Sample records for type iv pathogenesis

  1. Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

    USDA-ARS?s Scientific Manuscript database

    The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

  2. Secretion of TcpF by the Vibrio cholerae Toxin-Coregulated Pilus Biogenesis Apparatus Requires an N-Terminal Determinant

    PubMed Central

    Megli, Christina J.

    2013-01-01

    Type IV pili are important for microcolony formation, biofilm formation, twitching motility, and attachment. We and others have shown that type IV pili are important for protein secretion across the outer membrane, similar to type II secretion systems. This study explored the relationship between protein secretion and pilus formation in Vibrio cholerae. The toxin-coregulated pilus (TCP), a type IV pilus required for V. cholerae pathogenesis, is necessary for the secretion of the colonization factor TcpF (T. J. Kirn, N. Bose, and R. K. Taylor, Mol. Microbiol. 49:81–92, 2003). This phenomenon is not unique to V. cholerae; secreted virulence factors that are dependent on the presence of components of the type IV pilus biogenesis apparatus for secretion have been reported with Dichelobacter nodosus (R. M. Kennan, O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I. Rood, J. Bacteriol. 183:4451–4458, 2001) and Francisella tularensis (A. J. Hager et al., Mol. Microbiol. 62:227–237, 2006). Using site-directed mutagenesis, we demonstrated that the secretion of TcpF is dependent on the presence of selected amino acid R groups at position five. We were unable to find other secretion determinants, suggesting that Y5 is the major secretion determinant within TcpF. We also report that proteins secreted in a type IV pilus biogenesis apparatus-dependent manner have a YXS motif within the first 15 amino acids following the Sec cleavage site. The YXS motif is not present in proteins secreted by type II secretion systems, indicating that this is unique to type IV pilus-mediated secretion. Moreover, we show that TcpF interacts with the pilin TcpA, suggesting that these proteins are secreted by the type IV pilus biogenesis system. These data provide a starting point for understanding how type IV pili can mediate secretion of virulence factors important for bacterial pathogenesis. PMID:23564177

  3. New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis.

    PubMed

    Smith, Michael G; Gianoulis, Tara A; Pukatzki, Stefan; Mekalanos, John J; Ornston, L Nicholas; Gerstein, Mark; Snyder, Michael

    2007-03-01

    Acinetobacter baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections including pneumonia, meningitis, septicemia, and urinary tract infections. We explored the pathogenic content of this harmful pathogen using a combination of DNA sequencing and insertional mutagenesis. The genome of this organism was sequenced using a strategy involving high-density pyrosequencing, a novel, rapid method of high-throughput sequencing. Excluding the rDNA repeats, the assembled genome is 3,976,746 base pairs (bp) and has 3830 ORFs. A significant fraction of ORFs (17.2%) are located in 28 putative alien islands, indicating that the genome has acquired a large amount of foreign DNA. Consistent with its role in pathogenesis, a remarkable number of the islands (16) contain genes implicated in virulence, indicating the organism devotes a considerable portion of its genes to pathogenesis. The largest island contains elements homologous to the Legionella/Coxiella Type IV secretion apparatus. Type IV secretion systems have been demonstrated to be important for virulence in other organisms and thus are likely to help mediate pathogenesis of A. baumannii. Insertional mutagenesis generated avirulent isolates of A. baumannii and verified that six of the islands contain virulence genes, including two novel islands containing genes that lacked homology with others in the databases. The DNA sequencing approach described in this study allows the rapid elucidation of the DNA sequence of any microbe and, when combined with genetic screens, can identify many novel genes important for microbial pathogenesis.

  4. Native structure of a type IV secretion system core complex essential for Legionella pathogenesis.

    PubMed

    Kubori, Tomoko; Koike, Masafumi; Bui, Xuan Thanh; Higaki, Saori; Aizawa, Shin-Ichi; Nagai, Hiroki

    2014-08-12

    Bacterial type IV secretion systems are evolutionarily related to conjugation systems and play a pivotal role in infection by delivering numerous virulence factors into host cells. Using transmission electron microscopy, we report the native molecular structure of the core complex of the Dot/Icm type IV secretion system encoded by Legionella pneumophila, an intracellular human pathogen. The biochemically isolated core complex, composed of at least five proteins--DotC, DotD, DotF, DotG, and DotH--has a ring-shaped structure. Intriguingly, morphologically distinct premature complexes are formed in the absence of DotG or DotF. Our data suggest that DotG forms a central channel spanning inner and outer membranes. DotF, a component dispensable for type IV secretion, plays a role in efficient embedment of DotG into the functional core complex. These results highlight a common scheme for the biogenesis of transport machinery.

  5. The adherent abilities of Clostridium perfringens strains are critical for the pathogenesis of avian necrotic enteritis.

    PubMed

    Wade, Ben; Keyburn, Anthony L; Haring, Volker; Ford, Mark; Rood, Julian I; Moore, Robert J

    2016-12-25

    Necrotic enteritis of poultry is an emerging disease of substantial economic importance, but aspects of the pathogenesis of this multi-factorial disease are still unclear. We recently demonstrated that the ability of avian strains of the causative bacterium, Clostridium perfringens, to bind to specific collagen types correlated strongly with their virulence and we postulated that binding of the pathogen to collagen types IV and V and gelatin may involve the putative adhesin-encoding gene cnaA, which is found in the VR-10B locus. In this study we have used site-directed mutagenesis to demonstrate that disruption of the cnaA gene leads to a reduction in the expression of the three genes immediately downstream of cnaA and reduced adherence to collagen types IV and V and gelatin. In addition, a cnaA mutant of strain EHE-NE18 was no longer capable of causing necrotic enteritis in a chicken disease induction model and had a significantly reduced ability to colonise the chicken intestinal mucosa. These results were confirmed by generating and analysing a similar mutant in an independent necrotic enteritis causing C. perfringens strain. This study expands our understanding of the mechanisms involved in necrotic enteritis pathogenesis by demonstrating the importance of C. perfringens adherence to extracellular matrix proteins. Copyright © 2016. Published by Elsevier B.V.

  6. PML clastosomes prevent nuclear accumulation of mutant ataxin-7 and other polyglutamine proteins

    PubMed Central

    Janer, Alexandre; Martin, Elodie; Muriel, Marie-Paule; Latouche, Morwena; Fujigasaki, Hiroto; Ruberg, Merle; Brice, Alexis; Trottier, Yvon; Sittler, Annie

    2006-01-01

    The pathogenesis of spinocerebellar ataxia type 7 and other neurodegenerative polyglutamine (polyQ) disorders correlates with the aberrant accumulation of toxic polyQ-expanded proteins in the nucleus. Promyelocytic leukemia protein (PML) nuclear bodies are often present in polyQ aggregates, but their relation to pathogenesis is unclear. We show that expression of PML isoform IV leads to the formation of distinct nuclear bodies enriched in components of the ubiquitin-proteasome system. These bodies recruit soluble mutant ataxin-7 and promote its degradation by proteasome-dependent proteolysis, thus preventing the aggregate formation. Inversely, disruption of the endogenous nuclear bodies with cadmium increases the nuclear accumulation and aggregation of mutant ataxin-7, demonstrating their role in ataxin-7 turnover. Interestingly, β-interferon treatment, which induces the expression of endogenous PML IV, prevents the accumulation of transiently expressed mutant ataxin-7 without affecting the level of the endogenous wild-type protein. Therefore, clastosomes represent a potential therapeutic target for preventing polyQ disorders. PMID:16818720

  7. Protein contact dermatitis: allergens, pathogenesis, and management.

    PubMed

    Levin, Cheryl; Warshaw, Erin

    2008-01-01

    Protein contact dermatitis is an allergic skin reaction induced principally by proteins of either animal or plant origin. The clinical presentation is that of a chronic dermatitis, and it is often difficult to differentiate between allergic contact dermatitis and other eczematous dermatoses. One distinguishing clinical feature is that acute flares of pruritus, urticaria, edema, or vesiculation are noted minutes after contact with the causative substances. Additionally, the patch-test result is typically negative, and the scratch- or prick-test result is positive. The pathogenesis of protein contact dermatitis is unclear but may involve a type I (immunoglobulin E [IgE], immediate) hypersensitivity reaction, type IV (cell-mediated delayed) hypersensitivity reaction, and/or a delayed reaction due to IgE-bearing Langerhans' cells. Management involves avoidance of the allergen.

  8. Proposal for a histopathological consensus classification of the periprosthetic interface membrane

    PubMed Central

    Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-01-01

    Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

  9. Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

    PubMed

    Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-06-01

    The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

  10. The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

    PubMed

    Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

    2002-04-02

    The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

  11. Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

    Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

  12. Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

    PubMed

    Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

    2017-10-17

    Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  13. Pili of Mycobacterium tuberculosis: current knowledge and future prospects.

    PubMed

    Ramsugit, Saiyur; Pillay, Manormoney

    2015-08-01

    Many pathogenic bacteria express filamentous appendages, termed pili, on their surface. These organelles function in several important bacterial processes, including mediating bacterial interaction with, and colonization of the host, signalling events, locomotion, DNA uptake, electric conductance, and biofilm formation. In the last decade, it has been established that the tuberculosis-causing bacterium, Mycobacterium tuberculosis, produces two pili types: curli and type IV pili. In this paper, we review studies on M. tuberculosis pili, highlighting their structure and biological significance to M. tuberculosis pathogenesis, and discuss their potential as targets for therapeutic intervention and diagnostic test development.

  14. Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

    PubMed

    Lees, George E

    2013-01-01

    To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

  15. Isolation, characterization and comparative genomics of bacteriophage SfIV: a novel serotype converting phage from Shigella flexneri

    PubMed Central

    2013-01-01

    Background Shigella flexneri is the major cause of shigellosis in the developing countries. The O-antigen component of the lipopolysaccharide is one of the key virulence determinants required for the pathogenesis of S. flexneri. The glucosyltransferase and/or acetyltransferase genes responsible for the modification of the O-antigen are encoded by temperate serotype converting bacteriophage present in the S. flexneri genome. Several serotype converting phages have previously been isolated and characterized, however, attempts to isolate a serotype converting phage which encodes the modification genes of serotypes 4a strain have not been successful. Results In this study, a novel temperate serotype converting bacteriophage SfIV was isolated. Lysogenisation of phage SfIV converted serotype Y strain to serotype 4a. Electron microscopy indicated that SfIV belongs to Myoviridae family. The 39,758 bp genome of phage SfIV encompasses 54 open reading frames (orfs). Protein level comparison of SfIV with other serotype converting phages of S. flexneri revealed that SfIV is similar to phage SfII and SfV. The comparative analysis also revealed that SfIV phage contained five proteins which were not found in any other phages of S. flexneri. These proteins were: a tail fiber assembly protein, two hypothetical proteins with no clear function, and two other unknown proteins which were encoded by orfs present on a moron, that presumably got introduced in SfIV genome from another species via a transposon. These unique proteins of SfIV may play a role in the pathogenesis of the host. Conclusions This study reports the isolation and complete genome sequence analysis of bacteriophage SfIV. The SfIV phage has a host range significantly different from the other phages of Shigella. Comparative genome analysis identified several proteins unique to SfIV, which may potentially be involved in the survival and pathogenesis of its host. These findings will further our understanding on the evolution of these phages, and will also facilitate studies on development of new phage vectors and therapeutic agents to control infections caused by S. flexneri. PMID:24090466

  16. Deletion of pilA, a Minor Pilin-Like Gene, from Xanthomonas citri subsp. citri Influences Bacterial Physiology and Pathogenesis.

    PubMed

    Petrocelli, Silvana; Arana, Maite R; Cabrini, Marcela N; Casabuono, Adriana C; Moyano, Laura; Beltramino, Matías; Moreira, Leandro M; Couto, Alicia S; Orellano, Elena G

    2016-12-01

    Type IV pili (Tfp) are widely distributed adhesins of bacterial surfaces. In plant pathogenic bacteria, Tfp are involved in host colonization and pathogenesis. Xanthomonas citri subsp. citri (Xcc) is the phytopathogen responsible for citrus canker disease. In this work, three Tfp structural genes, fimA, fimA1, and pilA from Xcc were studied. A pilA mutant strain from Xcc (XccΔpilA) was constructed and differences in physiological features, such as motilities, adhesion, and biofilm formation, were observed. A structural study of the purified Tfp fractions from Xcc wild-type and Xcc∆pilA showed that pilins are glycosylated in both strains and that FimA and FimA1 are the main structural components of the pili. Furthermore, smaller lesion symptoms and reduced bacterial growth were produced by Xcc∆pilA in orange plants compared to the wild-type strain. These results indicate that the minor pilin-like gene, pilA, is involved in Tfp performance during the infection process.

  17. Genetic Ablation of Apolipoprotein A-IV Accelerates Alzheimer's Disease Pathogenesis in a Mouse Model

    PubMed Central

    Cui, Yujie; Huang, Mingwei; He, Yingbo; Zhang, Shuyan; Luo, Yongzhang

    2011-01-01

    The link between lipoprotein metabolism and Alzheimer's disease (AD) has been established. Apolipoprotein A-IV (apoA-IV), a component of lipoprotein particles similar to apolipoprotein E, has been suggested to play an important role in brain metabolism. Although there are clinical debates on the function of its polymorphism in AD, the pathologic role of apoA-IV in AD is still unknown. Here, we report that genetic ablation of apoA-IV is able to accelerate AD pathogenesis in mice. In a mouse model that overexpresses human amyloid precursor protein (APP) and presenilin 1, genetic reduction of apoA-IV augments extracellular amyloid-β peptide (Aβ) burden and aggravates neuron loss in the brain. In addition, genetic ablation of apoA-IV also accelerates spatial learning deficits and increases the mortality of mice. We have found that apoA-IV colocalizes within Aβ plaques in APP/presenilin 1 transgenic mice and binds to Aβ in vitro. Subsequent studies show that apoA-IV in this model facilitates Aβ uptake in the Aβ clearance pathway mediated by astrocytes rather than the amyloidogenic pathway of APP processing. Taken together, we conclude that apoA-IV deficiency increases Aβ deposition and results in cognitive damage in the mouse model. Enhancing levels of apoA-IV may have therapeutic potential in AD treatment. PMID:21356380

  18. Roles of the Putative Type IV-like Secretion System Key Component VirD4 and PrsA in Pathogenesis of Streptococcus suis Type 2

    PubMed Central

    Jiang, Xiaowu; Yang, Yunkai; Zhou, Jingjing; Zhu, Lexin; Gu, Yuanxing; Zhang, Xiaoyan; Li, Xiaoliang; Fang, Weihuan

    2016-01-01

    Streptococcus suis type 2 (SS2) is a zoonotic pathogen causing septic infection, meningitis and pneumonia in pigs and humans. SS2 may cause streptococcal toxic shock syndrome (STSS) probably due to excessive release of inflammatory cytokines. A previous study indicated that the virD4 gene in the putative type IV-like secretion system (T4SS) within the 89K pathogenicity island specific for recent epidemic strains contributed to the development of STSS. However, the functional basis of VirD4 in STSS remains unclear. Here we show that deletion of virD4 led to reduced virulence as shown by about 65% higher LD50, lower bacterial load in liver and brain, and lower level of expression of inflammatory cytokines in mice and cell lines than its parent strain. The ΔVirD4 mutant was more easily phagocytosed, suggesting its role as an anti-phagocytic factor. Oxidative stress that mimic bacterial exposure to respiratory burst of phagocytes upregulated expression of virD4. Proteomic analysis identified 10 secreted proteins of significant differences between the parent and mutant strains under oxidative stress, including PrsA, a peptidyl-prolyl isomerase. The SS2 PrsA expressed in E. coli caused a dose-dependent cell death and increased expression of proinflammatory IL-1β, IL-6 and TNF-α in murine macrophage cells. Our data provide novel insights into the contribution of the VirD4 factor to STSS pathogenesis, possibly via its anti-phagocytic activity, upregulation of its expression upon oxidative stress and its involvement in increased secretion of PrsA as a cell death inducer and proinflammatory effector. PMID:27995095

  19. Dipeptidyl peptidase IV activity and/or structure homologs: Contributing factors in the pathogenesis of rheumatoid arthritis?

    PubMed Central

    Sedo, Aleksi; Duke-Cohan, Jonathan S; Balaziova, Eva; Sedova, Liliana R

    2005-01-01

    Several of the proinflammatory peptides involved in rheumatoid arthritis pathogenesis, including peptides induced downstream of tumor necrosis factor-α as well as the monocyte/T cell-attracting chemokines RANTES and stromal cell-derived factor (SDF)-1α and the neuropeptides vasoactive intestinal peptide (VIP) and substance P, have their biological half-lives controlled by dipeptidyl peptidase IV (DPPIV). Proteolysis by DPPIV regulates not only the half-life but also receptor preference and downstream signaling. In this article, we examine the role of DPPIV homologs, including CD26, the canonical DPPIV, and their substrates in the pathogenesis of rheumatoid arthritis. The differing specific activities of the DPPIV family members and their differential inhibitor response provide new insights into therapeutic design. PMID:16277701

  20. Solution Structure of Homology Region (HR) Domain of Type II Secretion System*

    PubMed Central

    Gu, Shuang; Kelly, Geoff; Wang, Xiaohui; Frenkiel, Tom; Shevchik, Vladimir E.; Pickersgill, Richard W.

    2012-01-01

    The type II secretion system of Gram-negative bacteria is important for bacterial pathogenesis and survival; it is composed of 12 mostly multimeric core proteins, which build a sophisticated secretion machine spanning both bacterial membranes. OutC is the core component of the inner membrane subcomplex thought to be involved in both recognition of substrate and interaction with the outer membrane secretin OutD. Here, we report the solution structure of the HR domain of OutC and explore its interaction with the secretin. The HR domain adopts a β-sandwich-like fold consisting of two β-sheets each composed of three anti-parallel β-strands. This structure is strikingly similar to the periplasmic region of PilP, an inner membrane lipoprotein from the type IV pilus system highlighting the common evolutionary origin of these two systems and showing that all the core components of the type II secretion system have a structural or sequence ortholog within the type IV pili system. The HR domain is shown to interact with the N0 domain of the secretin. The importance of this interaction is explored in the context of the functional secretion system. PMID:22253442

  1. Novel degenerative and developmental defects in a zebrafish model of mucolipidosis type IV

    PubMed Central

    Li, Huiqing; Pei, Wuhong; Vergarajauregui, Sivia; Zerfas, Patricia M.; Raben, Nina; Burgess, Shawn M.; Puertollano, Rosa

    2017-01-01

    Abstract Mucolipidosis type IV (MLIV) is a lysosomal storage disease characterized by neurologic and ophthalmologic abnormalities. There is currently no effective treatment. MLIV is caused by mutations in MCOLN1, a lysosomal cation channel from the transient receptor potential (TRP) family. In this study, we used genome editing to knockout the two mcoln1 genes present in Danio rerio (zebrafish). Our model successfully reproduced the retinal and neuromuscular defects observed in MLIV patients, indicating that this model is suitable for studying the disease pathogenesis. Importantly, our model revealed novel insights into the origins and progression of the MLIV pathology, including the contribution of autophagosome accumulation to muscle dystrophy and the role of mcoln1 in embryonic development, hair cell viability and cellular maintenance. The generation of a MLIV model in zebrafish is particularly relevant given the suitability of this organism for large-scale in vivo drug screening, thus providing unprecedented opportunities for therapeutic discovery. PMID:28449103

  2. Variation in NCB5OR

    PubMed Central

    Andersen, Gitte; Wegner, Lise; Rose, Christian Schack; Xie, Jianxin; Zhu, Hao; Larade, Kevin; Johansen, Anders; Ek, Jakob; Lauenborg, Jeannet; Drivsholm, Thomas; Borch-Johnsen, Knut; Damm, Peter; Hansen, Torben; Bunn, H. Franklin; Pedersen, Oluf

    2011-01-01

    Recent data show that homozygous Ncb5or−/− knockout mice present with an early-onset nonautoimmune diabetes phenotype. Furthermore, genome-wide scans have reported linkage to the chromosome 6q14.2 region close to the human NCB5OR. We therefore considered NCB5OR to be a biological and positional candidate gene and examined the coding region of NCB5OR in 120 type 2 diabetic patients and 63 patients with maturity-onset diabetes of the young using denaturing high-performance liquid chromatography. We identified a total of 22 novel nucleotide variants. Three variants [IVS5+7del(CT), Gln187Arg, and His223Arg] were genotyped in a case-control design comprising 1,246 subjects (717 type 2 diabetic patients and 529 subjects with normal glucose tolerance). In addition, four rare variants were investigated for cosegregation with diabetes in multiplex type 2 diabetic families. The IVS5+7del (CT) variant was associated with common late-onset type 2 diabetes; however, we failed to relate this variant to any diabetes-related quantitative traits among the 529 control subjects. Thus, variation in the coding region of NCB5OR is not a major contributor in the pathogenesis of nonautoimmune diabetes. PMID:15504981

  3. Contribution of type IV pili to the virulence of Aeromonas salmonicida subsp. salmonicida in Atlantic salmon (Salmo salar L.).

    PubMed

    Boyd, Jessica M; Dacanay, Andrew; Knickle, Leah C; Touhami, Ahmed; Brown, Laura L; Jericho, Manfred H; Johnson, Stewart C; Reith, Michael

    2008-04-01

    Aeromonas salmonicida subsp. salmonicida, a bacterial pathogen of Atlantic salmon, has no visible pili, yet its genome contains genes for three type IV pilus systems. One system, Tap, is similar to the Pseudomonas aeruginosa Pil system, and a second, Flp, resembles the Actinobacillus actinomycetemcomitans Flp pilus, while the third has homology to the mannose-sensitive hemagglutinin pilus of Vibrio cholerae. The latter system is likely nonfunctional since eight genes, including the gene encoding the main pilin subunit, are deleted compared with the orthologous V. cholerae locus. The first two systems were characterized to investigate their expression and role in pathogenesis. The pili of A. salmonicida subsp. salmonicida were imaged using atomic force microscopy and Tap- and Flp-overexpressing strains. The Tap pili appeared to be polar, while the Flp pili appeared to be peritrichous. Strains deficient in tap and/or flp were used in live bacterial challenges of Atlantic salmon, which showed that the Tap pilus made a moderate contribution to virulence, while the Flp pilus made little or no contribution. Delivery of the tap mutant by immersion resulted in reduced cumulative morbidity compared with the cumulative morbidity observed with the wild-type strain; however, delivery by intraperitoneal injection resulted in cumulative morbidity similar to that of the wild type. Unlike the pili of other piliated bacterial pathogens, A. salmonicida subsp. salmonicida type IV pili are not absolutely required for virulence in Atlantic salmon. Significant differences in the behavior of the two mutant strains indicated that the two pilus systems are not redundant.

  4. Structural characterization of CFA/III and Longus type IVb pili from enterotoxigenic Escherichia coli.

    PubMed

    Kolappan, Subramaniapillai; Roos, Justin; Yuen, Alex S W; Pierce, Owen M; Craig, Lisa

    2012-05-01

    The type IV pili are helical filaments found on many Gram-negative pathogenic bacteria, with multiple diverse roles in pathogenesis, including microcolony formation, adhesion, and twitching motility. Many pathogenic enterotoxigenic Escherichia coli (ETEC) isolates express one of two type IV pili belonging to the type IVb subclass: CFA/III or Longus. Here we show a direct correlation between CFA/III expression and ETEC aggregation, suggesting that these pili, like the Vibrio cholerae toxin-coregulated pili (TCP), mediate microcolony formation. We report a 1.26-Å resolution crystal structure of CofA, the major pilin subunit from CFA/III. CofA is very similar in structure to V. cholerae TcpA but possesses a 10-amino-acid insertion that replaces part of the α2-helix with an irregular loop containing a 3(10)-helix. Homology modeling suggests a very similar structure for the Longus LngA pilin. A model for the CFA/III pilus filament was generated using the TCP electron microscopy reconstruction as a template. The unique 3(10)-helix insert fits perfectly within the gap between CofA globular domains. This insert, together with differences in surface-exposed residues, produces a filament that is smoother and more negatively charged than TCP. To explore the specificity of the type IV pilus assembly apparatus, CofA was expressed heterologously in V. cholerae by replacing the tcpA gene with that of cofA within the tcp operon. Although CofA was synthesized and processed by V. cholerae, no CFA/III filaments were detected, suggesting that the components of the type IVb pilus assembly system are highly specific to their pilin substrates.

  5. Genome Wide DNA Methylation Profiles Provide Clues to the Origin and Pathogenesis of Germ Cell Tumors

    PubMed Central

    Rijlaarsdam, Martin A.; Tax, David M. J.; Gillis, Ad J. M.; Dorssers, Lambert C. J.; Koestler, Devin C.; de Ridder, Jeroen; Looijenga, Leendert H. J.

    2015-01-01

    The cell of origin of the five subtypes (I-V) of germ cell tumors (GCTs) are assumed to be germ cells from different maturation stages. This is (potentially) reflected in their methylation status as fetal maturing primordial germ cells are globally demethylated during migration from the yolk sac to the gonad. Imprinted regions are erased in the gonad and later become uniparentally imprinted according to fetal sex. Here, 91 GCTs (type I-IV) and four cell lines were profiled (Illumina’s HumanMethylation450BeadChip). Data was pre-processed controlling for cross hybridization, SNPs, detection rate, probe-type bias and batch effects. The annotation was extended, covering snRNAs/microRNAs, repeat elements and imprinted regions. A Hidden Markov Model-based genome segmentation was devised to identify differentially methylated genomic regions. Methylation profiles allowed for separation of clusters of non-seminomas (type II), seminomas/dysgerminomas (type II), spermatocytic seminomas (type III) and teratomas/dermoid cysts (type I/IV). The seminomas, dysgerminomas and spermatocytic seminomas were globally hypomethylated, in line with previous reports and their demethylated precursor. Differential methylation and imprinting status between subtypes reflected their presumed cell of origin. Ovarian type I teratomas and dermoid cysts showed (partial) sex specific uniparental maternal imprinting. The spermatocytic seminomas showed uniparental paternal imprinting while testicular teratomas exhibited partial imprinting erasure. Somatic imprinting in type II GCTs might indicate a cell of origin after global demethylation but before imprinting erasure. This is earlier than previously described, but agrees with the totipotent/embryonic stem cell like potential of type II GCTs and their rare extra-gonadal localization. The results support the common origin of the type I teratomas and show strong similarity between ovarian type I teratomas and dermoid cysts. In conclusion, we identified specific and global methylation differences between GCT subtypes, providing insight into their developmental timing and underlying developmental biology. Data and extended annotation are deposited at GEO (GSE58538 and GPL18809). PMID:25859847

  6. [Proposal for the classification of the periprosthetic membrane from loosened hip and knee endoprostheses].

    PubMed

    Morawietz, L; Gehrke, Th; Classen, R-A; Barden, B; Otto, M; Hansen, T; Aigner, Th; Stiehl, P; Neidel, J; Schröder, J H; Frommelt, L; Schubert, Th; Meyer-Scholten, C; König, A; Ströbel, Ph; Rader, Ch P; Kirschner, S; Lintner, F; Rüther, W; Skwara, A; Bos, I; Kriegsmann, J; Krenn, V

    2004-09-01

    After 10 years, loosening of total joint endoprostheses occurs in about 3 to 10 percent of all patients, requiring elaborate revision surgery. A periprosthetic membrane is routinely found between bone and loosened prosthesis. Further histomorphological examination allows determination of the etiology of the loosening process. Aim of this study is the introduction of clearly defined histopathological criteria for a standardized evaluation of the periprosthetic membrane. Based on histomorphological criteria and polarized light microscopy, four types of the periprosthetic membrane were defined: periprosthetic membrane of wear particle type (type I), periprosthetic membrane of infectious type (type II), periprosthetic membrane of combined type (type III), periprosthetic membrane of indifferent type (type IV). Periprosthetic membranes of 268 patients were analyzed according to the defined criteria. The correlation between histopathological and microbiological diagnosis was high (89%, p<0,001), the inter-observer reproducibility was sufficient (95%). This classification system enables a standardized diagnostic procedure and therefore is a basis for further studies concerning the etiology of and pathogenesis of prosthesis loosening.

  7. A review of natural-rubber latex allergy in health care workers.

    PubMed

    Ranta, Peter M; Ownby, Dennis R

    2004-01-15

    This brief review of natural-rubber latex (NRL) allergy in health care workers (HCWs) includes the definition of NRL allergy and data on its epidemiology, pathogenesis, diagnostic algorithm, management, long-term outcomes, economic impact, cost-effectiveness of changing facilities to a latex-free environment, and prevention. The data presented suggest that an individual with type I or type IV hypersensitivity to NRL should be able to continue to work in the workplace with careful evaluation and reasonable accommodations. Reducing exposure to latex is a safe and more economical alternative to complete removal of the individual from the place of employment. The use of low-allergen, nonpowdered NRL gloves substantially reduces airborne exposure to latex in most health care settings.

  8. Endoglin (CD105) expression differentiates between aseptic loosening and periprosthetic joint infection after total joint arthroplasty.

    PubMed

    Jansen, Philipp; Mumme, Torsten; Randau, Thomas; Gravius, Sascha; Hermanns-Sachweh, Benita

    2014-01-01

    The differentiation between aseptic loosening and periprosthetic joint infection (PJI) after total joint arthroplasty is essential for successful therapy. A better understanding of pathogenesis of aseptic loosening and PJI may help to prevent or treat these complications. Previous investigations revealed an increased vascularization in the periprosthetic membrane in cases of PJI via PET signals. Based on these findings our hypothesis was that PJI is associated with an increased neovascularization in the periprosthetic membrane. Tissue samples from periprosthetic membranes of the bone-implant interface were investigated histologically for inflammation, wear particles, vascularization and fibrosis. To identify vascular structures antibodies against CD 31, CD 34, factor VIII and CD 105 (endoglin) were applied for immunohistochemical investigations. According to a consensus classification of Morawietz the tissue samples were divided into four types: type I (wear particle induced type, n = 11), type II (infectious type, n = 7), type III (combined type, n = 7) and type IV (indeterminate type, n = 7). Patients with PJI (type II) showed a pronounced infiltration of neutrophil granulocytes in the periprosthetic membrane and an enhanced neovascularization indicated by positive immunoreaction with antibodies against CD 105 (endoglin). Tissue samples classified as type I, type III and type IV showed significantly less immune reaction for CD 105. In cases of aseptic loosening and PJI vascularization is found in different expression in periprosthetic membranes. However, in aseptic loosening, there is nearly no neovascularization with CD 105-positive immune reaction. Therefore, endoglin (CD 105) expression allows for differentiation between aseptic loosening and PJI.

  9. Alport syndrome from bench to bedside: the potential of current treatment beyond RAAS blockade and the horizon of future therapies.

    PubMed

    Gross, Oliver; Perin, Laura; Deltas, Constantinos

    2014-09-01

    The hereditary type IV collagen disease Alport syndrome (AS) always leads to end-stage renal failure. Yesterday, for the past 90 years, this course was described as 'inevitable'. Today, RAAS blockade has changed the 'inevitable' course to a treatable disease. Tomorrow, researchers hope to erase the 'always' from 'always leads to renal failure' in the textbooks. This review elucidates therapeutic targets that evolve from research: (i) kidney embryogenesis and pathogenesis; (ii) phenotype-genotype correlation and the role of collagen receptors and podocytes; (iii) the malfunctioning Alport-GBM; (iv) tubulointerstitial fibrosis; (v) the role of proteinuria in pathogenesis and prognosis; and (vi) secondary events such as infections, hyperparathyroidism and hypercholesterolaemia. Therefore, moderate lifestyle, therapy of bacterial infections, Paricalcitol in adult patients with hyperparathyroidism and HMG-CoA-reductase inhibitors in adult patients with dyslipoproteinemia might contribute to a slower progression of AS and less cardiovascular events. In the future, upcoming treatments including stem cells, chaperon therapy, collagen receptor blockade and anti-microRNA therapy will expand our perspective in protecting the kidneys of Alport patients from further damage. This perspective on current and future therapies is naturally limited by our personal focus in research, but aims to motivate young scientists and clinicians to find a multimodal cure for AS. © The Author 2014. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  10. Ameliorating effect of anti-Alzheimer's drugs on the bidirectional association between type 2 diabetes mellitus and Alzheimer's disease.

    PubMed

    Ahmed, Amira S; Elgharabawy, Rehab M; Al-Najjar, Amal H

    2017-07-01

    Mild to severe forms of nervous system damage were exhibited by approximately 60-70% of diabetics. It is important to understand the association between type 2 diabetes mellitus and Alzheimer's disease. The aim of the present work is to understand the bidirectional association between type 2 diabetes and Alzheimer's disease pathogenesis, that was monitored by glycaemic status, lipid profile, amyloid beta 40 and 42 (Aβ40 and Aβ42), C-reactive protein, total creatine kinase, total lactate dehydrogenase, D-dimer and magnesium measurements, to assess the association between theses biochemical markers and each other, to estimate the possibility of utilizing the amyloid beta as biochemical marker of T2D in Alzheimer's patients, and to evaluate the effect of piracetam and memantine drugs on diabetes mellitus. This study involved 120 subjects divided into 20 healthy control (group I), 20 diabetic patients (group II), 20 Alzheimer's patients (group III), 20 diabetic Alzheimer's patients with symptomatic treatment (group IV), 20 diabetic Alzheimer's patients treated with memantine (group V), and 20 diabetic Alzheimer's patients treated with piracetam (group VI). The demographic characteristics, diabetic index, and lipid profile were monitored. Plasma amyloid beta 40 and amyloid beta 42, C-reactive protein, total creatine kinase, total lactate dehydrogenase, D-dimer, and magnesium were assayed. The levels of amyloid beta 40 and amyloid beta 42 were significantly elevated in diabetic Alzheimer's patients with symptomatic treatment (group IV) compared to group II (by 50.5 and 7.5 fold, respectively) and group III (by 25.4 and 2.8 fold, respectively). In groups II, III, IV, V and VI, significant and positive associations were monitored between insulin and amyloid beta 40, amyloid beta 42, C-reactive protein, total creatine kinase, and D-dimer. Diabetic markers were significantly decreased in diabetic Alzheimer's patients treated with anti-Alzheimer's drugs (especially piracetam) compared to group IV. This study reveals the role of amyloid beta 40, amyloid beta 42, insulin, HbA1c, lipid profile disturbance, C-reactive protein, D-dimer, and magnesium in the bidirectional correlation between T2D and pathogenesis of Alzheimer's disease, that is powered by their correlations, and therefore the possibility of utilizing Aβ as a biochemical marker of T2D in Alzheimer's patients is recommended. Impact statement Several aspects associated with T2D that contribute to AD and vice versa were investigated in this study. Additionally, this work reveals the role of Aβ40, Aβ42, insulin, HbA1c, lipid profile disturbance, CRP, D-dimer, and magnesium in the bidirectional association between T2D and the pathogenesis of AD, that is powered by their correlations, and therefore the possibility of utilizing Aβ as a biochemical marker of T2D in Alzheimer's patients is recommended. Furthermore, the ameloriating effect of anti-Alzheimer's drugs on diabetes mellitus confirms this association. Hereafter, a new approach for treating insulin resistance and diabetes may be developed by new therapeutic potentials such as neutralization of Aβ by anti-Aβ antibodies.

  11. Role for transforming growth factor-beta1 in alport renal disease progression.

    PubMed

    Sayers, R; Kalluri, R; Rodgers, K D; Shield, C F; Meehan, D T; Cosgrove, D

    1999-11-01

    Alport syndrome results from mutations in either the alpha3(IV), alpha4(IV), or alpha5(IV) collagen genes. The disease is characterized by a progressive glomerulonephritis usually associated with a high-frequency sensorineural hearing loss. A mouse model for an autosomal form of Alport syndrome [collagen alpha3(IV) knockout] was produced and characterized. In this study, the model was exploited to demonstrate a potential role for transforming growth factor-beta1 (TGF-beta1) in Alport renal disease pathogenesis. Kidneys from normal and Alport mice, taken at different stages during the course of renal disease progression, were analyzed by Northern blot, in situ hybridization, and immunohistology for expression of TGF-beta1 and components of the extracellular matrix. Normal and Alport human kidney was examined for TGF-beta1 expression using RNase protection. The mRNAs encoding TGF-beta1 (in both mouse and human), entactin, fibronectin, and the collagen alpha1(IV) and alpha2(IV) chains were significantly induced in total kidney as a function of Alport renal disease progression. The induction of these specific mRNAs was observed in the glomerular podocytes of animals with advanced disease. Type IV collagen, laminin-1, and fibronectin were markedly elevated in the tubulointerstitium at 10 weeks, but not at 6 weeks, suggesting that elevated expression of specific mRNAs on Northern blots reflects events associated with tubulointerstitial fibrosis. The concomitant accumulation of mRNAs encoding TGF-beta1 and extracellular matrix components in the podocytes of diseased kidneys may reflect key events in Alport renal disease progression. These data suggest a role for TGF-beta1 in both glomerular and tubulointerstitial damage associated with Alport syndrome.

  12. Herpes Simplex Virus Infections of the Central Nervous System.

    PubMed

    Whitley, Richard J

    2015-12-01

    This article summarizes knowledge of herpes simplex virus (HSV) infections of the central nervous system (CNS). Disease pathogenesis, detection of DNA polymerase chain reaction (PCR) for diagnosis and prognosis, and approaches to therapy warrant consideration. HSV infection of the CNS is one of few treatable viral diseases. Clinical trials indicate that outcome following neonatal herpes simplex virus type 2 (HSV-2) infections of the CNS is significantly improved when 6 months of suppressive oral acyclovir therapy follows IV antiviral therapy. In contrast, herpes simplex virus type 1 (HSV-1) infections of the brain do not benefit from extended oral antiviral therapy. This implies a difference in disease pathogenesis between HSV-2 and HSV-1 infections of the brain. PCR detection of viral DNA in the CSF is the gold standard for diagnosis. Use of PCR is now being adopted as a basis for determining the duration of therapy in the newborn. HSV infections are among the most common encountered by humans; seropositivity occurs in 50% to 90% of adult populations. Herpes simplex encephalitis, however, is an uncommon result of this infection. Since no new antiviral drugs have been introduced in nearly 3 decades, much effort has focused on learning how to better use acyclovir and how to use existing databases to establish earlier diagnosis.

  13. Functional selection of a type IV pili-binding peptide that specifically inhibits Salmonella Typhi adhesion to/invasion of human monocytic cells.

    PubMed

    Wu, Hong-Yan; Zhang, Xiao-Lian; Pan, Qin; Wu, Jianguo

    2005-11-01

    Salmonella enterica serovar Typhi (S. Typhi) is an important pathogen which infects humans exclusively and causes typhoid or enteric fever. Recently it has been discovered that type IVB pili, encoded by the S. Typhi pil operon located in the major pathogenicity island, may be important in the pathogenesis of epidemic enteric fever. To further investigate the roles of type IVB pili of S. Typhi, a 12-mer peptide (RQERSSLSKPVV), binding to the structural protein PilS of the type IVB pili of S. Typhi, was isolated with a ribosome display system. This peptide was designated as peptide R. We found that peptide R inhibited adhesion to/invasion of human monocytic THP-1 cells by piliated S. Typhi bacteria, but had no effects on nonpiliated S. Typhi bacteria. A random 12-mer peptide, of size and solubility equal to peptide R, served as a control on the specificity of peptide R. The specific interaction and binding equilibrium between the 12-mer peptide R and PilS protein was determined by isothermal titration calorimetry (ITC) and a binding constant Ka determined to be between 0.4 x 10(5) and 2.2 x 10(5)L mol(-1). Our findings suggest that the type IV pili-binding peptide R holds potential as an antibacterial peptide effective against S. Typhi infections, both in terms of prevention and therapeutic treatment. The data further provide insights into the understanding of the pathogenic roles of the type IVB pili of S. Typhi.

  14. Protection and attachment of Vibrio cholerae mediated by the toxin-coregulated pilus in the infant mouse model.

    PubMed

    Krebs, Shelly J; Taylor, Ronald K

    2011-10-01

    Colonization of the human small intestine by Vibrio cholerae is an essential step in pathogenesis that requires the type IV toxin-coregulated pilus (TCP). To date, three functions of TCP have been characterized: it serves as the CTXΦ receptor, secretes the colonization factor TcpF, and functions in microcolony formation by mediating bacterium-bacterium interactions. Although type IV pili in other pathogenic bacteria have been characterized as playing a major role in attachment to epithelial cells, there are very few studies to suggest that TCP acts as an attachment factor. Taking this into consideration, we investigated the function of TCP in attachment to Caco-2 cells and found that mutants lacking TCP were defective in attachment compared to the wild type. Overexpression of ToxT, the activator of TCP, significantly increased attachment of wild-type V. cholerae to Caco-2 cells. Using field-emission scanning electron microscopy (FESEM), we also observed TCP-mediated attachment to the small intestines of infected infant mice by using antibodies specific to TCP and V. cholerae. Remarkably, we also visualized matrices comprised of TCP appearing to engulf V. cholerae during infection, and we demonstrated that these matrices protected the bacteria from a component of bile, disclosing a possible new role of this pilus in protection of the bacterial cells from antimicrobial agents. This study provides new insights into TCP's function in V. cholerae colonization of the small intestine, describing additional roles in mediating attachment and protection of V. cholerae bacterial cells.

  15. Upregulated Expression of Integrin α1 in Mesangial Cells and Integrin α3 and Vimentin in Podocytes of Col4a3-Null (Alport) Mice

    PubMed Central

    Steenhard, Brooke M.; Vanacore, Roberto; Friedman, David; Zelenchuk, Adrian; Stroganova, Larysa; Isom, Kathryn; St. John, Patricia L.; Hudson, Billy G.; Abrahamson, Dale R.

    2012-01-01

    Alport disease in humans, which usually results in proteinuria and kidney failure, is caused by mutations to the COL4A3, COL4A4, or COL4A5 genes, and absence of collagen α3α4α5(IV) networks found in mature kidney glomerular basement membrane (GBM). The Alport mouse harbors a deletion of the Col4a3 gene, which also results in the lack of GBM collagen α3α4α5(IV). This animal model shares many features with human Alport patients, including the retention of collagen α1α2α1(IV) in GBMs, effacement of podocyte foot processes, gradual loss of glomerular barrier properties, and progression to renal failure. To learn more about the pathogenesis of Alport disease, we undertook a discovery proteomics approach to identify proteins that were differentially expressed in glomeruli purified from Alport and wild-type mouse kidneys. Pairs of cy3- and cy5-labeled extracts from 5-week old Alport and wild-type glomeruli, respectively, underwent 2-dimensional difference gel electrophoresis. Differentially expressed proteins were digested with trypsin and prepared for mass spectrometry, peptide ion mapping/fingerprinting, and protein identification through database searching. The intermediate filament protein, vimentin, was upregulated ∼2.5 fold in Alport glomeruli compared to wild-type. Upregulation was confirmed by quantitative real time RT-PCR of isolated Alport glomeruli (5.4 fold over wild-type), and quantitative confocal immunofluorescence microscopy localized over-expressed vimentin specifically to Alport podocytes. We next hypothesized that increases in vimentin abundance might affect the basement membrane protein receptors, integrins, and screened Alport and wild-type glomeruli for expression of integrins likely to be the main receptors for GBM type IV collagen and laminin. Quantitative immunofluorescence showed an increase in integrin α1 expression in Alport mesangial cells and an increase in integrin α3 in Alport podocytes. We conclude that overexpression of mesangial integrin α1 and podocyte vimentin and integrin α3 may be important features of glomerular Alport disease, possibly affecting cell-signaling, cell shape and cellular adhesion to the GBM. PMID:23236390

  16. Pathogenesis and Immunobiology of Brucellosis

    PubMed Central

    de Figueiredo, Paul; Ficht, Thomas A.; Rice-Ficht, Allison; Rossetti, Carlos A.; Adams, L. Garry

    2016-01-01

    This review of Brucella–host interactions and immunobiology discusses recent discoveries as the basis for pathogenesis-informed rationales to prevent or treat brucellosis. Brucella spp., as animal pathogens, cause human brucellosis, a zoonosis that results in worldwide economic losses, human morbidity, and poverty. Although Brucella spp. infect humans as an incidental host, 500,000 new human infections occur annually, and no patient-friendly treatments or approved human vaccines are reported. Brucellae display strong tissue tropism for lymphoreticular and reproductive systems with an intracellular lifestyle that limits exposure to innate and adaptive immune responses, sequesters the organism from the effects of antibiotics, and drives clinical disease manifestations and pathology. Stealthy brucellae exploit strategies to establish infection, including i) evasion of intracellular destruction by restricting fusion of type IV secretion system-dependent Brucella-containing vacuoles with lysosomal compartments, ii) inhibition of apoptosis of infected mononuclear cells, and iii) prevention of dendritic cell maturation, antigen presentation, and activation of naive T cells, pathogenesis lessons that may be informative for other intracellular pathogens. Data sets of next-generation sequences of Brucella and host time-series global expression fused with proteomics and metabolomics data from in vitro and in vivo experiments now inform interactive cellular pathways and gene regulatory networks enabling full-scale systems biology analysis. The newly identified effector proteins of Brucella may represent targets for improved, safer brucellosis vaccines and therapeutics. PMID:25892682

  17. Protein Kinase LegK2 Is a Type IV Secretion System Effector Involved in Endoplasmic Reticulum Recruitment and Intracellular Replication of Legionella pneumophila ▿

    PubMed Central

    Hervet, Eva; Charpentier, Xavier; Vianney, Anne; Lazzaroni, Jean-Claude; Gilbert, Christophe; Atlan, Danièle; Doublet, Patricia

    2011-01-01

    Legionella pneumophila is the etiological agent of Legionnaires' disease. Crucial to the pathogenesis of this intracellular pathogen is its ability to subvert host cell defenses, permitting intracellular replication in specialized vacuoles within host cells. The Dot/Icm type IV secretion system (T4SS), which translocates a large number of bacterial effectors into host cell, is absolutely required for rerouting the Legionella phagosome. Many Legionella effectors display distinctive eukaryotic domains, among which are protein kinase domains. In silico analysis and in vitro phosphorylation assays identified five functional protein kinases, LegK1 to LegK5, encoded by the epidemic L. pneumophila Lens strain. Except for LegK5, the Legionella protein kinases are all T4SS effectors. LegK2 plays a key role in bacterial virulence, as demonstrated by gene inactivation. The legK2 mutant containing vacuoles displays less-efficient recruitment of endoplasmic reticulum markers, which results in delayed intracellular replication. Considering that a kinase-dead substitution mutant of legK2 exhibits the same virulence defects, we highlight here a new molecular mechanism, namely, protein phosphorylation, developed by L. pneumophila to establish a replicative niche and evade host cell defenses. PMID:21321072

  18. Attenuation of the Type IV Pilus Retraction Motor Influences Neisseria gonorrhoeae Social and Infection Behavior.

    PubMed

    Hockenberry, Alyson M; Hutchens, Danielle M; Agellon, Al; So, Magdalene

    2016-12-06

    Retraction of the type IV pilus (Tfp) mediates DNA uptake, motility, and social and infection behavior in a wide variety of prokaryotes. To date, investigations into Tfp retraction-dependent activities have used a mutant deleted of PilT, the ATPase motor protein that causes the pilus fiber to retract. ΔpilT cells are nontransformable, nonmotile, and cannot aggregate into microcolonies. We tested the hypothesis that these retraction-dependent activities are sensitive to the strength of PilT enzymatic activity by using the pathogen Neisseria gonorrhoeae as a model. We constructed an N. gonorrhoeae mutant with an amino acid substitution in the PilT Walker B box (a substitution of cysteine for leucine at position 201, encoded by pilT L201C ). Purified PilT L201C forms a native hexamer, but mutant hexamers hydrolyze ATP at half the maximal rate. N. gonorrhoeae pilT L201C cells produce Tfp fibers, crawl at the same speed as the wild-type (wt) parent, and are equally transformable. However, the social behavior of pilT L201C cells is intermediate between the behaviors of wt and ΔpilT cells. The infection behavior of pilT L201C is also defective, due to its failure to activate the epidermal growth factor receptor (EGFR)-heparin-binding EGF-like growth factor (HB-EGF) pathway. Our study indicates that pilus retraction, per se, is not sufficient for N. gonorrhoeae microcolony formation or infectivity; rather, these activities are sensitive to the strength of PilT enzymatic activity. We discuss the implications of these findings for Neisseria pathogenesis in the context of mechanobiology. Type IV pili are fibers expressed on the surface of many bacteria. Neisseria gonorrhoeae cells crawl, take up DNA, and communicate with each other and with human cells by retracting these fibers. Here, we show that an N. gonorrhoeae mutant expressing an enzymatically weakened type IV pilus retraction motor still crawls and takes up DNA normally. However, mutant cells exhibit abnormal social behavior, and they are less infective because they fail to activate the epidermal growth factor receptor. Our study shows that N. gonorrhoeae social and infection behaviors are sensitive to the strength of the retraction motor enzyme. Copyright © 2016 Hockenberry et al.

  19. Behcet disease combined with Sjogren syndrome: A unique case report and literature review.

    PubMed

    Ju, Fang-He; Xu, Ting-Zhen; Hong, Hui-Hua; Mao, He; Wang, Meng; Wang, Zhen

    2018-03-01

    Behcet disease(BD) and Sjogren syndrome(SS) are separate conditions that rarely concomitantly affect an individual. In theory,mild symptoms of patients with BD or SS are easy to igore and,thus,remain undiagnosed. There,it is reasonable to believe there may be some clinical cases of combined diseases that go undiscovered and which needs to be taken seriously. In addition,it has been suggested that herpes simplex virus(HSV) types 1 and 2 are associated with BD,but have not been shown to be correlated to the direct pathogenesis of BD. The role of HSV in BD needs more research and attention. Here,we report a young woman who had both BD and SS. The first symptom of the disease was fever. However,the HSV type 1 IgG and HSV type 2 IgM antibody results were positive in our case and,which rendered this case unique. BD and SS concomitantly affect the individual,and BD was the acute type. IV methylprednisolone was used for 9 days and then oral glucocorticoids was used to instead,and the treatment works very well. BD and SS can concomitantly affect an individual,and we believe that HSV-2 may be directly related to the pathogenesis of BD. The nature of BD as an auto-inflammatory disorder, autoimmune disorder, or both, is controversial. If we can find more patients who combined affected these two disease, it might helpful for us to understand the nature of BD. For patients with clinical diagnosis of BD or SS,we need to be alert that it may combinded the other disease. Long term follow up and detailed inspection are important means to avoid undiscovered.

  20. A streamlined method for transposon mutagenesis of Rickettsia parkeri yields numerous mutations that impact infection.

    PubMed

    Lamason, Rebecca L; Kafai, Natasha M; Welch, Matthew D

    2018-01-01

    The rickettsiae are obligate intracellular alphaproteobacteria that exhibit a complex infectious life cycle in both arthropod and mammalian hosts. As obligate intracellular bacteria, rickettsiae are highly adapted to living inside a variety of host cells, including vascular endothelial cells during mammalian infection. Although it is assumed that the rickettsiae produce numerous virulence factors that usurp or disrupt various host cell pathways, they have been challenging to genetically manipulate to identify the key bacterial factors that contribute to infection. Motivated to overcome this challenge, we sought to expand the repertoire of available rickettsial loss-of-function mutants, using an improved mariner-based transposon mutagenesis scheme. Here, we present the isolation of over 100 transposon mutants in the spotted fever group species Rickettsia parkeri. Transposon insertions disrupted genes whose products are implicated in a variety of pathways, including bacterial replication and metabolism, the type IV secretion system, factors with previously established roles in host cell interactions and pathogenesis, or are of unknown function. Given the need to identify critical virulence factors, forward genetic screens such as this will provide an excellent platform to more directly investigate rickettsial biology and pathogenesis.

  1. Comprehensive overview of prostatitis.

    PubMed

    Khan, Farhan Ullah; Ihsan, Awais Ullah; Khan, Hidayat Ullah; Jana, Ruby; Wazir, Junaid; Khongorzul, Puregmaa; Waqar, Muhammad; Zhou, Xiaohui

    2017-10-01

    Prostatitis is a common urinary tract syndrome that many doctors find problematic to treat effectively. It is the third most commonly found urinary tract disease in men after prostate cancer and Benign Prostate Hyperplasia (BPH). Prostatitis may account for 25% of all office visits made to the urological clinics complaining about the genital and urinary systems all over the world. In the present study, we classified prostatitis and comprehensively elaborated the etiology, pathogenesis, diagnosis, and treatment of acute bacterial prostatitis (category I), chronic bacterial prostatitis (category II), chronic pelvic pain syndrome (CPPS) (category III), and asymptomatic prostatitis (category IV). In addition, we also tried to get some insights about other types of prostatitis-like fungal, viral and gonococcal prostatitis. The aim of this review is to present the detail current perspective of prostatitis in a single review. To the best of our knowledge currently, there is not a single comprehensive review, which can completely elaborate this important topic in an effective way. Furthermore, this review will provide a solid platform to conduct future studies on different aspects such as risk factors, mechanism of pathogenesis, proper diagnosis, and rational treatment plans for fungal, viral, and gonococcal prostatitis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. Pathogenesis and immunobiology of brucellosis: review of Brucella-host interactions.

    PubMed

    de Figueiredo, Paul; Ficht, Thomas A; Rice-Ficht, Allison; Rossetti, Carlos A; Adams, L Garry

    2015-06-01

    This review of Brucella-host interactions and immunobiology discusses recent discoveries as the basis for pathogenesis-informed rationales to prevent or treat brucellosis. Brucella spp., as animal pathogens, cause human brucellosis, a zoonosis that results in worldwide economic losses, human morbidity, and poverty. Although Brucella spp. infect humans as an incidental host, 500,000 new human infections occur annually, and no patient-friendly treatments or approved human vaccines are reported. Brucellae display strong tissue tropism for lymphoreticular and reproductive systems with an intracellular lifestyle that limits exposure to innate and adaptive immune responses, sequesters the organism from the effects of antibiotics, and drives clinical disease manifestations and pathology. Stealthy brucellae exploit strategies to establish infection, including i) evasion of intracellular destruction by restricting fusion of type IV secretion system-dependent Brucella-containing vacuoles with lysosomal compartments, ii) inhibition of apoptosis of infected mononuclear cells, and iii) prevention of dendritic cell maturation, antigen presentation, and activation of naive T cells, pathogenesis lessons that may be informative for other intracellular pathogens. Data sets of next-generation sequences of Brucella and host time-series global expression fused with proteomics and metabolomics data from in vitro and in vivo experiments now inform interactive cellular pathways and gene regulatory networks enabling full-scale systems biology analysis. The newly identified effector proteins of Brucella may represent targets for improved, safer brucellosis vaccines and therapeutics. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  3. Serum quantitative proteomic analysis reveals potential zinc-associated biomarkers for nonbacterial prostatitis.

    PubMed

    Yang, Xiaoli; Li, Hongtao; Zhang, Chengdong; Lin, Zhidi; Zhang, Xinhua; Zhang, Youjie; Yu, Yanbao; Liu, Kun; Li, Muyan; Zhang, Yuening; Lv, Wenxin; Xie, Yuanliang; Lu, Zheng; Wu, Chunlei; Teng, Ruobing; Lu, Shaoming; He, Min; Mo, Zengnan

    2015-10-01

    Prostatitis is one of the most common urological problems afflicting adult men. The etiology and pathogenesis of nonbacterial prostatitis, which accounts for 90-95% of cases, is largely unknown. As serum proteins often indicate the overall pathologic status of patients, we hypothesized that protein biomarkers of prostatitis might be identified by comparing the serum proteomes of patients with and without nonbacterial prostatitis. All untreated samples were collected from subjects attending the Fangchenggang Area Male Health and Examination Survey (FAMHES). We profiled pooled serum samples from four carefully selected groups of patients (n = 10/group) representing the various categories of nonbacterial prostatitis (IIIa, IIIb, and IV) and matched healthy controls using a mass spectrometry-based 4-plex iTRAQ proteomic approach. More than 160 samples were validated by ELISA. Overall, 69 proteins were identified. Among them, 42, 52, and 37 proteins were identified with differential expression in Category IIIa, IIIb, and IV prostatitis, respectively. The 19 common proteins were related to immunity and defense, ion binding, transport, and proteolysis. Two zinc-binding proteins, superoxide dismutase 3 (SOD3), and carbonic anhydrase I (CA1), were significantly higher in all types of prostatitis than in the control. A receiver operating characteristic curve estimated sensitivities of 50.4 and 68.1% and specificities of 92.1 and 83.8% for CA1 and SOD3, respectively, in detecting nonbacterial prostatitis. The serum CA1 concentration was inversely correlated to the zinc concentration in expressed-prostatic secretions. Our findings suggest that SOD3 and CA1 are potential diagnostic markers of nonbacterial prostatitis, although further large-scale studies are required. The molecular profiles of nonbacterial prostatitis pathogenesis may lay a foundation for discovery of new therapies. © 2015 Wiley Periodicals, Inc.

  4. Streptococcus agalactiae impairs cerebral bioenergetics in experimentally infected silver catfish.

    PubMed

    Baldissera, Matheus D; Souza, Carine F; Parmeggiani, Belisa S; Santos, Roberto C V; Leipnitz, Guilhian; Moreira, Karen L S; da Rocha, Maria Izabel U M; da Veiga, Marcelo L; Baldisserotto, Bernardo

    2017-10-01

    It is becoming evident that bacterial infectious diseases affect brain energy metabolism, where alterations of enzymatic complexes of the mitochondrial respiratory chain and creatine kinase (CK) lead to an impairment of cerebral bioenergetics which contribute to disease pathogenesis in the central nervous system (CNS). Based on this evidence, the aim of this study was to evaluate whether alterations in the activity of complex IV of the respiratory chain and CK contribute to impairment of cerebral bioenergetics during Streptococcus agalactiae infection in silver catfish (Rhamdia quelen). The activity of complex IV of the respiratory chain in brain increased, while the CK activity decreased in infected animals compared to uninfected animals. Brain histopathology revealed inflammatory demyelination, gliosis of the brain and intercellular edema in infected animals. Based on this evidence, S. agalactiae infection causes an impairment in cerebral bioenergetics through the augmentation of complex IV activity, which may be considered an adaptive response to maintain proper functioning of the electron respiratory chain, as well as to ensure ongoing electron flow through the electron transport chain. Moreover, inhibition of cerebral CK activity contributes to lower availability of ATP, contributing to impairment of cerebral energy homeostasis. In summary, these alterations contribute to disease pathogenesis linked to the CNS. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Disruption of fibronectin matrix affects type IV collagen, fibrillin and laminin deposition into extracellular matrix of human trabecular meshwork (HTM) cells.

    PubMed

    Filla, Mark S; Dimeo, Kaylee D; Tong, Tiegang; Peters, Donna M

    2017-12-01

    Fibronectin fibrils are a major component of the extracellular matrix (ECM) of the trabecular meshwork (TM). They are a key mediator of the formation of the ECM which controls aqueous humor outflow and contributes to the pathogenesis of glaucoma. The purpose of this work was to determine if a fibronectin-binding peptide called FUD, derived from the Streptococcus pyogenes Functional Upstream Domain of the F1 adhesin protein, could be used to control fibronectin fibrillogenesis and hence ECM formation under conditions where its expression was induced by treatment with the glucocorticoid dexamethasone. FUD was very effective at preventing fibronectin fibrillogenesis in the presence or absence of steroid treatment as well as the removal of existing fibronectin fibrils. Disruption of fibronectin fibrillogenesis by FUD also disrupted the incorporation of type IV collagen, laminin and fibrillin into the ECM. The effect of FUD on these other protein matrices, however, was found to be dependent upon the maturity of the ECM when FUD was added. FUD effectively disrupted the incorporation of these other proteins into matrices when added to newly confluent cells that were forming a nascent ECM. In contrast, FUD had no effect on these other protein matrices if the cell cultures already possessed a pre-formed, mature ECM. Our studies indicate that FUD can be used to control fibronectin fibrillogenesis and that these fibrils play a role in regulating the assembly of other ECM protein into matrices involving type IV collagen, laminin, and fibrillin within the TM. This suggests that under in vivo conditions, FUD would selectively disrupt fibronectin fibrils and de novo assembly of other proteins into the ECM. Finally, our studies suggest that targeting fibronectin fibril assembly may be a viable treatment for POAG as well as other glaucomas involving excessive or abnormal matrix deposition of the ECM. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Ecological fitness and strategies of adaptation of Bartonella species to their hosts and vectors☆

    PubMed Central

    Chomel, Bruno B.; Boulouis, Henri-Jean; Breitschwerdt, Edward B.; Kasten, Rickie W.; Vayssier-Taussat, Muriel; Birtles, Richard J.; Koehler, Jane E.; Dehio, Christoph

    2009-01-01

    Bartonella spp. are facultative intracellular bacteria that cause characteristic host-restricted hemotropic infections in mammals and are typically transmitted by blood-sucking arthropods. In the mammalian reservoir, these bacteria initially infect a yet unrecognized primary niche, which seeds organisms into the blood stream leading to the establishment of a long-lasting intra-erythrocytic bacteremia as the hall-mark of infection. Bacterial type IV secretion systems, which are supra-molecular transporters ancestrally related to bacterial conjugation systems, represent crucial pathogenicity factors that have contributed to a radial expansion of the Bartonella lineage in nature by facilitating adaptation to unique mammalian hosts. On the molecular level, the type IV secretion system VirB/VirD4 is known to translocate a cocktail of different effector proteins into host cells, which subvert multiple cellular functions to the benefit of the infecting pathogen. Furthermore, bacterial adhesins mediate a critical, early step in the pathogenesis of the bartonellae by binding to extracellular matrix components of host cells, which leads to firm bacterial adhesion to the cell surface as a prerequisite for the efficient translocation of type IV secretion effector proteins. The best-studied adhesins in bartonellae are the orthologous trimeric autotransporter adhesins, BadA in Bartonella henselae and the Vomp family in Bartonella quintana. Genetic diversity and strain variability also appear to enhance the ability of bartonellae to invade not only specific reservoir hosts, but also accidental hosts, as shown for B. henselae. Bartonellae have been identified in many different blood-sucking arthropods, in which they are typically found to cause extracellular infections of the mid-gut epithelium. Adaptation to specific vectors and reservoirs seems to be a common strategy of bartonellae for transmission and host diversity. However, knowledge regarding arthropod specificity/restriction, the mode of transmission, and the bacterial factors involved in arthropod infection and transmission is still limited. PMID:19284965

  7. Molecular Pathogenesis of Chlamydia Disease Complications: Epithelial-Mesenchymal Transition and Fibrosis.

    PubMed

    Igietseme, Joseph U; Omosun, Yusuf; Nagy, Tamas; Stuchlik, Olga; Reed, Matthew S; He, Qing; Partin, James; Joseph, Kahaliah; Ellerson, Debra; George, Zenas; Goldstein, Jason; Eko, Francis O; Bandea, Claudiu; Pohl, Jan; Black, Carolyn M

    2018-01-01

    The reproductive system complications of genital chlamydial infection include fallopian tube fibrosis and tubal factor infertility. However, the molecular pathogenesis of these complications remains poorly understood. The induction of pathogenic epithelial-mesenchymal transition (EMT) through microRNA (miRNA) dysregulation was recently proposed as the pathogenic basis of chlamydial complications. Focusing on fibrogenesis, we investigated the hypothesis that chlamydia-induced fibrosis is caused by EMT-driven generation of myofibroblasts, the effector cells of fibrosis that produce excessive extracellular matrix (ECM) proteins. The results revealed that the targets of a major category of altered miRNAs during chlamydial infection are key components of the pathophysiological process of fibrogenesis; these target molecules include collagen types I, III, and IV, transforming growth factor β (TGF-β), TGF-β receptor 1 (TGF-βR1), connective tissue growth factor (CTGF), E-cadherin, SRY-box 7 (SOX7), and NFAT (nuclear factor of activated T cells) kinase dual-specificity tyrosine (Y) phosphorylation-regulated kinase 1a (Dyrk1a). Chlamydial induction of EMT resulted in the generation of α-smooth muscle actin (α-SMA)-positive myofibroblasts that produced ECM proteins, including collagen types I and III and fibronectin. Furthermore, the inhibition of EMT prevented the generation of myofibroblasts and production of ECM proteins during chlamydial infection. These findings may provide useful avenues for targeting EMT or specific components of the EMT pathways as a therapeutic intervention strategy to prevent chlamydia-related complications. Copyright © 2017 American Society for Microbiology.

  8. Endothelin-1 Mediated Induction of Extracellular Matrix Genes in Strial Marginal Cells Underlies Strial Pathology in Alport Mice

    PubMed Central

    Meehan, Daniel T.; Delimont, Duane; Dufek, Brianna; Zallocchi, Marisa; Phillips, Grady; Gratton, Michael Anne; Cosgrove, Dominic

    2016-01-01

    Alport syndrome, a type IV collagen disorder, manifests as glomerular disease associated with hearing loss with thickening of the glomerular and strial capillary basement membranes (SCBMs). We have identified a role for endothelin-1 (ET-1) activation of endothelin A receptors (ETARs) in glomerular pathogenesis. Here we explore whether ET-1 plays a role in strial pathology. Wild type (WT) and Alport mice were treated with the ETAR antagonist, sitaxentan. The stria vascularis was analyzed for SCBM thickness and for extracellular matrix (ECM) proteins. Additional WT and Alport mice were exposed to noise or hypoxia and the stria analyzed for hypoxia-related and ECM genes. A strial marginal cell line cultured under hypoxic conditions, or stimulated with ET-1 was analyzed for expression of hypoxia-related and ECM transcripts. Noise exposure resulted in significantly elevated ABR thresholds in Alport mice relative to wild type littermates. Alport stria showed elevated expression of collagen α1(IV), laminin α2, and laminin α5 proteins relative to WT. SCBM thickening and elevated ECM protein expression was ameliorated by ETAR blockade. Stria from normoxic Alport mice and hypoxic WT mice showed upregulation of hypoxia-related, ECM, and ET-1 transcripts. Both ET-1 stimulation and hypoxia up-regulated ECM transcripts in cultured marginal cells. We conclude that ET-1 mediated activation of ETARs on strial marginal cells results in elevated expression of ECM genes and thickening of the SCBMs in Alport mice. SCBM thickening results in hypoxic stress further elevating ECM and ET-1 gene expression, exacerbating strial pathology. PMID:27553900

  9. Type IV Effector Proteins Involved in the Medicago-Sinorhizobium Symbiosis.

    PubMed

    Nelson, Matthew S; Chun, Chan Lan; Sadowsky, Michael J

    2017-01-01

    In this study, we investigated genetic elements of the type IV secretion system (T4SS) found in Sinorhizobium spp. and the role they play in symbiosis. Sinorhizobium meliloti and S. medicae each contain a putative T4SS similar to that used by Agrobacterium tumefaciens during pathogenesis. The Cre reporter assay for translocation system was used to validate potential effector proteins. Both S. meliloti and S. medicae contained the effector protein TfeA, which was translocated into the host plant. Sequence analysis revealed the presence of a nod box involved in transcriptional activation of symbiosis-related genes, upstream of the transcriptional regulator (virG) in the Sinorhizobium T4SS. Replicate quantitative reverse transcription-polymerase chain reaction analyses indicated that luteolin, released by roots and seeds of Medicago truncatula, upregulated transcription of tfeA and virG. Mutations in the T4SS apparatus or tfeA alone resulted in reduced numbers of nodules formed on M. truncatula genotypes. In addition, S. meliloti KH46c, which contains a deletion in the T4SS, was less competitive for nodule formation when coinoculated with an equal number of cells of the wild-type strain. To our knowledge, TfeA is the first T4SS effector protein identified in Sinorhizobium spp. Our results indicate that Sinorhizobium i) uses a T4SS during initiation of symbiosis with Medicago spp., and ii) alters Medicago cells in planta during symbiosis. This study also offers additional bioinformatic evidence that several different rhizobial species may use the T4SS in symbiosis with other legumes.

  10. Promotion and Rescue of Intracellular Brucella neotomae Replication during Coinfection with Legionella pneumophila.

    PubMed

    Kang, Yoon-Suk; Kirby, James E

    2017-05-01

    We established a new Brucella neotomae in vitro model system for study of type IV secretion system-dependent (T4SS) pathogenesis in the Brucella genus. Importantly, B. neotomae is a rodent pathogen, and unlike B. abortus , B. melitensis , and B. suis , B. neotomae has not been observed to infect humans. It therefore can be handled more facilely using biosafety level 2 practices. More particularly, using a series of novel fluorescent protein and lux operon reporter systems to differentially label pathogens and track intracellular replication, we confirmed T4SS-dependent intracellular growth of B. neotomae in macrophage cell lines. Furthermore, B. neotomae exhibited early endosomal (LAMP-1) and late endoplasmic reticulum (calreticulin)-associated phagosome maturation. These findings recapitulate prior observations for human-pathogenic Brucella spp. In addition, during coinfection experiments with Legionella pneumophila , we found that defective intracellular replication of a B. neotomae T4SS virB4 mutant was rescued and baseline levels of intracellular replication of wild-type B. neotomae were significantly stimulated by coinfection with wild-type but not T4SS mutant L. pneumophila Using confocal microscopy, it was determined that intracellular colocalization of B. neotomae and L. pneumophila was required for rescue and that colocalization came at a cost to L. pneumophila fitness. These findings were not completely expected based on known temporal and qualitative differences in the intracellular life cycles of these two pathogens. Taken together, we have developed a new system for studying in vitro Brucella pathogenesis and found a remarkable T4SS-dependent interplay between Brucella and Legionella during macrophage coinfection. Copyright © 2017 American Society for Microbiology.

  11. CXCL4 Contributes to the Pathogenesis of Chronic Liver Allograft Dysfunction

    PubMed Central

    Li, Jing; Shi, Yuan; Xie, Ke-Liang; Yin, Hai-Fang; Yan, Lu-nan; Lau, Wan-yee; Wang, Guo-Lin

    2016-01-01

    Chronic liver allograft dysfunction (CLAD) remains the most common cause of patient morbidity and allograft loss in liver transplant patients. However, the pathogenesis of CLAD has not been completely elucidated. By establishing rat CLAD models, in this study, we identified the informative CLAD-associated genes using isobaric tags for relative and absolute quantification (iTRAQ) proteomics analysis and validated these results in recipient rat liver allografts. CXCL4, CXCR3, EGFR, JAK2, STAT3, and Collagen IV were associated with CLAD pathogenesis. We validated that CXCL4 is upstream of these informative genes in the isolated hepatic stellate cells (HSC). Blocking CXCL4 protects against CLAD by reducing liver fibrosis. Therefore, our results indicated that therapeutic approaches that neutralize CXCL4, a newly identified target of fibrosis, may represent a novel strategy for preventing and treating CLAD after liver transplantation. PMID:28053995

  12. CXCL4 Contributes to the Pathogenesis of Chronic Liver Allograft Dysfunction.

    PubMed

    Li, Jing; Liu, Bin; Shi, Yuan; Xie, Ke-Liang; Yin, Hai-Fang; Yan, Lu-Nan; Lau, Wan-Yee; Wang, Guo-Lin

    2016-01-01

    Chronic liver allograft dysfunction (CLAD) remains the most common cause of patient morbidity and allograft loss in liver transplant patients. However, the pathogenesis of CLAD has not been completely elucidated. By establishing rat CLAD models, in this study, we identified the informative CLAD-associated genes using isobaric tags for relative and absolute quantification (iTRAQ) proteomics analysis and validated these results in recipient rat liver allografts. CXCL4, CXCR3, EGFR, JAK2, STAT3, and Collagen IV were associated with CLAD pathogenesis. We validated that CXCL4 is upstream of these informative genes in the isolated hepatic stellate cells (HSC). Blocking CXCL4 protects against CLAD by reducing liver fibrosis. Therefore, our results indicated that therapeutic approaches that neutralize CXCL4, a newly identified target of fibrosis, may represent a novel strategy for preventing and treating CLAD after liver transplantation.

  13. Pathogenesis of NOD Diabetes is Initiated by Reactivity to the Insulin B Chain 9–23 Epitope and Involves Functional Epitope Spreading1

    PubMed Central

    Prasad, Suchitra; Kohm, Adam P.; McMahon, Jeffrey S.; Luo, Xunrong; Miller, Stephen D.

    2012-01-01

    Type 1 diabetes (T1D) is mediated by destruction of pancreatic β cells by CD4 and CD8 T cells specific for epitopes on numerous diabetogenic autoantigens resulting in loss of glucose homeostasis. Employing antigen-specific tolerance induced by i.v. administration of syngeneic splenocytes ECDI cross-linked to various diabetogenic antigens/epitopes (Ag-SP), we show that epitope spreading plays a functional role in the pathogenesis of T1D in NOD mice. Specifically, Ag-SP coupled with intact insulin, Ins B9–23 or Ins B15–23, but not GAD65509–528, GAD65524–543 or IGRP206–214, protected 4–6 week-old NOD mice from the eventual development of clinical disease; infiltration of immune cells to the pancreatic islets; and blocked the induction of DTH responses in a Treg-dependent, antigen-specific manner. However, tolerance induction in 19–21 week-old NOD mice was effectively accomplished only by Ins-SP, suggesting Ins B9–23 is a dominant initiating epitope, but autoimmune responses to insulin epitope(s) distinct from Ins B9–23 emerge during disease progression. PMID:22647732

  14. Characterization and virulence clustering analysis of extraintestinal pathogenic Escherichia coli isolated from swine in China.

    PubMed

    Zhu, Yinchu; Dong, Wenyang; Ma, Jiale; Yuan, Lvfeng; Hejair, Hassan M A; Pan, Zihao; Liu, Guangjin; Yao, Huochun

    2017-04-08

    Swine extraintestinal pathogenic Escherichia coli (ExPEC) is an important pathogen that leads to economic and welfare costs in the swine industry worldwide, and is occurring with increasing frequency in China. By far, various virulence factors have been recognized in ExPEC. Here, we investigated the virulence genotypes and clonal structure of collected strains to improve the knowledge of phylogenetic traits of porcine ExPECs in China. We isolated 64 Chinese porcine ExPEC strains from 2013 to 14 in China. By multiplex PCR, the distribution of isolates belonging to phylogenetic groups B1, B2, A and D was 9.4%, 10.9%, 57.8% and 21.9%, respectively. Nineteen virulence-related genes were detected by PCR assay; ompA, fimH, vat, traT and iutA were highly prevalent. Virulence-related genes were remarkably more prevalent in group B2 than in groups A, B1 and D; notably, usp, cnf1, hlyD, papA and ibeA were only found in group B2 strains. Genotyping analysis was performed and four clusters of strains (named I to IV) were identified. Cluster IV contained all isolates from group B2 and Cluster IV isolates had the strongest pathogenicity in a mouse infection model. As phylogenetic group B2 and D ExPEC isolates are generally considered virulent, multilocus sequence typing (MLST) analysis was performed for these isolates to further investigate genetic relationships. Two novel sequence types, ST5170 and ST5171, were discovered. Among the nine clonal complexes identified among our group B2 and D isolates, CC12 and CC95 have been indicated to have high zoonotic pathogenicity. The distinction between group B2 and non-B2 isolates in virulence and genotype accorded with MLST analysis. This study reveals significant genetic diversity among ExPEC isolates and helps us to better understand their pathogenesis. Importantly, our data suggest group B2 (Cluster IV) strains have the highest risk of causing animal disease and illustrate the correlation between genotype and virulence.

  15. Pathogenesis of rhegmatogenous retinal detachment: predisposing anatomy and cell biology.

    PubMed

    Mitry, Danny; Fleck, Brian W; Wright, Alan F; Campbell, Harry; Charteris, David G

    2010-01-01

    The pathogenesis of rhegmatogenous retinal detachment is complex, and our knowledge of the exact mechanism of vitreoretinal attachment and detachment remains incomplete. We performed a Medline, Ovid, and EMBASE search using search words rhegmatogenous, retinal detachment, vitreous, and retinal adhesion. All appropriate articles were reviewed, and the evidence was compiled. Cortical vitreous contains fibrillar collagens type II, V/XI, and IX. The inner limiting membrane of the retina contains collagens type I, IV, VI, and XVIII as well as numerous other glycoproteins and potential adhesion molecules. The distribution and age-related changes in the structure of these molecules play an important role in the formation of a retinal break, which may compromise and disrupt the normal mechanisms of neurosensory retinal adhesion. Rhegmatogenous retinal detachment development is intimately related to changes in the fibrillar structure of the aging vitreous culminating in posterior vitreous detachment with regions of persistent and tangential vitreoretinal traction predisposing to retinal tear formation. A complex interplay of factors such as weakening of vitreoretinal adhesion, posterior migration of the vitreous base, and molecular changes at the vitreoretinal interface are important in predisposing to focal areas of vitreoretinal traction precipitating rhegmatogenous retinal detachment. Once formed, the passage of liquefied vitreous through a retinal break may overwhelm normal neurosensory-retinal pigment epithelium adhesion perpetuating and extending detachment and causing visual loss. To understand the molecular events underlying rhegmatogenous retinal detachment so that new therapies can be developed, it is important to appreciate the structural organization of the vitreous, the biology underlying vitreous liquefaction and posterior vitreous detachment, and the mechanisms of vitreoretinal attachment and detachment.

  16. Studies on the pathogenesis of fever. IV. The site of action of leucocytic and circulating endogenous pyrogen.

    PubMed

    KING, M K; WOOD, W B

    1958-02-01

    By means of a method designed to compare the febrile responses produced by intracarotid and intravenous injections, the endogenous pyrogen, which is contained in leucocytic exudates and is present in the serum of rabbits 2 hours after intravenous injections of typhoid vaccine, has been shown to act directly upon the thermoregulatory centers of the brain. In contrast, the exogenous bacterial pyrogen present in serum obtained 5 minutes after vaccine injections was found to act by a different and less direct mechanism. These observations add strong support to the original hypothesis that endogenous pyrogen, presumably derived from polymorphonuclear leucocytes, is an essential factor in the pathogenesis of endotoxin fever.

  17. Endothelin-1 mediated induction of extracellular matrix genes in strial marginal cells underlies strial pathology in Alport mice.

    PubMed

    Meehan, Daniel T; Delimont, Duane; Dufek, Brianna; Zallocchi, Marisa; Phillips, Grady; Gratton, Michael Anne; Cosgrove, Dominic

    2016-11-01

    Alport syndrome, a type IV collagen disorder, manifests as glomerular disease associated with hearing loss with thickening of the glomerular and strial capillary basement membranes (SCBMs). We have identified a role for endothelin-1 (ET-1) activation of endothelin A receptors (ET A Rs) in glomerular pathogenesis. Here we explore whether ET-1 plays a role in strial pathology. Wild type (WT) and Alport mice were treated with the ET A R antagonist, sitaxentan. The stria vascularis was analyzed for SCBM thickness and for extracellular matrix (ECM) proteins. Additional WT and Alport mice were exposed to noise or hypoxia and the stria analyzed for hypoxia-related and ECM genes. A strial marginal cell line cultured under hypoxic conditions, or stimulated with ET-1 was analyzed for expression of hypoxia-related and ECM transcripts. Noise exposure resulted in significantly elevated ABR thresholds in Alport mice relative to wild type littermates. Alport stria showed elevated expression of collagen α1(IV), laminin α2, and laminin α5 proteins relative to WT. SCBM thickening and elevated ECM protein expression was ameliorated by ET A R blockade. Stria from normoxic Alport mice and hypoxic WT mice showed upregulation of hypoxia-related, ECM, and ET-1 transcripts. Both ET-1 stimulation and hypoxia up-regulated ECM transcripts in cultured marginal cells. We conclude that ET-1 mediated activation of ET A Rs on strial marginal cells results in elevated expression of ECM genes and thickening of the SCBMs in Alport mice. SCBM thickening results in hypoxic stress further elevating ECM and ET-1 gene expression, exacerbating strial pathology. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis.

    PubMed

    Yamaoka, Yoshio

    2008-05-01

    Putative virulence genes of Helicobacter pylori are generally classified into three categories: strain-specific genes, phase-variable genes and genes with variable structures/genotypes. Among these, there has recently been considerable interest in strain-specific genes found outside of the cag pathogenicity island, especially genes in the plasticity regions. Nearly half of the strain-specific genes of H. pylori are located in the plasticity regions in strains 26695 and J99. Strain HPAG1, however, seems to lack a typical plasticity region; instead it has 43 HPAG1-specific genes which are either undetectable or incompletely represented in the genomes of strains 26695 and J99. Recent studies showed that certain genes or combination of genes in this region may play important roles in the pathogenesis of H. pylori-associated gastroduodenal diseases. Most previous studies have focused on the plasticity region in strain J99 (jhp0914-jhp0961) and the jhp0947 gene and the duodenal ulcer promoting (dupA) gene are good candidate markers for gastroduodenal diseases although there are some paradoxical findings. The jhp0947 gene is reported to be associated with an increased risk of both duodenal ulcers and gastric cancers, whereas the dupA gene, which encompasses jhp0917 and jhp0918, is reported to be associated with an increased risk of duodenal ulcers and protection against gastric cancers. In addition, recent studies showed that approximately 10-30 % of clinical isolates possess a 16.3 kb type IV secretion apparatus (tfs3) in the plasticity region. Studies on the plasticity region have only just begun, and further investigation is necessary to elucidate the roles of genes in this region in gastroduodenal pathogenesis.

  19. Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis

    PubMed Central

    Yamaoka, Yoshio

    2010-01-01

    Putative virulence genes of Helicobacter pylori are generally classified into three categories: strain-specific genes, phase-variable genes and genes with variable structures/genotypes. Among these, there has recently been considerable interest in strain-specific genes found outside of the cag pathogenicity island, especially genes in the plasticity regions. Nearly half of the strain-specific genes of H. pylori are located in the plasticity regions in strains 26695 and J99. Strain HPAG1, however, seems to lack a typical plasticity region; instead it has 43 HPAG1-specific genes which are either undetectable or incompletely represented in the genomes of strains 26695 and J99. Recent studies showed that certain genes or combination of genes in this region may play important roles in the pathogenesis of H. pylori-associated gastroduodenal diseases. Most previous studies have focused on the plasticity region in strain J99 (jhp0914–jhp0961) and the jhp0947 gene and the duodenal ulcer promoting (dupA) gene are good candidate markers for gastroduodenal diseases although there are some paradoxical findings. The jhp0947 gene is reported to be associated with an increased risk of both duodenal ulcers and gastric cancers, whereas the dupA gene, which encompasses jhp0917 and jhp0918, is reported to be associated with an increased risk of duodenal ulcers and protection against gastric cancers. In addition, recent studies showed that approximately 10–30% of clinical isolates possess a 16.3 kb type IV secretion apparatus (tfs3) in the plasticity region. Studies on the plasticity region have only just begun, and further investigation is necessary to elucidate the roles of genes in this region in gastroduodenal pathogenesis. PMID:18436586

  20. Master manipulators: an update on Legionella pneumophila Icm/Dot translocated substrates and their host targets

    PubMed Central

    Isaac, Dervla T; Isberg, Ralph

    2014-01-01

    Macrophages are the front line of immune defense against invading microbes. Microbes, however, have evolved numerous and diverse mechanisms to thwart these host immune defenses and thrive intracellularly. Legionella pneumophila, a Gram-negative pathogen of amoebal and mammalian phagocytes, is one such microbe. In humans, it causes a potentially fatal pneumonia referred to as Legionnaires' disease. Armed with the Icm/Dot type IV secretion system, which is required for virulence, and approximately 300 translocated proteins, Legionella is able to enter host cells, direct the biogenesis of its own vacuolar compartment, and establish a replicative niche, where it grows to high levels before lysing the host cell. Efforts to understand the pathogenesis of this bacterium have focused on characterizing the molecular activities of its many effectors. In this article, we highlight recent strides that have been made in understanding how Legionella effectors mediate host-pathogen interactions. PMID:24762308

  1. Mobile DNA in the pathogenic Neisseria

    PubMed Central

    Obergfell, Kyle P.; Seifert, H. Steven

    2015-01-01

    The genus Neisseria contains two pathogenic species of notable public health concern: Neisseria gonorrhoeae and Neisseria meningitidis. These pathogens display a notable ability to undergo frequent programmed recombination events. The recombination mediated pathways of transformation and pilin antigenic variation in the Neisseria are well studied systems that are critical for pathogenesis. Here we will detail the conserved and unique aspects of transformation and antigenic variation in the Neisseria. Transformation will be followed from initial DNA binding through recombination into the genome with consideration to the factors necessary at each step. Additional focus is paid to the unique type IV secretion system that mediates donation of transforming DNA in the pathogenic Neisseria. The pilin antigenic variation system uses programed recombinations to alter a major surface determinant which allows immune avoidance and promotes infection. We discuss the trans- and cis- acting factors which facilitate pilin antigenic variation and present the current understanding of the mechanisms involved in the process. PMID:25866700

  2. Extension of the classical classification of β-turns

    PubMed Central

    de Brevern, Alexandre G.

    2016-01-01

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

  3. Extension of the classical classification of β-turns.

    PubMed

    de Brevern, Alexandre G

    2016-09-15

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

  4. Differences in trauma history and psychopathology between PTSD patients with and without co-occurring dissociative disorders

    PubMed Central

    Wabnitz, Pascal; Gast, Ursula; Catani, Claudia

    2013-01-01

    Background The interplay between different types of potentially traumatizing events, posttraumatic symptoms, and the pathogenesis of PTSD or major dissociative disorders (DD) has been extensively studied during the last decade. However, the phenomenology and nosological classification of posttraumatic disorders is currently under debate. The current study was conducted to investigate differences between PTSD patients with and without co-occurring major DD with regard to general psychopathology, trauma history, and trauma-specific symptoms. Methods Twenty-four inpatients were administered the Clinician-Administered PTSD Scale for DSM-IV (CAPS) and the Mini-Structured Clinical Interview for DSM-IV Dissociative Disorders (MINI-SKID-D) to assess DD and PTSD. Additionally, participants completed questionnaires to assess general psychopathology and health status. Results Symptom profiles and axis I comorbidity were similar in all patients. Traumatic experiences did not differ between the two groups, with both reporting high levels of childhood trauma. Only trauma-specific avoidance behavior and dissociative symptoms differed between groups. Conclusion Results support the view that PTSD and DD are affiliated disorders that could be classified within the same diagnostic category. Our results accord with a typological model of dissociation in which profound forms of dissociation are specific to DD and are accompanied with higher levels of trauma-specific avoidance in DD patients. PMID:24298325

  5. Differences in trauma history and psychopathology between PTSD patients with and without co-occurring dissociative disorders.

    PubMed

    Wabnitz, Pascal; Gast, Ursula; Catani, Claudia

    2013-01-01

    The interplay between different types of potentially traumatizing events, posttraumatic symptoms, and the pathogenesis of PTSD or major dissociative disorders (DD) has been extensively studied during the last decade. However, the phenomenology and nosological classification of posttraumatic disorders is currently under debate. The current study was conducted to investigate differences between PTSD patients with and without co-occurring major DD with regard to general psychopathology, trauma history, and trauma-specific symptoms. Twenty-four inpatients were administered the Clinician-Administered PTSD Scale for DSM-IV (CAPS) and the Mini-Structured Clinical Interview for DSM-IV Dissociative Disorders (MINI-SKID-D) to assess DD and PTSD. Additionally, participants completed questionnaires to assess general psychopathology and health status. Symptom profiles and axis I comorbidity were similar in all patients. Traumatic experiences did not differ between the two groups, with both reporting high levels of childhood trauma. Only trauma-specific avoidance behavior and dissociative symptoms differed between groups. Results support the view that PTSD and DD are affiliated disorders that could be classified within the same diagnostic category. Our results accord with a typological model of dissociation in which profound forms of dissociation are specific to DD and are accompanied with higher levels of trauma-specific avoidance in DD patients.

  6. Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

    PubMed

    Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

    2017-01-01

    The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  7. AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

    PubMed

    Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

    2007-08-01

    Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

  8. [Diagnosis and treatment of gender identity disorder].

    PubMed

    Yamauchi, Toshio

    2004-02-01

    According to DSM-IV criteria, gender identity disorder(GID) is characterized as follows: 1) Strong, persistent cross-gender identification. 2) Persistent discomfort with one's assigned sex or the Sense of inappropriateness in that gender role. 3) Not due to an intersex condition. In this chapter, symptoms, diagnosis and treatment of GID are briefly described. Possible pathogenesis of GID is also discussed.

  9. [Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

    PubMed

    Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

    1985-04-01

    Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

  10. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

    PubMed

    Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

    2014-04-01

    The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

  11. Analysis of complete genome sequence of Neorickettsia risticii: causative agent of Potomac horse fever

    PubMed Central

    Lin, Mingqun; Zhang, Chunbin; Gibson, Kathryn; Rikihisa, Yasuko

    2009-01-01

    Neorickettsia risticii is an obligate intracellular bacterium of the trematodes and mammals. Horses develop Potomac horse fever (PHF) when they ingest aquatic insects containing encysted N. risticii-infected trematodes. The complete genome sequence of N. risticii Illinois consists of a single circular chromosome of 879 977 bp and encodes 38 RNA species and 898 proteins. Although N. risticii has limited ability to synthesize amino acids and lacks many metabolic pathways, it is capable of making major vitamins, cofactors and nucleotides. Comparison with its closely related human pathogen N. sennetsu showed that 758 (88.2%) of protein-coding genes are conserved between N. risticii and N. sennetsu. Four-way comparison of genes among N. risticii and other Anaplasmataceae showed that most genes are either shared among Anaplasmataceae (525 orthologs that generally associated with housekeeping functions), or specific to each genome (>200 genes that are mostly hypothetical proteins). Genes potentially involved in the pathogenesis of N. risticii were identified, including those encoding putative outer membrane proteins, two-component systems and a type IV secretion system (T4SS). The bipolar localization of T4SS pilus protein VirB2 on the bacterial surface was demonstrated for the first time in obligate intracellular bacteria. These data provide insights toward genomic potential of N. risticii and intracellular parasitism, and facilitate our understanding of PHF pathogenesis. PMID:19661282

  12. Analysis of complete genome sequence of Neorickettsia risticii: causative agent of Potomac horse fever.

    PubMed

    Lin, Mingqun; Zhang, Chunbin; Gibson, Kathryn; Rikihisa, Yasuko

    2009-10-01

    Neorickettsia risticii is an obligate intracellular bacterium of the trematodes and mammals. Horses develop Potomac horse fever (PHF) when they ingest aquatic insects containing encysted N. risticii-infected trematodes. The complete genome sequence of N. risticii Illinois consists of a single circular chromosome of 879 977 bp and encodes 38 RNA species and 898 proteins. Although N. risticii has limited ability to synthesize amino acids and lacks many metabolic pathways, it is capable of making major vitamins, cofactors and nucleotides. Comparison with its closely related human pathogen N. sennetsu showed that 758 (88.2%) of protein-coding genes are conserved between N. risticii and N. sennetsu. Four-way comparison of genes among N. risticii and other Anaplasmataceae showed that most genes are either shared among Anaplasmataceae (525 orthologs that generally associated with housekeeping functions), or specific to each genome (>200 genes that are mostly hypothetical proteins). Genes potentially involved in the pathogenesis of N. risticii were identified, including those encoding putative outer membrane proteins, two-component systems and a type IV secretion system (T4SS). The bipolar localization of T4SS pilus protein VirB2 on the bacterial surface was demonstrated for the first time in obligate intracellular bacteria. These data provide insights toward genomic potential of N. risticii and intracellular parasitism, and facilitate our understanding of PHF pathogenesis.

  13. Anti-GBM disease and ANCA during dengue infection.

    PubMed

    Lizarraga, Karlo J; Florindez, Jorge A; Daftarian, Pirouz; Andrews, David M; Ortega, Luis M; Mendoza, Jair Munoz; Contreras, Gabriel N; Nayer, Ali

    2015-02-01

    Anti-glomerular basement membrane (GBM) disease is a severe inflammatory renal disorder due to pathogenic autoantibodies directed mainly against the α3 chain of type IV collagen. In ~1/4 of patients with anti-GBM disease, antineutrophil cytoplasmic antibodies (ANCA) predominantly with myeloperoxidase (MPO) specificity can be detected. Although the inciting stimuli leading to the development of an immune response against the type IV collagen and neutrophils are unknown, evidence indicates that both genetic and environmental factors play a role. Of note, molecular mimicry between self-antigens and nonself-antigens such as antigenic determinants of microorganisms has been implicated in the pathogenesis of anti-GBM disease and ANCA-associated vasculitis. A mosquito-borne viral illness highly prevalent in the tropics and subtropics, dengue can be complicated by acute renal failure, proteinuria, hematuria and glomerulonephritis. We present a 66-year-old woman who was diagnosed with dengue infection and rapidly progressive glomerulonephritis during an outbreak of dengue in Honduras in the summer of 2013. Renal biopsy revealed severe crescentic glomerulonephritis. Immunofluorescence examination demonstrated strong linear IgG deposition along glomerular capillary walls. Serologic tests demonstrated antibodies against GBM, MPO and platelet glycoproteins. The patient was diagnosed with anti-GBM disease associated with p-ANCA with MPO specificity. Despite heavy immunosuppression and plasmapheresis, IgG titers against dengue virus continued to rise confirming the diagnosis of acute dengue infection. We present the first reported case of anti-GBM disease associated with p-ANCA with MPO specificity during dengue infection. This report calls for a heightened awareness of autoimmunity leading to crescentic glomerulonephritis in patients with dengue infection.

  14. Functional and Promoter Analysis of ChiIV3, a Chitinase of Pepper Plant, in Response to Phytophthora capsici Infection

    PubMed Central

    Liu, Zhiqin; Shi, Lanping; Yang, Sheng; Lin, Youquan; Weng, Yahong; Li, Xia; Hussain, Ansar; Noman, Ali; He, Shuilin

    2017-01-01

    Despite the involvement of many members of the chitinase family in plant immunity, the precise functions of the majority of the members remain poorly understood. Herein, the gene ChiIV3 in Capsicum annuum encoding a chitinase protein containing a chitin binding domain and targeting to the plasma membrane was found to be induced by Phytophthora capsici inoculation (PCI) and applied chitin treatment. Besides its direct inhibitory effect on growth of Phytophthora capsici (P. capsici), ChiIV3 was also found by virus-induced gene silencing (VIGS) and transient overexpression (TOE) in pepper plants to act as a positive regulator of plant cell death and in triggering defense signaling and upregulation of PR (pathogenesis related) genes against PCI. A 5′ deletion assay revealed that pChiIV3−712 to −459 bp was found to be sufficient for ChiIV3’ response to PCI. Furthermore, a mutation assay indicated that W-box−466 to −461 bp in pChiIV3−712 to −459 bp was noted to be the PCI-responsible element. These results collectively suggest that ChiIV3 acts as a likely antifungal protein and as a receptor for unidentified chitin in planta to trigger cell death and defense signaling against PCI. PMID:28763001

  15. Genetics Home Reference: familial porencephaly

    MedlinePlus

    ... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  16. A type IV burst associated with a coronal streamer disruption event

    NASA Technical Reports Server (NTRS)

    Kundu, M. R.

    1987-01-01

    A type IV burst was observed on February 17, 1985 with the Clark Lake Radio Observatory multifrequency radioheliograph operating in the frequency range 20-125 MHz. This burst was associated with a coronal streamer disruption event. From two-dimensional images produced at 50 MHz, evidence of a type II burst and a slow moving type IV burst are shown. The observations of the moving type IV burst suggests that a plasmoid containing energetic electrons can result from the disruption of a coronal streamer.

  17. Circulating tumour necrosis factor alpha & soluble TNF receptors in patients with Guillain-Barre syndrome.

    PubMed

    Radhakrishnan, V V; Sumi, M G; Reuben, S; Mathai, A; Nair, M D

    2003-05-01

    Tumour necrosis factor-alpha (TNF-alpha) is regarded as one of the immune factors that can induce demyelination of peripheral nerves in patients with Guillian-Barre syndrome (GBS). This present study was undertaken to find out the role of TNF-alpha and soluble TNF receptors in the pathogenesis of GBS; and to study the effect of intravenous immunoglobulin (ivIg) therapy on the serum TNF-alpha and soluble TNF receptors in patients with GBS. Thirty six patients with GBS in progressive stages of motor weakness were included in this study. The serum TNF-alpha and soluble TNF receptors (TNF-RI, TNF-RII) were measured in the serum samples of these patients before and after ivIg therapy by a sandwich ELISA. Of the 36 patients with GBS, 26 (72.2%) showed elevated serum TNF-alpha levels prior to ivIg therapy. Following a complete course of ivIg therapy there was a progressive decrease in the serum TNF-alpha concentrations in these 26 patients. On the other hand, the soluble TNF receptors, particularly TNF-RII showed an increase in the serum of GBS patients following ivIg therapy. The results indicate that ivIg reduces the serum TNF-alpha concentrations in the GBS patients having elevated levels prior to ivIg therapy. Elevated serum levels of soluble TNF receptors following ivIg therapy may play a protective role by inhibiting the demyelinating effect of TNF-alpha in the peripheral nerves of patients with GBS.

  18. Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

    MedlinePlus

    ... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

  19. viking: identification and characterization of a second type IV collagen in Drosophila.

    PubMed

    Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

    1997-10-01

    We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

  20. Proteome analysis of the plant pathogen Xylella fastidiosa reveals major cellular and extracellular proteins and a peculiar codon bias distribution.

    PubMed

    Smolka, Marcus Bustamante; Martins-de-Souza, Daniel; Martins, Daniel; Winck, Flavia Vischi; Santoro, Carlos Eduardo; Castellari, Rafael Ramos; Ferrari, Fernanda; Brum, Itaraju Junior; Galembeck, Eduardo; Della Coletta Filho, Helvécio; Machado, Marcos Antonio; Marangoni, Sergio; Novello, Jose Camillo

    2003-02-01

    The bacteria Xylella fastidiosa is the causative agent of a number of economically important crop diseases, including citrus variegated chlorosis. Although its complete genome is already sequenced, X. fastidiosa is very poorly characterized by biochemical approaches at the protein level. In an initial effort to characterize protein expression in X. fastidiosa we used one- and two-dimensional gel electrophoresis and mass spectrometry to identify the products of 142 genes present in a whole cell extract and in an extracellular fraction of the citrus isolated strain 9a5c. Of particular interest for the study of pathogenesis are adhesion and secreted proteins. Homologs to proteins from three different adhesion systems (type IV fimbriae, mrk pili and hsf surface fibrils) were found to be coexpressed, the last two being detected only as multimeric complexes in the high molecular weight region of one-dimensional electrophoresis gels. Using a procedure to extract secreted proteins as well as proteins weakly attached to the cell surface we identified 30 different proteins including toxins, adhesion related proteins, antioxidant enzymes, different types of proteases and 16 hypothetical proteins. These data suggest that the intercellular space of X. fastidiosa colonies is a multifunctional microenvironment containing proteins related to in vivo bacterial survival and pathogenesis. A codon usage analysis of the most expressed proteins from the whole cell extract revealed a low biased distribution, which we propose is related to the slow growing nature of X. fastidiosa. A database of the X. fastidiosa proteome was developed and can be accessed via the internet (URL: www.proteome.ibi.unicamp.br).

  1. Comparative Genomic and Phenotypic Characterization of Pathogenic and Non-Pathogenic Strains of Xanthomonas arboricola Reveals Insights into the Infection Process of Bacterial Spot Disease of Stone Fruits

    PubMed Central

    Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M.

    2016-01-01

    Xanthomonas arboricola pv. pruni is the causal agent of bacterial spot disease of stone fruits, a quarantinable pathogen in several areas worldwide, including the European Union. In order to develop efficient control methods for this disease, it is necessary to improve the understanding of the key determinants associated with host restriction, colonization and the development of pathogenesis. After an initial characterization, by multilocus sequence analysis, of 15 strains of X. arboricola isolated from Prunus, one strain did not group into the pathovar pruni or into other pathovars of this species and therefore it was identified and defined as a X. arboricola pv. pruni look-a-like. This non-pathogenic strain and two typical strains of X. arboricola pv. pruni were selected for a whole genome and phenotype comparative analysis in features associated with the pathogenesis process in Xanthomonas. Comparative analysis among these bacterial strains isolated from Prunus spp. and the inclusion of 15 publicly available genome sequences from other pathogenic and non-pathogenic strains of X. arboricola revealed variations in the phenotype associated with variations in the profiles of TonB-dependent transporters, sensors of the two-component regulatory system, methyl accepting chemotaxis proteins, components of the flagella and the type IV pilus, as well as in the repertoire of cell-wall degrading enzymes and the components of the type III secretion system and related effectors. These variations provide a global overview of those mechanisms that could be associated with the development of bacterial spot disease. Additionally, it pointed out some features that might influence the host specificity and the variable virulence observed in X. arboricola. PMID:27571391

  2. Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

    PubMed Central

    Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

    1994-01-01

    Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

  3. Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

    MedlinePlus

    ... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  4. Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

    PubMed

    McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

    2014-10-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

  5. Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

    PubMed Central

    McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

    2014-01-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

  6. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

    PubMed Central

    Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

    2014-01-01

    Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM. PMID:26069692

  7. Herpes simplex virus type 2 recurrent meningitis (Mollaret's meningitis): a consideration for the recurrent pathogenesis.

    PubMed

    Sato, Rumi; Ayabe, Mitsuyoshi; Shoji, Hiroshi; Ichiyama, Takashi; Saito, Yumiko; Hondo, Ryo; Eizuru, Yoshito

    2005-11-01

    We report a 44-year-old Japanese woman with herpes simplex virus (HSV) type 2 recurrent meningitis (Mollaret's meningitis). The diagnosis was confirmed by nested polymerase chain reaction in her cerebrospinal fluid, but the patient's conventional HSV antibodies by complement fixation, neutralizing test or enzyme immunoassay showed low titres with low lymphoproliferative response. Several similar cases are discussed. Although the reason for the recurrent pathogenesis is uncertain, our report suggests that the low immune response including immune evasion may be involved in the pathogenesis of HSV type 2 recurrent meningitis. For this patient, long-term suppressive and patient-initiated therapies were conducted to prevent the recurrence of meningitis.

  8. Matrix metalloproteinases in pathogenesis of hemorrhoidal disease.

    PubMed

    Kisli, Erol; Kemik, Ahu; Sümer, Aziz; Kemik, Özgür

    2013-11-01

    The aim of this study is to investigate the accuracy of serum matrix metalloproteinase (MMP) levels in an effort to find a reliable factor that may play an important role in pathogenesis of hemorrhoidal disease. Twenty control subjects and 21 Grade I, 19 Grade II, 20 Grade III, and 21 Grade IV patients with internal hemorrhoid were included in this prospective study. The mean ages of control subjects were 47.65 ± 6.71 standard deviation (SD) years (range, 37 to 60 years). The mean age of internal Grade I, Grade II, Grade III, and Grade IV patients with internal hemorrhoid were 48.85 ± 6.44, 47.20 ± 6.75, 44.90 ± 6.13, and 42.95 ± 3.49 SD years (ranges, 38 to 58, 38 to 60, 34 to 55, and 38 to 50 years), respectively. Ten milliliters of blood was taken from all subjects. Enzyme-linked immunosorbent assay (ELISA) for MMP-1, -2, -7, and -9 levels were performed using an ELISA kit (R&D Systems) following the manufacturer's instructions. There was an important difference between Grade I and Grade II groups in the serum levels of MMP-9 (P < 0.01). Patients with Grade III hemorrhoidal disease had significantly higher serum levels of all MMP than patients with Grade I and Grade II hemorrhoidal disease (P < 0.001). Also, patients with Grade 4 hemorrhoidal disease had higher serum levels of MMP-7 and -9 according to Grade I, II, and III groups (P < 0.01, 0.001). High serum levels of MMP are present in patients with hemorrhoids, suggesting the possible mechanism in the pathogenesis of hemorrhoids.

  9. Iron deficiency and heart failure: diagnostic dilemmas and therapeutic perspectives

    PubMed Central

    Jankowska, Ewa A.; von Haehling, Stephan; Anker, Stefan D.; Macdougall, Iain C.; Ponikowski, Piotr

    2013-01-01

    Iron is a micronutrient essential for cellular energy and metabolism, necessary for maintaining body homoeostasis. Iron deficiency is an important co-morbidity in patients with heart failure (HF). A major factor in the pathogenesis of anaemia, it is also a separate condition with serious clinical consequences (e.g. impaired exercise capacity) and poor prognosis in HF patients. Experimental evidence suggests that iron therapy in iron-deficient animals may activate molecular pathways that can be cardio-protective. Clinical studies have demonstrated favourable effects of i.v. iron on the functional status, quality of life, and exercise capacity in HF patients. It is hypothesized that i.v. iron supplementation may become a novel therapy in HF patients with iron deficiency. PMID:23100285

  10. Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

    PubMed Central

    Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

    2011-01-01

    Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

  11. Sensitization or tolerance to Mycobacterium leprae antigen by route of injection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shepard, C.C.; Walker, L.L.; Van Landingham, R.M.

    1982-11-01

    Aqueous suspensions of heat-killed Mycobacterium leprae in a dose of 10(7) organisms were highly immunogenic when injected intradermally (i.d.). The same dose of bacteria did not sensitize when given intraperitoneally (i.p.) or intravenously (i.v.), and did so only minimally at best when given subcutaneously. The i.d. route was the most immunogenic for sheep erythrocytes also. M. leprae injected i.p. or i.v. stimulated immune tolerance to M. leprae challenge i.d. In older mice (greater than or equal to 8 weeks), the i.v. injections gave more complete tolerance. Mice that had been rendered tolerant by i.v. injections maintained their tolerance for atmore » least 168 days. Prior UV irradiation of intact mice prevented sensitization by the i.d. route. In normal mice, living M. bovis BCG given i.d. produced good sensitization to M. leprae. Mice that had been made tolerant by i.v. injection of M. leprae could be partially sensitized to M. leprae by i.d. immunization with BCG; mixtures of living BCG and heat-killed M. leprae were no more effective than BCG alone. These findings appear to have relevance to the pathogenesis of lepromatous leprosy and its immunoprophylaxis.« less

  12. Trypanosoma cruzi discrete typing units in Chagas disease patients from endemic and non-endemic regions of Argentina.

    PubMed

    Cura, C I; Lucero, R H; Bisio, M; Oshiro, E; Formichelli, L B; Burgos, J M; Lejona, S; Brusés, B L; Hernández, D O; Severini, G V; Velazquez, E; Duffy, T; Anchart, E; Lattes, R; Altcheh, J; Freilij, H; Diez, M; Nagel, C; Vigliano, C; Favaloro, L; Favaloro, R R; Merino, D E; Sosa-Estani, S; Schijman, A G

    2012-04-01

    Genetic diversity of Trypanosoma cruzi may play a role in pathogenesis of Chagas disease forms. Natural populations are classified into 6 Discrete Typing Units (DTUs) Tc I-VI with taxonomical status. This study aimed to identify T. cruzi DTUs in bloodstream and tissue samples of Argentinean patients with Chagas disease. PCR-based strategies allowed DTU identification in 256 clinical samples from 239 Argentinean patients. Tc V prevailed in blood from both asymptomatic and symptomatic cases and Tc I was more frequent in bloodstream, cardiac tissues and chagoma samples from immunosuppressed patients. Tc II and VI were identified in a minority of cases, while Tc III and Tc IV were not detected in the studied population. Interestingly, Tc I and Tc II/VI sequences were amplified from the same skin biopsy slice from a kidney transplant patient suffering Chagas disease reactivation. Further data also revealed the occurrence of mixed DTU populations in the human chronic infection. In conclusion, our findings provide evidence of the complexity of the dynamics of T. cruzi diversity in the natural history of human Chagas disease and allege the pathogenic role of DTUs I, II, V and VI in the studied population.

  13. IFN-{gamma} sensitizes MIN6N8 insulinoma cells to TNF-{alpha}-induced apoptosis by inhibiting NF-{kappa}B-mediated XIAP upregulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hun Sik; Kim, Sunshin; Lee, Myung-Shik

    2005-10-28

    Although X-linked inhibitor of apoptosis protein (XIAP) is an important intracellular suppressor of apoptosis in a variety of cell types, its role in cytokine-induced pancreatic {beta}-cell apoptosis remains unclear. Here, we found that: (i) XIAP level was inversely correlated with tumor necrosis factor (TNF)-{alpha}-induced apoptosis in MIN6N8 insulinoma cells; (ii) adenoviral XIAP overexpression abrogated the TNF-{alpha}-induced apoptosis through inhibition of caspase activity; (iii) downregulation of XIAP by antisense oligonucleotide or Smac peptide sensitized MIN6N8 cells to TNF-{alpha}-induced apoptosis; (iv) XIAP expression was induced by TNF-{alpha} through a nuclear factor-{kappa}B (NF-{kappa}B)-dependent pathway, and interferon (IFN)-{gamma} prevented such an induction in amore » manner independent of NF-{kappa}B, which presents a potential mechanism underlying cytotoxic IFN-{gamma}/TNF-{alpha} synergism. Taken together, our results suggest that XIAP is an important modulator of TNF-{alpha}-induced apoptosis of MIN6N8 cells, and XIAP regulation in pancreatic {beta}-cells might play an important role in pancreatic {beta}-cell apoptosis and in the pathogenesis of type 1 diabetes.« less

  14. Type IV Secretion and Signal Transduction of Helicobacter pylori CagA through Interactions with Host Cell Receptors

    PubMed Central

    Backert, Steffen; Tegtmeyer, Nicole

    2017-01-01

    Helicobacter pylori is a highly successful human bacterium, which is exceptionally equipped to persistently inhabit the human stomach. Colonization by this pathogen is associated with gastric disorders ranging from chronic gastritis and peptic ulcers to cancer. Highly virulent H. pylori strains express the well-established adhesins BabA/B, SabA, AlpA/B, OipA, and HopQ, and a type IV secretion system (T4SS) encoded by the cag pathogenicity island (PAI). The adhesins ascertain intimate bacterial contact to gastric epithelial cells, while the T4SS represents an extracellular pilus-like structure for the translocation of the effector protein CagA. Numerous T4SS components including CagI, CagL, CagY, and CagA have been shown to target the integrin-β1 receptor followed by translocation of CagA across the host cell membrane. The interaction of CagA with membrane-anchored phosphatidylserine and CagA-containing outer membrane vesicles may also play a role in the delivery process. Translocated CagA undergoes tyrosine phosphorylation in C-terminal EPIYA-repeat motifs by oncogenic Src and Abl kinases. CagA then interacts with an array of host signaling proteins followed by their activation or inactivation in phosphorylation-dependent and phosphorylation-independent fashions. We now count about 25 host cell binding partners of intracellular CagA, which represent the highest quantity of all currently known virulence-associated effector proteins in the microbial world. Here we review the research progress in characterizing interactions of CagA with multiple host cell receptors in the gastric epithelium, including integrin-β1, EGFR, c-Met, CD44, E-cadherin, and gp130. The contribution of these interactions to H. pylori colonization, signal transduction, and gastric pathogenesis is discussed. PMID:28338646

  15. Brucella Modulates Secretory Trafficking via Multiple Type IV Secretion Effector Proteins

    PubMed Central

    Myeni, Sebenzile; Child, Robert; Ng, Tony W.; Kupko, John J.; Wehrly, Tara D.; Porcella, Stephen F.; Knodler, Leigh A.; Celli, Jean

    2013-01-01

    The intracellular pathogenic bacterium Brucella generates a replicative vacuole (rBCV) derived from the endoplasmic reticulum via subversion of the host cell secretory pathway. rBCV biogenesis requires the expression of the Type IV secretion system (T4SS) VirB, which is thought to translocate effector proteins that modulate membrane trafficking along the endocytic and secretory pathways. To date, only a few T4SS substrates have been identified, whose molecular functions remain unknown. Here, we used an in silico screen to identify putative T4SS effector candidate proteins using criteria such as limited homology in other bacterial genera, the presence of features similar to known VirB T4SS effectors, GC content and presence of eukaryotic-like motifs. Using β-lactamase and CyaA adenylate cyclase reporter assays, we identified eleven proteins translocated into host cells by Brucella, five in a VirB T4SS-dependent manner, namely BAB1_0678 (BspA), BAB1_0712 (BspB), BAB1_0847 (BspC), BAB1_1671 (BspE) and BAB1_1948 (BspF). A subset of the translocated proteins targeted secretory pathway compartments when ectopically expressed in HeLa cells, and the VirB effectors BspA, BspB and BspF inhibited protein secretion. Brucella infection also impaired host protein secretion in a process requiring BspA, BspB and BspF. Single or combined deletions of bspA, bspB and bspF affected Brucella ability to replicate in macrophages and persist in the liver of infected mice. Taken together, these findings demonstrate that Brucella modulates secretory trafficking via multiple T4SS effector proteins that likely act coordinately to promote Brucella pathogenesis. PMID:23950720

  16. Loss-of-function thrombospondin-1 mutations in familial pulmonary hypertension

    PubMed Central

    Stearman, Robert S.; Bull, Todd M.; Calabrese, David W.; Tripp-Addison, Megan L.; Wick, Marilee J.; Broeckel, Ulrich; Robbins, Ivan M.; Wheeler, Lisa A.; Cogan, Joy D.; Loyd, James E.

    2012-01-01

    Most patients with familial pulmonary arterial hypertension (FPAH) carry mutations in the bone morphogenic protein receptor 2 gene (BMPR2). Yet carriers have only a 20% risk of disease, suggesting that other factors influence penetrance. Thrombospondin-1 (TSP1) regulates activation of TGF-β and inhibits endothelial and smooth muscle cell proliferation, pathways coincidentally altered in pulmonary arterial hypertension (PAH). To determine whether a subset of FPAH patients also have mutations in the TSP1 gene (THBS1) we resequenced the type I repeats of THBS1 encoding the TGF-β regulation and cell growth inhibition domains in 60 FPAH probands, 70 nonfamilial PAH subjects, and in large control groups. We identified THBS1 mutations in three families: a novel missense mutation in two (Asp362Asn), and an intronic mutation in a third (IVS8+255 G/A). Neither mutation was detected in population controls. Mutant 362Asn TSP1 had less than half of the ability of wild-type TSP1 to activate TGF-β. Mutant 362Asn TSP1 also lost the ability to inhibit growth of pulmonary arterial smooth muscle cells and was over threefold less effective at inhibiting endothelial cell growth. The IVS8+255 G/A mutation decreased and/or eliminated local binding of the transcription factors SP1 and MAZ but did not affect RNA splicing. These novel mutations implicate THBS1 as a modifier gene in FPAH. These THBS1 mutations have implications in the genetic evaluation of FPAH patients. However, since FPAH is rare, these data are most relevant as evidence for the importance of TSP1 in pulmonary vascular homeostasis. Further examination of THBS1 in the pathogenesis of PAH is warranted. PMID:22198906

  17. Evolutionary Dynamics of Pathoadaptation Revealed by Three Independent Acquisitions of the VirB/D4 Type IV Secretion System in Bartonella

    PubMed Central

    Harms, Alexander; Segers, Francisca H.I.D.; Quebatte, Maxime; Mistl, Claudia; Manfredi, Pablo; Körner, Jonas; Chomel, Bruno B.; Kosoy, Michael; Maruyama, Soichi; Engel, Philipp

    2017-01-01

    The α-proteobacterial genus Bartonella comprises a group of ubiquitous mammalian pathogens that are studied as a model for the evolution of bacterial pathogenesis. Vast abundance of two particular phylogenetic lineages of Bartonella had been linked to enhanced host adaptability enabled by lineage-specific acquisition of a VirB/D4 type IV secretion system (T4SS) and parallel evolution of complex effector repertoires. However, the limited availability of genome sequences from one of those lineages as well as other, remote branches of Bartonella has so far hampered comprehensive understanding of how the VirB/D4 T4SS and its effectors called Beps have shaped Bartonella evolution. Here, we report the discovery of a third repertoire of Beps associated with the VirB/D4 T4SS of B. ancashensis, a novel human pathogen that lacks any signs of host adaptability and is only distantly related to the two species-rich lineages encoding a VirB/D4 T4SS. Furthermore, sequencing of ten new Bartonella isolates from under-sampled lineages enabled combined in silico analyses and wet lab experiments that suggest several parallel layers of functional diversification during evolution of the three Bep repertoires from a single ancestral effector. Our analyses show that the Beps of B. ancashensis share many features with the two other repertoires, but may represent a more ancestral state that has not yet unleashed the adaptive potential of such an effector set. We anticipate that the effectors of B. ancashensis will enable future studies to dissect the evolutionary history of Bartonella effectors and help unraveling the evolutionary forces underlying bacterial host adaptation. PMID:28338931

  18. Consensus in controversy: The modified Delphi method applied to Gynecologic Oncology practice.

    PubMed

    Cohn, David E; Havrilesky, Laura J; Osann, Kathryn; Lipscomb, Joseph; Hsieh, Susie; Walker, Joan L; Wright, Alexi A; Alvarez, Ronald D; Karlan, Beth Y; Bristow, Robert E; DiSilvestro, Paul A; Wakabayashi, Mark T; Morgan, Robert; Mukamel, Dana B; Wenzel, Lari

    2015-09-01

    To determine the degree of consensus regarding the probabilities of outcomes associated with IP/IV and IV chemotherapy. A survey was administered to an expert panel using the Delphi method. Ten ovarian cancer experts were asked to estimate outcomes for patients receiving IP/IV or IV chemotherapy. The clinical estimates were: 1) probability of completing six cycles of chemotherapy, 2) probability of surviving five years, 3) median survival, and 4) probability of ER/hospital visits during treatment. Estimates for two patients, one with a low comorbidity index (patient 1) and the other with a moderate index (patient 2), were included. The survey was administered in three rounds, and panelists could revise their subsequent responses based on review of the anonymous opinions of their peers. The ranges were smaller for IV compared with IP/IV therapy. Ranges decreased with each round. Consensus converged around outcomes related to IP/IV chemotherapy for: 1) completion of 6 cycles of therapy (type 1 patient, 62%, type 2 patient, 43%); 2) percentage of patients surviving 5 years (type 1 patient, 66%, type 2 patient, 47%); and 3) median survival (type 1 patient, 83 months, type 2 patient, 58 months). The group required three rounds to achieve consensus on the probabilities of ER/hospital visits (type 1 patient, 24%, type 2 patient, 35%). Initial estimates of survival and adverse events associated with IP/IV chemotherapy differ among experts. The Delphi process works to build consensus and may be a pragmatic tool to inform patients of their expected outcomes. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

    PubMed

    Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

    2018-07-01

    Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  20. Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

    PubMed

    Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

    2013-03-01

    The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

  1. The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

    2010-04-20

    Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

  2. Host cell processes that influence the intracellular survival of Legionella pneumophila.

    PubMed

    Shin, Sunny; Roy, Craig R

    2008-06-01

    Key to the pathogenesis of intracellular pathogens is their ability to manipulate host cell processes, permitting the establishment of an intracellular replicative niche. In turn, the host cell deploys defence mechanisms that limit intracellular infection. The bacterial pathogen Legionella pneumophila, the aetiological agent of Legionnaire's Disease, has evolved virulence mechanisms that allow it to replicate within protozoa, its natural host. Many of these tactics also enable L. pneumophila's survival and replication inside macrophages within a membrane-bound compartment known as the Legionella-containing vacuole. One of the virulence factors indispensable for L. pneumophila's intracellular survival is a type IV secretion system, which translocates a large repertoire of bacterial effectors into the host cell. These effectors modulate multiple host cell processes and in particular, redirect trafficking of the L. pneumophila phagosome and mediate its conversion into an ER-derived organelle competent for intracellular bacterial replication. In this review, we discuss how L. pneumophila manipulates host cells, as well as host cell processes that either facilitate or impede its intracellular survival.

  3. [The Expression of Pokemon in Endometrial Carcinoma Tissue and the Correlation with Mutant p53].

    PubMed

    Yi, Tian-jin; Wang, Ping

    2016-05-01

    To detect the expression of Pokemon in endometrial carcinoma (EC), to provide preliminary theoretical basis for clarifying pathogenesis and searching for effective targets. Ninety-eight cases of endometrial tissue paraffin specimens form July 2012 to July 2014 in West China Second University Hospital, Sichuan University, were collected, including: EC group, consisting of adenocarcinoma 23 cases, adenosquamous 12 cases, serous 3 cases, mucinous 11 cases and clear cell 9 cases, and control group, consisting of atypical hyperplasia endometrium 20 cases and normal endometrium 20 cases (secretory 10 cases, hyperplasia 10 cases). Immunohistochemistry was used to detect the expression of Pokemonin each section, analyzing the correlation of Pokemon expression with clinicopathologic characteristics and p53 expression. The positive rate of Pokemon in normal endometrium was 25% (5/20), significantly lower than that in atypical hyperplasia endometrium (60.0%, 12/20) and EC (93.1%, 54/58) (P < 0.05); the rate in type II was 97. 12% (34/35), significantly higher than that in type I (86.96%, 20/23) (P = 0.018). The positive rate of Pokemon in III-IV stage, type II and Ki-67 ≥ 50 EC tissue was much higher (P = 0.012, 0.023, 0.029). In type II EC tissue, the correlation index between Pokemon and p53 is 0.669 (P = 0.000). The over expression of Pokemon upregulates the expression of mutant p53, which may be one of the carcinogenesis modes in type II EC.

  4. Essential core of the Hawking–Ellis types

    NASA Astrophysics Data System (ADS)

    Martín-Moruno, Prado; Visser, Matt

    2018-06-01

    The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

  5. Observational properties of decameter type IV bursts

    NASA Astrophysics Data System (ADS)

    Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

    2013-04-01

    Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

  6. Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

    PubMed

    Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

    2007-01-01

    Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

  7. Genetic predisposition to parthenium dermatitis in an Indian cohort due to lower-producing genotypes of interleukin-10 (-) 1082 G>A and (-) 819 C>T loci but no association with interferon-γ (+) 874 A>T locus.

    PubMed

    Khatri, R; Mukhopadhyay, K; Verma, K K; Sethuraman, G; Sharma, A

    2011-07-01

    Parthenium dermatitis is an activated T cell-mediated type IV hypersensitivity. Its pathogenesis is well characterized, with interindividually varying serum levels of pro- and anti-inflammatory and regulatory T-cell cytokines and coherently perturbed cross-regulation between them. The functional single nucleotide polymorphisms (SNPs) in these cytokine genes might function as risk/susceptibility factors for the disease. We analysed the serum levels of interferon (IFN)-γ and interleukin (IL)-10 cytokines in cases vs. controls and investigated whether IFN-γ (+) 874 A>T and IL-10 (-) 1082 G > A and (-) 819 C>T are associated with serum levels and genetically predispose to the disease. The study included 60 patch test-confirmed patients and 60 age- and sex-matched controls. The serum levels of cytokines were estimated by high-sensitivity enzyme-linked immunosorbent assay kits. SNP genotyping was performed by amplification refractory mutational system-polymerase chain reaction. In patients, the serum level of IFN-γ was significantly increased and that of IL-10 was significantly decreased, with no difference in IgE concentration. Genetically no IFN-γ (+) 874 A>T alleles/genotypes were associated with the disease, but a strong predisposition was found due to lower-producing genotypes of IL-10 (-) 1082 G>A and (-) 819 C>T SNPs, with 2·1 and 3·5 times more risk, respectively, while intermediate IL-10-producing genotypes provided resistance. High serum IFN-γ might play a role in disease pathogenesis, but this is genetically not endowed by the IFN-γ SNP studied. In contrast, low serum IL-10 was very much connected, with the genetics of both studied IL-10 loci. These might be key managing factors concerning pathogenesis/susceptibility. © 2011 The Authors. BJD © 2011 British Association of Dermatologists 2011.

  8. Gene knockout of tau expression does not contribute to the pathogenesis of prion disease.

    PubMed

    Lawson, Victoria A; Klemm, Helen M; Welton, Jeremy M; Masters, Colin L; Crouch, Peter; Cappai, Roberto; Ciccotosto, Giuseppe D

    2011-11-01

    Prion diseases or transmissible spongiform encephalopathies are a group of fatal and transmissible disorders affecting the central nervous system of humans and animals. The principal agent of prion disease transmission and pathogenesis is proposed to be an abnormal protease-resistant isoform of the normal cellular prion protein. The microtubule-associated protein tau is elevated in patients with Creutzfeldt-Jakob disease. To determine whether tau expression contributes to prion disease pathogenesis, tau knockout and control wild-type mice were infected with the M1000 strain of mouse-adapted human prions. Immunohistochemical analysis for total tau expression in prion-infected wild-type mice indicated tau aggregation in the cytoplasm of a subpopulation of neurons in regions associated with spongiform change. Western immunoblot analysis of brain homogenates revealed a decrease in total tau immunoreactivity and epitope-specific changes in tau phosphorylation. No significant difference in incubation period or other disease features were observed between tau knockout and wild-type mice with clinical prion disease. These results demonstrate that, in this model of prion disease, tau does not contribute to the pathogenesis of prion disease and that changes in the tau protein profile observed in mice with clinical prion disease occurs as a consequence of the prion-induced pathogenesis.

  9. Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

    PubMed

    Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

    2014-01-01

    Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

    PubMed

    Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

    2017-08-01

    SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

  11. Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

    PubMed Central

    Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

    2009-01-01

    Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

  12. Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

    PubMed

    Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

    2015-06-16

    Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

  13. Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

    USGS Publications Warehouse

    Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

    2005-01-01

    Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

  14. Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

    PubMed

    Zachariae, R; Bjerring, P; Arendt-Nielsen, L

    1989-11-01

    Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

  15. Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

    PubMed

    Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

    2018-05-30

    The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Ontology-based representation and analysis of host-Brucella interactions.

    PubMed

    Lin, Yu; Xiang, Zuoshuang; He, Yongqun

    2015-01-01

    Biomedical ontologies are representations of classes of entities in the biomedical domain and how these classes are related in computer- and human-interpretable formats. Ontologies support data standardization and exchange and provide a basis for computer-assisted automated reasoning. IDOBRU is an ontology in the domain of Brucella and brucellosis. Brucella is a Gram-negative intracellular bacterium that causes brucellosis, the most common zoonotic disease in the world. In this study, IDOBRU is used as a platform to model and analyze how the hosts, especially host macrophages, interact with virulent Brucella strains or live attenuated Brucella vaccine strains. Such a study allows us to better integrate and understand intricate Brucella pathogenesis and host immunity mechanisms. Different levels of host-Brucella interactions based on different host cell types and Brucella strains were first defined ontologically. Three important processes of virulent Brucella interacting with host macrophages were represented: Brucella entry into macrophage, intracellular trafficking, and intracellular replication. Two Brucella pathogenesis mechanisms were ontologically represented: Brucella Type IV secretion system that supports intracellular trafficking and replication, and Brucella erythritol metabolism that participates in Brucella intracellular survival and pathogenesis. The host cell death pathway is critical to the outcome of host-Brucella interactions. For better survival and replication, virulent Brucella prevents macrophage cell death. However, live attenuated B. abortus vaccine strain RB51 induces caspase-2-mediated proinflammatory cell death. Brucella-associated cell death processes are represented in IDOBRU. The gene and protein information of 432 manually annotated Brucella virulence factors were represented using the Ontology of Genes and Genomes (OGG) and Protein Ontology (PRO), respectively. Seven inference rules were defined to capture the knowledge of host-Brucella interactions and implemented in IDOBRU. Current IDOBRU includes 3611 ontology terms. SPARQL queries identified many results that are critical to the host-Brucella interactions. For example, out of 269 protein virulence factors related to macrophage-Brucella interactions, 81 are critical to Brucella intracellular replication inside macrophages. A SPARQL query also identified 11 biological processes important for Brucella virulence. To systematically represent and analyze fundamental host-pathogen interaction mechanisms, we provided for the first time comprehensive ontological modeling of host-pathogen interactions using Brucella as the pathogen model. The methods and ontology representations used in our study are generic and can be broadened to study the interactions between hosts and other pathogens.

  17. Role of vascular endothelial cell growth factor in Ovarian Hyperstimulation Syndrome.

    PubMed Central

    Levin, E R; Rosen, G F; Cassidenti, D L; Yee, B; Meldrum, D; Wisot, A; Pedram, A

    1998-01-01

    Controlled ovarian hyperstimulation with gonadotropins is followed by Ovarian Hyperstimulation Syndrome (OHSS) in some women. An unidentified capillary permeability factor from the ovary has been implicated, and vascular endothelial cell growth/permeability factor (VEGF) is a candidate protein. Follicular fluids (FF) from 80 women who received hormonal induction for infertility were studied. FFs were grouped according to oocyte production, from group I (0-7 oocytes) through group IV (23-31 oocytes). Group IV was comprised of four women with the most severe symptoms of OHSS. Endothelial cell (EC) permeability induced by the individual FF was highly correlated to oocytes produced (r2 = 0.73, P < 0.001). Group IV FF stimulated a 63+/-4% greater permeability than FF from group I patients (P < 0. 01), reversed 98% by anti-VEGF antibody. Group IV fluids contained the VEGF165 isoform and significantly greater concentrations of VEGF as compared with group I (1,105+/-87 pg/ml vs. 353+/-28 pg/ml, P < 0. 05). Significant cytoskeletal rearrangement of F-actin into stress fibers and a destruction of ZO-1 tight junction protein alignment was caused by group IV FF, mediated in part by nitric oxide. These mechanisms, which lead to increased EC permeability, were reversed by the VEGF antibody. Our results indicate that VEGF is the FF factor responsible for increased vascular permeability, thereby contributing to the pathogenesis of OHSS. PMID:9835623

  18. Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

    PubMed

    Gulubova, M V

    1996-07-01

    Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

  19. Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

    PubMed

    Wang, Chao; Zhai, Wanying; Shan, Baoqing

    2016-05-01

    Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

  20. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

    PubMed Central

    Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

    2014-01-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

  1. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

    PubMed

    Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

    2014-02-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

  2. A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

    PubMed

    Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

    2008-01-01

    To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

  3. Blockade of AT1 Receptors Protects the Blood–Brain Barrier and Improves Cognition in Dahl Salt-Sensitive Hypertensive Rats

    PubMed Central

    Pelisch, Nicolas; Hosomi, Naohisa; Ueno, Masaki; Nakano, Daisuke; Hitomi, Hirofumi; Mogi, Masaki; Shimada, Kenji; Kobori, Hiroyuki; Horiuchi, Masatsugu; Sakamoto, Haruhiko; Matsumoto, Masayasu; Kohno, Masakazu; Nishiyama, Akira

    2011-01-01

    BACKGROUND The present study tested the hypothesis that inappropriate activation of the brain renin–angiotensin system (RAS) contributes to the pathogenesis of blood–brain barrier (BBB) disruption and cognitive impairment during development of salt-dependent hypertension. Effects of an angiotensin II (AngII) type-1 receptor blocker (ARB), at a dose that did not reduce blood pressure, were also examined. METHODS Dahl salt-sensitive (DSS) rats at 6 weeks of age were assigned to three groups: low-salt diet (DSS/L; 0.3% NaCl), high-salt diet (DSS/H; 8% NaCl), and high-salt diet treated with ARB, olmesartan at 1 mg/kg. RESULTS DSS/H rats exhibited hypertension, leakage from brain microvessels in the hippocampus, and impaired cognitive functions, which were associated with increased brain AngII levels, as well as decreased mRNA levels of tight junctions (TJs) and collagen-IV in the hippocampus. In DSS/H rats, olmesartan treatment, at a dose that did not alter blood pressure, restored the cognitive decline, and ameliorated leakage from brain microvessels. Olmesartan also decreased brain AngII levels and restored mRNA expression of TJs and collagen-IV in DSS/H rats. CONCLUSIONS These results suggest that during development of salt-dependent hypertension, activation of the brain RAS contributes to BBB disruption and cognitive impairment. Treatment with an ARB could elicit neuroprotective effects in cognitive disorders by preventing BBB permeability, which is independent of blood pressure changes. PMID:21164491

  4. [Total oxidative status of peritoneal fluid in women with endometriosis].

    PubMed

    Polak, Grzegorz; Kotarski, Jan

    2010-12-01

    Pathophysiology of endometriosis remains enigmatic despite extensive investigations. Accumulating data suggest that oxidative stress in the peritoneal cavity may be implicated in the pathogenesis of endometriosis. The aim of our study was to evaluate the oxidative status of peritoneal fluid (PF) in women with and without endometriosis. Sixty-five women participated in the study 40 women with endometriosis constituted the study group and 25 patients with functional follicle ovarian cysts comprised the reference group. Total oxidative status of PF was determined using a commercially available colorimetric assay kit (Immundiagnostic AG, Cat. nr. KC5100). Women with endometriosis had significantly higher PF oxidative status compared to women with follicle ovarian cysts. No significant difference in the peritoneal oxidative status was found between patients with stage I/II endometriosis, and women with stage III/IV endometriotic disease. Disrupted oxidative status in the peritoneal cavity of women with endometriosis plays a role in the pathogenesis of the disease.

  5. Ultraviolet properties of IRAS-selected Be stars

    NASA Technical Reports Server (NTRS)

    Bjorkman, Karen S.; Snow, Theodore P.

    1988-01-01

    New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

  6. Genetics Home Reference: congenital insensitivity to pain with anhidrosis

    MedlinePlus

    ... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

  7. Collagen type IV at the fetal-maternal interface.

    PubMed

    Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

    2015-01-01

    Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  9. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  10. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  11. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Xiu-Li, E-mail: usually.158@163.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, No 169 Donghu Road, Wuchang District, Wuhan 430071; Peng, Chun-Wei, E-mail: pqc278@163.com

    Highlights: {yields} HER2 level is closely related to the biologic behaviors of breast cancer cells. {yields} A new method to simultaneously image HER2 and type IV collagen was established. {yields} HER2 status and type IV collagen degradation predict breast cancer invasion. {yields} The complex interactions between tumor and its environment were revealed. -- Abstract: It has been well recognized that human epidermal growth factor receptor 2 (HER2) level in breast cancer (BC) is closely related to the malignant biologic behaviors of the tumor, including invasion and metastasis. Yet, there has been a lack of directly observable evidence to support suchmore » notion. Here we report a quantum dots (QDs)-based double-color imaging technique to simultaneously show the HER2 level on BC cells and the type IV collagen in the tumor matrix. In benign breast tumor, the type IV collagen was intact. With the increasing of HER2 expression level, there has been a progressive decrease in type IV collagen around the cancer nest. At HER2 (3+) expression level, there has virtually been a total destruction of type IV collagen. Moreover, HER2 (3+) BC cells also show direct invasion into the blood vessels. This novel imaging method provides direct observable evidence to support the theory that the HER2 expression level is directly related to BC invasion.« less

  13. Type two innate lymphoid cells; the Janus cells in health and disease

    PubMed Central

    Maazi, Hadi; Akbari, Omid

    2017-01-01

    Summary Innate lymphoid cells are functionally diverse subsets of immune cells including the conventional natural killer cells, lymphoid tissue inducers, type 1, 2 and 3 with significant roles in immunity and pathogenesis of inflammatory diseases. Type 2 innate lymphoid cells (ILC2s) resemble type 2 helper (Th2) cells in cytokine production and contribute to anti-helminth immunity, maintaining mucosal tissue integrity and adipose tissue browning. ILC2s play important roles in the pathogenesis of allergic diseases and asthma. Studying the pathways of activation and regulation of ILC2s are currently a priority for giving a better understanding of pathogenesis of diseases with immunological roots. Recently, our laboratory and others have shown several pathways of regulation of ILC2s by costimulatory molecules such as ICOS, regulatory T cells and by compounds such as nicotine. In this review, we summarize the current understanding of the mechanisms of activation and regulation of ILC2s and the role of these cells in health and disease. PMID:28658553

  14. On the Directivity of Low-Frequency Type IV Radio Bursts

    NASA Technical Reports Server (NTRS)

    Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

    2016-01-01

    An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

  15. Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

    PubMed

    Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

    2012-06-01

    Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Quantitative proteomic analysis of host--pathogen interactions: a study of Acinetobacter baumannii responses to host airways.

    PubMed

    Méndez, Jose Antonio; Mateos, Jesús; Beceiro, Alejandro; Lopez, María; Tomás, María; Poza, Margarita; Bou, Germán

    2015-05-30

    Acinetobacter baumannii is a major health problem. The most common infection caused by A. baumannii is hospital acquired pneumonia, and the associated mortality rate is approximately 50%. Neither in vivo nor ex vivo expression profiling has been performed at the proteomic or transcriptomic level for pneumonia caused by A. baumannii. In this study, we characterized the proteome of A. baumannii under conditions that simulate those found in the airways, to gain some insight into how A. baumannii adapts to the host and to improve knowledge about the pathogenesis and virulence of this bacterium. A clinical strain of A. baumannii was grown under different conditions: in the presence of bronchoalveolar lavage fluid from infected rats, of RAW 264.7 cells to simulate conditions in the respiratory tract and in control conditions. We used iTRAQ labelling and LC-MALDI-TOF/TOF to investigate how A. baumannii responds on exposure to macrophages/BALF. 179 proteins showed differential expression. In both models, proteins involved in the following processes were over-expressed: (i) pathogenesis and virulence (OmpA, YjjK); (ii) cell wall/membrane/envelope biogenesis (MurC); (iii) energy production and conversion (acetyl-CoA hydrolase); and (iv) translation (50S ribosomal protein L9). Proteins involved in the following were under-expressed: (i) lipid metabolism (short-chain dehydrogenase); (ii) amino acid metabolism and transport (aspartate aminotransferase); (iii) unknown function (DNA-binding protein); and (iv) inorganic ion transport and metabolism (hydroperoxidase). We observed alterations in cell wall synthesis and identified 2 upregulated virulence-associated proteins with >15 peptides/protein in both ex vivo models (OmpA and YjjK), suggesting that these proteins are fundamental for pathogenesis and virulence in the airways. This study is the first comprehensive overview of the ex vivo proteome of A. baumannii and is an important step towards identification of diagnostic biomarkers, novel drug targets and potential vaccine candidates in the fight against pneumonia caused by A. baumannii.

  17. Dipeptidyl peptidase-IV inhibitor use associated with increased risk of ACE inhibitor-associated angioedema.

    PubMed

    Brown, Nancy J; Byiers, Stuart; Carr, David; Maldonado, Mario; Warner, Barbara Ann

    2009-09-01

    Dipeptidyl peptidase-IV (DPP-IV) inhibitors decrease degradation of the incretins. DPP-IV inhibitors also decrease degradation of peptides, such as substance P, that may be involved in the pathogenesis of angiotensin-converting enzyme (ACE) inhibitor-associated angioedema. This study tested the hypothesis that DPP-IV inhibition affects risk of clinical angioedema, by comparing the incidence of angioedema in patients treated with the DPP-IV inhibitor vildagliptin versus those treated with comparator in Phase III randomized clinical trials. Prospectively defined angioedema-related events were adjudicated in a blinded fashion by an internal medicine adjudication committee and expert reviewer. Concurrent ACE inhibitor or angiotensin receptor blocker exposure was ascertained from case report forms. Study drug exposure was ascertained from unblinded data from phase III studies. Odds ratios and 95% confidence intervals comparing angioedema risk in vildagliptin-treated and comparator-treated patients were calculated for the overall population and for patients taking ACE inhibitors or angiotensin receptor blockers, using both an analysis of pooled data and a meta-analysis (Peto method). Overall, there was no association between vildagliptin use and angioedema. Among individuals taking an ACE inhibitor, however, vildagliptin use was associated with an increased risk of angioedema (14 confirmed cases among 2754 vildagliptin users versus 1 case among 1819 comparator users: odds ratio 4.57 [95% confidence interval 1.57 to 13.28]) in the meta-analysis. Vildagliptin use may be associated with increased risk of angioedema among patients taking ACE inhibitors, although absolute risk is small. Physicians confronted with angioedema in a patient taking an ACE inhibitor and DPP-IV inhibitor should consider this possible drug-drug interaction.

  18. Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

    PubMed

    Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

    2007-01-01

    Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

  19. MicroRNAs and exosomes in depression: Potential diagnostic biomarkers.

    PubMed

    Tavakolizadeh, Jahanshir; Roshanaei, Kambiz; Salmaninejad, Arash; Yari, Reza; Nahand, Javid Sadri; Sarkarizi, Hoda Khoshdel; Mousavi, Seyed Mojtaba; Salarinia, Reza; Rahmati, Majid; Mousavi, Seyed Farshid; Mokhtari, Ryan; Mirzaei, Hamed

    2018-05-01

    Depression is known as one of important psychiatric disorders which could be associated with disability among various populations. Diagnostic and statistical manual of mental disorders, 4th edition (DSM-IV) and international statistical classification of diseases and related health problems (ICD-10) could be used as subjective diagnostic schemes for identification of mental disorders such as depression. Utilization of subjective diagnostic schemes are associated with limitations. Hence, it seems that employing of new diagnosis platforms is required. Multiple lines of evidence indicated that measurement of several biomarkers could be useful for detection patients with depression. Among of various types of biomarkers, microRNAs (miRNAs) have been emerged as powerful tools for diagnosis patients with depression. MiRNAs are small non-coding RNAs which act as epigenetic regulators. It has been showed that these molecules have critical roles in pathogenesis of many diseases such as depression. These molecules exert their effects via targeting a variety of cellular and molecular pathways involved in initiation and progression of depression. Hence, miRNAs could be used as diagnostic and therapeutic biomarkers in patients with depression. Besides miRNAs, exosomes as nano- carriers could have been emerged as diagnostic biomarkers in several diseases such as depression. These vesicles are able to carry several cargos such as DNAs, proteins, mRNAs, and miRNAs to recipient cells. Here, we summarized several miRNAs involved in pathogenesis and response to treatment of depression which could be used as diagnostic biomarkers. Moreover, we highlighted exosomes as new diagnostic biomarkers for patients with depression. © 2017 Wiley Periodicals, Inc.

  20. Role of CD248 as a potential severity marker in idiopathic pulmonary fibrosis.

    PubMed

    Bartis, Domokos; Crowley, Louise E; D'Souza, Vijay K; Borthwick, Lee; Fisher, Andrew J; Croft, Adam P; Pongrácz, Judit E; Thompson, Richard; Langman, Gerald; Buckley, Christopher D; Thickett, David R

    2016-04-14

    CD248 or Endosialin is a transmembrane molecule expressed in stromal cells binding to extracellular matrix (ECM) components. It has been previously implicated in kidney fibrosis, rheumatoid arthritis as well as in tumour-stromal interactions. This study investigates the role of CD248 in the pathogenesis of fibrotic diseases in Idiopathic Pulmonary Fibrosis (IPF). CD248 quantitative immunohistochemistry (IHC) was performed on lung samples from 22 IPF patients and its expression was assayed in cultured pulmonary fibroblasts and epithelial cells. Effects of CD248 silencing was evaluated on fibroblast proliferation and myofibroblast differentiation. IHC revealed strong CD248 expression in mesenchymal cells of normal lung structures such as pleura and adventitia but not in epithelium. Fibrotic areas showed markedly stronger staining than unaffected lung tissue. The extent of CD248 staining showed a significant negative correlation to lung function parameters FEV1, FVC, TLC, and TLCO (r2 > 0 · 35, p < 0 · 01). CD248 protein levels were significantly greater in IPF-derived lung fibroblasts vs normal lung fibroblasts (p < 0 · 01) and CD248 silencing significantly reduced the proliferation of lung fibroblasts, but did not affected myofibroblast differentiation. We conclude that CD248 overexpression is possibly involved in the pathogenesis of IPF and it has potential as a disease severity marker. Given that CD248 ligands are collagen type I, IV and fibronectin, we hypothesise that CD248 signalling represents a novel matrix-fibroblast interaction that may be a potential therapeutic target in IPF.

  1. Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

    PubMed

    Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

    2015-04-02

    Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

  2. Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

    PubMed

    Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

    2005-04-01

    The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

  3. Review article: Pathogenesis and management of gastric carcinoid tumours.

    PubMed

    Burkitt, M D; Pritchard, D M

    2006-11-01

    Gastric carcinoid tumours are rare, but are increasing in incidence. To discuss tumour pathogenesis and outline current approaches to patient management. Review of published articles following a Pubmed search. Although interest in gastric carcinoids has increased since it was recognized that they are associated with achlorhydria, to date there is no definite evidence that humans taking long-term acid suppressing medication are at increased risk. Type I tumours are associated with autoimmune atrophic gastritis and hypergastrinaemia, type II are associated with Zollinger-Ellison syndrome, multiple endocrine neoplasia-1 and hypergastrinaemia and sporadic type III carcinoids are gastrin-independent and carry the worst prognosis. Careful investigation of these patients is required, particularly to identify the tumour type, the source of hypergastrinaemia and the presence of metastases. Treatment can be directed at the source of hypergastrinaemia if type I or II tumours are still gastrin responsive and not growing autonomously. Type III tumours should be treated surgically. Advances in our understanding of the pathogenesis of gastric carcinoids have led to recent improvements in investigation and management. Challenges remain in identifying the genetic and environmental factors, in addition to hypergastrinaemia, that are responsible for tumour development in susceptible patients.

  4. Mycobacterium tuberculosis TlyA Protein Negatively Regulates T Helper (Th) 1 and Th17 Differentiation and Promotes Tuberculosis Pathogenesis*

    PubMed Central

    Rahman, Md. Aejazur; Sobia, Parveen; Dwivedi, Ved Prakash; Bhawsar, Aakansha; Singh, Dhiraj Kumar; Sharma, Pawan; Moodley, Prashini; Van Kaer, Luc; Bishai, William R; Das, Gobardhan

    2015-01-01

    Mycobacterium tuberculosis, the causative agent of tuberculosis, is an ancient pathogen and a major cause of death worldwide. Although various virulence factors of M. tuberculosis have been identified, its pathogenesis remains incompletely understood. TlyA is a virulence factor in several bacterial infections and is evolutionarily conserved in many Gram-positive bacteria, but its function in M. tuberculosis pathogenesis has not been elucidated. Here, we report that TlyA significantly contributes to the pathogenesis of M. tuberculosis. We show that a TlyA mutant M. tuberculosis strain induces increased IL-12 and reduced IL-1β and IL-10 cytokine responses, which sharply contrasts with the immune responses induced by wild type M. tuberculosis. Furthermore, compared with wild type M. tuberculosis, TlyA-deficient M. tuberculosis bacteria are more susceptible to autophagy in macrophages. Consequently, animals infected with the TlyA mutant M. tuberculosis organisms exhibited increased host-protective immune responses, reduced bacillary load, and increased survival compared with animals infected with wild type M. tuberculosis. Thus, M. tuberculosis employs TlyA as a host evasion factor, thereby contributing to its virulence. PMID:25847237

  5. Quantitative proteomics identify an association between extracellular matrix degradation and immunopathology of genotype VII Newcastle disease virus in the spleen in chickens.

    PubMed

    Hu, Zenglei; Gu, Han; Hu, Jiao; Hu, Shunlin; Wang, Xiaoquan; Liu, Xiaowen; Jiao, Xinan; Liu, Xiufan

    2018-06-15

    Pathogenesis of genotype VII Newcastle disease virus (NDV) is characterized with remarkable immunopathology in the spleen in chickens. However, the mechanism for this unique pathological phenotype is not fully understood. Previous transcriptomics data showed that genotype VII NDV JS5/05 caused a greater downregulation of extracellular matrix (ECM) genes than genotype IV virus Herts/33 in the spleen. In this study, the role of ECM in pathology of genotype VII NDV was investigated using quantitative proteomics. Pathology studies showed that JS5/05 caused severe immunopathology characterized with remarkable necrosis in the spleen, whereas Herts/33 only induced mild pathological changes. The ECM was firstly enriched from the spleens and ECM proteins of different categories were identified by LC-MS/MS. Quantitative proteomic analysis showed that JS5/05 caused a significant disruption of ECM integrity and molecular composition compared to Herts/33. Particularly, JS5/05 induced a more remarkable collagen breakdown in the spleen compared to Herts/33. Moreover, matrix metalloproteinase (MMP)-13 and -14 were significantly upregulated by JS5/05 infection. KEGG pathway analysis suggested that differential regulation of ECM proteins by JS5/05 and Herts/33 may impact pathology through different pathways. Therefore, our results suggested that MMP upregulation and consequent ECM degradation contribute to immunopathology of genotype VII NDV in the spleen. Pathogenesis of genotype VII NDV is characterized with severe immunopathology in the spleen in chickens. Elucidating the mechanism of this pathology phenotype is critical to understand pathogenesis of genotype VII NDV. Here, we present the proteomic data of an important non-cellular compartment, the extracellular matrix (ECM), in the spleen from chickens infected with genotype VII and IV NDVs. Our results suggest that significant upregulation of matrix metalloproteinases by genotype VII NDV and consequent disruption of ECM integrity and composition may be associated with immunopathology in the spleen. Moreover, ECM degradation, represented by collagen breakdown, is an important pathology event in the process of genotype VII NDV infection. Our study for the first time presents evidence of ECM regulation by NDV and adds ECM remodeling as a new manifestation for NDV pathology. Our findings also deepen the understanding of NDV pathogenesis. Copyright © 2018. Published by Elsevier B.V.

  6. The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

    DTIC Science & Technology

    1999-05-01

    Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

  7. Defining the roles for Vpr in HIV-1-associated neuropathogenesis

    PubMed Central

    James, Tony; Nonnemacher, Michael R.; Wigdahl, Brian; Krebs, Fred C.

    2016-01-01

    It is increasingly evident that the human immunodeficiency virus type 1 (HIV-1) viral protein R (Vpr) has a unique role in neuropathogenesis. Its ability to induce G2/M arrest coupled with its capacity to increase viral gene transcription gives it a unique role in sustaining viral replication and aiding in the establishment and maintenance of a systemic infection. The requirement of Vpr for HIV-1 infection and replication in cells of monocytic origin (a key lineage of cells involved in HIV-1 neuroinvasion) suggests an important role in establishing and sustaining infection in the central nervous system (CNS). Contributions of Vpr to neuropathogenesis can be expanded further through (i) naturally occurring HIV-1 sequence variation that results in functionally divergent Vpr variants; (ii) the dual activities of Vpr as a intracellular protein delivered and expressed during HIV-1 infection and as an extracellular protein that can act on neighboring, uninfected cells; (iii) cell type-dependent consequences of Vpr expression and exposure, including cell cycle arrest, metabolic dysregulation, and cytotoxicity; and (iv) the effects of Vpr on exosome-based intercellular communication in the CNS. Revealing the effects of this pleiotropic viral protein is an essential part of a greater understanding of HIV-1-associated pathogenesis and potential approaches to treating and preventing disease caused by HIV-1 infection. PMID:27056720

  8. Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

    PubMed

    Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

    2018-06-01

    The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

  9. Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

    2008-01-15

    We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

  10. Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

    PubMed

    de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

    2007-10-01

    The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

  11. Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

    PubMed

    Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

    2016-07-01

    To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

  12. Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

    PubMed

    Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

    2013-10-01

    To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  13. Porcine circovirus type 2 (PCV2): pathogenesis and interaction with the immune system.

    PubMed

    Meng, Xiang-Jin

    2013-01-01

    Porcine circovirus type 2 (PCV2) is the primary causative agent of porcine circovirus-associated disease (PCVAD). The virus preferentially targets the lymphoid tissues, which leads to lymphoid depletion and immunosuppression in pigs. The disease is exacerbated by immunostimulation or concurrent infections with other pathogens. PCV2 resides in certain immune cells, such as macrophage and dendritic cells, and modulates their functions. Upregulation of IL-10 and proinflammatory cytokines in infected pigs may contribute to pathogenesis. Pig genetics influence host susceptibility to PCV2, but the viral genetic determinants for virulence remain unknown. PCV2 DNA and proteins interact with various cellular genes that control immune responses to regulate virus replication and pathogenesis. Both neutralizing antibodies and cell-mediated immunity are important immunological correlates of protection. Despite the availability of effective vaccines, variant strains of PCV2 continue to emerge. Although tremendous progress has been made toward understanding PCV2 pathogenesis and immune interactions, many important questions remain.

  14. Pathogenesis of Dengue Vaccine Viruses in Mosquitoes.

    DTIC Science & Technology

    1984-01-01

    type 2 (Price, 1973), and attenuated Japanese encephalitis vaccine virus (Chen and Beaty, 1982). Sabin (1948) showed that attenuated dengue virus...M194 992 PATHOGENESIS OF DENGUJE VACCINE VIRUSES IN NOSSUITOES vi1 (u) COLORADO STATE UNIV FORT COLLINS DEPT OF MICROBIOLOGY AND ENVIRONMENTAL...IW AV wWW W N A A~~ Nq .. mcFILE COPY 0)0 AD PATHOGENESIS OF DENGUE VACCINE VIRUSES IN MOSQUITOES Annual Report Barry J. Beaty, Ph.D. D T IC ELECTE

  15. 46 CFR 164.019-3 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

  16. Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

    2011-04-15

    Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

  17. Interstellar C IV and Si IV column densities toward early-type stars

    NASA Technical Reports Server (NTRS)

    Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

    1980-01-01

    Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

  18. Integrative analysis of differentially expressed microRNAs of pulmonary alveolar macrophages from piglets during H1N1 swine influenza A virus infection

    PubMed Central

    Jiang, Pengfei; Zhou, Na; Chen, Xinyu; Zhao, Xing; Li, Dengyun; Wang, Fen; Bi, Lijun; Zhang, Deli

    2015-01-01

    H1N1 swine influenza A virus (H1N1 SwIV) is one key subtype of influenza viruses with pandemic potential. MicroRNAs (miRNAs) are endogenous small RNA molecules that regulate gene expression. MiRNAs relevant with H1N1 SwIV have rarely been reported. To understand the biological functions of miRNAs during H1N1 SwIV infection, this study profiled differentially expressed (DE) miRNAs in pulmonary alveolar macrophages from piglets during the H1N1 SwIV infection using a deep sequencing approach, which was validated by quantitative real-time PCR. Compared to control group, 70 and 16 DE miRNAs were respectively identified on post-infection day (PID) 4 and PID 7. 56 DE miRNAs were identified between PID 4 and PID 7. Our results suggest that most host miRNAs are down-regulated to defend the H1N1 SwIV infection during the acute phase of swine influenza whereas their expression levels gradually return to normal during the recovery phase to avoid the occurrence of too severe porcine lung damage. In addition, targets of DE miRNAs were also obtained, for which bioinformatics analyses were performed. Our results would be useful for investigating the functions and regulatory mechanisms of miRNAs in human influenza because pig serves as an excellent animal model to study the pathogenesis of human influenza. PMID:25639204

  19. Evaluation of the Relationship between Brain-Derived Neurotropic Factor Levels and the Stroop Interference Effect in Children with Attention-Deficit Hyperactivity Disorder.

    PubMed

    Şimşek, Şeref; Gençoğlan, Salih; Yüksel, Tuğba; Kaplan, İbrahim; Aktaş, Hüseyin; Alaca, Rümeysa

    2016-12-01

    Brain-derived neurotropic factor (BDNF) has been suggested to play a role in the pathogenesis of attention-deficit hyperactivity disorder (ADHD). In addition, impairment in executive functions has been reported in children with ADHD. This study investigated the presence of a relationship between Stroop test scores and BDNF levels in children with ADHD. The study was conducted in the Department of Child Psychiatry at Dicle University. The study included 49 children between 6 and 15 years of age (M/F: 42/7), who were diagnosed with ADHD according to DSM-IV, and who did not receive previous therapy. Similar in terms of age and gender to the ADHD group, 40 children were selected in the control group. The Kiddie Schedule for Affective Disorders and Schizophrenia, Present and Lifetime version was administered to all participants. Parents and teachers were administered Turgay DSM-IV-based Child and Adolescent Behavior Disorders Screening and Rating Scale to measure symptom severity in children with ADHD. Children with ADHD underwent the Stroop test. BDNF levels were evaluated in serum by ELISA. The ADHD and control groups did not differ in terms of BDNF levels. BDNF levels did not differ between ADHD subtypes. There was also no relationship between the Stroop test interference scores and BDNF levels. The findings of the present study are in line with those in studies that demonstrated no significant role of BDNF in the pathogenesis of ADHD.

  20. Serotype IV and invasive group B Streptococcus disease in neonates, Minnesota, USA, 2000-2010.

    PubMed

    Ferrieri, Patricia; Lynfield, Ruth; Creti, Roberta; Flores, Aurea E

    2013-04-01

    Group B Streptococcus (GBS) is a major cause of invasive disease in neonates in the United States. Surveillance of invasive GBS disease in Minnesota, USA, during 2000-2010 yielded 449 isolates from 449 infants; 257 had early-onset (EO) disease (by age 6 days) and 192 late-onset (LO) disease (180 at age 7-89 days, 12 at age 90-180 days). Isolates were characterized by capsular polysaccharide serotype and surface-protein profile; types III and Ia predominated. However, because previously uncommon serotype IV constitutes 5/31 EO isolates in 2010, twelve type IV isolates collected during 2000-2010 were studied further. By pulsed-field gel electrophoresis, they were classified into 3 profiles; by multilocus sequence typing, representative isolates included new sequence type 468. Resistance to clindamycin or erythromycin was detected in 4/5 serotype IV isolates. Emergence of serotype IV GBS in Minnesota highlights the need for serotype prevalence monitoring to detect trends that could affect prevention strategies.

  1. The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

    DOT National Transportation Integrated Search

    1989-11-01

    The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

  2. An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

    DTIC Science & Technology

    1994-09-01

    wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

  3. The Big Entity of New RNA World: Long Non-Coding RNAs in Microvascular Complications of Diabetes.

    PubMed

    Raut, Satish K; Khullar, Madhu

    2018-01-01

    A major part of the genome is known to be transcribed into non-protein coding RNAs (ncRNAs), such as microRNA and long non-coding RNA (lncRNA). The importance of ncRNAs is being increasingly recognized in physiological and pathological processes. lncRNAs are a novel class of ncRNAs that do not code for proteins and are important regulators of gene expression. In the past, these molecules were thought to be transcriptional "noise" with low levels of evolutionary conservation. However, recent studies provide strong evidence indicating that lncRNAs are (i) regulated during various cellular processes, (ii) exhibit cell type-specific expression, (iii) localize to specific organelles, and (iv) associated with human diseases. Emerging evidence indicates an aberrant expression of lncRNAs in diabetes and diabetes-related microvascular complications. In the present review, we discuss the current state of knowledge of lncRNAs, their genesis from genome, and the mechanism of action of individual lncRNAs in the pathogenesis of microvascular complications of diabetes and therapeutic approaches.

  4. Characterization of a spontaneous avirulent mutant of Legionella pneumophila Serogroup 6: evidence of DotA and flagellin involvement in the loss of virulence.

    PubMed

    Scaturro, Maria; Meschini, Stefania; Arancia, Giuseppe; Stefano, Fontana; Ricci, Maria Luisa

    2009-12-01

    The pathogenesis of Legionella pneumophila mainly resides in its ability to inhibit the phagosome-lysosome fusion, which normally prevents the killing of the host cells. In order to characterize the molecular alterations that occurred in a spontaneous avirulent mutant of Legionella pneumophila serogroup 6, named Vir-, we investigated the ability of the mutant to adhere to and multiply in the WI26VA4 alveolar epithelial cell line and in human macrophages, when compared to its parental strain, Vir+. We also determined the colocalization of bacteria with LAMP-1 to gain an insight into the phagosome-lysosome fusion process. Additionally, we determined the flagellin expression and dotA nucleotide sequencing. We observed a lack of expression of flagellin and an in-frame mutation in the dotA. gene. The data obtained strongly suggest the loss of virulence of the mutant could probably be due to the absence of flagellin and the dysfunctional type IV secretion System, resulting from the DotA protein being severely compromised.

  5. Effects of 1,540-nm Fractional Nonablative Erbium and 2,940-nm Fractional Ablative Erbium on p53 Epidermal Expression After 3 months: A Split-Face Interventional Study.

    PubMed

    Borges, Juliano; Araújo, Luciana; de Oliveira, Rodrigo P B; Manela-Azulay, Monica

    2018-04-16

    Expression of p53 by keratinocytes may be important in the pathogenesis of skin cancer induced by ultraviolet light. We used side-by-side nonablative and ablative erbium fractional laser resurfacing to assess the effects on expression of p53 by facial keratinocytes. Ten female patients (age range, 50-63 years) with Fitzpatrick skin Types I-IV and clinical signs of photoaging underwent erbium fractional laser resurfacing (nonablative, 1,540-nm; ablative, 2,940-nm) on opposite sides of the face. Skin biopsies were obtained before treatment and 3 months after treatment for comparison with control biopsies of face and inner arm, quantifying p53 in immunostained tissue sections. Only ablative (2,940-nm) treatments produced a statistically significant reduction in p53 scoring after 3 months. The histologic appearance of skin after ablative resurfacing more closely resembled inner arm skin (rather than facial skin) of control subjects. Epidermal repopulation with p53-negative keratinocytes through ablative erbium fractional laser resurfacing may diminish the risk of eventual malignancy in photoaged skin.

  6. Structural basis of dual Ca2+/pH regulation of the endolysosomal TRPML1 channel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Minghui; Zhang, Wei K.; Benvin, Nicole M.

    The activities of organellar ion channels are often regulated by Ca2+ and H+, which are present in high concentrations in many organelles. Here we report a structural element critical for dual Ca2+/pH regulation of TRPML1, a Ca2+-release channel crucial for endolysosomal function. TRPML1 mutations cause mucolipidosis type IV (MLIV), a severe lysosomal storage disorder characterized by neurodegeneration, mental retardation and blindness. We obtained crystal structures of the 213-residue luminal domain of human TRPML1 containing three missense MLIV-causing mutations. This domain forms a tetramer with a highly electronegative central pore formed by a novel luminal pore loop. Cysteine cross-linking and cryo-EMmore » analyses confirmed that this architecture occurs in the full-length channel. Structure–function studies demonstrated that Ca2+ and H+ interact with the luminal pore and exert physiologically important regulation. The MLIV-causing mutations disrupt the luminal-domain structure and cause TRPML1 mislocalization. Our study reveals the structural underpinnings of TRPML1's regulation, assembly and pathogenesis.« less

  7. Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

    PubMed Central

    Cosgrove, Dominic; Liu, Shiguang

    2016-01-01

    Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

  8. Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

    PubMed

    Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

    2015-06-01

    The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

  9. Genetics Home Reference: glycogen storage disease type IV

    MedlinePlus

    ... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

  10. Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

    PubMed

    Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

    2017-07-01

    The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. Toll-like receptor 2 and type 2 diabetes.

    PubMed

    Sepehri, Zahra; Kiani, Zohre; Nasiri, Ali Akbar; Kohan, Farhad

    2016-01-01

    Innate immunity plays a crucial role in the pathogenesis of type 2 diabetes and related complications. Since the toll-like receptors (TLRs) are central to innate immunity, it appears that they are important participants in the development and pathogenesis of the disease. Previous investigations demonstrated that TLR2 homodimers and TLR2 heterodimers with TLR1 or TLR6 activate innate immunity upon recognition of damage-associated molecular patterns (DAMPs). Several DAMPs are released during type 2 diabetes, so it may be hypothesized that TLR2 is significantly involved in its progression. Here, we review recent data on the important roles and status of TLR2 in type 2 diabetes and related complications.

  12. 10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

  13. Type two innate lymphoid cells: the Janus cells in health and disease.

    PubMed

    Maazi, Hadi; Akbari, Omid

    2017-07-01

    Innate lymphoid cells are functionally diverse subsets of immune cells including the conventional natural killer cells, lymphoid tissue inducers, type 1, 2, and 3 with significant roles in immunity and pathogenesis of inflammatory diseases. Type 2 innate lymphoid cells (ILC2s) resemble type 2 helper (Th2) cells in cytokine production and contribute to anti-helminth immunity, maintaining mucosal tissue integrity, and adipose tissue browning. ILC2s play important roles in the pathogenesis of allergic diseases and asthma. Studying the pathways of activation and regulation of ILC2s are currently a priority for giving a better understanding of pathogenesis of diseases with immunological roots. Recently, our laboratory and others have shown several pathways of regulation of ILC2s by co-stimulatory molecules such as ICOS, regulatory T cells and by compounds such as nicotine. In this review, we summarize the current understanding of the mechanisms of activation and regulation of ILC2s and the role of these cells in health and disease. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Cowpox virus infection of cynomolgus macaques as a model of hemorrhagic smallpox.

    PubMed

    Johnson, Reed F; Yellayi, Srikanth; Cann, Jennifer A; Johnson, Anthony; Smith, Alvin L; Paragas, Jason; Jahrling, Peter B; Blaney, Joseph E

    2011-09-30

    Hemorrhagic smallpox was a rare but severe manifestation of variola virus infection that resulted in nearly 100% mortality. Here we describe intravenous (IV) inoculation of cowpox virus Brighton Red strain in cynomolgus macaques (Macaca fascicularis) which resulted in disease similar in presentation to hemorrhagic smallpox in humans. IV inoculation of macaques resulted in a uniformly lethal disease within 12 days post-inoculation in two independent experiments. Clinical observations and hematological and histopathological findings support hemorrhagic disease. Cowpox virus replicated to high levels in blood (8.0-9.0 log(10) gene copies/mL) and tissues including lymph nodes, thymus, spleen, bone marrow, and lungs. This unique model of hemorrhagic orthopoxvirus infection provides an accessible means to further study orthopoxvirus pathogenesis and to identify virus-specific and nonspecific therapies. Such studies will serve to complement the existing nonhuman primate models of more classical poxviral disease. Published by Elsevier Inc.

  15. SARS-CoV pathogenesis is regulated by a STAT1 dependent but a type I, II and III interferon receptor independent mechanism.

    PubMed

    Frieman, Matthew B; Chen, Jun; Morrison, Thomas E; Whitmore, Alan; Funkhouser, William; Ward, Jerrold M; Lamirande, Elaine W; Roberts, Anjeanette; Heise, Mark; Subbarao, Kanta; Baric, Ralph S

    2010-04-08

    Severe acute respiratory syndrome coronavirus (SARS-CoV) infection often caused severe end stage lung disease and organizing phase diffuse alveolar damage, especially in the elderly. The virus-host interactions that governed development of these acute end stage lung diseases and death are unknown. To address this question, we evaluated the role of innate immune signaling in protection from human (Urbani) and a recombinant mouse adapted SARS-CoV, designated rMA15. In contrast to most models of viral pathogenesis, infection of type I, type II or type III interferon knockout mice (129 background) with either Urbani or MA15 viruses resulted in clinical disease outcomes, including transient weight loss, denuding bronchiolitis and alveolar inflammation and recovery, identical to that seen in infection of wildtype mice. This suggests that type I, II and III interferon signaling play minor roles in regulating SARS pathogenesis in mouse models. In contrast, infection of STAT1-/- mice resulted in severe disease, high virus titer, extensive pulmonary lesions and 100% mortality by day 9 and 30 post-infection with rMA15 or Urbani viruses, respectively. Non-lethal in BALB/c mice, Urbani SARS-CoV infection in STAT1-/- mice caused disseminated infection involving the liver, spleen and other tissues after day 9. These findings demonstrated that SARS-CoV pathogenesis is regulated by a STAT1 dependent but type I, II and III interferon receptor independent, mechanism. In contrast to a well documented role in innate immunity, we propose that STAT1 also protects mice via its role as an antagonist of unrestrained cell proliferation.

  16. Behavioral Contributions to the Pathogenesis of Type 2 Diabetes

    PubMed Central

    Spruijt-Metz, Donna; Cook, Lauren; O’Reilly, Gillian A.; Page, Kathleen A.; Quinn, Charlene

    2014-01-01

    Behavioral Contributions to the pathogenesis of prediabetes and Type 2 diabetes (T2D) include lifestyle behaviors including dietary intake, exercise, sedentariness, sleep, and stress. The purpose of this paper is to review evidence for the metabolic pathways by which the behavior is linked to T2D. Evidence for interventions which change each of the lifestyle behaviors is discussed. The article will close with a brief discussion on how new technologies may provide opportunities to better understand relationships between moment-to-moment fluctuations in behaviors and diabetes pathogenesis, as well as provide opportunities to personalize and adapt interventions to achieve successful behavior change and maintenance of that change. Especially promising are new technologies which assist in tracking lifestyle behaviors along with clinical and metabolic outcomes. PMID:24604714

  17. Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

    PubMed

    Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

    1970-12-01

    Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

  18. Deficiency of eNOS exacerbates early-stage NAFLD pathogenesis by changing the fat distribution.

    PubMed

    Nozaki, Yuichi; Fujita, Koji; Wada, Koichiro; Yoneda, Masato; Shinohara, Yoshiyasu; Imajo, Kento; Ogawa, Yuji; Kessoku, Takaomi; Nakamuta, Makoto; Saito, Satoru; Masaki, Naohiko; Nagashima, Yoji; Terauchi, Yasuo; Nakajima, Atsushi

    2015-12-17

    Although many factors and molecules that are closely associated with non-alcoholic fatty liver disease (NAFLD)/non-alcoholic steatohepatitis (NASH) have been reported, the role of endothelial nitric oxide synthase (eNOS)-derived nitric oxide (NO) in the pathogenesis of NAFLD/NASH remains unclear. We therefore investigated the role of eNOS-derived NO in NAFLD pathogenesis using systemic eNOS-knockout mice fed a high-fat diet. eNOS-knockout and wild-type mice were fed a basal diet or a high-fat diet for 12 weeks. Lipid accumulation and inflammation were evaluated in the liver, and various factors that are closely associated with NAFLD/NASH and hepatic tissue blood flow were analyzed. Lipid accumulation and inflammation were more extensive in the liver and lipid accumulation was less extensive in the visceral fat tissue in eNOS-knockout mice, compared with wild-type mice, after 12 weeks of being fed a high-fat diet. While systemic insulin resistance was comparable between the eNOS-knockout and wild-type mice fed a high-fat diet, hepatic tissue blood flow was significantly suppressed in the eNOS-knockout mice, compared with the wild-type mice, in mice fed a high-fat diet. The microsomal triglyceride transfer protein activity was down-regulated in eNOS-knockout mice, compared with wild-type mice, in mice fed a high-fat diet. A deficiency of eNOS-derived NO may exacerbate the early-stage of NASH pathogenesis by changing the fat distribution in a mouse model via the regulation of hepatic tissue blood flow.

  19. Alport Syndrome Diagnosis

    MedlinePlus

    ... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

  20. Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

    PubMed

    Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

    2010-08-01

    Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  1. USP15 regulates type I interferon response and is required for pathogenesis of neuroinflammation.

    PubMed

    Torre, Sabrina; Polyak, Maria J; Langlais, David; Fodil, Nassima; Kennedy, James M; Radovanovic, Irena; Berghout, Joanne; Leiva-Torres, Gabriel A; Krawczyk, Connie M; Ilangumaran, Subburaj; Mossman, Karen; Liang, Chen; Knobeloch, Klaus-Peter; Healy, Luke M; Antel, Jack; Arbour, Nathalie; Prat, Alexandre; Majewski, Jacek; Lathrop, Mark; Vidal, Silvia M; Gros, Philippe

    2017-01-01

    Genes and pathways in which inactivation dampens tissue inflammation present new opportunities for understanding the pathogenesis of common human inflammatory diseases, including inflammatory bowel disease, rheumatoid arthritis and multiple sclerosis. We identified a mutation in the gene encoding the deubiquitination enzyme USP15 (Usp15 L749R ) that protected mice against both experimental cerebral malaria (ECM) induced by Plasmodium berghei and experimental autoimmune encephalomyelitis (EAE). Combining immunophenotyping and RNA sequencing in brain (ECM) and spinal cord (EAE) revealed that Usp15 L749R -associated resistance to neuroinflammation was linked to dampened type I interferon responses in situ. In hematopoietic cells and in resident brain cells, USP15 was coexpressed with, and functionally acted together with the E3 ubiquitin ligase TRIM25 to positively regulate type I interferon responses and to promote pathogenesis during neuroinflammation. The USP15-TRIM25 dyad might be a potential target for intervention in acute or chronic states of neuroinflammation.

  2. Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation.

    PubMed

    Shime-Hattori, Akiko; Iida, Tetsuya; Arita, Michiko; Park, Kwon-Sam; Kodama, Toshio; Honda, Takeshi

    2006-11-01

    Vibrio parahaemolyticus RIMD2210633 has two sets of type IV-A pilus genes. One set is similar to that found in other Gram-negative bacteria, such as Pseudomonas aeruginosa, Vibrio cholerae (chitin-regulated pilus; ChiRP), and Vibrio vulnificus. The other is homologous to the genes for the mannose-sensitive hemagglutinin (MSHA) pilus. In this study, we analyzed the effects of the deletions in the pilin genes for each type IV pilus (the ChiRP and the MSHA pilus) on biofilm formation. Although the MSHA pilin mutant formed aggregates, the number of bacteria that attached directly to the coverslip was reduced, suggesting that this pilus contributes to the bacterial attachment to the surface of the coverslip. In contrast, the ChiRP mutant attached to the surface of the coverslip, but did not form aggregates, suggesting that ChiRP plays a role in bacterial agglutination during biofilm formation. These results suggest that the two type IV pili of V. parahaemolyticus contribute to biofilm formation in different ways. Both mutants showed a lower fitness for adsorption onto chitin particles than that of the wild type. Collectively, these data suggest that the use of two type IV pili is a refined strategy of V. parahaemolyticus for survival in natural environments.

  3. Gaucher disease: A G[sup +1][yields]A[sup +1] IVS2 splice donor site mutation causing exon 2 skipping in the acid [beta]-glucosidase mRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Guo-Shun; Grabowski, G.A.

    1992-10-01

    Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less

  4. Evolutionary Dynamics of Pathoadaptation Revealed by Three Independent Acquisitions of the VirB/D4 Type IV Secretion System in Bartonella.

    PubMed

    Harms, Alexander; Segers, Francisca H I D; Quebatte, Maxime; Mistl, Claudia; Manfredi, Pablo; Körner, Jonas; Chomel, Bruno B; Kosoy, Michael; Maruyama, Soichi; Engel, Philipp; Dehio, Christoph

    2017-03-01

    The α-proteobacterial genus Bartonella comprises a group of ubiquitous mammalian pathogens that are studied as a model for the evolution of bacterial pathogenesis. Vast abundance of two particular phylogenetic lineages of Bartonella had been linked to enhanced host adaptability enabled by lineage-specific acquisition of a VirB/D4 type IV secretion system (T4SS) and parallel evolution of complex effector repertoires. However, the limited availability of genome sequences from one of those lineages as well as other, remote branches of Bartonella has so far hampered comprehensive understanding of how the VirB/D4 T4SS and its effectors called Beps have shaped Bartonella evolution. Here, we report the discovery of a third repertoire of Beps associated with the VirB/D4 T4SS of B. ancashensis, a novel human pathogen that lacks any signs of host adaptability and is only distantly related to the two species-rich lineages encoding a VirB/D4 T4SS. Furthermore, sequencing of ten new Bartonella isolates from under-sampled lineages enabled combined in silico analyses and wet lab experiments that suggest several parallel layers of functional diversification during evolution of the three Bep repertoires from a single ancestral effector. Our analyses show that the Beps of B. ancashensis share many features with the two other repertoires, but may represent a more ancestral state that has not yet unleashed the adaptive potential of such an effector set. We anticipate that the effectors of B. ancashensis will enable future studies to dissect the evolutionary history of Bartonella effectors and help unraveling the evolutionary forces underlying bacterial host adaptation. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

    PubMed

    Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

    2018-05-17

    Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

    PubMed

    Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

    2012-01-01

    Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

  7. Gene Discovery through Genomic Sequencing of Brucella abortus

    PubMed Central

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

    2001-01-01

    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

  8. The Bacterial Second Messenger Cyclic di-GMP Regulates Brucella Pathogenesis and Leads to Altered Host Immune Response.

    PubMed

    Khan, Mike; Harms, Jerome S; Marim, Fernanda M; Armon, Leah; Hall, Cherisse L; Liu, Yi-Ping; Banai, Menachem; Oliveira, Sergio C; Splitter, Gary A; Smith, Judith A

    2016-12-01

    Brucella species are facultative intracellular bacteria that cause brucellosis, a chronic debilitating disease significantly impacting global health and prosperity. Much remains to be learned about how Brucella spp. succeed in sabotaging immune host cells and how Brucella spp. respond to environmental challenges. Multiple types of bacteria employ the prokaryotic second messenger cyclic di-GMP (c-di-GMP) to coordinate responses to shifting environments. To determine the role of c-di-GMP in Brucella physiology and in shaping host-Brucella interactions, we utilized c-di-GMP regulatory enzyme deletion mutants. Our results show that a ΔbpdA phosphodiesterase mutant producing excess c-di-GMP displays marked attenuation in vitro and in vivo during later infections. Although c-di-GMP is known to stimulate the innate sensor STING, surprisingly, the ΔbpdA mutant induced a weaker host immune response than did wild-type Brucella or the low-c-di-GMP guanylate cyclase ΔcgsB mutant. Proteomics analysis revealed that c-di-GMP regulates several processes critical for virulence, including cell wall and biofilm formation, nutrient acquisition, and the type IV secretion system. Finally, ΔbpdA mutants exhibited altered morphology and were hypersensitive to nutrient-limiting conditions. In summary, our results indicate a vital role for c-di-GMP in allowing Brucella to successfully navigate stressful and shifting environments to establish intracellular infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

    PubMed Central

    Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

    2015-01-01

    Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

  10. Root canal morphology of South Asian Indian maxillary molar teeth

    PubMed Central

    Singh, Shishir; Pawar, Mansing

    2015-01-01

    Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

  11. Activation of Type I Interferon Pathway in Systemic Lupus Erythematosus: Association with Distinct Clinical Phenotypes

    PubMed Central

    Karageorgas, Theophanis P.; Tseronis, Dimitrios D.; Mavragani, Clio P.

    2011-01-01

    Growing evidence over the last few years suggests a central role of type I IFN pathway in the pathogenesis of systemic autoimmune disorders. Data from clinical and genetic studies in patients with systemic lupus erythematosus (SLE) and lupus-prone mouse models, indicates that the type I interferon system may play a pivotal role in the pathogenesis of several lupus and associated clinical features, such as nephritis, neuropsychiatric and cutaneous lupus, premature atherosclerosis as well as lupus-specific autoantibodies particularly against ribonucleoproteins. In the current paper, our aim is to summarize the latest findings supporting the association of type I IFN pathway with specific clinical manifestations in the setting of SLE providing insights on the potential use of type I IFN as a therapeutic target. PMID:22162633

  12. LeuX tRNA-dependent and -independent mechanisms of Escherichia coli pathogenesis in acute cystitis

    PubMed Central

    Hannan, Thomas J.; Mysorekar, Indira U.; Chen, Swaine L.; Walker, Jennifer N.; Jones, Jennifer M.; Pinkner, Jerome S.; Hultgren, Scott J.; Seed, Patrick C.

    2013-01-01

    Summary Uropathogenic Escherichia coli (UPEC) contain multiple horizontally acquired pathogenicity-associated islands (PAI) implicated in the pathogenesis of urinary tract infection. In a murine model of cystitis, type 1 pili-mediated bladder epithelial invasion and intracellular proliferation are key events associated with UPEC virulence. In this study, we examined the mechanisms by which a conserved PAI contributes to UPEC pathogenesis in acute cystitis. In the human UPEC strain UTI89, spontaneous excision of PAI IIUTI89 disrupts the adjacent leuX tRNA locus. Loss of wild-type leuX-encoded tRNA5Leu significantly delayed, but did not eliminate, FimB recombinase-mediated phase variation of type 1 pili. FimX, an additional FimB-like, leuX-independent recombinase, was also found to mediate type 1 pili phase variation. However, whereas FimX activity is relatively slow in vitro, it is rapid in vivo as a non-piliated strain lacking the other fim recombinases rapidly expressed type 1 pili upon experimental infection. Finally, we found that disruption of leuX, but not loss of PAI IIUTI89 genes, reduced bladder epithelial invasion and intracellular proliferation, independent of type 1 piliation. These findings indicate that the predominant mechanism for preservation of PAI IIUTI89 during the establishment of acute cystitis is maintenance of wild-type leuX, and not PAI IIUTI89 gene content. PMID:18036139

  13. Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

    PubMed

    Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

    2009-06-01

    Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

  14. Matrix Metalloproteinase Dysregulation in the Stria Vascularis of Mice with Alport Syndrome

    PubMed Central

    Gratton, Michael Anne; Rao, Velidi H.; Meehan, Daniel T.; Askew, Charles; Cosgrove, Dominic

    2005-01-01

    Alport syndrome results from mutations in genes encoding collagen α3(IV), α4(IV), or α5(IV) and is characterized by progressive glomerular disease associated with a high-frequency sensorineural hearing loss. Earlier studies of a gene knockout mouse model for Alport syndrome noted thickening of strial capillary basement membranes in the cochlea, suggesting that the stria vascularis is the primary site of cochlear pathogenesis. Here we combine a novel cochlear microdissection technique with molecular analyses to illustrate significant quantitative alterations in strial expression of mRNAs encoding matrix metalloproteinases-2, -9, -12, and -14. Gelatin zymography of extracts from the stria vascularis confirmed these findings. Treatment of Alport mice with a small molecule inhibitor of these matrix metalloproteinases exacerbated strial capillary basement membrane thickening, demonstrating that alterations in basement membrane metabolism result in matrix accumulation in the strial capillary basement membranes. This is the first demonstration of true quantitative analysis of specific mRNAs for matrix metalloproteinases in a cochlear microcompartment. Further, these data suggest that the altered basement membrane composition in Alport stria influences the expression of genes involved in basement membrane metabolism. PMID:15855646

  15. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli*

    PubMed Central

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-01-01

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. PMID:26324721

  16. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli.

    PubMed

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-10-23

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Oxidative Stress, Nitric Oxide, and Diabetes

    PubMed Central

    Pitocco, Dario; Zaccardi, Francesco; Di Stasio, Enrico; Romitelli, Federica; Santini, Stefano A.; Zuppi, Cecilia; Ghirlanda, Giovanni

    2010-01-01

    In the recent decades, oxidative stress has become focus of interest in most biomedical disciplines and many types of clinical research. Increasing evidence from research on several diseases show that oxidative stress is associated with the pathogenesis of diabetes, obesity, cancer, ageing, inflammation, neurodegenerative disorders, hypertension, apoptosis, cardiovascular diseases, and heart failure. Based on this research, the emerging concept is that oxidative stress is the “final common pathway”, through which risk factors of several diseases exert their deleterious effects. Oxidative stress causes a complex dysregulation of cell metabolism and cell-cell homeostasis. In this review, we discuss the role of oxidative stress in the pathogenesis of insulin resistance and beta-cell dysfunction. These are the two most relevant mechanisms in the pathophysiology of type 2 diabetes, and in the pathogenesis of diabetic vascular complications, the leading cause of death in diabetic patients. PMID:20703435

  18. Genome-scale identification of Legionella pneumophila effectors using a machine learning approach.

    PubMed

    Burstein, David; Zusman, Tal; Degtyar, Elena; Viner, Ram; Segal, Gil; Pupko, Tal

    2009-07-01

    A large number of highly pathogenic bacteria utilize secretion systems to translocate effector proteins into host cells. Using these effectors, the bacteria subvert host cell processes during infection. Legionella pneumophila translocates effectors via the Icm/Dot type-IV secretion system and to date, approximately 100 effectors have been identified by various experimental and computational techniques. Effector identification is a critical first step towards the understanding of the pathogenesis system in L. pneumophila as well as in other bacterial pathogens. Here, we formulate the task of effector identification as a classification problem: each L. pneumophila open reading frame (ORF) was classified as either effector or not. We computationally defined a set of features that best distinguish effectors from non-effectors. These features cover a wide range of characteristics including taxonomical dispersion, regulatory data, genomic organization, similarity to eukaryotic proteomes and more. Machine learning algorithms utilizing these features were then applied to classify all the ORFs within the L. pneumophila genome. Using this approach we were able to predict and experimentally validate 40 new effectors, reaching a success rate of above 90%. Increasing the number of validated effectors to around 140, we were able to gain novel insights into their characteristics. Effectors were found to have low G+C content, supporting the hypothesis that a large number of effectors originate via horizontal gene transfer, probably from their protozoan host. In addition, effectors were found to cluster in specific genomic regions. Finally, we were able to provide a novel description of the C-terminal translocation signal required for effector translocation by the Icm/Dot secretion system. To conclude, we have discovered 40 novel L. pneumophila effectors, predicted over a hundred additional highly probable effectors, and shown the applicability of machine learning algorithms for the identification and characterization of bacterial pathogenesis determinants.

  19. Contribution of Streptococcus mutans Strains with Collagen-Binding Proteins in the Presence of Serum to the Pathogenesis of Infective Endocarditis

    PubMed Central

    Otsugu, Masatoshi; Matayoshi, Saaya; Teramoto, Noboru; Nakano, Kazuhiko

    2017-01-01

    ABSTRACT Streptococcus mutans, a major pathogen of dental caries, is considered one of the causative agents of infective endocarditis (IE). Recently, bacterial DNA encoding 120-kDa cell surface collagen-binding proteins (CBPs) has frequently been detected from S. mutans-positive IE patients. In addition, some of the CBP-positive S. mutans strains lacked a 190-kDa protein antigen (PA), whose absence strengthened the adhesion to and invasion of endothelial cells. The interaction between pathogenic bacteria and serum or plasma is considered an important virulence factor in developing systemic diseases; thus, we decided to analyze the pathogenesis of IE induced by S. mutans strains with different patterns of CBP and PA expression by focusing on the interaction with serum or plasma. CBP-positive (CBP+)/PA-negative (PA−) strains showed prominent aggregation in the presence of human serum or plasma, which was significantly greater than that with CBP+/PA-positive (PA+) and CBP-negative (CBP−)/PA+ strains. Aggregation of CBP+/PA− strains was also observed in the presence of a high concentration of type IV collagen, a major extracellular matrix protein in serum. In addition, aggregation of CBP+/PA− strains was drastically reduced when serum complement was inactivated. Furthermore, an ex vivo adherence model and an in vivo rat model of IE showed that extirpated heart valves infected with CBP+/PA− strains displayed prominent bacterial mass formation, which was not observed following infection with CBP+/PA+ and CBP−/PA+ strains. These results suggest that CBP+/PA− S. mutans strains utilize serum to contribute to their pathogenicity in IE. PMID:28947650

  20. Contribution of Streptococcus mutans Strains with Collagen-Binding Proteins in the Presence of Serum to the Pathogenesis of Infective Endocarditis.

    PubMed

    Otsugu, Masatoshi; Nomura, Ryota; Matayoshi, Saaya; Teramoto, Noboru; Nakano, Kazuhiko

    2017-12-01

    Streptococcus mutans , a major pathogen of dental caries, is considered one of the causative agents of infective endocarditis (IE). Recently, bacterial DNA encoding 120-kDa cell surface collagen-binding proteins (CBPs) has frequently been detected from S. mutans -positive IE patients. In addition, some of the CBP-positive S. mutans strains lacked a 190-kDa protein antigen (PA), whose absence strengthened the adhesion to and invasion of endothelial cells. The interaction between pathogenic bacteria and serum or plasma is considered an important virulence factor in developing systemic diseases; thus, we decided to analyze the pathogenesis of IE induced by S. mutans strains with different patterns of CBP and PA expression by focusing on the interaction with serum or plasma. CBP-positive (CBP + )/PA-negative (PA - ) strains showed prominent aggregation in the presence of human serum or plasma, which was significantly greater than that with CBP + /PA-positive (PA + ) and CBP-negative (CBP - )/PA+ strains. Aggregation of CBP + /PA - strains was also observed in the presence of a high concentration of type IV collagen, a major extracellular matrix protein in serum. In addition, aggregation of CBP + /PA - strains was drastically reduced when serum complement was inactivated. Furthermore, an ex vivo adherence model and an in vivo rat model of IE showed that extirpated heart valves infected with CBP + /PA - strains displayed prominent bacterial mass formation, which was not observed following infection with CBP + /PA + and CBP - /PA + strains. These results suggest that CBP + /PA - S. mutans strains utilize serum to contribute to their pathogenicity in IE. Copyright © 2017 American Society for Microbiology.

  1. Characterization of HIV-associated Hodgkin's lymphoma in HIV-infected patients: a single-center experience.

    PubMed

    Ruiz, Marco; Parsons, Christopher; Cole, John

    2012-01-01

    Although the incidence and prevalence of AIDS-defining malignancies has decreased in the era of highly active antiretroviral therapy (HAART), the incidence and prevalence of Hodgkin's lymphoma (HL) in the HIV-infected population continues to rise. Compared with the general population, HIV-infected patients exhibit a 5-10-fold increased risk for developing HL. A retrospective review of charts and electronic records from 2000-2010 at the HIV outpatient clinic (HOP)-Louisiana State University in New Orleans was conducted, and pathologically confirmed cases of HIV-HL were identified within this cohort. We found a prevalence of 6.3 cases per 1,000 patients per year of HIV-HL over a period of 10 years in our HIV outpatient clinic. The mean absolute CD4 count before treatment was 284 cells/mm(3) and after treatment was 194 cells/mm(3). The average time from the diagnosis of HIV infection to the diagnosis of HIV-HL was 7.6 years. The most common histopathologic type was mixed cellularity followed by lymphocytic predominance. The majority of patients had 6 cycles delivered. In terms of HL staging 87% presented with advanced stages (III B or IV). To the best of our knowledge 5 out of the 14 patients remain alive. Patients in our cohort were older than most patients identified in other cohorts. All of our patients had coexisting chronic illnesses associated with inflammation, as well as detectable HIV viral loads and CD4 count >200, suggesting a role for both HIV- and non-HIV-associated inflammation in HIV-HL pathogenesis in this population. The role of HIV virus and other oncogenic viruses (EBV, HPV, and others) in the pathogenesis of Hodgkin's lymphoma in this group of patients needs to be elucidated.

  2. Down-regulation of a hepatic transporter multidrug resistance-associated protein 2 is involved in alteration of pharmacokinetics of glycyrrhizin and its metabolites in a rat model of chronic liver injury.

    PubMed

    Makino, Toshiaki; Ohtake, Nobuhiro; Watanabe, Akito; Tsuchiya, Naoko; Imamura, Sachiko; Iizuka, Seiichi; Inoue, Makoto; Mizukami, Hajime

    2008-07-01

    Glycyrrhizin (GL) has been used to treat chronic hepatitis in Japan and Europe. It is thought to induce pseudoaldosteronism via inhibition of type 2 11beta-hydroxysteroid dehydrogenase (11beta-HSD2) by glycyrrhetinic acid (GA), a major metabolite of GL. A previous clinical study suggested that 3-monoglucuronyl-glycyrrhetinic acid (3MGA), another metabolite of GL, might play a more important role in the pathogenesis of pseudoaldosteronism. The present study evaluates the pharmacokinetics of GL and its metabolites in rats with chronic liver injury induced by a choline-deficient l-amino acid-defined (CDAA) diet to clarify the relationship between 3MGA and pseudoaldosteronism. In rats fed a CDAA diet, plasma concentrations and urinary eliminations of GL and 3MGA were markedly higher than in the rats fed the control diet; the plasma concentration of GA was unaffected when GL was orally administered. Immunohistochemical analysis revealed the suppression of levels of multidrug resistance-associated protein (Mrp) 2 and its localization in the hepatic tissue of rats fed a CDAA diet. When 3MGA was i.v. injected in rats fed a CDAA diet or injected in Mrp2-dysfunctional Eisai hyperbilirubinemic rats, plasma concentrations of 3MGA were higher, and biliary excretion of 3MGA was lower than in each control group. The results suggested that 3MGA would be excreted to bile via hepatic Mrp2 and that its dysfunction would reduce 3MGA clearance. 3MGA accumulated by liver fibrosis resulted in the increased excretion through renal tubule and might be strongly related to the pathogenesis of pseudoaldosteronism because 11beta-HSD2 is expressed in renal tubular epithelial cells.

  3. Quantitative analysis of iris changes after physiologic and pharmacologic mydriasis in a rural Chinese population.

    PubMed

    Zhang, Ye; Li, Si Zhen; Li, Lei; He, Ming Guang; Thomas, Ravi; Wang, Ning Li

    2014-04-24

    To estimate and compare the change in iris cross-sectional area (IA) and iris volume (IV) following physiologic and pharmacologic pupil dilation in primary angle closure suspects (PACS) and normal subjects. Anterior segment-optical coherence tomography (AS-OCT) measurements in light, dark, and following pharmacologic dilation were obtained on 186 PACS and 224 normal subjects examined during the 5-year follow-up of the Handan Eye Study. Iris cross-sectional area, IV, and other biometric parameters calculated using the Zhongshan angle assessment program in the right eyes of all subjects were analyzed. The mean IA and IV decreased in dark compared with light and after pharmacologic dilation in both PACS and normal eyes. This change was statistically significant in normal eyes: light versus pharmacologic dilation for IA (P = 0.038) and for IV, both light versus dark (P = 0.031) and light versus pharmacologic dilation (P = 0.012). A longer axial length (P = 0.028) and a greater change in pupil diameter (PD) (P < 0.001) were associated with a larger decrease of IA for the light to dark comparison. A diagnosis of normal eyes (P = 0.011), larger PD in dark (P = 0.001), and a larger change in PD (P = 0.001) were associated with a larger decrease of IV from light to dark. The differences in iris behavior between PACS and normal rural Chinese subjects following physiologic or pharmacologic pupillary dilation may help provide insights into the pathogenesis of angle closure. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  4. Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

    2012-08-15

    Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

  5. Ferulic acid combined with astragaloside IV protects against vascular endothelial dysfunction in diabetic rats.

    PubMed

    Yin, Yonghui; Qi, Fanghua; Song, Zhenhua; Zhang, Bo; Teng, Jialin

    2014-08-01

    Dysfunction of the endothelium is regarded as an important factor in the pathogenesis of vascular disease in diabetes mellitus (DM). Unfortunately, prevention of the progression of vascular complications of DM remains pessimistic. Ferulic acid and astragaloside IV, isolated from traditional Chinese medicine Angelica sinensis and Radix astragali respectively, exhibit potential cardio-protective and anti-hyperglycemic properties. In the present study, we investigated the protective effects and underlying mechanism of ferulic acid and astragaloside IV against vascular endothelial dysfunction in diabetic rats. After the diabetic rat model was established using streptozotocin, sixty rats were divided into 6 groups (control, model, ferulic acid, astragaloside IV, ferulic acid + astragaloside IV, and metformin) and treated for 10 weeks. Blood samples were collected to measure levels of hemoglobin A1c (HbAlc), triglyceride (TG), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), low density lipoproteins (Ox-LDL), alanine aminotransferase (ALT), aspartate aminotransferase (AST) and creatinine (Cr), nitric oxide (NO) and endothelial nitric oxide synthase (eNOS), and abdominal aorta tissue samples were collected for observing histological morphology changes of endothelium and detecting gene and protein expression of nuclear factor-κB (NF-κB) P65, monocyte chemoattractant protein-1 (MCP-1), and tumor necrosis factor α (TNF-α). We found that ferulic acid combined with astragaloside IV was capable of improving the structure of the aortic endothelium wall, attenuating the increase of HbAlc, TG, TC, LDL-C and Ox-LDL, promoting the release of NO and eNOS, and inhibiting over-activation of MCP-1, TNF-α, and NF-κB P65, without damage to liver and kidney function. In conclusion, ferulic acid combined with astragaloside IV exhibited significant protective effects against vascular endothelial dysfunction in diabetic rats through the NF-κB pathway involving decrease of Ox-LDL, increase of NO and eNOS, and activation of NF-κB P65, MCP-1 and TNF-α.

  6. Neurons of human nucleus accumbens.

    PubMed

    Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

    2011-08-01

    Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

  7. Proteoglycan depletion and size reduction in lesions of early grade chondromalacia of the patella.

    PubMed

    Väätäinen, U; Häkkinen, T; Kiviranta, I; Jaroma, H; Inkinen, R; Tammi, M

    1995-10-01

    To determine the content and molecular size of proteoglycans (PGs) in patellar chondromalacia (CM) and control cartilages as a first step in investigating the role of matrix alterations in the pathogenesis of this disease. Chondromalacia tissue from 10 patients was removed with a surgical knife. Using identical techniques, apparently healthy cartilage of the same site was obtained from 10 age matched cadavers (mean age 31 years in both groups). Additional pathological cartilage was collected from 67 patients with grades II-IV CM (classified according to Outerbridge) using a motorised shaver under arthroscopic control. The shaved cartilage chips were collected with a dense net from the irrigation fluid of the shaver. The content of tissue PGs was determined by Safranin O precipitation or uronic acid content, and the molecular size by mobility on agarose gel electrophoresis. The mean PG content of the CM tissue samples with a knife was dramatically reduced, being only 15% of that in controls. The cartilage chips collected from shaving operations of grades II, III, and IV CM showed a decreasing PG content: 9%, 5%, and 1% of controls, respectively. Electrophoretic analysis of PGs extracted with guanidium chloride from the shaved tissue samples suggested a significantly reduced size of aggrecans in the mild (grade II) lesions. These data show that there is already a dramatic and progressive depletion of PGs in CM grade II lesions. This explains the softening of cartilage, a typical finding in the arthroscopic examination of CM. The PG size reduction observed in grade II implicates proteolytic attack as a factor in the pathogenesis of CM.

  8. Transcription Factor Amr1 Induces Melanin Biosynthesis and Suppresses Virulence in Alternaria brassicicola

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cho, Yangrae; Srivastava, Akhil; Ohm, Robin A.

    2012-05-01

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. Several A. brassicicola genes have been characterized as affecting pathogenesis of Brassica species. To study regulatory mechanisms of pathogenesis, we mined 421 genes in silico encoding putative transcription factors in a machine-annotated, draft genome sequence of A. brassicicola. In this study, targeted gene disruption mutants for 117 of the transcription factor genes were produced and screened. Three of these genes were associated with pathogenesis. Disruption mutants of one gene (AbPacC) were nonpathogenic and another gene (AbVf8) caused lesions less than half the diameter of wild-type lesions. Unexpectedly, mutants of themore » third gene, Amr1, caused lesions with a two-fold larger diameter than the wild type and complementation mutants. Amr1 is a homolog of Cmr1, a transcription factor that regulates melanin biosynthesis in several fungi. We created gene deletion mutants of ?amr1 and characterized their phenotypes. The ?amr1 mutants used pectin as a carbon source more efficiently than the wild type, were melanin-deficient, and more sensitive to UV light and glucanase digestion. The AMR1 protein was localized in the nuclei of hyphae and in highly melanized conidia during the late stage of plant pathogenesis. RNA-seq analysis revealed that three genes in the melanin biosynthesis pathway, along with the deleted Amr1 gene, were expressed at low levels in the mutants. In contrast, many hydrolytic enzyme-coding genes were expressed at higher levels in the mutants than in the wild type during pathogenesis. The results of this study suggested that a gene important for survival in nature negatively affected virulence, probably by a less efficient use of plant cell-wall materials. We speculate that the functions of the Amr1 gene are important to the success of A. brassicicola as a competitive saprophyte and plant parasite.« less

  9. Pathogenesis of Recalcitrant Chronic Rhinosinusitis: The Emerging Role of Innate Immune Cells.

    PubMed

    Kong, Il Gyu; Kim, Dae Woo

    2018-04-01

    Chronic rhinosinusitis (CRS) is a major part of the recalcitrant inflammatory diseases of the upper airway that needs enormous socioeconomic burden. T helper (Th) 2 type immune responses recruiting eosinophils were the most well-known immune players in CRS pathogenesis especially in western countries. By the piling up of a vast amount of researches to elucidate the pathogenic mechanism of CRS recently, heterogeneous inflammatory processes were found to be related to the phenotypes of CRS. Recently more cells other than T cells were in the focus of CRS pathogenesis, such as the epithelial cell, macrophage, innate lymphoid cells, and neutrophils. Here, we reviewed the recent research focusing on the innate immune cells related to CRS pathogenesis.

  10. Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

    PubMed

    Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

    2006-08-01

    The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

  11. Col4a1 mutations cause progressive retinal neovascular defects and retinopathy

    PubMed Central

    Alavi, Marcel V.; Mao, Mao; Pawlikowski, Bradley T.; Kvezereli, Manana; Duncan, Jacque L.; Libby, Richard T.; John, Simon W. M.; Gould, Douglas B.

    2016-01-01

    Mutations in collagen, type IV, alpha 1 (COL4A1), a major component of basement membranes, cause multisystem disorders in humans and mice. In the eye, these include anterior segment dysgenesis, optic nerve hypoplasia and retinal vascular tortuosity. Here we investigate the retinal pathology in mice carrying dominant-negative Col4a1 mutations. To this end, we examined retinas longitudinally in vivo using fluorescein angiography, funduscopy and optical coherence tomography. We assessed retinal function by electroretinography and studied the retinal ultrastructural pathology. Retinal examinations revealed serous chorioretinopathy, retinal hemorrhages, fibrosis or signs of pathogenic angiogenesis with chorioretinal anastomosis in up to approximately 90% of Col4a1 mutant eyes depending on age and the specific mutation. To identify the cell-type responsible for pathogenesis we generated a conditional Col4a1 mutation and determined that primary vascular defects underlie Col4a1-associated retinopathy. We also found focal activation of Müller cells and increased expression of pro-angiogenic factors in retinas from Col4a1+/Δex41mice. Together, our findings suggest that patients with COL4A1 and COL4A2 mutations may be at elevated risk of retinal hemorrhages and that retinal examinations may be useful for identifying patients with COL4A1 and COL4A2 mutations who are also at elevated risk of hemorrhagic strokes. PMID:26813606

  12. Pharmacologically-induced metabolic acidosis: a review.

    PubMed

    Liamis, George; Milionis, Haralampos J; Elisaf, Moses

    2010-05-01

    Metabolic acidosis may occasionally develop in the course of treatment with drugs used in everyday clinical practice, as well as with the exposure to certain chemicals. Drug-induced metabolic acidosis, although usually mild, may well be life-threatening, as in cases of lactic acidosis complicating antiretroviral therapy or treatment with biguanides. Therefore, a detailed medical history, with special attention to the recent use of culprit medications, is essential in patients with acid-base derangements. Effective clinical management can be handled through awareness of the adverse effect of certain pharmaceutical compounds on the acid-base status. In this review, we evaluate relevant literature with regard to metabolic acidosis associated with specific drug treatment, and discuss the clinical setting and underlying pathophysiological mechanisms. These mechanisms involve renal inability to excrete the dietary H+ load (including types I and IV renal tubular acidoses), metabolic acidosis owing to increased H+ load (including lactic acidosis, ketoacidosis, ingestion of various substances, administration of hyperalimentation solutions and massive rhabdomyolysis) and metabolic acidosis due to HCO3- loss (including gastrointestinal loss and type II renal tubular acidosis). Determinations of arterial blood gases, the serum anion gap and, in some circumstances, the serum osmolar gap are helpful in delineating the pathogenesis of the acid-base disorder. In all cases of drug-related metabolic acidosis, discontinuation of the culprit medications and avoidance of readministration is advised.

  13. Novel mutations of the AGXT gene causing primary hyperoxaluria type 1.

    PubMed

    Yuen, Yuet-Ping; Lai, Chi-Kong; Tong, Gensy Mei-Wah; Wong, Ping-Nam; Wong, Francis Kim-Ming; Mak, Siu-Ka; Lo, Kin-Yee; Wong, Andrew Kui-Man; Tong, Sui-Fan; Chan, Yan-Wo; Lam, Ching-Wan

    2004-01-01

    Primary hyperoxaluria type 1 (PH1), an inherited cause of nephrolithiasis, is due to a functional defect of the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). A definitive PH1 diagnosis can be established by analyzing AGT activity in liver tissue or mutation analysis of the AGXT gene. The molecular basis of PH1 in three Chinese patients, two with adult-onset and one with childhood-onset recurrent nephrolithiasis, was established by analyzing the entire AGXT gene. Three novel mutations (c2T>C, c817insAG and c844C>T) and two previously reported mutations (c33insC and 679-IVS6+2delAAgt) were identified. c2T>C converts the initiation codon from ATG to ACG, which predicts significant reduction, if not complete abolition, of protein translation. c817insAG leads to a frameshift and changes the amino acid sequence after codon 274. c844C>T changes glutamine at codon 282 to a termination codon, resulting in protein truncation. This is the first report describing AGXT gene mutations in Chinese patients with PH1. AGXT genotypes cannot fully explain the clinical heterogeneity of PH1, and other factors involved in disease pathogenesis remain to be identified. Our experience emphasizes the importance of excluding PH1 in patients with recurrent nephrolithiasis to avoid delay or inappropriate management.

  14. Environmentally Safe and Effective Processes for Paint Removal

    DTIC Science & Technology

    1995-04-01

    Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

  15. Ehlers-Danlos syndrome type IV

    PubMed Central

    Germain, Dominique P

    2007-01-01

    Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

  16. Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

    PubMed

    Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

    2016-01-01

    Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

  17. Case 22:Type II diabetes

    USDA-ARS?s Scientific Manuscript database

    Diabetes mellitus is characterized by elevated blood glucose levels. It is composed of two types depending on the pathogenesis. Type I diabetes is characterized by insulin deficiency and usually has its onset during childhood or teenage years. This is also called ketosis-prone diabetes. Type II diab...

  18. Molecular insights into primary hyperoxaluria type 1 pathogenesis.

    PubMed

    Cellini, Barbara; Oppici, Elisa; Paiardini, Alessandro; Montioli, Riccardo

    2012-01-01

    Primary hyperoxaluria type 1 (PH1) is a rare autosomal recessive disorder of glyoxylate metabolism caused by the deficiency of liver peroxisomal alanine:glyoxylate aminotransferase (AGT), a pyridoxal 5'-phosphate (PLP)-dependent enzyme. The PH1 pathogenesis is mostly due to single point mutations (more than 150 so far identified) on the AGXT gene, and is characterized by a marked heterogeneity in terms of genotype, enzymatic and clinical phenotypes. This article presents an up to date review of selected aspects of the biochemical properties of the two allelic forms of AGT and of some PH1-causing variants. These recent discoveries highlight the effects at the protein level of the pathogenic mutations, and, together with previous cell biology and clinical data, (i) improve the understanding of the molecular basis of PH1 pathogenesis, and (ii) help to delineate perspectives for predicting the response to pyridoxine treatment or for suggesting new strategies for PH1 patients bearing the analyzed mutations.

  19. Inflammation and angiogenesis in fibrotic lung disease.

    PubMed

    Keane, Michael P; Strieter, Robert M; Lynch, Joseph P; Belperio, John A

    2006-12-01

    The pathogenesis of pulmonary fibrosis is poorly understood. Although inflammation has been presumed to have an important role in the development of fibrosis this has been questioned recently, particularly with regard to idiopathic pulmonary fibrosis (IPF). It is, however, increasingly recognized that the polarization of the inflammatory response toward a type 2 phenotype supports fibroproliferation. Increased attention has been on the role of noninflammatory structural cells such as the fibroblast, myofibroblast, epithelial cell, and endothelial cells. Furthermore, the origin of these cells appears to be multifactorial and includes resident cells, bone marrow-derived cells, and epithelial to mesenchymal transition. Increasing evidence supports the presence of vascular remodeling in fibrotic lung disease, although the precise role in the pathogenesis of fibrosis remains to be determined. Therefore, the pathogenesis of pulmonary fibrosis is complex and involves the interaction of multiple cell types and compartments within the lung.

  20. Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

    PubMed

    Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

    2016-05-01

    To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  1. [Elective reconstruction of thoracoabdominal aortic aneurysm type IV by transabdominal approach].

    PubMed

    Marjanović, Ivan; Jevtić, Miodrag; Misović, Sidor; Sarac, Momir

    2012-01-01

    Thoracoabdominal aortic aneurysm (TAAA) type IV represents an aortic dilatation from the level of the diaphragmatic hiatus to the iliac arteries branches, including visceral branches of the aorta. In the traditional procedure of TAAA type IV repair, the body is opened using thoractomy and laparotomy in order to provide adequate exposure of the descending thoracic and abdominal aorta for safe aortic reconstruction. We reported a 71-year-old man with elective reconstruction of the TAAA type IV performed by transabdominal approach. Computed tomography scans angiography revealed a TAAA type IV with diameter of 62 mm in the region of celiac trunk andsuperior mesenteric artery branching, and the largest diameter of 75 mm in the infrarenal aortic level. The patient comorbidity included a chronic obstructive pulmonary disease and hypertension, therefore he was treated for a prolonged period. In preparation for the planned aortic reconstruction asymptomatic carotid disease (occlusion of the left internal carotid artery and subtotal stenosis of the right internal carotid artery) was diagnosed. Within the same intervention percutaneous transluminal angioplasty with stent placement in right internal carotid artery was made. In general, under endotracheal anesthesia and epidural analgesia, with transabdominal approach performed aortic reconstruction with tubular dakron graft 24 mm were, and reimplantation of visceral aortic branches into the graft performed. Postoperative course was uneventful, and the patient was discharged on the postoperative day 17. Control computed tomography scan angiography performed three months after the operation showed vascular state of the patient to be in order. Complete transabdominal approach to TAAA type IV represents an appropriate substitute for thoracoabdominal approach, without compromising safety of the patient. This approach is less traumatic, especially in patients with impaired pulmonary function, because there is no thoracotomy and any complications that could follow this approach.

  2. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed Central

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

  3. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

  4. Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

    PubMed

    Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

    2007-01-01

    Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

  5. Mechanisms of chiral discrimination by topoisomerase IV

    PubMed Central

    Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

    2009-01-01

    Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

  6. Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

    PubMed

    Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

    2016-11-01

    To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

  7. Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

    PubMed Central

    Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

    2011-01-01

    Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

  8. Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

    PubMed

    Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

    2016-02-28

    Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

  9. Atypical hereditary sensory and autonomic neuropathy type IV with neither mental retardation nor pain insensitivity.

    PubMed

    Jung, Chae Lim; Ki, Chang-Seok; Kim, Byoung Joon; Lee, Jong-Hyuck; Sung, Ki-Sun; Kim, Jong-Won; Park, Youn-Soo

    2013-12-01

    Hereditary sensory and autonomic neuropathy type IV is an autosomal recessive disorder characterized by severe mental retardation and self-mutilation-related complications. Recently, we investigated a 16-year-old Korean boy with normal intelligence. He had preserved pain sensation but was suspected of having hereditary sensory and autonomic neuropathy type IV because of the recurrent bone fractures and painless joint destruction in the absence of any predisposing medical conditions. Genetic analysis of the NTRK1 gene revealed compound heterozygous mutations including c.851-33T>A and c.2303C>T (p.Pro768Leu) in the NTRK1 gene. The p.Pro768Leu mutation has been identified in 2 Japanese patients with a mild phenotype. Therefore, although it is rare, hereditary sensory and autonomic neuropathy type IV should be considered in patients with recurrent bone fractures and painless joint destruction who do not have any predisposing conditions even when they do not have typical clinical features such as mental retardation or pain insensitivity.

  10. Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

    PubMed

    Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

    2017-05-04

    Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

  11. [Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

    PubMed

    Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

    2014-10-01

    To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

  12. Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

    PubMed Central

    Roos, David S.; Pohlschröder, Mechthild

    2011-01-01

    Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV pilus-like structures. Its use in combination with other currently available computational tools should improve the accuracy of predicting the subcellular localization of bacterial proteins. PMID:22216142

  13. Differences between T cell-type and natural killer cell-type chronic active Epstein-Barr virus infection.

    PubMed

    Kimura, Hiroshi; Hoshino, Yo; Hara, Shinya; Sugaya, Naomi; Kawada, Jun-Ichi; Shibata, Yukiko; Kojima, Seiji; Nagasaka, Tetsuro; Kuzushima, Kiyotaka; Morishima, Tsuneo

    2005-02-15

    Infections of T cells and natural killer (NK) cells play a central role in the pathogenesis of chronic active Epstein-Barr virus (CAEBV) infection. To characterize the virologic and cytokine profiles of T cell-type and NK cell-type infection, 39 patients with CAEBV infection were analyzed. Patients with T cell-type infection had higher titers of immunoglobulin G against early and late EBV antigens, suggesting lytic cycle infection. However, the pattern of EBV gene expression was latency type II; BZLF1, which is a hallmark of lytic cycle infection, could not be detected in any patients, regardless of infection type. Patients with CAEBV infection had high concentrations of proinflammatory, T helper cell type 1, and anti-inflammatory cytokines. The cytokine profile in patients with NK cell-type infection was similar to that in patients with T cell-type infection, but the concentration of IL-13 was high in patients with NK cell-type infection. These findings should help to clarify the pathogenesis of CAEBV infection and facilitate the development of more-effective treatments.

  14. Accentuated hyperparathyroidism in type II Bartter syndrome.

    PubMed

    Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

    2016-07-01

    Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

  15. Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, K. R.

    1994-01-01

    Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

  16. Infant botulism: review and clinical update.

    PubMed

    Rosow, Laura K; Strober, Jonathan B

    2015-05-01

    Botulism is a rare neuromuscular condition, and multiple clinical forms are recognized. Infant botulism was first identified in the 1970s, and it typically occurs in infants younger than 1 year of age who ingest Clostridium botulinum spores. A specific treatment for infant botulism, intravenous botulism immunoglobulin (BIG-IV or BabyBIG®), was developed in 2003, and this treatment has substantially decreased both morbidity and hospital costs associated with this illness. This article will review the pathogenesis of infant botulism as well as the epidemiology, clinical manifestations, diagnosis, and treatment of this condition. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

    PubMed

    Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

    2009-06-01

    Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

  18. Smallpox infections during pregnancy, lessons on pathogenesis from nonpregnant animal models of infection.

    PubMed

    Hassett, Daniel E

    2003-10-01

    Both vaccinated and unvaccinated women during pregnancy who contract variola virus, the causative agent of smallpox, suffer much higher mortality rates than nonpregnants. Furthermore, acute maternal smallpox leads to spontaneous abortion, premature termination of pregnancy and early postnatal infant mortality. The mechanisms governing the abortifacient activity of smallpox, as well as the enhanced susceptibility of gestating women to lethal disease, have remained largely unexamined. Experimental poxvirus infections in nonpregnant small animal models have revealed that T helper type 1 (TH1) cytokines promote efficient resolution of these infections whereas type 2 (TH2) cytokines enhance viral pathogenesis. These data, combined with recent understanding of how the immune system is modulated by pregnancy, may offer important clues as to the increased pathogenesis of variola in pregnant women. The aim of this review is to bring together the current literature on the effects of poxvirus infections in nonpregnant hosts, as well as the effects of pregnancy on the immune system, in order to develop unifying concepts that may provide insight into the pathogenesis of variola during pregnancy and why prior vaccination with vaccinia virus the live anti-variola vaccine offers less protection to pregnant women and their unborn children.

  19. TSLP: A Key Regulator of Asthma Pathogenesis.

    PubMed

    West, Erin E; Kashyap, Mohit; Leonard, Warren J

    2012-12-01

    Asthma is a complex disorder of the airways that is characterized by T helper type 2 (Th2) inflammation. The pleiotrophic cytokine TSLP has emerged as an important player involved in orchestrating the inflammation seen in asthma and other atopic diseases. Early research elucidated the role of TSLP on CD4 + T cells, and recent work has revealed the impact of TSLP on multiple cell types. Furthermore, TSLP plays an important role in the sequential progression of atopic dermatitis to asthma, clarifying the key role of TSLP in the pathogenesis of asthma, a finding with therapeutic implications.

  20. Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

    NASA Astrophysics Data System (ADS)

    Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

    1996-08-01

    Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

  1. The Role of Caveolin 1 in HIV Infection and Pathogenesis.

    PubMed

    Mergia, Ayalew

    2017-05-26

    Caveolin 1 (Cav-1) is a major component of the caveolae structure and is expressed in a variety of cell types including macrophages, which are susceptible to human immunodeficiency virus (HIV) infection. Caveolae structures are present in abundance in mechanically stressed cells such as endothelial cells and adipocytes. HIV infection induces dysfunction of these cells and promotes pathogenesis. Cav-1 and the caveolae structure are believed to be involved in multiple cellular processes that include signal transduction, lipid regulation, endocytosis, transcytosis, and mechanoprotection. Such a broad biological role of Cav-1/caveolae is bound to have functional cross relationships with several molecular pathways including HIV replication and viral-induced pathogenesis. The current review covers the relationship of Cav-1 and HIV in respect to viral replication, persistence, and the potential role in pathogenesis.

  2. DNA methylation links genetics, fetal environment, and an unhealthy lifestyle to the development of type 2 diabetes.

    PubMed

    Nilsson, Emma; Ling, Charlotte

    2017-01-01

    Type 2 diabetes is a complex trait with both environmental and hereditary factors contributing to the overall pathogenesis. One link between genes, environment, and disease is epigenetics influencing gene transcription and, consequently, organ function. Genome-wide studies have shown altered DNA methylation in tissues important for glucose homeostasis including pancreas, liver, skeletal muscle, and adipose tissue from subjects with type 2 diabetes compared with nondiabetic controls. Factors predisposing for type 2 diabetes including an adverse intrauterine environment, increasing age, overweight, physical inactivity, a family history of the disease, and an unhealthy diet have all shown to affect the DNA methylation pattern in target tissues for insulin resistance in humans. Epigenetics including DNA methylation may therefore improve our understanding of the type 2 diabetes pathogenesis, contribute to development of novel treatments, and be a useful tool to identify individuals at risk for developing the disease.

  3. Increased recovery rates of phosphocreatine and inorganic phosphate after isometric contraction in oxidative muscle fibers and elevated hepatic insulin resistance in homozygous carriers of the A-allele of FTO rs9939609.

    PubMed

    Grunnet, Louise G; Brøns, Charlotte; Jacobsen, Stine; Nilsson, Emma; Astrup, Arne; Hansen, Torben; Pedersen, Oluf; Poulsen, Pernille; Quistorff, Bjørn; Vaag, Allan

    2009-02-01

    Recent studies identified the rs9939609 A-allele of the FTO (fat mass and obesity associated) gene as being associated with obesity and type 2 diabetes. We studied the role of the A-allele in the regulation of peripheral organ functions involved in the pathogenesis of obesity and type 2 diabetes. Forty-six young men underwent a hyperinsulinemic euglycemic clamp with excision of skeletal muscle biopsies, an iv glucose tolerance test, 31phosphorous magnetic resonance spectroscopy, and 24-h whole body metabolism was measured in a respiratory chamber. The FTO rs9939609 A-allele was associated with elevated fasting blood glucose and plasma insulin, hepatic insulin resistance, and shorter recovery half-times of phosphocreatine and inorganic phosphate after exercise in a primarily type I muscle. These relationships--except for fasting insulin--remained significant after correction for body fat percentage. The risk allele was not associated with fat distribution, peripheral insulin sensitivity, insulin secretion, 24-h energy expenditure, or glucose and fat oxidation. The FTO genotype did not influence the mRNA expression of FTO or a set of key nuclear or mitochondrially encoded genes in skeletal muscle during rest. Increased energy efficiency--and potentially increased mitochondrial coupling--as suggested by faster recovery rates of phosphocreatine and inorganic phosphate in oxidative muscle fibers may contribute to the increased risk of obesity and type 2 diabetes in homozygous carriers of the FTO A-risk allele. Hepatic insulin resistance may represent the key metabolic defect responsible for mild elevations of fasting blood glucose associated with the FTO phenotype.

  4. International Life Science Institute North America Cronobacter (Formerly Enterobacter sakazakii) isolate set.

    PubMed

    Ivy, Reid A; Farber, Jeffrey M; Pagotto, Franco; Wiedmann, Martin

    2013-01-01

    Foodborne pathogen isolate collections are important for the development of detection methods, for validation of intervention strategies, and to develop an understanding of pathogenesis and virulence. We have assembled a publicly available Cronobacter (formerly Enterobacter sakazakii) isolate set that consists of (i) 25 Cronobacter sakazakii isolates, (ii) two Cronobacter malonaticus isolates, (iii) one Cronobacter muytjensii isolate, which displays some atypical phenotypic characteristics, biochemical profiles, and colony color on selected differential media, and (iv) two nonclinical Enterobacter asburiae isolates, which show some phenotypic characteristics similar to those of Cronobacter spp. The set consists of human (n = 10), food (n = 11), and environmental (n = 9) isolates. Analysis of partial 16S rDNA sequence and seven-gene multilocus sequence typing data allowed for reliable identification of these isolates to species and identification of 14 isolates as sequence type 4, which had previously been shown to be the most common C. sakazakii sequence type associated with neonatal meningitis. Phenotypic characterization was carried out with API 20E and API 32E test strips and streaking on two selective chromogenic agars; isolates were also assessed for sorbitol fermentation and growth at 45°C. Although these strategies typically produced the same classification as sequence-based strategies, based on a panel of four biochemical tests, one C. sakazakii isolate yielded inconclusive data and one was classified as C. malonaticus. EcoRI automated ribotyping and pulsed-field gel electrophoresis (PFGE) with XbaI separated the set into 23 unique ribotypes and 30 unique PFGE types, respectively, indicating subtype diversity within the set. Subtype and source data for the collection are publicly available in the PathogenTracker database (www. pathogentracker. net), which allows for continuous updating of information on the set, including links to publications that include information on isolates from this collection.

  5. Early-onset obsessive-compulsive disorder and personality disorders in adulthood.

    PubMed

    Maina, Giuseppe; Albert, Umberto; Salvi, Virginio; Pessina, Enrico; Bogetto, Filippo

    2008-03-15

    Obsessive-compulsive disorder (OCD) often emerges in childhood or adolescence. The aim of the present study was to evaluate whether adult patients with prepuberal onset differ from subjects with later onset in terms of personality disorder comorbidity. The Structured Clinical Interview for DSM-IV Axis II Disorders was used to assess 148 patients with a principal diagnosis of OCD according to the Structured Clinical Interview for DSM-IV Axis I Disorders. The following two subgroups of subjects were selected according to the age at onset of symptomatology: patients with an early-onset (< or =10 years), and patients with a later onset (> or =17 years). Of the 148 patients screened for the present study, 33 (22.3%) had an early onset and 1369 (46.6%) had a later onset. With regard to personality disorders, early-onset patients showed more OC personality disorders (OCPD) than later onset patients. Our finding suggests that OCD in childhood increases the risk for developing OCPD in adulthood, or that early-onset OCD and OCPD share a common pathogenesis.

  6. Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

    PubMed Central

    Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

    2005-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

  7. Signal transduction of Helicobacter pylori during interaction with host cell protein receptors of epithelial and immune cells

    PubMed Central

    Pachathundikandi, Suneesh Kumar; Tegtmeyer, Nicole; Backert, Steffen

    2013-01-01

    Helicobacter pylori infections can induce pathologies ranging from chronic gastritis, peptic ulceration to gastric cancer. Bacterial isolates harbor numerous well-known adhesins, vacuolating cytotoxin VacA, protease HtrA, urease, peptidoglycan, and type IV secretion systems (T4SS). It appears that H. pylori targets more than 40 known host protein receptors on epithelial or immune cells. A series of T4SS components such as CagL, CagI, CagY, and CagA can bind to the integrin α5β1 receptor. Other targeted membrane-based receptors include the integrins αvβ3, αvβ5, and β2 (CD18), RPTP-α/β, GP130, E-cadherin, fibronectin, laminin, CD46, CD74, ICAM1/LFA1, T-cell receptor, Toll-like receptors, and receptor tyrosine kinases EGFR, ErbB2, ErbB3, and c-Met. In addition, H. pylori is able to activate the intracellular receptors NOD1, NOD2, and NLRP3 with important roles in innate immunity. Here we review the interplay of various bacterial factors with host protein receptors. The contribution of these interactions to signal transduction and pathogenesis is discussed. PMID:24280762

  8. Flaviviral NS4b, chameleon and jack-in-the-box roles in viral replication and pathogenesis, and a molecular target for antiviral intervention.

    PubMed

    Zmurko, Joanna; Neyts, Johan; Dallmeier, Kai

    2015-07-01

    Dengue virus and other flaviviruses such as the yellow fever, West Nile, and Japanese encephalitis viruses are emerging vector-borne human pathogens that affect annually more than 100 million individuals and that may cause debilitating and potentially fatal hemorrhagic and encephalitic diseases. Currently, there are no specific antiviral drugs for the treatment of flavivirus-associated disease. A better understanding of the flavivirus-host interactions during the different events of the flaviviral life cycle may be essential when developing novel antiviral strategies. The flaviviral non-structural protein 4b (NS4b) appears to play an important role in flaviviral replication by facilitating the formation of the viral replication complexes and in counteracting innate immune responses such as the following: (i) type I IFN signaling; (ii) RNA interference; (iii) formation of stress granules; and (iv) the unfolded protein response. Intriguingly, NS4b has recently been shown to constitute an excellent target for the selective inhibition of flavivirus replication. We here review the current knowledge on NS4b. © 2015 The Authors. Reviews in Medical Virology published by John Wiley & Sons Ltd.

  9. Flaviviral NS4b, chameleon and jack‐in‐the‐box roles in viral replication and pathogenesis, and a molecular target for antiviral intervention

    PubMed Central

    Zmurko, Joanna; Dallmeier, Kai

    2015-01-01

    Summary Dengue virus and other flaviviruses such as the yellow fever, West Nile, and Japanese encephalitis viruses are emerging vector‐borne human pathogens that affect annually more than 100 million individuals and that may cause debilitating and potentially fatal hemorrhagic and encephalitic diseases. Currently, there are no specific antiviral drugs for the treatment of flavivirus‐associated disease. A better understanding of the flavivirus–host interactions during the different events of the flaviviral life cycle may be essential when developing novel antiviral strategies. The flaviviral non‐structural protein 4b (NS4b) appears to play an important role in flaviviral replication by facilitating the formation of the viral replication complexes and in counteracting innate immune responses such as the following: (i) type I IFN signaling; (ii) RNA interference; (iii) formation of stress granules; and (iv) the unfolded protein response. Intriguingly, NS4b has recently been shown to constitute an excellent target for the selective inhibition of flavivirus replication. We here review the current knowledge on NS4b. © 2015 The Authors. Reviews in Medical Virology published by John Wiley & Sons Ltd. PMID:25828437

  10. Searching for a treatment for Alport syndrome using mouse models

    PubMed Central

    Katayama, Kan; Nomura, Shinsuke; Tryggvason, Karl; Ito, Masaaki

    2014-01-01

    Alport syndrome (AS) is a hereditary nephritis caused by mutations in COL4A3, COL4A4 or COL4A5 encoding the type IV collagen α3, α4, and α5 chains, which are major components of the glomerular basement membrane. About 20 years have passed since COL4A3, COL4A4, and COL4A5 were identified and the first Alport mouse model was developed using a knockout approach. The phenotype of Alport mice is similar to that of Alport patients, including characteristic thickening and splitting of the glomerular basement membrane. Alport mice have been widely used to study the pathogenesis of AS and to develop effective therapies. In this review, the newer therapies for AS, such as pharmacological interventions, genetic approaches and stem cell therapies, are discussed. Although some stem cell therapies have been demonstrated to slow the renal disease progression in Alport mice, these therapies demand continual refinement as research advances. In terms of the pharmacological drugs, angiotensin-converting enzyme inhibitors have been shown to be effective in Alport mice. Novel therapies that can provide a better outcome or lead to a cure are still awaited. PMID:25374816

  11. Searching for a treatment for Alport syndrome using mouse models.

    PubMed

    Katayama, Kan; Nomura, Shinsuke; Tryggvason, Karl; Ito, Masaaki

    2014-11-06

    Alport syndrome (AS) is a hereditary nephritis caused by mutations in COL4A3, COL4A4 or COL4A5 encoding the type IV collagen α3, α4, and α5 chains, which are major components of the glomerular basement membrane. About 20 years have passed since COL4A3, COL4A4, and COL4A5 were identified and the first Alport mouse model was developed using a knockout approach. The phenotype of Alport mice is similar to that of Alport patients, including characteristic thickening and splitting of the glomerular basement membrane. Alport mice have been widely used to study the pathogenesis of AS and to develop effective therapies. In this review, the newer therapies for AS, such as pharmacological interventions, genetic approaches and stem cell therapies, are discussed. Although some stem cell therapies have been demonstrated to slow the renal disease progression in Alport mice, these therapies demand continual refinement as research advances. In terms of the pharmacological drugs, angiotensin-converting enzyme inhibitors have been shown to be effective in Alport mice. Novel therapies that can provide a better outcome or lead to a cure are still awaited.

  12. Type IV secretion system of Brucella spp. and its effectors

    PubMed Central

    Ke, Yuehua; Wang, Yufei; Li, Wengfeng; Chen, Zeliang

    2015-01-01

    Brucella spp. are intracellular bacterial pathogens that cause infection in domestic and wild animals. They are often used as model organisms to study intracellular bacterial infections. Brucella VirB T4SS is a key virulence factor that plays important roles in mediating intracellular survival and manipulating host immune response to infection. In this review, we discuss the roles of Brucella VirB T4SS and 15 effectors that are proposed to be crucial for Brucella pathogenesis. VirB T4SS regulates the inflammation response and manipulates vesicle trafficking inside host cells. VirB T4SS also plays crucial roles in the inhibition of the host immune response and intracellular survival during infection. Here, we list the key molecular events in the intracellular life cycle of Brucella that are potentially targeted by the VirB T4SS effectors. Elucidating the functions of these effectors will help clarify the molecular role of T4SS during infection. Furthermore, studying the effectors secreted by Brucella spp. might provide insights into the mechanisms used by the bacteria to hijack the host signaling pathways and aid in the development of better vaccines and therapies against brucellosis. PMID:26528442

  13. Type IV secretion system of Brucella spp. and its effectors.

    PubMed

    Ke, Yuehua; Wang, Yufei; Li, Wengfeng; Chen, Zeliang

    2015-01-01

    Brucella spp. are intracellular bacterial pathogens that cause infection in domestic and wild animals. They are often used as model organisms to study intracellular bacterial infections. Brucella VirB T4SS is a key virulence factor that plays important roles in mediating intracellular survival and manipulating host immune response to infection. In this review, we discuss the roles of Brucella VirB T4SS and 15 effectors that are proposed to be crucial for Brucella pathogenesis. VirB T4SS regulates the inflammation response and manipulates vesicle trafficking inside host cells. VirB T4SS also plays crucial roles in the inhibition of the host immune response and intracellular survival during infection. Here, we list the key molecular events in the intracellular life cycle of Brucella that are potentially targeted by the VirB T4SS effectors. Elucidating the functions of these effectors will help clarify the molecular role of T4SS during infection. Furthermore, studying the effectors secreted by Brucella spp. might provide insights into the mechanisms used by the bacteria to hijack the host signaling pathways and aid in the development of better vaccines and therapies against brucellosis.

  14. Suppression of hedgehog signaling regulates hepatic stellate cell activation and collagen secretion.

    PubMed

    Li, Tao; Leng, Xi-Sheng; Zhu, Ji-Ye; Wang, Gang

    2015-01-01

    Hepatic stellate cells (HSCs) play an important role in liver fibrosis. This study investigates the expression of hedgehog in HSC and the role of hedgehog signaling on activation and collagen secretion of HSC. Liver ex vivo perfusion with collagenase IV and density gradient centrifugation were used to isolate HSC. Expression of hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 in HSC were detected by RT-PCR. Hedgehog siRNA vectors targeting Ihh, Smo and Gli2 were constructed and transfected into HSC respectively. Suppression of hedgehog signaling were detected by SYBR Green fluorescence quantitative RT-PCR. Effects of hedgehog signaling inhibition on HSC activation and collagen I secretion were analyzed. Hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 were expressed in HSC. siRNA vectors targeting Ihh, Smo and Gli2 were successfully constructed and decreased target gene expression. Suppression of hedgehog signaling significantly decreased the expression of α-SMA in HSC (P<0.01). Collagen type I secretion of HSC were also significantly decreased (P<0.01). In summary, HSC activation and collagen secretion can be regulated by hedgehog signaling. Hedgehog may play a role in the pathogenesis of liver fibrosis.

  15. The Rab-binding Profiles of Bacterial Virulence Factors during Infection*

    PubMed Central

    So, Ernest C.; Schroeder, Gunnar N.; Carson, Danielle; Mattheis, Corinna; Mousnier, Aurélie; Broncel, Malgorzata; Tate, Edward W.; Frankel, Gad

    2016-01-01

    Legionella pneumophila, the causative agent of Legionnaire's disease, uses its type IV secretion system to translocate over 300 effector proteins into host cells. These effectors subvert host cell signaling pathways to ensure bacterial proliferation. Despite their importance for pathogenesis, the roles of most of the effectors are yet to be characterized. Key to understanding the function of effectors is the identification of host proteins they bind during infection. We previously developed a novel tandem-affinity purification (TAP) approach using hexahistidine and BirA-specific biotinylation tags for isolating translocated effector complexes from infected cells whose composition were subsequently deciphered by mass spectrometry. Here we further advanced the workflow for the TAP approach and determined the infection-dependent interactomes of the effectors SidM and LidA, which were previously reported to promiscuously bind multiple Rab GTPases in vitro. In this study we defined a stringent subset of Rab GTPases targeted by SidM and LidA during infection, comprising of Rab1A, 1B, 6, and 10; in addition, LidA targets Rab14 and 18. Taken together, this study illustrates the power of this approach to profile the intracellular interactomes of bacterial effectors during infection. PMID:26755725

  16. Association of locally produced IL10 and TGFb1 with tumor size, histological type and presence of metastases in patients with lung carcinoma.

    PubMed

    Karlicic, Vukoica; Vukovic, Jelena; Stanojevic, Ivan; Sotirovic, Jelena; Peric, Aleksandar; Jovic, Milena; Cvijanovic, Vlado; Djukic, Mirjana; Banovic, Tatjana; Vojvodic, Danilo

    2016-01-01

    Advanced lung carcinoma is charasterized with fast disease progression. Interleukin (IL)10 and transforming growth factor (TGF)b1 are immunosuppressive mediators and their role in lung carcinoma pathogenesis and in the antitumor response has not yet been elucidated. The purpose of this study was to correlate IL10 and TGFb1 levels in the serum and lung tumor microcirculation with clinical stage, disease extent, histological features and TNM stage. The study included 41 lung cancer patients in clinical stage III and IV. Histological type was determined immunohistochemically, while tumor size, localization and dissemination were determined radiologically by multislice computerized tomography (MSCT). IL10 and TGFb1 levels were quantified with commercial flow cytometric test in serum and lung tumor microcirculation samples. Non small cell lung cancer (NSCLC) patients had significantly elevated TGFb1 while small cell lung cancer (SCLC) patients had significantly increased IL10 in tumor microcirculation. IL10 was significantly elevated in patients with the largest tumors, as well as in patients with III clinical stage and without metastases, both in the serum and tumor microcirculation. TGFb1 was significantly increased in serum and tumor microcirculation in patients with larger tumors. We found significant correlation between these two immunosuppressive cytokines, IL10 and TGFb1, in tumor microcirculation but not in patient serum samples. IL10 and TGFb1 in systemic and tumor microcirculation are significantly associated with particular histological type of lung cancer, tumor size and degree of disease extent.

  17. (2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, D.; Wang, L.; Beconi, M.

    2010-11-10

    A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

  18. Genetics Home Reference: mucolipidosis type IV

    MedlinePlus

    ... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

  19. Plant-bacterial pathogen interactions mediated by type III effectors.

    PubMed

    Feng, Feng; Zhou, Jian-Min

    2012-08-01

    Effectors secreted by the bacterial type III system play a central role in the interaction between Gram-negative bacterial pathogens and their host plants. Recent advances in the effector studies have helped cementing several key concepts concerning bacterial pathogenesis, plant immunity, and plant-pathogen co-evolution. Type III effectors use a variety of biochemical mechanisms to target specific host proteins or DNA for pathogenesis. The identifications of their host targets led to the identification of novel components of plant innate immune system. Key modules of plant immune signaling pathways such as immune receptor complexes and MAPK cascades have emerged as a major battle ground for host-pathogen adaptation. These modules are attacked by multiple type III effectors, and some components of these modules have evolved to actively sense the effectors and trigger immunity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Screening of the USH1G gene among Spanish patients with Usher syndrome. Lack of mutations and evidence of a minor role in the pathogenesis of the syndrome.

    PubMed

    Aller, Elena; Jaijo, Teresa; Beneyto, Magdalena; Nájera, Carmen; Morera, Constantino; Pérez-Garrigues, Herminio; Ayuso, Carmen; Millán, Jose

    2007-09-01

    The Usher syndrome (USH) is an autosomal recessive hereditary disorder characterized by the association of sensorineural hearing loss, retinitis pigmentosa (RP) and, in some cases, vestibular dysfunction. The USH1G gene, encoding SANS, has been found to cause both Usher syndrome type I and atypical Usher syndrome. 109 Spanish unrelated patients suffering from Usher syndrome type I, type II, type III and unclassified Usher syndrome were screened for mutations in this gene, but only eight different changes without a clear pathogenic effect have been detected. Based on these results as well as previous studies in other populations where mutational analysis of this gene has been carried out, one can conclude that USH1G has a minor involvement in Usher syndrome pathogenesis.

  1. Mass loss in the interacting semi-detached binary delta librae

    NASA Technical Reports Server (NTRS)

    Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

    1995-01-01

    The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

  2. Hypothalamic pathogenesis of type 2 diabetes.

    PubMed

    Koshiyama, Hiroyuki; Hamamoto, Yoshiyuki; Honjo, Sachiko; Wada, Yoshiharu; Lkeda, Hiroki

    2006-01-01

    There have recently been increasing experimental and clinical evidences suggesting that hypothalamic dysregulation may be one of the underlying mechanisms of abnormal glucose metabolism. First, increased hypothalamic-pituitary-adrenal axis activity induced by uncontrollable excess stress may cause diabetes mellitus as well as dyslipidemia, visceral obesity, and osteoporosis with some resemblance to Cushing's disease. Second, several molecules are known to be expressed both in pancreas and hypothalamus; adenosine triphosphate-sensitive potassium channels, malonyl-CoA, glucokinase, and AMP-activated protein kinase. Those molecules appear to form an integrated hypothalamic system, which may sense hypothalamic fuel status, especially glucose level, and inhibit action of insulin on hepatic gluconeogenesis, thereby forming a brain-liver circuit. Third, hypothalamic resistance to insulin as an adiposity signal may be involved in pathogenesis of peripheral insulin resistance. The results with mice with a neuron-specific disruption of the insulin receptor gene or those lacking insulin receptor substrate 2 in hypothalamus supported this possibility. Finally, it has very recently been suggested that dysregulation of clock genes in hypothalamus may cause abnormal glucose metabolism. Taken together, it is plausible that some hypothalamic abnormality may underlie at least some portion of type 2 diabetes or insulin resistance in humans, and this viewpoint of hypothalamic pathogenesis of type 2 diabetes may lead to the development of new drugs for type 2 diabetes.

  3. Structural studies of a bifunctional inhibitor of neprilysin and DPP-IV.

    PubMed

    Oefner, Christian; Pierau, Sabine; Schulz, Henk; Dale, Glenn E

    2007-09-01

    Neutral endopeptidase (NEP) is the major enzyme involved in the metabolic inactivation of a number of bioactive peptides including the enkephalins, substance P, endothelin, bradykinin and atrial natriuretic factor, as well as the incretin hormone glucagon-like peptide 1 (GLP-1), which is a potent stimulator of insulin secretion. The activity of GLP-1 is also rapidly abolished by the serine protease dipeptidyl peptidase IV (DPP-IV), which led to an elevated interest in inhibitors of this enzyme for the treatment of type II diabetes. A dual NEP/DPP-IV inhibitor concept is proposed, offering an alternative strategy for the treatment of type 2 diabetes. Here, the synthesis and crystal structures of the soluble extracellular domain of human NEP (residues 52-749) complexed with the NEP, competitive and potent dual NEP/DPP-IV inhibitor MCB3937 are described.

  4. [Mucolipidoses type IV in a patient with mapuche ancestry].

    PubMed

    Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

    2008-07-01

    We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

  5. Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

    PubMed

    Mak, Ki M; Mei, Rena

    2017-08-01

    Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  6. Odorant transfer characteristics of white bread during baking.

    PubMed

    Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

    2011-01-01

    The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

  7. Imaging characteristics and pathogenesis of intracranial artery stenosis in patients with acute cerebral infarction

    PubMed Central

    Xu, Wenyuan; Xie, Ning; Zhang, Cheng; Huang, Qin

    2018-01-01

    The current study aimed to investigate the imaging characteristics and pathogenesis of intracranial artery stenosis in patients with acute cerebral infarction. In total, 84 patients diagnosed with acute cerebral infarction were recruited. Magnetic resonance angiography was performed to detect the existence of intracranial artery stenosis or occlusion. In addition, magnetic resonance imaging and diffusion weighted imaging were employed to analyze the infarction types and characteristics. In the majority of patients, the infarction resulted from internal carotid stenosis (77 cases; 91.7%), while it was caused by vertebral artery stenosis in a small number of cases (7 cases; 8.3%). Multiple infarction was identified the most common type of infarction among all cases (69.0%). The most common types of infarctions in the internal carotid system were multiple infarction implicating both the cortex and centrum ovale (23.4%), and internal watershed infarction (22.1%). Although the number of cases was relatively small, multiple infarction was observed to have a high incidence in the vertebral artery system. Bedside electrocardiogram was also recorded to determine the sinus rhythm and examine the abnormal hemodynamics. The sinus bradycardia rate of patients with multiple infarction was markedly greater in comparison with that in single infarction patients (χ2=0.01, P<0.05). Transcranial Doppler plus microembolus monitoring was utilized to explore the possible pathogenesis of all types of infarctions, such as arterial embolization. As compared with the single infarction patients, the embolus rate in patients with multiple infarction was notably increased by ~3.7-fold (χ2=8.65, P<0.05). In conclusion, the cerebral infarction was common in the internal carotid system, with multiple infarction observed in the majority of cases. The pathogenesis of cerebral infarction included arterial embolization and inadequate hemoperfusion. PMID:29725389

  8. Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

    PubMed

    Busek, P; Stremenová, J; Krepela, E; Sedo, A

    2008-01-01

    Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

  9. Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

    PubMed

    Pakravan, Nafiseh; Hassan, Zuhair Mohammad

    2018-03-01

    Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

  10. Lipid A binding proteins in macrophages detected by ligand blotting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.H.

    1987-05-01

    Endotoxin (LPS) stimulates a variety of eukaryotic cells. These actions are involved in the pathogenesis of Gram-negative septicemia. The site of action of the LPS toxic moiety, lipid A (LA), is unclear. Their laboratory has previously identified a bioactive LA precursor lipid IV/sub A/, which can be enzymatically labeled with /sup 32/P/sub i/ (10/sup 9/ dpm/nmole) and purified (99%). They now show that this ligand binds to specific proteins immobilized on nitrocellulose (NC) from LPS-sensitive RAW 264.7 cultured macrophages. NC blots were incubated with (/sup 32/P)-IV/sub A/ in a buffer containing BSA, NaCl, polyethylene glycol, and azide. Binding was assessedmore » using autoradiography or scintillation counting. Dot blot binding of the radioligand was inhibited by excess cold IV/sub A/, LA, or ReLPS but not by phosphatidylcholine, cardiolipin, phosphatidylinositol, or phosphatidic acid. Binding was trypsin-sensitive and dependent on protein concentration. Particulate macrophage proteins were subjected to SDS-PAGE and then electroblotted onto NC. Several discrete binding proteins were observed. Identical treatment of fetal bovine serum or molecular weight standards revealed no detectable binding. By avoiding high nonspecific binding of intact membranes, this ligand blotting assay may be useful in elucidating the molecular actions of LPS.« less

  11. Pattern differences in experimental fevers induced by endotoxin, endogenous pyrogen, and prostaglandins.

    PubMed

    Morimoto, A; Nakamori, T; Watanabe, T; Ono, T; Murakami, N

    1988-04-01

    To distinguish pattern differences in experimentally induced fevers, we investigated febrile responses induced by intravenous (IV), intracerebroventricular (ICV), and intra-preoptic/anterior hypothalamic (POA) administration of bacterial endotoxin (lipopolysaccharide, LPS), endogenous pyrogen (EP), human recombinant interleukin-1 alpha (IL-1), and prostaglandins E2 and F2 alpha (PGE2 and PGF2 alpha). Intravenous LPS, EP, or IL-1 in high concentrations caused biphasic fever. In low concentrations, they induced only the first phase of fever. Latency to onset and time to first peak of fever induced by IV injection of LPS or EP were almost the same as those after ICV or POA injection of PGE2. Fever induced by ICV or POA administration of LPS, EP, IL-1, or PGF2 alpha had a long latency to onset and a prolonged time course. There were significant differences among the latencies to fever onset exhibited by groups that received ICV or POA injections of LPS, EP, or PGF2 alpha and by groups given IV injections of LPS or EP and ICV or POA injections of PGE2. Present observations indicate different patterns of fever produced by several kinds of pyrogens when given by various routes. These results permit us to consider the possibility that there are several mediators or multiprocesses underlying the pathogenesis of fever.

  12. THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

    PubMed Central

    Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

    1932-01-01

    The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

  13. The Ca2+ induced two-component system, CvsSR regulates the Type III secretion system and the extracytoplasmic function sigma-factor AlgU in Pseudomonas syringae pv. tomato DC3000

    USDA-ARS?s Scientific Manuscript database

    Two-component systems (TCSs) of bacteria regulate many different aspects of the bacterial life cycle including pathogenesis. Most TCSs remain uncharacterized with no information about the signal(s) or regulatory targets and/or role in bacterial pathogenesis. Here, we characterize a TCS in the plant-...

  14. A STAT-1 Knockout Mouse Model for Machupo Virus Pathogenesis

    DTIC Science & Technology

    2011-06-14

    hemorrhagic fever viruses, including Ebola, Marburg, Junín, and Crimean - Congo Hemorrhagic Fever viruses [11-14...Akerstrom S, Klingstrom J, Mirazimi A: Crimean - Congo hemorrhagic fever virus infection is lethal for adult type I interferon receptor-knockout mice. J...Shieh WJ, Camus G, Stroher U, Zaki S, Jones SM: Pathogenesis and immune response of Crimean - Congo hemorrhagic fever virus in a STAT-1 knockout

  15. Pathogenesis of Salmonellosis: Salmonella Exotoxins

    DTIC Science & Technology

    1982-03-08

    membrane-as3ociated enterotowin produced by S. enteritidis and by S. typhimurium ; however they could find no similarities between their Salmonella ...AD. . 0 REPORT NUJMBER 1 Pathogenesis of Salmoneiliosis: Salmonella Exotoxins Annual Progress Report (12/1/77-9/1/78) Johnny W. Peterson. Ph.D. March...TYPE OF REPORT & PERIOD COVEREOD",- Uathogenesis of ,Salmonellosils: Salmonella Annual Progress Report Exotoxins 12/T/77 9/1/78 C. PERFORMCNG ORG

  16. Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

    PubMed

    Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

    2004-06-01

    We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

  17. Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

    PubMed

    Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

    2011-01-01

    Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

  18. Proteoglycan depletion and size reduction in lesions of early grade chondromalacia of the patella.

    PubMed Central

    Väätäinen, U; Häkkinen, T; Kiviranta, I; Jaroma, H; Inkinen, R; Tammi, M

    1995-01-01

    OBJECTIVE--To determine the content and molecular size of proteoglycans (PGs) in patellar chondromalacia (CM) and control cartilages as a first step in investigating the role of matrix alterations in the pathogenesis of this disease. METHODS--Chondromalacia tissue from 10 patients was removed with a surgical knife. Using identical techniques, apparently healthy cartilage of the same site was obtained from 10 age matched cadavers (mean age 31 years in both groups). Additional pathological cartilage was collected from 67 patients with grades II-IV CM (classified according to Outerbridge) using a motorised shaver under arthroscopic control. The shaved cartilage chips were collected with a dense net from the irrigation fluid of the shaver. The content of tissue PGs was determined by Safranin O precipitation or uronic acid content, and the molecular size by mobility on agarose gel electrophoresis. RESULTS--The mean PG content of the CM tissue samples with a knife was dramatically reduced, being only 15% of that in controls. The cartilage chips collected from shaving operations of grades II, III, and IV CM showed a decreasing PG content: 9%, 5%, and 1% of controls, respectively. Electrophoretic analysis of PGs extracted with guanidium chloride from the shaved tissue samples suggested a significantly reduced size of aggrecans in the mild (grade II) lesions. CONCLUSION--These data show that there is already a dramatic and progressive depletion of PGs in CM grade II lesions. This explains the softening of cartilage, a typical finding in the arthroscopic examination of CM. The PG size reduction observed in grade II implicates proteolytic attack as a factor in the pathogenesis of CM. Images PMID:7492223

  19. Filovirus pathogenesis and immune evasion: insights from Ebola virus and Marburg virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Messaoudi, Ilhem; Amarasinghe, Gaya K.; Basler, Christopher F.

    Ebola viruses and Marburg viruses, members of the filovirus family, are zoonotic pathogens that cause severe disease in people, as highlighted by the latest Ebola virus epidemic in West Africa. Filovirus disease is characterized by uncontrolled virus replication and the activation of host responses that contribute to pathogenesis. Underlying these phenomena is the potent suppression of host innate antiviral responses, particularly the type I interferon response, by viral proteins, which allows high levels of viral replication. In this Review, we describe the mechanisms used by filoviruses to block host innate immunity and discuss the links between immune evasion and filovirusmore » pathogenesis.« less

  20. Interactions of the innate and adaptive arms of the immune system in the pathogenesis of spondyloarthritis

    PubMed Central

    Stoll, Matthew L

    2011-01-01

    The immune system can be divided into the innate and adaptive arms. Historically, most of the research into the pathogenesis of spondyloarthritis (SpA) and other types of chronic arthritis focused on the adaptive immune system. Recently, the pendulum has shifted, and much current work in SpA focuses on innate immunity. Herein, I summarize evidence demonstrating that both the innate and the adaptive arms of the immune system are involved in the pathogenesis of SpA, propose a mechanism in which both arms interact to maintain chronic arthritis, and discuss potential research directions. PMID:21269576

  1. Filovirus pathogenesis and immune evasion: insights from Ebola virus and Marburg virus.

    PubMed

    Messaoudi, Ilhem; Amarasinghe, Gaya K; Basler, Christopher F

    2015-11-01

    Ebola viruses and Marburg viruses, members of the filovirus family, are zoonotic pathogens that cause severe disease in people, as highlighted by the latest Ebola virus epidemic in West Africa. Filovirus disease is characterized by uncontrolled virus replication and the activation of host responses that contribute to pathogenesis. Underlying these phenomena is the potent suppression of host innate antiviral responses, particularly the type I interferon response, by viral proteins, which allows high levels of viral replication. In this Review, we describe the mechanisms used by filoviruses to block host innate immunity and discuss the links between immune evasion and filovirus pathogenesis.

  2. Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

    NASA Astrophysics Data System (ADS)

    Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

    2018-03-01

    We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

  3. Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

    NASA Technical Reports Server (NTRS)

    Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

    2001-01-01

    Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

  4. Matrix metalloproteinases. Their role in degenerative chronic diseases of abdominal aorta.

    PubMed

    Palombo, D; Maione, M; Cifiello, B I; Udini, M; Maggio, D; Lupo, M

    1999-04-01

    The main chronic degenerative diseases of the abdominal aorta, namely aneurysmatic and steno-obstructive pathologies, have a common denominator: atherosclerosis. Both pathologies are characterised by the destruction of the structural integrity of the extracellular protein matrix (ME). A number of studies have shown the presence and involvement of a group of enzymes with proteolytic activity towards one or more ME components, the matrix metalloproteinases (MMPs), in the pathogenesis of aneurysms of the abdominal aorta. Other authors have underlined the role of MMPs in the proliferation and migration process of smooth muscle cells into the intima in the pathogenesis of atheromasic plaque. The aim of this study was to evaluate the possible role of these enzymes in the pathogenesis of chronic degenerative diseases of the aorta. Fragments of aortic wall were removed from patients undergoing elective aortic surgery for aneurysms (14 patients) or aortic steno-obstruction (4 patients). The samples obtained were treated appropriately and then subject to immunohistochemical analysis. The preparations were incubated with specific anti-MMP antibodies and were also incubated with substrate and chromogen, forming a pigmented precipitate on the site of the antigen, before being observed using an optic microscopic at an enlargement of 250x. Nuclear positivity linked to the presence of the antigen testified the validity of staining. Lastly, the MMP INDEX, or in other words the number of positive cells out of 100, was stained in the adventitia and in the tunica media in each preparation. MMPs were divided into three main groups: interstitial collagenase (MMP1) which degrade type I and III native collagen; gelatinases (MMP9, MMP2) which act on elastin and type IV collagen; stromelysins (MMP3) with specific proteolytic action towards proteoglycans, fibronectin and laminine. In our experience, those preparations obtained from aorta affected by steno-obstructive pathologies (4 patients) revealed the presence of MMPs with a preferential localisation on the intimal side of the tunica media. In particular, the increased activity of gelatinases MMP9 in atherosclerotic aorta might be responsible for destroying the internal elastic lamina and fostering the proliferation and migration of smooth muscle cells and the formation of atheromasic plaque. On the other hand, preparations obtained from aneurysmatic aorta (14 patients) showed an opposite situation with a preferential localisation within the adventitia and on the adventitial side of the media. Above all, the loss of elastin represents an essential stage in the formation of aortic aneurysms. This study concords with numerous authors who have demonstrated the involvement of proteinase MMPs in the development of aortic aneurysms and their possible role in the pathogenesis of atheromasic plaque. The different origin of these enzymes (inflammatory cells and macrophages or endothelial cells) may be the result of different pathogenetic mechanisms. Although they present different pathogenetic features, aortic aneurysms and steno-obstructions have a common denominator in atherosclerosis. The mechanisms responsible for their evolution towards one or other form are not known. The different expression of MMPs in the context of the aortic wall represents a field for future research.

  5. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

    PubMed

    Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

    2017-04-15

    Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

  6. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

    PubMed Central

    Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

    2017-01-01

    ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

  7. Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

    PubMed

    Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

    2013-11-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  8. A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

    PubMed

    Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

    2018-03-09

    Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

  9. Long-term neurocognitive outcome and auditory event-related potentials after complex febrile seizures in children.

    PubMed

    Tsai, Min-Lan; Hung, Kun-Long; Tsan, Ying-Ying; Tung, William Tao-Hsin

    2015-06-01

    Whether prolonged or complex febrile seizures (FS) produce long-term injury to the hippocampus is a critical question concerning the neurocognitive outcome of these seizures. Long-term event-related evoked potential (ERP) recording from the scalp is a noninvasive technique reflecting the sensory and cognitive processes associated with attention tasks. This study aimed to investigate the long-term outcome of neurocognitive and attention functions and evaluated auditory event-related potentials in children who have experienced complex FS in comparison with other types of FS. One hundred and forty-seven children aged more than 6 years who had experienced complex FS, simple single FS, simple recurrent FS, or afebrile seizures (AFS) after FS and age-matched healthy controls were enrolled. Patients were evaluated with Wechsler Intelligence Scale for Children (WISC; Chinese WISC-IV) scores, behavior test scores (Chinese version of Conners' continuous performance test, CPT II V.5), and behavior rating scales. Auditory ERPs were recorded in each patient. Patients who had experienced complex FS exhibited significantly lower full-scale intelligence quotient (FSIQ), perceptual reasoning index, and working memory index scores than did the control group but did not show significant differences in CPT scores, behavior rating scales, or ERP latencies and amplitude compared with the other groups with FS. We found a significant decrease in the FSIQ and four indices of the WISC-IV, higher behavior rating scales, a trend of increased CPT II scores, and significantly delayed P300 latency and reduced P300 amplitude in the patients with AFS after FS. We conclude that there is an effect on cognitive function in children who have experienced complex FS and patients who developed AFS after FS. The results indicated that the WISC-IV is more sensitive in detecting cognitive abnormality than ERP. Cognition impairment, including perceptual reasoning and working memory defects, was identified in patients with prolonged, multiple, or focal FS. These results may have implications for the pathogenesis of complex FS. Further comprehensive psychological evaluation and educational programs are suggested. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Intellectual Profile of Adolescents with Headache: A Case–Control Study Using the WISC-IV

    PubMed Central

    Chiappedi, Matteo; Mensi, Martina; Antonaci, Eliana; Zavani, Elena; Tronconi, Livio; Termine, Cristiano; Balottin, Umberto

    2018-01-01

    There are few literature evidences about the intellectual profile of adolescents with headache and no study has used the fourth edition of the Wechsler Intelligence Scale for Children (WISC-IV) in patients with a diagnosis of headache according to the ICHD-III-beta. We recruited 30 patients (age 11–14 years; male:female = 1:2) seen for headache in a tertiary center in Northern Italy and 30 healthy controls matched for age and sex, recruited in a public school from the same geographic area. The diagnosis of headache was done according to the ICHD-III criteria (beta version): the case group was composed of 16 patients with migraine and 14 with tension-type headache. Cognitive functioning was assessed using the WISC-IV. Recruited patients with idiopathic headache diagnosis had on average a cognitive function within the normal range. We found no statistically significant differences in the total Intellective Quotient comparing patients with headache and controls; the Working Memory Index was, however, lower in patients with headache (p = 0.012), and in particular, we found a lower Digit Span (p < 0.001). We also found a borderline statistical difference (p = 0.051) between case and controls Verbal Comprehension Index (CVI), which was due to a lower score in the Similarities subtest (p < 0.001). Our results suggest that, although within normal limits, cognitive functioning of adolescents with headache differs from that of healthy peers regarding memory and verbal skills. The Working Memory Index is related to the subject’s ability to store new information and keep them in short-term memory, to maintain focused attention and to manipulate them to find solutions. The difference in Similarities is also important because it provides a measure of the level of verbal reasoning and concept formation; it is also a measure of verbal abstract thinking skills relevant for language development, lexical knowledge, auditory comprehension, memory, and ability to discriminate between essential and non-essential characteristics. Our data, in keep with previous findings, suggest the need for further researches to better understand the pathogenesis of these difficulties and obtain ideas for an adequate rehabilitative treatment. PMID:29559952

  11. Colorectal laterally spreading tumors show characteristic expression of cell polarity factors, including atypical protein kinase C λ/ι, E-cadherin, β-catenin and basement membrane component.

    PubMed

    Ichikawa, Yasushi; Nagashima, Yoji; Morioka, Kaori; Akimoto, Kazunori; Kojima, Yasuyuki; Ishikawa, Takashi; Goto, Ayumu; Kobayashi, Noritoshi; Watanabe, Kazuteru; Ota, Mitsuyoshi; Fujii, Shoichi; Kawamata, Mayumi; Takagawa, Ryo; Kunizaki, Chikara; Takahashi, Hirokazu; Nakajima, Atsushi; Maeda, Shin; Shimada, Hiroshi; Inayama, Yoshiaki; Ohno, Shigeo; Endo, Itaru

    2014-09-01

    Colorectal flat-type tumors include laterally spreading tumors (LSTs) and flat depressed-type tumors. The former of which shows a predominant lateral spreading growth rather than an invasive growth. The present study examined the morphological characteristics of LSTs, in comparison with polypoid- or flat depressed-type tumors, along with the expression of atypical protein kinase C (aPKC) λ/ι, a pivotal cell polarity regulator, and the hallmarks of cell polarity, as well as with type IV collagen, β-catenin and E-cadherin. In total, 37 flat-type (24 LSTs and 13 flat depressed-type tumors) and 20 polypoid-type colorectal tumors were examined. The LSTs were classified as 15 LST adenoma (LST-A) and nine LST cancer in adenoma (LST-CA). An immunohistochemical examination was performed on aPKC λ/ι, type IV collagen, β-catenin and E-cadherin. The LST-A and -CA showed a superficial replacing growth pattern, with expression of β-catenin and E-cadherin in the basolateral membrane and type IV collagen along the basement membrane. In addition, 86.6% of LST-A and 55.6% of LST-CA showed aPKC λ/ι expression of 1+ (weak to normal intensity staining in the cytoplasm compared with the normal epithelium). Furthermore, ~45% of the polypoid-type adenomas showed 2+ (moderate intensity staining in the cytoplasm and/or nucleus) and 66.7% of the polypoid-type cancer in adenoma were 3+ (strong intensity staining in the cytoplasm and nucleus). A statistically significant positive correlation was observed between the expression of aPKC λ/ι and β-catenin (r=0.842; P<0.001), or type IV collagen (r=0.823; P<0.001). The LSTs showed a unique growth pattern, different from the expanding growth pattern presented by a polypoid tumor and invasive cancer. The growth characteristics of LST appear to be caused by adequate coexpression of β-catenin, type IV collagen and aPKC λ/ι.

  12. Exploring new classification criteria for the earliest type stars: the 3400 Aregion

    NASA Astrophysics Data System (ADS)

    Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

    2002-02-01

    We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

  13. Banting Lecture 2009: An Unfinished Journey: Molecular Pathogenesis to Prevention of Type 1A Diabetes

    PubMed Central

    Eisenbarth, George S.

    2010-01-01

    The Banting Medal for Scientific Achievement Award is the American Diabetes Association's highest scientific award and honors an individual who has made significant, long-term contributions to the understanding of diabetes, its treatment, and/or prevention. The award is named after Nobel Prize winner Sir Frederick Banting, who codiscovered insulin treatment for diabetes. Dr. Eisenbarth received the American Diabetes Association's Banting Medal for Scientific Achievement at the Association's 69th Scientific Sessions, June 5–9, 2009, in New Orleans, Louisiana. He presented the Banting Lecture, An Unfinished Journey—Type 1 Diabetes—Molecular Pathogenesis to Prevention, on Sunday, June 7, 2009. PMID:20350969

  14. A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

    2018-04-01

    A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

  15. Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

    PubMed

    Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

    2014-04-01

    There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

  16. A study of lip print pattern in Goan dental students - A digital approach.

    PubMed

    Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

    2012-10-01

    To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

  17. Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

    PubMed

    Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

    2006-12-01

    Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

  18. Anomalous ionization seen in the spectra of B supergiants

    NASA Technical Reports Server (NTRS)

    Cassinelli, J. P.; Abbott, D. C.

    1981-01-01

    An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

  19. Role of type 1 and S fimbriae in the pathogenesis of Escherichia coli O18:K1 bacteremia and meningitis in the infant rat.

    PubMed

    Saukkonen, K M; Nowicki, B; Leinonen, M

    1988-04-01

    The role of fimbriae in the pathogenesis of Escherichia coli infection was studied in the infant rat model. Rat pups were challenged intraperitoneally at the age of 5 days with E. coli K1 (strain IH3080, O18:K1:H7) and three different subpopulations (type 1, type S, or nonfimbriated) of it. All bacterial subpopulations were able to produce peritonitis, bacteremia, and meningitis. However, the type 1 fraction was the least virulent and the type S fraction was the most virulent, as judged by the bacterial counts in body fluids and by the mortality rates of the pups. Fimbrial phase variation to mainly the type-S-fimbriated forms was observed in all body fluids. An initially type-S-fimbriated inoculum remained predominantly type S fimbriated in the peritoneal fluid and blood. In the cerebrospinal fluid, however, about 50% of the bacteria were type S fimbriated and 50% were nonfimbriated 1 h after challenge with the type-S-fimbriated subpopulation; at later times the share of type-S-fimbriated bacteria also increased in the cerebrospinal fluid.

  20. Vitamin D and diabetes mellitus: an update 2013.

    PubMed

    Griz, Luiz Henrique Maciel; Bandeira, Francisco; Gabbay, Mônica Andrade Lima; Dib, Sergio Atala; Carvalho, Eduardo Freese de

    2014-02-01

    Vitamin D deficiency and diabetes mellitus are two common conditions and they are widely prevalent across all ages, races, geographical regions, and socioeconomic conditions. Epidemiologic studies have shown association of vitamin D deficiency and increased risk of chronic diseases, such as cancer, cardiovascular disease, type 2 diabetes, and autoimmune diseases, such as multiple sclerosis and type 1 diabetes mellitus. The identification of 1,25(OH)2D receptors and 1-α-hydroxilase expression in pancreatic beta cells, in cells of the immune system, and in various others tissues, besides the bone system support the role of vitamin D in the pathogenesis of type 2 diabetes. Observational studies have revealed an association between 25(OH) D deficiency and the prevalence of type 1 diabetes in children and adolescents. This review will focus on the concept of vitamin D deficiency, its prevalence, and its role in the pathogenesis and risk of diabetes mellitus and cardiovascular diseases.

  1. SOME COMMENTS ON TYPE IV BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, H.; Kakinuma, T.

    1962-01-01

    It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

  2. Singular cosmological evolution using canonical and ghost scalar fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

    2015-09-01

    We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

  3. Iron Overload Accelerates the Progression of Diabetic Retinopathy in Association with Increased Retinal Renin Expression.

    PubMed

    Chaudhary, Kapil; Promsote, Wanwisa; Ananth, Sudha; Veeranan-Karmegam, Rajalakshmi; Tawfik, Amany; Arjunan, Pachiappan; Martin, Pamela; Smith, Sylvia B; Thangaraju, Muthusamy; Kisselev, Oleg; Ganapathy, Vadivel; Gnana-Prakasam, Jaya P

    2018-02-14

    Diabetic retinopathy (DR) is a leading cause of blindness among working-age adults. Increased iron accumulation is associated with several degenerative diseases. However, there are no reports on the status of retinal iron or its implications in the pathogenesis of DR. In the present study, we found that retinas of type-1 and type-2 mouse models of diabetes have increased iron accumulation compared to non-diabetic retinas. We found similar iron accumulation in postmortem retinal samples from human diabetic patients. Further, we induced diabetes in HFE knockout (KO) mice model of genetic iron overload to understand the role of iron in the pathogenesis of DR. We found increased neuronal cell death, vascular alterations and loss of retinal barrier integrity in diabetic HFE KO mice compared to diabetic wildtype mice. Diabetic HFE KO mouse retinas also exhibited increased expression of inflammation and oxidative stress markers. Severity in the pathogenesis of DR in HFE KO mice was accompanied by increase in retinal renin expression mediated by G-protein-coupled succinate receptor GPR91. In light of previous reports implicating retinal renin-angiotensin system in DR pathogenesis, our results reveal a novel relationship between diabetes, iron and renin-angiotensin system, thereby unraveling new therapeutic targets for the treatment of DR.

  4. Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

    PubMed

    Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

    2018-02-06

    Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

  5. Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

    PubMed

    Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

    2002-09-01

    With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

  6. Pros and Cons While Looking Through an Asian Window on the Rome IV Criteria for Irritable Bowel Syndrome: Pros.

    PubMed

    Ghoshal, Uday C

    2017-07-30

    A decade after Rome III, in 2016, Rome IV criteria were published. There are major differences between Rome IV and the earlier iteration, some of which are in line with Asian viewpoints. The clinical applicability of the Rome IV criteria of irritable bowel syndrome (IBS) in Asian perspective is reviewed here. Instead of considering functional gastrointestinal disorders (FGIDs) to be largely psychogenic, Rome IV suggested the importance of the gut over brain ("disorders of gut-brain interaction" not "brain-gut interaction"). The word "functional" is underplayed. Multi-dimensional clinical profile attempts to recognize micro-organic nature, like slow colon transit and fecal evacuation disorders in constipation and dietary intolerance including that of lactose and fructose, bile acid malabsorption, non-celiac wheat sensitivity, small intestinal bacterial overgrowth, and gastrointestinal infection in diarrhea. Overlap between different FGIDs has been recognized as Rome IV suggests these to be a spectrum rather than discrete disorders. Bloating, common in Asia, received attention, though less. Sub-typing of IBS may be more clinician-friendly now as the patient-reported stool form may be used than a diary. However, a few issues, peculiar to Asia, need consideration; Rome IV, like Rome III, suggests that Bristol type I-II stool to denote constipation though Asian experts include type III as well. Work-up for physiological factors should be given greater importance. Language issue is important. Bloating, common in IBS, should be listed in the criteria. Threshold values for symptoms in Rome IV criteria are based on Western data. Post-infectious malabsorption (tropical sprue) should be excluded to diagnose post-infectious IBS, particularly in Asia.

  7. Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

    PubMed

    Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

    2008-05-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

  8. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Technical Reports Server (NTRS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-01-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  9. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Astrophysics Data System (ADS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-08-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  10. Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

    PubMed

    Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

    2003-03-01

    Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

  11. The Fibronectin-Binding Protein Fnm Contributes to Adherence to Extracellular Matrix Components and Virulence of Enterococcus faecium

    PubMed Central

    Somarajan, Sudha R.; La Rosa, Sabina Leanti; Singh, Kavindra V.; Roh, Jung H.; Höök, Magnus

    2015-01-01

    The interaction between bacteria and fibronectin is believed to play an important role in the pathogenicity of clinically important Gram-positive cocci. In the present study, we identified a gene encoding a predicted fibronectin-binding protein of Enterococcus faecium (fnm), a homologue of Streptococcus pneumoniae pavA, in the genomes of E. faecium strain TX82 and all other sequenced E. faecium isolates. Full-length recombinant Fnm from strain TX82 bound to immobilized fibronectin in a concentration-dependent manner and also appeared to bind collagen type V and laminin, but not other proteins, such as transferrin, heparin, bovine serum albumin, mucin, or collagen IV. We demonstrated that the N-terminal fragment of Fnm is required for full fibronectin binding, since truncation of this region caused a 2.4-fold decrease (P < 0.05) in the adhesion of E. faecium TX82 to fibronectin. Deletion of fnm resulted in a significant reduction (P < 0.001) in the ability of the mutant, TX6128, to bind fibronectin relative to that of the wild-type strain; in situ reconstitution of fnm in the deletion mutant strain restored adherence. In addition, the Δfnm mutant was highly attenuated relative to TX82 (P ≤ 0.0001) in a mixed-inoculum rat endocarditis model. Taken together, these results demonstrate that Fnm affects the adherence of E. faecium to fibronectin and is important in the pathogenesis of experimental endocarditis. PMID:26371130

  12. Molecular cloning, expression and characterization of albolamin: a type P-IIa snake venom metalloproteinase from green pit viper (Cryptelytrops albolabris).

    PubMed

    Jangprasert, Panchalee; Rojnuckarin, Ponlapat

    2014-03-01

    Snake venom metalloproteinases (SVMPs) can damage vessel wall, degrade clotting factors, inhibit integrins and block platelet functions. Studying them not only gives us deeper insights in pathogenesis of snakebites, but also potentially yields novel therapeutic agents. Here, we discovered a clone of an RGD-containing SVMP from the green pit viper (Cryptelytrops albolabris) venom gland cDNA library. Sequence analysis revealed that it belonged to the P-IIa subclass of SVMP comprising signal peptide, prodomain, metalloproteinase and disintegrin. Compared with other P-II SVMPs, it contained 2 additional conserved cysteines that were predicted to prevent the release of disintegrin from the metalloproteinase domain in the mature protein. The N-terminal histidine-tagged construct of metalloproteinase and disintegrin domains of albolamin was inserted into the pPICZαA vector and expressed in Pichia pastoris. The recombinant protein molecular weight was approximately 35 kDa on Western blot probed with anti-polyhistidine antibody. The recombinant albolamin could digest human type IV collagen starting within 15 min after incubation. In addition, it dose-dependently inhibited collagen-induced platelet aggregation with the IC50 of 1.8 μM. However, there was no effect on ADP-induced platelet aggregation. Therefore, the inhibition mechanism is probably through blocking collagen receptor(s). Albolamin activities probably contributed to pathology of green pit viper bites. Its disintegrin domain deserves further studies for the potential to be a useful agent affecting platelet functions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Role of intestinal flora imbalance in pathogenesis of pouchitis.

    PubMed

    Feng, Xiao-Bo; Jiang, Jun; Li, Min; Wang, Gang; You, Jin-Wei; Zuo, Jian

    2016-08-01

    To discuss the role of intestinal flora imbalance in the pathogenesis of pouchitis. The pouchitis rat model was established and the faeces sample and the mucous membrane sample were collected regularly, in which the bacterial nucleic acids were extracted for quantitative analysis of the intestinal flora in the samples through using the real-time quantitative PCR technique and high energy sequencing technology. The disorder phenomenon of the intestinal flora appeared at the 7th day of the experiment, and the pouchitis was presented at the 21st day of the experiment. At the 31st day of the experiment, compared to control group and non-pouchitis group, the quantity of Bifidobacterium and the Lactobacillus of the pouchitis model rats in the mucous membrane sample and the faeces sample were significantly decreased (P < 0.05), and the Bacteroidetes, Faecalibacterium prausnitzii and XIV Clostridium leptum subgroup in the mucous membrane of pouchitis were significantly decreased (P < 0.05). The IV Clostridium coccoides group was the main flora in the mucous membrane of pouchitis, the bacterial diversity of non-pouchitis group and control group was significantly higher than that of the pouchitis group (P < 0.05). The intestinal flora imbalance is one of the factors that cause the incidence of the pouchitis; this study provides a clue of the pathogenesis and treatment direction of the intestinal inflammatory disease. Copyright © 2016 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

  14. Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

    PubMed

    Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

    2013-04-01

    Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

  15. Estimation of Plasma Levels of Tumor Necrosis Factor-a, Interleukin-4 and 6 in Patients with Chronic Periodontitis and Type II Diabetes Mellitus.

    PubMed

    Bakshi, Dipanshu; Kaur, Guneet; Singh, Deepinder; Sahota, Jasjit; Thakur, Ambika; Grover, Shekhar

    2018-02-01

    Both periodontitis and type II diabetes mellitus (T2DM) are common diseases with a multifactorial etiology and have influence of cytokines in their pathogenesis and thus may also influence each other. In recent times, more attention has been given to understanding the influences of these inflammatory cytokines which are a main part of oral chronic inflammation on systemic health of the individuals. Therefore, the aim of this study was to evaluate the plasma cytokine levels, specifically tumor necrosis factor-a (TNF-a), interleukin (IL)-6, and IL-4, in chronic periodontitis patients and T2DM patients, so as to investigate the influence of chronic periodontitis in systemic inflammation associated with diabetes mellitus. The present study comprised a total sample size of 60 patients. A detailed history along with complete periodontal examination were done for each person. These patients were subdivided into four study groups with 15 subjects (n = 15) in each group: group I: healthy individuals, group II: chronic periodontitis, group III: diabetes mellitus without chronic periodontitis, and group IV: diabetes mellitus with chronic periodontitis. Venous blood was withdrawn for obtaining serum samples from the subjects. Hemoglobin A1c (HbAlc) levels were measured from the automated chromatography. Using enzyme-linked immunosorbent assay kit, TNF-a, IL-4, and IL-6 were measured. It was observed that the difference between almost all the results showed statistical significance. Not much of a difference was seen when TNF-a and IL-6 findings of group II were compared with group III. Furthermore, IL-4 also did not differ when group II was compared with group IV. The inflammatory cytokines together control the inflammation process and a balance is maintained. However, in patients with diabetes mellitus, this balance is interrupted, which affects the final development and progression of the disease. Thus, hyperglycemia may be partly associated with the severity of the periodontal status in diabetic patients. Hyperglycemia thus may play a role in increasing the severity of the periodontal status in diabetic patients. Keeping such relationship in mind, better treatment modalities can be provided to the patients.

  16. Vascular leakage in dengue--clinical spectrum and influence of parenteral fluid therapy.

    PubMed

    Rosenberger, Kerstin D; Lum, Lucy; Alexander, Neal; Junghanss, Thomas; Wills, Bridget; Jaenisch, Thomas

    2016-03-01

    Clinical management of dengue relies on careful monitoring of fluid balance combined with judicious intravenous (IV) fluid therapy. However, in patients with significant vascular leakage, IV fluids may aggravate serosal fluid accumulation and result in respiratory distress. Trained physicians followed suspected dengue cases prospectively at seven hospitals across Asia and Latin America, using a comprehensive case report form that included daily clinical assessment and detailed documentation of parenteral fluid therapy. Applying Cox regression, we evaluated risk factors for the development of shock or respiratory distress with fluid accumulation. Most confirmed dengue patients (1524/1734, 88%) never experienced dengue shock syndrome (DSS). Among those with DSS, 176/210 (84%) had fluid accumulation, and in the majority (83%), this was detectable clinically. Among all cases with clinically detectable fluid accumulation, 179/447 (40%) were diagnosed with shock or respiratory distress. The risk for respiratory distress with fluid accumulation increased significantly as the infused volume over the preceding 24 h increased (hazard ratio 1.18 per 10 ml/kg increase; P < 0.001). Longer duration of IV therapy, use of a fluid bolus in the preceding 24 h, female gender and poor nutrition also constituted independent risk factors. Shock and respiratory distress are relatively rare manifestations of dengue, but some evidence of fluid accumulation is seen in around 50% of cases. IV fluids play a crucial role in management, but they must be administered with caution. Clinically and/or radiologically detectable fluid accumulations have potential as intermediate severity endpoints for therapeutic intervention trials and/or pathogenesis studies. © 2016 John Wiley & Sons Ltd.

  17. A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

    PubMed

    Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

    2017-12-01

    The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  18. Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

    PubMed

    Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

    2017-08-01

    We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Atopic dermatitis: emerging therapies.

    PubMed

    Simpson, Eric; Udkoff, Jeremy; Borok, Jenna; Tom, Wynnis; Beck, Lisa; Eichenfield, Lawrence F

    2017-09-01

    Crisaborole and dupilumab represent the first 2 Food and Drug Administration (FDA)-approved therapies for atopic dermatitis (AD) in more than 15 years, and there are many promising drugs currently in development. This new wave of therapeutics capitalizes on the large body of work clarifying the pathogenesis of AD over the last several decades. In particular, type 2 cytokine-driven inflammation and skin barrier dysfunction are key processes underlying AD pathogenesis. ©2017 Frontline Medical Communications.

  20. Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

    DOE PAGES

    Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

    2015-03-01

    Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

  1. Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

    PubMed

    Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

    2015-10-01

    Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  2. Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

    ClinicalTrials.gov

    2014-02-14

    Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

  3. Specific Phobia among U.S. Adolescents: Phenomenology and Typology

    PubMed Central

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2014-01-01

    Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

  4. Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

    PubMed

    Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

    2002-12-06

    Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

  5. Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

    1994-01-01

    High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

  6. Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

    PubMed

    Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

    2006-04-01

    A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

  7. Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

    PubMed

    Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

    2013-11-22

    Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

    PubMed

    Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

    2016-10-01

    The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

  9. The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

    PubMed

    Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

    2012-06-01

    The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

  10. Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

    PubMed Central

    Watanabe, Ikuya; Wallace, Cameron

    2008-01-01

    The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

  11. Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

    PubMed Central

    Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

    2007-01-01

    Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

  12. Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

    PubMed Central

    Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

    2014-01-01

    Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

  13. Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

    PubMed

    Breadon, Jonith Y; Barnes, Chad A

    2007-01-01

    Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

  14. Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

    PubMed

    Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

    2017-09-01

    Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

    ERIC Educational Resources Information Center

    Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

    2015-01-01

    In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

  16. Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

    PubMed

    Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

    2014-05-01

    Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

    PubMed

    Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

    2010-08-01

    A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

  18. AAV9-based gene therapy partially ameliorates the clinical phenotype of a mouse model of Leigh syndrome.

    PubMed

    Di Meo, I; Marchet, S; Lamperti, C; Zeviani, M; Viscomi, C

    2017-10-01

    Leigh syndrome (LS) is the most common infantile mitochondrial encephalopathy. No treatment is currently available for this condition. Mice lacking Ndufs4, encoding NADH: ubiquinone oxidoreductase iron-sulfur protein 4 (NDUFS4) recapitulates the main findings of complex I (cI)-related LS, including severe multisystemic cI deficiency and progressive neurodegeneration. In order to develop a gene therapy approach for LS, we used here an AAV2/9 vector carrying the human NDUFS4 coding sequence (hNDUFS4). We administered AAV2/9-hNDUFS4 by intravenous (IV) and/or intracerebroventricular (ICV) routes to either newborn or young Ndufs4 -/- mice. We found that IV administration alone was only able to correct the cI deficiency in peripheral organs, whereas ICV administration partially corrected the deficiency in the brain. However, both treatments failed to improve the clinical phenotype or to prolong the lifespan of Ndufs4 -/- mice. In contrast, combined IV and ICV treatments resulted, along with increased cI activity, in the amelioration of the rotarod performance and in a significant prolongation of the lifespan. Our results indicate that extraneurological organs have an important role in LS pathogenesis and provide an insight into current limitations of adeno-associated virus (AAV)-mediated gene therapy in multisystem disorders. These findings warrant future investigations to develop new vectors able to efficiently target multiple organs.

  19. Level III and IV Ecoregions by State

    EPA Pesticide Factsheets

    Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  20. Level III and IV Ecoregions by EPA Region

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  1. Premenstrual Dysphoric Disorder: Evidence for a New Category for DSM-5

    PubMed Central

    Epperson, C. Neill; Steiner, Meir; Hartlage, S. Ann; Eriksson, Elias; Schmidt, Peter J.; Jones, Ian; Yonkers, Kimberly A.

    2012-01-01

    Premenstrual dysphoric disorder, which affects 2%–5% of premenopausal women, was included in Appendix B of DSM-IV, “Criterion Sets and Axes Provided for Further Study.” Since then, aided by the inclusion of specific and rigorous criteria in DSM-IV, there has been an explosion of research on the epidemiology, phenomenology, pathogenesis, and treatment of the disorder. In 2009, the Mood Disorders Work Group for DSM-5 convened a group of experts to examine the literature on premenstrual dysphoric disorder and provide recommendations regarding the appropriate criteria and placement for the disorder in DSM-5. Based on thorough review and lengthy discussion, the work group proposed that the information on the diagnosis, treatment, and validation of the disorder has matured sufficiently for it to qualify as a full category in DSM-5. A move to the position of category, rather than a criterion set in need of further study, will provide greater legitimacy for the disorder and encourage the growth of evidence-based research, ultimately leading to new treatments. PMID:22764360

  2. Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

    PubMed

    Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

    2010-11-01

    Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  3. Pathogenesis and treatment of HIV-1 infection: recent developments (Y2K update).

    PubMed

    Dewhurst, S L; da Cruz, R L; Whetter, L

    2000-01-01

    Human immunodeficiency virus type 1 (HIV-1) is the etiologic agent of acquired immunodeficiency syndrome (AIDS). The pathogenesis of HIV-1-induced disease is complex and characterized by the interplay of both viral and host factors, which together determine the outcome of infection. An improved understanding of the pathogenic mechanisms of AIDS, combined with recent insights into the dynamics of viral infection may provide powerful new opportunities for therapeutic intervention against this virus.

  4. Mayo Clinic/Renal Pathology Society Consensus Report on Pathologic Classification, Diagnosis, and Reporting of GN.

    PubMed

    Sethi, Sanjeev; Haas, Mark; Markowitz, Glen S; D'Agati, Vivette D; Rennke, Helmut G; Jennette, J Charles; Bajema, Ingeborg M; Alpers, Charles E; Chang, Anthony; Cornell, Lynn D; Cosio, Fernando G; Fogo, Agnes B; Glassock, Richard J; Hariharan, Sundaram; Kambham, Neeraja; Lager, Donna J; Leung, Nelson; Mengel, Michael; Nath, Karl A; Roberts, Ian S; Rovin, Brad H; Seshan, Surya V; Smith, Richard J H; Walker, Patrick D; Winearls, Christopher G; Appel, Gerald B; Alexander, Mariam P; Cattran, Daniel C; Casado, Carmen Avila; Cook, H Terence; De Vriese, An S; Radhakrishnan, Jai; Racusen, Lorraine C; Ronco, Pierre; Fervenza, Fernando C

    2016-05-01

    Renal pathologists and nephrologists met on February 20, 2015 to establish an etiology/pathogenesis-based system for classification and diagnosis of GN, with a major aim of standardizing the kidney biopsy report of GN. On the basis of etiology/pathogenesis, GN is classified into the following five pathogenic types, each with specific disease entities: immune-complex GN, pauci-immune GN, antiglomerular basement membrane GN, monoclonal Ig GN, and C3 glomerulopathy. The pathogenesis-based classification forms the basis of the kidney biopsy report. To standardize the report, the diagnosis consists of a primary diagnosis and a secondary diagnosis. The primary diagnosis should include the disease entity/pathogenic type (if disease entity is not known) followed in order by pattern of injury (mixed patterns may be present); score/grade/class for disease entities, such as IgA nephropathy, lupus nephritis, and ANCA GN; and additional features as detailed herein. A pattern diagnosis as the sole primary diagnosis is not recommended. Secondary diagnoses should be reported separately and include coexisting lesions that do not form the primary diagnosis. Guidelines for the report format, light microscopy, immunofluorescence microscopy, electron microscopy, and ancillary studies are also provided. In summary, this consensus report emphasizes a pathogenesis-based classification of GN and provides guidelines for the standardized reporting of GN. Copyright © 2016 by the American Society of Nephrology.

  5. Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

    PubMed Central

    Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

    2013-01-01

    Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

  6. A crosstalk between p21 and UPR-induced transcription factor C/EBP homologous protein (CHOP) linked to type 2 diabetes.

    PubMed

    Mihailidou, Chrysovalantou; Papavassiliou, Athanasios G; Kiaris, Hippokratis

    2014-04-01

    Type 2 diabetes (T2D) is a disease that is characterized by raised levels of glucose in the blood combined with insulin resistance and relative insulin deficiency. The pathogenesis of type 2 diabetes is associated with the induction of the unfolded protein response (UPR). While UPR aims to restore tissue homeostasis following stress of the endoplasmic reticulum (ER), prolonged ER stress triggers apoptosis at least in part through the unfolded protein response (UPR)-activated transcription factor C/EBP (CCAAT/enhancer binding protein) homologous protein (CHOP). CHOP has elevated as a critical mediator connecting accumulation and aggregation of unfolded proteins in the ER and oxidative stress and also contributes to the induction of apoptosis in β-cell (beta-cell) - cells under conditions of increased insulin demand. p21 is a cell cycle regulator that is implicated in the regulation of the UPR by various mechanisms involving inhibition of apoptosis and facilitation of the regeneration capacity of the β cells. In this review we summarize the role of ER stress in the pathogenesis of type 2 diabetes which is associated with the induction of the unfolded protein response (UPR). We also review recent evidence associating p21 activity with β cell health and regenerative capacity by mechanisms that may interfere with the effects of p21 in the UPR or operate independently of ER stress. Most likely understanding the molecular details of the pathogenesis of type 2 diabetes will be beneficial for the management of the disease. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

    PubMed

    Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

    2005-03-01

    To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

  8. A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

    PubMed

    Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

    2016-03-01

    The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  9. Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

    NASA Astrophysics Data System (ADS)

    Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

    2018-04-01

    We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

  10. HLA-B27 Anterior Uveitis: Immunology and Immunopathology.

    PubMed

    Wakefield, Denis; Yates, William; Amjadi, Shahriar; McCluskey, Peter

    2016-08-01

    Acute anterior uveitis (AAU) is the commonest type of uveitis and HLA-B27 AAU is the most frequently recognized type of acute anterior uveitis and anterior uveitis overall. Recent evidence indicates that acute anterior uveitis is a heterogenous disease, is polygenic and is frequently associated with the spondyloarthropathies (SpA). Studies of patients with AAU and animal models of disease indicate a role for innate immunity, the IL-23 cytokine pathway and exogenous factors, in the pathogenesis of both SpA and acute anterior uveitis. Recently described genetic associations cluster around immunologic pathways, including the IL-17 and IL-23 pathways, antigen processing and presentation, and lymphocyte development and activation. Patients with ankylosing spondylitis (AS) and AAU share other genetic markers, such as ERAP-1, which show strong evidence of gene-gene interaction and point to new mechanisms of disease pathogenesis. These observations have major implications for understanding the pathogenesis of HLA-B27 diseases, such as AAU, and may lead to the development of more specific therapy for AAU. Received 6 January 2016; revised 6 February 2016; accepted 18 February 2016; published online 31 May 2016.

  11. Inactivation of the sapA to sapF locus of Erwinia chrysanthemi reveals common features in plant and animal bacterial pathogenesis.

    PubMed

    López-Solanilla, E; García-Olmedo, F; Rodríguez-Palenzuela, P

    1998-06-01

    We investigated the role in pathogenesis of bacterial resistance to plant antimicrobial peptides. The sapA to sapF (for sensitive to antimicrobial peptides) operon from the pathogenic bacterium Erwinia chrysanthemi has been characterized. It has five open reading frames that are closely related (71% overall amino acid identity) and are in the same order as those of the sapA to sapF operon from Salmonella typhimurium. An E. chrysanthemi sap mutant strain was constructed by marker exchange. This mutant was more sensitive than was the wild type to wheat alpha-thionin and to snakin-1, which is the most abundant antimicrobial peptide from potato tubers. This mutant was also less virulent than was the wild-type strain in potato tubers: lesion area was 37% that of the control, and growth rate was two orders of magnitude lower. These results indicate that the interaction of antimicrobial peptides from the host with the sapA to sapF operon from the pathogen plays a similar role in animal and in plant bacterial pathogenesis.

  12. Construction of a reporter system to study Burkholderia mallei type III secretion and identification of the BopA effector protein function in intracellular survival.

    PubMed

    Whitlock, Gregory C; Estes, D Mark; Young, Glenn M; Young, Briana; Torres, Alfredo G

    2008-12-01

    Burkholderia mallei, the aetiological agent of glanders disease, is a Gram-negative facultative intracellular bacterium. Despite numerous studies, the detailed mechanism of its pathogenesis is almost unknown. The presence of a type III secretion system (TTSS) is one of the known mechanisms associated with virulence. An intact TTSS indicates that B. mallei is able to secrete proteins in response to different environmental conditions, which could play an important role in pathogenesis. Therefore, characterization of the TTSS and identification of the secreted proteins associated with bacterial pathogenesis could provide crucial information for the development of a candidate vaccine. In the current study, we used an enzymatic reporter system to establish some of the conditions enabling TTS. Construction of the TTSS bopA mutant revealed that BopA is important for B. mallei invasion and intracellular survival. Overall, our study elucidates how BopA can aid in the optimization of TTS and defines the function of TTS effectors in bacterial intracellular survival and invasion.

  13. Acute pancreatitis complicating choledochal cysts in children.

    PubMed

    Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

    2017-03-01

    To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  14. Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

    PubMed

    Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

    2012-07-01

    Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

  15. Animal models of middle ear cholesteatoma.

    PubMed

    Yamamoto-Fukuda, Tomomi; Takahashi, Haruo; Koji, Takehiko

    2011-01-01

    Middle ear acquired cholesteatoma is a pathological condition associated with otitis media, which may be associated with temporal bone resorption, otorrhea and hearing loss, and occasionally various other complications. Cholesteatoma is characterized by the enhanced proliferation of epithelial cells with aberrant morphologic characteristics. Unfortunately, our understanding of the mechanism underlying its pathogenesis is limited. To investigate its pathogenesis, different animal models have been used. This paper provides a brief overview of the current status of research in the field of pathogenesis of middle ear acquired cholesteatoma, four types of animal models previously reported on, up-to-date cholesteatoma research using these animal models, our current studies of the local hybrid ear model, and the future prospect of new animal models of middle ear cholesteatoma.

  16. Animal Models of Middle Ear Cholesteatoma

    PubMed Central

    Yamamoto-Fukuda, Tomomi; Takahashi, Haruo; Koji, Takehiko

    2011-01-01

    Middle ear acquired cholesteatoma is a pathological condition associated with otitis media, which may be associated with temporal bone resorption, otorrhea and hearing loss, and occasionally various other complications. Cholesteatoma is characterized by the enhanced proliferation of epithelial cells with aberrant morphologic characteristics. Unfortunately, our understanding of the mechanism underlying its pathogenesis is limited. To investigate its pathogenesis, different animal models have been used. This paper provides a brief overview of the current status of research in the field of pathogenesis of middle ear acquired cholesteatoma, four types of animal models previously reported on, up-to-date cholesteatoma research using these animal models, our current studies of the local hybrid ear model, and the future prospect of new animal models of middle ear cholesteatoma. PMID:21541229

  17. The diagnostic accuracy of multiparametric MRI to determine pediatric brain tumor grades and types.

    PubMed

    Koob, Mériam; Girard, Nadine; Ghattas, Badih; Fellah, Slim; Confort-Gouny, Sylviane; Figarella-Branger, Dominique; Scavarda, Didier

    2016-04-01

    Childhood brain tumors show great histological variability. The goal of this retrospective study was to assess the diagnostic accuracy of multimodal MR imaging (diffusion, perfusion, MR spectroscopy) in the distinction of pediatric brain tumor grades and types. Seventy-six patients (range 1 month to 18 years) with brain tumors underwent multimodal MR imaging. Tumors were categorized by grade (I-IV) and by histological type (A-H). Multivariate statistical analysis was performed to evaluate the diagnostic accuracy of single and combined MR modalities, and of single imaging parameters to distinguish the different groups. The highest diagnostic accuracy for tumor grading was obtained with diffusion-perfusion (73.24%) and for tumor typing with diffusion-perfusion-MR spectroscopy (55.76%). The best diagnostic accuracy was obtained for tumor grading in I and IV and for tumor typing in embryonal tumor and pilocytic astrocytoma. Poor accuracy was seen in other grades and types. ADC and rADC were the best parameters for tumor grading and typing followed by choline level with an intermediate echo time, CBV for grading and Tmax for typing. Multiparametric MR imaging can be accurate in determining tumor grades (primarily grades I and IV) and types (mainly pilocytic astrocytomas and embryonal tumors) in children.

  18. [Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

    PubMed

    Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

    2003-01-01

    The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

  19. Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

    PubMed

    Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

    2017-12-28

    The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

  20. Specific phobia among U.S. adolescents: phenomenology and typology.

    PubMed

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2012-12-01

    Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  1. Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

    PubMed Central

    Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

    1996-01-01

    We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

  2. Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

    PubMed

    Hidaka, Yoshie; Suzuki, Masakazu

    2004-06-01

    Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

  3. The Structure of RalF, an ADP-Ribosylation Factor Guanine Nucleotide Exchange Factor from Legionella pneumophila, Reveals the Presence of a Cap over the Active Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Amor,J.; Swails, J.; Zhu, X.

    2005-01-01

    The Legionella pneumophila protein RalF is secreted into host cytosol via the Dot/Icm type IV transporter where it acts to recruit ADP-ribosylation factor (Arf) to pathogen-containing phagosomes in the establishment of a replicative organelle. The presence in RalF of the Sec7 domain, present in all Arf guanine nucleotide exchange factors, has suggested that recruitment of Arf is an early step in pathogenesis. We have determined the crystal structure of RalF and of the isolated Sec7 domain and found that RalF is made up of two domains. The Sec7 domain is homologous to mammalian Sec7 domains. The C-terminal domain forms amore » cap over the active site in the Sec7 domain and contains a conserved folding motif, previously observed in adaptor subunits of vesicle coat complexes. The importance of the capping domain and of the glutamate in the 'glutamic finger,' conserved in all Sec7 domains, to RalF functions was examined using three different assays. These data highlight the functional importance of domains other than Sec7 in Arf guanine nucleotide exchange factors to biological activities and suggest novel mechanisms of regulation of those activities.« less

  4. Deficiency of merosin in dystrophic dy mouse homologue of congenital muscular dystrophy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sunada, Y.; Campbell, K.P.; Bernier, S.M.

    1994-09-01

    Merosin (laminin M chain) is the predominant laminin isoform in the basal lamina of striated muscle and peripheral nerve and is a native ligand for {alpha}-dystroglycan, a novel laminin receptor. Merosin is linked to the subsarcolemmal actin cytoskeleton via the dystrophin-glycoprotein complex (DGC), which plays an important role for maintenance of normal muscle function. We have mapped the mouse merosin gene, Lamm, to the region containing the dystrophia muscularis (dy) locus on chromosome 10. This suggested the possibility that a mutation in the merosin gene could be responsible for the dy mouse, an animal model for autosomal recessive muscular dystrophy,more » and prompted us to test this hypothesis. We analyzed the status of merosin expression in dy mouse by immunofluorescence and immunoblotting. In dy mouse skeletal and cardiac muscle and peripheral nerve, merosin was reduced greater than 90% as compared to control mice. However, the expression of laminin B1/B2 chains and collagen type IV was smaller to that in control mice. These findings strongly suggest that merosin deficiency may be the primary defect in the dy mouse. Furthermore, we have identified two patients afflicted with congenital muscular dystrophy with merosin deficiency, providing the basis for future studies of molecular pathogenesis and gene therapy.« less

  5. Multipronged regulatory functions of a novel endonuclease (TieA) from Helicobacter pylori

    PubMed Central

    Devi, Savita; Ansari, Suhail A.; Tenguria, Shivendra; Kumar, Naveen; Ahmed, Niyaz

    2016-01-01

    Helicobacter pylori portrays a classical paradigm of persistent bacterial infections. A well balanced homeostasis of bacterial effector functions and host responses is purported to be the key in achieving long term colonization in specific hosts. H. pylori nucleases have been shown to assist in natural transformation, but their role in virulence and colonization remains elusive. Therefore, it is imperative to understand the involvement of these nucleases in the pathogenesis of H. pylori. Here, we report the multifaceted role of a TNFR-1 interacting endonuclease A (TieA) from H. pylori. tieA expression is differentially regulated in response to environmental stress and post adherence to gastric epithelial cells. Studies with isogenic knockouts of tieA revealed it to be a secretory protein which translocates into the host gastric epithelial cells independent of a type IV secretion system, gets phosphorylated by DNA-PK kinase and auto-phosphorylates as serine kinase. Furthermore, TieA binds to and cleaves DNA in a non-specific manner and promotes Fas mediated apoptosis in AGS cells. Additionally, TieA induced pro-inflammatory cytokine secretion via activation of transcription factor AP-1 and signaled through MAP kinase pathway. Collectively, TieA with its multipronged and moonlighting functions could facilitate H. pylori in maintaining a balance of bacterial adaptation, and elimination by the host responses. PMID:27550181

  6. The Rab-binding Profiles of Bacterial Virulence Factors during Infection.

    PubMed

    So, Ernest C; Schroeder, Gunnar N; Carson, Danielle; Mattheis, Corinna; Mousnier, Aurélie; Broncel, Malgorzata; Tate, Edward W; Frankel, Gad

    2016-03-11

    Legionella pneumophila, the causative agent of Legionnaire's disease, uses its type IV secretion system to translocate over 300 effector proteins into host cells. These effectors subvert host cell signaling pathways to ensure bacterial proliferation. Despite their importance for pathogenesis, the roles of most of the effectors are yet to be characterized. Key to understanding the function of effectors is the identification of host proteins they bind during infection. We previously developed a novel tandem-affinity purification (TAP) approach using hexahistidine and BirA-specific biotinylation tags for isolating translocated effector complexes from infected cells whose composition were subsequently deciphered by mass spectrometry. Here we further advanced the workflow for the TAP approach and determined the infection-dependent interactomes of the effectors SidM and LidA, which were previously reported to promiscuously bind multiple Rab GTPases in vitro. In this study we defined a stringent subset of Rab GTPases targeted by SidM and LidA during infection, comprising of Rab1A, 1B, 6, and 10; in addition, LidA targets Rab14 and 18. Taken together, this study illustrates the power of this approach to profile the intracellular interactomes of bacterial effectors during infection. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Level III and IV Ecoregions of the Continental United States

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  8. Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

    PubMed Central

    Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

    2014-01-01

    Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

  9. The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

    PubMed

    Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

    2007-06-01

    Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

  10. Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

    2006-10-15

    Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

  11. The alternative sigma factor sigma B of Staphylococcus aureus modulates virulence in experimental central venous catheter-related infections.

    PubMed

    Lorenz, Udo; Hüttinger, Christian; Schäfer, Tina; Ziebuhr, Wilma; Thiede, Arnulf; Hacker, Jörg; Engelmann, Susanne; Hecker, Michael; Ohlsen, Knut

    2008-03-01

    The impact of the alternative sigma factor sigma B (SigB) on pathogenesis of Staphylococcus aureus is not conclusively clarified. In this study, a central venous catheter (CVC) related model of multiorgan infection was used to investigate the role of SigB for the pathogenesis of S. aureus infections and biofilm formation in vivo. Analysis of two SigB-positive wild-type strains and their isogenic mutants revealed uniformly that the wild-type was significantly more virulent than the SigB-deficient mutant. The observed difference in virulence was apparently not linked to the capability of the strains to form biofilms in vivo since wild-type and mutant strains were able to produce biofilm layers inside of the catheter. The data strongly indicate that the alternative sigma factor SigB plays a role in CVC-associated infections caused by S. aureus.

  12. [Human calcium channelopathies. Voltage-gated Ca(2+) channels in etiology, pathogenesis, and pharmacotherapy of neurologic disorders].

    PubMed

    Weiergräber, M; Hescheler, J; Schneider, T

    2008-04-01

    Voltage-gated calcium channels are key components in a variety of physiological processes. Within the last decade an increasing number of voltage-gated Ca(2+) channelopathies in both humans and animal models has been described, most of which are related to the neurologic and muscular system. In humans, mutations were found in L-type Ca(v)1.2 and Ca(v)1.4 Ca(2+) channels as well as the non-L-type Ca(v)2.1 and T-type Ca(v)3.2 channels, resulting in altered electrophysiologic properties. Based on their widespread distribution within the CNS, voltage-gated calcium channels are of particular importance in the etiology and pathogenesis of various forms of epilepsy and neuropsychiatric disorders. In this review we characterise the different human Ca(2+) channelopathies known so far, further illuminating basic pathophysiologic mechanisms and clinical aspects.

  13. Amyloidosis: Insights from Proteomics.

    PubMed

    Dogan, Ahmet

    2017-01-24

    Amyloidoses are a spectrum of disorders caused by abnormal folding and extracellular deposition of proteins. The deposits lead to tissue damage and organ dysfunction, particularly in the heart, kidneys, and nerves. There are at least 30 different proteins that can cause amyloidosis. The clinical management depends entirely on the type of protein deposited, and thus on the underlying pathogenesis, and often requires high-risk therapeutic intervention. Application of mass spectrometry-based proteomic technologies for analysis of amyloid plaques has transformed the way amyloidosis is diagnosed and classified. Proteomic assays have been extensively used for clinical management of patients with amyloidosis, providing unprecedented diagnostic and biological information. They have shed light on the pathogenesis of different amyloid types and have led to identification of numerous new amyloid types, including ALECT2 amyloidosis, which is now recognized as one of the most common causes of systemic amyloidosis in North America.

  14. Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

    PubMed

    Dickens, J C; Prestwich, G D

    1989-02-01

    For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

  15. Mitochondrial alterations in Parkinson's disease: new clues.

    PubMed

    Vila, Miquel; Ramonet, David; Perier, Celine

    2008-10-01

    Mitochondrial dysfunction has long been associated with Parkinson's disease (PD). In particular, complex I impairment and subsequent oxidative stress have been widely demonstrated in experimental models of PD and in post-mortem PD samples. A recent wave of new studies is providing novel clues to the potential involvement of mitochondria in PD. In particular, (i) mitochondria-dependent programmed cell death pathways have been shown to be critical to PD-related dopaminergic neurodegeneration, (ii) many disease-causing proteins associated with familial forms of PD have been demonstrated to interact either directly or indirectly with mitochondria, (iii) aging-related mitochondrial changes, such as alterations in mitochondrial DNA, are increasingly being associated with PD, and (iv) anomalies in mitochondrial dynamics and intra-neuronal distribution are emerging as critical participants in the pathogenesis of PD. These new findings are revitalizing the field and reinforcing the potential role of mitochondria in the pathogenesis of PD. Whether a primary or secondary event, or part of a multi-factorial pathogenic process, mitochondrial dysfunction remains at the forefront of PD research and holds the promise as a potential molecular target for the development of new therapeutic strategies for this devastating, currently incurable, disease.

  16. Aquaporin 4 in Astrocytes is a Target for Therapy in Alzheimer's Disease.

    PubMed

    Lan, Yu-Long; Chen, Jian-Jiao; Hu, Gang; Xu, Jun; Xiao, Ming; Li, Shao

    2017-01-01

    Current experimental evidence points to the conclusion that aquaporin 4 (AQP4), which is an important water-channel membrane protein found in the brain, could play major roles in various brain conditions pathologically including pathogenesis of Alzheimer's disease (AD). In this paper, we review how AQP4 and altered astrocyte functions interact in AD, and provide experimental evidence highlighting the importance of this topic for the future investigations. The interactions of AQP4 are as follows: (i) AQP4 could influence astrocytic calcium signaling and potassium homeostasis. (ii) AQP4 is linked with the removal of interstitial β-amyloid and glutamate transmission. (iii) Furthermore, AQP4 modulates the reactive astrogliosis and neuroinflammation mechanisms. (iv) To add to this, AQP4 could participate in the AD pathogenesis through affecting neurotrophic factor production. It is therefore possible to identify certain functional molecules that regulate astrocyte make-up and functions. However, making crucial efforts to develop specific agents or drugs that target AQP4 function and test their therapeutic efficiency will be a breakthrough for addressing AD in that AQP4 controls the various physiological as well as pathophysiological features of astrocytes. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Gallbladder emptying to endogenous and exogenous stimulation in chronic pancreatitis patients.

    PubMed

    Meguro, T; Shimosegawa, T; Kashimura, J; Kikuchi, Y; Koizumi, M; Toyota, T

    1994-02-01

    The present study was designed to analyze the underlying mechanism of gallbladder motor disturbance in chronic pancreatitis patients. Gallbladder emptying to endogenous (oral test meal, Daiyan 13 g) and exogenous stimulation (iv cerulein, 30 ng/kg for 5 min) was examined by real-time ultrasonography in 12 patients with chronic pancreatitis and 10 normal subjects (controls). Plasma cholecystokinin levels during the endogenous stimulation were measured by bioassay. In chronic pancreatitis patients compared with controls, the fasting gallbladder volume was significantly increased (29.5 +/- 2.2 vs. 21.5 +/- 2.8 ml), whereas the gallbladder emptying (percent change of the basal volume) to oral test meal was significantly decreased. Neither cholecystokinin secretion induced by the test meal, nor the gallbladder emptying response to intravenous cerulein, differed significantly between the two groups. However, when chronic pancreatitis patients were divided according to pathogenesis, it became clear that gallbladder emptying to intravenous cerulein was significantly greater in patients with alcoholic chronic pancreatitis than in patients with idiopathic pancreatitis. Gallbladder emptying during the intestinal phase is generally reduced in patients with chronic pancreatitis, but gallbladder responsiveness to exogenous stimulation might be heterogeneous according to the pathogenesis.

  18. Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

    PubMed

    Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

    2017-03-01

    We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

  19. Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

    PubMed

    Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

    2015-10-01

    To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  20. Pathogenesis and pharmacologic treatment of obesity: the role of energy regulatory mechanism.

    PubMed

    Manulu, Mangatas S M; Sutanegara, I N Dwi

    2006-01-01

    Obesity has become a worldwide public health problem affecting millions of people. This is a chronic, stigmatized, and costly disease, rarely curable and is increasing in prevalence to a point today where we define obesity as an epidemic disease that not only in developed but also on developing countries. The pathogenesis of obesity is largely unknown, especially about energy regulatory mechanism that involved wide area of neuroendocrinology that is very interesting but very complex and makes internists "refuse" to learn. Obesity occurs through a longstanding imbalance between energy intake and energy expenditure, influenced by a complex biologic system that regulates appetite and adiposity. Obesity influences the pathogenesis of hypertension, type 2 diabetes, dyslipidemia, kidney, heart, and cerebrovascular disease. It is very wise for every internist to learn the pathogenesis and treatment of this worldwide diseases. Until now, the available treatments, including drugs, are palliative and are effective only while the treatment is being actively used; and besides so many side effects reported.

  1. Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

    2006-12-15

    We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

  2. Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius

    PubMed Central

    Henche, Anna-Lena; Ghosh, Abhrajyoti; Yu, Xiong; Jeske, Torsten; Egelman, Edward; Albers, Sonja-Verena

    2014-01-01

    Archaea display a variety of type IV pili on their surface and employ them in different physiological functions. In the crenarchaeon Sulfolobus acidocaldarius the most abundant surface structure is the aap pilus (archaeal adhesive pilus). The construction of in frame deletions of the aap genes revealed that all the five genes (aapA, aapX, aapE, aapF, aapB) are indispensible for assembly of the pilus and an impact on surface motility and biofilm formation was observed. Our analyses revealed that there exists a regulatory cross-talk between the expression of aap genes and archaella (formerly archaeal flagella) genes during different growth phases. The structure of the aap pilus is entirely different from the known bacterial type IV pili as well as other archaeal type IV pili. An aap pilus displayed 3 stranded helices where there is a rotation per subunit of ~ 138° and a rise per subunit of ~ 5.7 Å. The filaments have a diameter of ~ 110 Å and the resolution was judged to be ~ 9 Å. We concluded that small changes in sequence might be amplified by large changes in higher-order packing. Our finding of an extraordinary stability of aap-pili possibly represents an adaptation to harsh environments that S. acidocaldarius encounters. PMID:23078543

  3. [Autism in children. Speech, behavior and motor activity point to diagnosis].

    PubMed

    Neumärker, K J

    2001-02-01

    Austistic disorders characteristically involve specific impairments of social skills, of the language and of stereotyped body movements. L Kanner and H. Asperger were the first to describe these psychopathologic features, which still form the core of the diagnostic criteria of contemporary psychiatric classification systems, ICD-10 and DSM-IV, in the category pervasive developmental disorders. Useful diagnostic tools have been developed to establish the clinical diagnosis. The results of research point to a predominantly genetic pathogenesis involving a complex interaction of multiple genes. While no causal treatments are available for these heterogenic disorders, there are many therapeutic concepts. Although some treatments may achieve significant improvements, autistic disorders usually mean a lifelong individual impairment.

  4. Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

    PubMed

    Hardy, Christine D; Cozzarelli, Nicholas R

    2003-03-01

    DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

  5. Potential role of pre- and postnatal testosterone levels in attention-deficit/hyperactivity disorder: is there a sex difference?

    PubMed

    Wang, Liang-Jen; Chou, Miao-Chun; Chou, Wen-Jiun; Lee, Min-Jing; Lee, Sheng-Yu; Lin, Pao-Yen; Lee, Yi-Hsuan; Yang, Yi-Hsin; Yen, Cheng-Fang

    2017-01-01

    Both prenatal testosterone (T) exposure and postnatal T levels have been associated with developing neural circuitry and behavioral systems. This study examined the potential correlation between pre- and postnatal T levels and behavioral and neurocognitive profiles of children with attention-deficit/hyperactivity disorder (ADHD). Two hundred ADHD patients with a mean age of 8.7±2.0 years (158 boys and 42 girls) were recruited. The ratio of the length of the right index finger (2D) to that of the right ring finger (4D) (2D/4D ratio) served as a surrogate of prenatal T exposure, and postnatal T was determined using salivary T concentration. Behavioral symptoms were evaluated using the Swanson, Nolan, and Pelham - Version IV Scale for ADHD (SNAP-IV). Neurocognitive function was assessed using the Wechsler Intelligence Scale for Children - Fourth Edition (WISC-IV) and Conners' Continuous Performance Test (CPT). Lower 2D/4D ratios were associated with comorbid disruptive behavior disorders ( t =2.15, P =0.033) in all participants. Among the boys with ADHD, neither 2D/4D ratios nor salivary T levels were associated with behavioral symptoms or neurocognitive function. Among the girls with ADHD, the salivary T level was positively correlated with the Perceptual Reasoning Index of the WISC-IV ( r =0.48, P =0.001) and the Confidence Index ( r =0.37, P =0.017) and Omission Errors of the CPT ( r =0.62, P <0.001). Findings suggest that a higher prenatal T exposure is associated with a greater risk of developing disruptive behavior disorders, and T may exert differential neurocognitive effects between boys and girls with ADHD. However, the neurobiological mechanisms of T involved in the pathogenesis of ADHD warrant further investigation.

  6. Matrix Metalloproteases and Tissue Inhibitors of Metalloproteinases in Medial Plica and Pannus-like Tissue Contribute to Knee Osteoarthritis Progression

    PubMed Central

    Yang, Chih-Chang; Lin, Cheng-Yu; Wang, Hwai-Shi; Lyu, Shaw-Ruey

    2013-01-01

    Osteoarthritis (OA) is characterized by degradation of the cartilage matrix, leading to pathologic changes in the joints. However, the pathogenic effects of synovial tissue inflammation on OA knees are not clear. To investigate whether the inflammation caused by the medial plica is involved in the pathogenesis of osteoarthritis, we examined the expression of matrix metalloproteinases (MMPs), tissue inhibitors of metalloproteinases (TIMPs), interleukin (IL)-1β, and tumor necrosis factor (TNF)-α in the medial plica and pannus-like tissue in the knees of patients with medial compartment OA who underwent either arthroscopic medial release (stage II; 15 knee joints from 15 patients) or total knee replacement (stage IV; 18 knee joints from 18 patients). MMP-2, MMP-3, MMP-9, IL-1β, and TNF-α mRNA and protein levels measured, respectively, by quantitative real-time PCR and Quantibody human MMP arrays, were highly expressed in extracts of medial plica and pannus-like tissue from stage IV knee joints. Immunohistochemical staining also demonstrated high expression of MMP-2, MMP-3, and MMP-9 in plica and pannus-like tissue of stage IV OA knees and not in normal cartilage. Some TIMP/MMP ratios decreased significantly in both medial plica and pannus-like tissue as disease progressed from stage II to stage IV. Furthermore, the migration of cells from the pannus-like tissue was enhanced by IL-1β, while plica cell migration was enhanced by TNF-α. The results suggest that medial plica and pannus-like tissue may be involved in the process of cartilage degradation in medial compartment OA of the knee. PMID:24223987

  7. Matrix metalloproteases and tissue inhibitors of metalloproteinases in medial plica and pannus-like tissue contribute to knee osteoarthritis progression.

    PubMed

    Yang, Chih-Chang; Lin, Cheng-Yu; Wang, Hwai-Shi; Lyu, Shaw-Ruey

    2013-01-01

    Osteoarthritis (OA) is characterized by degradation of the cartilage matrix, leading to pathologic changes in the joints. However, the pathogenic effects of synovial tissue inflammation on OA knees are not clear. To investigate whether the inflammation caused by the medial plica is involved in the pathogenesis of osteoarthritis, we examined the expression of matrix metalloproteinases (MMPs), tissue inhibitors of metalloproteinases (TIMPs), interleukin (IL)-1β, and tumor necrosis factor (TNF)-α in the medial plica and pannus-like tissue in the knees of patients with medial compartment OA who underwent either arthroscopic medial release (stage II; 15 knee joints from 15 patients) or total knee replacement (stage IV; 18 knee joints from 18 patients). MMP-2, MMP-3, MMP-9, IL-1β, and TNF-α mRNA and protein levels measured, respectively, by quantitative real-time PCR and Quantibody human MMP arrays, were highly expressed in extracts of medial plica and pannus-like tissue from stage IV knee joints. Immunohistochemical staining also demonstrated high expression of MMP-2, MMP-3, and MMP-9 in plica and pannus-like tissue of stage IV OA knees and not in normal cartilage. Some TIMP/MMP ratios decreased significantly in both medial plica and pannus-like tissue as disease progressed from stage II to stage IV. Furthermore, the migration of cells from the pannus-like tissue was enhanced by IL-1β, while plica cell migration was enhanced by TNF-α. The results suggest that medial plica and pannus-like tissue may be involved in the process of cartilage degradation in medial compartment OA of the knee.

  8. Iatrogenic Iron Overload in Dialysis Patients at the Beginning of the 21st Century.

    PubMed

    Rostoker, Guy; Vaziri, Nosratola D; Fishbane, Steven

    2016-05-01

    Iron overload used to be considered rare in hemodialysis patients but its clinical frequency is now increasingly realized. The liver is the main site of iron storage and the liver iron concentration (LIC) is closely correlated with total iron stores in patients with secondary hemosideroses and genetic hemochromatosis. Magnetic resonance imaging is now the gold standard method for LIC estimation and monitoring in non-renal patients. Studies of LIC in hemodialysis patients by quantitative magnetic resonance imaging and magnetic susceptometry have demonstrated a strong relation between the risk of iron overload and the use of intravenous (IV) iron products prescribed at doses determined by the iron biomarker cutoffs contained in current anemia management guidelines. These findings have challenged the validity of both iron biomarker cutoffs and current clinical guidelines, especially with respect to recommended IV iron doses. Three long-term observational studies have recently suggested that excessive IV iron doses may be associated with an increased risk of cardiovascular events and death in hemodialysis patients. We postulate that iatrogenic iron overload in the era of erythropoiesis-stimulating agents may silently increase complications in dialysis patients without creating frank clinical signs and symptoms. High hepcidin-25 levels were recently linked to fatal and nonfatal cardiovascular events in dialysis patients. It is therefore tempting to postulate that the main pathophysiological pathway leading to these events may involve the pleiotropic master hormone hepcidin (synergized by fibroblast growth factor 23), which regulates iron metabolism. Oxidative stress as a result of IV iron infusions and iron overload, by releasing labile non-transferrin-bound iron, might represent a 'second hit' on the vascular bed. Finally, iron deposition in the myocardium of patients with severe iron overload might also play a role in the pathogenesis of sudden death in some patients.

  9. First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

    PubMed Central

    Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

    2016-01-01

    Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

  10. Molecular Biology of Pseudorabies Virus: Impact on Neurovirology and Veterinary Medicine

    PubMed Central

    Pomeranz, Lisa E.; Reynolds, Ashley E.; Hengartner, Christoph J.

    2005-01-01

    Pseudorabies virus (PRV) is a herpesvirus of swine, a member of the Alphaherpesvirinae subfamily, and the etiological agent of Aujeszky's disease. This review describes the contributions of PRV research to herpesvirus biology, neurobiology, and viral pathogenesis by focusing on (i) the molecular biology of PRV, (ii) model systems to study PRV pathogenesis and neurovirulence, (iii) PRV transsynaptic tracing of neuronal circuits, and (iv) veterinary aspects of pseudorabies disease. The structure of the enveloped infectious particle, the content of the viral DNA genome, and a step-by-step overview of the viral replication cycle are presented. PRV infection is initiated by binding to cellular receptors to allow penetration into the cell. After reaching the nucleus, the viral genome directs a regulated gene expression cascade that culminates with viral DNA replication and production of new virion constituents. Finally, progeny virions self-assemble and exit the host cells. Animal models and neuronal culture systems developed for the study of PRV pathogenesis and neurovirulence are discussed. PRV serves as a self-perpetuating transsynaptic tracer of neuronal circuitry, and we detail the original studies of PRV circuitry mapping, the biology underlying this application, and the development of the next generation of tracer viruses. The basic veterinary aspects of pseudorabies management and disease in swine are discussed. PRV infection progresses from acute infection of the respiratory epithelium to latent infection in the peripheral nervous system. Sporadic reactivation from latency can transmit PRV to new hosts. The successful management of PRV disease has relied on vaccination, prevention, and testing. PMID:16148307

  11. Lesch typology and temperament in opioid dependence: a cross-sectional study.

    PubMed

    Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

    2014-08-01

    The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis.

    PubMed

    Luvan, M; Kanthan, S R; Roshan, G; Saw, A

    2015-11-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy.

  13. A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

    PubMed

    Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

    2009-05-01

    Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

  14. [Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

    PubMed

    Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

    2010-01-01

    Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

  15. Adult presentation of Bartter syndrome type IV with erythrocytosis.

    PubMed

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis.

  16. Audiological findings in children with mucopolysaccharidoses type i-iv.

    PubMed

    Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

    The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

  17. Risk evaluation for in-vehicle sign information.

    DOT National Transportation Integrated Search

    2016-05-01

    The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

  18. Theories on the pathogenesis of endometriosis.

    PubMed

    Sourial, Samer; Tempest, Nicola; Hapangama, Dharani K

    2014-01-01

    Endometriosis is a common, chronic inflammatory disease defined by the presence of extrauterine endometrial tissue. The aetiology of endometriosis is complex and multifactorial, where several not fully confirmed theories describe its pathogenesis. This review examines existing theories on the initiation and propagation of different types of endometriotic lesions, as well as critically appraises the myriad of biologically relevant evidence that support or oppose each of the proposed theories. The current literature suggests that stem cells, dysfunctional immune response, genetic predisposition, and aberrant peritoneal environment may all be involved in the establishment and propagation of endometriotic lesions. An orchestrated scientific and clinical effort is needed to consider all factors involved in the pathogenesis of this multifaceted disease and to propose novel therapeutic targets to reach effective treatments for this distressing condition.

  19. Theories on the Pathogenesis of Endometriosis

    PubMed Central

    Sourial, Samer; Hapangama, Dharani K.

    2014-01-01

    Endometriosis is a common, chronic inflammatory disease defined by the presence of extrauterine endometrial tissue. The aetiology of endometriosis is complex and multifactorial, where several not fully confirmed theories describe its pathogenesis. This review examines existing theories on the initiation and propagation of different types of endometriotic lesions, as well as critically appraises the myriad of biologically relevant evidence that support or oppose each of the proposed theories. The current literature suggests that stem cells, dysfunctional immune response, genetic predisposition, and aberrant peritoneal environment may all be involved in the establishment and propagation of endometriotic lesions. An orchestrated scientific and clinical effort is needed to consider all factors involved in the pathogenesis of this multifaceted disease and to propose novel therapeutic targets to reach effective treatments for this distressing condition. PMID:25763392

  20. Nonstatic radiating spheres in general relativity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krori, K.D.; Borgohain, P.; Sarma, R.

    1985-02-15

    The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

  1. Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

    DTIC Science & Technology

    2010-05-01

    Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

  2. Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

    NASA Astrophysics Data System (ADS)

    Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

    2013-09-01

    Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

  3. Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

    PubMed

    Satya, Ramadass; Vijayakumar, Vani

    2006-10-01

    A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

  4. Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

    PubMed

    Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

    2014-06-01

    The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

  5. Biomarker for Glycogen Storage Diseases

    ClinicalTrials.gov

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  6. Fungal-specific transcription factor AbPf2 activates pathogenicity in Alternaria brassicicola

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cho, Yangrae; Ohm, Robin A.; Grigoriev, Igor V.

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. To identify molecular determinants of pathogenicity, we created non-pathogenic mutants of a transcription factor-encoding gene, AbPf2. The frequency and timing of germination and appressorium formation on host plants were similar between the non-pathogenic abpf2 mutants and wild-type A. brassicicola. The mutants were also similar in vitro to wild-type A. brassicicola in terms of vegetative growth, conidium production, and responses to a phytoalexin, reactive oxygen species and osmolites. The hyphae of the mutants grew slowly but did not cause disease symptoms on the surface of host plants. Transcripts of the AbPf2more » gene increased exponentially soon after wild-type conidia contacted their host plants . A small amount of AbPf2 protein, as monitored using GFP fusions, was present in young, mature conidia. The protein level decreased during saprophytic growth, but increased and was located primarily in fungal nuclei during pathogenesis. Levels of the proteins and transcripts sharply decreased following colonization of host tissues beyond the initial infection site. When expression of the transcription factor was induced in the wild-type during early pathogenesis, 106 fungal genes were also induced in the wild-type but not in the abpf2 mutants. Notably, 33 of the 106 genes encoded secreted proteins, including eight putative effector proteins. Plants inoculated with abpf2 mutants expressed higher levels of genes associated with photosynthesis, the pentose phosphate pathway and primary metabolism, but lower levels of defense-related genes. Our results suggest that AbPf2 is an important regulator of pathogenesis, but does not affect other cellular processes in A. brassicicola.« less

  7. B cell IFN-γ receptor signaling promotes autoimmune germinal centers via cell-intrinsic induction of BCL-6

    PubMed Central

    Jackson, Shaun W.; Jacobs, Holly M.; Arkatkar, Tanvi; Dam, Elizabeth M.; Scharping, Nicole E.; Kolhatkar, Nikita S.; Hou, Baidong; Buckner, Jane H.

    2016-01-01

    Dysregulated germinal center (GC) responses are implicated in the pathogenesis of human autoimmune diseases, including systemic lupus erythematosus (SLE). Although both type 1 and type 2 interferons (IFNs) are involved in lupus pathogenesis, their respective impacts on the establishment of autoimmune GCs has not been addressed. In this study, using a chimeric model of B cell-driven autoimmunity, we demonstrate that B cell type 1 IFN receptor signals accelerate, but are not required for, lupus development. In contrast, B cells functioning as antigen-presenting cells initiate CD4+ T cell activation and IFN-γ production, and strikingly, B cell–intrinsic deletion of the IFN-γ receptor (IFN-γR) abrogates autoimmune GCs, class-switched autoantibodies (auto-Abs), and systemic autoimmunity. Mechanistically, although IFN-γR signals increase B cell T-bet expression, B cell–intrinsic deletion of T-bet exerts an isolated impact on class-switch recombination to pathogenic auto-Ab subclasses without impacting GC development. Rather, in both mouse and human B cells, IFN-γ synergized with B cell receptor, toll-like receptor, and/or CD40 activation signals to promote cell-intrinsic expression of the GC master transcription factor, B cell lymphoma 6 protein. Our combined findings identify a novel B cell–intrinsic mechanism whereby IFN signals promote lupus pathogenesis, implicating this pathway as a potential therapeutic target in SLE. PMID:27069113

  8. Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

    PubMed Central

    Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

    2014-01-01

    Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

  9. The Interaction of Endothelin-1 and TGF-β1 Mediates Vascular Cell Remodeling

    PubMed Central

    Lambers, Christopher; Roth, Michael; Zhong, Jun; Campregher, Christoph; Binder, Petra; Burian, Bernhard; Petkov, Ventzislav; Block, Lutz-Henning

    2013-01-01

    Background Pulmonary arterial hypertension is characterized by increased thickness of pulmonary vessel walls due to both increased proliferation of pulmonary arterial smooth muscle cell (PASMC) and deposition of extracellular matrix. In patients suffering from pulmonary arterial hypertension, endothelin-1 (ET-1) synthesis is up-regulated and may increase PASMC activity and vessel wall remodeling through transforming growth factor beta-1 (TGF-β1) and connective tissue growth factor. Objective To assess the signaling pathway leading to ET-1 induced proliferation and extracellular matrix deposition by human PASMC. Methods PASMC were serum starved for 24 hours before stimulation with either ET-1 and/or TGF-β1. ET-1 was inhibited by Bosentan, ERK1/2 mitogen activated protein kinase (MAPK) was inhibited by U0126 and p38 MAPK was inhibited by SB203580. Results ET-1 increased PASMC proliferation when combined with serum. This effect involved the mitogen activated protein kinases (MAPK) ERK1/2 MAPK and was abrogated by Bosentan which caused a G1- arrest through activation of p27(Kip). Regarding the contribution of extracellular matrix deposition in vessel wall remodeling, TGF-β1 increased the deposition of collagen type-I and fibronectin, which was further increased when ET-1 was added mainly through ERK1/2 MAPK. In contrast, collagen type-IV was not affected by ET-1. Bosentan dose-dependently reduced the stimulatory effect of ET-1 on collagen type-I and fibronectin, but had no effect on TGF-β1. Conclusion and Clinical Relevance ET-1 alone does not induce PASMC proliferation and extracellular matrix deposition. However, ET-1 significantly up-regulates serum induced proliferation and TGF-β1 induced extracellular matrix deposition, specifically of collagen type-I and fibronectin. The synergistic effects of ET-1 on serum and TGF-β1 involve ERK1/2 MAPK and may thus present a novel mode of action in the pathogenesis of pulmonary arterial hypertension. PMID:24015303

  10. Significance of Inactivated Genes in Leukemia: Pathogenesis and Prognosis

    PubMed Central

    Heidari, Nazanin; Abroun, Saeid; Bertacchini, Jessika; Vosoughi, Tina; Rahim, Fakher; Saki, Najmaldin

    2017-01-01

    Epigenetic and genetic alterations are two mechanisms participating in leukemia, which can inactivate genes involved in leukemia pathogenesis or progression. The purpose of this review was to introduce various inactivated genes and evaluate their possible role in leukemia pathogenesis and prognosis. By searching the mesh words “Gene, Silencing AND Leukemia” in PubMed website, relevant English articles dealt with human subjects as of 2000 were included in this study. Gene inactivation in leukemia is largely mediated by promoter’s hypermethylation of gene involving in cellular functions such as cell cycle, apoptosis, and gene transcription. Inactivated genes, such as ASPP1, TP53, IKZF1 and P15, may correlate with poor prognosis in acute lymphoid leukemia (ALL), chronic lymphoid leukemia (CLL), chronic myelogenous leukemia (CML) and acute myeloid leukemia (AML), respectively. Gene inactivation may play a considerable role in leukemia pathogenesis and prognosis, which can be considered as complementary diagnostic tests to differentiate different leukemia types, determine leukemia prognosis, and also detect response to therapy. In general, this review showed some genes inactivated only in leukemia (with differences between B-ALL, T-ALL, CLL, AML and CML). These differences could be of interest as an additional tool to better categorize leukemia types. Furthermore; based on inactivated genes, a diverse classification of Leukemias could represent a powerful method to address a targeted therapy of the patients, in order to minimize side effects of conventional therapies and to enhance new drug strategies. PMID:28580304

  11. Self aligned hysteresis free carbon nanotube field-effect transistors

    NASA Astrophysics Data System (ADS)

    Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

    2016-04-01

    Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

  12. The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

    PubMed

    Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

    2018-05-01

    Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

  13. Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

    PubMed

    Boos, A

    2000-01-01

    Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

  14. Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

    PubMed Central

    Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

    2017-01-01

    The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

  15. Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

    PubMed

    Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

    2016-01-01

    Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

  16. Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

    PubMed Central

    Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

    2016-01-01

    Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

  17. Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

    PubMed Central

    Harastani, Houda H.; Tokajian, Sima T.

    2014-01-01

    Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

  18. Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

    DTIC Science & Technology

    1983-12-01

    2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

  19. Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

    PubMed

    Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

    2017-01-01

    Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

  20. AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasanth, V.; Chen, Yao; Feng, Shiwei

    2016-10-10

    Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

  1. Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

    PubMed

    Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

    2015-07-01

    In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

  2. [Alcohol-related cognitive impairment and the DSM-5].

    PubMed

    Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

    2016-01-01

    It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

  3. Recent advances in cytokines in cutaneous and systemic lupus erythematosus.

    PubMed

    Mikita, Naoya; Ikeda, Takaharu; Ishiguro, Mariko; Furukawa, Fukumi

    2011-09-01

    Lupus erythematosus (LE) includes a broad spectrum of diseases from a cutaneous-limited type to a systemic type. Systemic lupus erythematosus (SLE) is a systemic autoimmune disease which affects multiple organs. Cutaneous lupus erythematosus (CLE) includes skin symptoms seen in SLE and cutaneous-limited LE. Although immune abnormalities, as well as heritable, hormonal and environmental factors, are involved in the pathology of LE, the actual pathogenesis is still unclear. Recently, the involvement of various cytokines has been shown in the pathogenesis of LE. Moreover, some trials with biological agents targeted specific cytokines are also ongoing for SLE. In this article, we review the contributions of major cytokines such as interferon, tumor necrosis factor-α and interleukin-18 to LE, especially SLE and CLE. © 2011 Japanese Dermatological Association.

  4. Innate immune escape by Dengue and West Nile viruses.

    PubMed

    Gack, Michaela U; Diamond, Michael S

    2016-10-01

    Dengue (DENV) and West Nile (WNV) viruses are mosquito-transmitted flaviviruses that cause significant morbidity and mortality worldwide. Disease severity and pathogenesis of DENV and WNV infections in humans depend on many factors, including pre-existing immunity, strain virulence, host genetics and virus-host interactions. Among the flavivirus-host interactions, viral evasion of type I interferon (IFN)-mediated innate immunity has a critical role in modulating pathogenesis. DENV and WNV have evolved effective strategies to evade immune surveillance pathways that lead to IFN induction and to block signaling downstream of the IFN-α/β receptor. Here, we discuss recent advances in our understanding of the molecular mechanisms by which DENV and WNV antagonize the type I IFN response in human cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis

    PubMed Central

    Luvan, M; Roshan, G; Saw, A

    2015-01-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy. PMID:28611907

  6. The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

    PubMed Central

    Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

    2012-01-01

    In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

  7. Neurenteric Cyst or Neuroendodermal Cyst? Immunohistochemical Study and Pathogenesis.

    PubMed

    Chen, Chun-Ting; Lai, Hung-Yi; Jung, Shih-Ming; Lee, Ching-Yi; Wu, Chieh-Tsai; Lee, Shih-Tseng

    2016-12-01

    Neurenteric cysts are rare central nervous system lesions derived from an endodermal origin. There is no consensus concerning pathogenesis because of the paucity of occurrences. We report an immunohistochemical study of 10 cases with neurenteric cysts and postulate its pathogenesis. Ten patients underwent surgical treatment for neurenteric cysts from 1995 to 2015. We retrospectively reviewed clinical, radiologic, operative, and pathologic findings for these patients. Immunohistochemical stains were completed in all cases to distinguish cell type and origin. Three cell types were identified: pseudostratified-ciliated, goblet-columnar, and simple cuboidal cells. All cases were positive for cytokeratin 7, and negative for cytokeratin 20, caudal-type homeobox 2, mucin 2, thyroid transcription factor 1, human chorionic gonadotropin, placental alkaline phosphatase, and cluster of differentiation 31. Four of them had positive staining for mucin 5AC, with expression only in goblet-columnar cells. According to the immunohistochemical results, the cells resembled the respiratory tract (pseudostratified-ciliated), stomach (goblet-columnar), and respiratory bronchioles (simple cuboidal). Seventy-five percent of cases with recurrence had a goblet-columnar component, emphasizing the importance of total resection of the cyst and complete pathologic examination. We postulate that the cystic tumor was derived from multipotent endodermal cells that migrated and traveled along the neuroectoderm, with incomplete differentiation into various cell types as a result of an unsuitable microenvironment. Because the neurenteric canal was only the channel of migration rather than a component of the cysts, the term neuroendodermal cysts is more precise in presenting the embryopathogenesis. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

    PubMed

    Madabhushi, Ram; Marians, Kenneth J

    2009-01-30

    In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

  9. Infection of immunodeficient horses with Sarcocystis neurona does not result in neurologic disease.

    PubMed

    Sellon, Debra C; Knowles, Donald P; Greiner, Ellis C; Long, Maureen T; Hines, Melissa T; Hochstatter, Tressa; Tibary, Ahmed; Dame, John B

    2004-11-01

    Equine protozoal myeloencephalitis is a progressive neurologic disease of horses most commonly caused by infection with the apicomplexan parasite Sarcocystis neurona. Factors affecting neuroinvasion and neurovirulence have not been determined. We investigated the pathogenesis of infection with S. neurona in horses with severe combined immune deficiency (SCID). Two immunocompetent (IC) Arabian horses and two Arabian horses with SCID were infected orally with 5 x 10(5) sporocysts of S. neurona. Four IC horses and one SCID horse were infected intravenously (i.v.) with 5 x 10(8) merozoites of the WSU-1 isolate of S. neurona. Despite prolonged parasitemia and persistent infection of visceral tissues (skeletal muscle, cardiac muscle, lung, liver, and spleen) as demonstrated by PCR and culture, SCID horses did not develop neurologic signs after oral or i.v. infection. S. neurona was undetectable in the neuronal tissues of SCID horses by either PCR, immunohistochemistry, or culture. In contrast, although parasitemia was undetectable in orally infected IC horses and of only short duration in i.v. infected IC horses, four of six IC horses developed neurologic signs. S. neurona was detectable by PCR and/or culture of neural tissue but not visceral tissue of IC horses with neurologic disease. Infected SCID horses are unable to clear S. neurona from visceral tissues, but the infection does not result in neurologic signs; in contrast, IC horses rapidly control parasitemia and infection of visceral tissues but frequently experience neuroinvasion and exhibit clinical signs of neurologic disease.

  10. Infection of Immunodeficient Horses with Sarcocystis neurona Does Not Result in Neurologic Disease

    PubMed Central

    Sellon, Debra C.; Knowles, Donald P.; Greiner, Ellis C.; Long, Maureen T.; Hines, Melissa T.; Hochstatter, Tressa; Tibary, Ahmed; Dame, John B.

    2004-01-01

    Equine protozoal myeloencephalitis is a progressive neurologic disease of horses most commonly caused by infection with the apicomplexan parasite Sarcocystis neurona. Factors affecting neuroinvasion and neurovirulence have not been determined. We investigated the pathogenesis of infection with S. neurona in horses with severe combined immune deficiency (SCID). Two immunocompetent (IC) Arabian horses and two Arabian horses with SCID were infected orally with 5 × 105 sporocysts of S. neurona. Four IC horses and one SCID horse were infected intravenously (i.v.) with 5 × 108 merozoites of the WSU-1 isolate of S. neurona. Despite prolonged parasitemia and persistent infection of visceral tissues (skeletal muscle, cardiac muscle, lung, liver, and spleen) as demonstrated by PCR and culture, SCID horses did not develop neurologic signs after oral or i.v. infection. S. neurona was undetectable in the neuronal tissues of SCID horses by either PCR, immunohistochemistry, or culture. In contrast, although parasitemia was undetectable in orally infected IC horses and of only short duration in i.v. infected IC horses, four of six IC horses developed neurologic signs. S. neurona was detectable by PCR and/or culture of neural tissue but not visceral tissue of IC horses with neurologic disease. Infected SCID horses are unable to clear S. neurona from visceral tissues, but the infection does not result in neurologic signs; in contrast, IC horses rapidly control parasitemia and infection of visceral tissues but frequently experience neuroinvasion and exhibit clinical signs of neurologic disease. PMID:15539518

  11. AAV9-based gene therapy partially ameliorates the clinical phenotype of a mouse model of Leigh syndrome

    PubMed Central

    Di Meo, I; Marchet, S; Lamperti, C; Zeviani, M; Viscomi, C

    2017-01-01

    Leigh syndrome (LS) is the most common infantile mitochondrial encephalopathy. No treatment is currently available for this condition. Mice lacking Ndufs4, encoding NADH: ubiquinone oxidoreductase iron-sulfur protein 4 (NDUFS4) recapitulates the main findings of complex I (cI)-related LS, including severe multisystemic cI deficiency and progressive neurodegeneration. In order to develop a gene therapy approach for LS, we used here an AAV2/9 vector carrying the human NDUFS4 coding sequence (hNDUFS4). We administered AAV2/9-hNDUFS4 by intravenous (IV) and/or intracerebroventricular (ICV) routes to either newborn or young Ndufs4−/− mice. We found that IV administration alone was only able to correct the cI deficiency in peripheral organs, whereas ICV administration partially corrected the deficiency in the brain. However, both treatments failed to improve the clinical phenotype or to prolong the lifespan of Ndufs4−/− mice. In contrast, combined IV and ICV treatments resulted, along with increased cI activity, in the amelioration of the rotarod performance and in a significant prolongation of the lifespan. Our results indicate that extraneurological organs have an important role in LS pathogenesis and provide an insight into current limitations of adeno-associated virus (AAV)-mediated gene therapy in multisystem disorders. These findings warrant future investigations to develop new vectors able to efficiently target multiple organs. PMID:28753212

  12. Blood Levels of Trace Elements in Children with Attention-Deficit Hyperactivity Disorder: Results from a Case-Control Study.

    PubMed

    Yang, Rongwang; Zhang, Yanyi; Gao, Weijia; Lin, Nannan; Li, Rong; Zhao, Zhengyan

    2018-06-16

    Some trace elements may participate in the pathogenesis of attention-deficit hyperactivity disorder (ADHD). This study aimed to investigate the trace element status of zinc (Zn), copper (Cu), iron (Fe), magnesium (Mg), and lead (Pb) in children with ADHD, and to compare them with normal controls. Associations between examined elements and SNAP-IV rating scores of ADHD symptoms were also assessed. Four hundred nineteen children with ADHD (8.8 ± 2.1 years) and 395 matched normal controls (8.9 ± 1.7 years) were recruited in the study. The concentrations of Zn, Fe, Cu, Mg, and Pb in the whole blood were measured by atomic absorption spectrometry. Lower zinc levels (P < 0.001) and the number out of normal ranges (P = 0.015) were found in children with ADHD when compared with the normal control group. The difference remained when adjusting the factor of BMI z-score. No significant between-group differences were found in levels of other elements. Zinc levels were negatively correlated with parent-rated scores of inattentive subscale of SNAP-IV (r = - 0.40) as well as with total score of SNAP-IV (r = - 0.24). Other significant associations were not observed. The present results indicated that there were alterations in blood levels of zinc, which was associated with the symptom scores of ADHD.

  13. Causes of endometriosis and prevalent infertility in patients undergoing laparoscopy without achieving pregnancy.

    PubMed

    DE Oliveira, Renato; Adami, Fernando; Mafra, Fernanda A; Bianco, Bianca; Vilarino, Fabia L; Barbosa, Caio P

    2016-06-01

    Endometriosis is a disease with an unknown pathogenesis that can lead to infertility. Endometrial polyps, fibroids, and polycystic ovarian syndrome (PCOS) have relatively high frequency and are causes of infertility. We hypothesized a possible relationship between the presence of polyps, fibroids, and PCOS in infertile women with endometriosis who underwent laparoscopy and did not get pregnant, compared to women in the control group. This study was a cross-sectional study of 1243 infertile patients (621 with endometriosis and 622 controls). Endometriosis, Body Mass Index (BMI), infertility duration, age, and smoking habits were analyzed in relation to the presence of endometrial polyps, fibroids, and PCOS. Polyps, 1.8 (95% CI 1.3-2.5); fibroids, 2.5 (95% CI 1.5-4.1); and PCOS, 1.0 (95% CI 0.6-1.6 were observed in the endometriosis group. A total of 285 patients (45.9%) were classified presenting endometriosis grades I and II, and 336 patients (54.1%) with grades III and IV. Our findings showed a significant association between the presence of fibroids in 129 women with endometriosis (20.8%), and in 69 (53.9%) with endometriosis grades III and IV (P=0:04). Among the 31 PCOS patients, 24 (77.4%) showed grades I and II (P<0.001). Endometriosis and infertility are associated with the presence of polyps and fibroids. Furthermore, associations between the presence of fibroids with endometriosis grades III and IV, and presence of PCOS with grades I and II were observed.

  14. Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

    PubMed

    Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

    2015-01-01

    A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

  15. Type 1 fimbriae and extracellular polysaccharides are preeminent uropathogenic Escherichia coli virulence determinants in the murine urinary tract.

    PubMed

    Bahrani-Mougeot, Farah K; Buckles, Eric L; Lockatell, C V; Hebel, J R; Johnson, D E; Tang, C M; Donnenberg, M S

    2002-08-01

    Escherichia coli is the leading cause of urinary tract infections (UTIs). Despite the association of numerous bacterial factors with uropathogenic E. coli (UPEC), few such factors have been proved to be required for UTI in animal models. Previous investigations of urovirulence factors have relied on prior identification of phenotypic characteristics. We used signature-tagged mutagenesis (STM) in an unbiased effort to identify genes that are essential for UPEC survival within the murine urinary tract. A library of 2049 transposon mutants of the prototypic UPEC strain CFT073 was constructed using mini-Tn5km2 carrying 92 unique tags and screened in a murine model of ascending UTI. After initial screening followed by confirmation in co-infection experiments, 19 survival-defective mutants were identified. These mutants were recovered in numbers 101- to 106-fold less than the wild type in the bladder, kidneys or urine or at more than one site. The transposon junctions from each attenuated mutant were sequenced and analysed. Mutations were found in: (i) the type 1 fimbrial operon; (ii) genes involved in the biosyn-thesis of extracellular polysaccharides including group I capsule, group II capsule and enterobacterial common antigen; (iii) genes involved in metabolic pathways; and (iv) genes with unknown function. Five of the genes identified are absent from the genome of the E. coli K-12 strain. Mutations in type 1 fimbrial genes resulted in severely attenuated colonization, even in the case of a mutant with an insertion upstream of the fim operon that affected the rate of fimbrial switching from the 'off' to the 'on' phase. Three mutants had insertions in a new type II capsule biosynthesis locus on a pathogenicity island and were impaired in the production of capsule in vivo. An additional mutant with an insertion in wecE was unable to synthesize enterobacterial common antigen. These results confirm the pre-eminence of type 1 fimbriae, establish the importance of extracellular polysaccharides in the pathogenesis of UTI and identify new urovirulence determinants.

  16. Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

    PubMed

    Hardie, Andrew D; Kereshi, Borko

    2014-06-01

    Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

  17. Pseudomonas syringae pv. tomato DC3000: a model pathogen for probing disease susceptibility and hormone signaling in plants.

    PubMed

    Xin, Xiu-Fang; He, Sheng Yang

    2013-01-01

    Since the early 1980s, various strains of the gram-negative bacterial pathogen Pseudomonas syringae have been used as models for understanding plant-bacterial interactions. In 1991, a P. syringae pathovar tomato (Pst) strain, DC3000, was reported to infect not only its natural host tomato but also Arabidopsis in the laboratory, a finding that spurred intensive efforts in the subsequent two decades to characterize the molecular mechanisms by which this strain causes disease in plants. Genomic analysis shows that Pst DC3000 carries a large repertoire of potential virulence factors, including proteinaceous effectors that are secreted through the type III secretion system and a polyketide phytotoxin called coronatine, which structurally mimics the plant hormone jasmonate (JA). Study of Pst DC3000 pathogenesis has not only provided several conceptual advances in understanding how a bacterial pathogen employs type III effectors to suppress plant immune responses and promote disease susceptibility but has also facilitated the discovery of the immune function of stomata and key components of JA signaling in plants. The concepts derived from the study of Pst DC3000 pathogenesis may prove useful in understanding pathogenesis mechanisms of other plant pathogens.

  18. Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

    DTIC Science & Technology

    2017-05-17

    490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

  19. Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

    PubMed

    Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

    2017-01-01

    The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

  20. Enterococcus faecium biofilm formation: identification of major autolysin AtlAEfm, associated Acm surface localization, and AtlAEfm-independent extracellular DNA Release.

    PubMed

    Paganelli, Fernanda L; Willems, Rob J L; Jansen, Pamela; Hendrickx, Antoni; Zhang, Xinglin; Bonten, Marc J M; Leavis, Helen L

    2013-04-16

    Enterococcus faecium is an important multidrug-resistant nosocomial pathogen causing biofilm-mediated infections in patients with medical devices. Insight into E. faecium biofilm pathogenesis is pivotal for the development of new strategies to prevent and treat these infections. In several bacteria, a major autolysin is essential for extracellular DNA (eDNA) release in the biofilm matrix, contributing to biofilm attachment and stability. In this study, we identified and functionally characterized the major autolysin of E. faecium E1162 by a bioinformatic genome screen followed by insertional gene disruption of six putative autolysin genes. Insertional inactivation of locus tag EfmE1162_2692 resulted in resistance to lysis, reduced eDNA release, deficient cell attachment, decreased biofilm, decreased cell wall hydrolysis, and significant chaining compared to that of the wild type. Therefore, locus tag EfmE1162_2692 was considered the major autolysin in E. faecium and renamed atlAEfm. In addition, AtlAEfm was implicated in cell surface exposure of Acm, a virulence factor in E. faecium, and thereby facilitates binding to collagen types I and IV. This is a novel feature of enterococcal autolysins not described previously. Furthermore, we identified (and localized) autolysin-independent DNA release in E. faecium that contributes to cell-cell interactions in the atlAEfm mutant and is important for cell separation. In conclusion, AtlAEfm is the major autolysin in E. faecium and contributes to biofilm stability and Acm localization, making AtlAEfm a promising target for treatment of E. faecium biofilm-mediated infections. IMPORTANCE Nosocomial infections caused by Enterococcus faecium have rapidly increased, and treatment options have become more limited. This is due not only to increasing resistance to antibiotics but also to biofilm-associated infections. DNA is released in biofilm matrix via cell lysis, caused by autolysin, and acts as a matrix stabilizer. In this study, we identified and characterized the major autolysin in E. faecium, which we designated AtlAEfm. atlAEfm disruption resulted in resistance to lysis, reduced extracellular DNA (eDNA), deficient cell attachment, decreased biofilm, decreased cell wall hydrolysis, and chaining. Furthermore, AtlAEfm is associated with Acm cell surface localization, resulting in less binding to collagen types I and IV in the atlAEfm mutant. We also identified AtlAEfm-independent eDNA release that contributes to cell-cell interactions in the atlAEfm mutant. These findings indicate that AtlAEfm is important in biofilm and collagen binding in E. faecium, making AtlAEfm a promising target for treatment of E. faecium infections.

  1. Adult presentation of Bartter syndrome type IV with erythrocytosis

    PubMed Central

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Abstract Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis. PMID:26537508

  2. An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

    PubMed Central

    MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

    2012-01-01

    SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

  3. Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

    PubMed

    Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

    2018-01-09

    Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

  4. The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

    PubMed Central

    Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

    2017-01-01

    Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

  5. Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

    PubMed Central

    Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

    2004-01-01

    NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

  6. Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

    PubMed Central

    Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

    2015-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

  7. Validity of DSM-IV attention–deficit/hyperactivity disorder symptom dimensions and subtypes

    PubMed Central

    Willcutt, Erik G.; Nigg, Joel T.; Pennington, Bruce F.; Solanto, Mary V.; Rohde, Luis A.; Tannock, Rosemary; Loo, Sandra K.; Carlson, Caryn L.; McBurnett, Keith; Lahey, Benjamin B.

    2013-01-01

    DSM-IV criteria for ADHD specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision-making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the validity of the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, it is concluded that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. PMID:22612200

  8. Molecular characterization of a functional type VI secretion system from a clinical isolate of Aeromonas hydrophila

    EPA Science Inventory

    Our laboratory recently molecularly characterized the type II secretion system (T2SS)-associated cytotoxic enterotoxin (Act) and the T3SS-secreted AexU effector from a diarrheal isolate SSU of Aeromonas hydrophila. The role of these toxin proteins in the pathogenesis of A. hydrop...

  9. Molecular Characterization of a Functional Type VI Secretion System from a Clinical Isolate of Aeromonas hydrophilia

    EPA Science Inventory

    Our laboratory recently molecularly characterized the type II secretion system (T2SS)-associated cytotoxic enterotoxin (Act) and the T3SS-secreted AexU effector from a diarrheal isolate SSU of Aeromonas hydrophila. The role of these toxin proteins in the pathogenesis of A. hydrop...

  10. Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

    PubMed

    Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

    2013-11-01

    The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

  11. β-Cell Autophagy in Diabetes Pathogenesis.

    PubMed

    Marasco, Michelle R; Linnemann, Amelia K

    2018-05-01

    Nearly 100 years have passed since Frederick Banting and Charles Best first discovered and purified insulin. Their discovery and subsequent improvements revolutionized the treatment of diabetes, and the field continues to move at an ever-faster pace with respect to unique treatments for both type 1 and type 2 diabetes. Despite these advances, we still do not fully understand how apoptosis of the insulin-producing β-cells is triggered, presenting a challenge in the development of preventative measures. In recent years, the process of autophagy has generated substantial interest in this realm due to discoveries highlighting its clear role in the maintenance of cellular homeostasis. As a result, the number of studies focused on islet and β-cell autophagy has increased substantially in recent years. In this review, we will discuss what is currently known regarding the role of β-cell autophagy in type 1 and type 2 diabetes pathogenesis, with an emphasis on new and exciting developments over the past 5 years. Further, we will discuss how these discoveries might be translated into unique treatments in the coming years.

  12. Influence of hospital type on survival in stage IV colorectal cancer.

    PubMed

    Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

    2016-08-01

    Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

  13. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  14. Identification of type IV collagen exposure as a molecular imaging target for early detection of thoracic aortic dissection

    PubMed Central

    Xu, Ke; Xu, Chen; Zhang, Yanzhenzi; Qi, Feiran; Yu, Bingran; Li, Ping; Jia, Lixin; Li, Yulin; Xu, Fu-jian; Du, Jie

    2018-01-01

    Thoracic aortic dissection (TAD) is an aggressive and life-threatening vascular disease and there is no effective means of early diagnosis of dissection. Type IV collagen (Col-IV) is a major component of the sub-endothelial basement membrane, which is initially exposed followed by endothelial injury as early-stage event of TAD. So, we want to build a noninvasive diagnostic method to detect early dissection by identifying the exposed Col-IV via MRI. Methods: Col-IV-targeted magnetic resonance/ fluorescence dual probe (Col-IV-DOTA-Gd-rhodamine B; CDR) was synthesized by amide reaction and coordination reaction. Flow cytometry analysis was used to evaluate the cell viability of SMC treated with CDR and fluorescence assays were used to assess the Col-IV targeting ability of CDR in vitro. We then examined the sensitivity and specificity of CDR at different stages of TAD via MRI and bioluminescence imaging in vivo. Results: The localization of Col-IV (under the intima) was observed by histology images. CDR bound specifically to Col-IV-expressing vascular smooth muscle cells and BAPN-induced dissected aorta. The CDR signal was co-detected by magnetic resonance imaging (MRI) and bioluminescence imaging as early as 2 weeks after BAPN administration (pre-dissection stage). The ability to detect rupture of dissected aorta was indicated by a strong normalized signal enhancement (NSE) in vivo. Moreover, NSE was negatively correlated with the time of dissection rupture after BAPN administration (r2 = 0.8482). Conclusion: As confirmed by in vivo studies, the CDR can identify the exposed Col-IV in degenerated aorta to monitor the progress of aortic dissection from the early stage to the rupture via MRI. Thus, CDR-enhanced MRI proposes a potential method for dissection screening, and for monitoring disease progression and therapeutic response. PMID:29290819

  15. Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression

    PubMed Central

    SUNAMOTO, MASAAKI; KUZE, KOGO; IEHARA, NORIYUKI; TAKEOKA, HIROYA; NAGATA, KAZUHIRO; KITA, TORU; DOI, TOSHIO

    1998-01-01

    Glomerulosclerosis is characterized by accumulation of the mesangial extracellular matrix, including type I and IV collagen. The processing for the collagens in the glomeruli may play a critical role for development of glomerulosclerosis. We examined the expression of heat shock protein 47 (HSP47), a collagen-binding molecular chaperone in the progresive glomerulosclerosis model. Subtotally nephrectomized rats, unlike sham-operated rats, developed focal and segmental glomerulosclerosis. Immunological staining demonstrated an increased expression of HSP47 which paralleled the expression of type I and IV collagen in the glomeruli of the nephrectomized rats as the glomerulosclerosis developed. The mRNA levels encoding type I and type IV collagen and HSP47 were increased 3.4 fold, 3.6 fold and 2.8 fold, respectively, at week 7 after nephrectomy. By in situ hybridization, the expression of HSP47 mRNA was determined to be localized to the glomeruli with segmental sclerosis. These results suggest that HSP47 may play a central role in the process of extracellular matrix accumulation during the development of glomerulosclerosis. PMID:9741355

  16. Diverticular Disease: An Update on Pathogenesis and Management

    PubMed Central

    Rezapour, Mona; Ali, Saima

    2018-01-01

    Diverticular disease is one of the most common conditions in the Western world and one of the most common findings identified at colonoscopy. Recently, there has been a significant paradigm shift in our understanding of diverticular disease and its management. The pathogenesis of diverticular disease is thought to be multifactorial and include both environmental and genetic factors in addition to the historically accepted etiology of dietary fiber deficiency. Symptomatic uncomplicated diverticular disease (SUDD) is currently considered a type of chronic diverticulosis that is perhaps akin to irritable bowel syndrome. Mesalamine, rifaximin and probiotics may achieve symptomatic relief in some patients with SUDD, although their role(s) in preventing complications remain unclear. Antibiotic use for acute diverticulitis and elective prophylactic resection surgery are considered more individualized treatment modalities that take into account the clinical status, comorbidities and lifestyle of the patient. Our understanding of the pathogenesis of diverticular disease continues to evolve and is likely to be diverse and multifactorial. Paradigm shifts in several areas of the pathogenesis and management of diverticular disease are explored in this review. PMID:28494576

  17. The Role of the Reactive Oxygen Species and Oxidative Stress in the Pathomechanism of the Age-Related Ocular Diseases and Other Pathologies of the Anterior and Posterior Eye Segments in Adults

    PubMed Central

    Nita, Małgorzata; Grzybowski, Andrzej

    2016-01-01

    The reactive oxygen species (ROS) form under normal physiological conditions and may have both beneficial and harmful role. We search the literature and current knowledge in the aspect of ROS participation in the pathogenesis of anterior and posterior eye segment diseases in adults. ROS take part in the pathogenesis of keratoconus, Fuchs endothelial corneal dystrophy, and granular corneal dystrophy type 2, stimulating apoptosis of corneal cells. ROS play a role in the pathogenesis of glaucoma stimulating apoptotic and inflammatory pathways on the level of the trabecular meshwork and promoting retinal ganglion cells apoptosis and glial dysfunction in the posterior eye segment. ROS play a role in the pathogenesis of Leber's hereditary optic neuropathy and traumatic optic neuropathy. ROS induce apoptosis of human lens epithelial cells. ROS promote apoptosis of vascular and neuronal cells and stimulate inflammation and pathological angiogenesis in the course of diabetic retinopathy. ROS are associated with the pathophysiological parainflammation and autophagy process in the course of the age-related macular degeneration. PMID:26881021

  18. Chondroitin sulphates A, B and C, collagen types I-IV and fibronectin in venous sinus of the red pulp in human spleen.

    PubMed

    Rovenská, E; Michalka, P; Papincák, J; Durdík, S; Jakubovský, J

    2005-01-01

    The morphological relationship of chondroitin sulphates A, B, and C, collagen types I-IV and fibronectin in the wall of venous sinuses of the red pulp in human spleen has not been a focus of interest among morphologists. Regarding the hypothesis that the structure of the spleen lends it the function of a blood filter the substances described in our study might play a significant role in the functional morphology. Of 146 human spleen surgical specimens, groups of 12 specimens each were examined under a light microscope using the method of antibodies against fibronectin, against collagen types I-IV and against chondroitin sulphates A, B, and C. The sections of the red pulp of human spleen stained with hematoxylin and eosin provided limited information about the wall of the sinuses. Chondroitin sulphates A and B were observed on the surface of sinus-lining cells (SLC), and fibronectin was detected on the surface of the annular fibers. Collagen type 11 was observed almost in the same places as chondroitin sulphates A and B. Collagen type IV was present in annular fibers of the wall of the sinus and in the basement membrane, like fibronectin. Chondroitin sulphate was not present in the walls of sinuses. Binding of antibodies against chondroitin sulphate A and against chondroitin sulphate B indicates the presence of chondroitin sulfates on the surface of SLC, where they probably play a role in helping the human organism to recognize alien and self substances. The presence of chondroitin,sulphates A and B probably affects inhibition of binding of cells with collagen type I, but not with fibronectin.

  19. Association of history of allergies and influenza-like infections with laryngeal cancer in a case-control study.

    PubMed

    Filippidis, Filippos T; Schwartz, Stephen M; Becker, Nikolaus; Dyckhoff, Gerhard; Kirschfink, Michael; Dietz, Andreas; Becher, Heiko; Ramroth, Heribert

    2015-08-01

    Prior studies suggest that history of allergy and infections early in life might be inversely associated with cancer. We explored the association between allergies, recent influenza infections and laryngeal cancer risk. We used data from a case-control study which included 229 cases of laryngeal cancer and 769 population controls matched for age and sex. History of a physician-diagnosed allergy, influenza-like infections in the past 5 years, smoking, alcohol consumption and occupational exposure to carcinogens were self-reported. Allergies were classified into two groups (Type I and Type IV), according to the underlying immunologic mechanism. Conditional logistic regression models were fitted using laryngeal cancer as the outcome, adjusting for smoking, alcohol consumption and occupational exposure and stratified for age and sex. Having any allergy was not associated significantly with laryngeal cancer. Although Type I and Type IV allergies were non-significantly associated with laryngeal cancer, Type IV allergies showed a strong inverse association after adjusting for smoking and alcohol (OR 0.50, 95 % CI 0.22-1.2). Participants who reported at least one influenza-like infection during the past 5 years were significantly less likely to have laryngeal cancer (OR 0.57, 95 % CI 0.39-0.81). After considering fever (≥38.5 °C) as a criterion for influenza infection, the association between influenza infection and laryngeal cancer was even stronger (OR 0.29, 95 % CI 0.13-0.63). We found no significant association between any allergy and laryngeal cancer, some indication of an inverse association between Type IV allergy and laryngeal cancer, whereas recent influenza infections were inversely associated with laryngeal cancer risk.

  20. Cutting Edge: Nanogel-Based Delivery of an Inhibitor of CaMK4 to CD4+ T Cells Suppresses Experimental Autoimmune Encephalomyelitis and Lupus-like Disease in Mice.

    PubMed

    Otomo, Kotaro; Koga, Tomohiro; Mizui, Masayuki; Yoshida, Nobuya; Kriegel, Christina; Bickerton, Sean; Fahmy, Tarek M; Tsokos, George C

    2015-12-15

    Treatment of autoimmune diseases is still largely based on the use of systemically acting immunosuppressive drugs, which invariably cause severe side effects. Calcium/calmodulin-dependent protein kinase IV is involved in the suppression of IL-2 and the production of IL-17. Its pharmacologic or genetic inhibition limits autoimmune disease in mice. In this study, we demonstrate that KN93, a small-molecule inhibitor of calcium/calmodulin-dependent protein kinase IV, targeted to CD4(+) T cells via a nanolipogel delivery system, markedly reduced experimental autoimmune encephalomyelitis and was 10-fold more potent than the free systemically delivered drug in the lupus mouse models. The targeted delivery of KN93 did not deplete T cells but effectively blocked Th17 cell differentiation and expansion as measured in the spinal cords and kidneys of mice developing experimental autoimmune encephalomyelitis or lupus, respectively. These results highlight the promise of cell-targeted inhibition of molecules involved in the pathogenesis of autoimmunity as a means of advancing the treatment of autoimmune diseases. Copyright © 2015 by The American Association of Immunologists, Inc.

  1. Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

    PubMed Central

    Charvin, G.; Bensimon, D.; Croquette, V.

    2003-01-01

    Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

  2. L-arginine mediated renaturation enhances yield of human, α6 type IV collagen non-collagenous domain from bacterial inclusion bodies

    PubMed Central

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Akul Sudhakar, Yakkanti

    2012-01-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated. PMID:22512648

  3. L-arginine mediated renaturation enhances yield of human, α6 Type IV collagen non-collagenous domain from bacterial inclusion bodies.

    PubMed

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul

    2012-10-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.

  4. [Joint endoprosthesis pathology. Histopathological diagnostics and classification].

    PubMed

    Krenn, V; Morawietz, L; Jakobs, M; Kienapfel, H; Ascherl, R; Bause, L; Kuhn, H; Matziolis, G; Skutek, M; Gehrke, T

    2011-05-01

    Prosthesis durability has steadily increased with high 10-year rates of 88-95%. However, four pathogenetic groups of diseases can decrease prosthesis durability: (1) periprosthetic wear particle disease (aseptic loosening) (2) bacterial infection (septic loosening) (3) periprosthetic ossification, and (4) arthrofibrosis. The histopathological "extended consensus classification of periprosthetic membranes" includes four types of membranes, arthrofibrosis, and osseous diseases of endoprosthetics: The four types of neosynovia are: wear particle-induced type (type I), mean prosthesis durability (MPD) in years 12.0; infectious type (type II), MPD 2.5; combined type (type III) MPD 4.2; and indeterminate type (type IV), MPD 5.5. Arthrofibrosis can be determined in three grades: grade 1 needs clinical information to be differentiated from a type IV membrane, and grades 2 & 3 can be diagnosed histopathologically. Periprosthetic ossification, osteopenia-induced fractures, and aseptic osteonecrosis can be histopathologically diagnosed safely with clinical information. The extended consensus classification of periprosthetic membranes may be a diagnostic groundwork for a future national endoprosthesis register.

  5. NATIONAL COASTAL CONDITION REPORT IV | Science ...

    EPA Pesticide Factsheets

    The National Coastal Condition Report IV (NCCR IV) is the fourth in a series of environmental assessments of U.S. coastal waters and the Great Lakes. The report includes assessments of all the nation’s estuaries in the contiguous 48 states and Puerto Rico, south-eastern Alaska, Hawaii, the U.S. Virgin Islands, Guam, and American Samoa. The NCCR IV presents four main types of data: (1) coastal monitoring data, (2) coastal ocean/ offshore monitoring data, (3) offshore fisheries data, and (4) assessment and advisory data (new to NCCR IV). The NCCR IV relies heavily on coastal monitoring data from EPA’s National Coastal Assessment (NCA) to assess coastal condition by evaluating five indicators of condition—water quality, sediment quality, benthic community condition, coastal habitat loss, and fish tissue contaminants. To assess and report on the condition of the nation's coastal resources

  6. Development of a Series of Kynurenine 3-Monooxygenase Inhibitors Leading to a Clinical Candidate for the Treatment of Acute Pancreatitis.

    PubMed

    Walker, Ann L; Ancellin, Nicolas; Beaufils, Benjamin; Bergeal, Marylise; Binnie, Margaret; Bouillot, Anne; Clapham, David; Denis, Alexis; Haslam, Carl P; Holmes, Duncan S; Hutchinson, Jonathan P; Liddle, John; McBride, Andrew; Mirguet, Olivier; Mowat, Christopher G; Rowland, Paul; Tiberghien, Nathalie; Trottet, Lionel; Uings, Iain; Webster, Scott P; Zheng, Xiaozhong; Mole, Damian J

    2017-04-27

    Recently, we reported a novel role for KMO in the pathogenesis of acute pancreatitis (AP). A number of inhibitors of kynurenine 3-monooxygenase (KMO) have previously been described as potential treatments for neurodegenerative conditions and particularly for Huntington's disease. However, the inhibitors reported to date have insufficient aqueous solubility relative to their cellular potency to be compatible with the intravenous (iv) dosing route required in AP. We have identified and optimized a novel series of high affinity KMO inhibitors with favorable physicochemical properties. The leading example is exquisitely selective, has low clearance in two species, prevents lung and kidney damage in a rat model of acute pancreatitis, and is progressing into preclinical development.

  7. When aging-onset diabetes is coming across with Alzheimer disease: comparable pathogenesis and therapy.

    PubMed

    Tang, Jun; Pei, Yijin; Zhou, Guangji

    2013-08-01

    Diabetes mellitus is a metabolic disorder that is characterized by high blood glucose because of the insulin-resistance and insulin-deficiency in Type 2, while the insulin deficiency due to destruction of islet cells in the pancreas in Type 1. The development of Type 2 diabetes is caused by a combination of lifestyle and genetic factors. Aging patients with diabetes are at increased risk of developing cognitive and memory dysfunctions, which is one of the significant symptoms of Alzheimer disease (AD). Also, over 2/3 of AD patients were clinically indentified with impairment of glucose. Cognitive dysfunction would be associated with poor self-care ability in diabetes patients. This review will briefly summarize the current knowledge of the pathogenesis of these two diseases and highlight similarities in their pathophysiologies. Furthermore, we will shortly discuss recent progress in the insulin-targeted strategy, aiming to explore the inner linkage between these two diseases in aging populations. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. 2- and 3-substituted imidazo[1,2-a]pyrazines as inhibitors of bacterial type IV secretion

    PubMed Central

    Sayer, James R.; Walldén, Karin; Pesnot, Thomas; Campbell, Frederick; Gane, Paul J.; Simone, Michela; Koss, Hans; Buelens, Floris; Boyle, Timothy P.; Selwood, David L.; Waksman, Gabriel; Tabor, Alethea B.

    2014-01-01

    A novel series of 8-amino imidazo[1,2-a]pyrazine derivatives has been developed as inhibitors of the VirB11 ATPase HP0525, a key component of the bacterial type IV secretion system. A flexible synthetic route to both 2- and 3-aryl substituted regioisomers has been developed. The resulting series of imidazo[1,2-a]pyrazines has been used to probe the structure–activity relationships of these inhibitors, which show potential as antibacterial agents. PMID:25438770

  9. Sfg

    NASA Astrophysics Data System (ADS)

    Fischer, R. X.; Baur, W. H.

    This document is part of Subvolume E `Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes RON to STI' of Volume 14 `Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV `Physical Chemistry'.

  10. Vet

    NASA Astrophysics Data System (ADS)

    Fischer, R. X.; Baur, W. H.

    This document is part of Subvolume F 'Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes STO to ZON' of Volume 14 'Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV 'Physical Chemistry'.

  11. Juvenile pityriasis rubra pilaris: report of 28 cases in Taiwan.

    PubMed

    Yang, Chao-Chun; Shih, I-Hsin; Lin, Wan-Lung; Yu, Yi-Sheng; Chiu, Hsien-Ching; Huang, Po-Han; Cheng, Yu-Wen; Lee, Julia Yu-Yun; Chen, WenChieh

    2008-12-01

    Pityriasis rubra pilaris (PRP) is a papulosquamous dermatosis uncommon in juveniles. Large-scale studies are limited, especially from Asian countries. We sought to analyze the clinical manifestations of juvenile PRP in Taiwanese patients and compare them with reported series in the literature. The diagnosis of juvenile PRP was made based on clinical-histopathologic correlation. The therapeutic response and disease course were followed up by re-examination of the patients or by telephone. A total of 47 patients were identified, with histopathologic confirmation of the clinical diagnosis of juvenile PRP in 28 cases. A preponderance of Griffiths' type IV PRP (85.7%) rather than type III PRP (14.3%) was found. Palmoplantar hyperkeratosis appeared to be a cardinal feature. In patients with type IV PRP, skin lesions in areas other than the elbows/knees and palms/soles were common. Treatment with systemic acitretin in 6 patients failed to effect a dose- or time-dependent improvement. In contrast with other studies, two thirds of our patients with type III and IV juvenile PRP had a protracted course lasting more than 3 years. This study was a retrospective review. Patient compliance with treatment was frequently poor. Type IV juvenile PRP predominated but our cases showed a wider distribution of skin lesions than is typically described. When children present with an acute onset of diffuse palmoplantar hyperkeratosis, a diagnosis of juvenile PRP should be considered. Because of the divergent clinical manifestations of juvenile PRP in different populations, there is a need to modify and re-evaluate classification systems based on regional differences.

  12. Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue

    PubMed Central

    Chamot-Rooke, Julia; Rousseau, Benoit; Lanternier, Fanny; Mikaty, Guillain; Mairey, Emilie; Malosse, Christian; Bouchoux, Guy; Pelicic, Vladimir; Camoin, Luc; Nassif, Xavier; Duménil, Guillaume

    2007-01-01

    The importance of protein glycosylation in the interaction of pathogenic bacteria with their host is becoming increasingly clear. Neisseria meningitidis, the etiological agent of cerebrospinal meningitis, crosses cellular barriers after adhering to host cells through type IV pili. Pilin glycosylation genes (pgl) are responsible for the glycosylation of PilE, the major subunit of type IV pili, with the 2,4-diacetamido-2,4,6-trideoxyhexose residue. Nearly half of the clinical isolates, however, display an insertion in the pglBCD operon, which is anticipated to lead to a different, unidentified glycosylation. Here the structure of pilin glycosylation was determined in such a strain by “top-down” MS approaches. MALDI-TOF, nanoelectrospray ionization Fourier transform ion cyclotron resonance, and nanoelectrospray ionization quadrupole TOF MS analysis of purified pili preparations originating from N. meningitidis strains, either wild type or deficient for pilin glycosylation, revealed a glycan mass inconsistent with 2,4-diacetamido-2,4,6-trideoxyhexose or any sugar in the databases. This unusual modification was determined by in-source dissociation of the sugar from the protein followed by tandem MS analysis with collision-induced fragmentation to be a hexose modified with a glyceramido and an acetamido group. We further show genetically that the nature of the sugar present on the pilin is determined by the carboxyl-terminal region of the pglB gene modified by the insertion in the pglBCD locus. We thus report a previously undiscovered monosaccharide involved in posttranslational modification of type IV pilin subunits by a MS-based approach and determine the molecular basis of its biosynthesis. PMID:17804791

  13. Nuclear localization of activated STAT6 and STAT3 in epidermis of prurigo nodularis.

    PubMed

    Fukushi, S; Yamasaki, K; Aiba, S

    2011-11-01

    Prurigo nodularis (PN) is a chronic dermatitis characterized by discrete, raised, and firm papulonodules with intense pruritus. The pathogenesis still remains to be elucidated. To clarify the role of Th1 and Th2 cytokines in the pathogenesis of PN. We examined the cytokine signatures, such as phosphorylation of STAT1, STAT3 and STAT6, HLA-DR and hyaluronan accumulation, to reveal the Th1 and Th2 cytokine influence on the lesional epidermis of PN. We first optimized antigen retrieval methods to detect these signatures with antibodies for phospho-STAT1 (pSTAT1), phospho-STAT3 (pSTAT3), phospho-STAT6 (pSTAT6), HLA-DR and hyaluronic acid binding protein (HABP) on the formalin-fixed paraffin-embedded sections of psoriasis, lichen planus and atopic dermatitis biopsy samples. Activation of STAT1 and STAT6 in epidermis by Th1 and Th2 cytokines was further confirmed in a cultured skin equivalent model treated with interferon-γ or interleukin (IL)-4/IL-13. With the relevant immunostaining methods, we examined the cytokine signatures in 22 cases of PN. The results revealed that (i) the entire epidermis of 19 cases was stained with anti-pSTAT6 antibody, (ii) 21 cases demonstrated nuclear staining with anti-pSTAT3 antibody, (iii) the entire epidermis of 21 cases was stained with HABP, (iv) the epidermis of eight cases showed scattered staining with anti-pSTAT1 antibody, and (v) six cases were positive for HLA-DR membrane expression. These data indicated that Th2 cytokines related to STAT6 activation together with some unknown stimuli that activate STAT3 play a principal role in the pathogenesis of PN. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  14. Failure mechanisms and closed reduction of a constrained tripolar acetabular liner.

    PubMed

    Robertson, William J; Mattern, Christopher J; Hur, John; Su, Edwin P; Pellicci, Paul M

    2009-02-01

    Unlike traditional bipolar constrained liners, the Osteonics Omnifit constrained acetabular insert is a tripolar device, consisting of an inner bipolar bearing articulating within an outer, true liner. Every reported failure of the Omnifit tripolar implant has been by failure at the shell-bone interface (Type I failure), failure at the shell-liner interface (Type II failure), or failure of the locking mechanism resulting in dislocation of the bipolar-liner interface (Type III failure). In this report we present two cases of failure of the Omnifit tripolar at the bipolar-femoral head interface. To our knowledge, these are the first reported cases of failure at the bipolar-femoral head interface (Type IV failure). In addition, we described the first successful closed reduction of a Type IV failure.

  15. Intravenous S-Ketamine Does Not Inhibit Alveolar Fluid Clearance in a Septic Rat Model

    PubMed Central

    Weber, Nina C.; van der Sluijs, Koen; Hackl, Florian; Hotz, Lorenz; Dahan, Albert; Hollmann, Markus W.; Berger, Marc M.

    2014-01-01

    We previously demonstrated that intratracheally administered S-ketamine inhibits alveolar fluid clearance (AFC), whereas an intravenous (IV) bolus injection had no effect. The aim of the present study was to characterize whether continuous IV infusion of S-ketamine, yielding clinically relevant plasma concentrations, inhibits AFC and whether its effect is enhanced in acute lung injury (ALI) which might favor the appearance of IV S-ketamine at the alveolar surface. AFC was measured in fluid-instilled rat lungs. S-ketamine was administered IV over 6 h (loading dose: 20 mg/kg, followed by 20 mg/kg/h), or intratracheally by addition to the instillate (75 µg/ml). ALI was induced by IV lipopolysaccharide (LPS; 7 mg/kg). Interleukin (IL)-6 and cytokine-induced neutrophil chemoattractant (CINC)-3 were measured by ELISA in plasma and bronchoalveolar lavage fluid. Isolated rat alveolar type-II cells were exposed to S-ketamine (75 µg/ml) and/or LPS (1 mg/ml) for 6 h, and transepithelial ion transport was measured as short circuit current (ISC). AFC was 27±5% (mean±SD) over 60 min in control rats and was unaffected by IV S-ketamine. Tracheal S-ketamine reduced AFC to 18±9%. In LPS-treated rats, AFC decreased to 16±6%. This effect was not enhanced by IV S-ketamine. LPS increased IL-6 and CINC-3 in plasma and bronchoalveolar lavage fluid. In alveolar type-II cells, S-ketamine reduced ISC by 37% via a decrease in amiloride-inhibitable sodium transport. Continuous administration of IV S-ketamine does not affect rat AFC even in endotoxin-induced ALI. Tracheal application with direct exposure of alveolar epithelial cells to S-ketamine decreases AFC by inhibition of amiloride-inhibitable sodium transport. PMID:25386677

  16. Two-View Gravity Stress Imaging Protocol for Nondisplaced Type II Supination External Rotation Ankle Fractures: Introducing the Gravity Stress Cross-Table Lateral View.

    PubMed

    Boffeli, Troy J; Collier, Rachel C; Gervais, Samuel J

    Assessing ankle stability in nondisplaced Lauge-Hansen supination external rotation type II injuries requires stress imaging. Gravity stress mortise imaging is routinely used as an alternative to manual stress imaging to assess deltoid integrity with the goal of differentiating type II from type IV injuries in cases without a posterior or medial fracture. A type II injury with a nondisplaced fibula fracture is typically treated with cast immobilization, and a type IV injury is considered unstable and often requires operative repair. The present case series (two patients) highlights a standardized 2-view gravity stress imaging protocol and introduces the gravity stress cross-table lateral view. The gravity stress cross-table lateral view provides a more thorough evaluation of the posterior malleolus owing to the slight external rotation and posteriorly directed stress. External rotation also creates less bony overlap between the tibia and fibula, allowing for better visualization of the fibula fracture. Gravity stress imaging confirmed medial-sided injury in both cases, confirming the presence of supination external rotation type IV or bimalleolar equivalent fractures. Open reduction and internal fixation was performed, and both patients achieved radiographic union. No further treatment was required at 21 and 33 months postoperatively. Copyright © 2017 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  17. Fine typing of methicillin-resistant Staphylococcus aureus isolates using direct repeat unit and staphylococcal interspersed repeat unit typing methods.

    PubMed

    Ho, Cheng-Mao; Ho, Mao-Wang; Li, Chi-Yuan; Lu, Jang-Jih

    2015-08-01

    Methicillin-resistant Staphylococcus aureus (MRSA) typing is an important epidemiologic tool for monitoring trends and preventing outbreaks. However, the efficiency of various MRSA typing methods for each SCCmec MRSA isolate is rarely evaluated. A total of 157 MRSA isolates from four different regions in Taiwan were typed with five different molecular methods, including SCCmec typing, multilocus sequence typing (MLST), spa typing, mec-associated direct repeat unit (dru) copy number determination, and staphylococcal interspersed repeat unit (SIRU) profiling. There were four SCCmec types, eight MLST types, 15 spa types, 11 dru types, and 31 SIRU profiles. The most common type determined by each molecular typing method was SCCmec III (115 isolates, 73.2%), ST239 (99 isolates, 63.1%), t037 (107 isolates, 68.2%), 14 dru copies (76 isolates, 48.4%), and SIRU profile 3013722 (102 isolates, 65%), respectively. When using the combination of MLST, spa typing, and dru copy number, ST5-t002-4 (n = 8), ST239-t037-14 (n = 68), ST59-t437-9 (n = 9), and ST59-t437-11 (n = 6) were found to be the most common types of SCCmec types II (n = 9), III (n = 115), IV (n = 21), and VT (n = 11) isolates, respectively. SCCmec type III isolates were further classified into 11 dru types. Of the 21 SCCmec type IV isolates, 14 SIRU profiles were found. Seven SIRU patterns were observed in the 11 SCCmec type VT isolates. Different typing methods showed a similar Hunter-Gaston discrimination index among the 157 MRSA isolates. However, dru and SIRU typing methods had a better discriminatory power for SCCmec type III and SCCmec types IV and VT isolates, respectively, suggesting that dru and SIRU can be used to further type these isolates. Copyright © 2013. Published by Elsevier B.V.

  18. Malleolar fractures and their ligamentous injury equivalents have similar outcomes in supination-external rotation type IV fractures of the ankle treated by anatomical internal fixation.

    PubMed

    Berkes, M B; Little, M T M; Lazaro, L E; Sculco, P K; Cymerman, R M; Daigl, M; Helfet, D L; Lorich, D G

    2012-11-01

    It has previously been suggested that among unstable ankle fractures, the presence of a malleolar fracture is associated with a worse outcome than a corresponding ligamentous injury. However, previous studies have included heterogeneous groups of injury. The purpose of this study was to determine whether any specific pattern of bony and/or ligamentous injury among a series of supination-external rotation type IV (SER IV) ankle fractures treated with anatomical fixation was associated with a worse outcome. We analysed a prospective cohort of 108 SER IV ankle fractures with a follow-up of one year. Pre-operative radiographs and MRIs were undertaken to characterise precisely the pattern of injury. Operative treatment included fixation of all malleolar fractures. Post-operative CT was used to assess reduction. The primary and secondary outcome measures were the Foot and Ankle Outcome Score (FAOS) and the range of movement of the ankle. There were no clinically relevant differences between the four possible SER IV fracture pattern groups with regard to the FAOS or range of movement. In this population of strictly defined SER IV ankle injuries, the presence of a malleolar fracture was not associated with a significantly worse clinical outcome than its ligamentous injury counterpart. Other factors inherent to the injury and treatment may play a more important role in predicting outcome.

  19. Genetics of Lesch's typology of alcoholism.

    PubMed

    Samochowiec, Jerzy; Kucharska-Mazur, Jolanta; Grzywacz, Anna; Pelka-Wysiecka, Justyna; Mak, Monika; Samochowiec, Agnieszka; Bienkowski, Przemyslaw

    2008-02-15

    It is widely accepted that dopamine and serotonin (5-HT) neurotransmission can be critically involved in the development of alcohol abuse and alcohol dependence. Lesch's typology of alcoholism has been gaining increasing popularity as it qualitatively differentiates patients into different treatment response subgroups. The aim of the present study was to evaluate a possible genetic background of Lesch's typology with special emphasis placed on dopamine- and serotonin-related genes. 122 alcoholics (the mean age: 35+/-9 years) were investigated. According to Lesch's typology, 58 patients were of type I, 36 patients of type II, 11 patients of type III, and 17 patients of type IV. Alcohol drinking and family history was assessed by means of a structured interview, based on the Semi-Structured Assessment for the Genetics of Alcoholism. 150 control subjects without psychiatric disorders were also recruited. The control group was ethnically-, age- and gender-matched to the patients. The DRD2 TaqIA, exon 8, and promoter -141C ins/del polymorphisms as well as COMT Val158Met, 5HTT 44 bp del in promoter, and DAT 40 bp VNTR polymorphisms were detected by means of PCR. No significant differences were observed when the whole group of alcoholics and the controls were compared. Similarly, there were no differences between either the Lesch type I or type II alcoholics and the control subjects. No significant differences were observed between type I and type II alcoholics. Alleles frequencies were not calculated for the Lesch type III and type IV alcoholics since the number of patients was too small. The present results argue against any major role of the investigated polymorphisms in either Lesch type I or type II alcoholism. More comprehensive studies are needed to define the role of the investigated polymorphisms in Lesch type III and type IV alcoholism.

  20. Mechanisms and implications of a type IV functional response for short-term intake rate of dry matter in large mammalian herbivores.

    PubMed

    Mezzalira, Jean C; Bonnet, Olivier J F; Carvalho, Paulo C de F; Fonseca, Lidiane; Bremm, Carolina; Mezzalira, Carlos C; Laca, Emilio A

    2017-09-01

    The functional response (i.e. the relationship between consumers' intake rate and resource density) is central in plant-herbivore interactions. Its shape and the biological processes leading to it have significant implications for both foraging theory and ecology of grazing systems. A type IV functional response (i.e. dome-shaped relationship) of short-term intake rate of dry matter (intake while grazing) has rarely been reported for large herbivores and the conditions that can lead to it are poorly understood. We report a type IV functional response observed in heifers grazing monocultures of Cynodon sp. and Avena strigosa. The mechanisms and consequences of this type of functional response for grazed system dynamics are discussed. Intake rate was higher at intermediate than at short or tall sward heights in both grass species. The type IV functional response resulted from changes in bite mass instead of a longer time needed to encounter and process bites. Thus, the decrease of intake rate of dry matter in tall swards is not explained by a shift from process 3 (potential bites are concentrated and apparent) to process 2 (potential bites are apparent but dispersed, Spalinger & Hobbs 1992). Bite mass was smaller in tall than in intermediate swards due to a reduction of bite volume possibly caused by the greater proportion of stem and sheath acting as a physical barrier to bite formation. It is generally accepted that potential bites are abundant and apparent in most grassland and meadow systems, as they were in the present experiments. Therefore, a type IV response of intake rate not directly related to digestive constraints may determine the dynamics of intake and defoliation under a much larger set of conditions than previously thought. These results have implications for foraging theory and stability of grazing systems. For example, if animals prefer patches of intermediate stature that yield the highest intake rate, grazing should lead to the widely observed bimodal distribution of plant mass per unit area, even when tall patches are not of significantly lower digestive quality than the pasture average. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

  1. Role of the Lung Microbiome in the Pathogenesis of Chronic Obstructive Pulmonary Disease.

    PubMed

    Wang, Lei; Hao, Ke; Yang, Ting; Wang, Chen

    2017-09-05

    The development of culture-independent techniques for microbiological analysis shows that bronchial tree is not sterile in either healthy or chronic obstructive pulmonary disease (COPD) individuals. With the advance of sequencing technologies, lung microbiome has become a new frontier for pulmonary disease research, and such advance has led to better understanding of the lung microbiome in COPD. This review aimed to summarize the recent advances in lung microbiome, its relationships with COPD, and the possible mechanisms that microbiome contributed to COPD pathogenesis. Literature search was conducted using PubMed to collect all available studies concerning lung microbiome in COPD. The search terms were "microbiome" and "chronic obstructive pulmonary disease", or "microbiome" and "lung/pulmonary". The papers in English about lung microbiome or lung microbiome in COPD were selected, and the type of articles was not limited. The lung is a complex microbial ecosystem; the microbiome in lung is a collection of viable and nonviable microbiota (bacteria, viruses, and fungi) residing in the bronchial tree and parenchymal tissues, which is important for health. The following types of respiratory samples are often used to detect the lung microbiome: sputum, bronchial aspirate, bronchoalveolar lavage, and bronchial mucosa. Disordered bacterial microbiome is participated in pathogenesis of COPD; there are also dynamic changes in microbiota during COPD exacerbations. Lung microbiome may contribute to the pathogenesis of COPD by manipulating inflammatory and/or immune process. Normal lung microbiome could be useful for prophylactic or therapeutic management in COPD, and the changes of lung microbiome could also serve as biomarkers for the evaluation of COPD.

  2. Current challenges to overcome in the management of type 2 diabetes mellitus and associated neurological disorders.

    PubMed

    Khan, Nazir M; Ahmad, Ausaf; Tiwari, Rajesh K; Kamal, Mohammad A; Mushtaq, Gohar; Ashraf, Ghulam M

    2014-01-01

    The increasing worldwide prevalence of type 2 diabetes mellitus (T2DM) and associated neurological disorders (NDs), such as Alzheimer disease and Parkinson's disease, have raised concerns about increasing health care and financial burden. Due to the overwhelming growth rate of T2DM and its strong association with NDs, there is an ever-growing and an urgent need to improve the diagnosis and management of the disease. Major hurdles in the management of T2DM comprise of striving for glycemic targets, polypharmacy, patient adherence and clinical inertia. The challenges occurring in the treatment of T2DM are mainly attributed to the complex heterogeneous nature of the disease and its close association with a wide variety of neurological, metabolic and cardiovascular disorders. To overcome these challenges, authors propose to focus on the treatment strategies that employ shared pathogenesis and common molecular denominators involved in the aetiology of T2DM and associated NDs. Impaired insulin signalling (as a result of perturbed redox status), insulin resistance and mitochondrial dysfunction are key molecular events that may lead to the pathogenesis of T2DM and associated NDs. However, effective management of these therapeutic strategies requires holistic experimental evidence from animal as well as clinical human studies. Therefore, a shift in the treatment paradigm from single point glycemic control to shared pathogenesis control would be an ideal approach to combat the alarming progression of diabetes and associated NDs. Therapeutic interventions focused on shared molecular pathogenesis, along with effective glycemic control, may provide protection from associated NDs.

  3. Slope Stability of Geosynthetic Clay Liner Test Plots

    EPA Science Inventory

    Fourteen full-scale field test plots containing five types of geosynthetic clay liners (GCLs) were constructed on 2H:IV and 3H:IV slopes for the purpose of assessing slope stability. The test plots were designed to simulate typical final cover systems for landfill. Slides occurr...

  4. Oxidative Stress in Diabetes: Implications for Vascular and Other Complications

    PubMed Central

    Pitocco, Dario; Tesauro, Manfredi; Alessandro, Rizzi; Ghirlanda, Giovanni; Cardillo, Carmine

    2013-01-01

    In recent decades, oxidative stress has become a focus of interest in most biomedical disciplines and many types of clinical research. Increasing evidence shows that oxidative stress is associated with the pathogenesis of diabetes, obesity, cancer, ageing, inflammation, neurodegenerative disorders, hypertension, apoptosis, cardiovascular diseases, and heart failure. Based on these studies, an emerging concept is that oxidative stress is the “final common pathway” through which the risk factors for several diseases exert their deleterious effects. Oxidative stress causes a complex dysregulation of cell metabolism and cell–cell homeostasis; in particular, oxidative stress plays a key role in the pathogenesis of insulin resistance and β-cell dysfunction. These are the two most relevant mechanisms in the pathophysiology of type 2 diabetes and its vascular complications, the leading cause of death in diabetic patients. PMID:24177571

  5. A developmental and genetic classification for midbrain-hindbrain malformations

    PubMed Central

    Millen, Kathleen J.; Dobyns, William B.

    2009-01-01

    Advances in neuroimaging, developmental biology and molecular genetics have increased the understanding of developmental disorders affecting the midbrain and hindbrain, both as isolated anomalies and as part of larger malformation syndromes. However, the understanding of these malformations and their relationships with other malformations, within the central nervous system and in the rest of the body, remains limited. A new classification system is proposed, based wherever possible, upon embryology and genetics. Proposed categories include: (i) malformations secondary to early anteroposterior and dorsoventral patterning defects, or to misspecification of mid-hindbrain germinal zones; (ii) malformations associated with later generalized developmental disorders that significantly affect the brainstem and cerebellum (and have a pathogenesis that is at least partly understood); (iii) localized brain malformations that significantly affect the brain stem and cerebellum (pathogenesis partly or largely understood, includes local proliferation, cell specification, migration and axonal guidance); and (iv) combined hypoplasia and atrophy of putative prenatal onset degenerative disorders. Pertinent embryology is discussed and the classification is justified. This classification will prove useful for both physicians who diagnose and treat patients with these disorders and for clinical scientists who wish to understand better the perturbations of developmental processes that produce them. Importantly, both the classification and its framework remain flexible enough to be easily modified when new embryologic processes are described or new malformations discovered. PMID:19933510

  6. Aldehyde dehydrogenase inhibition as a pathogenic mechanism in Parkinson disease

    PubMed Central

    Fitzmaurice, Arthur G.; Rhodes, Shannon L.; Lulla, Aaron; Murphy, Niall P.; Lam, Hoa A.; O’Donnell, Kelley C.; Barnhill, Lisa; Casida, John E.; Cockburn, Myles; Sagasti, Alvaro; Stahl, Mark C.; Maidment, Nigel T.; Ritz, Beate; Bronstein, Jeff M.

    2013-01-01

    Parkinson disease (PD) is a neurodegenerative disorder particularly characterized by the loss of dopaminergic neurons in the substantia nigra. Pesticide exposure has been associated with PD occurrence, and we previously reported that the fungicide benomyl interferes with several cellular processes potentially relevant to PD pathogenesis. Here we propose that benomyl, via its bioactivated thiocarbamate sulfoxide metabolite, inhibits aldehyde dehydrogenase (ALDH), leading to accumulation of the reactive dopamine metabolite 3,4-dihydroxyphenylacetaldehyde (DOPAL), preferential degeneration of dopaminergic neurons, and development of PD. This hypothesis is supported by multiple lines of evidence. (i) We previously showed in mice the metabolism of benomyl to S-methyl N-butylthiocarbamate sulfoxide, which inhibits ALDH at nanomolar levels. We report here that benomyl exposure in primary mesencephalic neurons (ii) inhibits ALDH and (iii) alters dopamine homeostasis. It induces selective dopaminergic neuronal damage (iv) in vitro in primary mesencephalic cultures and (v) in vivo in a zebrafish system. (vi) In vitro cell loss was attenuated by reducing DOPAL formation. (vii) In our epidemiology study, higher exposure to benomyl was associated with increased PD risk. This ALDH model for PD etiology may help explain the selective vulnerability of dopaminergic neurons in PD and provide a potential mechanism through which environmental toxicants contribute to PD pathogenesis. PMID:23267077

  7. A novel GBE1 gene variant in a child with glycogen storage disease type IV.

    PubMed

    Said, Samar M; Murphree, Marine I; Mounajjed, Taofic; El-Youssef, Mounif; Zhang, Lizhi

    2016-08-01

    Glycogen storage disease type IV is an autosomal recessive disorder of carbohydrates caused by deficiency of amylo-1-4-glycanoglycosyltransferase, which leads to accumulation of amylopectin-like polysaccharides in tissues including liver, heart and neuromuscular system. More than 40 different mutations in the glycogen branching enzyme gene (GBE1) have been described. In this study, we report a 2-year-old boy who presented with developmental delay and muscle weakness. He subsequently was diagnosed with glycogen storage disease type IV based on a liver biopsy histology and electron microscopy. Glycogen branching enzyme activity was in the low range. Genetic analysis demonstrated a novel heterozygous variant (c.760A>G; p.Thr254Ala) in exon 6 of the GBE1 gene, which is believed to be pathogenic. This variant was inherited from the patient's mother who was asymptomatic with normal glycogen branching enzyme activity. Whole-exome sequencing failed to reveal additional variations in the GBE1 gene. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

    PubMed

    Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

    2002-06-01

    Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

  9. Diagnostic efficiency of amylase and type IV collagen in predicting chronic pancreatitis.

    PubMed

    Das, Subir Kumar; Varadhan, Sowmya; Dhanya, L; Mukherjee, Sukhes; Mohana, S; Balakrishnan, V; Vasudevan, D M

    2009-01-01

    Chronic pancreatitis, an irreversible inflammatory disease of the pancreas, is associated with the replacement of the destroyed parenchyma by extended development of fibrosis. Despite marked progress in diagnostic tools, no consensus has been reached in diagnosis of chronic pancreatitis. In this study we examined the hematological and biochemical parameters among 40 chronic pancreatitis patients within 18 to 67 yrs. ESR level and ALP activity was elevated in 40% cases. Serum amylase activity increased in 32 patients and it showed significant correlation with ALP (r=0.458, p=0.003), CA-19.9 (r=0.556, p<0.001), and calcium level (r=-0.472, p=0.002). Type IV collagen level in chronic pancreatitis also elevated (164.4 ± 55.5 ng/ml) and showed negative significant correlation with calcium level (r= -0.505, p=0.001). However, no significant correlation was observed between amylase activity and type IV collagen (r=0.289, p= 0.07).

  10. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

    PubMed Central

    2011-01-01

    Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

  11. Effect of microwave disinfection on compressive and tensile strengths of dental stones.

    PubMed

    Robati Anaraki, Mahmood; Moslehifard, Elnaz; Aminifar, Soran; Ghanati, Hamed

    2013-01-01

    Although microwave irradiation has been used for disinfection of dental stone casts, there are concerns regarding mechanical damage to casts during the process. The aim of this study was to evaluate the effect of microwave irradiation on the compressive strength (CS) and diametral tensile strength (DTS) of stone casts. In this in vitro study, 80 cylindrical type III and IV stone models (20 × 40 mm) were prepared and divided into 8 groups of 10. The DTS and CS of the specimens were measured by a mechanical testing machine at a crosshead speed of 0.5 cm/min after 7 times of frequent wetting, irradiating at an energy level of 600 W for 3 minutes and cooling. Data were analyzed by Student's t-test. Microwave irradiation significantly increased DTS of type III and IV to 5.23 ± 0.64 and 8.17 ± 0.94, respectively (P < 0.01). According to the results, microwave disinfection increases DTS of type III and IV stone casts without any effects on their CS.

  12. Identification of another module involved in the horizontal transfer of the Haemophilus genomic island ICEHin1056.

    PubMed

    Juhas, Mario; Dimopoulou, Ioanna; Robinson, Esther; Elamin, Abdel; Harding, Rosalind; Hood, Derek; Crook, Derrick

    2013-09-01

    A significant part of horizontal gene transfer is facilitated by genomic islands. Haemophilus influenzae genomic island ICEHin1056 is an archetype of a genomic island that accounts for pandemic spread of antibiotics resistance. ICEHin1056 has modular structure and harbors modules involved in type IV secretion and integration. Previous studies have shown that ICEHin1056 encodes a functional type IV secretion system; however, other modules have not been characterized yet. Here we show that the module on the 5' extremity of ICEHin1056 consists of 15 genes that are well conserved in a number of related genomic islands. Furthermore by disrupting six genes of the investigated module of ICEHin1056 by site-specific mutagenesis we demonstrate that in addition to type IV secretion system module, the investigated module is also important for the successful conjugal transfer of ICEHin1056 from donor to recipient cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Exome sequencing establishes a gelsolin mutation as the cause of inherited bulbar-onset neuropathy.

    PubMed

    Caress, James B; Johnson, Janel O; Abramzon, Yevgeniya A; Hawkins, Gregory A; Gibbs, J Raphael; Sullivan, Elizabeth A; Chahal, Chamanpreet S; Traynor, Bryan J

    2017-11-01

    Progressive bulbar motor neuropathy is primarily caused by bulbar-onset ALS. Hereditary amyloidosis type IV also presents with a bulbar neuropathy that mimics motor neuron disease. The disease is prevalent in Finland only and is not commonly included in the differential diagnosis of ALS. We studied 18 members of a family in which some had bulbar motor neuropathy, and we performed exome sequencing. Five affected family members were found to have a D187Y substitution in the GSN gene known to cause hereditary amyloidosis type IV. This American family presented with progressive bulbar neuropathy due to a gelsolin mutation not found in Finland. Hereditary amyloidosis type IV presents with bulbar motor neuropathy and not with peripheral neuropathy as occurs with common forms of amyloidosis. This report demonstrates the power of exome sequencing to determine the cause of rare hereditary diseases with incomplete or atypical phenotypes. Muscle Nerve 56: 1001-1005, 2017. © 2016 Wiley Periodicals, Inc.

  14. Gluteo-vaginal sinus formation complicating posterior intravaginal slingplasty followed by successful IVS removal. A case report and review of the literature.

    PubMed

    Mikos, Themistoklis; Tsalikis, Tryfon; Papanikolaou, Alexios; Pournaropoulos, Fotios; Bontis, John N

    2008-03-01

    Posterior intravaginal slingplasty (IVS) is a technique used for the treatment of apical prolapse. Type III meshes have been mostly used with this technique. In this article, a case of bilateral gluteo-vaginal sinus tract formation that complicated a posterior vaginal slingplasty with a type III mesh is presented. At 3 months follow-up, the patient complained for bulking through the vagina, continuous offensive vaginal discharge, and constant pain at the buttocks. She had prolapse recurrence, and there was defective healing at the gluteal entry points of the posterior IVS. Ten months after the initial surgery, she underwent a laparotomic subtotal hysterectomy and sacrocervicopexy with prolene type I mesh. At the same time, the posterior mesh was removed allowing the surgeon to discover communication of the canal of the mesh extending from gluteal incisions to the vagina epithelium. The sinus tract was managed surgically with excision of the surrounding tissues. There was no recurrence or other complications at 2 months follow-up.

  15. Cannabinoid Receptor Type 2, but Not Type 1, Is Up-Regulated in Peripheral Blood Mononuclear Cells of Children Affected by Autistic Disorders

    ERIC Educational Resources Information Center

    Siniscalco, Dario; Sapone, Anna; Giordano, Catia; Cirillo, Alessandra; de Magistris, Laura; Rossi, Francesco; Fasano, Alessio; Bradstreet, James Jeffrey; Maione, Sabatino; Antonucci, Nicola

    2013-01-01

    Autistic disorders (ADs) are heterogeneous neurodevelopmental disorders arised by the interaction of genes and environmental factors. Dysfunctions in social interaction and communication skills, repetitive and stereotypic verbal and non-verbal behaviours are common features of ADs. There are no defined mechanisms of pathogenesis, rendering…

  16. Type 2 Diabetes and Uric Acid Nephrolithiasis

    NASA Astrophysics Data System (ADS)

    Maalouf, Naim M.

    2008-09-01

    Type 2 diabetes is associated with an increased propensity for uric acid nephrolithiasis. In individuals with diabetes, this increased risk is due to a lower urine pH that results from obesity, dietary factors, and impaired renal ammoniagenesis. The epidemiology and pathogenesis of uric acid stone disease in patients with diabetes are hereby reviewed, and potential molecular mechanisms are proposed.

  17. A Eukaryotic-Type Serine/Threonine Protein Kinase Is Required for Biofilm Formation, Genetic Competence, and Acid Resistance in Streptococcus mutans

    PubMed Central

    Hussain, Haitham; Branny, Pavel; Allan, Elaine

    2006-01-01

    We report an operon encoding a eukaryotic-type serine/threonine protein kinase (STPK) and its cognate phosphatase (STPP) in Streptococcus mutans. Mutation of the gene encoding the STPK produced defects in biofilm formation, genetic competence, and acid resistance, determinants important in caries pathogenesis. PMID:16452447

  18. In vivo imaging of cortical pathology in multiple sclerosis using ultra-high field MRI

    PubMed Central

    Mainero, C; Benner, T; Radding, A; van der Kouwe, A; Jensen, R; Rosen, B R.; Kinkel, R P.

    2009-01-01

    Objective: We used ultra-high field MRI to visualize cortical lesion types described by neuropathology in 16 patients with multiple sclerosis (MS) compared with 8 age-matched controls; to characterize the contrast properties of cortical lesions including T2*, T2, T1, and phase images; and to investigate the relationship between cortical lesion types and clinical data. Methods: We collected, on a 7-T scanner, 2-dimensional fast low-angle shot (FLASH)-T2*-weighted spoiled gradient-echo, T2-weighted turbo spin-echo (TSE) images (0.33 × 033 × 1 mm3), and a 3-dimensional magnetization-prepared rapid gradient echo. Results: Overall, 199 cortical lesions were detected in patients on both FLASH-T2* and T2-TSE scans. Seven-tesla MRI allowed for characterization of cortical plaques into type I (leukocortical), type II (intracortical), and type III/IV (subpial extending partly or completely through the cortical width) lesions as described histopathologically. Types III and IV were the most frequent type of cortical plaques (50.2%), followed by type I (36.2%) and type II (13.6%) lesions. Each lesion type was more frequent in secondary progressive than in relapsing–remitting MS. This difference, however, was significant only for type III/IV lesions. T2*-weighted images showed the highest, while phase images showed the lowest, contrast-to-noise ratio for all cortical lesion types. In patients, the number of type III/IV lesions was associated with greater disability (p < 0.02 by Spearman test) and older age (p < 0.04 by Spearman test). Conclusions: Seven-tesla MRI detected different histologic cortical lesion types in our small multiple sclerosis (MS) sample, suggesting, if validated in a larger population, that it may prove a valuable tool to assess the contribution of cortical MS pathology to clinical disability. GLOSSARY ANOVA = analysis of variance; BN = background noise; CNR = contrast-to-noise ratio; DIR = double-inversion recovery; EDSS = Expanded Disability Status Scale; FLAIR = fluid-attenuated inversion recovery; FLASH = fast low-angle shot; GM = gray matter; MPRAGE = magnetization-prepared rapid gradient echo; MR = magnetic resonance; MS = multiple sclerosis; NACGM = normal-appearing cortical gray matter; RF = radiofrequency; ROI = region of interest; RRMS = relapsing–remitting multiple sclerosis; SNR = signal-to-noise ratio; SPMS = secondary progressive multiple sclerosis; TA = time of acquisition; TE = echo time; TR = repetition time; TSE = turbo spin-echo; WM = white matter. PMID:19641168

  19. Transarterial treatment with Onyx of Cognard type IV anterior cranial fossa dural arteriovenous fistulas.

    PubMed

    Li, Chuanhui; Wu, Zhongxue; Yang, Xinjian; Li, Youxiang; Jiang, Chuhan; He, Hongwei

    2014-03-01

    Cognard type IV anterior cranial fossa dural arteriovenous fistulas (DAVFs) are rare lesions with a high risk of intracranial hemorrhage. We present our experience with the use of Onyx via the arterial route in these aggressive lesions. Between October 2009 and October 2011, six consecutive patients diagnosed with Cognard type IV anterior cranial fossa DAVFs were treated transarterially with Onyx in our department. All patients were male; mean age was 55 years (range 38-68). Four patients presented with intracranial hemorrhage as the initial manifestation; one patient presented with seizures at the time of diagnosis and experienced intracranial hemorrhage during the antiepileptic therapy; and the other patient was asymptomatic. In five patients, complete obliteration was achieved with transarterial Onyx injection in a single treatment session; in the remaining patient, subtotal occlusion was achieved and gamma knife treatment was followed. The average time of injection was 19 min (range 5-28) for every pedicle catheterized and the average amount of Onyx was 3.2 ml (range 0.4-6.3) for each lesion. All patients recovered uneventfully after embolization. No mortality or permanent morbidity was observed in this series. Follow-up digital subtraction or MR angiography confirmed durable obliteration of the fistulas in five cured cases. No patients suffered intracranial hemorrhage during the follow-up period. In this small series, our experience with the use of Onyx for arterial embolization of Cognard type IV DAVFs is encouraging, with durable complete cure in most lesions without severe complications.

  20. CT-based radiomics signature for differentiating Borrmann type IV gastric cancer from primary gastric lymphoma.

    PubMed

    Ma, Zelan; Fang, Mengjie; Huang, Yanqi; He, Lan; Chen, Xin; Liang, Cuishan; Huang, Xiaomei; Cheng, Zixuan; Dong, Di; Liang, Changhong; Xie, Jiajun; Tian, Jie; Liu, Zaiyi

    2017-06-01

    To evaluate the value of CT-based radiomics signature for differentiating Borrmann type IV gastric cancer (GC) from primary gastric lymphoma (PGL). 40 patients with Borrmann type IV GC and 30 patients with PGL were retrospectively recruited. 485 radiomics features were extracted and selected from the portal venous CT images to build a radiomics signature. Subjective CT findings, including gastric wall peristalsis, perigastric fat infiltration, lymphadenopathy below the renal hila and enhancement pattern, were assessed to construct a subjective findings model. The radiomics signature, subjective CT findings, age and gender were integrated into a combined model by multivariate analysis. The diagnostic performance of these three models was assessed with receiver operating characteristics curves (ROC) and were compared using DeLong test. The subjective findings model, the radiomics signature and the combined model showed a diagnostic accuracy of 81.43% (AUC [area under the curve], 0.806; 95% CI [confidence interval]: 0.696-0.917; sensitivity, 63.33%; specificity, 95.00%), 84.29% (AUC, 0.886 [95% CI: 0.809-0.963]; sensitivity, 86.67%; specificity, 82.50%), 87.14% (AUC, 0.903 [95%CI: 0.831-0.975]; sensitivity, 70.00%; specificity, 100%), respectively. There were no significant differences in AUC among these three models (P=0.051-0.422). Radiomics analysis has the potential to accurately differentiate Borrmann type IV GC from PGL. Copyright © 2017 Elsevier B.V. All rights reserved.

Top