamel surfaces by sandblasting increased the SBS of all retainer-wires. Transbond™-LR showed the best results compared to Tetric-EvoFlow™ and everStick®ORTHO, while all combinations used provided sufficient bonding strengths for clinical use.

  4. Ferroelectric and photocatalytic behavior of bismuth ferrite nano wire

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    William, R. V.; Marikani, A., E-mail: amari@mepcoeng.ac.in; Madhavan, D.

    Multiferroic bismuth ferrite nanowires are prepared through polyol method with an average diameter of 35 nm with a narrow size distribution. The band gap was determined to be 2.10 eV, indicating their potential application as visible-light-response photo catalyst. The magnificent photocatalytic behaviors of BiFeO{sub 3} nanowires are understood from the methyl violet degradation under visible light irradiation. Moreover, the nano-wire takes only a lesser time for the diffusion of electron-hole pair from the surface of the sample. Further the BiFeO{sub 3} nano-wire was characterized using XRD, SEM, and U-V. The ferroelectric studies of BiFeO{sub 3} nano-wire show a frequency dependent propertymore » and maximum coercivity of 2.7 V/cm were achieved with a remanent polarization at 0.5 µC/cm{sup 2} at the frequency 4 kHz. The coercivity of BiFeO{sub 3} nano wire changes with variation of frequency from 1 kHz to 4 kHz.« less

  5. Josephson effect in multiterminal superconductor-ferromagnet junctions coupled via triplet components

    NASA Astrophysics Data System (ADS)

    Moor, Andreas; Volkov, Anatoly F.; Efetov, Konstantin B.

    2016-03-01

    On the basis of the Usadel equation we study a multiterminal Josephson junction. This junction is composed by "magnetic" superconductors Sm, which have singlet pairing and are separated from the normal n wire by spin filters so that the Josephson coupling is caused only by fully polarized triplet components. We show that there is no interaction between triplet Cooper pairs with antiparallel total spin orientations. The presence of an additional singlet superconductor S attached to the n wire leads to a finite Josephson current IQ with an unusual current-phase relation. The density of states in the n wire for different orientations of spins of Cooper pairs is calculated. We derive a general formula for the current IQ in a multiterminal Josephson contact and apply this formula for analysis of two four-terminal Josephson junctions of different structures. It is shown in particular that both the "nematic" and the "magnetic" cases can be realized in these junctions. In a two-terminal structure with parallel filter orientations and in a three-terminal structure with antiparallel filter orientations of the "magnetic" superconductors with attached additional singlet superconductor, we find a nonmonotonic temperature dependence of the critical current. Also, in these structures, the critical current shows a Riedel peak like dependence on the exchange field in the "magnetic" superconductors. Although there is no current through the S/n interface due to orthogonality of the singlet and triplet components, the phase of the order parameter in the superconuctor S is shown to affect the Josephson current in a multiterminal structure.

  6. Analysis of a monolithic crystal plate acoustic wave filter.

    PubMed

    He, Huijing; Liu, Jinxi; Yang, Jiashi

    2011-12-01

    We study thickness-shear and thickness-twist vibrations of a finite, monolithic, AT-cut quartz plate crystal filter with two pairs of electrodes. The equations of anisotropic elasticity are used with the omission of the small elastic constant c(56). An analytical solution is obtained using Fourier series from which the resonant frequencies, mode shapes, and the vibration confinement due to the electrode inertia are calculated and examined. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Human Tau Isoforms Assemble into Ribbon-like Fibrils That Display Polymorphic Structure and Stability*

    PubMed Central

    Wegmann, Susanne; Jung, Yu Jin; Chinnathambi, Subashchandrabose; Mandelkow, Eva-Maria; Mandelkow, Eckhard; Muller, Daniel J.

    2010-01-01

    Fibrous aggregates of Tau protein are characteristic features of Alzheimer disease. We applied high resolution atomic force and EM microscopy to study fibrils assembled from different human Tau isoforms and domains. All fibrils reveal structural polymorphism; the “thin twisted” and “thin smooth” fibrils resemble flat ribbons (cross-section ∼10 × 15 nm) with diverse twist periodicities. “Thick fibrils” show periodicities of ∼65–70 nm and thicknesses of ∼9–18 nm such as routinely reported for “paired helical filaments” but structurally resemble heavily twisted ribbons. Therefore, thin and thick fibrils assembled from different human Tau isoforms challenge current structural models of paired helical filaments. Furthermore, all Tau fibrils reveal axial subperiodicities of ∼17–19 nm and, upon exposure to mechanical stress or hydrophobic surfaces, disassemble into uniform fragments that remain connected by thin thread-like structures (∼2 nm). This hydrophobically induced disassembly is inhibited at enhanced electrolyte concentrations, indicating that the fragments resemble structural building blocks and the fibril integrity depends largely on hydrophobic and electrostatic interactions. Because full-length Tau and repeat domain constructs assemble into fibrils of similar thickness, the “fuzzy coat” of Tau protein termini surrounding the fibril axis is nearly invisible for atomic force microscopy and EM, presumably because of its high flexibility. PMID:20566652

  8. Sensor for detecting changes in magnetic fields

    DOEpatents

    Praeg, W.F.

    1980-02-26

    A sensor is described for detecting changes in the magnetic field of the equilibrium-field coil of a Tokamak plasma device that comprises a pair of bifilar wires disposed circumferentially, one inside and one outside the equilibrium-field coil. Each is shorted at one end. The difference between the voltages detected at the other ends of the bifilar wires provides a measure of changing flux in the equilibrium-field coil. This difference can be used to detect faults in the coil in time to take action to protect the coil.

  9. Aging Wire Insulation Assessment by Phase Spectrum Examination of Ultrasonic Guided Waves

    NASA Technical Reports Server (NTRS)

    Anastasi, Robert F.; Madaras, Eric I.

    2003-01-01

    Wire integrity has become an area of concern to the aerospace community including DoD, NASA, FAA, and Industry. Over time and changing environmental conditions, wire insulation can become brittle and crack. The cracks expose the wire conductor and can be a source of equipment failure, short circuits, smoke, and fire. The technique of using the ultrasonic phase spectrum to extract material properties of the insulation is being examined. Ultrasonic guided waves will propagate in both the wire conductor and insulation. Assuming the condition of the conductor remains constant then the stiffness of the insulator can be determined by measuring the ultrasonic guided wave velocity. In the phase spectrum method the guided wave velocity is obtained by transforming the time base waveform to the frequency domain and taking the phase difference between two waveforms. The result can then be correlated with a database, derived by numerical model calculations, to extract material properties of the wire insulator. Initial laboratory tests were performed on a simple model consisting of a solid cylinder and then a solid cylinder with a polymer coating. For each sample the flexural mode waveform was identified. That waveform was then transformed to the frequency domain and a phase spectrum was calculated from a pair of waveforms. Experimental results on the simple model compared well to numerical calculations. Further tests were conducted on aircraft or mil-spec wire samples, to see if changes in wire insulation stiffness can be extracted using the phase spectrum technique.

  10. In vitro biocompatibility of nickel-titanium esthetic orthodontic archwires.

    PubMed

    Rongo, Roberto; Valletta, Rosa; Bucci, Rosaria; Rivieccio, Virginia; Galeotti, Angela; Michelotti, Ambrosina; D'Antò, Vincenzo

    2016-09-01

    To investigate the cytotoxicity of nickel-titanium (NiTi) esthetic orthodontic archwires with different surface coatings. Three fully coated, tooth-colored NiTi wires (BioCosmetic, Titanol Cosmetic, EverWhite), two ion-implanted wires (TMA Purple, Sentalloy High Aesthetic), five uncoated NiTi wires (BioStarter, BioTorque, Titanol Superelastic, Memory Wire Superelastic, and Sentalloy), one β-titanium wire (TMA), and one stainless steel wire (Stainless Steel) were considered for this study. The wire samples were placed at 37°C in airtight test tubes containing Dulbecco's Modified Eagle's Medium (0.1 mg/mL) for 1, 7, 14, and 30 days. The cell viability of human gingival fibroblasts (HGFs) cultured with this medium was assessed by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Data were analyzed by a two-way analysis of variance (α  =  .05). The highest cytotoxic effect was reached on day 30 for all samples. The archwires exhibited a cytotoxicity on HGFs ranging from "none" to "slight," with the exception of the BioTorque, which resulted in moderate cytotoxicity on day 30. Significant differences were found between esthetic archwires and their uncoated pairs only for BioCosmetic (P  =  .001) and EverWhite (P < .001). Under the experimental conditions, all of the NiTi esthetic archwires resulted in slight cytotoxicity, as did the respective uncoated wires. For this reason their clinical use may be considered to have similar risks to the uncoated archwires.

  11. New tension band material for fixation of transverse olecranon fractures: a biomechanical study.

    PubMed

    Lalonde, James Allen; Rabalais, R David; Mansour, Alfred; Burger, Evalina L; Riemer, Barry L; Lu, Yun; Baratta, Richard V

    2005-10-01

    This study tested the use of braided polyethylene cable as an option for repairing transverse olecranon fractures. Six cadaveric elbows underwent a transverse olecranon osteotomy followed by fixation with tension band constructs using 18-gauge wire and Secure-Strand (U.S. Surgical, North Haven, Conn). Distraction forces up to 450 N were applied to the triceps tendon while measuring fracture displacement with an extensometer. The average maximal fracture gap with the standard AO tension band technique using stainless steel wire was 0.66 +/- 0.43 mm, as opposed to 0.68 +/- 0.45 mm with braided polyethylene cable. A paired t test indicated no significant difference between the two materials. These results support the feasibility of braided polyethylene cable as an alternative to the standard steel-wire tension band.

  12. Domain wall structure and interactions in 50 nm wide Cobalt nanowires

    NASA Astrophysics Data System (ADS)

    Tu, Kun-Hua; Ojha, Shuchi; Ross, Caroline A.

    2018-05-01

    Arrays of cobalt nanowires with widths of 50 nm, thickness of 5 and 20 nm and periodicity of 70 nm were fabricated by pattern transfer from a self-assembled block copolymer film. Transverse domain walls (DWs) were imaged by magnetic force microscopy, indicating repulsive interactions between DWs of the same sign in the 20 nm thick wires. Micromagnetic simulations were used to identify the interactions in the six distinct cases of a pair of transverse DWs in adjacent wires, considering all the possible combinations of head-to-head and tail-to-tail DWs and the orientation of the core magnetization. The boundary between repulsive and attractive DW interactions is mapped out for wires as a function of thickness, width and interwire spacing.

  13. Operational verification of a 40-MHz annular array transducer

    PubMed Central

    Ketterling, Jeffrey A.; Ramachandran, Sarayu; Aristizäbal, Orlando

    2006-01-01

    An experimental system to take advantage of the imaging capabilities of a 5-ring polyvinylidene fluoride (PVDF) based annular array is presented. The array has a 6 mm total aperture and a 12 mm geometric focus. The experimental system is designed to pulse a single element of the array and then digitize the received data of all array channels simultaneously. All transmit/receive pairs are digitized and then the data are post-processed with a synthetic focusing technique to achieve an enhanced depth of field (DOF). The performance of the array is experimentally tested with a wire phantom consisting of 25-μm diameter wires diagonally spaced at 1 mm by 1 mm intervals. The phantom permitted the efficacy of the synthetic focusing algorithm to be tested and was also used for two-way beam characterization. Experimental results are compared to a spatial impulse response method beam simulation. After synthetic focusing, the two-way echo amplitude was enhanced over the range of 8 to 19 mm and the 6-dB DOF spanned from 9 to 15 mm. For a wire at a fixed axial depth, the relative time delays between transmit/receive ring pairs agreed with theoretical predictions to within ± 2 ns. To further test the system, B-mode images of an excised bovine eye are rendered. PMID:16555771

  14. In vitro biomechanical analysis of torque capabilities of various 0.018″ lingual bracket-wire systems: total torque play and slot size.

    PubMed

    Daratsianos, Nikolaos; Bourauel, Christoph; Fimmers, Rolf; Jäger, Andreas; Schwestka-Polly, Rainer

    2016-10-01

    To determine the total torque play of various rectangular titanium molybdenum alloy (TMA)/stainless steel (SS) wires in various 0.018″ upper incisor lingual brackets and slot size measurements. TMA (0.0175″ × 0.0175″, 0.0170″ × 0.025″, 0.0182″ × 0.0182″, 0.0182″ × 0.025″) and SS wires (0.016″ × 0.022″, 0.016″ × 0.024″, 0.018″ × 0.025″) were twisted in standard (Hiro, Incognito™, Joy®, Kurz 7th generation, STb™: fixation with elastic modules) and self-ligating brackets (Evolution SLT®, In-Ovation® L MTM: closed ligation mechanism) from -20 degrees to +20 degrees with a custom-made machine. The total torque play was calculated by extrapolating the linear portion of the twist/moment curves to the x-axis and adding the absolute negative and positive angle values at the intercepts. The bracket slot height was measured before and after the experiments with a series of pin gauges with round profile. Brackets in ascending order for total torque play with the most slot-filling wire TMA 0.0182″ × 0.025″: Evolution SLT® (0 degree ± 0 degree), Incognito™ (2.2 degrees ±1.1 degrees), Hiro (5.1 degrees ±3.0 degrees), In-Ovation® L MTM (6.3 degrees ±2.2 degrees), STb™ (6.6 degrees ±1.8 degrees), Kurz 7th generation (7.1 degrees ±0.8 degrees), and Joy® (12.0 degrees ±0.8 degrees). Wires in ascending order for total torque play with the most precise slot Incognito™: TMA 0.0182″ × 0.025″ (2.2 degrees ±1.1 degrees), TMA 0.0182″ × 0.0182″ (2.4 degrees ±0.9 degrees), SS 0.018″ × 0.025″ (5.5 degrees ±1.0 degrees), TMA 0.0170″ × 0.025″ (9.4 degrees ±1.8 degrees), TMA 0.0175″ × 0.0175″ (13.0 degrees ±1.5 degrees), SS 0.016″ × 0.024″ (16.1 degrees ±1.4 degrees), SS 0.016″ × 0.022″ (17.8 degrees ±1.0 degrees); differences between some of the experimental groups were not statistically significant. Bracket slot dimensions in ascending order: Evolution SLT® (less than 0.452mm), Incognito™ (0.460mm ±0.002mm), In-Ovation® L MTM (0.469mm ±0.001mm), Hiro (0.469mm ±0.010mm), STb™ (0.471mm ±0.002mm), Kurz 7th generation (0.473mm ±0.002mm), and Joy® (greater than 0.498mm). The applied method must be questioned when used with brackets with incomplete slot walls (Evolution SLT®). Slot measurement with pin gauges may not register bracket wing deformation. All brackets showed a differing slot size from the nominal 0.018″ (0.457mm). Incognito™ presented the most precise and Joy® the widest slot. The main wires for the retraction phase SS 0.016″ × 0.022″/SS 0.016″ × 0.024″ showed poor torque control. Among the finishing TMA wires, TMA 0.0175″ × 0.0175″ exhibited the highest and TMA 0.0182″ × 0.0182″/TMA 0.0182″ × 0.025″ the smallest torque play. The manufacturers could profit from this investigation towards optimization of the dimensional precision of their products. The orthodontist must be aware of the torque play of the wire-bracket combinations to be able to plan and individualize the appliance by third order customization. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  15. Elliptic jets, part 2. Dynamics of coherent structures: Pairing

    NASA Technical Reports Server (NTRS)

    Husain, Hyder S.; Hussain, Fazle

    1992-01-01

    The dynamics of the jet column mode of vortex pairing in the near field of an elliptic jet was investigated. Hot-wire measurements and flow visualization were used to examine the details of the pairing mechanism of nonplanar vortical elliptic structures and its effect on such turbulence measures as coherent velocities, incoherent turbulence intensities, incoherent and coherent Reynolds, stresses, turbulence production, and mass entrainment. It was found that pairing of elliptic vortices in the jet column does not occur uniformly around the entire perimeter, unlike in a circular jet. Merger occurs only in the initial major-axis plane. In the initial minor-axis plane, the trailing vortex rushes through the leading vortex without pairing and then breaks down violently, producing considerably greater entrainment and mixing than in circular or plane jets.

  16. Stereo matching algorithm based on double components model

    NASA Astrophysics Data System (ADS)

    Zhou, Xiao; Ou, Kejun; Zhao, Jianxin; Mou, Xingang

    2018-03-01

    The tiny wires are the great threat to the safety of the UAV flight. Because they have only several pixels isolated far from the background, while most of the existing stereo matching methods require a certain area of the support region to improve the robustness, or assume the depth dependence of the neighboring pixels to meet requirement of global or semi global optimization method. So there will be some false alarms even failures when images contains tiny wires. A new stereo matching algorithm is approved in the paper based on double components model. According to different texture types the input image is decomposed into two independent component images. One contains only sparse wire texture image and another contains all remaining parts. Different matching schemes are adopted for each component image pairs. Experiment proved that the algorithm can effectively calculate the depth image of complex scene of patrol UAV, which can detect tiny wires besides the large size objects. Compared with the current mainstream method it has obvious advantages.

  17. Highly Conductive Thin Uniform Gold-Coated DNA Nanowires.

    PubMed

    Stern, Avigail; Eidelshtein, Gennady; Zhuravel, Roman; Livshits, Gideon I; Rotem, Dvir; Kotlyar, Alexander; Porath, Danny

    2018-06-01

    Over the past decades, DNA, the carrier of genetic information, has been used by researchers as a structural template material. Watson-Crick base pairing enables the formation of complex 2D and 3D structures from DNA through self-assembly. Various methods have been developed to functionalize these structures for numerous utilities. Metallization of DNA has attracted much attention as a means of forming conductive nanostructures. Nevertheless, most of the metallized DNA wires reported so far suffer from irregularity and lack of end-to-end electrical connectivity. An effective technique for formation of thin gold-coated DNA wires that overcomes these drawbacks is developed and presented here. A conductive atomic force microscopy setup, which is suitable for measuring tens to thousands of nanometer long molecules and wires, is used to characterize these DNA-based nanowires. The wires reported here are the narrowest gold-coated DNA wires that display long-range conductivity. The measurements presented show that the conductivity is limited by defects, and that thicker gold coating reduces the number of defects and increases the conductive length. This preparation method enables the formation of molecular wires with dimensions and uniformity that are much more suitable for DNA-based molecular electronics. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Inclusive Prompt Photons from the Color Glass Condensate at NLO

    NASA Astrophysics Data System (ADS)

    Benić, Sanjin; Fukushima, Kenji; Garcia-Montero, Oscar; Venugopalan, Raju

    2018-05-01

    The cross-section for photons radiated by quarks in proton-nucleus collisions at collider energies was obtained using the Color Glass Condensate framework, in the dense-dilute kinematics regime. We observe that the inclusive photon cross-section is proportional to all-twist Wilson line correlators in the nucleus. These correlators also appear in quark-pair production; unlike the latter, photon production is insensitive to hadronization uncertainties and therefore more sensitive to multi-parton correlations in the gluon saturation regime of QCD.

  19. Photoinduced Charge Shifts and Electron Transfer in Viologen-Tetraphenylborate Complexes: Push-Pull Character of the Exciplex.

    PubMed

    Santos, Willy G; Budkina, Darya S; Deflon, Victor M; Tarnovsky, Alexander N; Cardoso, Daniel R; Forbes, Malcolm D E

    2017-06-14

    Viologen-tetraarylborate ion-pair complexes were prepared and investigated by steady-state and time-resolved spectroscopic techniques such as fluorescence and femtosecond transient absorption. The results highlight a charge transfer transition that leads to changes in the viologen structure in the excited singlet state. Femtosecond transient absorption reveals the formation of excited-state absorption and stimulated emission bands assigned to the planar (k obs < 10 12 s -1 ) and twisted (k obs ∼ 10 10 s -1 ) structures between two pyridinium groups in the viologen ion. An efficient photoinduced electron transfer from the tetraphenylborate anionic moiety to the viologen dication was observed less than 1 μs after excitation. This is a consequence of the push-pull character of the electron donor twisted viologen structure, which helps formation of the borate triplet state. The borate triplet state is deactivated further via a second electron transfer process, generating viologen cation radical (V •+ ).

  20. Spin Physics Experiments at NICA-SPD

    NASA Astrophysics Data System (ADS)

    Kouznetsov, O.; Savin, I.

    2017-01-01

    Nuclotron based Ion Collider fAcility (NICA) is a flagship project of the Joint Institute for Nuclear Research which is expected to be operational by 2021. Main tasks of ;NICA Facility; are study of hot and dense baryonic matter, investigation the polarisation phenomena and the nucleon spin structure. The material presented here based on the Letter of Intent (LoI) dedicated to nucleon spin structure studies at NICA. Measurements of asymmetries in the lepton pair (Drell-Yan) production in collisions of non-polarised, longitudinally and transversely polarised proton and deuteron beams to be performed using the specialized Spin Physics Detector (SPD). These measurements can provide an access to all leading twist collinear and Transverse Momentum Dependent Parton Distribution Functions (TMD PDFs) in nucleons. The measurements of asymmetries in production of J/ψ and direct photons, which supply complimentary information on the nucleon structure, will be performed simultaneously. The set of these measurements permits to tests the quark-parton model of nucleons at the QCD twist-2 level with minimal systematic errors.

  1. High-Power Actuation from Molecular Photoswitches in Enantiomerically Paired Soft Springs.

    PubMed

    Aßhoff, Sarah J; Lancia, Federico; Iamsaard, Supitchaya; Matt, Benjamin; Kudernac, Tibor; Fletcher, Stephen P; Katsonis, Nathalie

    2017-03-13

    Motion in plants often relies on dynamic helical systems as seen in coiling tendrils, spasmoneme springs, and the opening of chiral seedpods. Developing nanotechnology that would allow molecular-level phenomena to drive such movements in artificial systems remains a scientific challenge. Herein, we describe a soft device that uses nanoscale information to mimic seedpod opening. The system exploits a fundamental mechanism of stimuli-responsive deformation in plants, namely that inflexible elements with specific orientations are integrated into a stimuli-responsive matrix. The device is operated by isomerization of a light-responsive molecular switch that drives the twisting of strips of liquid-crystal elastomers. The strips twist in opposite directions and work against each other until the pod pops open from stress. This mechanism allows the photoisomerization of molecular switches to stimulate rapid shape changes at the macroscale and thus to maximize actuation power. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  2. SAMPLING DEVICE FOR pH MEASUREMENT IN PROCESS STREAMS

    DOEpatents

    Michelson, C.E.; Carson, W.N. Jr.

    1958-11-01

    A pH cell is presented for monitoring the hydrogen ion concentration of a fluid in a process stream. The cell is made of glass with a side entry arm just above a reservoir in which the ends of a glass electrode and a reference electrode are situated. The glass electrode contains the usual internal solution which is connected to a lead. The reference electrode is formed of saturated calomel having a salt bridge in its bottom portion fabricated of a porous glass to insure low electrolyte flow. A flush tube leads into the cell through which buffer and flush solutions are introduced. A ground wire twists about both electrode ends to insure constant electrical grounding of the sample. The electrode leads are electrically connected to a pH meter of aay standard type.

  3. Note: A sample holder design for sensitive magnetic measurements at high temperatures in a magnetic properties measurement system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arauzo, A.; Guerrero, E.; Urtizberea, A.

    2012-06-15

    A sample holder design for high temperature measurements in a commercial MPMS SQUID magnetometer from Quantum Design is presented. It fulfills the requirements for the simultaneous use of the oven and reciprocating sample option (RSO) options, thus allowing sensitive magnetic measurements up to 800 K. Alternating current susceptibility can also be measured, since the holder does not induce any phase shift relative to the ac driven field. It is easily fabricated by twisting Constantan Copyright-Sign wires into a braid nesting the sample inside. This design ensures that the sample be placed tightly into a tough holder with its orientation fixed,more » and prevents any sample displacement during the fast movements of the RSO transport, up to high temperatures.« less

  4. SHOCKPROOF MAGNETIC REED SWITCH

    DOEpatents

    Medal, E.

    1962-03-13

    A shockproof magnetic reed switch is described which comprises essentially a plurality of pairs of reed contacts of magnetic, electrical conducting material which are arranged generally in circumferential spaced relationship. At least two of the pairs are disposed to operate at a predetermined angle with respect to each other, and the contacts are wired in the circuit, so that the continuity, or discontinuity, of the circuit is not affected by a shock imposed on the switch. The contacts are hermetically sealed within an outer tubular jacket. (AEC)

  5. Arthroscopic Talar Dome Access Using a Standard Versus Wire-Based Traction Method for Ankle Joint Distraction.

    PubMed

    Barg, Alexej; Saltzman, Charles L; Beals, Timothy C; Bachus, Kent N; Blankenhorn, Brad D; Nickisch, Florian

    2016-07-01

    To evaluate the accessibility of the talar dome through anterior and posterior portals for ankle arthroscopy with the standard noninvasive distraction versus wire-based longitudinal distraction using a tensioned wire placed transversely through the calcaneal tuberosity. Seven matched pairs of thigh-to-foot specimens underwent ankle arthroscopy with 1 of 2 methods of distraction: a standard noninvasive strapping technique or a calcaneal tuberosity wire-based technique. The order of the arthroscopic approach and use of a distraction method was randomly determined. The areas accessed from both 2-portal anterior and 2-portal posterior approaches were determined by using a molded translucent grid. The mean talar surface accessible by anterior ankle arthroscopy was comparable with noninvasive versus calcaneal wire distraction with 57.8% ± 17.2% (range, 32.9% to 75.7%) versus 61.5% ± 15.2% (range, 38.5% to 79.1%) of the talar dome, respectively (P = .590). The use of calcaneal wire distraction significantly improved posterior talar dome accessibility compared with noninvasive distraction, with 56.4% ± 20.0% (range, 14.4% to 78.0%) versus 39.8% ± 14.9% (range, 20.0% to 57.6%) of the talar dome, respectively (P = .031). Under the conditions studied, our cadaveric model showed equivalent talar dome access with 2-portal anterior arthroscopy of calcaneal wire-based distraction versus noninvasive strap distraction, but improved access for 2-portal posterior arthroscopy with calcaneal wire-based distraction versus noninvasive strap distraction. The posterior 40% of the talar dome is difficult to access via anterior ankle arthroscopy. Posterior calcaneal tuberosity wire-based longitudinal distraction improved arthroscopic access to the centro-posterior talar dome with a posterior arthroscopic approach. Published by Elsevier Inc.

  6. A gating grid driver for time projection chambers

    NASA Astrophysics Data System (ADS)

    Tangwancharoen, S.; Lynch, W. G.; Barney, J.; Estee, J.; Shane, R.; Tsang, M. B.; Zhang, Y.; Isobe, T.; Kurata-Nishimura, M.; Murakami, T.; Xiao, Z. G.; Zhang, Y. F.; SπRIT Collaboration

    2017-05-01

    A simple but novel driver system has been developed to operate the wire gating grid of a Time Projection Chamber (TPC). This system connects the wires of the gating grid to its driver via low impedance transmission lines. When the gating grid is open, all wires have the same voltage allowing drift electrons, produced by the ionization of the detector gas molecules, to pass through to the anode wires. When the grid is closed, the wires have alternating higher and lower voltages causing the drift electrons to terminate at the more positive wires. Rapid opening of the gating grid with low pickup noise is achieved by quickly shorting the positive and negative wires to attain the average bias potential with N-type and P-type MOSFET switches. The circuit analysis and simulation software SPICE shows that the driver restores the gating grid voltage to 90% of the opening voltage in less than 0.20 μs, for small values of the termination resistors. When tested in the experimental environment of a time projection chamber larger termination resistors were chosen so that the driver opens the gating grid in 0.35 μs. In each case, opening time is basically characterized by the RC constant given by the resistance of the switches and terminating resistors and the capacitance of the gating grid and its transmission line. By adding a second pair of N-type and P-type MOSFET switches, the gating grid is closed by restoring 99% of the original charges to the wires within 3 μs.

  7. Controlling temperature dependence of silicon waveguide using slot structure.

    PubMed

    Lee, Jong-Moo; Kim, Duk-Jun; Kim, Gwan-Ha; Kwon, O-Kyun; Kim, Kap-Joong; Kim, Gyungock

    2008-02-04

    We show that the temperature dependence of a silicon waveguide can be controlled well by using a slot waveguide structure filled with a polymer material. Without a slot, the amount of temperature-dependent wavelength shift for TE mode of a silicon waveguide ring resonator is very slightly reduced from 77 pm/ degrees C to 66 pm/ degrees C by using a polymer (WIR30-490) upper cladding instead of air upper cladding. With a slot filled with the same polymer, however, the reduction of the temperature dependence is improved by a pronounced amount and can be controlled down to -2 pm/ degrees C by adjusting several variables of the slot structure, such as the width of the slot between the pair of silicon wires, the width of the silicon wire pair, and the height of the silicon slab in our experiment. This measurement proves that a reduction in temperature dependence can be improved about 8 times more by using the slot structure.

  8. A fully relativistic twisted disc around a slowly rotating Kerr black hole: derivation of dynamical equations and the shape of stationary configurations

    NASA Astrophysics Data System (ADS)

    Zhuravlev, V. V.; Ivanov, P. B.

    2011-08-01

    In this paper we derive equations describing the dynamics and stationary configurations of a twisted fully relativistic thin accretion disc around a slowly rotating black hole. We assume that the inclination angle of the disc is small and that the standard relativistic generalization of the α model of accretion discs is valid when the disc is flat. We find that similar to the case of non-relativistic twisted discs the disc dynamics and stationary shapes can be determined by a pair of equations formulated for two complex variables describing the orientation of the disc rings and velocity perturbations induced by the twist. We analyse analytically and numerically the shapes of stationary twisted configurations of accretion discs having non-zero inclinations with respect to the black hole equatorial plane at large distances r from the black hole. It is shown that the stationary configurations depend on two parameters - the viscosity parameter α and the parameter ?, where δ* is the opening angle (δ*˜h/r, where h is the disc half-thickness and r is large) of a flat disc and a is the black hole rotational parameter. When a > 0 and ? the shapes depend drastically on the value of α. When α is small the disc inclination angle oscillates with radius with amplitude and radial frequency of the oscillations dramatically increasing towards the last stable orbit, Rms. When α has a moderately small value the oscillations do not take place but the disc does not align with the equatorial plane at small radii. The disc inclination angle either is increasing towards Rms or exhibits a non-monotonic dependence on the radial coordinate. Finally, when α is sufficiently large the disc aligns with the equatorial plane at small radii. When a < 0 the disc aligns with the equatorial plane for all values of α. The results reported here may have implications for determining the structure and variability of accretion discs close to Rms as well as for modelling of emission spectra coming from different sources, which are supposed to contain black holes.

  9. Design and implementation of a hot-wire probe for simultaneous velocity and vorticity vector measurements in boundary layers

    NASA Astrophysics Data System (ADS)

    Zimmerman, S.; Morrill-Winter, C.; Klewicki, J.

    2017-10-01

    A multi-sensor hot-wire probe for simultaneously measuring all three components of velocity and vorticity in boundary layers has been designed, fabricated and implemented in experiments up to large Reynolds numbers. The probe consists of eight hot-wires, compactly arranged in two pairs of orthogonal ×-wire arrays. The ×-wire sub-arrays are symmetrically configured such that the full velocity and vorticity vectors are resolved about a single central location. During its design phase, the capacity of this sensor to accurately measure each component of velocity and vorticity was first evaluated via a synthetic experiment in a set of well-resolved DNS fields. The synthetic experiments clarified probe geometry effects, allowed assessment of various processing schemes, and predicted the effects of finite wire length and wire separation on turbulence statistics. The probe was subsequently fabricated and employed in large Reynolds number experiments in the Flow Physics Facility wind tunnel at the University of New Hampshire. Comparisons of statistics from the actual probe with those from the simulated sensor exhibit very good agreement in trend, but with some differences in magnitude. These comparisons also reveal that the use of gradient information in processing the probe data can significantly improve the accuracy of the spanwise velocity measurement near the wall. To the authors' knowledge, the present are the largest Reynolds number laboratory-based measurements of all three vorticity components in boundary layers.

  10. Measurement of in vivo stress resultants in neurulation-stage amphibian embryos.

    PubMed

    Benko, Richard; Brodland, G Wayne

    2007-04-01

    In order to obtain the first quantitative measurements of the in vivo stresses in early-stage amphibian embryos, we developed a novel instrument that uses a pair of parallel wires that are glued to the surface of an embryo normal to the direction in which the stress is to be determined. When a slit is made parallel to the wires and between them, tension in the surrounding tissue causes the slit to open. Under computer control, one of the wires is moved so as to restore the original wire spacing, and the steady-state closure force is determined from the degree of wire flexure. A cell-level finite element model is used to convert the wire bending force to an in-plane stress since the wire force is not proportional to the slit length. The device was used to measure stress resultants (force carried per unit of slit length) on the dorsal, ventral and lateral aspects of neurulation-stage axolotl (Ambystoma mexicanum) embryos. The resultants were anisotropic and varied with location and developmental stage, with values ranging from -0.17 mN/m to 1.92 mN/m. In general, the resultants could be decomposed into patterns associated with internal pressure in the embryo, bending of the embryo along its mid-sagittal plane and neural tube closure. The patterns of stress revealed by the experiments support a number of current theories about the mechanics of neurulation.

  11. Galvanic corrosion between orthodontic wires and brackets in fluoride mouthwashes.

    PubMed

    Schiff, Nicolas; Boinet, Mickaël; Morgon, Laurent; Lissac, Michèle; Dalard, Francis; Grosgogeat, Brigitte

    2006-06-01

    The aim of this investigation was to determine the influence of fluoride in certain mouthwashes on the risk of corrosion through galvanic coupling of orthodontic wires and brackets. Two titanium alloy wires, nickel-titanium (NiTi) and copper-nickel-titanium (CuNiTi), and the three most commonly used brackets, titanium (Ti), iron-chromium-nickel (FeCrNi) and cobalt-chromium (CoCr), were tested in a reference solution of Fusayama-Meyer artificial saliva and in two commercially available fluoride (250 ppm) mouthwashes, Elmex and Meridol. Corrosion resistance was assessed by inductively coupled plasma-atomic emission spectrometry (ICP-MS), analysis of released metal ions, and a scanning electron microscope (SEM) study of the metal surfaces after immersion of different wire-bracket pairs in the test solutions. The study was completed by an electrochemical analysis. Meridol mouthwash, which contains stannous fluoride, was the solution in which the NiTi wires coupled with the different brackets showed the highest corrosion risk, while in Elmex mouthwash, which contains sodium fluoride, the CuNiTi wires presented the highest corrosion risk. Such corrosion has two consequences: deterioration in mechanical performance of the wire-bracket system, which would negatively affect the final aesthetic result, and the risk of local allergic reactions caused by released Ni ions. The results suggest that mouthwashes should be prescribed according to the orthodontic materials used. A new type of mouthwash for use during orthodontic therapy could be an interesting development in this field.

  12. Optimal Design of Litz Wire Coils With Sandwich Structure Wirelessly Powering an Artificial Anal Sphincter System.

    PubMed

    Ke, Lei; Yan, Guozheng; Yan, Sheng; Wang, Zhiwu; Li, Xiaoyang

    2015-07-01

    Transcutaneous energy transfer system (TETS) is widely used to energize implantable biomedical devices. As a key part of the TETS, a pair of applicable coils with low losses, high unloaded Q factor, and strong coupling is required to realize an efficient TETS. This article presents an optimal design methodology of planar litz wire coils sandwiched between two ferrite substrates wirelessly powering a novel mechanical artificial anal sphincter system for treating severe fecal incontinence, with focus on the main parameters of the coils such as the wire diameter, number of turns, geometry, and the properties of the ferrite substrate. The theoretical basis of optimal power transfer efficiency in an inductive link was analyzed. A set of analytical expressions are outlined to calculate the winding resistance of a litz wire coil on ferrite substrate, taking into account eddy-current losses, including conduction losses and induction losses. Expressions that describe the geometrical dimension dependence of self- and mutual inductance are derived. The influence of ferrite substrate relative permeability and dimensions is also considered. We have used this foundation to devise an applicable coil design method that starts with a set of realistic constraints and ends with the optimal coil pair geometries. All theoretical predictions are verified with measurements using different types of fabricated coils. The results indicate that the analysis is useful for optimizing the geometry design of windings and the ferrite substrate in a sandwich structure as part of which, in addition to providing design insight, allows speeding up the system efficiency-optimizing design process. Copyright © 2015 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

  13. Universal entanglement crossover of coupled quantum wires

    NASA Astrophysics Data System (ADS)

    Vasseur, Romain; Jacobsen, Jesper; Saleur, Hubert

    2014-03-01

    We consider the entanglement between two one-dimensional quantum wires (Luttinger Liquids) coupled by tunneling through a quantum impurity. The physics of the system involves a crossover between weak and strong coupling regimes characterized by an energy scale TB, and methods of conformal field theory therefore cannot be applied. The evolution of the entanglement in this crossover has led to many numerical studies, but has remained little understood, analytically or even qualitatively. This is, in part, due to the fact that the entanglement in this case is non-perturbative in the tunneling amplitude. We argue that the correct universal scaling form of the entanglement entropy S (for an arbitrary interval containing the impurity) is ∂S / ∂lnL = f(LTB) . In the special case where the coupling to the impurity can be refermionized, we show how the universal function f(LTB) can be obtained analytically using recent results on form factors of twist fields and a defect massless-scattering formalism. Our results are carefully checked against numerical simulations. This work was supported by the the French ANR (ANR Projet 2010 Blanc SIMI 4 : DIME), the US DOE (grant number DE-FG03-01ER45908), the Quantum Materials program of LBNL (RV) and the Institut Universitaire de France (JLJ).

  14. Test of a flexible spacecraft dynamics simulator

    NASA Technical Reports Server (NTRS)

    Dichmann, Donald; Sedlak, Joseph

    1998-01-01

    There are a number of approaches one can take to modeling the dynamics of a flexible body. While one can attempt to capture the full dynamical behavior subject to disturbances from actuators and environmental torques, such a detailed description often is unnecessary. Simplification is possible either by limiting the amplitude of motion to permit linearization of the dynamics equations or by restricting the types of allowed motion. In this work, we study the nonlinear dynamics of bending deformations of wire booms on spinning spacecraft. The theory allows for large amplitude excursions from equilibrium while enforcing constraints on the dynamics to prohibit those modes that are physically less relevant or are expected to damp out fast. These constraints explicitly remove the acoustic modes (i.e., longitudinal sound waves and shear waves) while allowing for arbitrary bending and twisting, motions which typically are of lower frequency. As a test case, a spin axis reorientation maneuver by the Polar Plasma Laboratory (POLAR) spacecraft has been simulated. POLAR was chosen as a representative spacecraft because it has flexible wire antennas that extend to a length of 65 meters. Bending deformations in these antennas could be quite large and have a significant effect on the attitude dynamics of the spacecraft body. Summary results from the simulation are presented along, with a comparison with POLAR flight data.

  15. Fatigue resistance of engine-driven rotary nickel-titanium instruments produced by new manufacturing methods.

    PubMed

    Gambarini, Gianluca; Grande, Nicola Maria; Plotino, Gianluca; Somma, Francesco; Garala, Manish; De Luca, Massimo; Testarelli, Luca

    2008-08-01

    The aim of the present study was to investigate whether cyclic fatigue resistance is increased for nickel-titanium instruments manufactured by using new processes. This was evaluated by comparing instruments produced by using the twisted method (TF; SybronEndo, Orange, CA) and those using the M-wire alloy (GTX; Dentsply Tulsa-Dental Specialties, Tulsa, OK) with instruments produced by a traditional NiTi grinding process (K3, SybronEndo). Tests were performed with a specific cyclic fatigue device that evaluated cycles to failure of rotary instruments inside curved artificial canals. Results indicated that size 06-25 TF instruments showed a significant increase (p < 0.05) in the mean number of cycles to failure when compared with size 06-25 K3 files. Size 06-20 K3 instruments showed no significant increase (p > 0.05) in the mean number of cycles to failure when compared with size 06-20 GT series X instruments. The new manufacturing process produced nickel-titanium rotary files (TF) significantly more resistant to fatigue than instruments produced with the traditional NiTi grinding process. Instruments produced with M-wire (GTX) were not found to be more resistant to fatigue than instruments produced with the traditional NiTi grinding process.

  16. The Development of an IMU Integrated Clothes for Postural Monitoring Using Conductive Yarn and Interconnecting Technology.

    PubMed

    Kang, Sung-Won; Choi, Hyeob; Park, Hyung-Il; Choi, Byoung-Gun; Im, Hyobin; Shin, Dongjun; Jung, Young-Giu; Lee, Jun-Young; Park, Hong-Won; Park, Sukyung; Roh, Jung-Sim

    2017-11-07

    Spinal disease is a common yet important condition that occurs because of inappropriate posture. Prevention could be achieved by continuous posture monitoring, but most measurement systems cannot be used in daily life due to factors such as burdensome wires and large sensing modules. To improve upon these weaknesses, we developed comfortable "smart wear" for posture measurement using conductive yarn for circuit patterning and a flexible printed circuit board (FPCB) for interconnections. The conductive yarn was made by twisting polyester yarn and metal filaments, and the resistance per unit length was about 0.05 Ω/cm. An embroidered circuit was made using the conductive yarn, which showed increased yield strength and uniform electrical resistance per unit length. Circuit networks of sensors and FPCBs for interconnection were integrated into clothes using a computer numerical control (CNC) embroidery process. The system was calibrated and verified by comparing the values measured by the smart wear with those measured by a motion capture camera system. Six subjects performed fixed movements and free computer work, and, with this system, we were able to measure the anterior/posterior direction tilt angle with an error of less than 4°. The smart wear does not have excessive wires, and its structure will be optimized for better posture estimation in a later study.

  17. Cassini UVIS Observations of Saturn during the Grand Finale Orbits

    NASA Astrophysics Data System (ADS)

    Pryor, W. R.; Esposito, L. W.; West, R. A.; Jouchoux, A.; Radioti, A.; Grodent, D. C.; Gerard, J. C. M. C.; Gustin, J.; Lamy, L.; Badman, S. V.

    2017-12-01

    In 2016 and 2017, the Cassini Saturn orbiter executed a final series of high inclination, low-periapsis orbits ideal for studies of Saturn's polar regions. The Cassini Ultraviolet Imaging Spectrograph (UVIS) obtained an extensive set of auroral images, some at the highest spatial resolution obtained during Cassini's long orbital mission (2004-2017). In some cases, two or three spacecraft slews at right angles to the long slit of the spectrograph were required to cover the entire auroral region to form auroral images. We will present selected images from this set showing narrow arcs of emission, more diffuse auroral emissions, multiple auroral arcs in a single image, discrete spots of emission, small scale vortices, large-scale spiral forms, and parallel linear features that appear to cross in places like twisted wires. Some shorter features are transverse to the main auroral arcs, like barbs on a wire. UVIS observations were in some cases simultaneous with auroral observations from the Hubble Space Telescope Space Telescope Imaging Spectrograph (STIS) that will also be presented. UVIS polar images also contain spectral information suitable for studies of the auroral electron energy distribution. The long wavelength part of the UVIS polar images contains a signal from reflected sunlight containing absorption signatures of acetylene and other Saturn hydrocarbons. The hydrocarbon spatial distribution will also be examined.

  18. Development of Ground Coils with Low Eddy Current Loss by Applying the Compression Molding Method after the Coil Winding

    NASA Astrophysics Data System (ADS)

    Suzuki, Masao; Aiba, Masayuki; Takahashi, Noriyuki; Ota, Satoru; Okada, Shigenori

    In a magnetically levitated transportation (MAGLEV) system, a huge number of ground coils will be required because they must be laid for the whole line. Therefore, stable performance and reduced cost are essential requirements for the ground coil development. On the other hand, because the magnetic field changes when the superconducting magnet passes by, an eddy current will be generated in the conductor of the ground coil and will result in energy loss. The loss not only increases the magnetic resistance for the train running but also brings an increase in the ground coil temperature. Therefore, the reduction of the eddy current loss is extremely important. This study examined ground coils in which both the eddy current loss and temperature increase were small. Furthermore, quantitative comparison for the eddy current loss of various magnet wire samples was performed by bench test. On the basis of the comparison, a round twisted wire having low eddy current loss was selected as an effective ground coil material. In addition, the ground coils were manufactured on trial. A favorable outlook to improve the size accuracy of the winding coil and uneven thickness of molded resin was obtained without reducing the insulation strength between the coil layers by applying a compression molding after winding.

  19. Integrated Services Digital Network

    DTIC Science & Technology

    1992-01-01

    users. " Pair Gain • ISDN’s capability to deliver multiple communications channels over a limited set of wires (as in 2B+D service or pasive bus...configuration commands to devices encountered in a communications path, is not yet a reality at Redstone. But for that matter , transparent connectivity

  20. Flexible Bond Wire Capacitive Strain Sensor for Vehicle Tyres.

    PubMed

    Cao, Siyang; Pyatt, Simon; Anthony, Carl J; Kubba, Ammar I; Kubba, Ali E; Olatunbosun, Oluremi

    2016-06-21

    The safety of the driving experience and manoeuvrability of a vehicle can be improved by detecting the strain in tyres. To measure strain accurately in rubber, the strain sensor needs to be flexible so that it does not deform the medium that it is measuring. In this work, a novel flexible bond wire capacitive strain sensor for measuring the strain in tyres is developed, fabricated and calibrated. An array of 25 micron diameter wire bonds in an approximately 8 mm × 8 mm area is built to create an interdigitated structure, which consists of 50 wire loops resulting in 49 capacitor pairs in parallel. Laser machining was used to pattern copper on a flexible printed circuit board PCB to make the bond pads for the wire attachment. The wire array was finally packaged and embedded in polydimethylsiloxane (PDMS), which acts as the structural material that is strained. The capacitance of the device is in a linear like relationship with respect to the strain, which can measure the strain up to at least ±60,000 micro-strain (±6%) with a resolution of ~132 micro-strain (0.013%). In-tyre testing under static loading has shown the ability of the sensor to measure large tyre strains. The technology used for sensor fabrication lends itself to mass production and so the design is considered to be consistent with low cost commercialisable strain sensing technology.

  1. Nickel-titanium alloys: stress-related temperature transitional range.

    PubMed

    Santoro, M; Beshers, D N

    2000-12-01

    The inducement of mechanical stress within nickel-titanium wires can influence the transitional temperature range of the alloy and therefore the expression of the superelastic properties. An analogous variation of the transitional temperature range may be expected during orthodontic therapy, when the archwires are engaged into the brackets. To investigate this possibility, samples of currently used orthodontic nickel-titanium wires (Sentalloy, GAC; Copper Ni-Ti superelastic at 27 degrees C, 35 degrees C, 40 degrees C, Ormco; Nitinol Heat-Activated, 3M-Unitek) were subjected to temperature cycles ranging between 4 degrees C and 60 degrees C. The wires were mounted in a plexiglass loading device designed to simulate clinical situations of minimum and severe dental crowding. Electrical resistivity was used to monitor the phase transformations. The data were analyzed with paired t tests. The results confirmed the presence of displacements of the transitional temperature ranges toward higher temperatures when stress was induced. Because nickel-titanium wires are most commonly used during the aligning stage in cases of severe dental crowding, particular attention was given to the performance of the orthodontic wires under maximum loading. An alloy with a stress-related transitional temperature range corresponding to the fluctuations of the oral temperature should express superelastic properties more consistently than others. According to our results, Copper Ni-Ti 27 degrees C and Nitinol Heat-Activated wires may be considered suitable alloys for the alignment stage.

  2. Lower incisor intrusion with intraoral transosseous stainless steel wire anchorage in rabbits.

    PubMed

    Wu, Jian-chao; Huang, Ji-na; Lin, Xin-ping

    2010-06-01

    The purpose of this research was to investigate the potential use of intraoral transosseous stainless steel wires as anchorage for intrusion of the lower incisors using a rabbit model. Placement of intraoral transosseous stainless steel wires around incisors is similar to that of intraoral transosseous wiring of edentulous mandibular fractures. Ten male New Zealand rabbits, 9 +/- 1.5 months of age, average weight 1.8 +/- 0.3 kg, were used in this study. One lower incisor was intruded with a 50 g bilateral force using a coil spring for 10 weeks, while the other incisor served as the control. Clinical measurements of the distances between the occlusal edges of the incisors (EE) were performed weekly with a calliper. In addition to standard descriptive statistical calculations, a paired Student's t-test was used for comparison of the two groups. All surgical sites healed uneventfully after insertion of the wires. Significant differences were found in the change of EE between the experimental and control sides from 4 weeks onwards. Intrusion of the incisor, 4 +/- 0.58 mm, was seen on the test side, while EE on the control side remained unchanged. Within the limits of this animal study, it is concluded that the intraoral transosseous stainless steel wire anchorage system is a cost-effective method for intrusion of lower incisors when the use of other anchorage system is not possible.

  3. Flexible Bond Wire Capacitive Strain Sensor for Vehicle Tyres

    PubMed Central

    Cao, Siyang; Pyatt, Simon; Anthony, Carl J.; Kubba, Ammar I.; Kubba, Ali E.; Olatunbosun, Oluremi

    2016-01-01

    The safety of the driving experience and manoeuvrability of a vehicle can be improved by detecting the strain in tyres. To measure strain accurately in rubber, the strain sensor needs to be flexible so that it does not deform the medium that it is measuring. In this work, a novel flexible bond wire capacitive strain sensor for measuring the strain in tyres is developed, fabricated and calibrated. An array of 25 micron diameter wire bonds in an approximately 8 mm × 8 mm area is built to create an interdigitated structure, which consists of 50 wire loops resulting in 49 capacitor pairs in parallel. Laser machining was used to pattern copper on a flexible printed circuit board PCB to make the bond pads for the wire attachment. The wire array was finally packaged and embedded in polydimethylsiloxane (PDMS), which acts as the structural material that is strained. The capacitance of the device is in a linear like relationship with respect to the strain, which can measure the strain up to at least ±60,000 micro-strain (±6%) with a resolution of ~132 micro-strain (0.013%). In-tyre testing under static loading has shown the ability of the sensor to measure large tyre strains. The technology used for sensor fabrication lends itself to mass production and so the design is considered to be consistent with low cost commercialisable strain sensing technology. PMID:27338402

  4. Remote two-wire data entry method and device

    DOEpatents

    Kronberg, James W.

    1995-01-01

    A device for detecting switch closure such as in a keypad for entering data comprising a matrix of conductor pairs and switches, each pair of conductors shorted by the pressing of a particular switch, and current-regulating devices on each conductor for limiting current in one direction and passing it without limit in the other direction. The device is driven by alternating current. The ends of the conductors in a conductor pair limit current of opposing polarities with respect to each other so that the signal on a shorted pair is an alternating current signal with a unique combination of a positive and a negative peak, which, when analyzed, allows the determination of which key was pressed. The binary identification of the pressed key is passed to the input port of a host device.

  5. Thermal Hydraulic Computational Fluid Dynamics Simulations and Experimental Investigation of Deformed Fuel Assemblies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mays, Brian; Jackson, R. Brian

    2017-03-08

    The project, Toward a Longer Life Core: Thermal Hydraulic CFD Simulations and Experimental Investigation of Deformed Fuel Assemblies, DOE Project code DE-NE0008321, was a verification and validation project for flow and heat transfer through wire wrapped simulated liquid metal fuel assemblies that included both experiments and computational fluid dynamics simulations of those experiments. This project was a two year collaboration between AREVA, TerraPower, Argonne National Laboratory and Texas A&M University. Experiments were performed by AREVA and Texas A&M University. Numerical simulations of these experiments were performed by TerraPower and Argonne National Lab. Project management was performed by AREVA Federal Services.more » The first of a kind project resulted in the production of both local point temperature measurements and local flow mixing experiment data paired with numerical simulation benchmarking of the experiments. The project experiments included the largest wire-wrapped pin assembly Mass Index of Refraction (MIR) experiment in the world, the first known wire-wrapped assembly experiment with deformed duct geometries and the largest numerical simulations ever produced for wire-wrapped bundles.« less

  6. Sensors for Using Times of Flight to Measure Flow Velocities

    NASA Technical Reports Server (NTRS)

    Fralick, Gutave; Wrbanek, John D.; Hwang, Danny; Turso, James

    2006-01-01

    Thin-film sensors for measuring flow velocities in terms of times of flight are undergoing development. These sensors are very small and can be mounted flush with surfaces of airfoils, ducts, and other objects along which one might need to measure flows. Alternatively or in addition, these sensors can be mounted on small struts protruding from such surfaces for acquiring velocity measurements at various distances from the surfaces for the purpose of obtaining boundary-layer flow-velocity profiles. These sensors are related to, but not the same as, hot-wire anemometers. Each sensor includes a thin-film, electrically conductive loop, along which an electric current is made to flow to heat the loop to a temperature above that of the surrounding fluid. Instantaneous voltage fluctuations in segments of the loop are measured by means of electrical taps placed at intervals along the loop. These voltage fluctuations are caused by local fluctuations in electrical resistance that are, in turn, caused by local temperature fluctuations that are, in turn, caused by fluctuations in flow-induced cooling and, hence, in flow velocity. The differential voltage as a function of time, measured at each pair of taps, is subjected to cross-correlation processing with the corresponding quantities measured at other pairs of taps at different locations on the loop. The cross-correlations yield the times taken by elements of fluid to travel between the pairs of taps. Then the component of velocity along the line between any two pairs of taps is calculated simply as the distance between the pairs of taps divided by the travel time. Unlike in the case of hot-wire anemometers, there is no need to obtain calibration data on voltage fluctuations versus velocity fluctuations because, at least in principle, the correlation times are independent of the calibration data.

  7. Spin-polarized current in Zeeman-split d-wave superconductor/quantum wire junctions

    NASA Astrophysics Data System (ADS)

    Emamipour, Hamidreza

    2016-06-01

    We study a thin-film quantum wire/unconventional superconductor junction in the presence of an intrinsic exchange field for a d-wave symmetry of the superconducting order parameter. A strongly spin-polarized current is generated due to an interplay between Zeeman splitting of bands and the nodal structure of the superconducting order parameter. We show that strongly spin-polarized current is achievable for both metallic and tunnel junctions. This is because of the presence of a quantum wire (one-dimensional metal) in our junction. While in two-dimensional junctions with both conventional [F. Giazotto, F. Taddei, Phys. Rev. B 77 (2008) 132501] and unconventional [J. Linder, T. Yokoyama, Y. Tanaka, A. Sudbo, Phys. Rev. B 78 (2008) 014516] pairing states, highly spin polarized current takes place just for a tunnel junction. Also, the obtained spin-polarized current is tunable in sign and magnitude in terms of exchange field and applied bias voltage.

  8. Crystal structure of methyl 3'-benzamido-4'-(4-meth-oxy-phen-yl)-1'-methyl-spiro-[indeno-[1,2-b]quinoxaline-11,2'-pyrrolidine]-3'-carboxyl-ate.

    PubMed

    Chandralekha, Kuppan; Sureshbabu, Adukamparai Rajukrishnan; Gavaskar, Deivasigamani; Lakshmi, Srinivasakannan

    2016-09-01

    In the title compound, C 35 H 30 N 4 O 3 , the spiro C atom connects the five-membered pyrrolidine ring and the indeno-quinoxaline ring system. The pyrrolidine ring adopts a twist conformation. An intra-molecular N-H⋯N inter-action between the amino group and the pyrazine ring is observed. In the crystal, mol-ecules are linked by a pairs of C-H⋯O hydrogen bonds, forming inversion dimers.

  9. Functional asymmetry of posture and body system regulation

    NASA Technical Reports Server (NTRS)

    Boloban, V. N.; Otsupok, A. P.

    1980-01-01

    The manifestation of functional asymmetry during the regulation of an athlete's posture and a system of bodies and its effect on the execution of individual and group acrobatic exercises were studied. Functional asymmetry of posture regulation was recorded in acrobats during the execution of individual and group exercises. It was shown that stability is maintained at the expense of bending and twisting motions. It is important to consider whether the functional asymmetry of posture regulation is left or right sided in making up pairs and groups of acrobats.

  10. Pilot usage of decoupled flight path and pitch controls

    NASA Technical Reports Server (NTRS)

    Berkhout, J.; Osgood, R.; Berry, D.

    1985-01-01

    Data from decoupled flight maneuvers have been collected and analyzed for four AFTI-F-16 pilots operating this aircraft's highly augmented fly-by-wire control system, in order to obtain spectral density, cross spectra, and Bode amplitude data, as well as coherences and phase angles for the two longitudinal axis control functions of each of 50 20-sec epochs. The analysis of each epoch yielded five distinct plotted parameters for the left hand twist grip and right hand sidestick controller output time series. These two control devices allow the left hand to generate vertical translation, direct lift, or pitch-pointing commands that are decoupled from those of the right hand. Attention is given to the control patterns obtained for decoupled normal flight, air-to-air gun engagement decoupled maneuvering, and decoupled air-to-surface bombing run maneuvering.

  11. Evaluation of surface characteristics of rotary nickel-titanium instruments produced by different manufacturing methods.

    PubMed

    Inan, U; Gurel, M

    2017-02-01

    Instrument fracture is a serious concern in endodontic practice. The aim of this study was to investigate the surface quality of new and used rotary nickel-titanium (NiTi) instruments manufactured by the traditional grinding process and twisting methods. Total 16 instruments of two rotary NiTi systems were used in this study. Eight Twisted Files (TF) (SybronEndo, Orange, CA, USA) and 8 Mtwo (VDW, Munich, Germany) instruments were evaluated. New and used of 4 experimental groups were evaluated using an atomic force microscopy (AFM). New and used instruments were analyzed on 3 points along a 3 mm. section at the tip of the instrument. Quantitative measurements according to the topographical deviations were recorded. The data were statistically analyzed with paired samples t-test and independent samples t-test. Mean root mean square (RMS) values for new and used TF 25.06 files were 10.70 ± 2.80 nm and 21.58 ± 6.42 nm, respectively, and the difference between them was statistically significant (P < 0.05). Mean RMS values for new and used Mtwo 25.06 files were 24.16 ± 9.30 nm and 39.15 ± 16.20 nm respectively, the difference between them also was statistically significant (P < 0.05). According to the AFM analysis, instruments produced by twisting method (TF 25.06) had better surface quality than the instruments produced by traditional grinding process (Mtwo 25.06 files).

  12. Structure and Mobility of Dissociated Vacancies at Twist Grain Boundaries and Screw Dislocations in Ionic Rocksalt Compounds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kolluri, Kedarnath; Martinez Saez, Enrique; Uberuaga, Blas Pedro

    Interfaces, grain boundaries, and dislocations are known to have significant impact on the transport properties of materials. Even so, it is still not clear how the structure of interfaces influences the mobility and concentration of carriers that are responsible for transport. Using low angle twist grain boundaries in MgO as a model system, we examine the structural and kinetic properties of vacancies. These boundaries are characterized by a network of screw dislocations. Vacancies of both types, Mg and O, are strongly attracted to the dislocation network, residing preferentially at the misfit dislocation intersections (MDIs). However, the vacancies can lower theirmore » energy by splitting into two parts, which then repel each other along the dislocation line between two MDIs, further lowering their energy. This dissociated structure has important consequences for transport, as the free energy of the dissociated vacancies decreases with decreasing twist angle, leading to an increase in the net migration barrier for diffusion as revealed by molecular dynamics simulations. Similar behavior is observed in BaO and NaCl, highlighting the generality of the behavior. Finally, we analyze the structure of the dissociated vacancies as a pair of jogs on the dislocation and construct a model containing electrostatic and elastic contributions that qualitatively describe the energetics of the dissociated vacancy. Our results represent the first validation of a mechanism for vacancy dissociation on screw dislocations in ionic materials first discussed by Thomson and Balluffi in 1962.« less

  13. Structure and Mobility of Dissociated Vacancies at Twist Grain Boundaries and Screw Dislocations in Ionic Rocksalt Compounds

    DOE PAGES

    Kolluri, Kedarnath; Martinez Saez, Enrique; Uberuaga, Blas Pedro

    2018-03-05

    Interfaces, grain boundaries, and dislocations are known to have significant impact on the transport properties of materials. Even so, it is still not clear how the structure of interfaces influences the mobility and concentration of carriers that are responsible for transport. Using low angle twist grain boundaries in MgO as a model system, we examine the structural and kinetic properties of vacancies. These boundaries are characterized by a network of screw dislocations. Vacancies of both types, Mg and O, are strongly attracted to the dislocation network, residing preferentially at the misfit dislocation intersections (MDIs). However, the vacancies can lower theirmore » energy by splitting into two parts, which then repel each other along the dislocation line between two MDIs, further lowering their energy. This dissociated structure has important consequences for transport, as the free energy of the dissociated vacancies decreases with decreasing twist angle, leading to an increase in the net migration barrier for diffusion as revealed by molecular dynamics simulations. Similar behavior is observed in BaO and NaCl, highlighting the generality of the behavior. Finally, we analyze the structure of the dissociated vacancies as a pair of jogs on the dislocation and construct a model containing electrostatic and elastic contributions that qualitatively describe the energetics of the dissociated vacancy. Our results represent the first validation of a mechanism for vacancy dissociation on screw dislocations in ionic materials first discussed by Thomson and Balluffi in 1962.« less

  14. Vortex/boundary layer interactions

    NASA Technical Reports Server (NTRS)

    Cutler, A. D.; Bradshaw, P.

    1989-01-01

    Detailed and high quality measurements with hot-wires and pressure probes are presented for two different interactions between a vortex pair with common flow down and a turbulent boundary layer. The interactions studied have larger values of the vortex circulation parameter than those studied previously. The results indicate that the boundary layer under the vortex pair is thinned by lateral divergence and that boundary layer fluid is entrained into the vortex. The effect of the interaction on the vortex core (other than the inviscid effect of the image vortices behind the surface) is small.

  15. Temperature gating and competing temperature-dependent effects in DNA molecular wires

    NASA Astrophysics Data System (ADS)

    Wibowo, Denni; Narenji, Alaleh; Kassegne, Sam

    2017-02-01

    While recent research in electron-transport mechanism on a double strands DNA seems to converge into a consensus, experiments in direct electrical measurements on a long DNA molecules still lead to a conflicting result This study is the continuation of our previous research in electrical characterization of DNA molecular wires, where we furtherly investigate the effects of temperature on the electrical conductivity of DNA molecular wires by measuring its impedance response. We found that at higher temperatures, the expected increase in charge hopping mechanism may account for the decrease in impedance (and hence increase in conductivity) supporting the 'charge hopping mechanism' theory. UV light exposure, on the other hand, causes damage to GC base pairs reducing the path available for hopping mechanism and hence resulting in increased impedance - this again supporting the 'charge hopping mechanism' theory. We also report that λ-DNA molecular wires have differing impedance responses at two temperature regimes: impedance increases between 4 °C - 40 °C and then decreases between 40 °C - melting point (˜110 °C), after which λ-DNA denatures resulting in no current transduction. We submit that the low impedance of λ-DNA molecular wires observed at moderate to high frequencies may have significant implications to the field of DNA-based bionanoelectronics.

  16. X-ray-structure of a cytidylyl-3',5'-adenosine-proflavine complex: a self-paired parallel-chain double helical dimer with an intercalated acridine dye.

    PubMed Central

    Westhof, E; Sundaralingam, M

    1980-01-01

    The non-self-complementary dinucleoside monophosphate cytidylyl-3',5'-adenosine (CpA) forms a base-paired parallel-chain dimer with an intercalated proflavine. The dimer complex possesses a right-handed helical twist. The dimer helix has an irregular girth with a neutral adenine-adenine (A-A) pair, hydrogen-bonded through the N6 and N7 sites (C1'...C1' separation of 10.97 A), and a triply hydrogen-bonded protonated cytosine-cytosine (C-C) pair with a proton shared between the base N3 sites (Cl'...Cl' separation of 9.59 A). The torsion angles of the sugar-phosphate backbone are within their most preferred ranges and the sugar puckering sequence (5' leads to 3') is C3'-endo, C2'-endo. There is also a second proflavine molecule sandwiched between CpA dimers on the 21-axis. Both proflavines are necessarily disordered, being on dyad axis, and this suggests possible insights into the dynamics of intercalation of planar drugs. This structure shows that intercalation of planar drugs in nucleic acids may not be restricted to antiparallel complementary Watson-Crick pairing regions and provides additional mechanisms for acridine mutagenesis. PMID:6929524

  17. Sequence-dependent effects in drug-DNA interaction: the crystal structure of Hoechst 33258 bound to the d(CGCAAATTTGCG)2 duplex.

    PubMed Central

    Spink, N; Brown, D G; Skelly, J V; Neidle, S

    1994-01-01

    The bis-benzimidazole drug Hoechst 33258 has been co-crystallized with the dodecanucleotide sequence d(CGCAAATTTGCG)2. The structure has been solved by molecular replacement and refined to an R factor of 18.5% for 2125 reflections collected on a Xentronics area detector. The drug is bound in the minor groove, at the five base-pair site 5'-ATTTG and is in a unique orientation. This is displaced by one base pair in the 5' direction compared to previously-determined structures of this drug with the sequence d(CGCGAATTCGCG)2. Reasons for this difference in behaviour are discussed in terms of several sequence-dependent structural features of the DNA, with particular reference to differences in propeller twist and minor-groove width. Images PMID:7515488

  18. Josephson junctions of multiple superconducting wires

    NASA Astrophysics Data System (ADS)

    Deb, Oindrila; Sengupta, K.; Sen, Diptiman

    2018-05-01

    We study the spectrum of Andreev bound states and Josephson currents across a junction of N superconducting wires which may have s - or p -wave pairing symmetries and develop a scattering matrix based formalism which allows us to address transport across such junctions. For N ≥3 , it is well known that Berry curvature terms contribute to the Josephson currents; we chart out situations where such terms can have relatively large effects. For a system of three s -wave or three p -wave superconductors, we provide analytic expressions for the Andreev bound-state energies and study the Josephson currents in response to a constant voltage applied across one of the wires; we find that the integrated transconductance at zero temperature is quantized to integer multiples of 4 e2/h , where e is the electron charge and h =2 π ℏ is Planck's constant. For a sinusoidal current with frequency ω applied across one of the wires in the junction, we find that Shapiro plateaus appear in the time-averaged voltage across that wire for any rational fractional multiple (in contrast to only integer multiples in junctions of two wires) of 2 e /(ℏ ω ) . We also use our formalism to study junctions of two p -wave and one s -wave wires. We find that the corresponding Andreev bound-state energies depend on the spin of the Bogoliubov quasiparticles; this produces a net magnetic moment in such junctions. The time variation of these magnetic moments may be controlled by an external voltage applied across the junction. We discuss experiments which may test our theory.

  19. Three-dimensional quantification of pretorqued nickel-titanium wires in edgewise and prescription brackets.

    PubMed

    Mittal, Nitika; Xia, Zeyang; Chen, Jie; Stewart, Kelton T; Liu, Sean Shih-Yao

    2013-05-01

    To quantify the three-dimensional moments and forces produced by pretorqued nickel-titanium (NiTi) rectangular archwires fully engaged in 0.018- and 0.022-inch slots of central incisor and molar edgewise and prescription brackets. Ten identical acrylic dental models with retroclined maxillary incisors were fabricated for bonding with various bracket-wire combinations. Edgewise, Roth, and MBT brackets with 0.018- and 0.022-inch slots were bonded in a simulated 2 × 4 clinical scenario. The left central incisor and molar were sectioned and attached to load cells. Correspondingly sized straight and pretorqued NiTi archwires were ligated to the brackets using 0.010-inch ligatures. Each load cell simultaneously measured three force (Fx, Fy, Fz) and three moment (Mx, My, Mz) components. The faciolingual, mesiodistal, and inciso-occluso/apical axes of the teeth corresponded to the x, y, and z axes of the load cells, respectively. Each wire was removed and retested seven times. Three-way analysis of variance (ANOVA) examined the effects of wire type, wire size, and bracket type on the measured orthodontic load systems. Interactions among the three effects were examined and pair-wise comparisons between significant combinations were performed. The force and moment components on each tooth were quantified according to their local coordinate axes. The three-way ANOVA interaction terms were significant for all force and moment measurements (P < .05), except for Fy (P > .05). The pretorqued wire generates a significantly larger incisor facial crown torquing moment in the MBT prescription compared to Roth, edgewise, and the straight NiTi wire.

  20. α-Synuclein Amyloid Fibrils with Two Entwined, Asymmetrically Associated Protofibrils*

    PubMed Central

    Dearborn, Altaira D.; Wall, Joseph S.; Cheng, Naiqian; Heymann, J. Bernard; Kajava, Andrey V.; Varkey, Jobin; Langen, Ralf; Steven, Alasdair C.

    2016-01-01

    Parkinson disease and other progressive neurodegenerative conditions are characterized by the intracerebral presence of Lewy bodies, containing amyloid fibrils of α-synuclein. We used cryo-electron microscopy and scanning transmission electron microscopy (STEM) to study in vitro-assembled fibrils. These fibrils are highly polymorphic. Focusing on twisting fibrils with an inter-crossover spacing of 77 nm, our reconstructions showed them to consist of paired protofibrils. STEM mass per length data gave one subunit per 0.47 nm axial rise per protofibril, consistent with a superpleated β-structure. The STEM images show two thread-like densities running along each of these fibrils, which we interpret as ladders of metal ions. These threads confirmed the two-protofibril architecture of the 77-nm twisting fibrils and allowed us to identify this morphotype in STEM micrographs. Some other, but not all, fibril morphotypes also exhibit dense threads, implying that they also present a putative metal binding site. We propose a molecular model for the protofibril and suggest that polymorphic variant fibrils have different numbers of protofibrils that are associated differently. PMID:26644467

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Benic, Sanjin; Fukushima, Kenji; Garcia-Montero, Oscar

    Here, we compute the cross section for photons emitted from sea quarks in proton-nucleus collisions at collider energies. The computation is performed within the dilute-dense kinematics of the Color Glass Condensate (CGC) effective field theory. Albeit the result obtained is formally at next-to-leading order in the CGC power counting, it provides the dominant contribution for central rapidities. We observe that the inclusive photon cross section is proportional to all-twist Wilson line correlators in the nucleus. These correlators also appear in quark-pair production; unlike the latter, photon production is insensitive to hadronization uncertainties and therefore more sensitive to multi-parton correlations inmore » the gluon saturation regime of QCD. We demonstrate that k ⊥ and collinear factorized expressions for inclusive photon production are obtained as leading twist approximations to our result. In particular, the collinearly factorized expression is directly sensitive to the nuclear gluon distribution at small x. Other results of interest include the realization of the Low-Burnett-Kroll soft photon theorem in the CGC framework and a comparative study of how the photon amplitude is obtained in Lorenz and light-cone gauges.« less

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dearborn, Altaira D.; Wall, Joseph S.; Cheng, Naiqian

    Parkinson disease and other progressive neurodegenerative conditions are characterized by the intracerebral presence of Lewy bodies, containing amyloid fibrils of α-synuclein. We used cryo-electron microscopy and scanning transmission electron microscopy (STEM) to study in vitro-assembled fibrils. These fibrils are highly polymorphic. Focusing on twisting fibrils with an inter-crossover spacing of 77 nm, our reconstructions showed them to consist of paired protofibrils. STEM mass per length data gave one subunit per 0.47 nm axial rise per protofibril, consistent with a superpleated β-structure. The STEM images show two thread-like densities running along each of these fibrils, which we interpret as ladders ofmore » metal ions. These threads confirmed the two-protofibril architecture of the 77-nm twisting fibrils and allowed us to identify this morphotype in STEM micrographs. Some other, but not all, fibril morphotypes also exhibit dense threads, implying that they also present a putative metal binding site. As a result, we propose a molecular model for the protofibril and suggest that polymorphic variant fibrils have different numbers of protofibrils that are associated differently.« less

  3. The Twist Box Domain is Required for Twist1-induced Prostate Cancer Metastasis

    PubMed Central

    Gajula, Rajendra P.; Chettiar, Sivarajan T.; Williams, Russell D.; Thiyagarajan, Saravanan; Kato, Yoshinori; Aziz, Khaled; Wang, Ruoqi; Gandhi, Nishant; Wild, Aaron T.; Vesuna, Farhad; Ma, Jinfang; Salih, Tarek; Cades, Jessica; Fertig, Elana; Biswal, Shyam; Burns, Timothy F.; Chung, Christine H.; Rudin, Charles M.; Herman, Joseph M.; Hales, Russell K.; Raman, Venu; An, Steven S.; Tran, Phuoc T.

    2013-01-01

    Twist1, a basic helix-loop-helix transcription factor, plays a key role during development and is a master regulator of the epithelial-mesenchymal transition (EMT) that promotes cancer metastasis. Structure-function relationships of Twist1 to cancer-related phenotypes are underappreciated, so we studied the requirement of the conserved Twist box domain for metastatic phenotypes in prostate cancer (PCa). Evidence suggests that Twist1 is overexpressed in clinical specimens and correlated with aggressive/metastatic disease. Therefore, we examined a transactivation mutant, Twist1-F191G, in PCa cells using in vitro assays which mimic various stages of metastasis. Twist1 overexpression led to elevated cytoskeletal stiffness and cell traction forces at the migratory edge of cells based on biophysical single-cell measurements. Twist1 conferred additional cellular properties associated with cancer cell metastasis including increased migration, invasion, anoikis resistance, and anchorage-independent growth. The Twist box mutant was defective for these Twist1 phenotypes in vitro. Importantly, we observed a high frequency of Twist1-induced metastatic lung tumors and extra-thoracic metastases in vivo using the experimental lung metastasis assay. The Twist box was required for PCa cells to colonize metastatic lung lesions and extra-thoracic metastases. Comparative genomic profiling revealed transcriptional programs directed by the Twist box that were associated with cancer progression, such as Hoxa9. Mechanistically, Twist1 bound to the Hoxa9 promoter and positively regulated Hoxa9 expression in PCa cells. Finally, Hoxa9 was important for Twist1-induced cellular phenotypes associated with metastasis. These data suggest that the Twist box domain is required for Twist1 transcriptional programs and PCa metastasis. PMID:23982216

  4. Remote two-wire data entry method and device

    DOEpatents

    Kronberg, J.W.

    1991-01-01

    This invention is comprised of a device for detecting switch closure such as in a keypad for entering data comprising a matrix of conductor pairs and switches, each pair of conductors shorted by the pressing of a particular switch, and current-regulating devices on each conductor for limiting current in one direction and passing it without limit in the other direction. The device is driven by alternating current. The ends of the conductors in a conductor pair limit current of opposing polarities with respect to each other so that the signal on a shorted pair is an alternating current signal with a unique combination of a positive and a negative peak, which, when analyzed, allows the determination of which key was pressed. The binary identification of the pressed key is passed to the input port of a host device.

  5. Improvement of sternal closure stability with reinforced steel wires.

    PubMed

    McGregor, Walter E; Payne, Maryann; Trumble, Dennis R; Farkas, Kathleen M; Magovern, James A

    2003-11-01

    Sternal dehiscence occurs when steel wires pull through sternal bone. This study tests the hypothesis that closure stability can be improved by jacketing sternal wires with stainless steel coils, which distribute the force exerted on the bone over a larger area. Midline sternotomies were performed in 6 human cadavers (4 male). Two sternal closure techniques were tested: (1) approximation with six interrupted wires, and (2) the same closure technique reinforced with 3.0-mm-diameter stainless steel coils that jacket wires at the lateral and posterior aspects of the sternum. Intrathoracic pressure was increased with an inflatable rubber bladder placed beneath the anterior chest wall, and sternal separation was measured by means of sonomicrometry crystals. In each trial, intrathoracic pressure was increased until 2.0 mm of motion was detected. Differences in displacement pressures between groups were examined at 0.25-mm intervals using the paired Student's t test. The use of coil-reinforced closures produced significant improvement in sternal stability at all eight displacement levels examined (p < 0.03). Mean pressure required to cause displacement increased 140% (15.5 to 37.3 mm Hg) at 0.25 mm of separation, 103% (34.3 to 69.8 mm Hg) at 1.0 mm of separation, and 122% (46.8 to 103.8 mm Hg) at 2.0 mm of separation. Reinforcement of sternal wires with stainless steel coils substantially improves stability of sternotomy closure in a human cadaver model.

  6. Environmental Influence of Gravity and Pressure on Arc Tracking of Insulated Wires Investigated

    NASA Technical Reports Server (NTRS)

    2005-01-01

    Momentary short-circuit arcs between a defective polyimide-insulated wire and another conductor may thermally char (pyrolize) the insulating material. The charred polyimide, being conductive, can sustain the short-circuit arc, which may propagate along the wire through continuous pyrolization of the polyimide insulation (arc tracking). If the arcing wire is part of a multiple-wire bundle, the polyimide insulation of other wires within the bundle may become thermally charred and start arc tracking also (flash over). Such arc tracking can lead to complete failure of an entire wire bundle, causing other critical spacecraft or aircraft failures. Unfortunately, all tested candidate wire insulations for aerospace vehicles were susceptible to arc tracking. Therefore, a test procedure was designed at the NASA Lewis Research Center to select the insulation type least susceptible to arc tracking. This test procedure addresses the following three areas of concern: (1) probability of initiation, (2) probability of reinitiation (restrike), and (3) extent of arc tracking damage (propagation rate). Item 2 (restrike probability) is an issue if power can be terminated from and reapplied to the arcing wire (by a switch, fuse, or resettable circuit breaker). The degree of damage from an arcing event (item 3) refers to how easily the arc chars nearby insulation and propagates along the wire pair. Ease of nearby insulation charring can be determined by measuring the rate of arc propagation. Insulation that chars easily will propagate the arc faster than insulation that does not char very easily. A popular polyimide insulated wire for aerospace vehicles, MIL-W-81381, was tested to determine a degree of damage from an arcing event (item 3) in the following three environments: (1) microgravity with air at 1-atm pressure, (2) 1g with air at 1 atm, and (3) 1g within a 10^-6 Torr vacuum. The microgravity 1-atm air was the harshest environment, with respect to the rate of damage of arc tracking, for the 20 AWG (American Wiring Gauge) MIL-W-81381 wire insulation type . The vacuum environment resulted in the least damage. Further testing is planned to determine if the environmental results are consistent between insulation types and to evaluate the other two parameters associated with arc tracking susceptibility.

  7. The Morphogenesis of Cranial Sutures in Zebrafish

    PubMed Central

    Topczewska, Jolanta M.; Shoela, Ramy A.; Tomaszewski, Joanna P.; Mirmira, Rupa B.; Gosain, Arun K.

    2016-01-01

    Using morphological, histological, and TEM analyses of the cranium, we provide a detailed description of bone and suture growth in zebrafish. Based on expression patterns and localization, we identified osteoblasts at different degrees of maturation. Our data confirm that, unlike in humans, zebrafish cranial sutures maintain lifelong patency to sustain skull growth. The cranial vault develops in a coordinated manner resulting in a structure that protects the brain. The zebrafish cranial roof parallels that of higher vertebrates and contains five major bones: one pair of frontal bones, one pair of parietal bones, and the supraoccipital bone. Parietal and frontal bones are formed by intramembranous ossification within a layer of mesenchyme positioned between the dermal mesenchyme and meninges surrounding the brain. The supraoccipital bone has an endochondral origin. Cranial bones are separated by connective tissue with a distinctive architecture of osteogenic cells and collagen fibrils. Here we show RNA in situ hybridization for col1a1a, col2a1a, col10a1, bglap/osteocalcin, fgfr1a, fgfr1b, fgfr2, fgfr3, foxq1, twist2, twist3, runx2a, runx2b, sp7/osterix, and spp1/ osteopontin, indicating that the expression of genes involved in suture development in mammals is preserved in zebrafish. We also present methods for examining the cranium and its sutures, which permit the study of the mechanisms involved in suture patency as well as their pathological obliteration. The model we develop has implications for the study of human disorders, including craniosynostosis, which affects 1 in 2,500 live births. PMID:27829009

  8. Three-Dimensional MHD Simulation of FTEs Produced by Merging at an Isolated Point in a Sheared Magnetic Field Configuration

    NASA Technical Reports Server (NTRS)

    Santos, J. C.; Sibeck, D. G.; Buchner, J.; Gonzalez, W. D.; Ferreira, J. L.

    2014-01-01

    We present predictions for the evolution of FTEs generated by localized bursts of reconnection on a planar magnetopause that separates a magnetosheath region of high densities and weak magnetic field from a magnetospheric region of low densities and strong magnetic field. The magnetic fields present a shear angle of 105 degrees. Reconnection forms a pair of FTEs each crossing the magnetopause in the field reversal region and bulging into the magnetosphere and magnetosheath. At their initial stage they can be characterized as flux tubes since the newly reconnected magnetic field lines are not twisted. Reconnection launches Alfvenic perturbations that propagate along the FTEs generating high-speed jets, which move the pair of FTEs in opposite directions. As the FTE moves, it displaces the ambient magnetic field and plasma producing bipolar magnetic field and plasma velocity signatures normal to the nominal magnetopause in the regions surrounding the FTE. The combination of the ambient plasma with the FTE flows generates a vortical velocity pattern around the reconnected field lines. During its evolution the FTE evolves to a flux rope configuration due to the twist of the magnetic field lines. The alfvenic perturbations propagate faster along the part of the FTE bulging into the magnetosphere than in the magnetosheath, and due to the differences between the plasma and magnetic field properties the perturbations have slightly different signatures in the two regions. As a consequence, the FTEs have different signatures depending on whether the satellite encounters the part bulging into the magnetosphere or into the magnetosheath.

  9. Using Variable-Length Aligned Fragment Pairs and an Improved Transition Function for Flexible Protein Structure Alignment.

    PubMed

    Cao, Hu; Lu, Yonggang

    2017-01-01

    With the rapid growth of known protein 3D structures in number, how to efficiently compare protein structures becomes an essential and challenging problem in computational structural biology. At present, many protein structure alignment methods have been developed. Among all these methods, flexible structure alignment methods are shown to be superior to rigid structure alignment methods in identifying structure similarities between proteins, which have gone through conformational changes. It is also found that the methods based on aligned fragment pairs (AFPs) have a special advantage over other approaches in balancing global structure similarities and local structure similarities. Accordingly, we propose a new flexible protein structure alignment method based on variable-length AFPs. Compared with other methods, the proposed method possesses three main advantages. First, it is based on variable-length AFPs. The length of each AFP is separately determined to maximally represent a local similar structure fragment, which reduces the number of AFPs. Second, it uses local coordinate systems, which simplify the computation at each step of the expansion of AFPs during the AFP identification. Third, it decreases the number of twists by rewarding the situation where nonconsecutive AFPs share the same transformation in the alignment, which is realized by dynamic programming with an improved transition function. The experimental data show that compared with FlexProt, FATCAT, and FlexSnap, the proposed method can achieve comparable results by introducing fewer twists. Meanwhile, it can generate results similar to those of the FATCAT method in much less running time due to the reduced number of AFPs.

  10. Shoe Box Circuits

    ERIC Educational Resources Information Center

    Sandifer, Cody

    2009-01-01

    Students' eyes grow wide with wonder as they get a motor to work or make a bulb light for the first time. As these daunting feats of electrical engineering remind us, teaching electricity is invariably rewarding and worthwhile. In this inquiry-based science project, elementary students work in pairs to design and wire a shoe box "room" that meets…

  11. Investigations of Crossed Andreev Reflection in Hybrid Superconductor-Ferromagnet Structures

    ERIC Educational Resources Information Center

    Colci O'Hara, Madalina

    2009-01-01

    Cooper pair splitting is predicted to occur in hybrid devices where a superconductor is coupled to two ferromagnetic wires placed at a distance less than the superconducting coherence length. This thesis searches for signatures of this process, called crossed Andreev reflection (CAR), in three device geometries. The first devices studied are…

  12. Handbook of Oceanographic Winch, Wire, and Cable Technology.

    DTIC Science & Technology

    1982-10-18

    Strength Members (Figure 2-3), involve a center arrangement of electrical conductors Tone, coax, tristed, pair, triad, etc.) with the braided metal or...8217. .. . . . .-.. . . . . .. - . . . C. Robert Shaw, Chief Engineer Union Metal Manufacturing...2-4 1.1 COINCIDENCE............................ 2-4 *1 .2 CEN4TER STRENGTH MEMBER.................. 2-4 *1.3 BRAIDED OUTER STRENGTH MIBER

  13. Magnon-drag thermopile.

    PubMed

    Costache, Marius V; Bridoux, German; Neumann, Ingmar; Valenzuela, Sergio O

    2011-12-18

    Thermoelectric effects in spintronics are gathering increasing attention as a means of managing heat in nanoscale structures and of controlling spin information by using heat flow. Thermal magnons (spin-wave quanta) are expected to play a major role; however, little is known about the underlying physical mechanisms involved. The reason is the lack of information about magnon interactions and of reliable methods to obtain it, in particular for electrical conductors because of the intricate influence of electrons. Here, we demonstrate a conceptually new device that enables us to gather information on magnon-electron scattering and magnon-drag effects. The device resembles a thermopile formed by a large number of pairs of ferromagnetic wires placed between a hot and a cold source and connected thermally in parallel and electrically in series. By controlling the relative orientation of the magnetization in pairs of wires, the magnon drag can be studied independently of the electron and phonon-drag thermoelectric effects. Measurements as a function of temperature reveal the effect on magnon drag following a variation of magnon and phonon populations. This information is crucial to understand the physics of electron-magnon interactions, magnon dynamics and thermal spin transport.

  14. Dry cryomagnetic system with MgB2 coil

    NASA Astrophysics Data System (ADS)

    Abin, D. A.; Mineev, N. A.; Osipov, M. A.; Pokrovskii, S. V.; Rudnev, I. A.

    2017-12-01

    MgB2 may be the future superconducting wire material for industrial magnets due to it’s higher operation temperature and potentially lower cost than low temperature superconductors (LTS) have. We designed a compact cryomagnetic system with the use of MgB2. The possibility of creating a magnet with a central field of 5 T from a commercial MgB2 wire by the “react and wound” method was investigated. The magnetic system is cooled by a cryocooler through a copper bus. The magnet has a warm bore diameter of 4 cm. The design of a magnet consisting of three concentric solenoids is proposed: an internal one of high-temperature superconductor (HTS), an average of MgB2, and an external of NbTi. The operating current of the system is 100 A. Two pairs of current leads are used. A separate pair of current leads for power supplying NbTi coil allows testing of MgB2 and HTS coils in an external field. The load curves for each of the magnets are calculated.

  15. Magneto-optical observation of twisted vortices in type-II superconductors

    NASA Astrophysics Data System (ADS)

    Indenbom, M. V.; van der Beek, C. J.; Berseth, V.; Benoit, W.; D'Anna, G.; Erb, A.; Walker, E.; Flükiger, R.

    1997-02-01

    When magnetic flux penetrates a type-II superconductor, it does so as quantized flux lines or vortex lines, so called because each is surrounded by a supercurrent vortex. Interactions between such vortices lead to a very rich and well characterized phenomenology for this 'mixed state'. But an outstanding question remains: are individual vortex lines 'strong', or can they easily be cut and made to pass through one another? The concept of vortex cutting was originally proposed to account for dissipation observed in superconducting wires oriented parallel to an applied magnetic field, where the vortex lines and transport current should be in a force-free configuration1-6. Previous experiments, however, have been unable to establish the vortex topology in the force-free configuration or the size of the energy barrier for vortex cutting. Here we report magneto-optical images of YBa2Cu3O7-δ samples in the force-free configuration which show that thousands of vortex lines can twist together to form highly stable structures. In some cases, these 'vortex twisters' interact with one another to produce wave-like dynamics. Our measurements also determine directly the current required to initiate vortex cutting, and show that it is much higher than that needed to overcome the pinning of vortices by material defects. This implies that thermodynamic phases of entangled vortices7-10 are intrinsically stable and may occupy a significant portion of the mixed-state phase diagram for type-II superconductors.

  16. Development of shape memory alloy (SMA) torsional actuators for variable twist tilt rotor (VTTR) blades

    NASA Astrophysics Data System (ADS)

    Prahlad, Harsha

    This dissertation presents the development of a torsional actuator to alter the twist distributions of a tiltrotor blade between hover and forward flight. The actuator uses a Shape Memory Alloy (SMA) tube as its active element. The historical development of the tiltrotor aircraft is discussed, with emphasis on advanced tiltrotor concepts. The central theme in these concepts is to reduce the compromises for tiltrotor blade design, thereby improving performance of the aircraft in both hover and forward flight modes. A survey of research conducted in the application of smart structures to performance enhancement of aircraft is conducted. A review of other torsional actuators that are based on SMAs is presented. An assessment of the state-of-the-art in SMA modeling and characterization, both in mechanical tensile and torsional loading, is also discussed. Shape Memory Alloys are "smart" actuation materials that are capable of providing high stroke and high force of actuation at relatively low bandwidth. However, their behavior is complex, and influenced by material non-linearities, thermo-mechanical conditions and history of loading. In addition, the behavior of torsional SMA actuators has not been investigated in detail. In order to address these issues, the current research carries out a comprehensive characterization of SMAs. Experimental characteristics of SMA wires under extensional loading, and SMA rods and tubes in both extensional and torsional loading under a variety of thermo-mechanical conditions are presented in this dissertation. It is demonstrated that the uniaxial quasistatic SMA models show good overall agreement with the experimental behavior of an SMA wire under extensional loading. In addition, an approach that incorporates these models with radial non-uniformity due to torsional deflections is shown to provide good predictions of torsional characteristics of SMA rods and tubes. Several differences of the material response under non-quasistatic loading conditions are also shown. A modeling technique that predicts these effects by coupling the material phenomenology with an energy equilibrium analysis is proposed. In addition, a theoretical and experimental study involving composite laminates with embedded SMAs is also presented in this work. The concept of tuning the natural frequencies of a composite structure using embedded SMAs is demonstrated, and associated manufacturing issues discussed. Using the concepts developed in the study on SMAs, a torsional actuator involving an SMA tube is developed for the proposed application. The design of the heat transfer and torque transfer assemblies for the actuator is described. Benchtop testing of the actuator shows the feasibility of this actuator in applications involving large recovery torques of actuation. It is demonstrated that using the current concept, one actuator is not sufficient to meet the twist actuation requirements for a full-scale tiltrotor blade. However, a modification in the blade torsional stiffness, in conjunction with the use of two discrete SMA actuators, may render the concept feasible for a full-scale tiltrotor.

  17. Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism.

    PubMed

    Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

    2018-02-28

    Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.

  18. Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism

    PubMed Central

    Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

    2018-01-01

    Abstract Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure. PMID:29267977

  19. Single-handed helical carbonaceous nanotubes prepared using a pair of cationic low molecular weight gelators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Huayan; Wang, Qing; Guo, Yongmin

    Highlights: • 3-aminophenol-formaldeyde resins were prepared through a templating method. • A pair of cationic gelators have been used as the templates. • Single-handed helical carbonaceous nanotubes were obtained after carbonization. • The carbonaceous nanotubes showed optical activity. - Abstract: We design a facile route to obtain enantiopure carbonaceous nanostructures, which have potential application as chiral sensors, electromagnetic wave absorbers, and asymmetric catalysts. A pair of cationic low molecular weight gelators was synthesized, which were able to self-assemble into twisted nanoribbons in ethanol at a concentration of 20 g L{sup −1} at 25 °C. Single-handed helical 3-aminophenol-formaldehyde resin nanotubes withmore » optical activity were prepared using the self-assembly of the low molecular weight gelators as templates. After carbonization, single-handed helical carbonaceous nanotubes were obtained and characterized using circular dichroism, wide-angle X-ray diffraction, field-emission scanning electron microscopy, transmission electron microscopy, and Raman spectroscopy. The results indicate that the walls of the nanotubes are amorphous carbon. Moreover, the left- and right-handed helical nanotubes exhibit opposite optical activity.« less

  20. A possible regulatory link between Twist 1 and PPARγ gene regulation in 3T3-L1 adipocytes.

    PubMed

    Ren, Rui; Chen, Zhufeng; Zhao, Xia; Sun, Tao; Zhang, Yuchao; Chen, Jie; Lu, Sumei; Ma, Wanshan

    2016-11-08

    Peroxisome proliferator-activated receptor γ (PPARγ) is a critical gene that regulates the function of adipocytes. Therefore, studies on the molecular regulation mechanism of PPARγ are important to understand the function of adipose tissue. Twist 1 is another important functional gene in adipose tissue, and hundreds of genes are regulated by Twist 1. The aim of this study was to investigate the regulation of Twist 1 and PPARγ expression in 3T3-L1 mature adipocytes. We induced differentiation in 3T3-L1 preadipocytes and examined alterations in Twist 1 and PPARγ expression. We used the PPARγ agonist pioglitazone and the PPARγ antagonist T0070907 to investigate the effect of PPARγ on Twist 1 expression. In addition, we utilized retroviral interference and overexpression of Twist 1 to determine the effects of Twist 1 on PPARγ expression. The expression levels of Twist 1 and PPARγ were induced during differentiation in 3T3-L1 adipocytes. Application of either a PPARγ agonist (pioglitazone) or antagonist (T0070907) influenced Twist 1 expression, with up-regulation of Twist 1 under pioglitazone (1 μM, 24 h) and down-regulation of Twist 1 under T0070907 (100 μM, 24 h) exposure. Furthermore, the retroviral interference of Twist 1 decreased the protein and mRNA expression of PPARγ, while Twist 1 overexpression had the opposite effect. There was a possible regulatory link between Twist 1 and PPARγ in 3T3-L1 mature adipocytes. This regulatory link enhanced the regulation of PPARγ and may be a functional mechanism of Twist 1 regulation of adipocyte physiology and pathology.

  1. Cooling arrangement for a tapered turbine blade

    DOEpatents

    Liang, George

    2010-07-27

    A cooling arrangement (11) for a highly tapered gas turbine blade (10). The cooling arrangement (11) includes a pair of parallel triple-pass serpentine cooling circuits (80,82) formed in an inner radial portion (50) of the blade, and a respective pair of single radial channel cooling circuits (84,86) formed in an outer radial portion (52) of the blade (10), with each single radial channel receiving the cooling fluid discharged from a respective one of the triple-pass serpentine cooling circuit. The cooling arrangement advantageously provides a higher degree of cooling to the most highly stressed radially inner portion of the blade, while providing a lower degree of cooling to the less highly stressed radially outer portion of the blade. The cooling arrangement can be implemented with known casting techniques, thereby facilitating its use on highly tapered, highly twisted Row 4 industrial gas turbine blades that could not be cooled with prior art cooling arrangements.

  2. A braided monoidal category for free super-bosons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Runkel, Ingo, E-mail: ingo.runkel@uni-hamburg.de

    The chiral conformal field theory of free super-bosons is generated by weight one currents whose mode algebra is the affinisation of an abelian Lie super-algebra h with non-degenerate super-symmetric pairing. The mode algebras of a single free boson and of a single pair of symplectic fermions arise for even|odd dimension 1|0 and 0|2 of h, respectively. In this paper, the representations of the untwisted mode algebra of free super-bosons are equipped with a tensor product, a braiding, and an associator. In the symplectic fermion case, i.e., if h is purely odd, the braided monoidal structure is extended to representations ofmore » the Z/2Z-twisted mode algebra. The tensor product is obtained by computing spaces of vertex operators. The braiding and associator are determined by explicit calculations from three- and four-point conformal blocks.« less

  3. Annual-ring-type quasi-phase-matching crystal for generation of narrowband high-dimensional entanglement

    NASA Astrophysics Data System (ADS)

    Hua, Yi-Lin; Zhou, Zong-Quan; Liu, Xiao; Yang, Tian-Shu; Li, Zong-Feng; Li, Pei-Yun; Chen, Geng; Xu, Xiao-Ye; Tang, Jian-Shun; Xu, Jin-Shi; Li, Chuan-Feng; Guo, Guang-Can

    2018-01-01

    A photon pair can be entangled in many degrees of freedom such as polarization, time bins, and orbital angular momentum (OAM). Among them, the OAM of photons can be entangled in an infinite-dimensional Hilbert space which enhances the channel capacity of sharing information in a network. Twisted photons generated by spontaneous parametric down-conversion offer an opportunity to create this high-dimensional entanglement, but a photon pair generated by this process is typically wideband, which makes it difficult to interface with the quantum memories in a network. Here we propose an annual-ring-type quasi-phase-matching (QPM) crystal for generation of the narrowband high-dimensional entanglement. The structure of the QPM crystal is designed by tracking the geometric divergences of the OAM modes that comprise the entangled state. The dimensionality and the quality of the entanglement can be greatly enhanced with the annual-ring-type QPM crystal.

  4. π-Electron-system-layered polymer: through-space conjugation and properties as a single molecular wire.

    PubMed

    Morisaki, Yasuhiro; Ueno, Shizue; Saeki, Akinori; Asano, Atsushi; Seki, Shu; Chujo, Yoshiki

    2012-04-02

    [2.2]Paracyclophane-based through-space conjugated oligomers and polymers were prepared, in which poly(p-arylene-ethynylene) (PAE) units were partially π-stacked and layered, and their properties in the ground state and excited state were investigated in detail. Electronic interactions among PAE units were effective through at least ten units in the ground state. Photoexcited energy transfer occurred from the stacked PAE units to the end-capping PAE moieties. The electrical conductivity of the polymers was estimated using the flash-photolysis time-resolved microwave conductivity (FP-TRMC) method and investigated together with time-dependent density functional theory (TD-DFT) calculations, showing that intramolecular charge carrier mobility through the stacked PAE units was a few tens of percentage larger than through the twisted PAE units. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Mechanical Description of the Mars Climate Sounder Instrument

    NASA Technical Reports Server (NTRS)

    Jau, Bruno M.

    2008-01-01

    This paper introduces the Mars Climate Sounder (MCS) Instrument of the Mars Reconnaissance Orbiter (MRO) spacecraft. The instrument scans the Martian atmosphere almost continuously to systematically acquire weather and climate observations over time. Its primary components are an optical bench that houses dual telescopes with a total of nine channels for visible and infrared sensing, and a two axis gimbal that provides pointing capabilities. Both rotating joints consist of an integrated actuator with a hybrid planetary/harmonic transmission and a twist cap section that enables the electrical wiring to pass through the rotating joint. Micro stepping is used to reduce spacecraft disturbance torques to acceptable levels while driving the stepper motors. To ensure survivability over its four year life span, suitable mechanical components, lubrication, and an active temperature control system were incorporated. Some life test results and lessons learned are provided to serve as design guidelines for actuator parts and flex cables.

  6. AC electrical characterisation and insight to charge transfer mechanisms in DNA molecular wires through temperature and UV effects.

    PubMed

    Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John

    2015-06-01

    In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.

  7. Complications of retrograde balloon cautery endopyelotomy.

    PubMed

    Schwartz, B F; Stoller, M L

    1999-11-01

    Adult ureteropelvic junction obstruction is increasingly managed with endoscopic techniques. Retrograde balloon cautery endopyelotomy is quick, requires minimal hospital stay and allows most patients a rapid return to work. The complication rate of retrograde balloon cautery endopyelotomy ranges from 13 to 34%, with vascular injury in 0 to 16% of patients. We report 5 uncommon complications, including 4 vascular injuries, that clinicians should be familiar with when using this technique. We reviewed 52 retrograde endoscopic endopyelotomy procedures performed during a 5-year period. There were 5 uncommon complications. Accessory lower pole renal artery injuries occurred in 3 patients, 1 of whom presented 12 days after endopyelotomy. Embolization was successfully performed in all 3 cases and none had subsequent hypertension. In 1 case a right ovarian vein laceration was not evident on preoperative or postoperative angiography. Emergency post-embolization abdominal exploration revealed a 2 mm. injury to the right ovarian vein before entering the right renal vein close to the ureteropelvic junction incision. Nephrectomy and ovarian vein ligature were curative. In 1 case the electrocautery wire broke intracorporeally after firing, resulting in a bobby pin-like configuration. Successful removal was accomplished by twisting the catheter and wrapping the wire around the tip, enabling atraumatic removal. Retrograde balloon cautery endopyelotomy is an emerging technology with potential adverse outcomes. The complications we noted are complex and potentially life threatening. Awareness of these complications may help avoid poor outcomes and expedite appropriate treatment.

  8. Influence of File Motion on Shaping, Apical Debris Extrusion and Dentinal Defects: A Critical Review.

    PubMed

    Pedrinha, Victor Feliz; Brandão, Juliana Melo da Silva; Pessoa, Oscar Faciola; Rodrigues, Patrícia de Almeida

    2018-01-01

    Advances in endodontics have enabled the evolution of file manufacturing processes, improving performance beyond that of conventional files. In the present study, systems manufactured using state of the art methods and possessing special properties related to NiTi alloys ( i.e ., CM-Wire, M-Wire and R-Phase) were selected. The aim of this review was to provide a detailed analysis of the literature about the relationship between recently introduced NiTi files with different movement kinematics and shaping ability, apical extrusion of debris and dentin defects in root canal preparations. From March 2016 to January 2017, electronic searches were conducted in the PubMed and SCOPUS databases for articles published since January 2010. In vitro studies performed on extracted human teeth and published in English were considered for this review. Based on the inclusion criteria, 71 papers were selected for the analysis of full-text copies. Specific analysis was performed on 45 articles describing the effects of reciprocating, continuous and adaptive movements on the WaveOne Gold, Reciproc, HyFlex CM and Twisted File Adaptive systems. A wide range of testing conditions and methodologies have been used to compare the systems. Due the controversies among the results, the characteristics of the files used, such as their design and alloys, appear to be inconsistent to determine the best approach.

  9. TEM Cell Testing of Cable Noise Reduction Techniques from 2 MHz to 200 MHz -- Part 2

    NASA Technical Reports Server (NTRS)

    Bradley, Arthur T.; Evans, William C.; Reed, Joshua L.; Shimp, Samuel K., III; Fitzpatrick, Fred D.

    2008-01-01

    This paper presents empirical results of cable noise reduction techniques as demonstrated in a TEM cell operating with radiated fields from 2 - 200 MHz. It is the second part of a two-paper series. The first paper discussed cable types and shield connections. In this second paper, the effects of load and source resistances and chassis connections are examined. For each topic, well established theories are compared to data from a real-world physical system. Finally, recommendations for minimizing cable susceptibility (and thus cable emissions) are presented. There are numerous papers and textbooks that present theoretical analyses of cable noise reduction techniques. However, empirical data is often targeted to low frequencies (e.g. <50 KHz) or high frequencies (>100 MHz). Additionally, a comprehensive study showing the relative effects of various noise reduction techniques is needed. These include the use of dedicated return wires, twisted wiring, cable shielding, shield connections, changing load or source impedances, and implementing load- or source-to-chassis isolation. We have created an experimental setup that emulates a real-world electrical system, while still allowing us to independently vary a host of parameters. The goal of the experiment was to determine the relative effectiveness of various noise reduction techniques when the cable is in the presence of radiated emissions from 2 MHz to 200 MHz.

  10. The Development of an IMU Integrated Clothes for Postural Monitoring Using Conductive Yarn and Interconnecting Technology

    PubMed Central

    Kang, Sung-Won; Park, Hyung-Il; Choi, Byoung-Gun; Shin, Dongjun; Jung, Young-Giu; Lee, Jun-Young; Park, Hong-Won; Park, Sukyung

    2017-01-01

    Spinal disease is a common yet important condition that occurs because of inappropriate posture. Prevention could be achieved by continuous posture monitoring, but most measurement systems cannot be used in daily life due to factors such as burdensome wires and large sensing modules. To improve upon these weaknesses, we developed comfortable “smart wear” for posture measurement using conductive yarn for circuit patterning and a flexible printed circuit board (FPCB) for interconnections. The conductive yarn was made by twisting polyester yarn and metal filaments, and the resistance per unit length was about 0.05 Ω/cm. An embroidered circuit was made using the conductive yarn, which showed increased yield strength and uniform electrical resistance per unit length. Circuit networks of sensors and FPCBs for interconnection were integrated into clothes using a computer numerical control (CNC) embroidery process. The system was calibrated and verified by comparing the values measured by the smart wear with those measured by a motion capture camera system. Six subjects performed fixed movements and free computer work, and, with this system, we were able to measure the anterior/posterior direction tilt angle with an error of less than 4°. The smart wear does not have excessive wires, and its structure will be optimized for better posture estimation in a later study. PMID:29112125

  11. Mechanical effects of third-order movement in self-ligated brackets by the measurement of torque expression.

    PubMed

    Major, Thomas W; Carey, Jason P; Nobes, David S; Heo, Giseon; Major, Paul W

    2011-01-01

    Axial rotation of orthodontic wire produces buccal or lingual root movement and is often referred to as third-order movement or "torque expression." The objective of this study was to quantify torque expression in 3 self-ligation bracket systems (Damon Q, Ormco, Orange, Calif; In-Ovation R, GAC, Bohemia, NY; and Speed, Strite Industries, Cambridge, Ontario, Canada) during loading and unloading. A stepper motor was used to rotate a wire in a fixed bracket slot from -15° to 63° in 3° increments, and then back to -15°. The bracket was mounted on top of a load cell that measured forces and moments in all directions. Damon's and In-Ovation's maximum average torque values at 63° were 105 and 113 Nmm, respectively. Many Speed brackets experienced premature loss of torque between 48° and 63°, and the average maximum was 82 Nmm at 54°. The torque plays for Damon, In-Ovation, and Speed were 11.3°, 11.9°, and 10.8°, respectively. Generally, In-Ovation expressed the most torque at a given angle of twist, followed by Damon and then Speed. However, there was no significant difference between brackets below 34 Nmm of torque. From a clinical perspective, the torque plays between brackets were virtually indistinguishable. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

  12. Test report for twinax cable (Rockwell type MB0150-051). [effects of mismatched termination

    NASA Technical Reports Server (NTRS)

    Doland, G. D.

    1978-01-01

    A controlled impedance twisted pair shielded cable was tested to determine the frequency response and effects of mismatched termination. It was found that a long length of this cable, about 100 feet, exhibited a frequency sensitive attenuation roll-off greater than 1.5 db down at 5 MHz. It was also determined that improper termination resulted in losses of 1/2 to 1 db within the frequency range of 200 KHz to greater than 1-1/2 MHz. The test results indicate a possible problem where mismatched connectors are used in video signal cables.

  13. A Multiple-range Self-balancing Thermocouple Potentiometer

    NASA Technical Reports Server (NTRS)

    Warshawsky, I; Estrin, M

    1951-01-01

    A multiple-range potentiometer circuit is described that provides automatic measurement of temperatures or temperature differences with any one of several thermocouple-material pairs. Techniques of automatic reference junction compensation, span adjustment, and zero suppression are described that permit rapid selection of range and wire material, without the necessity for restandardization, by setting of two external tap switches.

  14. A Survey of Telecommunications Technology. Part II. President's Task Force on Communications Policy. Staff Paper One, Part II.

    ERIC Educational Resources Information Center

    Rostow, Eugene V.

    The document contains the final four appendices to a staff paper submitted to the President's Task Force on Communications Policy. "The Digital Loop" describes changes in urban telecommunications which are predicted for 1970-80, considering three possible systems: paired wires with single analog signals (present telephones), coaxial…

  15. Exploring Magnetic Fields with a Compass

    ERIC Educational Resources Information Center

    Lunk, Brandon; Beichner, Robert

    2011-01-01

    A compass is an excellent classroom tool for the exploration of magnetic fields. Any student can tell you that a compass is used to determine which direction is north, but when paired with some basic trigonometry, the compass can be used to actually measure the strength of the magnetic field due to a nearby magnet or current-carrying wire. In this…

  16. Spatially resolved single crystal x-ray spectropolarimetry of wire array z-pinch plasmas

    NASA Astrophysics Data System (ADS)

    Wallace, M. S.; Haque, S.; Neill, P.; Pereira, N. R.; Presura, R.

    2018-01-01

    A recently developed single-crystal x-ray spectropolarimeter has been used to record paired sets of polarization-dependent and axially resolved x-ray spectra emitted by wire array z-pinches. In this measurement, two internal planes inside a suitable crystal diffract the x-rays into two perpendicular directions that are normal to each other, thereby separating incident x-rays into their linearly polarized components. This paper gives considerations for fielding the instrument on extended sources. Results from extended sources are difficult to interpret because generally the incident x-rays are not separated properly by the crystal. This difficulty is mitigated by using a series of collimating slits to select incident x-rays that propagate in a plane of symmetry between the polarization-splitting planes. The resulting instrument and some of the spatially resolved polarized x-ray spectra recorded for a 1-MA aluminum wire array z-pinch at the Nevada Terawatt Facility at the University of Nevada, Reno will be presented.

  17. Gate tunable parallel double quantum dots in InAs double-nanowire devices

    NASA Astrophysics Data System (ADS)

    Baba, S.; Matsuo, S.; Kamata, H.; Deacon, R. S.; Oiwa, A.; Li, K.; Jeppesen, S.; Samuelson, L.; Xu, H. Q.; Tarucha, S.

    2017-12-01

    We report fabrication and characterization of InAs nanowire devices with two closely placed parallel nanowires. The fabrication process we develop includes selective deposition of the nanowires with micron scale alignment onto predefined finger bottom gates using a polymer transfer technique. By tuning the double nanowire with the finger bottom gates, we observed the formation of parallel double quantum dots with one quantum dot in each nanowire bound by the normal metal contact edges. We report the gate tunability of the charge states in individual dots as well as the inter-dot electrostatic coupling. In addition, we fabricate a device with separate normal metal contacts and a common superconducting contact to the two parallel wires and confirm the dot formation in each wire from comparison of the transport properties and a superconducting proximity gap feature for the respective wires. With the fabrication techniques established in this study, devices can be realized for more advanced experiments on Cooper-pair splitting, generation of Parafermions, and so on.

  18. True-3D Strain Mapping for Assessment of Material Deformation by Synchrotron X-Ray Microtomography

    NASA Astrophysics Data System (ADS)

    Ahn, J. J.; Toda, H.; Niinomi, M.; Kobayashi, T.; Akahori, T.; Uesugi, K.

    2005-04-01

    Downsizing of products with complex shapes has been accelerated thanks to the rapid development of electrodevice manufacturing technology. Micro electromechanical systems (MEMS) are one of such typical examples. 3D strain measurement of such miniature products is needed to ensure their reliability. In the present study, as preliminary trial for it 3D tensile deformation behavior of a pure aluminum wire is examined using the synchrotron X-ray microtomography technique at Spring-8, Japan. Multipurpose in-situ tester is used to investigate real-time tensile deformation behavior of the Al wire. Tensile tests are carried out under strokes of 0, 0.005, 0.01 and 0.015mm. It measures 3D local deformation of a region of interest by tracking a relative movement of a pair of particles at each point. Local deformation behavior of the Al wire is identified to be different from macroscopic deformation behavior. It may be closely associated with underlying microstructure.

  19. Spatially resolved single crystal x-ray spectropolarimetry of wire array z-pinch plasmas.

    PubMed

    Wallace, M S; Haque, S; Neill, P; Pereira, N R; Presura, R

    2018-01-01

    A recently developed single-crystal x-ray spectropolarimeter has been used to record paired sets of polarization-dependent and axially resolved x-ray spectra emitted by wire array z-pinches. In this measurement, two internal planes inside a suitable crystal diffract the x-rays into two perpendicular directions that are normal to each other, thereby separating incident x-rays into their linearly polarized components. This paper gives considerations for fielding the instrument on extended sources. Results from extended sources are difficult to interpret because generally the incident x-rays are not separated properly by the crystal. This difficulty is mitigated by using a series of collimating slits to select incident x-rays that propagate in a plane of symmetry between the polarization-splitting planes. The resulting instrument and some of the spatially resolved polarized x-ray spectra recorded for a 1-MA aluminum wire array z-pinch at the Nevada Terawatt Facility at the University of Nevada, Reno will be presented.

  20. Excess current in ferromagnet-superconductor structures with fully polarized triplet component

    NASA Astrophysics Data System (ADS)

    Moor, Andreas; Volkov, Anatoly F.; Efetov, Konstantin B.

    2016-05-01

    We study the I -V characteristics of ST/n/N contacts, where ST is a BCS superconductor S with a built-in exchange field h , n represents a normal metal wire, and N a normal metal reservoir. The superconductor ST is separated from the n wire by a spin filter which allows the passage of electrons with a certain spin direction so that only fully polarized triplet Cooper pairs penetrate into the n wire. We show that both the subgap conductance σsg and the excess current Iexc, which occur in conventional S/n/N contacts due to Andreev reflection (AR), exist also in the considered system. In our case, they are caused by unconventional AR that is not accompanied by spin flip. The excess current Iexc exists only if h exceeds a certain magnitude hc. At h

  1. True-3D Strain Mapping for Assessment of Material Deformation by Synchrotron X-Ray Microtomography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahn, J.J.; Toda, H.; Niinomi, M.

    2005-04-09

    Downsizing of products with complex shapes has been accelerated thanks to the rapid development of electrodevice manufacturing technology. Micro electromechanical systems (MEMS) are one of such typical examples. 3D strain measurement of such miniature products is needed to ensure their reliability. In the present study, as preliminary trial for it 3D tensile deformation behavior of a pure aluminum wire is examined using the synchrotron X-ray microtomography technique at Spring-8, Japan. Multipurpose in-situ tester is used to investigate real-time tensile deformation behavior of the Al wire. Tensile tests are carried out under strokes of 0, 0.005, 0.01 and 0.015mm. It measuresmore » 3D local deformation of a region of interest by tracking a relative movement of a pair of particles at each point. Local deformation behavior of the Al wire is identified to be different from macroscopic deformation behavior. It may be closely associated with underlying microstructure.« less

  2. Endothelial TWIST1 Promotes Pathological Ocular Angiogenesis

    PubMed Central

    Li, Jie; Liu, Chi-Hsiu; Sun, Ye; Gong, Yan; Fu, Zhongjie; Evans, Lucy P.; Tian, Katherine T.; Juan, Aimee M.; Hurst, Christian G.; Mammoto, Akiko; Chen, Jing

    2014-01-01

    Purpose. Pathological neovessel formation impacts many blinding vascular eye diseases. Identification of molecular signatures distinguishing pathological neovascularization from normal quiescent vessels is critical for developing new interventions. Twist-related protein 1 (TWIST1) is a transcription factor important in tumor and pulmonary angiogenesis. This study investigated the potential role of TWIST1 in modulating pathological ocular angiogenesis in mice. Methods. Twist1 expression and localization were analyzed in a mouse model of oxygen-induced retinopathy (OIR). Pathological ocular angiogenesis in Tie2-driven conditional Twist1 knockout mice were evaluated in both OIR and laser-induced choroidal neovascularization models. In addition, the effects of TWIST1 on angiogenesis and endothelial cell function were analyzed in sprouting assays of aortic rings and choroidal explants isolated from Twist1 knockout mice, and in human retinal microvascular endothelial cells treated with TWIST1 small interfering RNA (siRNA). Results. TWIST1 is highly enriched in pathological neovessels in OIR retinas. Conditional Tie2-driven depletion of Twist1 significantly suppressed pathological neovessels in OIR without impacting developmental retinal angiogenesis. In a laser-induced choroidal neovascularization model, Twist1 deficiency also resulted in significantly smaller lesions with decreased vascular leakage. In addition, loss of Twist1 significantly decreased vascular sprouting in both aortic ring and choroid explants. Knockdown of TWIST1 in endothelial cells led to dampened expression of vascular endothelial growth factor receptor 2 (VEGFR2) and decreased endothelial cell proliferation. Conclusions. Our study suggests that TWIST1 is a novel regulator of pathologic ocular angiogenesis and may represent a new molecular target for developing potential therapeutic treatments to suppress pathological neovascularization in vascular eye diseases. PMID:25414194

  3. Efficacy of 25-OH Vitamin D3 prophylactic administration for reducing lameness in broilers grown on wire flooring.

    PubMed

    Wideman, R F; Blankenship, J; Pevzner, I Y; Turner, B J

    2015-08-01

    Bacterial chondronecrosis with osteomyelitis (BCO) is the most common cause of lameness in commercial broilers. Growing broilers on wire flooring provides an excellent experimental model for reproducibly triggering significant levels of lameness attributable to BCO. In the present study we evaluated the efficacy of adding HyD (25-OH vitamin D3) to the drinking water as a preventative/prophylactic treatment for lameness. Broiler chicks were reared on 5 x 10 ft flat wire floor panels within 6 environmental chambers. Three chambers were supplied with tap water (Control group) and the remaining chambers were supplied with HyD (HyD group: 0.06 mL HyD solution/L water; dosing based on the HyD Solution label to provide 33.9 μg 25-OHD3/L) from d 1 through 56. Feed was provided ad libitum and was formulated to meet or exceed minimum standards for all ingredients, including 5,500 IU vitamin D3/kg. Lameness initially was detected on d 28, and the cumulative incidence of lameness on d 56 was higher in the Control group than in the HyD group (34.7 vs. 22.7%, respectively; P = 0.03; Z-test of proportions; chambers pooled). The most prevalent diagnoses for lame birds were osteochondrosis and osteomyelitis (BCO) of the proximal femora (52%) and tibiae (79%), accompanied by minor incidences of tibial dyschondroplasia (0.33%), spondylolisthesis, or kinky back (0.67%), and twisted legs (1%). Broilers that survived to d 56 without developing lameness did not differ in BW when compared by group within a gender. The wire flooring model imposes a rigorous, sustained challenge that undoubtedly is much more severe than typically would be experienced by broilers under normal commercial conditions. Therefore the encouraging response to HyD supplementation in the present study supports the potential for 25-OH vitamin D3 to attenuate outbreaks of lameness caused by BCO in commercial broiler flocks. © 2015 Poultry Science Association Inc.

  4. Variation in flexural properties of photo-pultruded composite archwires: analyses of round and rectangular profiles.

    PubMed

    Fallis, D W; Kusy, R P

    2000-11-01

    Prototype continuous, unidirectional, fiber-reinforced composite archwires were manufactured into round and rectangular profiles utilizing a photo-pultrusion process. Both 0.022 inch (0.56 mm) diameter and 0.021 x 0.028 inch (0.53 x 0.71 mm) rectangular composites were formed utilizing commercially available S2-glass reinforcement within a polymeric matrix. Reinforcement was varied according to the number, denier and twists per inch (TPI) of four S2-glass yarns to volume levels of 32-74% for round and 41-61% for rectangular profiles. Cross-sectional geometry was evaluated via light microscopy to determine loading characteristics; whereas two flexural properties (the elastic moduli and flexural strengths) were determined by 3-point bending tests. Morphological evaluation of samples revealed that as the TPI increased from 1 to 8, the yarns were more separated from one another and distributed more peripherally within a profile. For round and rectangular profiles utilizing 1 TPI fibers, moduli increased with fiber content approaching theoretical values. For round profiles utilizing 1 TPI and 4 TPI fibers, flexural strengths increased until the loading geometry was optimized. In contrast, the flexural strengths of composites that were pultruded with 8 TPI fibers were not improved at any loading level. Doubling the denier of the yarn, without altering the loading, increased both the moduli and flexural strengths in rectangular samples; whereas, the increases observed in round samples were not statistically significant. At optimal loading the maximum mean moduli and strengths equaled 53.6 +/- 2.0 and 1.36 +/- 0.17 GPa for round wire and equaled 45.7 +/- 0.8 and 1.40 +/- 0.05 GPa for rectangular wires, respectively. These moduli were midway between that of martensitic NiTi (33.4 GPa) and beta-titanium (72.4 GPa), and produced about one-quarter the force of a stainless steel wire per unit of activation. Values of strengths placed this composite material in the range of published values for beta-titanium wires (1.3-1.5 GPa). Copyright 2000 Kluwer Academic Publishers

  5. Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease.

    PubMed

    Xue, Gongda; Hemmings, Brian A

    2012-02-01

    The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.

  6. Role of left ventricular twist mechanics in cardiomyopathies, dance of the helices

    PubMed Central

    Kauer, Floris; Geleijnse, Marcel Leonard; van Dalen, Bastiaan Martijn

    2015-01-01

    Left ventricular twist is an essential part of left ventricular function. Nevertheless, knowledge is limited in “the cardiology community” as it comes to twist mechanics. Fortunately the development of speckle tracking echocardiography, allowing accurate, reproducible and rapid bedside assessment of left ventricular twist, has boosted the interest in this important mechanical aspect of left ventricular deformation. Although the fundamental physiological role of left ventricular twist is undisputable, the clinical relevance of assessment of left ventricular twist in cardiomyopathies still needs to be established. The fact remains; analysis of left ventricular twist mechanics has already provided substantial pathophysiological understanding on a comprehensive variety of cardiomyopathies. It has become clear that increased left ventricular twist in for example hypertrophic cardiomyopathy may be an early sign of subendocardial (microvascular) dysfunction. Furthermore, decreased left ventricular twist may be caused by left ventricular dilatation or an extensive myocardial scar. Finally, the detection of left ventricular rigid body rotation in noncompaction cardiomyopathy may provide an indispensible method to objectively confirm this difficult diagnosis. All this endorses the value of left ventricular twist in the field of cardiomyopathies and may further encourage the implementation of left ventricular twist parameters in the “diagnostic toolbox” for cardiomyopathies. PMID:26322187

  7. Feature extraction using molecular planes for fuzzy relational clustering of a flexible dopamine reuptake inhibitor.

    PubMed

    Banerjee, Amit; Misra, Milind; Pai, Deepa; Shih, Liang-Yu; Woodley, Rohan; Lu, Xiang-Jun; Srinivasan, A R; Olson, Wilma K; Davé, Rajesh N; Venanzi, Carol A

    2007-01-01

    Six rigid-body parameters (Shift, Slide, Rise, Tilt, Roll, Twist) are commonly used to describe the relative displacement and orientation of successive base pairs in a nucleic acid structure. The present work adapts this approach to describe the relative displacement and orientation of any two planes in an arbitrary molecule-specifically, planes which contain important pharmacophore elements. Relevant code from the 3DNA software package (Nucleic Acids Res. 2003, 31, 5108-5121) was generalized to treat molecular fragments other than DNA bases as input for the calculation of the corresponding rigid-body (or "planes") parameters. These parameters were used to construct feature vectors for a fuzzy relational clustering study of over 700 conformations of a flexible analogue of the dopamine reuptake inhibitor, GBR 12909. Several cluster validity measures were used to determine the optimal number of clusters. Translational (Shift, Slide, Rise) rather than rotational (Tilt, Roll, Twist) features dominate clustering based on planes that are relatively far apart, whereas both types of features are important to clustering when the pair of planes are close by. This approach was able to classify the data set of molecular conformations into groups and to identify representative conformers for use as template conformers in future Comparative Molecular Field Analysis studies of GBR 12909 analogues. The advantage of using the planes parameters, rather than the combination of atomic coordinates and angles between molecular planes used in our previous fuzzy relational clustering of the same data set (J. Chem. Inf. Model. 2005, 45, 610-623), is that the present clustering results are independent of molecular superposition and the technique is able to identify clusters in the molecule considered as a whole. This approach is easily generalizable to any two planes in any molecule.

  8. Extension-twist coupling of composite circular tubes with application to tilt rotor blade design

    NASA Technical Reports Server (NTRS)

    Nixon, Mark W.

    1987-01-01

    This investigation was conducted to determine if twist deformation required for the design of full-scale extension-twist-coupled tilt-rotor blades can be achieved within material design limit loads, and to demonstrate the accuracy of a coupled-beam analysis in predicting twist deformations. Two extension-twist-coupled tilt-rotor blade designs were developed based on theoretically optimum aerodynamic twist distributions. The designs indicated a twist rate requirement of between .216 and .333 deg/in. Agreement between axial tests and analytical predictions was within 10 percent at design limit loads. Agreement between the torsion tests and predictions was within 11 percent.

  9. The Twist Limit for Bipolar Active Regions

    NASA Technical Reports Server (NTRS)

    Moore, Ron; Falconer, David; Gary, Allen

    2008-01-01

    We present new evidence that further supports the standard idea that active regions are emerged magnetic-flux-rope omega loops. When the axial magnetic twist of a cylindrical flux rope exceeds a critical amount, the flux rope becomes unstable to kinking, and the excess axial twist is converted into writhe twist by the kinking. This suggests that, if active regions are emerged omega loops, then (1) no active region should have magnetic twist much above the limit set by kinking, (2) active regions having twist near the limit should often arise from kinked omega loops, and (3) since active regions having large delta sunspots are outstandingly twisted, these arise from kinked omega loops and should have twist near the limit for kinking. From each of 36 vector magnetograms of bipolar active regions, we have measured (1) the total flux of the vertical field above 100 G, (2) the area covered by this flux, and (3) the net electric current that arches over the polarity inversion line. These three quantities yield an estimate of the axial magnetic twist in a simple model cylindrical flux rope that corresponds to the top of the active region s hypothetical omega loop prior to emergence. In all 36 cases, the estimated twist is below the critical limit for kinking. The 11 most twisted active regions (1) have estimated twist within a factor of approx.3 of the limit, and (2) include all of our 6 active regions having large delta sunspots. Thus, our observed twist limit for bipolar active regions is in good accord with active regions being emerged omega loops.

  10. Twisted intramolecular charge transfer investigation of semi organic L-Glutamic acid hydrochloride single crystal for organic light-emitting and optical limiting applications

    NASA Astrophysics Data System (ADS)

    Joy, Lija K.; George, Merin; Alex, Javeesh; Aravind, Arun; Sajan, D.; Vinitha, G.

    2018-03-01

    Single crystals of L-Glutamic acid hydrochloride (LGHCl) were grown by slow evaporation solution technique and good crystalline perfection was confirmed by Powder X-ray diffraction studies. The complete vibrational studies of the compound were analyzed by FT-IR, FT-Raman and UV-visible spectra combined with Normal Coordinate Analysis (NCA) following the scaled quantum mechanical force field methodology and density functional theory (DFT). Twisted Intramolecular Charge Transfer (ICT) occurs due to the presence of strong ionic intra-molecular Nsbnd H⋯O hydrogen bonding was confirmed by Hirshfeld Surface analysis. The existence of intermolecular Nsbnd H⋯Cl hydrogen bonds due to the interaction between the lone pair of oxygen with the antibonding orbital was established by NBO analysis. The Z-scan result indicated that the title molecule exhibits saturable absorption behavior. The attractive third-order nonlinear properties suggest that LGHCl can be a promising candidate for the design and development devices for optical limiting applications. LGHCL exhibits distinct emission in the blue region of the fluorescence lifetime which proves to be a potential candidate for blue- Organic light-emitting diodes (OLEDs) fabrication.

  11. α-Synuclein amyloid fibrils with two entwined, asymmetrically associated protofibrils [α-Synuclein amyloid fibrils with two entwined, asymmetrically associated, protofibrils and axially stacked metal binding sites

    DOE PAGES

    Dearborn, Altaira D.; Wall, Joseph S.; Cheng, Naiqian; ...

    2015-12-07

    Parkinson disease and other progressive neurodegenerative conditions are characterized by the intracerebral presence of Lewy bodies, containing amyloid fibrils of α-synuclein. We used cryo-electron microscopy and scanning transmission electron microscopy (STEM) to study in vitro-assembled fibrils. These fibrils are highly polymorphic. Focusing on twisting fibrils with an inter-crossover spacing of 77 nm, our reconstructions showed them to consist of paired protofibrils. STEM mass per length data gave one subunit per 0.47 nm axial rise per protofibril, consistent with a superpleated β-structure. The STEM images show two thread-like densities running along each of these fibrils, which we interpret as ladders ofmore » metal ions. These threads confirmed the two-protofibril architecture of the 77-nm twisting fibrils and allowed us to identify this morphotype in STEM micrographs. Some other, but not all, fibril morphotypes also exhibit dense threads, implying that they also present a putative metal binding site. As a result, we propose a molecular model for the protofibril and suggest that polymorphic variant fibrils have different numbers of protofibrils that are associated differently.« less

  12. A dual-satellite study of the spatial properties of FTEs. [flux transfer events

    NASA Technical Reports Server (NTRS)

    Saunders, M. A.; Russell, C. T.; Sckopke, N.

    1984-01-01

    Reconnection at the earth's dayside magnetopause may manifest itself primarily as a localized and transient process called a flux-transfer event (FTE). The spatial properties of FTEs are investigated directly by examining data from the ISEE satellite pair when the satellites were separated by more than 1000 km in the vicinity of the magnetopause. Examples of magnetosheath and boundary layer FTEs, each having a dimension normal to the magnetopause of order an earth radius, R(E), are shown, and this scale-size result is substantiated statistically for magnetosheath FTEs. When combined with other information, a 1-R(E) normal dimension implies that the voltage associated with the FTE process at one magnetopause location is at least 10 kV. These findings strengthen the view that the magnetic field comprising an FTE is twisted, this twisting appearing to be continuous in sense across the magnetopause and corresponding to a core field-aligned current of magnitude a few hundred kA. Changes in plasma flow speed and direction are found to be associated with FTEs. The transverse field and flow perturbations accompanying the three magnetosheath FTEs studied here satisfy approximately the Walen relation, the relation which describes a propagating Alfven wave.

  13. Probing gluon saturation with next-to-leading order photon production at central rapidities in proton-nucleus collisions

    DOE PAGES

    Benic, Sanjin; Fukushima, Kenji; Garcia-Montero, Oscar; ...

    2017-01-26

    Here, we compute the cross section for photons emitted from sea quarks in proton-nucleus collisions at collider energies. The computation is performed within the dilute-dense kinematics of the Color Glass Condensate (CGC) effective field theory. Albeit the result obtained is formally at next-to-leading order in the CGC power counting, it provides the dominant contribution for central rapidities. We observe that the inclusive photon cross section is proportional to all-twist Wilson line correlators in the nucleus. These correlators also appear in quark-pair production; unlike the latter, photon production is insensitive to hadronization uncertainties and therefore more sensitive to multi-parton correlations inmore » the gluon saturation regime of QCD. We demonstrate that k ⊥ and collinear factorized expressions for inclusive photon production are obtained as leading twist approximations to our result. In particular, the collinearly factorized expression is directly sensitive to the nuclear gluon distribution at small x. Other results of interest include the realization of the Low-Burnett-Kroll soft photon theorem in the CGC framework and a comparative study of how the photon amplitude is obtained in Lorenz and light-cone gauges.« less

  14. Handbook for Implementing Agile in Department of Defense Information Technology Acquisition

    DTIC Science & Technology

    2010-12-15

    Wire-frame Mockup of iTunes Cover Flow Feature (source: http://www.balsamiq.com/products/mockups/examples#mytunez...programming. The JOPES customer was included early in the development process in order to understand requirements management (story cards ), observe...transition by teaching the new members Agile processes, such as story card development, refactoring, and pair programming. Additionally, the team worked to

  15. Processing mechanics of alternate twist ply (ATP) yarn technology

    NASA Astrophysics Data System (ADS)

    Elkhamy, Donia Said

    Ply yarns are important in many textile manufacturing processes and various applications. The primary process used for producing ply yarns is cabling. The speed of cabling is limited to about 35m/min. With the world's increasing demands of ply yarn supply, cabling is incompatible with today's demand activated manufacturing strategies. The Alternate Twist Ply (ATP) yarn technology is a relatively new process for producing ply yarns with improved productivity and flexibility. This technology involves self plying of twisted singles yarn to produce ply yarn. The ATP process can run more than ten times faster than cabling. To implement the ATP process to produce ply yarns there are major quality issues; uniform Twist Profile and yarn Twist Efficiency. The goal of this thesis is to improve these issues through process modeling based on understanding the physics and processing mechanics of the ATP yarn system. In our study we determine the main parameters that control the yarn twist profile. Process modeling of the yarn twist across different process zones was done. A computational model was designed to predict the process parameters required to achieve a square wave twist profile. Twist efficiency, a measure of yarn torsional stability and bulk, is determined by the ratio of ply yarn twist to singles yarn twist. Response Surface Methodology was used to develop the processing window that can reproduce ATP yarns with high twist efficiency. Equilibrium conditions of tensions and torques acting on the yarns at the self ply point were analyzed and determined the pathway for achieving higher twist efficiency. Mechanistic modeling relating equilibrium conditions to the twist efficiency was developed. A static tester was designed to zoom into the self ply zone of the ATP yarn. A computer controlled, prototypic ATP machine was constructed and confirmed the mechanistic model results. Optimum parameters achieving maximum twist efficiency were determined in this study. The successful results of this work have led to the filing of a US patent disclosing the method for producing ATP yarns with high yarn twist efficiency using a high convergence angle at the self ply point together with applying ply torque.

  16. Genomic pathways modulated by Twist in breast cancer.

    PubMed

    Vesuna, Farhad; Bergman, Yehudit; Raman, Venu

    2017-01-13

    The basic helix-loop-helix transcription factor TWIST1 (Twist) is involved in embryonic cell lineage determination and mesodermal differentiation. There is evidence to indicate that Twist expression plays a role in breast tumor formation and metastasis, but the role of Twist in dysregulating pathways that drive the metastatic cascade is unclear. Moreover, many of the genes and pathways dysregulated by Twist in cell lines and mouse models have not been validated against data obtained from larger, independant datasets of breast cancer patients. We over-expressed the human Twist gene in non-metastatic MCF-7 breast cancer cells to generate the estrogen-independent metastatic breast cancer cell line MCF-7/Twist. These cells were inoculated in the mammary fat pad of female severe compromised immunodeficient mice, which subsequently formed xenograft tumors that metastasized to the lungs. Microarray data was collected from both in vitro (MCF-7 and MCF-7/Twist cell lines) and in vivo (primary tumors and lung metastases) models of Twist expression. Our data was compared to several gene datasets of various subtypes, classes, and grades of human breast cancers. Our data establishes a Twist over-expressing mouse model of breast cancer, which metastasizes to the lung and replicates some of the ontogeny of human breast cancer progression. Gene profiling data, following Twist expression, exhibited novel metastasis driver genes as well as cellular maintenance genes that were synonymous with the metastatic process. We demonstrated that the genes and pathways altered in the transgenic cell line and metastatic animal models parallel many of the dysregulated gene pathways observed in human breast cancers. Analogous gene expression patterns were observed in both in vitro and in vivo Twist preclinical models of breast cancer metastasis and breast cancer patient datasets supporting the functional role of Twist in promoting breast cancer metastasis. The data suggests that genetic dysregulation of Twist at the cellular level drives alterations in gene pathways in the Twist metastatic mouse model which are comparable to changes seen in human breast cancers. Lastly, we have identified novel genes and pathways that could be further investigated as targets for drugs to treat metastatic breast cancer.

  17. Characterization of sequences in human TWIST required for nuclear localization

    PubMed Central

    Singh, Shalini; Gramolini, Anthony O

    2009-01-01

    Background Twist is a transcription factor that plays an important role in proliferation and tumorigenesis. Twist is a nuclear protein that regulates a variety of cellular functions controlled by protein-protein interactions and gene transcription events. The focus of this study was to characterize putative nuclear localization signals (NLSs) 37RKRR40 and 73KRGKK77 in the human TWIST (H-TWIST) protein. Results Using site-specific mutagenesis and immunofluorescences, we observed that altered TWISTNLS1 K38R, TWISTNLS2 K73R and K77R constructs inhibit nuclear accumulation of H-TWIST in mammalian cells, while TWISTNLS2 K76R expression was un-affected and retained to the nucleus. Subsequently, co-transfection of TWIST mutants K38R, K73R and K77R with E12 formed heterodimers and restored nuclear localization despite the NLSs mutations. Using a yeast-two-hybrid assay, we identified a novel TWIST-interacting candidate TCF-4, a basic helix-loop-helix transcription factor. The interaction of TWIST with TCF-4 confirmed using NLS rescue assays, where nuclear expression of mutant TWISTNLS1 with co-transfixed TCF-4 was observed. The interaction of TWIST with TCF-4 was also seen using standard immunoprecipitation assays. Conclusion Our study demonstrates the presence of two putative NLS motifs in H-TWIST and suggests that these NLS sequences are functional. Furthermore, we identified and confirmed the interaction of TWIST with a novel protein candidate TCF-4. PMID:19534813

  18. Teaching Spatial Awareness for Better Twisting Somersaults.

    ERIC Educational Resources Information Center

    Hennessy, Jeff T.

    1985-01-01

    The barani (front somersault with one-half twist) and the back somersault with one twist are basic foundation skills necessary for more advanced twisting maneuvers. Descriptions of these movements on a trampoline surface are offered. (DF)

  19. miR-300 inhibits epithelial to mesenchymal transition and metastasis by targeting Twist in human epithelial cancer

    PubMed Central

    2014-01-01

    Background Epithelial-to-mesenchymal transition (EMT) is a key step of the progression of tumor cell metastasis. Recent work has demonstrated some miRNAs play critical roles in EMT. In this study, we focused on the roles of miR-300 in regulating EMT. Methods The expression levels of miR-300 were examined in epithelial carcinoma cells that underwent an EMT using quantitative reverse transcription-PCR. The role of miR-300 in EMT was investigated by transfection of the miR-300 mimic or inhibitor in natural epithelial-mesenchymal phenotype cell line pairs and in transforming growth factor (TGF) beta-induced EMT cell models. A luciferase reporter assay and a rescue experiment were conducted to confirm the target gene of miR-300. The efficacy of miR-300 against tumor invasion and metastasis was evaluated both in vitro and in vivo. Correlation analysis between miR-300 expression and the expression levels of its target gene, as well as tumor metastasis was performed in specimens from patients with head and neck squamous cell carcinoma (HNSCC). Results MiR-300 was found down-regulated in the HNSCC cells and breast cancer cells that underwent EMT. Ectopic expression of miR-300 effectively blocked TGF-beta-induced EMT and reversed the phenotype of EMT in HN-12 and MDA-MB-231 cells, but inhibition of miR-300 in the epithelial phenotype cells, HN-4 and MCF-7 cells, could induce EMT. The luciferase reporter assay and the rescue assay results showed that miR-300 directly targets the 3′UTR of Twist. Enforced miR-300 expression suppressed cell invasion in vitro and experimental metastasis in vivo. Clinically, miR-300 expression was found inversely correlated with Twist expression and reduced miR-300 was associated with metastasis in patient specimens. Conclusions Down-regulation of miR-300 is required for EMT initiation and maintenance. MiR-300 may negatively regulate EMT by direct targeting Twist and therefore inhibit cancer cell invasion and metastasis, which implicates miR-300 as an attractive candidate for cancer therapy. PMID:24885626

  20. miR-300 inhibits epithelial to mesenchymal transition and metastasis by targeting Twist in human epithelial cancer.

    PubMed

    Yu, Jingshuang; Xie, Furong; Bao, Xin; Chen, Wantao; Xu, Qin

    2014-05-24

    Epithelial-to-mesenchymal transition (EMT) is a key step of the progression of tumor cell metastasis. Recent work has demonstrated some miRNAs play critical roles in EMT. In this study, we focused on the roles of miR-300 in regulating EMT. The expression levels of miR-300 were examined in epithelial carcinoma cells that underwent an EMT using quantitative reverse transcription-PCR. The role of miR-300 in EMT was investigated by transfection of the miR-300 mimic or inhibitor in natural epithelial-mesenchymal phenotype cell line pairs and in transforming growth factor (TGF) beta-induced EMT cell models. A luciferase reporter assay and a rescue experiment were conducted to confirm the target gene of miR-300. The efficacy of miR-300 against tumor invasion and metastasis was evaluated both in vitro and in vivo. Correlation analysis between miR-300 expression and the expression levels of its target gene, as well as tumor metastasis was performed in specimens from patients with head and neck squamous cell carcinoma (HNSCC). MiR-300 was found down-regulated in the HNSCC cells and breast cancer cells that underwent EMT. Ectopic expression of miR-300 effectively blocked TGF-beta-induced EMT and reversed the phenotype of EMT in HN-12 and MDA-MB-231 cells, but inhibition of miR-300 in the epithelial phenotype cells, HN-4 and MCF-7 cells, could induce EMT. The luciferase reporter assay and the rescue assay results showed that miR-300 directly targets the 3'UTR of Twist. Enforced miR-300 expression suppressed cell invasion in vitro and experimental metastasis in vivo. Clinically, miR-300 expression was found inversely correlated with Twist expression and reduced miR-300 was associated with metastasis in patient specimens. Down-regulation of miR-300 is required for EMT initiation and maintenance. MiR-300 may negatively regulate EMT by direct targeting Twist and therefore inhibit cancer cell invasion and metastasis, which implicates miR-300 as an attractive candidate for cancer therapy.

  1. Metastasis-associated in colon cancer-1 promotes vasculogenic mimicry in gastric cancer by upregulating TWIST1/2

    PubMed Central

    Wang, Lin; Lin, Li; Chen, Xi; Sun, Li; Liao, Yulin; Huang, Na; Liao, Wangjun

    2015-01-01

    Vasculogenic mimicry (VM) is a blood supply modality that is strongly associated with the epithelial-mesenchymal transition (EMT), TWIST1 activation and tumor progression. We previously reported that metastasis-associated in colon cancer-1 (MACC1) induced the EMT and was associated with a poor prognosis of patients with gastric cancer (GC), but it remains unknown whether MACC1 promotes VM and regulates the TWIST signaling pathway in GC. In this study, we investigated MACC1 expression and VM by immunohistochemistry in 88 patients with stage IV GC, and also investigated the role of TWIST1 and TWIST2 in MACC1-induced VM by using nude mice with GC xenografts and GC cell lines. We found that the VM density was significantly increased in the tumors of patients who died of GC and was positively correlated with MACC1 immunoreactivity (p < 0.05). The 3-year survival rate was only 8.6% in patients whose tumors showed double positive staining for MACC1 and VM, whereas it was 41.7% in patients whose tumors were negative for both MACC1 and VM. Moreover, nuclear expression of MACC1, TWIST1, and TWIST2 was upregulated in GC tissues compared with matched adjacent non-tumorous tissues (p < 0.05). Overexpression of MACC1 increased TWIST1/2 expression and induced typical VM in the GC xenografts of nude mice and in GC cell lines. MACC1 enhanced TWIST1/2 promoter activity and facilitated VM, while silencing of TWIST1 or TWIST2 inhibited VM. Hepatocyte growth factor (HGF) increased the nuclear translocation of MACC1, TWIST1, and TWIST2, while a c-Met inhibitor reduced these effects. These findings indicate that MACC1 promotes VM in GC by regulating the HGF/c-Met-TWIST1/2 signaling pathway, which means that MACC1 and this pathway are potential new therapeutic targets for GC. PMID:25895023

  2. Numerical investigation of heat transfer and friction factor characteristics in a circular tube fitted with V-cut twisted tape inserts.

    PubMed

    Salman, Sami D; Kadhum, Abdul Amir H; Takriff, Mohd S; Mohamad, Abu Bakar

    2013-01-01

    Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration.

  3. Numerical Investigation of Heat Transfer and Friction Factor Characteristics in a Circular Tube Fitted with V-Cut Twisted Tape Inserts

    PubMed Central

    Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

    2013-01-01

    Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration. PMID:24078795

  4. Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

    NASA Astrophysics Data System (ADS)

    Hu, F.; Das, Suprem R.; Luan, Y.; Chung, T.-F.; Chen, Y. P.; Fei, Z.

    2017-12-01

    We report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly due to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.

  5. Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, F.; Das, Suprem R.; Luan, Y.

    Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

  6. Hydrogen bonds and twist in cellulose microfibrils.

    PubMed

    Kannam, Sridhar Kumar; Oehme, Daniel P; Doblin, Monika S; Gidley, Michael J; Bacic, Antony; Downton, Matthew T

    2017-11-01

    There is increasing experimental and computational evidence that cellulose microfibrils can exist in a stable twisted form. In this study, atomistic molecular dynamics (MD) simulations are performed to investigate the importance of intrachain hydrogen bonds on the twist in cellulose microfibrils. We systematically enforce or block the formation of these intrachain hydrogen bonds by either constraining dihedral angles or manipulating charges. For the majority of simulations a consistent right handed twist is observed. The exceptions are two sets of simulations that block the O2-O6' intrachain hydrogen bond, where no consistent twist is observed in multiple independent simulations suggesting that the O2-O6' hydrogen bond can drive twist. However, in a further simulation where exocyclic group rotation is also blocked, right-handed twist still develops suggesting that intrachain hydrogen bonds are not necessary to drive twist in cellulose microfibrils. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

    DOE PAGES

    Hu, F.; Das, Suprem R.; Luan, Y.; ...

    2017-12-13

    Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

  8. Gauge transformations for twisted spectral triples

    NASA Astrophysics Data System (ADS)

    Landi, Giovanni; Martinetti, Pierre

    2018-05-01

    It is extended to twisted spectral triples the fluctuations of the metric as bounded perturbations of the Dirac operator that arises when a spectral triple is exported between Morita equivalent algebras, as well as gauge transformations which are obtained by the action of the unitary endomorphisms of the module implementing the Morita equivalence. It is firstly shown that the twisted-gauged Dirac operators, previously introduced to generate an extra scalar field in the spectral description of the standard model of elementary particles, in fact follow from Morita equivalence between twisted spectral triples. The law of transformation of the gauge potentials turns out to be twisted in a natural way. In contrast with the non-twisted case, twisted fluctuations do not necessarily preserve the self-adjointness of the Dirac operator. For a self-Morita equivalence, conditions are obtained in order to maintain self-adjointness that are solved explicitly for the minimal twist of a Riemannian manifold.

  9. Random waves in the brain: Symmetries and defect generation in the visual cortex

    NASA Astrophysics Data System (ADS)

    Schnabel, M.; Kaschube, M.; Löwel, S.; Wolf, F.

    2007-06-01

    How orientation maps in the visual cortex of the brain develop is a matter of long standing debate. Experimental and theoretical evidence suggests that their development represents an activity-dependent self-organization process. Theoretical analysis [1] exploring this hypothesis predicted that maps at an early developmental stage are realizations of Gaussian random fields exhibiting a rigorous lower bound for their densities of topological defects, called pinwheels. As a consequence, lower pinwheel densities, if observed in adult animals, are predicted to develop through the motion and annihilation of pinwheel pairs. Despite of being valid for a large class of developmental models this result depends on the symmetries of the models and thus of the predicted random field ensembles. In [1] invariance of the orientation map's statistical properties under independent space rotations and orientation shifts was assumed. However, full rotation symmetry appears to be broken by interactions of cortical neurons, e.g. selective couplings between groups of neurons with collinear orientation preferences [2]. A recently proposed new symmetry, called shift-twist symmetry [3], stating that spatial rotations have to occur together with orientation shifts in order to be an appropriate symmetry transformation, is more consistent with this organization. Here we generalize our random field approach to this important symmetry class. We propose a new class of shift-twist symmetric Gaussian random fields and derive the general correlation functions of this ensemble. It turns out that despite strong effects of the shift-twist symmetry on the structure of the correlation functions and on the map layout the lower bound on the pinwheel densities remains unaffected, predicting pinwheel annihilation in systems with low pinwheel densities.

  10. Arm position influences the activation patterns of trunk muscles during trunk range-of-motion movements.

    PubMed

    Siu, Aaron; Schinkel-Ivy, Alison; Drake, Janessa Dm

    2016-10-01

    To understand the activation patterns of the trunk musculature, it is also important to consider the implications of adjacent structures such as the upper limbs, and the muscles that act to move the arms. This study investigated the effects of arm positions on the activation patterns and co-activation of the trunk musculature and muscles that move the arm during trunk range-of-motion movements (maximum trunk axial twist, flexion, and lateral bend). Fifteen males and fifteen females, asymptomatic for low back pain, performed maximum trunk range-of-motion movements, with three arm positions for axial twist (loose, crossed, abducted) and two positions for flexion and lateral bend (loose, crossed). Electromyographical data were collected for eight muscles bilaterally, and activation signals were cross-correlated between trunk muscles and the muscles that move the arms (upper trapezius, latissimus dorsi). Results revealed consistently greater muscle co-activation (higher cross-correlation coefficients) between the trunk muscles and upper trapezius for the abducted arm position during maximum trunk axial twist, while results for the latissimus dorsi-trunk pairings were more dependent on the specific trunk muscles (either abdominal or back) and latissimus dorsi muscle (either right or left side), as well as the range-of-motion movement. The findings of this study contribute to the understanding of interactions between the upper limbs and trunk, and highlight the influence of arm positions on the trunk musculature. In addition, the comparison of the present results to those of individuals with back or shoulder conditions may ultimately aid in elucidating underlying mechanisms or contributing factors to those conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Discrete and continuum modeling of solvent effects in a twisted intramolecular charge transfer system: The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule.

    PubMed

    Modesto-Costa, Lucas; Borges, Itamar

    2018-08-05

    The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Study of nonlinear MHD equations governing the wave propagation in twisted coronal loops

    NASA Technical Reports Server (NTRS)

    Parhi, S.; DeBruyne, P.; Goossens, M.; Zhelyazkov, I.

    1995-01-01

    The solar corona, modelled by a low beta, resistive plasma slab, sustains MHD wave propagations due to shearing footpoint motions in the photosphere. By using a numerical algorithm the excitation and nonlinear development of MHD waves in twisted coronal loops are studied. The plasma responds to the footpoint motion by sausage waves if there is no twist. The twist in the magnetic field of the loop destroys initially developed sausage-like wave modes and they become kinks. The transition from sausage to kink modes is analyzed. The twist brings about mode degradation producing high harmonics and this generates more complex fine structures. This can be attributed to several local extrema in the perturbed velocity profiles. The Alfven wave produces remnants of the ideal 1/x singularity both for zero and non-zero twist and this pseudo-singularity becomes less pronounced for larger twist. The effect of nonlinearity is clearly observed by changing the amplitude of the driver by one order of magnitude. The magnetosonic waves also exhibit smoothed remnants of ideal logarithmic singularities when the frequency of the driver is correctly chosen. This pseudo-singularity for fast waves is absent when the coronal loop does not undergo any twist but becomes pronounced when twist is included. On the contrary, it is observed for slow waves even if there is no twist. Increasing the twist leads to a higher heating rate of the loop. The larger twist shifts somewhat uniformly distributed heating to layers inside the slab corresponding to peaks in the magnetic field strength.

  13. Twist promotes tumor metastasis in basal-like breast cancer by transcriptionally upregulating ROR1.

    PubMed

    Cao, Jingying; Wang, Xin; Dai, Tao; Wu, Yuanzhong; Zhang, Meifang; Cao, Renxian; Zhang, Ruhua; Wang, Gang; Jiang, Rou; Zhou, Binhua P; Shi, Jian; Kang, Tiebang

    2018-01-01

    Rationale: Twist is a key transcription factor for induction of epithelial-mesenchymal transition (EMT), which promotes cell migration, invasion, and cancer metastasis, confers cancer cells with stem cell-like characteristics, and provides therapeutic resistance. However, the functional roles and targeted genes of Twist in EMT and cancer progression remain elusive. Methods: The potential targeted genes of Twist were identified from the global transcriptomes of T47D/Twist cells by microarray analysis. EMT phenotype was detected by western blotting and immunofluorescence of marker proteins. The dual-luciferase reporter and chromatin immunoprecipitation assays were employed to observe the direct transcriptional induction of ROR1 by Twist. A lung metastasis model was used to study the pro-metastatic role of Twist and ROR1 by injecting MDA-MB-231 cells into tail vein of nude mice. Bio-informatics analysis was utilized to measure the metastasis-free survival of breast cancer patients. Results: Twist protein was proved to directly activate the transcription of ROR1 gene, a receptor of Wnt5a in non-canonical WNT signaling pathway. Silencing of ROR1 inhibited EMT process, cell migration, invasion, and cancer metastasis of basal-like breast cancer (BLBC) cells. Knockdown of ROR1 also ameliorated the pro-metastatic effect of Twist. Furthermore, analyses of clinical specimens indicated that high expression of both ROR1 and Twist tightly correlates with poor metastasis-free survival of breast cancer patients. Conclusion: ROR1 is a targeted gene of Twist. Twist/ROR1 signaling is critical for invasion and metastasis of BLBC cells.

  14. Twist for Snyder space

    NASA Astrophysics Data System (ADS)

    Meljanac, Daniel; Meljanac, Stjepan; Mignemi, Salvatore; Pikutić, Danijel; Štrajn, Rina

    2018-03-01

    We construct the twist operator for the Snyder space. Our starting point is a non-associative star product related to a Hermitian realisation of the noncommutative coordinates originally introduced by Snyder. The corresponding coproduct of momenta is non-coassociative. The twist is constructed using a general definition of the star product in terms of a bi-differential operator in the Hopf algebroid approach. The result is given by a closed analytical expression. We prove that this twist reproduces the correct coproducts of the momenta and the Lorentz generators. The twisted Poincaré symmetry is described by a non-associative Hopf algebra, while the twisted Lorentz symmetry is described by the undeformed Hopf algebra. This new twist might be important in the construction of different types of field theories on Snyder space.

  15. Effect of twist on single-mode fiber-optic 3 × 3 couplers

    NASA Astrophysics Data System (ADS)

    Chen, Dandan; Ji, Minning; Peng, Lei

    2018-01-01

    In the fabricating process of a 3 × 3 fused tapered coupler, the three fibers are usually twisted to be close-contact. The effect of twist on 3 × 3 fused tapered couplers is investigated in this paper. It is found that though a linear 3 × 3 coupler may realize equal power splitting ratio theoretically by twisting a special angle, it is hard to be fabricated actually because the twist angle and the coupler's length must be determined in advance. While an equilateral 3 × 3 coupler can not only realize approximate equal power splitting ratio theoretically but can also be fabricated just by controlling the elongation length. The effect of twist on the equilateral 3 × 3 coupler lies in the relationship between the equal ratio error and the twist angle. The more the twist angle is, the larger the equal ratio error may be. The twist angle usually should be no larger than 90° on one coupling period length in order to keep the equal ratio error small enough. The simulation results agree well with the experimental data.

  16. Evidence for conformational capture mechanism for damage recognition by NER protein XPC/Rad4.

    NASA Astrophysics Data System (ADS)

    Chakraborty, Sagnik; Steinbach, Peter J.; Paul, Debamita; Min, Jung-Hyun; Ansari, Anjum

    Altered flexibility of damaged DNA sites is considered to play an important role in damage recognition by DNA repair proteins. Characterizing lesion-induced DNA dynamics has remained a challenge. We have combined ps-resolved fluorescence lifetime measurements with cytosine analog FRET pair uniquely sensitive to local unwinding/twisting to analyze DNA conformational distributions. This innovative approach maps out with unprecedented sensitivity the alternative conformations accessible to a series of DNA constructs containing 3-base-pair mismatch, suitable model lesions for the DNA repair protein xeroderma pigmentosum C (XPC) complex. XPC initiates eukaryotic nucleotide excision repair by recognizing various DNA lesions primarily through DNA deformability. Structural studies show that Rad4 (yeast ortholog of XPC) unwinds DNA at the lesion site and flips out two nucleotide pairs. Our results elucidate a broad range of conformations accessible to mismatched DNA even in the absence of the protein. Notably, the most severely distorted conformations share remarkable resemblance to the deformed conformation seen in the crystal structure of the Rad4-bound ``recognition'' complex supporting for the first time a possible ``conformational capture'' mechanism for damage recognition by XPC/Rad4. NSF Univ of Illinois-Chicago.

  17. Simultaneous measurement of cholinergic tone and neuronal network dynamics in vivo in the rat brain using a novel choline oxidase based electrochemical biosensor.

    PubMed

    Santos, Ricardo M; Laranjinha, João; Barbosa, Rui M; Sirota, Anton

    2015-07-15

    Acetylcholine (ACh) modulates neuronal network activities implicated in cognition, including theta and gamma oscillations but the mechanisms remain poorly understood. Joint measurements of cholinergic activity and neuronal network dynamics with high spatio-temporal resolution are critical to understand ACh neuromodulation. However, current electrochemical biosensors are not optimized to measure nanomolar cholinergic signals across small regions like hippocampal sub-layers. Here, we report a novel oxidase-based electrochemical biosensor that matches these constraints. The approach is based on measurement of H2O2 generated by choline oxidase (ChOx) in the presence of choline (Ch). The microelectrode design consists of a twisted pair of 50µm diameter Pt/Ir wires (sensor and sentinel), which is scalable, provides high spatial resolution and optimizes common mode rejection. Microelectrode coating with ChOx in chitosan cross-linked with benzoquinone is simple, mechanically robust and provides high sensitivity (324±46nAµM(-1)cm(-2)), a limit of detection of 16nM and a t50 response time of 1.4s. Local field potential (LFP)-related currents dominate high-frequency component of electrochemical recordings in vivo. We significantly improved signal-to-noise-ratio compared to traditional sentinel subtraction by a novel frequency domain common mode rejection procedure that accounts for differential phase and amplitude of LFP-related currents on the two channels. We demonstrate measurements of spontaneous nanomolar Ch fluctuations, on top of which micromolar Ch increases occurred during periods of theta activity in anesthetized rats. Measurements were not affected by physiological O2 changes, in agreement with the low biosensor Km for O2 (2.6µM). Design and performance of the novel biosensor opens the way for multisite recordings of spontaneous cholinergic dynamics in behaving animals. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. ACIST-FFR Study (Assessment of Catheter-Based Interrogation and Standard Techniques for Fractional Flow Reserve Measurement)

    PubMed Central

    Chambers, Jeffrey W.; Seto, Arnold H.; Sarembock, Ian J.; Raveendran, Ganesh; Sakarovitch, Charlotte; Yang, Lingyao; Desai, Manisha; Jeremias, Allen; Price, Matthew J.

    2017-01-01

    Background— Measurement of fractional flow reserve (FFR) to guide coronary revascularization lags despite robust supportive data, partly because of the handling characteristics of traditional coronary pressure wires. An optical pressure-monitoring microcatheter, which can be advanced over a traditional coronary guidewire, facilitates FFR assessment but may underestimate pressure wire–derived FFR. Methods and Results— In this prospective, multicenter trial, 169 patients underwent FFR assessment with a pressure wire alone and with a pressure microcatheter over the pressure wire. An independent core laboratory performed quantitative coronary angiography and evaluated all pressure tracings. The primary end point was the bias or difference between the microcatheter FFR and the pressure wire FFR, as assessed by Bland–Altman analysis. The mean difference between the microcatheter and the pressure wire–derived FFR values was −0.022 (95% confidence interval, −0.029 to −0.015). On multivariable analysis, reference vessel diameter (P=0.027) and lesion length (P=0.044) were independent predictors of bias between the 2 FFR measurements. When the microcatheter FFR was added to this model, it was the only independent predictor of bias (P<0.001). The mean FFR value from the microcatheter was significantly lower than from the pressure wire (0.81 versus 0.83; P<0.001). In 3% of cases (95% confidence interval, 1.3%–6.7%), there was clinically meaningful diagnostic discordance, with the FFR from the pressure wire >0.80 and that from the microcatheter <0.75. These findings were similar when including all 210 patients with site-reported paired FFR data. Conclusions— An optical, pressure-monitoring microcatheter measures lower FFR compared with a pressure wire, but the diagnostic impact appears to be minimal in most cases. Clinical Trial Registration— URL: https://www.clinicaltrials.gov. Unique identifier: NCT02577484. PMID:29246917

  19. Twisted supersymmetry: Twisted symmetry versus renormalizability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dimitrijevic, Marija; Nikolic, Biljana; Radovanovic, Voja

    We discuss a deformation of superspace based on a Hermitian twist. The twist implies a *-product that is noncommutative, Hermitian and finite when expanded in a power series of the deformation parameter. The Leibniz rule for the twisted supersymmetry transformations is deformed. A minimal deformation of the Wess-Zumino action is proposed and its renormalizability properties are discussed. There is no tadpole contribution, but the two-point function diverges. We speculate that the deformed Leibniz rule, or more generally the twisted symmetry, interferes with renormalizability properties of the model. We discuss different possibilities to render a renormalizable model.

  20. Twist limits for late twisting double somersaults on trampoline.

    PubMed

    Yeadon, M R; Hiley, M J

    2017-06-14

    An angle-driven computer simulation model of aerial movement was used to determine the maximum amount of twist that could be produced in the second somersault of a double somersault on trampoline using asymmetrical movements of the arms and hips. Lower bounds were placed on the durations of arm and hip angle changes based on performances of a world trampoline champion whose inertia parameters were used in the simulations. The limiting movements were identified as the largest possible odd number of half twists for forward somersaulting takeoffs and even number of half twists for backward takeoffs. Simulations of these two limiting movements were found using simulated annealing optimisation to produce the required amounts of somersault, tilt and twist at landing after a flight time of 2.0s. Additional optimisations were then run to seek solutions with the arms less adducted during the twisting phase. It was found that 3½ twists could be produced in the second somersault of a forward piked double somersault with arms abducted 8° from full adduction during the twisting phase and that three twists could be produced in the second somersault of a backward straight double somersault with arms fully adducted to the body. These two movements are at the limits of performance for elite trampolinists. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Design and Performance Evaluation of Real-time Endovascular Interventional Surgical Robotic System with High Accuracy.

    PubMed

    Wang, Kundong; Chen, Bing; Lu, Qingsheng; Li, Hongbing; Liu, Manhua; Shen, Yu; Xu, Zhuoyan

    2018-05-15

    Endovascular interventional surgery (EIS) is performed under a high radiation environment at the sacrifice of surgeons' health. This paper introduces a novel endovascular interventional surgical robot that aims to reduce radiation to surgeons and physical stress imposed by lead aprons during fluoroscopic X-ray guided catheter intervention. The unique mechanical structure allowed the surgeon to manipulate the axial and radial motion of the catheter and guide wire. Four catheter manipulators (to manipulate the catheter and guide wire), and a control console which consists of four joysticks, several buttons and two twist switches (to control the catheter manipulators) were presented. The entire robotic system was established on a master-slave control structure through CAN (Controller Area Network) bus communication, meanwhile, the slave side of this robotic system showed highly accurate control over velocity and displacement with PID controlling method. The robotic system was tested and passed in vitro and animal experiments. Through functionality evaluation, the manipulators were able to complete interventional surgical motion both independently and cooperatively. The robotic surgery was performed successfully in an adult female pig and demonstrated the feasibility of superior mesenteric and common iliac artery stent implantation. The entire robotic system met the clinical requirements of EIS. The results show that the system has the ability to imitate the movements of surgeons and to accomplish the axial and radial motions with consistency and high-accuracy. Copyright © 2018 John Wiley & Sons, Ltd.

  2. Blast injury face: An exemplified review of management

    PubMed Central

    Kumar, Vijay; Singh, Arun Kumar; Kumar, Parmod; Shenoy, Yogesh Ramdas; Verma, Anoop K.; Borole, Ateesh Jayram; Prasad, Veerendra

    2013-01-01

    Facial injuries are extremely common due to increased incidence of vehicular and industrial trauma and warfare injuries. But isolated injury to the face due to low voltage cells exploding is rare. In blast injury, the force can cause massive soft tissue injury, along with injury to facial fractures and damage to adnexa. Facial injury is not life threatening unless associated with other injuries of the skull and airway. The major risks to airway in facial trauma are due to anatomic alteration of patient's airway through bony and soft tissue disruption and increased chances of aspiration. The past several decades have seen a rapid growth in the range of procedures available for reconstructive purposes. However, the essential preliminary management is a must and needs to be structured. The patient, a 10-year-old boy, was joining three pencil batteries in series and twisting the wire with his teeth when one battery exploded causing severe injuries to midface and mandibular region. After stabilization, the patient was taken up for surgery. A cap splint with zygomatic suspension was done for the maxilla, and wiring of residual mandibular segments with lining and skin cover provided by a deltopectoral flap was done. Reconstructive surgeries for reconstruction of the upper lip and maintenance of oral continence were planned for the future. The present case stresses the importance of educating the masses about unsafe handling of low voltage devices, management of airway, massive soft tissue injury, along with facial fractures and damage to adnexa. PMID:24163550

  3. Bone-anchored intermaxillary elastics in an asymmetric Class II malocclusion: A case report.

    PubMed

    Manni, Antonio; Lupini, Daniela; Cozzani, Mauro

    2017-06-01

    A 13-year-old male patient, presenting a Class II, division 1 malocclusion and crowding was treated by an innovative technique. After rapid palatal expansion by a Hyrax appliance, the teeth were bonded with straightwire brackets. Two miniscrews were inserted, one per side, in the mandibular buccal bone between the roots of the mandibular first molar and the second premolar. On the right side, the miniscrew implant was connected to the hook clamped on a 0.021×0.028″ SS wire with a twisted SS ligature in order to maintain the inclination of the frontal incisors during the Class II mechanics. On the left side, where the Class II relationship was more marked, intermaxillary elastics were applied from the upper left hook clamped on the archwire to the lower first molar and a power chain (100g) was stretched from the lower left hook to the miniscrew implant. Class II correction was accomplished using sequential Class II elastics of progressive strength coupled with rectangular stainless steel wires. After 22 months of active treatment, the results were balanced facial esthetics and a good occlusion. This dual anchorage set-up of Class II elastics reinforced with TADs produced protrusive action on the mandible with minimal side effects and with no significant change in the vertical dimension during the sagittal correction of the Class II malocclusion. Copyright © 2017 CEO. Published by Elsevier Masson SAS. All rights reserved.

  4. Unstructured Facility Navigation by Applying the NIST 4D/RCS Architecture

    DTIC Science & Technology

    2006-07-01

    control, and the planner); wire- less data and emergency stop radios; GPS receiver; inertial navigation unit; dual stereo cameras; infrared sensors...current Actuators Wheel motors, camera controls Scale & filter signals status commands commands commands GPS Antenna Dual stereo cameras...used in the sensory processing module include the two pairs of stereo color cameras, the physical bumper and infrared bumper sensors, the motor

  5. Agreement in the determination of preformed wire shape templates on plaster models and customized digital arch form diagrams on digital models.

    PubMed

    Camardella, Leonardo Tavares; Sá, Maiara da Silva Bezerra; Guimarães, Luciana Campos; Vilella, Beatriz de Souza; Vilella, Oswaldo de Vasconcellos

    2018-03-01

    The aim of this study was to verify the accuracy of preformed wire shape templates on plaster models and those of customized digital arch form diagrams on digital models. Twenty pairs of dental plaster models were randomly selected from the archives of the Department of Orthodontics of Federal Fluminense University, Niterói, Rio de Janeiro, Brazil. All plaster model samples were scanned in a plaster model scanner to create the respective digital models. Three examiners defined the arch form on the mandibular arch of these models by selecting the ideal preformed wire shape template on each plaster model or by making a customized digital arch form on the digital models using a digital arch form customization tool. These 2 arch forms were superimposed by the best-fit method. The greatest differences in the 6 regions on the superimposed arches were evaluated. Each examiner presented a descriptive analysis with the means, standard deviation, and minimum and maximum intervals of the differences on the superimpositions. Intraclass correlation coefficient and paired t tests were used to evaluate the accuracy of the superimpositions. Among the 6 regions analyzed in the superimpositions, the largest differences in the anterior and premolar regions were considered clinically insignificant, whereas the largest differences in the right molar region, especially the second molar area, were considered clinically significant by all 3 examiners. The intraclass correlation coefficients showed a weak correlation in the premolar region and moderate correlations in the anterior and molar regions. The paired t test showed statistically significant differences in the left anterior and premolar regions. The superimpositions between the arch forms on plaster and digital models were considered accurate, and the differences were not clinically significant, with the exception of the second molar area. Despite the favorable results, the requirement of correcting some software problems may hamper the transition from plaster to digital models. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  6. Customized Hermetic Feedthrough Developed to Isolate Fluids

    NASA Technical Reports Server (NTRS)

    Meredith, Roger D.

    1999-01-01

    A common problem occurs when refrigerant fluids wick inside the insulation of thermocouple wires through a compressor's casing feedthrough and then leak into the adjacent disconnect box outside the casing. Leaking fluids create an unfavorable situation inside the disconnect box and may contaminate the fluids. To address this problem, NASA Lewis Research Center s Manufacturing Engineering Division developed a customized hermetic feedthrough for a bank of Worthington compressors. In these compressors, bearing temperatures are measured by internal thermocouples embedded in bearings located inside the compressor casings. The thermocouple wires need to be routed outside the casing and read at another location. These wires are short and are terminated to a disconnect strip inside the casing. The bearings operate at about 170 F, but because the casing is filled with R12 refrigerant oil, the casing has a maximum temperature of about 100 F. The operating conditions of these compressors permit the use of an epoxy that is compatible with the R12 fluid. The desired finished product is a stainless steel tube that has been filled solid with epoxy after thermocouple wires bonded and sealed by epoxy have been inserted through its length. Shrink tubing extends from both ends of the tube. The process that was developed to isolate the thermocouple wires from the R12 fluid follows. For this application, use an 8-in.-long piece of 0.500-in. 304 stainless steel tube with six pairs of 24-gauge stranded, PTFE-insulated (polytetrafluoroethylene) type "T" thermocouple wires for each feedthrough. Use shrink tubing to strain relief the insulated wires at their exit from the stainless steel tube. Cut the wire to length and identify the location of the stainless steel tube sleeve with masking tape. Then, remove the outer insulation from a 2-in. section of wire that will be inside the tube, and carefully strip to bare wire a 1-in. section in the middle of the section with the outer insulation removed. For an effective seal, the epoxy must penetrate between the strands when stranded conductors are used. Make the seal with epoxy bond on the bare wire. The bare wire must be encapsulated with a thin layer of the epoxy that leaves only a very low profile. These encapsulated wires must cure before the assembly can be continued. Then, inspect the cured wires for complete encapsulation before going to the next step. Insert the wires in the stainless steel tube and orient them so that the epoxied stripped sections are staggered within the tube; then, apply shrink tubing to one end of the cleaned wires, positioning it inside the edge of the tube. The small gaps between the wires on the other end will be used to inject the epoxy into the tube. Let the epoxy cure inside the tube, free of any voids. Then, continue to fill the tube until the entire 8-in. length is nearly filled, allowing room for the other strain-relieving shrink tubing. Since this first design, the process has been adjusted to fit many needs and situations. Customized feedthroughs have been assembled from various wire types, wire gauges, and/or stainless steel tube passages. The fittings selected to mount these feedthroughs allow their use in other areas, such as pressure or vacuum systems.

  7. Knockdown of TWIST1 enhances arsenic trioxide- and ionizing radiation-induced cell death in lung cancer cells by promoting mitochondrial dysfunction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seo, Sung-Keum; Kim, Jae-Hee; Choi, Ha-Na

    Highlights: • Knockdown of TWIST1 enhanced ATO- and IR-induced cell death in NSCLCs. • Intracellular ROS levels were increased in cells treated with TWIST1 siRNA. • TWIST1 siRNA induced MMP loss and mitochondrial fragmentation. • TWIST1 siRNA upregulated the fission-related proteins FIS1 and DRP1. - Abstract: TWIST1 is implicated in the process of epithelial mesenchymal transition, metastasis, stemness, and drug resistance in cancer cells, and therefore is a potential target for cancer therapy. In the present study, we found that knockdown of TWIST1 by small interfering RNA (siRNA) enhanced arsenic trioxide (ATO)- and ionizing radiation (IR)-induced cell death in non-small-cellmore » lung cancer cells. Interestingly, intracellular reactive oxygen species levels were increased in cells treated with TWIST1 siRNA and further increased by co-treatment with ATO or IR. Pretreatment of lung cancer cells with the antioxidant N-acetyl-cysteine markedly suppressed the cell death induced by combined treatment with TWIST1 siRNA and ATO or IR. Moreover, treatment of cells with TWIST1 siRNA induced mitochondrial membrane depolarization and significantly increased mitochondrial fragmentation (fission) and upregulated the fission-related proteins FIS1 and DRP1. Collectively, our results demonstrate that siRNA-mediated TWIST1 knockdown induces mitochondrial dysfunction and enhances IR- and ATO-induced cell death in lung cancer cells.« less

  8. TWIST1-WDR5-Hottip regulates Hoxa9 chromatin to facilitate prostate cancer metastasis

    PubMed Central

    Malek, Reem; Gajula, Rajendra P.; Williams, Russell D.; Nghiem, Belinda; Simons, Brian W.; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R.; True, Lawrence; An, Steven S.; DeWeese, Theodore L.; Ross, Ashley E.; Schaeffer, Edward M.; Pienta, Kenneth J.; Hurley, Paula J.; Morrissey, Colm; Tran, Phuoc T.

    2017-01-01

    TWIST1 is a transcription factor critical for development which can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are co-expressed in mouse prostate and then silenced post-natally. Here we report that TWIST1 and HOXA9 co-expression are re-activated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to co-enrichment of TWIST1 and WDR5 as well increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacological inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo. This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. PMID:28484075

  9. Twist1 Suppresses Senescence Programs and Thereby Accelerates and Maintains Mutant Kras-Induced Lung Tumorigenesis

    PubMed Central

    Thiyagarajan, Saravanan; Das, Sandhya T.; Zabuawala, Tahera; Chen, Joy; Cho, Yoon-Jae; Luong, Richard; Tamayo, Pablo; Salih, Tarek; Aziz, Khaled; Adam, Stacey J.; Vicent, Silvestre; Nielsen, Carsten H.; Withofs, Nadia; Sweet-Cordero, Alejandro; Gambhir, Sanjiv S.; Rudin, Charles M.; Felsher, Dean W.

    2012-01-01

    KRAS mutant lung cancers are generally refractory to chemotherapy as well targeted agents. To date, the identification of drugs to therapeutically inhibit K-RAS have been unsuccessful, suggesting that other approaches are required. We demonstrate in both a novel transgenic mutant Kras lung cancer mouse model and in human lung tumors that the inhibition of Twist1 restores a senescence program inducing the loss of a neoplastic phenotype. The Twist1 gene encodes for a transcription factor that is essential during embryogenesis. Twist1 has been suggested to play an important role during tumor progression. However, there is no in vivo evidence that Twist1 plays a role in autochthonous tumorigenesis. Through two novel transgenic mouse models, we show that Twist1 cooperates with KrasG12D to markedly accelerate lung tumorigenesis by abrogating cellular senescence programs and promoting the progression from benign adenomas to adenocarcinomas. Moreover, the suppression of Twist1 to physiological levels is sufficient to cause Kras mutant lung tumors to undergo senescence and lose their neoplastic features. Finally, we analyzed more than 500 human tumors to demonstrate that TWIST1 is frequently overexpressed in primary human lung tumors. The suppression of TWIST1 in human lung cancer cells also induced cellular senescence. Hence, TWIST1 is a critical regulator of cellular senescence programs, and the suppression of TWIST1 in human tumors may be an effective example of pro-senescence therapy. PMID:22654667

  10. Transverse kink oscillations in the presence of twist

    NASA Astrophysics Data System (ADS)

    Terradas, J.; Goossens, M.

    2012-12-01

    Context. Magnetic twist is thought to play an important role in coronal loops. The effects of magnetic twist on stable magnetohydrodynamic (MHD) waves is poorly understood because they are seldom studied for relevant cases. Aims: The goal of this work is to study the fingerprints of magnetic twist on stable transverse kink oscillations. Methods: We numerically calculated the eigenmodes of propagating and standing MHD waves for a model of a loop with magnetic twist. The azimuthal component of the magnetic field was assumed to be small in comparison to the longitudinal component. We did not consider resonantly damped modes or kink instabilities in our analysis. Results: For a nonconstant twist the frequencies of the MHD wave modes are split, which has important consequences for standing waves. This is different from the degenerated situation for equilibrium models with constant twist, which are characterised by an azimuthal component of the magnetic field that linearly increases with the radial coordinate. Conclusions: In the presence of twist standing kink solutions are characterised by a change in polarisation of the transverse displacement along the tube. For weak twist, and in the thin tube approximation, the frequency of standing modes is unaltered and the tube oscillates at the kink speed of the corresponding straight tube. The change in polarisation is linearly proportional to the degree of twist. This has implications with regard to observations of kink modes, since the detection of this variation in polarisation can be used as an indirect method to estimate the twist in oscillating loops.

  11. A reticle retrofit and dosimetric consideration for a linear accelerator.

    PubMed

    Krithivas, V

    1996-01-01

    An imperfect reticle system in an accelerator causes uncertainties in source-skin distance (SSD), off-axis distance (OAD), isocenter, and so forth. A reticle was designed and fabricated, and its implications on x-ray and electron beam dosimetry were investigated. A new reticle frame was dimensioned to fit snugly in the accelerator. The frame was fabricated to carry a pair of adjustable cross wires and to allow the machine operation in the photon and electron modes. The impact of the cross wires on 6 MV photon and 5-10 MeV electron beam parameters such as dose rate (Gy/monitor unit), beam uniformity, surface dose, and so forth, were studied using suitable ion chambers and phantoms. The retrofitted system offered long-term mechanical stability leading to precise SSD, OAD, and isocenter measurements. Changes introduced by the cross wires on the 6 MV photon and 5-10 MeV electron beams are presented. Long-term stability of a reticle in an accelerator is important for an accurate patient setup and for making reliable dosimetric measurements. Beam characteristrics have to be studied whenever modifications on a reticle system are made.

  12. Decaying spectral oscillations in a Majorana wire with finite coherence length

    NASA Astrophysics Data System (ADS)

    Fleckenstein, C.; Domínguez, F.; Traverso Ziani, N.; Trauzettel, B.

    2018-04-01

    Motivated by recent experiments, we investigate the excitation energy of a proximitized Rashba wire in the presence of a position dependent pairing. In particular, we focus on the spectroscopic pattern produced by the overlap between two Majorana bound states that appear for values of the Zeeman field smaller than the value necessary for reaching the bulk topological superconducting phase. The two Majorana bound states can arise because locally the wire is in the topological regime. We find three parameter ranges with different spectral properties: crossings, anticrossings, and asymptotic reduction of the energy as a function of the applied Zeeman field. Interestingly, all these cases have already been observed experimentally. Moreover, since an increment of the magnetic field implies the increase of the distance between the Majorana bound states, the amplitude of the energy oscillations, when present, gets reduced. The existence of the different Majorana scenarios crucially relies on the fact that the two Majorana bound states have distinct k -space structures. We develop analytical models that clearly explain the microscopic origin of the predicted behavior.

  13. Position-sensitive proportional counter with low-resistance metal-wire anode

    DOEpatents

    Kopp, Manfred K.

    1980-01-01

    A position-sensitive proportional counter circuit is provided which allows the use of a conventional (low-resistance, metal-wire anode) proportional counter for spatial resolution of an ionizing event along the anode of the counter. A pair of specially designed active-capacitance preamplifiers are used to terminate the anode ends wherein the anode is treated as an RC line. The preamplifiers act as stabilized active capacitance loads and each is composed of a series-feedback, low-noise amplifier, a unity-gain, shunt-feedback amplifier whose output is connected through a feedback capacitor to the series-feedback amplifier input. The stabilized capacitance loading of the anode allows distributed RC-line position encoding and subsequent time difference decoding by sensing the difference in rise times of pulses at the anode ends where the difference is primarily in response to the distributed capacitance along the anode. This allows the use of lower resistance wire anodes for spatial radiation detection which simplifies the counter construction and handling of the anodes, and stabilizes the anode resistivity at high count rates (>10.sup.6 counts/sec).

  14. Modeling and control of active twist aircraft

    NASA Astrophysics Data System (ADS)

    Cramer, Nicholas Bryan

    The Wright Brothers marked the beginning of powered flight in 1903 using an active twist mechanism as their means of controlling roll. As time passed due to advances in other technologies that transformed aviation the active twist mechanism was no longer used. With the recent advances in material science and manufacturability, the possibility of the practical use of active twist technologies has emerged. In this dissertation, the advantages and disadvantages of active twist techniques are investigated through the development of an aeroelastic modeling method intended for informing the designs of such technologies and wind tunnel testing to confirm the capabilities of the active twist technologies and validate the model. Control principles for the enabling structural technologies are also proposed while the potential gains of dynamic, active twist are analyzed.

  15. Anderson transition in a multiply-twisted helix.

    PubMed

    Ugajin, R

    2001-06-01

    We investigated the Anderson transition in a multiply-twisted helix in which a helical chain of components, i.e., atoms or nanoclusters, is twisted to produce a doubly-twisted helix, which itself can be twisted to produce a triply-twisted helix, and so on, in which there are couplings between adjacent rounds of helices. As the strength of the on-site random potentials increases, an Anderson transition occurs, suggesting that the number of dimensions is 3 for electrons running along the multiply-twisted helix when the couplings between adjacent rounds are strong enough. If the couplings are weakened, the dimensionality becomes less, resulting in localization of electrons. The effect of random connections between adjacent rounds of helices and random magnetic fields that thread the structure is analyzed using the spectral statistics of a quantum particle.

  16. Association between Twist and multidrug resistance gene-associated proteins in Taxol®-resistant MCF-7 cells and a 293 cell model of Twist overexpression.

    PubMed

    Wang, Li; Tan, Rui-Zhi; Zhang, Zhi-Xia; Yin, Rui; Zhang, Yong-Liang; Cui, Wei-Jia; He, Tao

    2018-01-01

    Multidrug resistance (MDR) severely limits the effectiveness of chemotherapy. Previous studies have identified Twist as a key factor of acquired MDR in breast, gastric and prostate cancer. However, the underlying mechanisms of action of Twist in MDR remain unclear. In the present study, the expression levels of MDR-associated proteins, including lung resistance-related protein (LRP), topoisomerase IIα (TOPO IIα), MDR-associated protein (MRP) and P-glycoprotein (P-gp), and the expression of Twist in cancerous tissues and pericancerous tissues of human breast cancer, were examined. In order to simulate Taxol ® resistance in cells, a Taxol ® -resistant human mammary adenocarcinoma cell subline (MCF-7/Taxol ® ) was established by repeatedly exposing MCF-7 cells to high concentrations of Taxol ® (up to 15 µg/ml). Twist was also overexpressed in 293 cells by transfecting this cell line with pcDNA5/FRT/TO vector containing full-length hTwist cDNA to explore the dynamic association between Twist and MDR gene-associated proteins. It was identified that the expression levels of Twist, TOPO IIα, MRP and P-gp were upregulated and LRP was downregulated in human breast cancer tissues, which was consistent with the expression of these proteins in the Taxol ® -resistant MCF-7 cell model. Notably, the overexpression of Twist in 293 cells increased the resistance to Taxol ® , Trichostatin A and 5-fluorouracil, and also upregulated the expression of MRP and P-gp. Taken together, these data demonstrated that Twist may promote drug resistance in cells and cancer tissues through regulating the expression of MDR gene-associated proteins, which may assist in understanding the mechanisms of action of Twist in drug resistance.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Shyy Woei; Yang, Tsun Lirng; Liou, Jin Shuen

    An experimental study measuring the axial heat transfer distributions and the pressure drop coefficients of the tube fitted with a broken twisted tape of twist ratio 1, 1.5, 2, 2.5 or {infinity} is performed in the Re range of 1000-40,000. This type of broken twisted tape is newly invented without previous investigations available. Local Nusselt numbers and mean Fanning friction factors in the tube fitted with the broken twisted tape increase as the twist ratio decreases. Heat transfer coefficients, mean Fanning friction factors and thermal performance factors in the tube fitted with the broken twisted tape are, respectively, augmented tomore » 1.28-2.4, 2-4.7 and 0.99-1.8 times of those in the tube fitted with the smooth twisted tape. Empirical heat transfer and pressure drop correlations which evaluate the local Nusselt number and the mean Fanning friction factor for the tube with the broken twisted tape insert are generated to assist the industrial applications. (author)« less

  18. Conical twist fields and null polygonal Wilson loops

    NASA Astrophysics Data System (ADS)

    Castro-Alvaredo, Olalla A.; Doyon, Benjamin; Fioravanti, Davide

    2018-06-01

    Using an extension of the concept of twist field in QFT to space-time (external) symmetries, we study conical twist fields in two-dimensional integrable QFT. These create conical singularities of arbitrary excess angle. We show that, upon appropriate identification between the excess angle and the number of sheets, they have the same conformal dimension as branch-point twist fields commonly used to represent partition functions on Riemann surfaces, and that both fields have closely related form factors. However, we show that conical twist fields are truly different from branch-point twist fields. They generate different operator product expansions (short distance expansions) and form factor expansions (large distance expansions). In fact, we verify in free field theories, by re-summing form factors, that the conical twist fields operator product expansions are correctly reproduced. We propose that conical twist fields are the correct fields in order to understand null polygonal Wilson loops/gluon scattering amplitudes of planar maximally supersymmetric Yang-Mills theory.

  19. The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis.

    PubMed

    Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

    2011-02-01

    The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis.

  20. In Silico Measurements of Twist and Bend Moduli for β-Solenoid Protein Self-Assembly Units.

    PubMed

    Heinz, Leonard P; Ravikumar, Krishnakumar M; Cox, Daniel L

    2015-05-13

    We compute potentials of mean force for bend and twist deformations via force pulling and umbrella sampling experiments for four β-solenoid proteins (BSPs) that show promise in nanotechnology applications. In all cases, we find quasi-Hooke's law behavior until the point of rupture. Bending moduli show modest anisotropy for two-sided and three-sided BSPs, and little anisotropy for a four-sided BSP. There is a slight clockwise/counterclockwise asymmetry in the twist potential of mean force, showing greater stiffness when the applied twist follows the intrinsic twist. When we extrapolate to beam theory appropriate for amyloid fibrils of the BSPs, we find bend/twist moduli which are somewhat smaller than those in the literature for other amyloid fibrils. Twist persistence lengths are on the order of a micron, and bend persistence lengths are several microns. Provided the intrinsic twist can be reversed, these results support the usage of BSPs in biomaterials applications.

  1. Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.

    PubMed

    Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F

    2016-05-01

    Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.

  2. Analysis of lead twist in modern high-performance grinding methods

    NASA Astrophysics Data System (ADS)

    Kundrák, J.; Gyáni, K.; Felhő, C.; Markopoulos, AP; Deszpoth, I.

    2016-11-01

    According to quality requirements of road vehicles shafts, which bear dynamic seals, twisted-pattern micro-geometrical topography is not allowed. It is a question whether newer modern grinding methods - such as quick-point grinding and peel grinding - could provide twist- free topography. According to industrial experience, twist-free surfaces can be made, however with certain settings, same twist occurs. In this paper it is proved by detailed chip-geometrical analysis that the topography generated by the new procedures is theoretically twist-patterned because of the feeding motion of the CBN tool. The presented investigation was carried out by a single-grain wheel model and computer simulation.

  3. Highly sensitive torsion sensor based on long period fiber grating fabricated by femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Dong, Xinran; Xie, Zheng; Song, Yuxin; Yin, Kai; Luo, Zhi; Duan, Ji'an; Wang, Cong

    2017-12-01

    A highly sensitive torsion sensor based on long period fiber grating (LPFG) fabricated by 800 nm femtosecond laser pulses is proposed and demonstrated. LPFG with an attenuation depth of ∼14 dB is achieved within the wavelength range of 1425-1575 nm. The experiment results show that the LP02 and LP03 resonant wavelengths experience red-shift when the twist direction is clockwise while they occur blue-shift in the twist counterclockwise direction as the twist rate increases. However, the LP04 resonant wavelength is always shifted toward shorter wavelength independently of the twist directions and higher twist sensitivity is observed. In addition, the loss peak amplitude of LPFG shows a tendency to decrease with the twist rate increases whether the LPFG is twisted clockwise or counterclockwise. Meanwhile, the resonant wavelength occurs splitting phenomenon in the case of higher twist rate as well as the high order resonant wavelength performs more significantly. Additionally, the sensor shows a twist sensitivity as high as 118.7 pm/(rad/m) in the range of -105 to -52.5 rad/m and that of 181.7 pm/(rad/m) in the range of 52.5-105 rad/m.

  4. Experimental Analysis of the Thermo-Hydraulic Performance on a Cylindrical Parabolic Concentrating Solar Water Heater with Twisted Tape Inserts in an Absorber Tube

    NASA Astrophysics Data System (ADS)

    Kumar, Birendra; Nayak, Rajen Kumar; Singh, S. N.

    2018-05-01

    A twisted tape inserted in an absorber tube may be an excellent option to enhance the performance of a cylindrical parabolic concentrating solar collector (CPC). The present work is an experimental study of the flow and heat transfer with and without twisted tape inserts in the absorber tube of a CPC. Results are presented for mass flow rates of water, ṁ=0.0198-0.0525 kg/s, twist ratio, y=5-10 and Reynolds number, Re=2577.46-6785.55. In the present study, we found that the outlet water temperature, collector efficiency and Nusselt number (Nu) are higher in the twisted tapes as compared to those without the twisted tape inserts in the absorber tube of the CPC. For fixed mass flow rate of water ṁ, the To and η increased with the decrease in twist ratio, y, and is higher in lower twist ratio, y=5, of the twisted tapes. The whole experiment was performed at the Indian Institute of Technology (ISM) in Dhanbad, India during the months of March-April 2017. Based on the experimental data, the correlations for the Nu and friction factor were also developed.

  5. Electronic and Optical Properties of Twisted Bilayer Graphene

    NASA Astrophysics Data System (ADS)

    Huang, Shengqiang

    The ability to isolate single atomic layers of van der Waals materials has led to renewed interest in the electronic and optical properties of these materials as they can be fundamentally different at the monolayer limit. Moreover, these 2D crystals can be assembled together layer by layer, with controllable sequence and orientation, to form artificial materials that exhibit new features that are not found in monolayers nor bulk. Twisted bilayer graphene is one such prototype system formed by two monolayer graphene layers placed on top of each other with a twist angle between their lattices, whose electronic band structure depends on the twist angle. This thesis presents the efforts to explore the electronic and optical properties of twisted bilayer graphene by Raman spectroscopy and scanning tunneling microscopy measurements. We first synthesize twisted bilayer graphene with various twist angles via chemical vapor deposition. Using a combination of scanning tunneling microscopy and Raman spectroscopy, the twist angles are determined. The strength of the Raman G peak is sensitive to the electronic band structure of twisted bilayer graphene and therefore we use this peak to monitor changes upon doping. Our results demonstrate the ability to modify the electronic and optical properties of twisted bilayer graphene with doping. We also fabricate twisted bilayer graphene by controllable stacking of two graphene monolayers with a dry transfer technique. For twist angles smaller than one degree, many body interactions play an important role. It requires eight electrons per moire unit cell to fill up each band instead of four electrons in the case of a larger twist angle. For twist angles smaller than 0.4 degree, a network of domain walls separating AB and BA stacking regions forms, which are predicted to host topologically protected helical states. Using scanning tunneling microscopy and spectroscopy, these states are confirmed to appear on the domain walls when inversion symmetry is broken with an external electric field. We observe a double-line profile of these states on the domain walls, only occurring when the AB and BA regions are gaped. These states give rise to channels that could transport charge in a dissipationless manner making twisted bilayer graphene a promising platform to realize controllable topological networks for future applications.

  6. Loss of Twist1 in the Mesenchymal Compartment Promotes Increased Fibrosis in Experimental Lung Injury by Enhanced Expression of CXCL12

    PubMed Central

    Tan, Jiangning; Tedrow, John R.; Nouraie, Mehdi; Dutta, Justin A.; Miller, David T.; Li, Xiaoyun; Yu, Shibing; Chu, Yanxia; Juan-Guardela, Brenda; Kaminski, Naftali; Ramani, Kritika; Biswas, Partha S.; Zhang, Yingze

    2017-01-01

    Idiopathic pulmonary fibrosis (IPF) is a disease characterized by the accumulation of apoptosis-resistant fibroblasts in the lung. We have previously shown that high expression of the transcription factor Twist1 may explain this prosurvival phenotype in vitro. However, this observation has never been tested in vivo. We found that loss of Twist1 in COL1A2+ cells led to increased fibrosis characterized by very significant accumulation of T cells and bone marrow–derived matrix-producing cells. We found that Twist1-null cells expressed high levels of the T cell chemoattractant CXCL12. In vitro, we found that the loss of Twist1 in IPF lung fibroblasts increased expression of CXCL12 downstream of increased expression of the noncanonical NF-κB transcription factor RelB. Finally, blockade of CXCL12 with AMD3100 attenuated the exaggerated fibrosis observed in Twist1-null mice. Transcriptomic analysis of 134 IPF patients revealed that low expression of Twist1 was characterized by enrichment of T cell pathways. In conclusion, loss of Twist1 in collagen-producing cells led to increased bleomycin-induced pulmonary fibrosis, which is mediated by increased expression of CXCL12. Twist1 expression is associated with dysregulation of T cells in IPF patients. Twist1 may shape the IPF phenotype and regulate inflammation in fibrotic lung injury. PMID:28179498

  7. TWIST1-WDR5-Hottip Regulates Hoxa9 Chromatin to Facilitate Prostate Cancer Metastasis.

    PubMed

    Malek, Reem; Gajula, Rajendra P; Williams, Russell D; Nghiem, Belinda; Simons, Brian W; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R; True, Lawrence; An, Steven S; DeWeese, Theodore L; Ross, Ashley E; Schaeffer, Edward M; Pienta, Kenneth J; Hurley, Paula J; Morrissey, Colm; Tran, Phuoc T

    2017-06-15

    TWIST1 is a transcription factor critical for development that can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are coexpressed in mouse prostate and then silenced postnatally. Here we report that TWIST1 and HOXA9 coexpression are reactivated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to coenrichment of TWIST1 and WDR5 as well as increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter, which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacologic inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. Cancer Res; 77(12); 3181-93. ©2017 AACR . ©2017 American Association for Cancer Research.

  8. Mean-field description of topological charge 4e superconductors

    NASA Astrophysics Data System (ADS)

    Gabriele, Victoria; Luo, Jing; Teo, Jeffrey C. Y.

    BCS superconductors can be understood by a mean-field approximation of two-body interacting Hamiltonians, whose ground states break charge conservation spontaneously by allowing non-vanishing expectation values of charge 2e Cooper pairs. Topological superconductors, such as one-dimensional p-wave wires, have non-trivial ground states that support robust gapless boundary excitations. We construct a four-body Hamiltonian in one dimension and perform a mean-field analysis. The mean-field Hamiltonian is now quartic in fermions but is still exactly solvable. The ground state exhibits 4-fermion expectation values instead of Cooper pair ones. There also exists a topological phase, where the charge 4e superconductor carries exotic zero energy boundary excitations.

  9. A Comparison of pical Root Resorption in Incisors after Fixed Orthodontic Treatment with Standard Edgewise and Straight Wire (MBT) Method

    PubMed Central

    Zahed Zahedani, SM; Oshagh, M; Momeni Danaei, Sh; Roeinpeikar, SMM

    2013-01-01

    Statement of Problem: One of the major outcomes of orthodontic treatment is the apical root resorption of teeth moved during the treatment. Identifying the possible risk factors, are necessary for every orthodontist. Purpose: The aim of this study was to compare the rate of apical root resorption after fixed orthodontic treatment with standard edgewise and straight wire (MBT) method, and also to evaluate other factors effecting the rate of root resorption in orthodontic treatments. Materials and Method: In this study, parallel periapical radiographs of 127 patients imaging a total of 737 individual teeth, were collected. A total of 76 patients were treated by standard edgewise and 51 patients by straight wire method. The periapical radiographs were scanned and then the percentage of root resorption was calculated by Photoshop software. The data were analyzed by Paired-Samples t-test and the Generalized Linear Model adopting the SPSS 15.0. Results: In patients treated with straight wire method (MBT), mean root resorption was 18.26% compared to 14.82% in patients treated with standard edgewise technique (p< .05). Male patients had higher rate of root resorption,statistically significant (p< .05). Age at onset of treatment, duration of treatment, type of dental occlusion, premolar extractions and the use of intermaxillary elastics had no significant effect on the root resorption in this study. Conclusion: Having more root resorption in the straight wire method and less in the standard edgewise technique can be attributed to more root movement in pre-adjusted MBT technique due to the brackets employed in this method. PMID:24724131

  10. A Comparison of pical Root Resorption in Incisors after Fixed Orthodontic Treatment with Standard Edgewise and Straight Wire (MBT) Method.

    PubMed

    Zahed Zahedani, Sm; Oshagh, M; Momeni Danaei, Sh; Roeinpeikar, Smm

    2013-09-01

    One of the major outcomes of orthodontic treatment is the apical root resorption of teeth moved during the treatment. Identifying the possible risk factors, are necessary for every orthodontist. The aim of this study was to compare the rate of apical root resorption after fixed orthodontic treatment with standard edgewise and straight wire (MBT) method, and also to evaluate other factors effecting the rate of root resorption in orthodontic treatments. In this study, parallel periapical radiographs of 127 patients imaging a total of 737 individual teeth, were collected. A total of 76 patients were treated by standard edgewise and 51 patients by straight wire method. The periapical radiographs were scanned and then the percentage of root resorption was calculated by Photoshop software. The data were analyzed by Paired-Samples t-test and the Generalized Linear Model adopting the SPSS 15.0. In patients treated with straight wire method (MBT), mean root resorption was 18.26% compared to 14.82% in patients treated with standard edgewise technique (p< .05). Male patients had higher rate of root resorption,statistically significant (p< .05). Age at onset of treatment, duration of treatment, type of dental occlusion, premolar extractions and the use of intermaxillary elastics had no significant effect on the root resorption in this study. Having more root resorption in the straight wire method and less in the standard edgewise technique can be attributed to more root movement in pre-adjusted MBT technique due to the brackets employed in this method.

  11. Define the Twist ATX LPAR1 Signaling Axis in Promoting Obesity Associated Triple Negative Breast Cancer

    DTIC Science & Technology

    2017-05-01

    developed CRISPR technology to examine if Twist enhances ATX and LPAR1 expression. Specifically, we performed lentiviral transduction of Twist...targeting gRNA into breast cancer cells MDA-MB-578 and SUM-1315, and selected single cell colony with Twist knockout. We chose CRISPR -gRNA over the...shRNA system which was originally proposed, as CRISPR provides higher specificity and fewer off-target effects. To verify knockout of Twist, we first

  12. Modeling Hidden Circuits: An Authentic Research Experience in One Lab Period

    NASA Astrophysics Data System (ADS)

    Moore, J. Christopher; Rubbo, Louis J.

    2016-10-01

    Two wires exit a black box that has three exposed light bulbs connected together in an unknown configuration. The task for students is to determine the circuit configuration without opening the box. In the activity described in this paper, we navigate students through the process of making models, developing and conducting experiments that can support or falsify models, and confronting ways of distinguishing between two different models that make similar predictions. We also describe a twist that forces students to confront new phenomena, requiring revision of their mental model of electric circuits. This activity is designed to mirror the practice of science by actual scientists and expose students to the "messy" side of science, where our simple explanations of reality often require expansion and/or revision based on new evidence. The purpose of this paper is to present a simple classroom activity within the context of electric circuits that supports students as they learn to test hypotheses and refine and revise models based on evidence.

  13. Mechanical abuse simulation and thermal runaway risks of large-format Li-ion batteries

    NASA Astrophysics Data System (ADS)

    Wang, Hsin; Lara-Curzio, Edgar; Rule, Evan T.; Winchester, Clinton S.

    2017-02-01

    Internal short circuit of large-format Li-ion pouch cells induced by mechanical abuse was simulated using a modified mechanical pinch test. A torsion force was added manually at ∼40% maximum compressive loading force during the pinch test. The cell was twisted about 5° to the side by horizontally pulling a wire attached to the anode tab. The combined torsion-compression force created small failure at the separator yet allowed testing of fully charged large format Li-ion cells without triggering thermal runaway. Two types of commercial cells were tested using 4-6 cells at each state-of-charge (SOC). Commercially available 18 Ahr LiFePO4 (LFP) and 25 Ahr Li(NiMnCo)1/3O2 (NMC) cells were tested, and a thermal runaway risk (TRR) score system was used to evaluate the safety of the cells under the same testing conditions. The aim was to provide the cell manufacturers and end users with a tool to compare different designs and safety features.

  14. An effective model of DNA like helicoidal structure: with length fluctuation nonlinearity

    NASA Astrophysics Data System (ADS)

    Tseytlin, Y. M.

    2011-03-01

    One of the natural helicoidal nanostructure, which thermomechanical features are studied carefully with the help of different mechanical models, is a DNA cell / molecule. Our study proves that the experimentally determined nonlinear fluctuations of the molecular length of DNA can be better understood by modeling the molecule as a helicoidal pretwisted nanostrip sensor with nonlinear function. The calculations presented here are in good agreement with the experimental data within 10%. Other used by many researchers mechanical models such as an elastic rod, wormlike chain (WLC), accordion bellows, or an elastic core wrapped with rigid wires do not show the possible variance nonlinearity of thermomechanical DNA molecular length fluctuations. We have found that the nonlinear variance of the length fluctuations is an intrinsic property of the micro-nano-sensors with helicoidal shape. This model allows us to estimate the persistence length and twist-stretch coupling of a DNA molecule as well. It also shows the molecule's overwinding possibility at initial stretching with correct numerical representation.

  15. Development of a collapsible reinforced cylindrical space observation window

    NASA Technical Reports Server (NTRS)

    Khan, A. Q.

    1971-01-01

    Existing material technology was applied to the development of a collapsible transparent window suitable for manned spacecraft structures. The effort reported encompasses the evaluation of flame retardants intended for use in the window matrix polymer, evaluation of reinforcement angle which would allow for a twisting pantographing motion as the cylindrical window is mechanically collapsed upon itself, and evaluation of several reinforcement embedment methods. A fabrication technique was developed to produce a reinforced cylindrical space window of 45.7 cm diameter and 61.0 cm length. The basic technique involved the application of a clear film on a male-section mold; winding axial and girth reinforcements and vacuum casting the outer layer. The high-strength transparent window composite consisted of a polyether urethane matrix reinforced with an orthogonal pattern of black-coated carbon steel wire cable. A thin film of RTV silicone rubber was applied to both surfaces of the urethane. The flexibility, retraction system, and installation system are described.

  16. Adaptive frozen orbital treatment for the fragment molecular orbital method combined with density-functional tight-binding

    NASA Astrophysics Data System (ADS)

    Nishimoto, Yoshio; Fedorov, Dmitri G.

    2018-02-01

    The exactly analytic gradient is derived and implemented for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB) using adaptive frozen orbitals. The response contributions which arise from freezing detached molecular orbitals on the border between fragments are computed by solving Z-vector equations. The accuracy of the energy, its gradient, and optimized structures is verified on a set of representative inorganic materials and polypeptides. FMO-DFTB is applied to optimize the structure of a silicon nano-wire, and the results are compared to those of density functional theory and experiment. FMO accelerates the DFTB calculation of a boron nitride nano-ring with 7872 atoms by a factor of 406. Molecular dynamics simulations using FMO-DFTB applied to a 10.7 μm chain of boron nitride nano-rings, consisting of about 1.2 × 106 atoms, reveal the rippling and twisting of nano-rings at room temperature.

  17. Highly sensitive twist sensor based on tilted fiber Bragg grating of polarization-dependent properties

    NASA Astrophysics Data System (ADS)

    Lu, Yanfang; Shen, Changyu; Chen, Debao; Chu, Jinlei; Wang, Qiang; Dong, Xinyong

    2014-10-01

    The transmission intensity of the tilted fiber Bragg grating (TFBG) is strongly dependent on the polarization properties of the TFBG. The polarization characteristic of the cladding modes can be used for twist measuring. In this paper, a highly sensitive fiber twist sensor is proposed. The transmission intensity on the strong loss wavelength showed a quasi-sin θ changing with the twist angle ranging from 0° to 180° for S- or P-polarized input. A high sensitivity of 0.299 dB/° is achieved, which is almost 17.9 times higher than that of the current similar existing twist sensor. The twist angle can be measured precisely with the matrix.

  18. Au-coated tilted fiber Bragg grating twist sensor based on surface plasmon resonance

    NASA Astrophysics Data System (ADS)

    Shen, Changyu; Zhang, Yang; Zhou, Wenjun; Albert, Jacques

    2014-02-01

    A fiber twist sensor based on the surface plasmon resonance (SPR) effect of an Au-coated tilted fiber Bragg grating (TFBG) is proposed. The SPR response to the twist effect on an Au-coated TFBG (immersing in distilled water) is studied theoretically and experimentally. The results show that the transmission power around the wavelength of SPR changes with the twist angle. For the twist ranging from 0° to 180° in clockwise or anti-clockwise directions, the proposed sensor shows sensitivities of 0.037 dBm/° (S-polarized) and 0.039 dBm/° (P-polarized), which are almost 7.5 times higher than that of the current similar existing twist sensor.

  19. The effect of prior sandblasting of the wire on the shear bond strength of two different types of lingual retainers.

    PubMed

    Kilinç, Delal Dara; Sayar, Gülşilay

    2018-04-07

    The aim of this study was to evaluate the effect of total surface sandblasting on the shear bond strength of two different retainer wires. The null hypothesis was that there is no difference in the bond strength of the two types of lingual retainer wires when they are sandblasted. One hundred and sixty human premolar teeth were equally divided into four groups (n=40). A pair of teeth was embedded in self-curing acrylic resin and polished. Retainer wires were applied on the etched and rinsed surfaces of the teeth. Four retainers were used: group 1: braided retainer (0.010×0.028″, Ortho Technology); group 2: sandblasted braided retainer (0.010×0.028″, Ortho Technology); group 3: coaxial retainer (0.0215″ Coaxial, 3M) and group 4: sandblasted coaxial retainer (0.0215″ Coaxial, 3M). The specimens were tested using a universal test machine in shear mode with a crosshead speed of one mm/min. One-way analysis of variance (Anova) was used to determine the significant differences among the groups. There was no significant difference (P=0.117) among the groups according to this test. The null hypothesis was accepted. There was no statistically significant difference among the shear bond strength values of the four groups. Copyright © 2018 CEO. Published by Elsevier Masson SAS. All rights reserved.

  20. Shuttleless toroid winder

    DOEpatents

    Lindenmeyer, Carl W.

    1981-01-01

    A lower support receives a toroid at a winding station with the axis of the toroid aligned with a slot in the support. An upper guide member applies an axial force to hold the toroid against the lower support. A pair of movable jaws carried by an indexing mechanism engage the outer surface of the toroid to apply a radial holding force. While the toroid is thus held, a wire is placed axially through the toroid, assisted by a funnel-shaped surface in the upper guide member, and is drawn tight about the toroid by a pair of cooperating draw rollers. When operated in the "full cycle" mode, the operator then actuates a switch which energizes a power drive to release the axial clamp and to drive the indexing mechanism and the jaws to rotate the toroid about its axis. At the same time, the wire is ejected from the draw rollers beneath the toroid so that the operator may grasp it to form another loop. When the toroid is fully indexed, the jaws release it, and the upper guide member is returned to clamp the toroid axially while the indexing mechanism is returned to its starting position. The apparatus may also be operated in a "momentary contact" mode in which the mechanism is driven only for the time a switch is actuated.

  1. On Multiple AER Handshaking Channels Over High-Speed Bit-Serial Bidirectional LVDS Links With Flow-Control and Clock-Correction on Commercial FPGAs for Scalable Neuromorphic Systems.

    PubMed

    Yousefzadeh, Amirreza; Jablonski, Miroslaw; Iakymchuk, Taras; Linares-Barranco, Alejandro; Rosado, Alfredo; Plana, Luis A; Temple, Steve; Serrano-Gotarredona, Teresa; Furber, Steve B; Linares-Barranco, Bernabe

    2017-10-01

    Address event representation (AER) is a widely employed asynchronous technique for interchanging "neural spikes" between different hardware elements in neuromorphic systems. Each neuron or cell in a chip or a system is assigned an address (or ID), which is typically communicated through a high-speed digital bus, thus time-multiplexing a high number of neural connections. Conventional AER links use parallel physical wires together with a pair of handshaking signals (request and acknowledge). In this paper, we present a fully serial implementation using bidirectional SATA connectors with a pair of low-voltage differential signaling (LVDS) wires for each direction. The proposed implementation can multiplex a number of conventional parallel AER links for each physical LVDS connection. It uses flow control, clock correction, and byte alignment techniques to transmit 32-bit address events reliably over multiplexed serial connections. The setup has been tested using commercial Spartan6 FPGAs attaining a maximum event transmission speed of 75 Meps (Mega events per second) for 32-bit events at a line rate of 3.0 Gbps. Full HDL codes (vhdl/verilog) and example demonstration codes for the SpiNNaker platform will be made available.

  2. The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis

    PubMed Central

    Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

    2011-01-01

    The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis. PMID:20714342

  3. The Effect of a Twisted Magnetic Field on the Phase Mixing of the Kink Magnetohydrodynamic Waves in Coronal Loops

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ebrahimi, Zanyar; Karami, Kayoomars; Soler, Roberto, E-mail: z.ebrahimi@uok.ac.ir

    There is observational evidence for the existence of a twisted magnetic field in the solar corona. This inspires us to investigate the effect of a twisted magnetic field on the evolution of magnetohydrodynamic (MHD) kink waves in coronal loops. With this aim, we solve the incompressible linearized MHD equations in a magnetically twisted nonuniform coronal flux tube in the limit of long wavelengths. Our results show that a twisted magnetic field can enhance or diminish the rate of phase mixing of the Alfvén continuum modes and the decay rate of the global kink oscillation depending on the twist model andmore » the sign of the longitudinal ( k{sub z} ) and azimuthal ( m ) wavenumbers. Also, our results confirm that in the presence of a twisted magnetic field, when the sign of one of the two wavenumbers m and k {sub z} is changed, the symmetry with respect to the propagation direction is broken. Even a small amount of twist can have an important impact on the process of energy cascading to small scales.« less

  4. Heat Transfer Enhancement of Laminar Nanofluids Flow in a Circular Tube Fitted with Parabolic-Cut Twisted Tape Inserts

    PubMed Central

    Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

    2014-01-01

    Numerical investigation has been carried out on heat transfer and friction factor characteristics of copper-water nanofluid flow in a constant heat-fluxed tube with the existence of new configuration of vortex generator using Computational Fluid Dynamics (CFD) simulation. Two types of swirl flow generator: Classical twisted tape (CTT) and Parabolic-cut twisted tape (PCT) with a different twist ratio (y = 2.93, 3.91 and 4.89) and different cut depth (w = 0.5, 1.0 and 1.5 cm) with 2% and 4% volume concentration of CuO nanofluid were used for simulation. The effect of different parameters such as flow Reynolds number, twist ratio, cut depth and nanofluid were considered. The results show that the enhancement of heat transfer rate and the friction factor induced by the Classical (CTT) and Parabolic-cut (PCT) inserts increases with twist ratio and cut depth decreases. The results also revealed that the heat transfer enhancement increases with an increase in the volume fraction of the CuO nanoparticle. Furthermore, the twisted tape with twist ratio (y = 2.93) and cut depth w = 0.5 cm offered 10% enhancement of the average Nusselt number with significant increases in friction factor than those of Classical twisted tape. PMID:24605055

  5. Insulin-like growth factor-I induces CLU expression through Twist1 to promote prostate cancer growth.

    PubMed

    Takeuchi, Ario; Shiota, Masaki; Beraldi, Eliana; Thaper, Daksh; Takahara, Kiyoshi; Ibuki, Naokazu; Pollak, Michael; Cox, Michael E; Naito, Seiji; Gleave, Martin E; Zoubeidi, Amina

    2014-03-25

    Clusterin (CLU) is cytoprotective molecular chaperone that is highly expressed in castrate-resistant prostate cancer (CRPC). CRPC is also characterized by increased insulin-like growth factor (IGF)-I responsiveness which induces prostate cancer survival and CLU expression. However, how IGF-I induces CLU expression and whether CLU is required for IGF-mediated growth signaling remain unknown. Here we show that IGF-I induced CLU via STAT3-Twist1 signaling pathway. In response to IGF-I, STAT3 was phosphorylated, translocated to the nucleus and bound to the Twist1 promoter to activate Twist1 transcription. In turn, Twist1 bound to E-boxes on the CLU promoter and activated CLU transcription. Inversely, we demonstrated that knocking down Twist1 abrogated IGF-I induced CLU expression, indicating that Twist1 mediated IGF-I-induced CLU expression. When PTEN knockout mice were crossed with lit/lit mice, the resultant IGF-I deficiency suppressed Twist1 as well as CLU gene expression in mouse prostate glands. Moreover, both Twist1 and CLU knockdown suppressed prostate cancer growth accelerated by IGF-I, suggesting the relevance of this signaling not only in an in vitro, but also in an in vivo. Collectively, this study indicates that IGF-I induces CLU expression through sequential activation of STAT3 and Twist1, and suggests that this signaling cascade plays a critical role in prostate cancer pathogenesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Twist number and order properties of periodic orbits

    NASA Astrophysics Data System (ADS)

    Petrisor, Emilia

    2013-11-01

    A less studied numerical characteristic of periodic orbits of area preserving twist maps of the annulus is the twist or torsion number, called initially the amount of rotation Mather (1984) [2]. It measures the average rotation of tangent vectors under the action of the derivative of the map along that orbit, and characterizes the degree of complexity of the dynamics. The aim of this paper is to give new insights into the definition and properties of the twist number and to relate its range to the order properties of periodic orbits. We derive an algorithm to deduce the exact value or a demi-unit interval containing the exact value of the twist number. We prove that at a period-doubling bifurcation threshold of a mini-maximizing periodic orbit, the new born doubly periodic orbit has the absolute twist number larger than the absolute twist of the original orbit after bifurcation. We give examples of periodic orbits having large absolute twist number, that are badly ordered, and illustrate how characterization of these orbits only by their residue can lead to incorrect results. In connection to the study of the twist number of periodic orbits of standard-like maps we introduce a new tool, called 1-cone function. We prove that the location of minima of this function with respect to the vertical symmetry lines of a standard-like map encodes a valuable information on the symmetric periodic orbits and their twist number.

  7. How is the relationship between TWIST-1 and BCR-ABL1 gene expressions in chronic myeloid leukaemia patients?

    PubMed

    Heidari, Nazanin; Vosoughi, Tina; Mohammadi Asl, Javad; Saki Malehi, Amal; Saki, Najmaldin

    2018-01-12

    The activation and increased expression of BCR-ABL1 lead to malignant chronic myelogenous leukaemia (CML) cells, as well as the resistance to antitumour agents and apoptosis inducers. Moreover, TWIST-1 protein is a prognostic factor of leukemogenesis, and its level is raised in CML patients with cytogenetic resistance to imatinib. So, there is a likely relationship between BCR-ABL1 and TWIST-1 genes. The aim of the study was to assess the relationship between TWIST-1 and BCR-ABL1 expressions. Peripheral blood samples were obtained from 44 CML patients under treatment and also from ten healthy subjects as normal controls. The expression of TWIST-1 and BCR-ABL1 genes was measured using real-time PCR, and ABL1 was used as the reference gene. The gene expression was evaluated by REST software. The expression levels of TWIST-1 and BCR-ABL1 genes in CML patients was changed 40.23 ± 177.75-fold and 6 ± 18-fold, respectively. No significant relationship was observed between the expressions of TWIST-1 and BCR-ABL1 genes. All patients with TWIST-1 expression levels ≥100-fold had failure of response to treatment. The probability of the relationship between BCR-ABL1 and TWIST-1 is still debatable, and the average of TWIST-1 expression has been higher in patients without response to treatment. Definitive conclusion needs further investigations.

  8. Optimal flapping wing for maximum vertical aerodynamic force in hover: twisted or flat?

    PubMed

    Phan, Hoang Vu; Truong, Quang Tri; Au, Thi Kim Loan; Park, Hoon Cheol

    2016-07-08

    This work presents a parametric study, using the unsteady blade element theory, to investigate the role of twist in a hovering flapping wing. For the investigation, a flapping-wing system was developed to create a wing motion of large flapping amplitude. Three-dimensional kinematics of a passively twisted wing, which is capable of creating a linearly variable geometric angle of attack (AoA) along the wingspan, was measured during the flapping motion and used for the analysis. Several negative twist or wash-out configurations with different values of twist angle, which is defined as the difference in the average geometric AoAs at the wing root and the wing tip, were obtained from the measured wing kinematics through linear interpolation and extrapolation. The aerodynamic force generation and aerodynamic power consumption of these twisted wings were obtained and compared with those of flat wings. For the same aerodynamic power consumption, the vertical aerodynamic forces produced by the negatively twisted wings are approximately 10%-20% less than those produced by the flat wings. However, these twisted wings require approximately 1%-6% more power than flat wings to produce the same vertical force. In addition, the maximum-force-producing twisted wing, which was found to be the positive twist or wash-in configuration, was used for comparison with the maximum-force-producing flat wing. The results revealed that the vertical aerodynamic force and aerodynamic power consumption of the two types of wings are almost identical for the hovering condition. The power loading of the positively twisted wing is only approximately 2% higher than that of the maximum-force-producing flat wing. Thus, the flat wing with proper wing kinematics (or wing rotation) can be regarded as a simple and efficient candidate for the development of hovering flapping-wing micro air vehicle.

  9. Epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia modulates proliferation, cell survival and chemosensitivity

    PubMed Central

    Thathia, Shabnam H.; Ferguson, Stuart; Gautrey, Hannah E.; van Otterdijk, Sanne D.; Hili, Michela; Rand, Vikki; Moorman, Anthony V.; Meyer, Stefan; Brown, Robert; Strathdee, Gordon

    2012-01-01

    Background Altered regulation of many transcription factors has been shown to be important in the development of leukemia. TWIST2 modulates the activity of a number of important transcription factors and is known to be a regulator of hematopoietic differentiation. Here, we investigated the significance of epigenetic regulation of TWIST2 in the control of cell growth and survival and in response to cytotoxic agents in acute lymphoblastic leukemia. Design and Methods TWIST2 promoter methylation status was assessed quantitatively, by combined bisulfite and restriction analysis (COBRA) and pyrosequencing assays, in multiple types of leukemia and TWIST2 expression was determined by quantitative reverse transcriptase polymerase chain reaction analysis. The functional role of TWIST2 in cell proliferation, survival and response to chemotherapy was assessed in transient and stable expression systems. Results We found that TWIST2 was inactivated in more than 50% of cases of childhood and adult acute lymphoblastic leukemia through promoter hypermethylation and that this epigenetic regulation was especially prevalent in RUNX1-ETV6-driven cases. Re-expression of TWIST2 in cell lines resulted in a dramatic reduction in cell growth and induction of apoptosis in the Reh cell line. Furthermore, re-expression of TWIST2 resulted in increased sensitivity to the chemotherapeutic agents etoposide, daunorubicin and dexamethasone and TWIST2 hypermethylation was almost invariably found in relapsed adult acute lymphoblastic leukemia (91% of samples hypermethylated). Conclusions This study suggests a dual role for epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia, initially through altering cell growth and survival properties and subsequently by increasing resistance to chemotherapy. PMID:22058208

  10. The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise

    PubMed Central

    Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J.

    2016-01-01

    Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, V˙O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32–69% of V˙O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results. PMID:27100099

  11. The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise.

    PubMed

    Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J

    2016-01-01

    Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, [Formula: see text]O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32-69% of [Formula: see text]O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results.

  12. Tyrosine kinase receptor c-ros-oncogene 1 inhibition alleviates aberrant bone formation of TWIST-1 haploinsufficient calvarial cells from Saethre-Chotzen syndrome patients.

    PubMed

    Camp, Esther; Anderson, Peter J; Zannettino, Andrew C W; Glackin, Carlotta A; Gronthos, Stan

    2018-09-01

    Saethre-Chotzen syndrome (SCS), associated with TWIST-1 mutations, is characterized by premature fusion of cranial sutures. TWIST-1 haploinsufficiency, leads to alterations in suture mesenchyme cellular gene expression patterns, resulting in aberrant osteogenesis and craniosynostosis. We analyzed the expression of the TWIST-1 target, Tyrosine kinase receptor c-ros-oncogene 1 (C-ROS-1) in TWIST-1 haploinsufficient calvarial cells derived from SCS patients and calvaria of Twist-1 del/+ mutant mice and found it to be highly expressed when compared to TWIST-1 wild-type controls. Knock-down of C-ROS-1 expression in TWIST-1 haploinsufficient calvarial cells derived from SCS patients was associated with decreased capacity for osteogenic differentiation in vitro. Furthermore, treatment of human SCS calvarial cells with the tyrosine kinase chemical inhibitor, Crizotinib, resulted in reduced C-ROS-1 activity and the osteogenic potential of human SCS calvarial cells with minor effects on cell viability or proliferation. Cultured human SCS calvarial cells treated with Crizotinib exhibited a dose-dependent decrease in alkaline phosphatase activity and mineral deposition, with an associated decrease in expression levels of Runt-related transcription factor 2 and OSTEOPONTIN, with reduced PI3K/Akt signalling in vitro. Furthermore, Crizotinib treatment resulted in reduced BMP-2 mediated bone formation potential of whole Twist-1 del/+ mutant mouse calvaria organotypic cultures. Collectively, these results suggest that C-ROS-1 promotes osteogenic differentiation of TWIST-1 haploinsufficient calvarial osteogenic progenitor cells. Furthermore, the aberrant osteogenic potential of these cells is inhibited by the reduction of C-ROS-1. Therefore, targeting C-ROS-1 with a pharmacological agent, such as Crizotinib, may serve as a novel therapeutic strategy to alleviate craniosynostosis associated with aberrant TWIST-1 function. © 2018 Wiley Periodicals, Inc.

  13. High strength kiloampere Bi 2Sr 2CaCu 2O x cables for high-field magnet applications

    DOE PAGES

    Shen, Tengming; Li, Pei; Jiang, Jianyi; ...

    2015-04-17

    Multifilamentary Ag-sheathed Bi 2Sr 2CaCu 2O x (Bi-2212) wire can carry sufficient critical current density J c for the development of powerful superconducting magnets. But, the range of its applications is limited by the low mechanical strength of the Ag/Bi-2212 strand. A potential solution is to cable Ag/Bi-2212 wire with high-strength materials that are compatible with the Bi-2212 heat treatment in an oxygen atmosphere. Past attempts have not always been successful, because the high-strength materials reacted with Bi-2212 wires, significantly reducing their J c. We examined the nature of reactions occurring when Ag/Bi-2212 wires are heat-treated in direct contact withmore » several commonly used high-strength alloys and a new Fe-Cr-Al alloy. INCONEL X750 and INCONEL 600 resulted in significant J c loss, whereas Ni80-Cr caused little or no J c loss; however, all of them formed chromium oxide that subsequently reacted with silver, creating cracks in the silver sheath. We found that Fe-Cr-Al did not show significant reactions with Ag/Bi-2212 strands. Scanning electron microscopy (SEM) and energy dispersive x-ray (EDS) examinations revealed that the Fe-Cr-Al alloy benefits from the formation of a uniform, crack-free, continuous alumina layer on its surface that does not react with Ag and that helps minimize the Cu loss found with INCONEL X750 and INCONEL 600. We then fabricated prototype 6-around-1 cables with six Bi-2212 strands twisted and transposed around an Fe-Cr-Al alloy core coated with TiO 2. After standard 1 bar melt processing, the cable retained 100% of the total current-carrying capability of its strands, and, after a 10 bar overpressure processing, the cable reached a total current of 1025 A at 4.2 K and 10 T. Tensile tests showed that Fe-Cr-Al becomes brittle after being cooled to 4.2 K, whereas INCONEL X750 remains ductile and retains a modulus of 183 GPa. Finally. we proposed new cable designs that take advantage of the chemical compatibility of Fe-Cr-Al and high strength of INCONEL X750 for various high-field magnet applications.« less

  14. On structural transitions, thermodynamic equilibrium, and the phase diagram of DNA and RNA duplexes under torque and tension.

    PubMed

    Wereszczynski, Jeff; Andricioaei, Ioan

    2006-10-31

    A precise understanding of the flexibility of double stranded nucleic acids and the nature of their deformed conformations induced by external forces is important for a wide range of biological processes including transcriptional regulation, supercoil and catenane removal, and site-specific recombination. We present, at atomic resolution, a simulation of the dynamics involved in the transitions from B-DNA and A-RNA to Pauling (P) forms and to denatured states driven by application of external torque and tension. We then calculate the free energy profile along a B- to P-transition coordinate and from it, compute a reversible pathway, i.e., an isotherm of tension and torque pairs required to maintain P-DNA in equilibrium. The reversible isotherm maps correctly onto a phase diagram derived from single molecule experiments, and yields values of elongation, twist, and twist-stretch coupling in agreement with measured values. We also show that configurational entropy compensates significantly for the large electrostatic energy increase due to closer-packed P backbones. A similar set of simulations applied to RNA are used to predict a novel structure, P-RNA, with its associated free energy, equilibrium tension, torque and structural parameters, and to assign the location, on the phase-diagram, of a putative force-torque-dependent RNA "triple point."

  15. Chirality of Single-Handed Twisted Titania Tubular Nanoribbons Prepared Through Sol-gel Transcription.

    PubMed

    Wang, Sibing; Zhang, Chuanyong; Li, Yi; Li, Baozong; Yang, Yonggang

    2015-08-01

    Single-handed twisted titania tubular nanoribbons were prepared through sol-gel transcription using a pair of enantiomers. Handedness was controlled by that of the template. The obtained samples were characterized using field-emission electron microscopy, transmission electron microscopy, diffuse reflectance circular dichroism (DRCD), and X-ray diffraction. The DRCD spectra indicated that the titania nanotubes exhibit optical activity. Although the tubular structure was destroyed after being calcined at 700 °C for 2.0 h, DRCD signals were still identified. However, the DRCD signals disappeared after being calcined at 1000 °C for 2.0 h. The optical activity of titania was proposed to be due to chiral defects. Previous results showed that straight titania tubes could be used as asymmetric autocatalysts, indicating that titania exhibit chirality at the angstrom level. Herein, it was found that they also exhibit DRCD signals, indicating that there are no obvious relationships between morphology at the nano level and chirality at the angstrom level. The nanotube chirality should originate from the chiral defects on the nanotube inner surface. The Fourier transform infrared spectra indicated that the chirality of the titania was transferred from the gelators through the hydrogen bonding between N-H and Ti-OH. © 2015 Wiley Periodicals, Inc.

  16. Predicting conformational ensembles and genome-wide transcription factor binding sites from DNA sequences.

    PubMed

    Andrabi, Munazah; Hutchins, Andrew Paul; Miranda-Saavedra, Diego; Kono, Hidetoshi; Nussinov, Ruth; Mizuguchi, Kenji; Ahmad, Shandar

    2017-06-22

    DNA shape is emerging as an important determinant of transcription factor binding beyond just the DNA sequence. The only tool for large scale DNA shape estimates, DNAshape was derived from Monte-Carlo simulations and predicts four broad and static DNA shape features, Propeller twist, Helical twist, Minor groove width and Roll. The contributions of other shape features e.g. Shift, Slide and Opening cannot be evaluated using DNAshape. Here, we report a novel method DynaSeq, which predicts molecular dynamics-derived ensembles of a more exhaustive set of DNA shape features. We compared the DNAshape and DynaSeq predictions for the common features and applied both to predict the genome-wide binding sites of 1312 TFs available from protein interaction quantification (PIQ) data. The results indicate a good agreement between the two methods for the common shape features and point to advantages in using DynaSeq. Predictive models employing ensembles from individual conformational parameters revealed that base-pair opening - known to be important in strand separation - was the best predictor of transcription factor-binding sites (TFBS) followed by features employed by DNAshape. Of note, TFBS could be predicted not only from the features at the target motif sites, but also from those as far as 200 nucleotides away from the motif.

  17. The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

    PubMed Central

    Mooers, Blaine H.M.; Singh, Amritanshu

    2011-01-01

    Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

  18. Position control of twisted and coiled polymer actuator using a controlled fan for cooling

    NASA Astrophysics Data System (ADS)

    Takagi, Kentaro; Arakawa, Takeshi; Takeda, Jun; Masuya, Ken; Tahara, Kenji; Asaka, Kinji

    2017-04-01

    Recently, artificial muscles made of fishing lines or sewing threads, namely twisted and coiled polymer actuators (TCPAs), have been proposed by Haines et al. A TCPA contracts by applying heat and returns to its initial length by cooling. A TCPA can be driven by voltage if the TCPA is plated by metal or if conductive wire such as nichrome is wound around it. Compared with the conventional electroactive polymers, advantages of TCPAs are low cost, simple structure, large actuation strain, and large force. However, a big disadvantage of TCPAs is slow response due to heat transfer. The problem becomes apparent during cooling, although the response of heating can be improved by feedback control. This paper proposes a control method of switching heating and cooling. In the proposed method, a TCPA is cooled by an electric cooling fan. When the TCPA is heating, the cooling fan is stopped. In a previous report, the response speed can be improved by keeping cooling fan always on; however, unnecessary energy consumption is required even during heating. In the proposed method, energy consumption during heating does not increase and the response speed can be improved using fan only during cooling. The proposed control law is as follows. Firstly, the desired control input is determined by PI-D control with respect to the length of the actuator. Then, the control inputs to the heater and to the cooling fan are switched according to the sign of the PI-D controller output. The effectiveness of the proposed control method is demonstrated by comparing the cases with and without the cooling fan in the experiments.

  19. Superconducting flat tape cable magnet

    DOEpatents

    Takayasu, Makoto

    2015-08-11

    A method for winding a coil magnet with the stacked tape cables, and a coil so wound. The winding process is controlled and various shape coils can be wound by twisting about the longitudinal axis of the cable and bending following the easy bend direction during winding, so that sharp local bending can be obtained by adjusting the twist pitch. Stack-tape cable is twisted while being wound, instead of being twisted in a straight configuration and then wound. In certain embodiments, the straight length should be half of the cable twist-pitch or a multiple of it.

  20. Twist-induced tuning in tapered fiber couplers.

    PubMed

    Birks, T A

    1989-10-01

    The power-splitting ratio of fused tapered single-mode fiber couplers can be reversibly tuned by axial twisting without affecting loss. The twist-tuning behavior of a range of different tapered couplers is described. A simple expression for twist-tuning can be derived by representing the effects of twist by a change in the refractive index profile. Good agreement between this expression and experimental results is demonstrated. Repeated tuning over tens of thousands of cycles is found not to degrade coupler performance, and a number of practical applications, including a freely tunable tapered coupler, are described.

  1. Multiple Differential-Amplifier MMICs Embedded in Waveguides

    NASA Technical Reports Server (NTRS)

    Kangaslahti, Pekka; Schlecht, Erich

    2010-01-01

    Compact amplifier assemblies of a type now being developed for operation at frequencies of hundreds of gigahertz comprise multiple amplifier units in parallel arrangements to increase power and/or cascade arrangements to increase gains. Each amplifier unit is a monolithic microwave integrated circuit (MMIC) implementation of a pair of amplifiers in differential (in contradistinction to single-ended) configuration. Heretofore, in cascading amplifiers to increase gain, it has been common practice to interconnect the amplifiers by use of wires and/or thin films on substrates. This practice has not yielded satisfactory results at frequencies greater than 200 Hz, in each case, for either or both of two reasons: Wire bonds introduce large discontinuities. Because the interconnections are typically tens of wavelengths long, any impedance mismatches give rise to ripples in the gain-vs.-frequency response, which degrade the performance of the cascade.

  2. Conditional sampling technique to test the applicability of the Taylor hypothesis for the large-scale coherent structures

    NASA Technical Reports Server (NTRS)

    Hussain, A. K. M. F.

    1980-01-01

    Comparisons of the distributions of large scale structures in turbulent flow with distributions based on time dependent signals from stationary probes and the Taylor hypothesis are presented. The study investigated an area in the near field of a 7.62 cm circular air jet at a Re of 32,000, specifically having coherent structures through small-amplitude controlled excitation and stable vortex pairing in the jet column mode. Hot-wire and X-wire anemometry were employed to establish phase averaged spatial distributions of longitudinal and lateral velocities, coherent Reynolds stress and vorticity, background turbulent intensities, streamlines and pseudo-stream functions. The Taylor hypothesis was used to calculate spatial distributions of the phase-averaged properties, with results indicating that the usage of the local time-average velocity or streamwise velocity produces large distortions.

  3. Effect of Magnetic Twist on Nonlinear Transverse Kink Oscillations of Line-tied Magnetic Flux Tubes

    NASA Astrophysics Data System (ADS)

    Terradas, J.; Magyar, N.; Van Doorsselaere, T.

    2018-01-01

    Magnetic twist is thought to play an important role in many structures of the solar atmosphere. One of the effects of twist is to modify the properties of the eigenmodes of magnetic tubes. In the linear regime standing kink solutions are characterized by a change in polarization of the transverse displacement along the twisted tube. In the nonlinear regime, magnetic twist affects the development of shear instabilities that appear at the tube boundary when it is oscillating laterally. These Kelvin–Helmholtz instabilities (KHI) are produced either by the jump in the azimuthal component of the velocity at the edge of the sharp boundary between the internal and external part of the tube or by the continuous small length scales produced by phase mixing when there is a smooth inhomogeneous layer. In this work the effect of twist is consistently investigated by solving the time-dependent problem including the process of energy transfer to the inhomogeneous layer. It is found that twist always delays the appearance of the shear instability, but for tubes with thin inhomogeneous layers the effect is relatively small for moderate values of twist. On the contrary, for tubes with thick layers, the effect of twist is much stronger. This can have some important implications regarding observations of transverse kink modes and the KHI itself.

  4. Sox5 induces epithelial to mesenchymal transition by transactivation of Twist1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pei, Xin-Hong; Department of Pathology, The Basic Medical College of Zhengzhou University, Zhengzhou, Henan; Lv, Xin-Quan

    2014-03-28

    Highlights: • Depletion of Sox5 inhibits breast cancer proliferation, migration, and invasion. • Sox5 transactivates Twist1 expression. • Sox5 induces epithelial to mesenchymal transition through transactivation of Twist1 expression. - Abstract: The epithelial to mesenchymal transition (EMT), a highly conserved cellular program, plays an important role in normal embryogenesis and cancer metastasis. Twist1, a master regulator of embryonic morphogenesis, is overexpressed in breast cancer and contributes to metastasis by promoting EMT. In exploring the mechanism underlying the increased Twist1 in breast cancer cells, we found that the transcription factor SRY (sex-determining region Y)-box 5(Sox5) is up-regulation in breast cancer cellsmore » and depletion of Sox5 inhibits breast cancer cell proliferation, migration, and invasion. Furthermore, depletion of Sox5 in breast cancer cells caused a dramatic decrease in Twist1 and chromosome immunoprecipitation assay showed that Sox5 can bind directly to the Twist1 promoter, suggesting that Sox5 transactivates Twist1 expression. We further demonstrated that knockdown of Sox5 up-regulated epithelial phenotype cell biomarker (E-cadherin) and down-regulated mesenchymal phenotype cell biomarkers (N-cadherin, Vimentin, and Fibronectin 1), resulting in suppression of EMT. Our study suggests that Sox5 transactivates Twist1 expression and plays an important role in the regulation of breast cancer progression.« less

  5. Twist Model Development and Results from the Active Aeroelastic Wing F/A-18 Aircraft

    NASA Technical Reports Server (NTRS)

    Lizotte, Andrew M.; Allen, Michael J.

    2007-01-01

    Understanding the wing twist of the active aeroelastic wing (AAW) F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption. This technique produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

  6. Twist Model Development and Results From the Active Aeroelastic Wing F/A-18 Aircraft

    NASA Technical Reports Server (NTRS)

    Lizotte, Andrew; Allen, Michael J.

    2005-01-01

    Understanding the wing twist of the active aeroelastic wing F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption and by using neural networks. These techniques produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

  7. Coexistence of twisted and untwisted crystals: An impurity/structural order model with implications for agate patterns

    USGS Publications Warehouse

    Comer, J.; Ortoleva, P.

    2007-01-01

    Coexistence of twisted and untwisted crystals is explained via a model that accounts for the coupling of the entropic and energetic effects of impurities and a supra-lattice-scale structural order parameter. It is shown that twisted impure crystals can be in equilibrium with untwisted purer ones. The model explains how coexistence can occur in agates and other systems under hydrostatic stress. The model implies that untwisted crystals grown under one set of conditions could undergo a phase separation that, when accompanied by an imposed compositional gradient, leads to commonly observed, alternating bands of twisted and untwisted crystals and, when occurring in the absence of an external gradient, mossy patterns of crystal texture can emerge. This phenomenon is not related to anisotropic applied stress. Rather coexistence is a consequence of a compositional segregation/twist phase transition. Since twist coexistence is a compositional equilibrium, it arises from the exchange between bulk phases; hence, the detailed nature of the atomic structure within an interface between twisted and untwisted zones is not relevant. The approach places crystal-twist phenomena within the theory of order/disorder phase transitions.

  8. Operator constraints for twist-3 functions and Lorentz invariance properties of twist-3 observables

    DOE PAGES

    Kanazawa, Koichi; Pitonyak, Daniel; Koike, Yuji; ...

    2016-03-14

    We investigate the behavior under Lorentz transformations of perturbative coefficient functions in a collinear twist-3 formalism relevant for high-energy observables including transverse polarization of hadrons. We argue that those perturbative coefficient functions can, a priori, acquire quite different yet Lorentz-invariant forms in various frames. This somewhat surprising difference can be traced back to a general dependence of the perturbative coefficient functions on light cone vectors which are introduced by the twist-3 factorization formulas and which are frame-dependent. One can remove this spurious frame dependence by invoking so-called Lorentz invariance relations (LIRs) between twist-3 parton correlation functions. Some of those relationsmore » for twist-3 distribution functions were discussed in the literature before. In this paper we derive the corresponding LIRs for twist-3 fragmentation functions. We explicitly demonstrate that these LIRs remove the light cone vector dependence by considering transverse spin observables in the single-inclusive production of hadrons in lepton-nucleon collisions, ℓN→hX. Furthermore, with the LIRs in hand, we also show that twist-3 observables in general can be written solely in terms of three-parton correlation functions.« less

  9. Experimental Investigation of the Electronic Properties of Twisted Bilayer Graphene by STM and STS

    NASA Astrophysics Data System (ADS)

    Yin, Longjing; Qiao, Jiabin; Wang, Wenxiao; Zuo, Weijie; He, Lin

    The electronic properties of graphene multilayers depend sensitively on their stacking order. A twisted angle is treated as a unique degree of freedom to tune the electronic properties of graphene system. Here we study electronic structures of the twisted bilayers by scanning tunneling microscopy (STM) and spectroscopy (STS). We demonstrate that the interlayer coupling strength affects both the Van Hove singularities and the Fermi velocity of twisted bilayers dramatically. This removes the discrepancy about the Fermi velocity renormalization in the twisted bilayers and provides a consistent interpretation of all current data. Moreover, we report the experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers by STM and STS. At a magic twisted angle, about 1.11°, a pronounced sharp peak is observed in the tunnelling spectra due to the action of the non-Abelian gauge fields. Because of the effective non-Abelian gauge fields, the rotation angle could transfer the charge carriers in the twisted bilayers from massless Dirac fermions into well localized electrons, or vice versa, efficiently. This provides a new route to tune the electronic properties of graphene systems, which will be essential in future graphene nanoelectronics.

  10. An analysis of rotor blade twist variables associated with different Euler sequences and pretwist treatments

    NASA Technical Reports Server (NTRS)

    Alkire, K.

    1984-01-01

    A nonlinear analysis which is necessary to adequately model elastic helicopter rotor blades experiencing moderately large deformations was examined. The analysis must be based on an appropriate description of the blade's deformation geometry including elastic bending and twist. Built-in pretwist angles complicate the deformation process ant its definition. Relationships between the twist variables associated with different rotation sequences and corresponding forms of the transformation matrix are lasted. Relationships between the twist variables associated with first, the pretwist combined with the deformation twist are included. Many of the corresponding forms of the transformation matrix for the two cases are listed. It is shown that twist variables connected with the combined twist treatment are related to those where the pretwist is applied initially. A method to determine the relationships and some results are outlined. A procedure to evaluate the transformation matrix that eliminates the Eulerlike sequence altogether is demonstrated. The resulting form of the transformation matrix is unaffected by rotation sequence or pretwist treatment.

  11. Aeroelastic Analysis of Helicopter Rotor Blades Incorporating Anisotropic Piezoelectric Twist Actuation

    NASA Technical Reports Server (NTRS)

    Wilkie, W. Keats; Belvin, W. Keith; Park, K. C.

    1996-01-01

    A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consists of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for dynamics simulation using numerical integration. The twist actuation responses for three conceptual fullscale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

  12. An aeroelastic analysis of helicopter rotor blades incorporating piezoelectric fiber composite twist actuation

    NASA Technical Reports Server (NTRS)

    Wilkie, W. Keats; Park, K. C.

    1996-01-01

    A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consist of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for numerical integration. The twist actuation responses for three conceptual full-scale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

  13. Electrostatic contribution to twist rigidity of DNA.

    PubMed

    Mohammad-Rafiee, Farshid; Golestanian, Ramin

    2004-06-01

    The electrostatic contribution to the twist rigidity of DNA is studied, and it is shown that the Coulomb self-energy of the double-helical sugar-phosphate backbone makes a considerable contribution-the electrostatic twist rigidity of DNA is found to be C(elec) approximately 5 nm, which makes up about 7% of its total twist rigidity ( C(DNA) approximately 75 nm). The electrostatic twist rigidity is found, however, to depend only weakly on the salt concentration, because of a competition between two different screening mechanisms: (1) Debye screening by the salt ions in the bulk, and (2) structural screening by the periodic charge distribution along the backbone of the helical polyelectrolyte. It is found that, depending on the parameters, the electrostatic contribution to the twist rigidity could stabilize or destabilize the structure of a helical polyelectrolyte.

  14. Effect of twist on transverse impact response of ballistic fiber yarns

    DOE PAGES

    Song, Bo; Lu, Wei -Yang

    2015-06-15

    A Hopkinson bar was employed to conduct transverse impact testing of twisted Kevlar KM2 fiber yarns at the same impact speed. The speed of Euler transverse wave generated by the impact was measured utilizing a high speed digital camera. The study included fiber yarns twisted by different amounts. The Euler transverse wave speed was observed to increase with increasing amount of twist of the fiber yarn, within the range of this investigation. As a result, the higher transverse wave speeds in the more twisted fiber yarns indicate better ballistic performance in soft body armors for personal protection.

  15. The CRRES Langmuir Probe and Fluxgate Magnetometer Instrument

    DTIC Science & Technology

    1989-05-09

    Gbntract tenager Branch Chief i r FOR THE COWhbDER RITA C. SAGALYN Division Director Qualified requestors may obtain additional copies from the... Computations 73 2.9 Sawtooth Generation 80 2.10 Bias Sweeps 84 2.11 Main Program Loader 96 2.12 Boom Deployment 98 2.13 General Utilities...separated by 100 meters. The other pair of conductors are cylindrical wire boom elements also in the spin plane that are separated by an effective

  16. Combined detection of Twist1, Snail1 and squamous cell carcinoma antigen for the prognostic evaluation of invasion and metastasis in cervical squamous cell carcinoma.

    PubMed

    Yang, Huilun; Hu, Haiyang; Gou, Yanling; Hu, Yuhong; Li, Hui; Zhao, Hongwei; Wang, Beidi; Li, Peiling; Zhang, Zongfeng

    2018-04-01

    Cervical cancer is one of the most common malignant tumours of the female reproductive system, ranking second only to breast cancer in morbidity worldwide. Essential features of the progression of cervical cancer are invasion and metastasis, which are closely related to disease prognosis and mortality rate. At the present time there is no effective method to evaluate cancer invasion and metastasis before surgery. Here we report our study on molecular changes in biopsy tissue for the prognostic evaluation of cancer invasion and metastasis. Expression of the epithelial-mesenchymal transition-inducing transcription factors Twist1 and Snail1 was detected by immunohistochemistry in 32 normal, 36 low-grade squamous intraepithelial neoplasia (LSIL), 54 high-grade squamous intraepithelial neoplasia (HSIL) and 320 cervical squamous cell carcinoma (CSCC) samples. The correlation between the expression of Twist1, Snail1 and squamous cell carcinoma antigen (SCCA) in CSCC tissues and clinical pathology results was evaluated. A transwell migration and invasion assay was used to explore the roles of Twist1 and Snail1 in the invasion of cancer cells. Lymph node metastasis and lymphovascular space invasion (LVSI) rates for the following groups were analysed: SCCA(+) group, Twist1(+) group, Snail1(+) group, Twist1(+)Snail1(+)group, Twist1(+)SCCA(+)group, Snail1(+)SCCA(+)group and Twist1(+)Snail1(+)SCCA(+) group. The expression of Twist1 and Snail1 was significantly upregulated in HSIL and CSCC (p < 0.05). Twist1 and Snail1 expression levels were associated with LVSI, lymph node metastasis and histological grade (p < 0.05) but not with age or FIGO stage (p > 0.05). The expression of SCCA was associated with LVSI, lymph node metastasis, FIGO stage and histological grade (p < 0.05) but not with age (p > 0.05). Twist1 was an independent factor contributing to the invasion ability of cervical cancer cells. In addition, the positive rate of lymph node metastasis and LVSI was higher in the Twist1(+)Snail1(+)SCCA(+) group than in the SCCA(+) group, Twist1(+) group and Snail1(+) group, respectively (p < 0.05). Combined detection of Twist1 and Snail1 in SCCA-positive biopsy specimens may be a potential method for evaluating the invasion and metastasis of CSCC prior to surgery.

  17. Effect of archwire size and material on the resistance to sliding of self-ligating brackets with second-order angulation in the dry state.

    PubMed

    Thorstenson, Glenys A; Kusy, Robert P

    2002-09-01

    When paired with a particular self-ligating bracket design, the material and the geometric characteristics of an archwire influence its resistance to sliding. Four designs of self-ligating brackets (1 with a slide, 3 with clips) were coupled with 5 types of archwires: 14-mil round austenitic nickel-titanium, 16 x 22-mil rectangular austenitic nickel-titanium, 19 x 25-mil rectangular austenitic nickel-titanium, 19 x 25-mil rectangular martensitic nickel-titanium, and 19 x 25-mil rectangular stainless steel. The resistance to sliding (RS) of each archwire-bracket couple was measured at second-order angles between -9 degrees and 9 degrees. Interbracket distances of 8 and 18 mm between the test bracket and the adjacent brackets mimicked closure of a premolar extraction. When clearance exists, the RS is negligible for self-ligating brackets with slides coupled to any size of wire as well as for those with clips when coupled to wires that do not contact the clip. Once the wire attains a certain size and contacts the clip, the RS depends on the archwire size, the bracket design, and the materials of the couple. When coupled with the 16 x 22-mil wire, the brackets with clips applied normal forces ranging from a low of 5.6 centi-Newtons (cN) (1 cN = 1 g) to a high of 230 cN. When clearance disappears, the RS increased proportionally with the second-order angle. The 19 x 25-mil stainless steel wires, which were the most stiff, increased at rates between 75 and 84 cN/degree; the 14-mil austenitic nickel-titanium wires, which were the least stiff, increased at rates from 2.6 to 5.4 cN/degree. The treatment objectives for a particular patient at a specific stage should determine the appropriate archwire-bracket combination.

  18. Anisotropic piezoelectric twist actuation of helicopter rotor blades: Aeroelastic analysis and design optimization

    NASA Astrophysics Data System (ADS)

    Wilkie, William Keats

    1997-12-01

    An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain a soluti An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain amited additional piezoelectric material mass, it is shown that blade twist actuation approaches which exploit in-plane piezoelectric free-stain anisotropies are capable of producing amplitudes of oscillatory blade twisting sufficient for rotor vibration reduction applications. The second study examines the effectiveness of using embedded piezoelectric actuator laminae to alleviate vibratory loads due to retreating blade stall. A 10 to 15 percent improvement in dynamic stall limited forward flight speed, and a 5 percent improvement in stall limited rotor thrust were numerically demonstrated for the active twist rotor blade relative to a conventional blade design. The active twist blades are also demonstrated to be more susceptible than the conventional blades to dynamic stall induced vibratory loads when not operating with twist actuation. This is the result of designing the active twist blades with low torsional stiffness in order to maximize piezoelectric twist authority. Determining the optimum tradeoff between blade torsional stiffness and piezoelectric twist actuation authority is the subject of the third study. For this investigation, a linearized hovering-flight eigenvalue analysis is developed. Linear optimal control theory is then utilized to develop an optimum active twist blade design in terms of reducing structural energy and control effort cost. The forward flight vibratory loads characteristics of the torsional stiffness optimized active twist blade are then examined using the nonlinear, forward flight aeroelastic analysis. The optimized active twist rotor blade is shown to have improved passive and active vibratory loads characteristics relative to the baseline active twist blades.

  19. Twisting failure of centrally loaded open-section columns in the elastic range

    NASA Technical Reports Server (NTRS)

    Kappus, Robert

    1938-01-01

    In the following report a complete theory of twisting failure by the energy method is developed, based on substantially the same assumptions as those employed by Wagner and Bleich. Problems treated in detail are: the stress and strain condition under St. Venant twist and in twist with axial constraint; the concept of shear center and the energy method for problems of elastic stability.

  20. On the twists of interplanetary magnetic flux ropes observed at 1 AU

    NASA Astrophysics Data System (ADS)

    Wang, Yuming; Zhuang, Bin; Hu, Qiang; Liu, Rui; Shen, Chenglong; Chi, Yutian

    2016-10-01

    Magnetic flux ropes (MFRs) are one kind of fundamental structures in the solar/space physics and involved in various eruption phenomena. Twist, characterizing how the magnetic field lines wind around a main axis, is an intrinsic property of MFRs, closely related to the magnetic free energy and stableness. Although the effect of the twist on the behavior of MFRs had been widely studied in observations, theory, modeling, and numerical simulations, it is still unclear how much amount of twist is carried by MFRs in the solar atmosphere and in heliosphere and what role the twist played in the eruptions of MFRs. Contrasting to the solar MFRs, there are lots of in situ measurements of magnetic clouds (MCs), the large-scale MFRs in interplanetary space, providing some important information of the twist of MFRs. Thus, starting from MCs, we investigate the twist of interplanetary MFRs with the aid of a velocity-modified uniform-twist force-free flux rope model. It is found that most of MCs can be roughly fitted by the model and nearly half of them can be fitted fairly well though the derived twist is probably overestimated by a factor of 2.5. By applying the model to 115 MCs observed at 1 AU, we find that (1) the twist angles of interplanetary MFRs generally follow a trend of about 0.6l/R radians, where l/R is the aspect ratio of a MFR, with a cutoff at about 12π radians AU-1, (2) most of them are significantly larger than 2.5π radians but well bounded by 2l/R radians, (3) strongly twisted magnetic field lines probably limit the expansion and size of MFRs, and (4) the magnetic field lines in the legs wind more tightly than those in the leading part of MFRs. These results not only advance our understanding of the properties and behavior of interplanetary MFRs but also shed light on the formation and eruption of MFRs in the solar atmosphere. A discussion about the twist and stableness of solar MFRs are therefore given.

  1. Operation of a test bed axial-gap brushless dc rotor with a superconducting stator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McKeever, J.W.; Sohns, C.W.; Schwenterly, S.W.

    1993-08-01

    A variable-speed axial-gap motor with a stator consisting of four liquid helium cooled superconducting electromagnets (two pole pairs) was built and proof tested up to 608 rpm in November 1990 as a tool for joint industry-laboratory evaluation of coils fabricated from high-temperature oxide superconductors. A second rotor was fabricated with improved materia winding configuration, and wire type, and the drive system was modified to eliminate current spiking. The modified motor was characterized to design speed, 188 rad/s (1800 rpm), to acquire a performance baseline for future comparison with that of high-temperature superconducting (HIS) wire. As it becomes commercially available, HTSmore » wire will replace the low-temperature electromagnet wire in a stator modified to control wire temperatures between 4 K and 77 K. Measurements of the superconducting electromagnetic field and locked rotor torque as functions of cryocurrent and dc current through two phases of the rotor, respectively, provided data to estimate power that could be developed by the rotor. Back emf and parasitic mechanical and electromagnetic drag torques were measured as functions of angular velocity to calculate actual rotor power developed and to quantify losses, which reduce the motor`s efficiency. A detailed measurement of motor power at design speed confirmed the developed power equation. When subsequently operated at the 33-A maximum available rotor current, the motor delivered 15.3 kill (20.5 hp) to the load. In a final test, the cryostat was operated at 2500 A, 200 A below its critical current. At rotor design current of 60 A and 2500 A stator current, the extrapolated developed power would be 44.2 kill (59.2 hp) with 94% efficiency.« less

  2. An Accurately Controlled Antagonistic Shape Memory Alloy Actuator with Self-Sensing

    PubMed Central

    Wang, Tian-Miao; Shi, Zhen-Yun; Liu, Da; Ma, Chen; Zhang, Zhen-Hua

    2012-01-01

    With the progress of miniaturization, shape memory alloy (SMA) actuators exhibit high energy density, self-sensing ability and ease of fabrication, which make them well suited for practical applications. This paper presents a self-sensing controlled actuator drive that was designed using antagonistic pairs of SMA wires. Under a certain pre-strain and duty cycle, the stress between two wires becomes constant. Meanwhile, the strain to resistance curve can minimize the hysteresis gap between the heating and the cooling paths. The curves of both wires are then modeled by fitting polynomials such that the measured resistance can be used directly to determine the difference between the testing values and the target strain. The hysteresis model of strains to duty cycle difference has been used as compensation. Accurate control is demonstrated through step response and sinusoidal tracking. The experimental results show that, under a combination control program, the root-mean-square error can be reduced to 1.093%. The limited bandwidth of the frequency is estimated to be 0.15 Hz. Two sets of instruments with three degrees of freedom are illustrated to show how this type actuator could be potentially implemented. PMID:22969368

  3. Theoretical analysis for the mechanical behavior caused by an electromagnetic cycle in ITER Nb3Sn cable-in-conduit conductors

    NASA Astrophysics Data System (ADS)

    Yue, Donghua; Zhang, Xingyi; Zhou, You-He

    2018-02-01

    The central solenoid (CS) is one of the key components of the International Thermonuclear Experimental Reactor (ITER) tokamak and which is often considered as the heart of this fusion reactor. This solenoid will be built by using Nb3Sn cable-in-conduit conductors (CICC), capable of generating a 13 T magnetic field. In order to assess the performance of the Nb3Sn CICC in nearly the ITER condition, many short samples have been evaluated at the SULTAN test facility (the background magnetic field is of 10.85 T with the uniform length of 400 mm at 1% homogeneity) in Centre de Recherches en Physique des Plasma (CRPP). It is found that the samples with pseudo-long twist pitch (including baseline specimens) show a significant degradation in the current-sharing temperature (Tcs), while the qualification tests of all short twist pitch (STP) samples, which show no degradation versus electromagnetic cycling, even exhibits an increase of Tcs. This behavior was perfectly reproduced in the coil experiments at the central solenoid model coil (CSMC) facility last year. In this paper, the complex structure of the Nb3Sn CICC would be simplified into a wire rope consisting of six petals and a cooling spiral. An analytical formula for the Tcs behavior as a function of the axial strain of the cable is presented. Based on this, the effects of twist pitch, axial and transverse stiffness, thermal mismatch, cycling number, magnetic distribution, etc., on the axial strain are discussed systematically. The calculated Tcs behavior with cycle number show consistency with the previous experimental results qualitatively and quantitatively. Lastly, we focus on the relationship between Tcs and axial strain of the cable, and we conclude that the Tcs behavior caused by electromagnetic cycles is determined by the cable axial strain. Once the cable is in a compression situation, this compression strain and its accumulation would lead to the Tcs degradation. The experimental observation of the Tcs enhancement in the CS STP samples should be considered as a contribution of the shorter length of the high field zone in SULTAN and CSMC devices, as well as the tight cable structure.

  4. Aeromechanical Evaluation of Smart-Twisting Active Rotor

    NASA Technical Reports Server (NTRS)

    Lim, Joon W.; Boyd, D. Douglas, Jr.; Hoffman, Frauke; van der Wall, Berend G.; Kim, Do-Hyung; Jung, Sung N.; You, Young H.; Tanabe, Yasutada; Bailly, Joelle; Lienard, Caroline; hide

    2014-01-01

    An investigation of Smart-Twisting Active Rotor (STAR) was made to assess potential benefits of the current active twist rotor concept for performance improvement, vibration reduction, and noise alleviation. The STAR rotor is a 40% Mach-scaled, Bo105 rotor with an articulated flap-lag hinge at 3.5%R and no pre-cone. The 0-5 per rev active twist harmonic inputs were applied for various flight conditions including hover, descent, moderate to high speed level flights, and slowed rotor high advance ratio. For the analysis, the STAR partners used multiple codes including CAMRAD II, S4, HOST, rFlow3D, elsA, and their associated software. At the high thrust level in hover, the 0 per rev active twist with 80% amplitude increased figure of merit (FM) by 0.01-0.02 relative to the baseline. In descent, the largest BVI noise reduction was on the order of 2 to 5 dB at the 3 per rev active twist. In the high speed case (mu = 0.35), the 2 per rev actuation was found to be the most effective in achieving a power reduction as well as a vibration reduction. At the 2 per rev active twist, total power was reduced by 0.65% at the 60 deg active twist phase, and vibration was reduced by 47.6% at the 45 deg active twist phase. The use of the 2 per rev active twist appears effective for vibration reduction. In the high advance ratio case (mu = 0.70), the 0 per rev actuation appeared to have negligible impact on performance improvement. In summary, computational simulations successfully demonstrated that the current active twist concept provided a significant reduction of the maximum BVI noise in descent, a significant reduction of the vibration in the high speed case, a small improvement on rotor performance in hover, and a negligible impact on rotor performance in forward flight.

  5. The low radioactivity link of the CUORE experiment

    NASA Astrophysics Data System (ADS)

    Andreotti, E.; Arnaboldi, C.; Barucci, M.; Brofferio, C.; Cosmelli, C.; Calligaris, L.; Capelli, S.; Clemenza, M.; Maiano, C.; Pellicciari, M.; Pessina, G.; Pirro, S.

    2009-09-01

    CUORE will be an array of 988 TeO2 bolometers (5 × 5 × 5 cm3) held at about 10 mK. It will study the very rare double β decay process from 130Te. The electrical connections of the array to the room temperature electronics will consist in about 2000 wires. We will describe the design and characterization of the 3 interconnection sectors going from the detectors to the mixing chamber, the coldest stage at which the array is thermally and mechanically anchored, and from the mixing chamber to room temperature. The lower part consists of a set of 2.3 m long, 50 μm thick, Cu-insulator tapes having PEN (Polyethylene 2.6 Naphthalate) substrate, on which a pattern of copper tracks are etched. The differential layout pattern chosen allows obtaining a signal cross talk between adjacent channels of about 0.024%, together with a capacitance of about 26 pF/m and a resistance larger than 200 GΩ/m. On the top of the mixing chamber, Cu-Kapton boards are used to join the tapes to the second upward-going 2 m long links, implemented with twisted NbTi wires, interwoven in a NOMEX® texture. NbTi-NOMEX link features about 100 pF/m and negligible level of cross-talk. The radioactivity content of Cu-PEN tapes, Cu-Kapton boards, NbTi-NOMEX ribbons and connectors has been investigated and found to be compliant with the experimental requirements. A mechanical study has been done to quote the vibration transmission properties of the highly packaged tapes.

  6. Pressure-constrained, reduced-DOF, interconnected parallel manipulators with applications to space suit design

    NASA Astrophysics Data System (ADS)

    Jacobs, Shane Earl

    This dissertation presents the concept of a Morphing Upper Torso, an innovative pressure suit design that incorporates robotic elements to enable a resizable, highly mobile and easy to don/doff spacesuit. The torso is modeled as a system of interconnected, pressure-constrained, reduced-DOF, wire-actuated parallel manipulators, that enable the dimensions of the suit to be reconfigured to match the wearer. The kinematics, dynamics and control of wire-actuated manipulators are derived and simulated, along with the Jacobian transforms, which relate the total twist vector of the system to the vector of actuator velocities. Tools are developed that allow calculation of the workspace for both single and interconnected reduced-DOF robots of this type, using knowledge of the link lengths. The forward kinematics and statics equations are combined and solved to produce the pose of the platforms along with the link tensions. These tools allow analysis of the full Morphing Upper Torso design, in which the back hatch of a rear-entry torso is interconnected with the waist ring, helmet ring and two scye bearings. Half-scale and full-scale experimental models are used along with analytical models to examine the feasibility of this novel space suit concept. The analytical and experimental results demonstrate that the torso could be expanded to facilitate donning and doffng, and then contracted to match different wearer's body dimensions. Using the system of interconnected parallel manipulators, suit components can be accurately repositioned to different desired configurations. The demonstrated feasibility of the Morphing Upper Torso concept makes it an exciting candidate for inclusion in a future planetary suit architecture.

  7. Solution structure of a DNA complex with the fluorescent bis-intercalator TOTO determined by NMR spectroscopy.

    PubMed

    Spielmann, H P; Wemmer, D E; Jacobsen, J P

    1995-07-11

    We have used two-dimensional 1H NMR spectroscopy to determine the solution structure of the DNA oligonucleotide d(5'-CGCTAGCG-3')2 complexed with the bis-intercalating dye 1,1'-(4,4,8,8-tetramethyl-4,8-diazaundecamethylene)bis[4-(3-methyl -2,3- dihydrobenzo-1,3-thiazolyl-2-methylidene)qui nolinium] tetraiodide (TOTO). The determination of the structure was based on total relaxation matrix analysis of the NOESY cross-peak intensities using the program MARDIGRAS. Improved procedures to consider the experimental "noise" in NOESY spectra during these calculations have been employed. The NOE-derived distance restraints were applied in restrained molecular dynamics calculations. Twenty final structures each were generated for the TOTO complex from both A-form and B-form dsDNA starting structures. The root-mean-square (rms) deviation of the coordinates for the 40 structures of the complex was 1.45 A. The local DNA structure is distorted in the complex. The helix is unwound by 60 degrees and has an overall helical repeat of 12 base pairs, caused by bis-intercalation of TOTO. The poly(propylenamine) linker chain is located in the minor groove of dsDNA. Calculations indicate that the benzothiazole ring system is twisted relative to the quinoline in the uncomplexed TOTO molecule. The site selectivity of TOTO for the CTAG-CTAG site is explained by its ability to adapt to the base pair propeller twist of dsDNA to optimize stacking and the hydrophobic interaction between the thymidine methyl group and the benzothiazole ring. There is a 3000-fold fluorescence enhancement upon binding of TOTO to dsDNA. Rotation about the cyanine methine bonds is possible in free TOTO, allowing relaxation nonradiatively. When bound to dsDNA, the benzothiazole ring and the quinolinium ring are clamped by the nucleobases preventing this rotation, and the chromophore loses excitation energy by fluorescence instead.

  8. Optical Access Networks

    NASA Astrophysics Data System (ADS)

    Zheng, Jun; Ansari, Nirwan

    2005-02-01

    Call for Papers: Optical Access Networks With the wide deployment of fiber-optic technology over the past two decades, we have witnessed a tremendous growth of bandwidth capacity in the backbone networks of today's telecommunications infrastructure. However, access networks, which cover the "last-mile" areas and serve numerous residential and small business users, have not been scaled up commensurately. The local subscriber lines for telephone and cable television are still using twisted pairs and coaxial cables. Most residential connections to the Internet are still through dial-up modems operating at a low speed on twisted pairs. As the demand for access bandwidth increases with emerging high-bandwidth applications, such as distance learning, high-definition television (HDTV), and video on demand (VoD), the last-mile access networks have become a bandwidth bottleneck in today's telecommunications infrastructure. To ease this bottleneck, it is imperative to provide sufficient bandwidth capacity in the access networks to open the bottleneck and thus present more opportunities for the provisioning of multiservices. Optical access solutions promise huge bandwidth to service providers and low-cost high-bandwidth services to end users and are therefore widely considered the technology of choice for next-generation access networks. To realize the vision of optical access networks, however, many key issues still need to be addressed, such as network architectures, signaling protocols, and implementation standards. The major challenges lie in the fact that an optical solution must be not only robust, scalable, and flexible, but also implemented at a low cost comparable to that of existing access solutions in order to increase the economic viability of many potential high-bandwidth applications. In recent years, optical access networks have been receiving tremendous attention from both academia and industry. A large number of research activities have been carried out or are now underway this hot area. The purpose of this feature issue is to expose the networking community to the latest research breakthroughs and progresses in the area of optical access networks.

  9. Spectral determinants for twist field correlators

    NASA Astrophysics Data System (ADS)

    Belitsky, A. V.

    2018-04-01

    Twist fields were introduced a few decades ago as a quantum counterpart to classical kink configurations and disorder variables in low dimensional field theories. In recent years they received a new incarnation within the framework of geometric entropy and strong coupling limit of four-dimensional scattering amplitudes. In this paper, we study their two-point correlation functions in a free massless scalar theory, namely, twist-twist and twist-antitwist correlators. In spite of the simplicity of the model in question, the properties of the latter are far from being trivial. The problem is reduced, within the formalism of the path integral, to the study of spectral determinants on surfaces with conical points, which are then computed exactly making use of the zeta function regularization. We also provide an insight into twist correlators for a massive complex scalar by means of the Lifshitz-Krein trace formula.

  10. THE EFFECT OF A TWISTED MAGNETIC FIELD ON THE PERIOD RATIO P{sub 1}/P{sub 2} OF NONAXISYMMETRIC MAGNETOHYDRODYNAMIC WAVES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karami, K.; Bahari, K., E-mail: KKarami@uok.ac.ir, E-mail: K.Bahari@razi.ac.ir

    2012-10-01

    We consider nonaxisymmetric magnetohydrodynamic (MHD) modes in a zero-beta cylindrical compressible thin magnetic flux tube modeled as a twisted core surrounded by a magnetically twisted annulus, with both embedded in a straight ambient external field. The dispersion relation is derived and solved analytically and numerically to obtain the frequencies of the nonaxisymmetric MHD waves. The main result is that the twisted magnetic annulus does affect the period ratio P{sub 1}/P{sub 2} of the kink modes. For the kink modes, the magnetic twist in the annulus region can achieve deviations from P{sub 1}/P{sub 2} = 2 of the same order ofmore » magnitude as in the observations. Furthermore, the effect of the internal twist on the fluting modes is investigated.« less

  11. To investigate the relation between pore size and twist angle in enhanced thermoelectric efficient porous armchair graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Kaur, Sukhdeep; Randhawa, Deep Kamal Kaur; Bindra Narang, Sukhleen

    2018-05-01

    Based on Non-Equilibrium Green’s function method, we demonstrate that the twisted deformation is an efficient method to improve the figure of merit ZT of porous armchair graphene nanoribbons AGNRs. The peak value of ZT can be obtained for a certain tunable twist angle. Further analysis shows that the tunable twist angle exhibits an inverse relationship with the pore size laying forth the designers a choice for the larger twists to be replaced by smaller ones simply by increasing the size of the pore. Ballistic transport regime and semi-empirical method using Huckel basis set is used to obtain the electrical properties while the Tersoff potential is employed for the phononic system. These interesting findings indicate that the twisted porous AGNRs can be utilized as designing materials for potential thermoelectric applications.

  12. Mesoporous Silica Nanoparticle Delivery of Chemically Modified siRNA Against TWIST1 Leads to Reduced Tumor Burden

    PubMed Central

    Finlay, James; Roberts, Cai M.; Dong, Juyao; Zink, Jeffrey I.; Tamanoi, Fuyuhiko; Glackin, Carlotta A.

    2015-01-01

    Growth and progression of solid tumors depends on the integration of multiple pro-growth and survival signals, including the induction of angiogenesis. TWIST1 is a transcription factor whose reactivation in tumors leads to epithelial to mesenchymal transition (EMT), including increased cancer cell stemness, survival, and invasiveness. Additionally, TWIST1 drives angiogenesis via activation of IL-8 and CCL2, independent of VEGF signaling. In this work, results suggest that chemically modified siRNA against TWIST1 reverses EMT both in vitro and in vivo. siRNA delivery with a polyethyleneimine-coated mesoporous silica nanoparticle (MSN) led to reduction of TWIST1 target genes and migratory potential in vitro. In mice bearing xenograft tumors, weekly intravenous injections of the siRNA-nanoparticle complexes resulted in decreased tumor burden together with a loss of CCL2 suggesting a possible anti-angiogenic response. Therapeutic use of TWIST1 siRNA delivered via MSNs has the potential to inhibit tumor growth and progression in many solid tumor types. Chemically modified siRNA against TWIST1 was complexed to cation-coated mesoporous silica nanoparticles and tested in vitro and in vivo. In cell culture experiments, siRNA reduced expression of TWIST1 and its target genes, and reduced cell migration. In mice, injections of the siRNA-nanoparticle complex led to reduced tumor weight. Data suggest that diminished tumor burden was the result of reduced CCL2 expression and angiogenesis following TWIST1 knockdown. PMID:26115637

  13. Twisted surfaces with vanishing curvature in Galilean 3-space

    NASA Astrophysics Data System (ADS)

    Dede, Mustafa; Ekici, Cumali; Goemans, Wendy; Ünlütürk, Yasin

    In this work, we define twisted surfaces in Galilean 3-space. In order to construct these surfaces, a planar curve is subjected to two simultaneous rotations, possibly with different rotation speeds. The existence of Euclidean rotations and isotropic rotations leads to three distinct types of twisted surfaces in Galilean 3-space. Then we classify twisted surfaces in Galilean 3-space with zero Gaussian curvature or zero mean curvature.

  14. Twisting integrin receptors increases endothelin-1 gene expression in endothelial cells

    NASA Technical Reports Server (NTRS)

    Chen, J.; Fabry, B.; Schiffrin, E. L.; Wang, N.; Ingber, D. E. (Principal Investigator)

    2001-01-01

    A magnetic twisting stimulator was developed based on the previously published technique of magnetic twisting cytometry. Using ligand-coated ferromagnetic microbeads, this device can apply mechanical stresses with varying amplitudes, duration, frequencies, and waveforms to specific cell surface receptors. Biochemical and biological responses of the cells to the mechanical stimulation can be assayed. Twisting integrin receptors with RGD (Arg-Gly-Asp)-containing peptide-coated beads increased endothelin-1 (ET-1) gene expression by >100%. In contrast, twisting scavenger receptors with acetylated low-density lipoprotein-coated beads or twisting HLA antigen with anti-HLA antibody-coated beads did not lead to alterations in ET-1 gene expression. In situ hybridization showed that the increase in ET-1 mRNA was localized in the cells that were stressed with the RGD-coated beads. Blocking stretch-activated ion channels with gadolinium, chelating Ca2+ with EGTA, or inhibiting tyrosine phosphorylation with genistein abolished twist-induced ET-1 mRNA elevation. Abolishing cytoskeletal tension with an inhibitor of the myosin ATPase, with an inhibitor of myosin light chain kinase, or with an actin microfilament disrupter blocked twisted-induced increases in ET-1 expression. Our results are consistent with the hypothesis that the molecular structural linkage of integrin-cytoskeleton is an important pathway for stress-induced ET-1 gene expression.

  15. TiO2/water Nanofluid Heat Transfer in Heat Exchanger Equipped with Double Twisted-Tape Inserts

    NASA Astrophysics Data System (ADS)

    Eiamsa-ard, S.; Ketrain, R.; Chuwattanakul, V.

    2018-05-01

    Nowadays, heat transfer enhancement plays an important role in improving efficiency of heat transfer and thermal systems for numerous areas such as heat recovery processes, chemical reactors, air-conditioning/refrigeration system, food engineering, solar air/water heater, cooling of high power electronics etc. The present work presents the experimental results of the heat transfer enhancement of TiO2/water nanofluid in a heat exchanger tube fitted with double twisted tapes. The study covered twist ratios of twisted tapes (y/w) of 1.5, 2.0, and 2.5) while the concentration of the nanofluid was kept constant at 0.05% by volume. Observations show that heat transfer, friction loss and thermal performance increase as twist ratio (y/w) decreases. The use of the nanofluid in the tube equipped with the double twisted-tapes with the smallest twist ratio (y/w = 1.5) results in the increases of heat transfer rates and friction factor up to 224.8% and 8.98 times, respectively as compared to those of water. In addition, the experimental results performed that double twisted tapes induced dual swirling-flows which played an important role in improving fluid mixing and heat transfer enhancement. It is also observed that the TiO2/water nanofluid was responsible for low pressure loss behaviors.

  16. Structural and electron diffraction scaling of twisted graphene bilayers

    NASA Astrophysics Data System (ADS)

    Zhang, Kuan; Tadmor, Ellad B.

    2018-03-01

    Multiscale simulations are used to study the structural relaxation in twisted graphene bilayers and the associated electron diffraction patterns. The initial twist forms an incommensurate moiré pattern that relaxes to a commensurate microstructure comprised of a repeating pattern of alternating low-energy AB and BA domains surrounding a high-energy AA domain. The simulations show that the relaxation mechanism involves a localized rotation and shrinking of the AA domains that scales in two regimes with the imposed twist. For small twisting angles, the localized rotation tends to a constant; for large twist, the rotation scales linearly with it. This behavior is tied to the inverse scaling of the moiré pattern size with twist angle and is explained theoretically using a linear elasticity model. The results are validated experimentally through a simulated electron diffraction analysis of the relaxed structures. A complex electron diffraction pattern involving the appearance of weak satellite peaks is predicted for the small twist regime. This new diffraction pattern is explained using an analytical model in which the relaxation kinematics are described as an exponentially-decaying (Gaussian) rotation field centered on the AA domains. Both the angle-dependent scaling and diffraction patterns are in quantitative agreement with experimental observations. A Matlab program for extracting the Gaussian model parameters accompanies this paper.

  17. Twisted sigma-model solitons on the quantum projective line

    NASA Astrophysics Data System (ADS)

    Landi, Giovanni

    2018-04-01

    On the configuration space of projections in a noncommutative algebra, and for an automorphism of the algebra, we use a twisted Hochschild cocycle for an action functional and a twisted cyclic cocycle for a topological term. The latter is Hochschild-cohomologous to the former and positivity in twisted Hochschild cohomology results into a lower bound for the action functional. While the equations for the critical points are rather involved, the use of the positivity and the bound by the topological term lead to self-duality equations (thus yielding twisted noncommutative sigma-model solitons, or instantons). We present explicit nontrivial solutions on the quantum projective line.

  18. Explicit formulae for Chern-Simons invariants of the twist-knot orbifolds and edge polynomials of twist knots

    NASA Astrophysics Data System (ADS)

    Ham, J.-Y.; Lee, J.

    2016-09-01

    We calculate the Chern-Simons invariants of twist-knot orbifolds using the Schläfli formula for the generalized Chern-Simons function on the family of twist knot cone-manifold structures. Following the general instruction of Hilden, Lozano, and Montesinos-Amilibia, we here present concrete formulae and calculations. We use the Pythagorean Theorem, which was used by Ham, Mednykh and Petrov, to relate the complex length of the longitude and the complex distance between the two axes fixed by two generators. As an application, we calculate the Chern-Simons invariants of cyclic coverings of the hyperbolic twist-knot orbifolds. We also derive some interesting results. The explicit formulae of the A-polynomials of twist knots are obtained from the complex distance polynomials. Hence the edge polynomials corresponding to the edges of the Newton polygons of the A-polynomials of twist knots can be obtained. In particular, the number of boundary components of every incompressible surface corresponding to slope -4n+2 turns out to be 2. Bibliography: 39 titles.

  19. Scanning tunneling microscopy and spectroscopy of twisted trilayer graphene

    NASA Astrophysics Data System (ADS)

    Zuo, Wei-Jie; Qiao, Jia-Bin; Ma, Dong-Lin; Yin, Long-Jing; Sun, Gan; Zhang, Jun-Yang; Guan, Li-Yang; He, Lin

    2018-01-01

    Twist, as a simple and unique degree of freedom, could lead to enormous novel quantum phenomena in bilayer graphene. A small rotation angle introduces low-energy van Hove singularities (VHSs) approaching the Fermi level, which result in unusual correlated states in the bilayer graphene. It is reasonable to expect that the twist could also affect the electronic properties of few-layer graphene dramatically. However, such an issue has remained experimentally elusive. Here, by using scanning tunneling microscopy/spectroscopy (STM/STS), we systematically studied a twisted trilayer graphene (TTG) with two different small twist angles between adjacent layers. Two sets of VHSs, originating from the two twist angles, were observed in the TTG, indicating that the TTG could be simply regarded as a combination of two different twisted bilayers of graphene. By using high-resolution STS, we observed a split of the VHSs and directly imaged the spatial symmetry breaking of electronic states around the VHSs. These results suggest that electron-electron interactions play an important role in affecting the electronic properties of graphene systems with low-energy VHSs.

  20. A miniature cable-driven robot for crawling on the heart.

    PubMed

    Patronik, N A; Zenati, M A; Riviere, C N

    2005-01-01

    This document describes the design and preliminary testing of a cable-driven robot for the purpose of traveling on the surface of the beating heart to administer therapy. This methodology obviates mechanical stabilization and lung deflation, which are typically required during minimally invasive cardiac surgery. Previous versions of the robot have been remotely actuated through push-pull wires, while visual feedback was provided by fiber optic transmission. Although these early models were able to perform locomotion in vivo on porcine hearts, the stiffness of the wire-driven transmission and fiber optic camera limited the mobility of the robots. The new prototype described in this document is actuated by two antagonistic cable pairs, and contains a color CCD camera located in the front section of the device. These modifications have resulted in superior mobility and visual feedback. The cable-driven prototype has successfully demonstrated prehension, locomotion, and tissue dye injection during in vitro testing with a poultry model.

Top