Outer Membrane Targeting, Ultrastructure, and Single Molecule Localization of the Enteropathogenic Escherichia coli Type IV Pilus Secretin BfpB

PubMed Central

Lieberman, Joshua A.; Frost, Nicholas A.; Hoppert, Michael; Fernandes, Paula J.; Vogt, Stefanie L.; Raivio, Tracy L.; Blanpied, Thomas A.

2012-01-01

Type IV pili (T4P) are filamentous surface appendages required for tissue adherence, motility, aggregation, and transformation in a wide array of bacteria and archaea. The bundle-forming pilus (BFP) of enteropathogenic Escherichia coli (EPEC) is a prototypical T4P and confirmed virulence factor. T4P fibers are assembled by a complex biogenesis machine that extrudes pili through an outer membrane (OM) pore formed by the secretin protein. Secretins constitute a superfamily of proteins that assemble into multimers and support the transport of macromolecules by four evolutionarily ancient secretion systems: T4P, type II secretion, type III secretion, and phage assembly. Here, we determine that the lipoprotein transport pathway is not required for targeting the BfpB secretin protein of the EPEC T4P to the OM and describe the ultrastructure of the single particle averaged structures of the assembled complex by transmission electron microscopy. Furthermore, we use photoactivated localization microscopy to determine the distribution of single BfpB molecules fused to photoactivated mCherry. In contrast to findings in other T4P systems, we found that BFP components predominantly have an uneven distribution through the cell envelope and are only found at one or both poles in a minority of cells. In addition, we report that concurrent mutation of both the T4bP secretin and the retraction ATPase can result in viable cells and found that these cells display paradoxically low levels of cell envelope stress response activity. These results imply that secretins can direct their own targeting, have complex distributions and provide feedback information on the state of pilus biogenesis. PMID:22247509

The Pseudomonas aeruginosa Pathogenicity Island PAPI-1 is transferred via a novel Type IV pilus

USDA-ARS?s Scientific Manuscript database

Pseudomonas aeruginosa is a major cause of nosocomial infections, particularly in immunocompromised patients or in individuals with cystic fibrosis. The notable ability of P. aeruginosa to inhabit a broad range of environments including humans is in part due to its large and diverse genomic repertoi...

Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

PubMed Central

Roos, David S.; Pohlschröder, Mechthild

2011-01-01

Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV pilus-like structures. Its use in combination with other currently available computational tools should improve the accuracy of predicting the subcellular localization of bacterial proteins. PMID:22216142

Characterization and sequence analysis of pilin from F-like plasmids.

PubMed Central

Frost, L S; Finlay, B B; Opgenorth, A; Paranchych, W; Lee, J S

1985-01-01

Conjugative pili are expressed by derepressed plasmids and initiate cell-to-cell contact during bacterial conjugation. They are also the site of attachment for pilus-specific phages (f1, f2, and QB). In this study, the number of pili per cell and their ability to retract in the presence of cyanide was estimated for 13 derepressed plasmids. Selected pilus types were further characterized for reactivity with anti-F and anti-ColB2 pilus antisera as well as two F pilus-specific monoclonal antibodies, one of which is specific for a sequence common to most F-like pilin types (JEL92) and one which is specific for the amino terminus of F pilin (JEL93). The pilin genes from eight of these plasmids were cloned and sequenced, and the results were compared with information on F, ColB2, and pED208 pilin. Six pilus groups were defined: I, was F-like [F, pED202(R386), ColV2-K94, and ColVBtrp]; IIA was ColB2-like in sequence but had a lowered sensitivity to f1 phage due to its decreased ability for pilus retraction [pED236(ColB2) and pED203(ColB4)]; IIB was ColB2-like but retained f1 sensitivity [pED200(R124) and pED207(R538-1)]; III contained R1-19, which had a ColB2-like amino terminus but had an additional lysine residue at its carboxy terminus which may affect its phage sensitivity pattern and its antigenicity; IV was R100-1-like [R100-1 and presumably pED241(R136) and pED204(R6)] which had a unique amino-terminal sequence combined with a carboxy terminus similar to that of F. pED208(Folac) formed group V, which was multipiliated and exhibited poor pilus retraction although it retained full sensitivity to f1 phage. The pED208 pilin gene could not be cloned at this time since it shared no homology with the pilin gene of the F plasmid. Images PMID:2999074

Mutation of the Conserved Calcium-Binding Motif in Neisseria gonorrhoeae PilC1 Impacts Adhesion but Not Piliation

PubMed Central

Cheng, Yuan; Johnson, Michael D. L.; Burillo-Kirch, Christine; Mocny, Jeffrey C.; Anderson, James E.; Garrett, Christopher K.; Redinbo, Matthew R.

2013-01-01

Neisseria gonorrhoeae PilC1 is a member of the PilC family of type IV pilus-associated adhesins found in Neisseria species and other type IV pilus-producing genera. Previously, a calcium-binding domain was described in the C-terminal domains of PilY1 of Pseudomonas aeruginosa and in PilC1 and PilC2 of Kingella kingae. Genetic analysis of N. gonorrhoeae revealed a similar calcium-binding motif in PilC1. To evaluate the potential significance of this calcium-binding region in N. gonorrhoeae, we produced recombinant full-length PilC1 and a PilC1 C-terminal domain fragment. We show that, while alterations of the calcium-binding motif disrupted the ability of PilC1 to bind calcium, they did not grossly affect the secondary structure of the protein. Furthermore, we demonstrate that both full-length wild-type PilC1 and full-length calcium-binding-deficient PilC1 inhibited gonococcal adherence to cultured human cervical epithelial cells, unlike the truncated PilC1 C-terminal domain. Similar to PilC1 in K. kingae, but in contrast to the calcium-binding mutant of P. aeruginosa PilY1, an equivalent mutation in N. gonorrhoeae PilC1 produced normal amounts of pili. However, the N. gonorrhoeae PilC1 calcium-binding mutant still had partial defects in gonococcal adhesion to ME180 cells and genetic transformation, which are both essential virulence factors in this human pathogen. Thus, we conclude that calcium binding to PilC1 plays a critical role in pilus function in N. gonorrhoeae. PMID:24002068

Surface association and the MreB cytoskeleton regulate pilus production, localization and function in Pseudomonas aeruginosa.

PubMed

Cowles, Kimberly N; Gitai, Zemer

2010-06-01

Spatial organization of bacterial proteins influences many cellular processes, including division, chromosome segregation and motility. Virulence-associated proteins also localize to specific destinations within bacterial cells. However, the functions and mechanisms of virulence factor localization remain largely unknown. In this work, we demonstrate that polar assembly of the Pseudomonas aeruginosa PAO1 type IV pilus is regulated by surface association in a manner that affects gene transcription, protein levels and protein localization. We also uncover one mechanism for this regulation that acts through the actin homologue MreB. Inactivation of MreB leads to mislocalization of the pilus retraction ATPase PilT, mislocalization of the pili themselves and a reduction in motility. Furthermore, the role of MreB in polar localization of PilT is modulated by surface association, corroborating our results that environmental factors influence the regulation of pilus production. Specifically, MreB mediates both the initiation and maintenance of PilT localization when cells are grown in suspension but only affects the initiation of localization when cells are grown on a surface. Together, these results suggest that the bacterial cytoskeleton provides a mechanism for the polar localization of P. aeruginosa pili and demonstrate that protein localization may represent an important aspect of virulence factor regulation in bacterial pathogens.

Functional role of the type 1 pilus rod structure in mediating host-pathogen interactions

PubMed Central

Dodson, Karen W; Hazen, Jennie E; Conover, Matt S; Wang, Fengbin; Svenmarker, Pontus; Luna-Rico, Areli; Francetic, Olivera; Andersson, Magnus; Egelman, Edward H

2018-01-01

Uropathogenic E. coli (UPEC), which cause urinary tract infections (UTI), utilize type 1 pili, a chaperone usher pathway (CUP) pilus, to cause UTI and colonize the gut. The pilus rod, comprised of repeating FimA subunits, provides a structural scaffold for displaying the tip adhesin, FimH. We solved the 4.2 Å resolution structure of the type 1 pilus rod using cryo-electron microscopy. Residues forming the interactive surfaces that determine the mechanical properties of the rod were maintained by selection based on a global alignment of fimA sequences. We identified mutations that did not alter pilus production in vitro but reduced the force required to unwind the rod. UPEC expressing these mutant pili were significantly attenuated in bladder infection and intestinal colonization in mice. This study elucidates an unappreciated functional role for the molecular spring-like property of type 1 pilus rods in host-pathogen interactions and carries important implications for other pilus-mediated diseases. PMID:29345620

Type III Pilus of Corynebacteria: Pilus Length Is Determined by the Level of Its Major Pilin Subunit

PubMed Central

Swierczynski, Arlene; Ton-That, Hung

2006-01-01

Multiple pilus gene clusters have been identified in several gram-positive bacterial genomes sequenced to date, including the Actinomycetales, clostridia, streptococci, and corynebacteria. The genome of Corynebacterium diphtheriae contains three pilus gene clusters, two of which have been previously characterized. Here, we report the characterization of the third pilus encoded by the spaHIG cluster. By using electron microscopy and biochemical analysis, we demonstrate that SpaH forms the pilus shaft, while SpaI decorates the structure and SpaG is largely located at the pilus tip. The assembly of the SpaHIG pilus requires a specific sortase located within the spaHIG pilus gene cluster. Deletion of genes specific for the synthesis and polymerization of the other two pilus types does not affect the SpaHIG pilus. Moreover, SpaH but not SpaI or SpaG is essential for the formation of the filament. When expressed under the control of an inducible promoter, the amount of the SpaH pilin regulates pilus length; no pili are assembled from an SpaH precursor that has an alanine in place of the conserved lysine of the SpaH pilin motif. Thus, the spaHIG pilus gene cluster encodes a pilus structure that is independently assembled and antigenically distinct from other pili of C. diphtheriae. We incorporate these findings in a model of sortase-mediated pilus assembly that may be applicable to many gram-positive pathogens. PMID:16923899

Type III pilus of corynebacteria: Pilus length is determined by the level of its major pilin subunit.

PubMed

Swierczynski, Arlene; Ton-That, Hung

2006-09-01

Multiple pilus gene clusters have been identified in several gram-positive bacterial genomes sequenced to date, including the Actinomycetales, clostridia, streptococci, and corynebacteria. The genome of Corynebacterium diphtheriae contains three pilus gene clusters, two of which have been previously characterized. Here, we report the characterization of the third pilus encoded by the spaHIG cluster. By using electron microscopy and biochemical analysis, we demonstrate that SpaH forms the pilus shaft, while SpaI decorates the structure and SpaG is largely located at the pilus tip. The assembly of the SpaHIG pilus requires a specific sortase located within the spaHIG pilus gene cluster. Deletion of genes specific for the synthesis and polymerization of the other two pilus types does not affect the SpaHIG pilus. Moreover, SpaH but not SpaI or SpaG is essential for the formation of the filament. When expressed under the control of an inducible promoter, the amount of the SpaH pilin regulates pilus length; no pili are assembled from an SpaH precursor that has an alanine in place of the conserved lysine of the SpaH pilin motif. Thus, the spaHIG pilus gene cluster encodes a pilus structure that is independently assembled and antigenically distinct from other pili of C. diphtheriae. We incorporate these findings in a model of sortase-mediated pilus assembly that may be applicable to many gram-positive pathogens.

The Escherichia coli P and Type 1 Pilus Assembly Chaperones PapD and FimC Are Monomeric in Solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarowar, Samema; Hu, Olivia J.; Werneburg, Glenn T.

ABSTRACT The chaperone/usher pathway is used by Gram-negative bacteria to assemble adhesive surface structures known as pili or fimbriae. Uropathogenic strains ofEscherichia coliuse this pathway to assemble P and type 1 pili, which facilitate colonization of the kidney and bladder, respectively. Pilus assembly requires a periplasmic chaperone and outer membrane protein termed the usher. The chaperone allows folding of pilus subunits and escorts the subunits to the usher for polymerization into pili and secretion to the cell surface. Based on previous structures of mutant versions of the P pilus chaperone PapD, it was suggested that the chaperone dimerizes in themore » periplasm as a self-capping mechanism. Such dimerization is counterintuitive because the chaperone G1 strand, important for chaperone-subunit interaction, is buried at the dimer interface. Here, we show that the wild-type PapD chaperone also forms a dimer in the crystal lattice; however, the dimer interface is different from the previously solved structures. In contrast to the crystal structures, we found that both PapD and the type 1 pilus chaperone, FimC, are monomeric in solution. Our findings indicate that pilus chaperones do not sequester their G1 β-strand by forming a dimer. Instead, the chaperones may expose their G1 strand for facile interaction with pilus subunits. We also found that the type 1 pilus adhesin, FimH, is flexible in solution while in complex with its chaperone, whereas the P pilus adhesin, PapGII, is rigid. Our study clarifies a crucial step in pilus biogenesis and reveals pilus-specific differences that may relate to biological function. IMPORTANCEPili are critical virulence factors for many bacterial pathogens. UropathogenicE. colirelies on P and type 1 pili assembled by the chaperone/usher pathway to adhere to the urinary tract and establish infection. Studying pilus assembly is important for understanding mechanisms of protein secretion, as well as for identifying points for therapeutic intervention. Pilus biogenesis is a multistep process. This work investigates the oligomeric state of the pilus chaperone in the periplasm, which is important for understanding early assembly events. Our work unambiguously demonstrates that both PapD and FimC chaperones are monomeric in solution. We further demonstrate that the solution behavior of the FimH and PapGII adhesins differ, which may be related to functional differences between the two pilus systems.« less

Identification and phenotypic characterization of a second collagen adhesin, Scm, and genome-based identification and analysis of 13 other predicted MSCRAMMs, including four distinct pilus loci, in Enterococcus faecium

PubMed Central

Sillanpää, Jouko; Nallapareddy, Sreedhar R.; Prakash, Vittal P.; Qin, Xiang; Hook, Magnus; Weinstock, George M.; Murray, Barbara E.

2009-01-01

SUMMARY Attention has recently been drawn to Enterococcus faecium because of an increasing number of nosocomial infections caused by this species and its resistance to multiple antibacterial agents. However, relatively little is known about pathogenic determinants of this organism. We have previously identified a cell wall anchored collagen adhesin, Acm, produced by some isolates of E. faecium, and a secreted antigen, SagA, exhibiting broad spectrum binding to extracellular matrix proteins. Here, we analyzed the draft genome of strain TX0016 for potential MSCRAMMs (microbial surface component recognizing adhesive matrix molecules). Genome-based bioinformatics identified 22 predicted cell wall anchored E. faeciumsurface proteins (Fms) of which 15 (including Acm) have typical characteristics of MSCRAMMs including predicted folding into a modular architecture with multiple immunoglobulin-like domains. Functional characterization of one (Fms10, redesignated Scm for second collagen adhesin of E. faeciu m) revealed that recombinant Scm65 (A- and B-domains) and Scm36 (A-domain) bound efficiently to collagen type V in a concentration dependent manner, bound considerably less to collagen type I and fibrinogen, and differed from Acm in their binding specificities to collagen types IV and V. Results from far-UV circular dichroism of recombinant Scm36 and of Acm37 indicated that these proteins are rich in β-sheets, supporting our folding predictions. Whole-cell ELISA and FACS analyses unambiguously demonstrated surface expression of Scm in most E. faecium isolates. Strikingly, 11 of the 15 predicted MSCRAMMs clustered in four loci, each with a class C sortase gene; 9 of these showed similarity to Enterococcus faecalis Ebp pilus subunits and also contained motifs essential for pilus assembly. Antibodies against one of the predicted major pilus proteins, Fms9 (redesignated as EbpCfm), detected a “ladder” pattern of high-molecular weight protein bands in a Western blot analysis of cell surface extracts from E. faecium, suggesting that EbpCfm is polymerized into a pilus structure. Further analysis of the transcripts of the corresponding gene cluster indicated that fms1 (ebpAfm), fms5 (ebpBfm) and ebpCfm are co-transcribed, consistent with pilus-encoding gene clusters of other gram-positive bacteria. All 15 genes occurred frequently in 30 clinically-derived diverse E. faecium isolates tested. The common occurrence of MSCRAMM and pilus-encoding genes and the presence of a second collagen-binding protein may have important implications for our understanding of this emerging pathogen. PMID:18832325

Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

PubMed

Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

2015-06-16

Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

Crystal structure of the Vibrio cholerae colonization factor TcpF and identification of a functional immunogenic site.

PubMed

Megli, Christina J; Yuen, Alex S W; Kolappan, Subramaniapillai; Richardson, Malcolm R; Dharmasena, Madushini N; Krebs, Shelly J; Taylor, Ronald K; Craig, Lisa

2011-06-03

Vibrio cholerae relies on two main virulence factors--toxin-coregulated pilus (TCP) and cholera toxin--to cause the gastrointestinal disease cholera. TCP is a type IV pilus that mediates bacterial autoagglutination and colonization of the intestine. TCP is encoded by the tcp operon, which also encodes TcpF, a protein of unknown function that is secreted by V. cholerae in a TCP-dependent manner. Although TcpF is not required for TCP biogenesis, a tcpF mutant has a colonization defect in the infant mouse cholera model that is as severe as a pilus mutant. Furthermore, TcpF antisera protect against V. cholerae infection. TcpF has no apparent sequence homology to any known protein. Here, we report the de novo X-ray crystal structure of TcpF and the identification of an epitope that is critical for its function as a colonization factor. A monoclonal antibody recognizing this epitope is protective against V. cholerae challenge and adds to the protection provided by an anti-TcpA antibody. These data suggest that TcpF has a novel function in V. cholerae colonization and define a region crucial for this function. Copyright © 2011 Elsevier Ltd. All rights reserved.

The Cryoelectron Microscopy Structure of the Type 1 Chaperone-Usher Pilus Rod.

PubMed

Hospenthal, Manuela K; Zyla, Dawid; Costa, Tiago R D; Redzej, Adam; Giese, Christoph; Lillington, James; Glockshuber, Rudi; Waksman, Gabriel

2017-12-05

Adhesive chaperone-usher pili are long, supramolecular protein fibers displayed on the surface of many bacterial pathogens. The type 1 and P pili of uropathogenic Escherichia coli (UPEC) play important roles during urinary tract colonization, mediating attachment to the bladder and kidney, respectively. The biomechanical properties of the helical pilus rods allow them to reversibly uncoil in response to flow-induced forces, allowing UPEC to retain a foothold in the unique and hostile environment of the urinary tract. Here we provide the 4.2-Å resolution cryo-EM structure of the type 1 pilus rod, which together with the previous P pilus rod structure rationalizes the remarkable "spring-like" properties of chaperone-usher pili. The cryo-EM structure of the type 1 pilus rod differs in its helical parameters from the structure determined previously by a hybrid approach. We provide evidence that these structural differences originate from different quaternary structures of pili assembled in vivo and in vitro. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

PubMed

Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

2017-07-01

The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Streptococcus agalactiae Serotype IV in Humans and Cattle, Northern Europe1

PubMed Central

Lyhs, Ulrike; Kulkas, Laura; Katholm, Jørgen; Waller, Karin Persson; Saha, Kerttu; Tomusk, Richard J.

2016-01-01

Streptococcus agalactiae is an emerging pathogen of nonpregnant human adults worldwide and a reemerging pathogen of dairy cattle in parts of Europe. To learn more about interspecies transmission of this bacterium, we compared contemporaneously collected isolates from humans and cattle in Finland and Sweden. Multilocus sequence typing identified 5 sequence types (STs) (ST1, 8, 12, 23, and 196) shared across the 2 host species, suggesting possible interspecies transmission. More than 54% of the isolates belonged to those STs. Molecular serotyping and pilus island typing of those isolates did not differentiate between populations isolated from different host species. Isolates from humans and cattle differed in lactose fermentation, which is encoded on the accessory genome and represents an adaptation to the bovine mammary gland. Serotype IV-ST196 isolates were obtained from multiple dairy herds in both countries. Cattle may constitute a previously unknown reservoir of this strain. PMID:27869599

The Pilin N-terminal Domain Maintains Neisseria gonorrhoeae Transformation Competence during Pilus Phase Variation

PubMed Central

2016-01-01

The obligate human pathogen Neisseria gonorrhoeae is the sole aetiologic agent of the sexually transmitted infection, gonorrhea. Required for gonococcal infection, Type IV pili (Tfp) mediate many functions including adherence, twitching motility, defense against neutrophil killing, and natural transformation. Critical for immune escape, the gonococcal Tfp undergoes antigenic variation, a recombination event at the pilE locus that varies the surface exposed residues of the major pilus subunit PilE (pilin) in the pilus fiber. This programmed recombination system has the potential to produce thousands of pilin variants and can produce strains with unproductive pilin molecules that are completely unable to form Tfp. Saturating mutagenesis of the 3’ third of the pilE gene identified 68 unique single nucleotide mutations that each resulted in an underpiliated colony morphology. Notably, all isolates, including those with undetectable levels of pilin protein and no observable surface-exposed pili, retained an intermediate level of transformation competence not exhibited in ΔpilE strains. Site-directed, nonsense mutations revealed that only the first 38 amino acids of the mature pilin N-terminus (the N-terminal domain or Ntd) are required for transformation competence, and microscopy, ELISAs and pilus purification demonstrate that extended Tfp are not required for competence. Transformation in strains producing only the pilin Ntd has the same genetic determinants as wild-type transformation. The Ntd corresponds to the alternative product of S-pilin cleavage, a specific proteolysis unique to pathogenic Neisseria. Mutation of the S-pilin cleavage site demonstrated that S-pilin cleavage mediated release of the Ntd is required for competence when a strain produces unproductive pilin molecules that cannot assemble into a Tfp through mutation or antigenic variation. We conclude that S-pilin cleavage evolved as a mechanism to maintain competence in nonpiliated antigenic variants and suggest there are alternate forms of the Tfp assembly apparatus that mediate various functions including transformation. PMID:27213957

Crystal structure analysis reveals Pseudomonas PilY1 as an essential calcium-dependent regulator of bacterial surface motility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orans, Jillian; Johnson, Michael D.L.; Coggan, Kimberly A.

Several bacterial pathogens require the 'twitching' motility produced by filamentous type IV pili (T4P) to establish and maintain human infections. Two cytoplasmic ATPases function as an oscillatory motor that powers twitching motility via cycles of pilus extension and retraction. The regulation of this motor, however, has remained a mystery. We present the 2.1 {angstrom} resolution crystal structure of the Pseudomonas aeruginosa pilus-biogenesis factor PilY1, and identify a single site on this protein required for bacterial translocation. The structure reveals a modified {beta}-propeller fold and a distinct EF-hand-like calcium-binding site conserved in pathogens with retractile T4P. We show that preventing calciummore » binding by PilY1 using either an exogenous calcium chelator or mutation of a single residue disrupts Pseudomonas twitching motility by eliminating surface pili. In contrast, placing a lysine in this site to mimic the charge of a bound calcium interferes with motility in the opposite manner - by producing an abundance of nonfunctional surface pili. Our data indicate that calcium binding and release by the unique loop identified in the PilY1 crystal structure controls the opposing forces of pilus extension and retraction. Thus, PilY1 is an essential, calcium-dependent regulator of bacterial twitching motility.« less

Immunocytochemical localization of HrpA and HrpZ supports a role for the Hrp pilus in the transfer of effector proteins from Pseudomonas syringae pv. tomato across the host plant cell wall.

PubMed

Brown, I R; Mansfield, J W; Taira, S; Roine, E; Romantschuk, M

2001-03-01

The Hrp pilus, composed of HrpA subunits, is an essential component of the type III secretion system in Pseudomonas syringae. We used electron microscopy (EM) and immunocytochemistry to examine production of the pilus in vitro from P. syringae pv. tomato strain DC3000 grown under hrp-inducing conditions on EM grids. Pili, when labeled with antibodies to HrpA, developed rapidly in a nonpolar manner shortly after the detection of the hrpA transcript and extended up to 5 microm into surrounding media. Structures at the base of the pilus were clearly differentiated from the basal bodies of flagella. The HrpZ protein, also secreted via the type III system, was found by immunogold labeling to be associated with the pilus in vitro. Accumulation and secretion of HrpA and HrpZ were also examined quantitatively after the inoculation of wild-type DC3000 and hrpA and hrpZ mutants into leaves of Arabidopsis thaliana. The functional pilus crossed the plant cell wall to generate tracks of immunogold labeling for HrpA and HrpZ. Mutants that produced HrpA but did not assemble pili were nonpathogenic, did not secrete HrpA protein, and were compromised for the accumulation of HrpZ. A model is proposed in which the rapidly elongating Hrp pilus acts as a moving conveyor, facilitating transfer of effector proteins from bacteria to the plant cytoplasm across the formidable barrier of the plant cell wall.

Bacterial Translocation Ratchets: Shared Physical Principles with Different Molecular Implementations: How bacterial secretion systems bias Brownian motion for efficient translocation of macromolecules.

PubMed

Hepp, Christof; Maier, Berenike

2017-10-01

Secretion systems enable bacteria to import and secrete large macromolecules including DNA and proteins. While most components of these systems have been identified, the molecular mechanisms of macromolecular transport remain poorly understood. Recent findings suggest that various bacterial secretion systems make use of the translocation ratchet mechanism for transporting polymers across the cell envelope. Translocation ratchets are powered by chemical potential differences generated by concentration gradients of ions or molecules that are specific to the respective secretion systems. Bacteria employ these potential differences for biasing Brownian motion of the macromolecules within the conduits of the secretion systems. Candidates for this mechanism include DNA import by the type II secretion/type IV pilus system, DNA export by the type IV secretion system, and protein export by the type I secretion system. Here, we propose that these three secretion systems employ different molecular implementations of the translocation ratchet mechanism. © 2017 The Authors. BioEssays Published by WILEY Periodicals, Inc.

Pilus distribution among lineages of group b streptococcus: an evolutionary and clinical perspective

PubMed Central

2014-01-01

Background Group B Streptococcus (GBS) is an opportunistic pathogen in both humans and bovines. Epidemiological and phylogenetic analyses have found strains belonging to certain phylogenetic lineages to be more frequently associated with invasive newborn disease, asymptomatic maternal colonization, and subclinical bovine mastitis. Pilus structures in GBS facilitate colonization and invasion of host tissues and play a role in biofilm formation, though few large-scale studies have estimated the frequency and diversity of the three pilus islands (PIs) across diverse genotypes. Here, we examined the distribution of pilus islands (PI) 1, 2a and 2b among 295 GBS strains representing 73 multilocus sequence types (STs) belonging to eight clonal complexes. PCR-based RFLP was also used to evaluate variation in the genes encoding pilus backbone proteins of PI-2a and PI-2b. Results All 295 strains harbored one of the PI-2 variants and most human-derived strains contained PI-1. Bovine-derived strains lacked PI-1 and possessed a unique PI-2b backbone protein allele. Neonatal strains more frequently had PI-1 and a PI-2 variant than maternal colonizing strains, and most CC-17 strains had PI-1 and PI-2b with a distinct backbone protein allele. Furthermore, we present evidence for the frequent gain and loss of genes encoding certain pilus types. Conclusions These data suggest that pilus combinations impact host specificity and disease presentation and that diversification often involves the loss or acquisition of PIs. Such findings have implications for the development of GBS vaccines that target the three pilus islands. PMID:24943359

Functional analysis of an unusual type IV pilus in the Gram‐positive Streptococcus sanguinis

PubMed Central

Gurung, Ishwori; Spielman, Ingrid; Davies, Mark R.; Lala, Rajan; Gaustad, Peter; Biais, Nicolas

2015-01-01

Summary Type IV pili (Tfp), which have been studied extensively in a few Gram‐negative species, are the paradigm of a group of widespread and functionally versatile nano‐machines. Here, we performed the most detailed molecular characterisation of Tfp in a Gram‐positive bacterium. We demonstrate that the naturally competent S treptococcus sanguinis produces retractable Tfp, which like their Gram‐negative counterparts can generate hundreds of piconewton of tensile force and promote intense surface‐associated motility. Tfp power ‘train‐like’ directional motion parallel to the long axis of chains of cells, leading to spreading zones around bacteria grown on plates. However, S . sanguinis  Tfp are not involved in DNA uptake, which is mediated by a related but distinct nano‐machine, and are unusual because they are composed of two pilins in comparable amounts, rather than one as normally seen. Whole genome sequencing identified a locus encoding all the genes involved in Tfp biology in S . sanguinis. A systematic mutational analysis revealed that Tfp biogenesis in S . sanguinis relies on a more basic machinery (only 10 components) than in Gram‐negative species and that a small subset of four proteins dispensable for pilus biogenesis are essential for motility. Intriguingly, one of the piliated mutants that does not exhibit spreading retains microscopic motility but moves sideways, which suggests that the corresponding protein controls motion directionality. Besides establishing S . sanguinis as a useful new model for studying Tfp biology, these findings have important implications for our understanding of these widespread filamentous nano‐machines. PMID:26435398

Role of Pilus Proteins in Adherence and Invasion of Streptococcus agalactiae to the Lung and Cervical Epithelial Cells*

PubMed Central

Sharma, Puja; Lata, Hem; Arya, Deepak Kumar; Kashyap, Arun Kumar; Kumar, Hemant; Dua, Meenakshi; Ali, Arif; Johri, Atul Kumar

2013-01-01

Streptococcus agalactiae, or group B Streptococcus (GBS), is an important opportunistic pathogen that causes pneumonia, sepsis, and meningitis in neonates and severe diseases in immunocompromised adults. We have performed comparative genomics of prevalent GBS serotypes of Indian origin (i.e. Ia, III, V, and VII). Pilus-proteins were commonly found up-regulated, and their expression was studied by using antiserum for GBS80 (backbone protein of pilus island-I), GBS67 (ancillary protein of PI-2a), and SAN1518 (backbone protein of PI-2b) by whole cell and Western blot analysis. To check the role of pilus proteins in adherence and invasion, an inhibition assay was performed. Comparative immunoblotting experiments revealed that expression of pili proteins does not differ in geographically different selected serotypes, Ia and V, of India and the United States. In the case of A549 cells, we found that GBS VII invasion and adherence was inhibited by pilus protein-specific antiserum SAN1518 significantly (p < 0.001) by 88.5 and 91%, respectively. We found that mutant strains, deficient in the pilus proteins (Δgbs80 and Δsan1518) exhibit a significant decrease in adherence in the case of type Ia, III, and VII. In the case of type VII, we have found a 95% reduction in invasion when Δsan1518 was used with A549 cells. Because the pilus proteins were identified previously as vaccine candidates against GBS serotypes of developed countries, we also found their role in the attachment and invasion of GBS of Indian origin. Thus, the present work supports the idea of making a more effective pilus protein-based vaccine that can be used universally. PMID:23209289

Involvement of T6 pili in biofilm formation by serotype M6 Streptococcus pyogenes.

PubMed

Kimura, Keiji Richard; Nakata, Masanobu; Sumitomo, Tomoko; Kreikemeyer, Bernd; Podbielski, Andreas; Terao, Yutaka; Kawabata, Shigetada

2012-02-01

The group A streptococcus (GAS) Streptococcus pyogenes is known to cause self-limiting purulent infections in humans. The role of GAS pili in host cell adhesion and biofilm formation is likely fundamental in early colonization. Pilus genes are found in the FCT (fibronectin-binding protein, collagen-binding protein, and trypsin-resistant antigen) genomic region, which has been classified into nine subtypes based on the diversity of gene content and nucleotide sequence. Several epidemiological studies have indicated that FCT type 1 strains, including serotype M6, produce large amounts of monospecies biofilm in vitro. We examined the direct involvement of pili in biofilm formation by serotype M6 clinical isolates. In the majority of tested strains, deletion of the tee6 gene encoding pilus shaft protein T6 compromised the ability to form biofilm on an abiotic surface. Deletion of the fctX and srtB genes, which encode pilus ancillary protein and class C pilus-associated sortase, respectively, also decreased biofilm formation by a representative strain. Unexpectedly, these mutant strains showed increased bacterial aggregation compared with that of the wild-type strain. When the entire FCT type 1 pilus region was ectopically expressed in serotype M1 strain SF370, biofilm formation was promoted and autoaggregation was inhibited. These findings indicate that assembled FCT type 1 pili contribute to biofilm formation and also function as attenuators of bacterial aggregation. Taken together, our results show the potential role of FCT type 1 pili in the pathogenesis of GAS infections.

The Product of the fimI Gene Is Necessary for Escherichia coli Type 1 Pilus Biosynthesis

PubMed Central

Valenski, Mary L.; Harris, Sandra L.; Spears, Patricia A.; Horton, John R.; Orndorff, Paul E.

2003-01-01

Site-directed mutagenesis was employed to create lesions in fimI, a gene of uncertain function located in the chromosomal gene cluster (fim) involved in Escherichia coli type 1 pilus biosynthesis. Chromosomal fimI mutations produced a piliation-negative phenotype. Complementation analysis indicated that a fimI′-kan insertion mutation and a fimI frameshift mutation produced polarity-like effects not seen with an in-frame fimI deletion mutation. Minicell analysis associated fimI with a 16.4-kDa noncytoplasmic protein product (FimI). We conclude that FimI has a required role in normal pilus biosynthesis. PMID:12897022

Involvement of T6 Pili in Biofilm Formation by Serotype M6 Streptococcus pyogenes

PubMed Central

Kimura, Keiji Richard; Nakata, Masanobu; Sumitomo, Tomoko; Kreikemeyer, Bernd; Podbielski, Andreas; Terao, Yutaka

2012-01-01

The group A streptococcus (GAS) Streptococcus pyogenes is known to cause self-limiting purulent infections in humans. The role of GAS pili in host cell adhesion and biofilm formation is likely fundamental in early colonization. Pilus genes are found in the FCT (fibronectin-binding protein, collagen-binding protein, and trypsin-resistant antigen) genomic region, which has been classified into nine subtypes based on the diversity of gene content and nucleotide sequence. Several epidemiological studies have indicated that FCT type 1 strains, including serotype M6, produce large amounts of monospecies biofilm in vitro. We examined the direct involvement of pili in biofilm formation by serotype M6 clinical isolates. In the majority of tested strains, deletion of the tee6 gene encoding pilus shaft protein T6 compromised the ability to form biofilm on an abiotic surface. Deletion of the fctX and srtB genes, which encode pilus ancillary protein and class C pilus-associated sortase, respectively, also decreased biofilm formation by a representative strain. Unexpectedly, these mutant strains showed increased bacterial aggregation compared with that of the wild-type strain. When the entire FCT type 1 pilus region was ectopically expressed in serotype M1 strain SF370, biofilm formation was promoted and autoaggregation was inhibited. These findings indicate that assembled FCT type 1 pili contribute to biofilm formation and also function as attenuators of bacterial aggregation. Taken together, our results show the potential role of FCT type 1 pili in the pathogenesis of GAS infections. PMID:22155780

Rapid, synchronous, and stable induction of type 1 piliation in Escherichia coli by using a chromosomal lacUV5 promoter.

PubMed Central

Woodall, L D; Russell, P W; Harris, S L; Orndorff, P E

1993-01-01

Type 1 pili are filamentous proteinaceous appendages produced by certain members of the family Enterobacteriaceae. In Escherichia coli, the adhesive properties of these pili are due to the binding of at least one minor pilus component to mannose, a sugar common to cell surface molecules of many eukaryotic cells. The study of pilus assembly may be benefited by a rapid way of inducing pilus synthesis de novo. We describe herein the construction and characterization of a strain in which piliation can be rapidly induced by the addition of lactose or its analog isopropyl-beta-D-thiogalactopyranoside. This was accomplished by placing the chromosomal fimA gene (encoding the major structural subunit of pili) under lacUV5 promoter control. Further experiments suggested that transcription of genes downstream of fimA, whose products are required for normal pilus assembly and function, may also be controlled by the lacUV5 promoter. The construction described herein may have a variety of applications apart from aiding the study of pilus assembly since its adhesive properties can be rapidly and easily turned on and off. Images PMID:8097517

Adhesion by pathogenic corynebacteria.

PubMed

Rogers, Elizabeth A; Das, Asis; Ton-That, Hung

2011-01-01

Pathogenic members of the genus Corynebacterium cause a wide range of serious infections in humans including diphtheria. Adhesion to host cells is a crucial step during infection. In Corynebacterium diphtheriae, adhesion is mediated primarily by filamentous structures called pili or fimbriae that are covalently attached to the bacterial cell wall. C. diphtheriae produces three distinct pilus structures, SpaA-, SpaD- and SpaH-type pili. Similar to other types, the prototype SpaA pilus consists of SpaA forming the pilus shaft and two minor pilins SpaB and SpaC located at the base and at the tip, respectively. The minor pilins SpaB/SpaC are critical for bacterial binding to human pharyngeal cells, and thus represent the major adhesins of corynebacteria. Like pili of many other gram-positive microbes, the assembly of corynebacterial pili occurs by a two-step mechanism, whereby pilins are covalently polymerized by a transpeptidase enzyme named pilin-specific sortase and the generated pilus polymer is subsequently anchored to the cell wall peptidoglycan via the base pilin by the housekeeping sortase or a non-polymerizing sortase. This chapter reviews the current knowledge of corynebacterial adhesion, with a specific focus on pilus structures, their assembly, and the mechanism of adhesion mediated by pili.

Crystal Structure of a Type IV Pilus Assembly ATPase: Insights into the Molecular Mechanism of PilB from Thermus thermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mancl, Jordan M.; Black, Wesley P.; Robinson, Howard

Type IV pili (T4P) mediate bacterial motility and virulence. The PilB/GspE family ATPases power the assembly of T4P and type 2 secretion systems. We determined the structure of the ATPase region of PilB (PilB ATP) in complex with ATPγS to provide a model of a T4P assembly ATPase and a view of a PilB/GspE family hexamer at better than 3-Å resolution. Spatial positioning and conformations of the protomers suggest a mechanism of force generation. All six PilB ATP protomers contain bound ATPγS. Two protomers form a closed conformation poised for ATP hydrolysis. The other four molecules assume an open conformationmore » but separate into two pairs with distinct active-site accessibilities. We propose that one pair represents the post-hydrolysis phase while the other pair appears poised for ADP/ATP exchange. In conclusion, collectively, the data suggest that T4P assembly is powered by coordinating concurrent substrate binding with ATP hydrolysis across the PilB hexamer.« less

Crystal Structure of a Type IV Pilus Assembly ATPase: Insights into the Molecular Mechanism of PilB from Thermus thermophilus

DOE PAGES

Mancl, Jordan M.; Black, Wesley P.; Robinson, Howard; ...

2016-09-22

Type IV pili (T4P) mediate bacterial motility and virulence. The PilB/GspE family ATPases power the assembly of T4P and type 2 secretion systems. We determined the structure of the ATPase region of PilB (PilB ATP) in complex with ATPγS to provide a model of a T4P assembly ATPase and a view of a PilB/GspE family hexamer at better than 3-Å resolution. Spatial positioning and conformations of the protomers suggest a mechanism of force generation. All six PilB ATP protomers contain bound ATPγS. Two protomers form a closed conformation poised for ATP hydrolysis. The other four molecules assume an open conformationmore » but separate into two pairs with distinct active-site accessibilities. We propose that one pair represents the post-hydrolysis phase while the other pair appears poised for ADP/ATP exchange. In conclusion, collectively, the data suggest that T4P assembly is powered by coordinating concurrent substrate binding with ATP hydrolysis across the PilB hexamer.« less

Solution Structure of Homology Region (HR) Domain of Type II Secretion System*

PubMed Central

Gu, Shuang; Kelly, Geoff; Wang, Xiaohui; Frenkiel, Tom; Shevchik, Vladimir E.; Pickersgill, Richard W.

2012-01-01

The type II secretion system of Gram-negative bacteria is important for bacterial pathogenesis and survival; it is composed of 12 mostly multimeric core proteins, which build a sophisticated secretion machine spanning both bacterial membranes. OutC is the core component of the inner membrane subcomplex thought to be involved in both recognition of substrate and interaction with the outer membrane secretin OutD. Here, we report the solution structure of the HR domain of OutC and explore its interaction with the secretin. The HR domain adopts a β-sandwich-like fold consisting of two β-sheets each composed of three anti-parallel β-strands. This structure is strikingly similar to the periplasmic region of PilP, an inner membrane lipoprotein from the type IV pilus system highlighting the common evolutionary origin of these two systems and showing that all the core components of the type II secretion system have a structural or sequence ortholog within the type IV pili system. The HR domain is shown to interact with the N0 domain of the secretin. The importance of this interaction is explored in the context of the functional secretion system. PMID:22253442

Identification and characterization of genes determining receptor binding and pilus length of Escherichia coli type 1 pili.

PubMed Central

Maurer, L; Orndorff, P E

1987-01-01

We describe the identification and characterization of two genes and their gene products responsible for determining receptor binding and pilus length in type 1-piliated Escherichia coli. One gene, pilE, conferred the ability of piliated cells to agglutinate guinea pig erythrocytes. The other gene, pilF, determined pilus length, in that mutants having lesions in pilF had very long pili. The two genes were detected after Tn5 mutagenesis of a cloned segment of DNA that normally complemented a pilE lesion in the chromosome. Thus, lesions in pilE or pilF on the cloned segment resulted in mutants having the PilE- phenotype (piliated but unable to agglutinate erythrocytes). Introduction of the plasmid-encoded mutant alleles of pilE and pilF into the chromosome followed by electron microscopic examination of the mutants showed that only lesions in pilF conferred the striking increase in pilus length. Mutations in pilF could be complemented in trans by the original cloned segment to produce cells with parental-length pili. Minicell transcription and translation of the cloned pilE and pilF genes having representative Tn5 insertion mutations showed that the pilE gene product was a protein of ca. 31 kilodaltons and that the pilF gene product was a protein of ca. 18 kilodaltons. We believe that the pilF gene product may act as a competitive inhibitor of pilus polymerization. Thus, pilus length may be controlled by the ratio of pilin to pilF gene product present within the cell. Images PMID:2879830

Structural Basis of Typhoid: Salmonella typhi Type IVb pilin (PilS) and Cystic Fibrosis Transmembrane Conductance Regulatory Interaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balakrishna, A.; Saxena, A; Mok, H

2009-01-01

The type IVb pilus of the enteropathogenic bacteria Salmonella typhi is a major adhesion factor during the entry of this pathogen into gastrointestinal epithelial cells. Its target of adhesion is a stretch of 10 residues from the first extracellular domain of cystic fibrosis transmembrane conductance regulator (CFTR). The crystal structure of the N-terminal 25 amino acid deleted S. typhi native PilS protein (PilS), which makes the pilus, was determined at 1.9 A resolution by the multiwavelength anomalous dispersion method. Also, the structure of the complex of PilS and a target CFTR peptide, determined at 1.8 A, confirms that residues 113-117more » (NKEER) of CFTR are involved in binding with the pilin protein and gives us insight on the amino acids that are essential for binding. Furthermore, we have also explored the role of a conserved disulfide bridge in pilus formation. The subunit structure and assembly architecture are crucial for understanding pilus functions and designing suitable therapeutics against typhoid.« less

Structural basis of typhod: Salmonella typhi type IVb pilin (PilS) and cystic fibrosis transmembrane conductance regulator interaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balakrishna, A.; Saxena, A; Mok, H

2009-01-01

The type IVb pilus of the enteropathogenic bacteria Salmonella typhi is a major adhesion factor during the entry of this pathogen into gastrointestinal epithelial cells. Its target of adhesion is a stretch of 10 residues from the first extracellular domain of cystic fibrosis transmembrane conductance regulator (CFTR). The crystal structure of the N-terminal 25 amino acid deleted S. typhi native PilS protein (PilS), which makes the pilus, was determined at 1.9 A resolution by the multiwavelength anomalous dispersion method. Also, the structure of the complex of PilS and a target CFTR peptide, determined at 1.8 A, confirms that residues 113-117more » (NKEER) of CFTR are involved in binding with the pilin protein and gives us insight on the amino acids that are essential for binding. Furthermore, we have also explored the role of a conserved disulfide bridge in pilus formation. The subunit structure and assembly architecture are crucial for understanding pilus functions and designing suitable therapeutics against typhoid.« less

Nitazoxanide Inhibits Pilus Biogenesis by Interfering with Folding of the Usher Protein in the Outer Membrane

PubMed Central

Chahales, Peter; Hoffman, Paul S.

2016-01-01

Many bacterial pathogens assemble surface fibers termed pili or fimbriae that facilitate attachment to host cells and colonization of host tissues. The chaperone/usher (CU) pathway is a conserved secretion system that is responsible for the assembly of virulence-associated pili by many different Gram-negative bacteria. Pilus biogenesis by the CU pathway requires a dedicated periplasmic chaperone and an integral outer membrane (OM) assembly and secretion platform termed the usher. Nitazoxanide (NTZ), an antiparasitic drug, was previously shown to inhibit the function of aggregative adherence fimbriae and type 1 pili assembled by the CU pathway in enteroaggregative Escherichia coli, an important causative agent of diarrhea. We show here that NTZ also inhibits the function of type 1 and P pili from uropathogenic E. coli (UPEC). UPEC is the primary causative agent of urinary tract infections, and type 1 and P pili mediate colonization of the bladder and kidneys, respectively. By analysis of the different stages of the CU pilus biogenesis pathway, we show that treatment of bacteria with NTZ causes a reduction in the number of usher molecules in the OM, resulting in a loss of pilus assembly on the bacterial surface. In addition, we determine that NTZ specifically prevents proper folding of the usher β-barrel domain in the OM. Our findings demonstrate that NTZ is a pilicide with a novel mechanism of action and activity against diverse CU pathways. This suggests that further development of the NTZ scaffold may lead to new antivirulence agents that target the usher to prevent pilus assembly. PMID:26824945

Corynebacterium diphtheriae employs specific minor pilins to target human pharyngeal epithelial cells

PubMed Central

Mandlik, Anjali; Swierczynski, Arlene; Das, Asis; Ton-That, Hung

2010-01-01

Summary Adherence to host tissues mediated by pili is pivotal in the establishment of infection by many bacterial pathogens. Corynebacterium diphtheriae assembles on its surface three distinct pilus structures. The function and the mechanism of how various pili mediate adherence, however, have remained poorly understood. Here we show that the SpaA-type pilus is sufficient for the specific adherence of corynebacteria to human pharyngeal epithelial cells. The deletion of the spaA gene, which encodes the major pilin forming the pilus shaft, abolishes pilus assembly but not adherence to pharyngeal cells. In contrast, adherence is greatly diminished when either minor pilin SpaB or SpaC is absent. Antibodies directed against either SpaB or SpaC block bacterial adherence. Consistent with a direct role of the minor pilins, latex beads coated with SpaB or SpaC protein bind specifically to pharyngeal cells. Therefore, tissue tropism of corynebacteria for pharyngeal cells is governed by specific minor pilins. Importantly, immunoelectron microscopy and immunofluorescence studies reveal clusters of minor pilins that are anchored to cell surface in the absence of a pilus shaft. Thus, the minor pilins may also be cell wall anchored in addition to their incorporation into pilus structures that could facilitate tight binding to host cells during bacterial infection. PMID:17376076

Structure-based approach to rationally design a chimeric protein for an effective vaccine against Group B Streptococcus infections.

PubMed

Nuccitelli, Annalisa; Cozzi, Roberta; Gourlay, Louise J; Donnarumma, Danilo; Necchi, Francesca; Norais, Nathalie; Telford, John L; Rappuoli, Rino; Bolognesi, Martino; Maione, Domenico; Grandi, Guido; Rinaudo, C Daniela

2011-06-21

Structural vaccinology is an emerging strategy for the rational design of vaccine candidates. We successfully applied structural vaccinology to design a fully synthetic protein with multivalent protection activity. In Group B Streptococcus, cell-surface pili have aroused great interest because of their direct roles in virulence and importance as protective antigens. The backbone subunit of type 2a pilus (BP-2a) is present in six immunogenically different but structurally similar variants. We determined the 3D structure of one of the variants, and experimentally demonstrated that protective antibodies specifically recognize one of the four domains that comprise the protein. We therefore constructed a synthetic protein constituted by the protective domain of each one of the six variants and showed that the chimeric protein protects mice against the challenge with all of the type 2a pilus-carrying strains. This work demonstrates the power of structural vaccinology and will facilitate the development of an optimized, broadly protective pilus-based vaccine against Group B Streptococcus by combining the uniquely generated chimeric protein with protective pilin subunits from two other previously identified pilus types. In addition, this work describes a template procedure that can be followed to develop vaccines against other bacterial pathogens.

Nitazoxanide Inhibits Pilus Biogenesis by Interfering with Folding of the Usher Protein in the Outer Membrane.

PubMed

Chahales, Peter; Hoffman, Paul S; Thanassi, David G

2016-04-01

Many bacterial pathogens assemble surface fibers termed pili or fimbriae that facilitate attachment to host cells and colonization of host tissues. The chaperone/usher (CU) pathway is a conserved secretion system that is responsible for the assembly of virulence-associated pili by many different Gram-negative bacteria. Pilus biogenesis by the CU pathway requires a dedicated periplasmic chaperone and an integral outer membrane (OM) assembly and secretion platform termed the usher. Nitazoxanide (NTZ), an antiparasitic drug, was previously shown to inhibit the function of aggregative adherence fimbriae and type 1 pili assembled by the CU pathway in enteroaggregativeEscherichia coli, an important causative agent of diarrhea. We show here that NTZ also inhibits the function of type 1 and P pili from uropathogenicE. coli(UPEC). UPEC is the primary causative agent of urinary tract infections, and type 1 and P pili mediate colonization of the bladder and kidneys, respectively. By analysis of the different stages of the CU pilus biogenesis pathway, we show that treatment of bacteria with NTZ causes a reduction in the number of usher molecules in the OM, resulting in a loss of pilus assembly on the bacterial surface. In addition, we determine that NTZ specifically prevents proper folding of the usher β-barrel domain in the OM. Our findings demonstrate that NTZ is a pilicide with a novel mechanism of action and activity against diverse CU pathways. This suggests that further development of the NTZ scaffold may lead to new antivirulence agents that target the usher to prevent pilus assembly. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Immunoglobulin-Mediated Agglutination of and Biofilm Formation by Escherichia coli K-12 Require the Type 1 Pilus Fiber

PubMed Central

Orndorff, Paul E.; Devapali, Aditya; Palestrant, Sarah; Wyse, Aaron; Everett, Mary Lou; Bollinger, R. Randal; Parker, William

2004-01-01

The binding of human secretory immunoglobulin A (SIgA), the primary immunoglobulin in the gut, to Escherichia coli is thought to be dependent on type 1 pili. Type 1 pili are filamentous bacterial surface attachment organelles comprised principally of a single protein, the product of the fimA gene. A minor component of the pilus fiber (the product of the fimH gene, termed the adhesin) mediates attachment to a variety of host cell molecules in a mannose inhibitable interaction that has been extensively described. We found that the aggregation of E. coli K-12 by human secretory IgA (SIgA) was dependent on the presence of the pilus fiber, even in the absence of the mannose specific adhesin or in the presence of 25 mM α-CH3Man. The presence of pilus without adhesin also facilitated SIgA-mediated biofilm formation on polystyrene, although biofilm formation was stronger in the presence of the adhesin. IgM also mediated aggregation and biofilm formation in a manner dependent on pili with or without adhesin. These findings indicate that the pilus fiber, even in the absence of the adhesin, may play a role in biologically important processes. Under conditions in which E. coli was agglutinated by SIgA, the binding of SIgA to E. coli was not increased by the presence of the pili, with or without adhesin. This observation suggests that the pili, with or without adhesin, affect factors such as cell surface rigidity or electrostatic repulsion, which can affect agglutination but which do not necessarily determine the level of bound immunoglobulin. PMID:15039312

Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus

PubMed Central

Youderian, Philip; Hartzell, Patricia L.

2006-01-01

Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386

Dynamic localization of HmpF regulates type IV pilus activity and directional motility in the filamentous cyanobacterium Nostoc punctiforme.

PubMed

Cho, Ye Won; Gonzales, Alfonso; Harwood, Thomas V; Huynh, Jessica; Hwang, Yeji; Park, Jun Sang; Trieu, Anthony Q; Italia, Parth; Pallipuram, Vivek K; Risser, Douglas D

2017-10-01

Many cyanobacteria exhibit surface motility powered by type 4 pili (T4P). In the model filamentous cyanobacterium Nostoc punctiforme, the T4P systems are arrayed in static, bipolar rings in each cell. The chemotaxis-like Hmp system is essential for motility and the coordinated polar accumulation of PilA on cells in motile filaments, while the Ptx system controls positive phototaxis. Using transposon mutagenesis, a gene, designated hmpF, was identified as involved in motility. Synteny among filamentous cyanobacteria and the similar expression patterns for hmpF and hmpD imply that HmpF is part of the Hmp system. Deletion of hmpF produced a phenotype distinct from other hmp genes, but indistinguishable from pilB or pilQ. Both an HmpF-GFPuv fusion protein, and PilA, as assessed by in situ immunofluorescence, displayed coordinated, unipolar localization at the leading pole of each cell. Reversals were modulated by changes in light intensity and preceded by the migration of HmpF-GFPuv to the lagging cell poles. These results are consistent with a model where direct interaction between HmpF and the T4P system activates pilus extension, the Hmp system facilitates coordinated polarity of HmpF to establish motility, and the Ptx system modulates HmpF localization to initiate reversals in response to changes in light intensity. © 2017 John Wiley & Sons Ltd.

Phenotypical Analysis of the Lactobacillus rhamnosus GG Fimbrial spaFED Operon: Surface Expression and Functional Characterization of Recombinant SpaFED Pili in Lactococcus lactis

PubMed Central

Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

2014-01-01

A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided the first phenotypical description of a spaFED pilus operon, and with that furthered the functional understanding of surface piliation for a particular gut-commensalic genre of piliated Gram-positive bacteria. PMID:25415357

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

PubMed

Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

2014-01-01

A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided the first phenotypical description of a spaFED pilus operon, and with that furthered the functional understanding of surface piliation for a particular gut-commensalic genre of piliated Gram-positive bacteria.

Lesions in two Escherichia coli type 1 pilus genes alter pilus number and length without affecting receptor binding.

PubMed Central

Russell, P W; Orndorff, P E

1992-01-01

We describe the characterization of two genes, fimF and fimG (also called pilD), that encode two minor components of type 1 pili in Escherichia coli. Defined, in-frame deletion mutations were generated in vitro in each of these two genes. A double mutation that had deletions identical to both single lesions was also constructed. Examination of minicell transcription and translation products of parental and mutant plasmids revealed that, as predicted from the nucleotide sequence and previous reports, the fimF gene product was a protein of ca. 16 kDa and that the fimG gene product was a protein of ca. 14 kDa. Each of the constructions was introduced, via homologous recombination, into the E. coli chromosome. All three of the resulting mutants produced type 1 pili and exhibited hemagglutination of guinea pig erythrocytes. The latter property was also exhibited by partially purified pili isolated from each of the mutants. Electron microscopic examination revealed that the fimF mutant had markedly reduced numbers of pili per cell, whereas the fimG mutant had very long pili. The double mutant displayed the characteristics of both single mutants. However, pili in the double mutant were even longer than those seen in the fimG mutant, and the numbers of pili were even fewer than those displayed by the fimF mutant. All three mutants could be complemented in trans with a single-copy-number plasmid bearing the appropriate parental gene or genes to give near-normal parental piliation. On the basis of the phenotypes exhibited by the single and double mutants, we believe that the fimF gene product may aid in initiating pilus assembly and that the fimG product may act as an inhibitor of pilus polymerization. In contrast to previous studies, we found that neither gene product was required for type 1 pilus receptor binding. Images PMID:1355769

Molecular basis of usher pore gating in Escherichia coli pilus biogenesis.

PubMed

Volkan, Ender; Kalas, Vasilios; Pinkner, Jerome S; Dodson, Karen W; Henderson, Nadine S; Pham, Thieng; Waksman, Gabriel; Delcour, Anne H; Thanassi, David G; Hultgren, Scott J

2013-12-17

Extracellular fibers called chaperone-usher pathway pili are critical virulence factors in a wide range of Gram-negative pathogenic bacteria that facilitate binding and invasion into host tissues and mediate biofilm formation. Chaperone-usher pathway ushers, which catalyze pilus assembly, contain five functional domains: a 24-stranded transmembrane β-barrel translocation domain (TD), a β-sandwich plug domain (PLUG), an N-terminal periplasmic domain, and two C-terminal periplasmic domains (CTD1 and 2). Pore gating occurs by a mechanism whereby the PLUG resides stably within the TD pore when the usher is inactive and then upon activation is translocated into the periplasmic space, where it functions in pilus assembly. Using antibiotic sensitivity and electrophysiology experiments, a single salt bridge was shown to function in maintaining the PLUG in the TD channel of the P pilus usher PapC, and a loop between the 12th and 13th beta strands of the TD (β12-13 loop) was found to facilitate pore opening. Mutation of the β12-13 loop resulted in a closed PapC pore, which was unable to efficiently mediate pilus assembly. Deletion of the PapH terminator/anchor resulted in increased OM permeability, suggesting a role for the proper anchoring of pili in retaining OM integrity. Further, we introduced cysteine residues in the PLUG and N-terminal periplasmic domains that resulted in a FimD usher with a greater propensity to exist in an open conformation, resulting in increased OM permeability but no loss in type 1 pilus assembly. These studies provide insights into the molecular basis of usher pore gating and its roles in pilus biogenesis and OM permeability.

Organization and expression of genes responsible for type 1 piliation in Escherichia coli.

PubMed Central

Orndorff, P E; Falkow, S

1984-01-01

The genetic organization of a segment of recombinant DNA conferring the capacity of synthesize E. coli type 1 pili was examined. This 11.2-kilobase (kb) segment of DNA, derived from a clinical isolate, conferred a piliated phenotype (Pil+) on a nonpiliated (Pil-) strain of E. coli K-12 that lacked DNA homologous to the 11.2-kb region. Insertional mutagenesis, deletion mutagenesis, and subcloning of various regions of the 11.2-kb fragment allowed the localization of five genes, each encoding a polypeptide, that were associated with pilus expression. Three gene products, 17, 86, and 30 kilodaltons (kd) in size, were involved in pilus assembly; assembly of the 17-kd structural (pilin) protein into pili was not seen in mutants lacking either the 86- or 30-kd proteins, but pilin synthesis and proteolytic processing were not affected. The fourth polypeptide, 23 kd in size, appeared to be involved in the regulation of pilus expression because mutants lacking this protein exhibited a 40-fold increase in the amount of pilin antigen per cell. The last protein, 14 kd in size, was not associated with piliation by genetic criteria; however, the 14-kd protein was immunoprecipitated with pili, suggesting an association with pili or immunological cross-reactivity with pilin. Immunoprecipitates of minicell transcription translation products revealed that pilus polymerization was taking place in minicells. This may facilitate the study of the molecular steps in pilus biosynthesis and, as a consequence, provide clues to the assembly of supramolecular structures in general. Images PMID:6146599

Pilus hijacking by a bacterial coaggregation factor critical for oral biofilm development.

PubMed

Reardon-Robinson, Melissa E; Wu, Chenggang; Mishra, Arunima; Chang, Chungyu; Bier, Naomi; Das, Asis; Ton-That, Hung

2014-03-11

The formation of dental plaque, a highly complex biofilm that causes gingivitis and periodontitis, requires specific adherence among many oral microbes, including the coaggregation of Actinomyces oris with Streptococcus oralis that helps to seed biofilm development. Here, we report the discovery of a key coaggregation factor for this process. This protein, which we named coaggregation factor A (CafA), is one of 14 cell surface proteins with the LPXTG motif predicted in A. oris MG1, whose function was hitherto unknown. By systematic mutagenesis of each of these genes and phenotypic characterization, we found that the Actinomyces/Streptococcus coaggregation is only abolished by deletion of cafA. Subsequent biochemical and cytological experiments revealed that CafA constitutes the tip of a unique form of the type 2 fimbria long known for its role in coaggregation. The direct and predominant role of CafA in adherence is evident from the fact that CafA or an antibody against CafA inhibits coaggregation, whereas the shaft protein FimA or a polyclonal antibody against FimA has no effect. Remarkably, FimA polymerization was blocked by deletion of genes for both CafA and FimB, the previously described tip protein of the type 2 fimbria. Together, these results indicate that some surface proteins not linked to a pilus gene cluster in Gram-positive bacteria may hijack the pilus. These unique tip proteins displayed on a common pilus shaft may serve distinct physiological functions. Furthermore, the pilus shaft assembly in Gram-positive bacteria may require a tip, as is true for certain Gram-negative bacterial pili.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balakrishna, A.M.; Saxena, A.; Mok, H. Y.-K.

The type IVb pilus of the enteropathogenic bacteria Salmonella typhi is a major adhesion factor during the entry of this pathogen into gastrointestinal epithelial cells. Its target of adhesion is a stretch of 10 residues from the first extracellular domain of cystic fibrosis transmembrane conductance regulator (CFTR). The crystal structure of the N-terminal 25 amino acid deleted S. typhi native PilS protein ({Delta}PilS), which makes the pilus, was determined at 1.9 {angstrom} resolution by the multiwavelength anomalous dispersion method. Also, the structure of the complex of {Delta}PilS and a target CFTR peptide, determined at 1.8 {angstrom}, confirms that residues 113-117more » (NKEER) of CFTR are involved in binding with the pilin protein and gives us insight on the amino acids that are essential for binding. Furthermore, we have also explored the role of a conserved disulfide bridge in pilus formation. The subunit structure and assembly architecture are crucial for understanding pilus functions and designing suitable therapeutics against typhoid.« less

Mitis group streptococci express variable pilus islet 2 pili.

PubMed

Zähner, Dorothea; Gandhi, Ashish R; Yi, Hong; Stephens, David S

2011-01-01

Streptococcus oralis, Streptococcus mitis, and Streptococcus sanguinis are members of the Mitis group of streptococci and agents of oral biofilm, dental plaque and infective endocarditis, disease processes that involve bacteria-bacteria and bacteria-host interactions. Their close relative, the human pathogen S. pneumoniae uses pilus-islet 2 (PI-2)-encoded pili to facilitate adhesion to eukaryotic cells. PI-2 pilus-encoding genetic islets were identified in S. oralis, S. mitis, and S. sanguinis, but were absent from other isolates of these species. The PI-2 islets resembled the genetic organization of the PI-2 islet of S. pneumoniae, but differed in the genes encoding the structural pilus proteins PitA and PitB. Two and three variants of pitA (a pseudogene in S. pneumoniae) and pitB, respectively, were identified that showed ≈20% difference in nucleotide as well as corresponding protein sequence. Species-independent combinations of pitA and pitB variants indicated prior intra- and interspecies horizontal gene transfer events. Polyclonal antisera developed against PitA and PitB of S. oralis type strain ATCC35037 revealed that PI-2 pili in oral streptococci were composed of PitA and PitB. Electronmicrographs showed pilus structures radiating >700 nm from the bacterial surface in the wild type strain, but not in an isogenic PI-2 deletion mutant. Anti-PitB-antiserum only reacted with pili containing the same PitB variant, whereas anti-PitA antiserum was cross-reactive with the other PitA variant. Electronic multilocus sequence analysis revealed that all PI-2-encoding oral streptococci were closely-related and cluster with non-PI-2-encoding S. oralis strains. This is the first identification of PI-2 pili in Mitis group oral streptococci. The findings provide a striking example of intra- and interspecies horizontal gene transfer. The PI-2 pilus diversity provides a possible key to link strain-specific bacterial interactions and/or tissue tropisms with pathogenic traits in the Mitis group streptococci.

Organization and PprB-dependent control of the Pseudomonas aeruginosa tad Locus, involved in Flp pilus biology.

PubMed

Bernard, Christophe S; Bordi, Christophe; Termine, Elise; Filloux, Alain; de Bentzmann, Sophie

2009-03-01

Bacterial attachment to the substratum involves several cell surface organelles, including various types of pili. The Pseudomonas aeruginosa Tad machine assembles type IVb pili, which are required for adhesion to abiotic surfaces and to eukaryotic cells. Type IVb pili consist of a major subunit, the Flp pilin, processed by the FppA prepilin peptidase. In this study, we investigated the regulatory mechanism of the tad locus. We showed that the flp gene is expressed late in the stationary growth phase in aerobic conditions. We also showed that the tad locus was composed of five independent transcriptional units. We used transcriptional fusions to show that tad gene expression was positively controlled by the PprB response regulator. We subsequently showed that PprB bound to the promoter regions, directly controlling the expression of these genes. We then evaluated the contribution of two genes, tadF and rcpC, to type IVb pilus assembly. The deletion of these two genes had no effect on Flp production, pilus assembly, or Flp-mediated adhesion to abiotic surfaces in our conditions. However, our results suggest that the putative RcpC protein modifies the Flp pilin, thereby promoting Flp-dependent adhesion to eukaryotic cells.

Molecular Characterization of Streptococcus agalactiae Isolated from Bovine Mastitis in Eastern China

PubMed Central

Yang, Yongchun; Liu, Yinglong; Ding, Yunlei; Yi, Li; Ma, Zhe; Fan, Hongjie; Lu, Chengping

2013-01-01

One hundred and two Streptococcus agalactiae (group B streptococcus [GBS]) isolates were collected from dairy cattle with subclinical mastitis in Eastern China during 2011. Clonal groups were established by multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE), respectively. Capsular polysaccharides (CPS), pilus and alpha-like-protein (Alp) family genes were also characterized by molecular techniques. MLST analysis revealed that these isolates were limited to three clonal groups and were clustered in six different lineages, i.e. ST (sequence type) 103, ST568, ST67, ST301, ST313 and ST570, of which ST568 and ST570 were new genotypes. PFGE analysis revealed this isolates were clustered in 27 PFGE types, of which, types 7, 8, 14, 15, 16, 18, 23 and 25 were the eight major types, comprising close to 70% (71/102) of all the isolates. The most prevalent sequence types were ST103 (58% isolates) and ST568 (31% isolates), comprising capsular genotype Ia isolates without any of the detected Alp genes, suggesting the appearance of novel genomic backgrounds of prevalent strains of bovine S. agalactiae. All the strains possessed the pilus island 2b (PI-2b) gene and the prevalent capsular genotypes were types Ia (89% isolates) and II (11% isolates), the conserved pilus type providing suitable data for the development of vaccines against mastitis caused by S. agalactiae. PMID:23874442

Cloning-independent markerless gene editing in Streptococcus sanguinis: novel insights in type IV pilus biology.

PubMed

Gurung, Ishwori; Berry, Jamie-Lee; Hall, Alexander M J; Pelicic, Vladimir

2017-04-07

Streptococcus sanguinis, a naturally competent opportunistic human pathogen, is a Gram-positive workhorse for genomics. It has recently emerged as a model for the study of type IV pili (Tfp)-exceptionally widespread and important prokaryotic filaments. To enhance genetic manipulation of Streptococcus sanguinis, we have developed a cloning-independent methodology, which uses a counterselectable marker and allows sophisticated markerless gene editing in situ. We illustrate the utility of this methodology by answering several questions regarding Tfp biology by (i) deleting single or mutiple genes, (ii) altering specific bases in genes of interest, and (iii) engineering genes to encode proteins with appended affinity tags. We show that (i) the last six genes in the pil locus harbouring all the genes dedicated to Tfp biology play no role in piliation or Tfp-mediated motility, (ii) two highly conserved Asp residues are crucial for enzymatic activity of the prepilin peptidase PilD and (iii) that pilin subunits with a C-terminally appended hexa-histidine (6His) tag are still assembled into functional Tfp. The methodology for genetic manipulation we describe here should be broadly applicable. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cloning-independent markerless gene editing in Streptococcus sanguinis: novel insights in type IV pilus biology

PubMed Central

Gurung, Ishwori; Berry, Jamie-Lee; Hall, Alexander M. J.

2017-01-01

Abstract Streptococcus sanguinis, a naturally competent opportunistic human pathogen, is a Gram-positive workhorse for genomics. It has recently emerged as a model for the study of type IV pili (Tfp)—exceptionally widespread and important prokaryotic filaments. To enhance genetic manipulation of Streptococcus sanguinis, we have developed a cloning-independent methodology, which uses a counterselectable marker and allows sophisticated markerless gene editing in situ. We illustrate the utility of this methodology by answering several questions regarding Tfp biology by (i) deleting single or mutiple genes, (ii) altering specific bases in genes of interest, and (iii) engineering genes to encode proteins with appended affinity tags. We show that (i) the last six genes in the pil locus harbouring all the genes dedicated to Tfp biology play no role in piliation or Tfp-mediated motility, (ii) two highly conserved Asp residues are crucial for enzymatic activity of the prepilin peptidase PilD and (iii) that pilin subunits with a C-terminally appended hexa-histidine (6His) tag are still assembled into functional Tfp. The methodology for genetic manipulation we describe here should be broadly applicable. PMID:27903891

The role of an alternative sigma factor in motility and pilus formation in the cyanobacterium Synechocystis sp. strain PCC6803

PubMed Central

Bhaya, Devaki; Watanabe, Natsu; Ogawa, Teruo; Grossman, Arthur R.

1999-01-01

Disruption of a gene for an alternative sigma factor, designated sigF, in the freshwater, unicellular cyanobacterium Synechocystis sp. strain PCC6803 resulted in a pleiotropic phenotype. Most notably, this mutant lost phototactic movement with a concomitant loss of pili, which are abundant on the surface of wild-type cells. The sigF mutant also secreted both high levels of yellow–brown and UV-absorbing pigments and a polypeptide that is similar to a large family of extracellular proteins that includes the hemolysins. Furthermore, the sigF mutant had a dramatically reduced level of the transcript from two tandemly arranged pilA genes (sll1694 and sll1695), which encode major structural components of type IV pili. Inactivation of these pilA genes eliminated phototactic movement, though some pili were still present in this strain. Together, these results demonstrate that SigF plays a critical role in motility via the control of pili formation and is also likely to regulate other features of the cell surface. Furthermore, the data provide evidence that type IV pili are required for phototactic movement in certain cyanobacteria and suggest that different populations of pili present on the Synechocystis cell surface may perform different functions. PMID:10077659

Structural Differences between the Streptococcus agalactiae Housekeeping and Pilus-Specific Sortases: SrtA and SrtC1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khare, B.; Krishnan, V.; Rajashankar, K.R.

2011-10-21

The assembly of pili on the cell wall of Gram-positive bacteria requires transpeptidase enzymes called sortases. In Streptococcus agalactiae, the PI-1 pilus island of strain 2603V/R encodes two pilus-specific sortases (SrtC1 and SrtC2) and three pilins (GBS80, GBS52 and GBS104). Although either pilus-specific sortase is sufficient for the polymerization of the major pilin, GBS80, incorporation of the minor pilins GBS52 and GBS104 into the pilus structure requires SrtC1 and SrtC2, respectively. The S. agalactiae housekeeping sortase, SrtA, whose gene is present at a different location and does not catalyze pilus polymerization, was shown to be involved in cell wall anchoringmore » of pilus polymers. To understand the structural basis of sortases involved in such diverse functions, we determined the crystal structures of S. agalactiae SrtC1 and SrtA. Both enzymes are made of an eight-stranded beta-barrel core with variations in their active site architecture. SrtA exhibits a catalytic triad arrangement similar to that in Streptococcus pyogenes SrtA but different from that in Staphylococcus aureus SrtA. In contrast, the SrtC1 enzyme contains an N-terminal helical domain and a 'lid' in its putative active site, which is similar to that seen in Streptococcus pneumoniae pilus-specific sortases, although with subtle differences in positioning and composition. To understand the effect of such differences on substrate recognition, we have also determined the crystal structure of a SrtC1 mutant, in which the conserved DP(W/F/Y) motif was replaced with the sorting signal motif of GBS80, IPNTG. By comparing the structures of WT wild type SrtA and SrtC1 and the 'lid' mutant of SrtC1, we propose that structural elements within the active site and the lid may be important for defining the role of specific sortase in pili biogenesis.« less

Draft genome sequence for virulent and avirulent strains of Xanthomonas arboricola isolated from Prunus spp. in Spain.

PubMed

Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M; Cubero, Jaime

2016-01-01

Xanthomonas arboricola is a species in genus Xanthomonas which is mainly comprised of plant pathogens. Among the members of this taxon, X. arboricola pv. pruni, the causal agent of bacterial spot disease of stone fruits and almond, is distributed worldwide although it is considered a quarantine pathogen in the European Union. Herein, we report the draft genome sequence, the classification, the annotation and the sequence analyses of a virulent strain, IVIA 2626.1, and an avirulent strain, CITA 44, of X. arboricola associated with Prunus spp. The draft genome sequence of IVIA 2626.1 consists of 5,027,671 bp, 4,720 protein coding genes and 50 RNA encoding genes. The draft genome sequence of strain CITA 44 consists of 4,760,482 bp, 4,250 protein coding genes and 56 RNA coding genes. Initial comparative analyses reveals differences in the presence of structural and regulatory components of the type IV pilus, the type III secretion system, the type III effectors as well as variations in the number of the type IV secretion systems. The genome sequence data for these strains will facilitate the development of molecular diagnostics protocols that differentiate virulent and avirulent strains. In addition, comparative genome analysis will provide insights into the plant-pathogen interaction during the bacterial spot disease process.

Evaluation of humoral and cell-mediated inducible immunity to Haemophilus ducreyi in an animal model of chancroid.

PubMed Central

Desjardins, M; Filion, L G; Robertson, S; Kobylinski, L; Cameron, D W

1996-01-01

To study the mechanisms of inducible immunity to Haemophilus ducreyi infection in the temperature-dependent rabbit model of chancroid, we conducted passive immunization experiments and characterized the inflammatory infiltrate of chancroidal lesions. Polyclonal immunoglobulin G was purified from immune sera raised against H. ducreyi 35000 whole-cell lysate or a pilus preparation and from naive control rabbits. Rabbits were passively immunized with 24 or 48 mg of purified polyclonal immunoglobulin G intravenously, followed 24 h after infusion by homologous titered infectious challenge. Despite titratable antibody, no significant difference in infection or disease was observed. We then evaluated the immunohistology of lesions produced by homologous-strain challenge in sham-immunized rabbits and those protectively vaccinated by pilus preparation immunization. Immunohistochemical stains for CD5 and CD4 T-lymphocyte markers were performed on lesion sections 4, 10, 15, and 21 days from infection. Lesions of pilus preparation vaccinees compared with those of controls had earlier infiltration with significantly more T lymphocytes (CD5+) and with a greater proportion of CD4+ T lymphocytes at day 4 (33% +/- 55% versus 9.7% +/- 2%; P = 0.002), corroborating earlier sterilization (5.0 +/- 2 versus 13.7 +/- 0.71 days; P < 0.001) and lesion resolution. Intraepithelial challenge of pilus-vaccinated rabbits with 100 micrograms of the pilus preparation alone produced indurated lesions within 48 h with lymphoid and plasmacytoid infiltration, edema, and extravasation of erythrocytes. We conclude that passive immunization may not confer a vaccine effect in this model and that active vaccination with a pilus preparation induces a delayed-type hypersensitivity skin test response and confers protection through cell-mediated immunity seen as an amplified lymphocytic infiltrate and accelerated maturation of the T-lymphocyte response. PMID:8613391

Structure of the Pseudomonas aeruginosa Type IVa Pilus Secretin at 7.4 Å.

PubMed

Koo, Jason; Lamers, Ryan P; Rubinstein, John L; Burrows, Lori L; Howell, P Lynne

2016-10-04

Type IVa pili (T4aP) function as bacterial virulence factors. T4aP pass through the outer membranes of Gram-negative bacteria via homo-oligomeric secretins. We present a 7.4 Å cryoelectron microscopy structure of the Pseudomonas aeruginosa PilQ secretin. Peripheral and internal features show that the secretin is composed of 14 subunits with C7 symmetry. The channel is a ribbed cylinder with central peripheral spokes and a central gate closed on the periplasmic side. The structure suggests that during pilus extrusion, the central gate is displaced to the interior walls and that no additional conformational changes are required, as the internal diameter can accommodate the pilus. The N1 domain was resolved, while the N0 and the N-terminal β-domains proposed to bind peptidoglycan were absent in class average images and the final 3D map, indicating a high flexibility. These data provide the highest-resolution structure to date of a T4aP secretin. Copyright © 2016 Elsevier Ltd. All rights reserved.

Assembly mechanism of FCT region type 1 pili in serotype M6 Streptococcus pyogenes.

PubMed

Nakata, Masanobu; Kimura, Keiji Richard; Sumitomo, Tomoko; Wada, Satoshi; Sugauchi, Akinari; Oiki, Eiji; Higashino, Miharu; Kreikemeyer, Bernd; Podbielski, Andreas; Okahashi, Nobuo; Hamada, Shigeyuki; Isoda, Ryutaro; Terao, Yutaka; Kawabata, Shigetada

2011-10-28

The human pathogen Streptococcus pyogenes produces diverse pili depending on the serotype. We investigated the assembly mechanism of FCT type 1 pili in a serotype M6 strain. The pili were found to be assembled from two precursor proteins, the backbone protein T6 and ancillary protein FctX, and anchored to the cell wall in a manner that requires both a housekeeping sortase enzyme (SrtA) and pilus-associated sortase enzyme (SrtB). SrtB is primarily required for efficient formation of the T6 and FctX complex and subsequent polymerization of T6, whereas proper anchoring of the pili to the cell wall is mainly mediated by SrtA. Because motifs essential for polymerization of pilus backbone proteins in other Gram-positive bacteria are not present in T6, we sought to identify the functional residues involved in this process. Our results showed that T6 encompasses the novel VAKS pilin motif conserved in streptococcal T6 homologues and that the lysine residue (Lys-175) within the motif and cell wall sorting signal of T6 are prerequisites for isopeptide linkage of T6 molecules. Because Lys-175 and the cell wall sorting signal of FctX are indispensable for substantial incorporation of FctX into the T6 pilus shaft, FctX is suggested to be located at the pilus tip, which was also implied by immunogold electron microscopy findings. Thus, the elaborate assembly of FCT type 1 pili is potentially organized by sortase-mediated cross-linking between sorting signals and the amino group of Lys-175 positioned in the VAKS motif of T6, thereby displaying T6 and FctX in a temporospatial manner.

Clonal success of piliated penicillin nonsusceptible pneumococci

PubMed Central

Sjöström, K.; Blomberg, C.; Fernebro, J.; Dagerhamn, J.; Morfeldt, E.; Barocchi, M. A.; Browall, S.; Moschioni, M.; Andersson, M.; Henriques, F.; Albiger, B.; Rappuoli, Rino; Normark, S.; Henriques-Normark, B.

2007-01-01

Antibiotic resistance in pneumococci is due to the spread of strains belonging to a limited number of clones. The Spain9V-3 clone of sequence type (ST)156 is one of the most successful clones with reduced susceptibility to penicillin [pneumococci nonsusceptible to penicillin (PNSP)]. In Sweden during 2000–2003, a dramatic increase in the number of PNSP isolates was observed. Molecular characterization of these isolates showed that a single clone of sequence type ST156 increased from 40% to 80% of all serotype 14, thus causing the serotype expansion. Additionally, during the same time period, we examined the clonal composition of two serotypes 9V and 19F: all 9V and 20% of 19F isolates belonged to the clonal cluster of ST156, and overall ≈50% of all PNSP belonged to the ST156 clonal cluster. Moreover, microarray and PCR analysis showed that all ST156 isolates, irrespective of capsular type, carried the rlrA pilus islet. This islet was also found to be present in the penicillin-sensitive ST162 clone, which is believed to be the drug-susceptible ancestor of ST156. Competitive experiments between related ST156 serotype 19F strains confirmed that those containing the rlrA pilus islet were more successful in an animal model of carriage. We conclude that the pilus island is an important biological factor common to ST156 isolates and other successful PNSP clones. In Sweden, a country where the low antibiotic usage does not explain the spread of resistant strains, at least 70% of all PNSP isolates collected during year 2003 carried the pilus islet. PMID:17644611

Genetic Identification of a PilT Motor in Geobacter sulfurreducens Reveals a Role for Pilus Retraction in Extracellular Electron Transfer

PubMed Central

Speers, Allison M.; Schindler, Bryan D.; Hwang, Jihwan; Genc, Aycin; Reguera, Gemma

2016-01-01

The metal-reducing bacterium Geobacter sulfurreducens requires the expression of conductive pili to reduce iron oxides and to wire electroactive biofilms, but the role of pilus retraction in these functions has remained elusive. Here we show that of the four PilT proteins encoded in the genome of G. sulfurreducens, PilT3 powered pilus retraction in planktonic cells of a PilT-deficient strain of P. aeruginosa and restored the dense mutant biofilms to wild-type levels. Furthermore, PilT3 and PilT4 rescued the twitching motility defect of the PilT-deficient mutant. However, PilT4 was the only paralog whose inactivation in G. sulfurreducens lead to phenotypes associated with the hyperpiliation of non-retractile mutants such as enhanced adhesion and biofilm-forming abilities. In addition, PilT4 was required to reduce iron oxides. Taken together, the results indicate that PilT4 is the motor ATPase of G. sulfurreducens pili and reveal a previously unrecognized role for pilus retraction in extracellular electron transfer, a strategy that confers on Geobacter spp. an adaptive advantage for metal reduction in the natural environment. PMID:27799920

A Tad pilus promotes the establishment and resistance of Vibrio vulnificus biofilms to mechanical clearance.

PubMed

Pu, Meng; Rowe-Magnus, Dean Allistair

2018-01-01

Vibrio vulnificus is autochthonous to estuaries and warm coastal waters. Infection occurs via open wounds or ingestion, where its asymptomatic colonization of seafood, most infamously oysters, provides a gateway into the human food chain. Colonization begins with initial surface contact, which is often mediated by bacterial surface appendages called pili. Type IV Tad pili are widely distributed in the Vibrionaceae, but evidence for a physiological role for these structures is scant. The V. vulnificus genome codes for three distinct tad loci. Recently, a positive correlation was demonstrated between the expression of tad-3 and the phenotypes of a V. vulnificus descendent (NT) that exhibited increased biofilm formation, auto-aggregation, and oyster colonization relative to its parent. However, the mechanism by which tad pilus expression promoted these phenotypes was not determined. Here, we show that deletion of the tad pilin gene ( flp ) altered the near-surface motility profile of NT cells from high curvature, orbital retracing patterns characteristic of cells actively probing the surface to low curvature traces indicative of wandering and diminished bacteria-surface interactions. The NT flp pilin mutant also exhibited decreased initial surface attachment, attenuated auto-aggregation and formed fragile biofilms that disintegrated under hydrodynamic flow. Thus, the tad-3 locus, designated iam , promoted i nitial surface attachment, a uto-aggregation and resistance to m echanical clearance of V. vulnificus biofilms. The prevalence of tad loci in the Vibrionaceae suggests that they may play equally important roles in other family members.

The pilus usher controls protein interactions via domain masking and is functional as an oligomer.

PubMed

Werneburg, Glenn T; Henderson, Nadine S; Portnoy, Erica B; Sarowar, Samema; Hultgren, Scott J; Li, Huilin; Thanassi, David G

2015-07-01

The chaperone-usher (CU) pathway assembles organelles termed pili or fimbriae in Gram-negative bacteria. Type 1 pili expressed by uropathogenic Escherichia coli are prototypical structures assembled by the CU pathway. Biogenesis of pili by the CU pathway requires a periplasmic chaperone and an outer-membrane protein termed the usher (FimD). We show that the FimD C-terminal domains provide the high-affinity substrate-binding site but that these domains are masked in the resting usher. Domain masking requires the FimD plug domain, which serves as a switch controlling usher activation. We demonstrate that usher molecules can act in trans for pilus biogenesis, providing conclusive evidence for a functional usher oligomer. These results reveal mechanisms by which molecular machines such as the usher regulate and harness protein-protein interactions and suggest that ushers may interact in a cooperative manner during pilus assembly in bacteria.

The Pilus Usher Controls Protein Interactions via Domain Masking and is Functional as an Oligomer

PubMed Central

Werneburg, Glenn T.; Henderson, Nadine S.; Portnoy, Erica B.; Sarowar, Samema; Hultgren, Scott J.; Li, Huilin; Thanassi, David G.

2015-01-01

The chaperone-usher (CU) pathway assembles organelles termed pili or fimbriae in Gram-negative bacteria. Type 1 pili expressed by uropathogenic Escherichia coli are prototypical structures assembled by the CU pathway. Biogenesis of pili by the CU pathway requires a periplasmic chaperone and an outer membrane protein termed the usher (FimD). We show that the FimD C-terminal domains provide the high-affinity substrate binding site, but that these domains are masked in the resting usher. Domain masking requires the FimD plug domain, which serves as a switch controlling usher activation. We demonstrate that usher molecules can act in trans for pilus biogenesis, providing conclusive evidence for a functional usher oligomer. These results reveal mechanisms by which molecular machines such as the usher regulate and harness protein-protein interactions, and suggest that ushers may interact in a cooperative manner during pilus assembly in bacteria. PMID:26052892

P. aeruginosa PilT Structures with and without Nucleotide Reveal a Dynamic Type IV Pilus Retraction Motor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Misic, Ana M.; Satyshur, Kenneth A.; Forest, Katrina T.

Type IV pili are bacterial extracellular filaments that can be retracted to create force and motility. Retraction is accomplished by the motor protein PilT. Crystal structures of Pseudomonas aeruginosa PilT with and without bound {beta},{gamma}-methyleneadenosine-5{prime}-triphosphate have been solved at 2.6 {angstrom} and 3.1 {angstrom} resolution, respectively, revealing an interlocking hexamer formed by the action of a crystallographic 2-fold symmetry operator on three subunits in the asymmetric unit and held together by extensive ionic interactions. The roles of two invariant carboxylates, Asp Box motif Glu163 and Walker B motif Glu204, have been assigned to Mg{sup 2+} binding and catalysis, respectively. Themore » nucleotide ligands in each of the subunits in the asymmetric unit of the {beta},{gamma}-methyleneadenosine-5{prime}-triphosphate-bound PilT are not equally well ordered. Similarly, the three subunits in the asymmetric unit of both structures exhibit differing relative conformations of the two domains. The 12{sup o} and 20{sup o} domain rotations indicate motions that occur during the ATP-coupled mechanism of the disassembly of pili into membrane-localized pilin monomers. Integrating these observations, we propose a three-state 'Ready, Active, Release' model for the action of PilT.« less

Outside-in assembly pathway of the type IV pilus system in Myxococcus xanthus.

PubMed

Friedrich, Carmen; Bulyha, Iryna; Søgaard-Andersen, Lotte

2014-01-01

Type IV pili (T4P) are ubiquitous bacterial cell surface structures that undergo cycles of extension, adhesion, and retraction. T4P function depends on a highly conserved envelope-spanning macromolecular machinery consisting of 10 proteins that localizes polarly in Myxococcus xanthus. Using this localization, we investigated the entire T4P machinery assembly pathway by systematically profiling the stability of all and the localization of eight of these proteins in the absence of other T4P machinery proteins as well as by mapping direct protein-protein interactions. Our experiments uncovered a sequential, outside-in pathway starting with the outer membrane (OM) PilQ secretin ring. PilQ recruits a subcomplex consisting of the inner membrane (IM) lipoprotein PilP and the integral IM proteins PilN and PilO by direct interaction with the periplasmic domain of PilP. The PilP/PilN/PilO subcomplex recruits the cytoplasmic PilM protein, by direct interaction between PilN and PilM, and the integral IM protein PilC. The PilB/PilT ATPases that power extension/retraction localize independently of other T4P machinery proteins. Thus, assembly of the T4P machinery initiates with formation of the OM secretin ring and continues inwards over the periplasm and IM to the cytoplasm.

Multiple roles of Pseudomonas aeruginosa TBCF10839 PilY1 in motility, transport and infection

PubMed Central

Bohn, Yu-Sing Tammy; Brandes, Gudrun; Rakhimova, Elza; Horatzek, Sonja; Salunkhe, Prabhakar; Munder, Antje; van Barneveld, Andrea; Jordan, Doris; Bredenbruch, Florian; Häußler, Susanne; Riedel, Kathrin; Eberl, Leo; Jensen, Peter Østrup; Bjarnsholt, Thomas; Moser, Claus; Hoiby, Niels; Tümmler, Burkhard; Wiehlmann, Lutz

2008-01-01

Polymorphonuclear neutrophils are the most important mammalian host defence cells against infections with Pseudomonas aeruginosa. Screening of a signature tagged mutagenesis library of the non-piliated P. aeruginosa strain TBCF10839 uncovered that transposon inactivation of its pilY1 gene rendered the bacterium more resistant against killing by neutrophils than the wild type and any other of the more than 3000 tested mutants. Inactivation of pilY1 led to the loss of twitching motility in twitching-proficient wild-type PA14 and PAO1 strains, predisposed to autolysis and impaired the secretion of quinolones and pyocyanin, but on the other hand promoted growth in stationary phase and bacterial survival in murine airway infection models. The PilY1 population consisted of a major full-length and a minor shorter PilY1* isoform. PilY1* was detectable in small extracellular quinolone-positive aggregates, but not in the pilus. P. aeruginosa PilY1 is not an adhesin on the pilus tip, but assists in pilus biogenesis, twitching motility, secretion of secondary metabolites and in the control of cell density in the bacterial population. PMID:19054330

Ramifications of kinetic partitioning on usher-mediated pilus biogenesis.

PubMed Central

Saulino, E T; Thanassi, D G; Pinkner, J S; Hultgren, S J

1998-01-01

The biogenesis of diverse adhesive structures in a variety of Gram-negative bacterial species is dependent on the chaperone/usher pathway. Very little is known about how the usher protein translocates protein subunits across the outer membrane or how assembly of these adhesive structures occurs. We have discovered several mechanisms by which the usher protein acts to regulate the ordered assembly of type 1 pili, specifically through critical interactions of the chaperone-adhesin complex with the usher. A study of association and dissociation events of chaperone-subunit complexes with the usher in real time using surface plasmon resonance revealed that the chaperone-adhesin complex has the tightest and fastest association with the usher. This suggests that kinetic partitioning of chaperone-adhesin complexes to the usher is a defining factor in tip localization of the adhesin in the pilus. Furthermore, we identified and purified a chaperone-adhesin-usher assembly intermediate that was formed in vivo. Trypsin digestion assays showed that the usher in this complex was in an altered conformation, which was maintained during pilus assembly. The data support a model in which binding of the chaperone-adhesin complex to the usher stabilizes the usher in an assembly-competent conformation and allows initiation of pilus assembly. PMID:9545231

Role and Regulation of the Flp/Tad Pilus in the Virulence of Pectobacterium atrosepticum SCRI1043 and Pectobacterium wasabiae SCC3193

PubMed Central

Nykyri, Johanna; Mattinen, Laura; Niemi, Outi; Adhikari, Satish; Kõiv, Viia; Somervuo, Panu; Fang, Xin; Auvinen, Petri; Mäe, Andres; Palva, E. Tapio; Pirhonen, Minna

2013-01-01

In this study, we characterized a putative Flp/Tad pilus-encoding gene cluster, and we examined its regulation at the transcriptional level and its role in the virulence of potato pathogenic enterobacteria of the genus Pectobacterium. The Flp/Tad pilus-encoding gene clusters in Pectobacterium atrosepticum, Pectobacterium wasabiae and Pectobacterium aroidearum were compared to previously characterized flp/tad gene clusters, including that of the well-studied Flp/Tad pilus model organism Aggregatibacter actinomycetemcomitans, in which this pilus is a major virulence determinant. Comparative analyses revealed substantial protein sequence similarity and open reading frame synteny between the previously characterized flp/tad gene clusters and the cluster in Pectobacterium, suggesting that the predicted flp/tad gene cluster in Pectobacterium encodes a Flp/Tad pilus-like structure. We detected genes for a novel two-component system adjacent to the flp/tad gene cluster in Pectobacterium, and mutant analysis demonstrated that this system has a positive effect on the transcription of selected Flp/Tad pilus biogenesis genes, suggesting that this response regulator regulate the flp/tad gene cluster. Mutagenesis of either the predicted regulator gene or selected Flp/Tad pilus biogenesis genes had a significant impact on the maceration ability of the bacterial strains in potato tubers, indicating that the Flp/Tad pilus-encoding gene cluster represents a novel virulence determinant in Pectobacterium. Soft-rot enterobacteria in the genera Pectobacterium and Dickeya are of great agricultural importance, and an investigation of the virulence of these pathogens could facilitate improvements in agricultural practices, thus benefiting farmers, the potato industry and consumers. PMID:24040039

Role and regulation of the Flp/Tad pilus in the virulence of Pectobacterium atrosepticum SCRI1043 and Pectobacterium wasabiae SCC3193.

PubMed

Nykyri, Johanna; Mattinen, Laura; Niemi, Outi; Adhikari, Satish; Kõiv, Viia; Somervuo, Panu; Fang, Xin; Auvinen, Petri; Mäe, Andres; Palva, E Tapio; Pirhonen, Minna

2013-01-01

In this study, we characterized a putative Flp/Tad pilus-encoding gene cluster, and we examined its regulation at the transcriptional level and its role in the virulence of potato pathogenic enterobacteria of the genus Pectobacterium. The Flp/Tad pilus-encoding gene clusters in Pectobacterium atrosepticum, Pectobacterium wasabiae and Pectobacterium aroidearum were compared to previously characterized flp/tad gene clusters, including that of the well-studied Flp/Tad pilus model organism Aggregatibacter actinomycetemcomitans, in which this pilus is a major virulence determinant. Comparative analyses revealed substantial protein sequence similarity and open reading frame synteny between the previously characterized flp/tad gene clusters and the cluster in Pectobacterium, suggesting that the predicted flp/tad gene cluster in Pectobacterium encodes a Flp/Tad pilus-like structure. We detected genes for a novel two-component system adjacent to the flp/tad gene cluster in Pectobacterium, and mutant analysis demonstrated that this system has a positive effect on the transcription of selected Flp/Tad pilus biogenesis genes, suggesting that this response regulator regulate the flp/tad gene cluster. Mutagenesis of either the predicted regulator gene or selected Flp/Tad pilus biogenesis genes had a significant impact on the maceration ability of the bacterial strains in potato tubers, indicating that the Flp/Tad pilus-encoding gene cluster represents a novel virulence determinant in Pectobacterium. Soft-rot enterobacteria in the genera Pectobacterium and Dickeya are of great agricultural importance, and an investigation of the virulence of these pathogens could facilitate improvements in agricultural practices, thus benefiting farmers, the potato industry and consumers.

The pilus usher controls protein interactions via domain masking and is functional as an oligomer

DOE PAGES

Werneburg, Glenn T.; Li, Huilin; Henderson, Nadine S.; ...

2015-06-08

The chaperone/usher (CU) pathway is responsible for biogenesis of organelles termed pili or fimbriae in Gram-negative bacteria. Type 1 pili expressed by uropathogenic Escherichia coli are prototypical structures assembled by the CU pathway. Assembly and secretion of pili by the CU pathway requires a dedicated periplasmic chaperone and a multidomain outer membrane protein termed the usher (FimD). We show that the FimD C-terminal domains provide the high-affinity substrate binding site, but that these domains are masked in the resting usher. Domain masking requires the FimD plug domain, which served as a central switch controlling usher activation. In addition, we demonstratemore » that usher molecules can act in trans for pilus biogenesis, providing conclusive evidence for a functional usher oligomer. These results reveal mechanisms by which molecular machines such as the usher regulate and harness protein-protein interactions, and suggest that ushers may interact in a cooperative manner during pilus assembly in bacteria.« less

Group A Streptococcus produce pilus-like structures containing protective antigens and Lancefield T antigens.

PubMed

Mora, Marirosa; Bensi, Giuliano; Capo, Sabrina; Falugi, Fabiana; Zingaretti, Chiara; Manetti, Andrea G O; Maggi, Tiziana; Taddei, Anna Rita; Grandi, Guido; Telford, John L

2005-10-25

Although pili have long been recognized in Gram-negative pathogens as important virulence factors involved in adhesion and invasion, very little is known about extended surface organelles in Gram-positive pathogens. Here we report that Group A Streptococcus (GAS), a Gram-positive human-specific pathogen that causes pharyngitis, impetigo, invasive disease, necrotizing fasciitis, and autoimmune sequelae has long, surface-exposed, pilus-like structures composed of members of a family of extracellular matrix-binding proteins. We describe four variant pili and show that each is recognized by a specific serum of the Lancefield T-typing system, which has been used for over five decades to characterize GAS isolates. Furthermore, we show that immunization of mice with a combination of recombinant pilus proteins confers protection against mucosal challenge with virulent GAS bacteria. The data indicate that induction of a protective immune response against these structures may be a useful strategy for development of a vaccine against disease caused by GAS infection.

Linkage of T3 and Cpa pilins in the Streptococcus pyogenes M3 pilus.

PubMed

Quigley, Bernard R; Zähner, Dorothea; Hatkoff, Matthew; Thanassi, David G; Scott, June R

2009-06-01

The important human pathogen Streptococcus pyogenes (group A streptococcus, GAS) initiates infection by pilus-mediated attachment to host tissue. Thus, the pilus is an excellent target for design of anti-infective strategies. The T3 pilus of GAS is composed of multiple covalently linked subunits of the T3 protein to which the two minor pilins, Cpa and OrfB, are covalently attached. Because the proteins of GAS pili do not contain either of the motifs required for pilus polymerization in other Gram-positive bacteria, we investigated the residues involved in their linkage. We show that linkage of Cpa to T3 by the sortase family transpeptidase SrtC2 requires the VPPTG motif in the cell wall-sorting signal of Cpa. We also demonstrate that K173 of T3 is required both for T3 polymerization and for attachment of Cpa to T3. Therefore, attachment of Cpa to K173 of a T3 subunit would block further addition of T3 subunits to this end of the growing pilus. This implies that Cpa is located exclusively at the pilus tip, a location supported by immunogold electron microscopy, and suggests that, as for well-studied pili on Gram-negative bacteria, the role of the pilus is to present the adhesin external to the bacterial capsule.

Structural Basis for Metallic-Like Conductivity in Microbial Nanowires

DOE PAGES

Malvankar, Nikhil S.; Vargas, Madeline; Nevin, Kelly; ...

2015-03-03

Direct measurement of multiple physical properties of Geobacter sulfurreducens pili have demonstrated that they possess metallic-like conductivity, but several studies have suggested that metallic-like conductivity is unlikely based on the structures of the G. sulfurreducens pilus predicted from homology models. In order to further evaluate this discrepancy, pili were examined with synchrotron X-ray microdiffraction and rocking-curve X-ray diffraction. Both techniques revealed a periodic 3.2-Å spacing in conductive, wild-type G. sulfurreducens pili that was missing in the nonconductive pili of strain Aro5, which lack key aromatic acids required for conductivity. The intensity of the 3.2-Å peak increased 100-fold when the pHmore » was shifted from 10.5 to 2, corresponding with a previously reported 100-fold increase in pilus conductivity with this pH change. These results suggest a clear structure-function correlation for metallic-like conductivity that can be attributed to overlapping π-orbitals of aromatic amino acids. A homology model of the G. sulfurreducens pilus was constructed with a Pseudomonas aeruginosa pilus model as a template as an alternative to previous models, which were based on a Neisseria gonorrhoeae pilus structure. This alternative model predicted that aromatic amino acids in G. sulfurreducens pili are packed within 3 to 4 Å, consistent with the experimental results. Thus, the predictions of homology modeling are highly sensitive to assumptions inherent in the model construction. Finally, the experimental results reported here further support the concept that the pili of G. sulfurreducens represent a novel class of electronically functional proteins in which aromatic amino acids promote long-distance electron transport.« less

A slow-forming isopeptide bond in the structure of the major pilin SpaD from Corynebacterium diphtheriae has implications for pilus assembly

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang, Hae Joo; Paterson, Neil G.; Kim, Chae Un

2014-05-01

Two crystal structures of the major pilin SpaD from C. diphtheriae have been determined at 1.87 and 2.5 Å resolution. The N-terminal domain is found to contain an isopeptide bond that forms slowly over time in the recombinant protein. Given its structural context, this provides insight into the relationship between internal isopeptide-bond formation and pilus assembly. The Gram-positive organism Corynebacterium diphtheriae, the cause of diphtheria in humans, expresses pili on its surface which it uses for adhesion and colonization of its host. These pili are covalent protein polymers composed of three types of pilin subunit that are assembled by specificmore » sortase enzymes. A structural analysis of the major pilin SpaD, which forms the polymeric backbone of one of the three types of pilus expressed by C. diphtheriae, is reported. Mass-spectral and crystallographic analysis shows that SpaD contains three internal Lys–Asn isopeptide bonds. One of these, shown by mass spectrometry to be located in the N-terminal D1 domain of the protein, only forms slowly, implying an energy barrier to bond formation. Two crystal structures, of the full-length three-domain protein at 2.5 Å resolution and of a two-domain (D2-D3) construct at 1.87 Å resolution, show that each of the three Ig-like domains contains a single Lys–Asn isopeptide-bond cross-link, assumed to give mechanical stability as in other such pili. Additional stabilizing features include a disulfide bond in the D3 domain and a calcium-binding loop in D2. The N-terminal D1 domain is more flexible than the others and, by analogy with other major pilins of this type, the slow formation of its isopeptide bond can be attributed to its location adjacent to the lysine used in sortase-mediated polymerization during pilus assembly.« less

Conjugative DNA Transfer Is Enhanced by Plasmid R1 Partitioning Proteins

PubMed Central

Gruber, Christian J.; Lang, Silvia; Rajendra, Vinod K. H.; Nuk, Monika; Raffl, Sandra; Schildbach, Joel F.; Zechner, Ellen L.

2016-01-01

Bacterial conjugation is a form of type IV secretion used to transport protein and DNA directly to recipient bacteria. The process is cell contact-dependent, yet the mechanisms enabling extracellular events to trigger plasmid transfer to begin inside the cell remain obscure. In this study of plasmid R1 we investigated the role of plasmid proteins in the initiation of gene transfer. We find that TraI, the central regulator of conjugative DNA processing, interacts physically, and functionally with the plasmid partitioning proteins ParM and ParR. These interactions stimulate TraI catalyzed relaxation of plasmid DNA in vivo and in vitro and increase ParM ATPase activity. ParM also binds the coupling protein TraD and VirB4-like channel ATPase TraC. Together, these protein-protein interactions probably act to co-localize the transfer components intracellularly and promote assembly of the conjugation machinery. Importantly these data also indicate that the continued association of ParM and ParR at the conjugative pore is necessary for plasmid transfer to start efficiently. Moreover, the conjugative pilus and underlying secretion machinery assembled in the absence of Par proteins mediate poor biofilm formation and are completely dysfunctional for pilus specific R17 bacteriophage uptake. Thus, functional integration of Par components at the interface of relaxosome, coupling protein, and channel ATPases appears important for an optimal conformation and effective activation of the transfer machinery. We conclude that low copy plasmid R1 has evolved an active segregation system that optimizes both its vertical and lateral modes of dissemination. PMID:27486582

Comparative Analysis of Type IV Pilin in Desulfuromonadales

PubMed Central

Shu, Chuanjun; Xiao, Ke; Yan, Qin; Sun, Xiao

2016-01-01

During anaerobic respiration, the bacteria Geobacter sulfurreducens can transfer electrons to extracellular electron accepters through its pilus. G. sulfurreducens pili have been reported to have metallic-like conductivity that is similar to doped organic semiconductors. To study the characteristics and origin of conductive pilin proteins found in the pilus structure, their genetic, structural, and phylogenetic properties were analyzed. The genetic relationships, and conserved structures and sequences that were obtained were used to predict the evolution of the pilins. Homologous genes that encode conductive pilin were found using PilFind and Cluster. Sequence characteristics and protein tertiary structures were analyzed with MAFFT and QUARK, respectively. The origin of conductive pilins was explored by building a phylogenetic tree. Truncation is a characteristic of conductive pilin. The structures of truncated pilins and their accompanying proteins were found to be similar to the N-terminal and C-terminal ends of full-length pilins respectively. The emergence of the truncated pilins can probably be ascribed to the evolutionary pressure of their extracellular electron transporting function. Genes encoding truncated pilins and proteins similar to the C-terminal of full-length pilins, which contain a group of consecutive anti-parallel beta-sheets, are adjacent in bacterial genomes. According to the genetic, structure, and phylogenetic analyses performed in this study, we inferred that the truncated pilins and their accompanying proteins probably evolved from full-length pilins by gene fission through duplication, degeneration, and separation. These findings provide new insights about the molecular mechanisms involved in long-range electron transport along the conductive pili of Geobacter species. PMID:28066394

Electron Transport Chain Is Biochemically Linked to Pilus Assembly Required for Polymicrobial Interactions and Biofilm Formation in the Gram-Positive Actinobacterium Actinomyces oris

PubMed Central

Sanchez, Belkys C.; Chang, Chungyu; Wu, Chenggang; Tran, Bryan

2017-01-01

ABSTRACT The Gram-positive actinobacteria Actinomyces spp. are key colonizers in the development of oral biofilms due to the inherent ability of Actinomyces to adhere to receptor polysaccharides on the surface of oral streptococci and host cells. This receptor-dependent bacterial interaction, or coaggregation, requires a unique sortase-catalyzed pilus consisting of the pilus shaft FimA and the coaggregation factor CafA forming the pilus tip. While the essential role of the sortase machine SrtC2 in pilus assembly, biofilm formation, and coaggregation has been established, little is known about trans-acting factors contributing to these processes. We report here a large-scale Tn5 transposon screen for mutants defective in Actinomyces oris coaggregation with Streptococcus oralis. We obtained 33 independent clones, 13 of which completely failed to aggregate with S. oralis, and the remainder of which exhibited a range of phenotypes from severely to weakly defective coaggregation. The former had Tn5 insertions in fimA, cafA, or srtC2, as expected; the latter were mapped to genes coding for uncharacterized proteins and various nuo genes encoding the NADH dehydrogenase subunits. Electron microscopy and biochemical analyses of mutants with nonpolar deletions of nuo genes and ubiE, a menaquinone C-methyltransferase-encoding gene downstream of the nuo locus, confirmed the pilus and coaggregation defects. Both nuoA and ubiE mutants were defective in oxidation of MdbA, the major oxidoreductase required for oxidative folding of pilus proteins. Furthermore, supplementation of the ubiE mutant with exogenous menaquinone-4 rescued the cell growth and pilus defects. Altogether, we propose that the A. oris electron transport chain is biochemically linked to pilus assembly via oxidative protein folding. PMID:28634238

Increased Pilus Production Conferred by a Naturally Occurring Mutation Alters Host-Pathogen Interaction in Favor of Carriage in Streptococcus pyogenes

PubMed Central

Olsen, Randall J.; Cantu, Concepcion; Pallister, Kyler B.; Guerra, Fermin E.; Voyich, Jovanka M.; Musser, James M.

2017-01-01

ABSTRACT Studies of the human pathogen group A Streptococcus (GAS) define the carrier phenotype to be an increased ability to adhere to and persist on epithelial surfaces and a decreased ability to cause disease. We tested the hypothesis that a single amino acid change (Arg135Gly) in a highly conserved sensor kinase (LiaS) of a poorly defined GAS regulatory system contributes to a carrier phenotype through increased pilus production. When introduced into an emm serotype-matched invasive strain, the carrier allele (the gene encoding the LiaS protein with an arginine-to-glycine change at position 135 [liaSR135G]) recapitulated a carrier phenotype defined by an increased ability to adhere to mucosal surfaces and a decreased ability to cause disease. Gene transcript analyses revealed that the liaS mutation significantly altered transcription of the genes encoding pilus in the presence of bacitracin. Elimination of pilus production in the isogenic carrier mutant decreased its ability to colonize the mouse nasopharynx and to adhere to and be internalized by cultured human epithelial cells and restored the virulence phenotype in a mouse model of necrotizing fasciitis. We also observed significantly reduced survival of the isogenic carrier mutant compared to that of the parental invasive strain after exposure to human neutrophils. Elimination of pilus in the isogenic carrier mutant increased the level of survival after exposure to human neutrophils to that for the parental invasive strain. Together, our data demonstrate that the carrier mutation (liaSR135G) affects pilus expression. Our data suggest new mechanisms of pilus gene regulation in GAS and that the invasiveness associated with pilus gene regulation in GAS differs from the enhanced invasiveness associated with increased pilus production in other bacterial pathogens. PMID:28264907

Asymmetric distribution of type IV pili triggered by directional light in unicellular cyanobacteria

PubMed Central

Nishizaka, Takayuki

2017-01-01

The type IV pili (T4P) system is a supermolecular machine observed in prokaryotes. Cells repeat the cycle of T4P extension, surface attachment, and retraction to drive twitching motility. Although the properties of T4P as a motor have been scrutinized with biophysics techniques, the mechanism of regulation remains unclear. Here we provided the framework of the T4P dynamics at the single-cell level in Synechocystis sp. PCC6803, which can recognize light direction. We demonstrated that the dynamics was detected by fluorescent beads under an optical microscope and controlled by blue light that induces negative phototaxis; extension and retraction of T4P was activated at the forward side of lateral illumination to move away from the light source. Additionally, we directly visualized each pilus by fluorescent labeling, allowing us to quantify their asymmetric distribution. Finally, quantitative analyses of cell tracking indicated that T4P was generated uniformly within 0.2 min after blue-light exposure, and within the next 1 min the activation became asymmetric along the light axis to achieve directional cell motility; this process was mediated by the photo-sensing protein, PixD. This sequential process provides clues toward a general regulation mechanism of T4P system, which might be essentially common between archaella and other secretion apparatuses. PMID:28584115

Monoclonal antibodies against colonization factor antigen I pili from enterotoxigenic Escherichia coli.

PubMed

Worobec, E A; Shastry, P; Smart, W; Bradley, R; Singh, B; Paranchych, W

1983-09-01

Hybridomas secreting monoclonal antibodies directed against intact colonization factor antigen I pili have been produced by the fusion of spleen cells from immunized BALB/c mice with NS1/SP2 myeloma cells. The four monoclones with the highest antibody titer, as detected by enzyme-linked immunosorbant assay (ELISA), were chosen for antibody amplification by production of mouse ascitic fluid. These four were examined for antibody specificity by ELISA and immunoblot assays, using six different pilus types. Three of the four monoclonal isolates were specific for only colonization factor antigen I pili in both assays, whereas the remaining isolate showed a distinct cross-reactivity with K99 pili in the ELISA assay but not in immunoblot analysis. These results indicate that this monoclone may be recognizing a common structural element between the two adhesive pilus types.

Monoclonal antibodies against colonization factor antigen I pili from enterotoxigenic Escherichia coli.

PubMed Central

Worobec, E A; Shastry, P; Smart, W; Bradley, R; Singh, B; Paranchych, W

1983-01-01

Hybridomas secreting monoclonal antibodies directed against intact colonization factor antigen I pili have been produced by the fusion of spleen cells from immunized BALB/c mice with NS1/SP2 myeloma cells. The four monoclones with the highest antibody titer, as detected by enzyme-linked immunosorbant assay (ELISA), were chosen for antibody amplification by production of mouse ascitic fluid. These four were examined for antibody specificity by ELISA and immunoblot assays, using six different pilus types. Three of the four monoclonal isolates were specific for only colonization factor antigen I pili in both assays, whereas the remaining isolate showed a distinct cross-reactivity with K99 pili in the ELISA assay but not in immunoblot analysis. These results indicate that this monoclone may be recognizing a common structural element between the two adhesive pilus types. Images PMID:6136463

Location of the antigenic determinants of conjugative F-like pili.

PubMed Central

Worobec, E A; Frost, L S; Pieroni, P; Armstrong, G D; Hodges, R S; Parker, J M; Finlay, B B; Paranchych, W

1986-01-01

The amino terminus of the pilin protein constitutes the major epitope of F-like conjugative pili studied to date (F, ColB2, R1-19, R100-1, and pED208). Anti-pED208 pilus antibodies were passed through a CNBr-Sepharose affinity column linked to bovine serum albumin which was conjugated to a synthetic peptide, AcP(1-12), containing the major epitope at the amino terminus of pED208 pilin. This allowed the separation of two classes of antibodies; one was specific for the amino terminus and bound to the column, while the other, which recognizes a second epitope on the pilus, did not bind to the column. In addition, antibodies were raised against two amino-terminal peptide-bovine serum albumin conjugates [AcP(1-8) and AcP(1-12)] to ensure a source of pure, high-titer antibodies directed against the amino terminus. The location of these antibodies on intact pili was assayed by immunoelectron microscopy with a protein A-gold technique. The amino terminus-specific antibodies did not bind to the sides of the pili but appeared to be associated with the pilus tip. In addition, these antibodies were found to bind to the vesicle-like structure at the base of the pilus. The anti-pilus antibodies not specific for the amino terminus (unbound immunoglobulin G) were found to bind to the sides of the pilus. Anti-F and anti-ColB2 pilus antibodies bound to the sides of F, ColB2, and R1-19 pili, which have only their secondary epitope in common. The carboxyl-terminal lysine of R1-19 pilin prevents the absorption of anti-F plus antiserum but not anti-ColB2 pilus antiserum to the sides of the pilus, presumably by interfering with the recognition of this secondary epitope. Images PMID:2426247

Location of the antigenic determinants of conjugative F-like pili.

PubMed

Worobec, E A; Frost, L S; Pieroni, P; Armstrong, G D; Hodges, R S; Parker, J M; Finlay, B B; Paranchych, W

1986-08-01

The amino terminus of the pilin protein constitutes the major epitope of F-like conjugative pili studied to date (F, ColB2, R1-19, R100-1, and pED208). Anti-pED208 pilus antibodies were passed through a CNBr-Sepharose affinity column linked to bovine serum albumin which was conjugated to a synthetic peptide, AcP(1-12), containing the major epitope at the amino terminus of pED208 pilin. This allowed the separation of two classes of antibodies; one was specific for the amino terminus and bound to the column, while the other, which recognizes a second epitope on the pilus, did not bind to the column. In addition, antibodies were raised against two amino-terminal peptide-bovine serum albumin conjugates [AcP(1-8) and AcP(1-12)] to ensure a source of pure, high-titer antibodies directed against the amino terminus. The location of these antibodies on intact pili was assayed by immunoelectron microscopy with a protein A-gold technique. The amino terminus-specific antibodies did not bind to the sides of the pili but appeared to be associated with the pilus tip. In addition, these antibodies were found to bind to the vesicle-like structure at the base of the pilus. The anti-pilus antibodies not specific for the amino terminus (unbound immunoglobulin G) were found to bind to the sides of the pilus. Anti-F and anti-ColB2 pilus antibodies bound to the sides of F, ColB2, and R1-19 pili, which have only their secondary epitope in common. The carboxyl-terminal lysine of R1-19 pilin prevents the absorption of anti-F plus antiserum but not anti-ColB2 pilus antiserum to the sides of the pilus, presumably by interfering with the recognition of this secondary epitope.

Electron Transport Chain Is Biochemically Linked to Pilus Assembly Required for Polymicrobial Interactions and Biofilm Formation in the Gram-Positive Actinobacterium Actinomyces oris.

PubMed

Sanchez, Belkys C; Chang, Chungyu; Wu, Chenggang; Tran, Bryan; Ton-That, Hung

2017-06-20

The Gram-positive actinobacteria Actinomyces spp. are key colonizers in the development of oral biofilms due to the inherent ability of Actinomyces to adhere to receptor polysaccharides on the surface of oral streptococci and host cells. This receptor-dependent bacterial interaction, or coaggregation, requires a unique sortase-catalyzed pilus consisting of the pilus shaft FimA and the coaggregation factor CafA forming the pilus tip. While the essential role of the sortase machine SrtC2 in pilus assembly, biofilm formation, and coaggregation has been established, little is known about trans -acting factors contributing to these processes. We report here a large-scale Tn 5 transposon screen for mutants defective in Actinomyces oris coaggregation with Streptococcus oralis We obtained 33 independent clones, 13 of which completely failed to aggregate with S. oralis , and the remainder of which exhibited a range of phenotypes from severely to weakly defective coaggregation. The former had Tn 5 insertions in fimA , cafA , or srtC2 , as expected; the latter were mapped to genes coding for uncharacterized proteins and various nuo genes encoding the NADH dehydrogenase subunits. Electron microscopy and biochemical analyses of mutants with nonpolar deletions of nuo genes and ubiE , a menaquinone C-methyltransferase-encoding gene downstream of the nuo locus, confirmed the pilus and coaggregation defects. Both nuoA and ubiE mutants were defective in oxidation of MdbA, the major oxidoreductase required for oxidative folding of pilus proteins. Furthermore, supplementation of the ubiE mutant with exogenous menaquinone-4 rescued the cell growth and pilus defects. Altogether, we propose that the A. oris electron transport chain is biochemically linked to pilus assembly via oxidative protein folding. IMPORTANCE The Gram-positive actinobacterium A. oris expresses adhesive pili, or fimbriae, that are essential to biofilm formation and Actinomyces interactions with other bacteria, termed coaggregation. While the critical role of the conserved sortase machine in pilus assembly and the disulfide bond-forming catalyst MdbA in oxidative folding of pilins has been established, little is known about other trans -acting factors involved in these processes. Using a Tn 5 transposon screen for mutants defective in coaggregation with Streptococcus oralis , we found that genetic disruption of the NADH dehydrogenase and menaquinone biosynthesis detrimentally alters pilus assembly. Further biochemical characterizations determined that menaquinone is important for reactivation of MdbA. This study supports the notion that the electron transport chain is biochemically linked to pilus assembly in A. oris via oxidative folding of pilin precursors. Copyright © 2017 Sanchez et al.

The small regulatory RNA FasX enhances group A Streptococcus virulence and inhibits pilus expression via serotype-specific targets

PubMed Central

Danger, Jessica L.; Cao, Tram N.; Cao, Tran H.; Sarkar, Poulomee; Treviño, Jeanette; Pflughoeft, Kathryn J.; Sumby, Paul

2015-01-01

Summary Bacterial pathogens commonly show intra-species variation in virulence factor expression and often this correlates with pathogenic potential. The group A Streptococcus (GAS) produces a small regulatory RNA (sRNA), FasX, which regulates the expression of pili and the thrombolytic agent streptokinase. As GAS serotypes are polymorphic regarding (a) FasX abundance, (b) the fibronectin, collagen, T-antigen (FCT) region of the genome, which contains the pilus genes (nine different FCT-types), and (c) the streptokinase-encoding gene (ska) sequence (two different alleles), we sought to test whether FasX regulates pilus and streptokinase expression in a serotype-specific manner. Parental, fasX mutant, and complemented derivatives of serotype M1 (ska-2, FCT-2), M2 (ska-1, FCT-6), M6 (ska-2, FCT-1), and M28 (ska-1, FCT-4) isolates were compared. While FasX reduced pilus expression in each serotype, the molecular basis differed, as FasX bound, and inhibited the translation of, different FCT-region mRNAs. FasX enhanced streptokinase expression in each serotype, although the degree of regulation varied. Finally, we established that the regulation afforded by FasX enhances GAS virulence, assessed by a model of bacteremia using human plasminogen-expressing mice. Our data are the first to identify and characterize serotype-specific regulation by an sRNA in GAS, and to show an sRNA directly contributes to GAS virulence. PMID:25586884

Functional genome analysis of Bifidobacterium breve UCC2003 reveals type IVb tight adherence (Tad) pili as an essential and conserved host-colonization factor

PubMed Central

O'Connell Motherway, Mary; Zomer, Aldert; Leahy, Sinead C.; Reunanen, Justus; Bottacini, Francesca; Claesson, Marcus J.; O'Brien, Frances; Flynn, Kiera; Casey, Patrick G.; Moreno Munoz, Jose Antonio; Kearney, Breda; Houston, Aileen M.; O'Mahony, Caitlin; Higgins, Des G.; Shanahan, Fergus; Palva, Airi; de Vos, Willem M.; Fitzgerald, Gerald F.; Ventura, Marco; O'Toole, Paul W.; van Sinderen, Douwe

2011-01-01

Development of the human gut microbiota commences at birth, with bifidobacteria being among the first colonizers of the sterile newborn gastrointestinal tract. To date, the genetic basis of Bifidobacterium colonization and persistence remains poorly understood. Transcriptome analysis of the Bifidobacterium breve UCC2003 2.42-Mb genome in a murine colonization model revealed differential expression of a type IVb tight adherence (Tad) pilus-encoding gene cluster designated “tad2003.” Mutational analysis demonstrated that the tad2003 gene cluster is essential for efficient in vivo murine gut colonization, and immunogold transmission electron microscopy confirmed the presence of Tad pili at the poles of B. breve UCC2003 cells. Conservation of the Tad pilus-encoding locus among other B. breve strains and among sequenced Bifidobacterium genomes supports the notion of a ubiquitous pili-mediated host colonization and persistence mechanism for bifidobacteria. PMID:21690406

Functional genome analysis of Bifidobacterium breve UCC2003 reveals type IVb tight adherence (Tad) pili as an essential and conserved host-colonization factor.

PubMed

O'Connell Motherway, Mary; Zomer, Aldert; Leahy, Sinead C; Reunanen, Justus; Bottacini, Francesca; Claesson, Marcus J; O'Brien, Frances; Flynn, Kiera; Casey, Patrick G; Munoz, Jose Antonio Moreno; Kearney, Breda; Houston, Aileen M; O'Mahony, Caitlin; Higgins, Des G; Shanahan, Fergus; Palva, Airi; de Vos, Willem M; Fitzgerald, Gerald F; Ventura, Marco; O'Toole, Paul W; van Sinderen, Douwe

2011-07-05

Development of the human gut microbiota commences at birth, with bifidobacteria being among the first colonizers of the sterile newborn gastrointestinal tract. To date, the genetic basis of Bifidobacterium colonization and persistence remains poorly understood. Transcriptome analysis of the Bifidobacterium breve UCC2003 2.42-Mb genome in a murine colonization model revealed differential expression of a type IVb tight adherence (Tad) pilus-encoding gene cluster designated "tad(2003)." Mutational analysis demonstrated that the tad(2003) gene cluster is essential for efficient in vivo murine gut colonization, and immunogold transmission electron microscopy confirmed the presence of Tad pili at the poles of B. breve UCC2003 cells. Conservation of the Tad pilus-encoding locus among other B. breve strains and among sequenced Bifidobacterium genomes supports the notion of a ubiquitous pili-mediated host colonization and persistence mechanism for bifidobacteria.

The Road to Infection: Host-Microbe Interactions Defining the Pathogenicity of Streptococcus bovis/Streptococcus equinus Complex Members

PubMed Central

Jans, Christoph; Boleij, Annemarie

2018-01-01

The Streptococcus bovis/Streptococcus equinus complex (SBSEC) comprises several species inhabiting the animal and human gastrointestinal tract (GIT). They match the pathobiont description, are potential zoonotic agents and technological organisms in fermented foods. SBSEC members are associated with multiple diseases in humans and animals including ruminal acidosis, infective endocarditis (IE) and colorectal cancer (CRC). Therefore, this review aims to re-evaluate adhesion and colonization abilities of SBSEC members of animal, human and food origin paired with genomic and functional host-microbe interaction data on their road from colonization to infection. SBSEC seem to be a marginal population during GIT symbiosis that can proliferate as opportunistic pathogens. Risk factors for human colonization are considered living in rural areas and animal-feces contact. Niche adaptation plays a pivotal role where Streptococcus gallolyticus subsp. gallolyticus (SGG) retained the ability to proliferate in various environments. Other SBSEC members have undergone genome reduction and niche-specific gene gain to yield important commensal, pathobiont and technological species. Selective colonization of CRC tissue is suggested for SGG, possibly related to increased adhesion to cancerous cell types featuring enhanced collagen IV accessibility. SGG can colonize, proliferate and may shape the tumor microenvironment to their benefit by tumor promotion upon initial neoplasia development. Bacteria cell surface structures including lipotheichoic acids, capsular polysaccharides and pilus loci (pil1, pil2, and pil3) govern adhesion. Only human blood-derived SGG contain complete pilus loci and other disease-associated surface proteins. Rumen or feces-derived SGG and other SBSEC members lack or harbor mutated pili. Pili also contribute to binding to fibrinogen upon invasion and translocation of cells from the GIT into the blood system, subsequent immune evasion, human contact system activation and collagen-I-binding on damaged heart valves. Only SGG carrying complete pilus loci seem to have highest IE potential in humans with significant links between SGG bacteremia/IE and underlying diseases including CRC. Other SBSEC host-microbe combinations might rely on currently unknown mechanisms. Comparative genome data of blood, commensal and food isolates are limited but required to elucidate the role of pili and other virulence factors, understand pathogenicity mechanisms, host specificity and estimate health risks for animals, humans and food alike. PMID:29692760

Selective depletion of uropathogenic E. coli from the gut by a FimH antagonist

PubMed Central

Spaulding, Caitlin N.; Klein, Roger D.; Ruer, Ségolène; Kau, Andrew L.; Schreiber, Henry L.; Cusumano, Zachary T.; Dodson, Karen W.; Pinkner, Jerome S.; Fremont, Daved H.; Janetka, James W.; Remaut, Han; Gordon, Jeffrey I.; Hultgren, Scott J.

2017-01-01

Summary Urinary tract infections (UTI) caused by uropathogenic E. coli (UPEC) affect 150 million people annually1,2. Despite effective antibiotic therapy, 30–50% of patients experience recurrent UTI (rUTI)1. Additionally, the growing prevelance of UPEC resistant to last-line antibiotic treatments, and more recently carbapenems and colistin, make UTIs a prime example of the antibiotic-resistance crisis and emphasize the need for new approaches to treat and prevent bacterial infections3–5. UPEC strains establish reservoirs in the gut from which they are shed in the feces, can colonize the peri-urethral area or vagina and subsequently ascend through the urethra to the urinary tract, where they cause UTI6. UPEC isolates encode up to 16 distinct chaperone-usher pathway (CUP) pili and each pilus type likely enables colonization of a habitat in the host or environment7. For example, the type 1 pilus adhesin, FimH, binds mannose on the bladder surface, mediating bladder colonization. However, little is known regarding the mechanisms underlying UPEC persistence in the gut5. Using a mouse model, we found that F17-like and type 1 pili promote intestinal colonization and show distinct binding to epithelial cells distributed along colonic crypts. Phylogenomic and structural analyses reveal that F17-like pili are closely related to pilus types carried by intestinal pathogens, but are restricted to extra-intestinal pathogenic E. coli. Moreover, we show that targeting FimH with a high-affinity inhibitor, mannoside M4284, reduces intestinal colonization of genetically diverse UPEC isolates, while simultaneously treating UTI, without significantly disrupting the the structural configuration of the gut microbiota. By selectively depleting the intestinal UPEC reservoir, mannosides could significantly reduce the rate of UTI and rUTI. PMID:28614296

Prokaryotic Information Games: How and When to Take up and Secrete DNA.

PubMed

Stingl, Kerstin; Koraimann, Günther

2017-01-01

Besides transduction via bacteriophages natural transformation and bacterial conjugation are the most important mechanisms driving bacterial evolution and horizontal gene spread. Conjugation systems have evolved in eubacteria and archaea. In Gram-positive and Gram-negative bacteria, cell-to-cell DNA transport is typically facilitated by a type IV secretion system (T4SS). T4SSs also mediate uptake of free DNA in Helicobacter pylori, while most transformable bacteria use a type II secretion/type IV pilus system. In this chapter, we focus on how and when bacteria "decide" that such a DNA transport apparatus is to be expressed and assembled in a cell that becomes competent. Development of DNA uptake competence and DNA transfer competence is driven by a variety of stimuli and often involves intricate regulatory networks leading to dramatic changes in gene expression patterns and bacterial physiology. In both cases, genetically homogeneous populations generate a distinct subpopulation that is competent for DNA uptake or DNA transfer or might uniformly switch into competent state. Phenotypic conversion from one state to the other can rely on bistable genetic networks that are activated stochastically with the integration of external signaling molecules. In addition, we discuss principles of DNA uptake processes in naturally transformable bacteria and intend to understand the exceptional use of a T4SS for DNA import in the gastric pathogen H. pylori. Realizing the events that trigger developmental transformation into competence within a bacterial population will eventually help to create novel and effective therapies against the transmission of antibiotic resistances among pathogens.

Type IV Pilus Expression Is Upregulated in Nontypeable Haemophilus influenzae Biofilms Formed at the Temperature of the Human Nasopharynx

PubMed Central

Mokrzan, Elaine M.; Ward, Michael O.

2016-01-01

ABSTRACT Nontypeable Haemophilus influenzae (NTHI), a commensal of the human nasopharynx (hNP), is a common cause of biofilm-associated diseases of the respiratory tract. However, NTHI biofilm biology at the average hNP temperature, i.e., 34°C, has not been well studied. Here we grew NTHI biofilms at 34°C and 37°C, to evaluate relative biofilm growth, expression, and function of the type IV pilus (Tfp), a critical adhesin important for NTHI biofilm formation. The kinetics and regulation of Tfp expression in NTHI biofilms are unclear, especially at 34°C. Tfp expression, as estimated by pilA promoter activity, was distributed throughout the biofilms, with a unique pattern that was dependent on temperature, time in culture, and position within the maturing biofilm. Tfp expression was required for the formation of the characteristic tower structures of NTHI biofilms and was significantly upregulated in NTHI biofilms formed at 34°C versus 37°C. This increase correlated with significantly greater twitching motility at 34°C than at 37°C. Treatment with antisera targeting the major subunit of Tfp (PilA) significantly inhibited NTHI biofilm formation at both temperatures, confirming the importance of this critical adhesin in biofilm formation. Additionally, treatment of preestablished biofilms with antisera against PilA significantly decreased biofilm biomass and mean thickness at both temperatures. These results demonstrated a pivotal role for Tfp in NTHI biofilm formation and stability at the temperature of the hNP, and they underscore the utility of PilA as a vaccine candidate for treatment and/or prevention of NTHI biofilm-associated diseases. IMPORTANCE NTHI is an important cause of chronic respiratory tract infections, including otitis media, chronic rhinosinusitis, and exacerbations of chronic obstructive pulmonary disease and cystic fibrosis. The chronic and recurrent nature of these diseases is attributed to the presence of bacterial biofilms, which are highly resistant to antimicrobials. We characterized NTHI biofilm growth and expression of PilA, the major subunit of the Tfp, at the temperature of the hNP, which is the commensal habitat of NTHI. Our results expand the current understanding of the role of Tfp during biofilm formation and maturation at the temperature of both the hNP and the middle ear, and they strengthen support for PilA as a vaccine candidate for the prevention and treatment of NTHI biofilm-associated diseases. PMID:27044626

Type IV Pilus Expression Is Upregulated in Nontypeable Haemophilus influenzae Biofilms Formed at the Temperature of the Human Nasopharynx.

PubMed

Mokrzan, Elaine M; Ward, Michael O; Bakaletz, Lauren O

2016-10-01

Nontypeable Haemophilus influenzae (NTHI), a commensal of the human nasopharynx (hNP), is a common cause of biofilm-associated diseases of the respiratory tract. However, NTHI biofilm biology at the average hNP temperature, i.e., 34°C, has not been well studied. Here we grew NTHI biofilms at 34°C and 37°C, to evaluate relative biofilm growth, expression, and function of the type IV pilus (Tfp), a critical adhesin important for NTHI biofilm formation. The kinetics and regulation of Tfp expression in NTHI biofilms are unclear, especially at 34°C. Tfp expression, as estimated by pilA promoter activity, was distributed throughout the biofilms, with a unique pattern that was dependent on temperature, time in culture, and position within the maturing biofilm. Tfp expression was required for the formation of the characteristic tower structures of NTHI biofilms and was significantly upregulated in NTHI biofilms formed at 34°C versus 37°C. This increase correlated with significantly greater twitching motility at 34°C than at 37°C. Treatment with antisera targeting the major subunit of Tfp (PilA) significantly inhibited NTHI biofilm formation at both temperatures, confirming the importance of this critical adhesin in biofilm formation. Additionally, treatment of preestablished biofilms with antisera against PilA significantly decreased biofilm biomass and mean thickness at both temperatures. These results demonstrated a pivotal role for Tfp in NTHI biofilm formation and stability at the temperature of the hNP, and they underscore the utility of PilA as a vaccine candidate for treatment and/or prevention of NTHI biofilm-associated diseases. NTHI is an important cause of chronic respiratory tract infections, including otitis media, chronic rhinosinusitis, and exacerbations of chronic obstructive pulmonary disease and cystic fibrosis. The chronic and recurrent nature of these diseases is attributed to the presence of bacterial biofilms, which are highly resistant to antimicrobials. We characterized NTHI biofilm growth and expression of PilA, the major subunit of the Tfp, at the temperature of the hNP, which is the commensal habitat of NTHI. Our results expand the current understanding of the role of Tfp during biofilm formation and maturation at the temperature of both the hNP and the middle ear, and they strengthen support for PilA as a vaccine candidate for the prevention and treatment of NTHI biofilm-associated diseases. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Two Isoforms of Geobacter sulfurreducens PilA Have Distinct Roles in Pilus Biogenesis, Cytochrome Localization, Extracellular Electron Transfer, and Biofilm Formation

PubMed Central

Richter, Lubna V.; Sandler, Steven J.

2012-01-01

Type IV pili of Geobacter sulfurreducens are composed of PilA monomers and are essential for long-range extracellular electron transfer to insoluble Fe(III) oxides and graphite anodes. A previous analysis of pilA expression indicated that transcription was initiated at two positions, with two predicted ribosome-binding sites and translation start codons, potentially producing two PilA preprotein isoforms. The present study supports the existence of two functional translation start codons for pilA and identifies two isoforms (short and long) of the PilA preprotein. The short PilA isoform is found predominantly in an intracellular fraction. It seems to stabilize the long isoform and to influence the secretion of several outer-surface c-type cytochromes. The long PilA isoform is required for secretion of PilA to the outer cell surface, a process that requires coexpression of pilA with nine downstream genes. The long isoform was determined to be essential for biofilm formation on certain surfaces, for optimum current production in microbial fuel cells, and for growth on insoluble Fe(III) oxides. PMID:22408162

ComEA Is Essential for the Transfer of External DNA into the Periplasm in Naturally Transformable Vibrio cholerae Cells

PubMed Central

Seitz, Patrick; Pezeshgi Modarres, Hassan; Borgeaud, Sandrine; Bulushev, Roman D.; Steinbock, Lorenz J.; Radenovic, Aleksandra; Dal Peraro, Matteo; Blokesch, Melanie

2014-01-01

The DNA uptake of naturally competent bacteria has been attributed to the action of DNA uptake machineries resembling type IV pilus complexes. However, the protein(s) for pulling the DNA across the outer membrane of Gram-negative bacteria remain speculative. Here we show that the competence protein ComEA binds incoming DNA in the periplasm of naturally competent Vibrio cholerae cells thereby promoting DNA uptake, possibly through ratcheting and entropic forces associated with ComEA binding. Using comparative modeling and molecular simulations, we projected the 3D structure and DNA-binding site of ComEA. These in silico predictions, combined with in vivo and in vitro validations of wild-type and site-directed modified variants of ComEA, suggested that ComEA is not solely a DNA receptor protein but plays a direct role in the DNA uptake process. Furthermore, we uncovered that ComEA homologs of other bacteria (both Gram-positive and Gram-negative) efficiently compensated for the absence of ComEA in V. cholerae, suggesting that the contribution of ComEA in the DNA uptake process might be conserved among naturally competent bacteria. PMID:24391524

Key steps in type III secretion system (T3SS) towards translocon assembly with potential sensor at plant plasma membrane.

PubMed

Ji, Hongtao; Dong, Hansong

2015-09-01

Many plant- and animal-pathogenic Gram-negative bacteria employ the type III secretion system (T3SS) to translocate effector proteins from bacterial cells into the cytosol of eukaryotic host cells. The effector translocation occurs through an integral component of T3SS, the channel-like translocon, assembled by hydrophilic and hydrophobic proteinaceous translocators in a two-step process. In the first, hydrophilic translocators localize to the tip of a proteinaceous needle in animal pathogens, or a proteinaceous pilus in plant pathogens, and associate with hydrophobic translocators, which insert into host plasma membranes in the second step. However, the pilus needs to penetrate plant cell walls in advance. All hydrophilic translocators so far identified in plant pathogens are characteristic of harpins: T3SS accessory proteins containing a unitary hydrophilic domain or an additional enzymatic domain. Two-domain harpins carrying a pectate lyase domain potentially target plant cell walls and facilitate the penetration of the pectin-rich middle lamella by the bacterial pilus. One-domain harpins target plant plasma membranes and may play a crucial role in translocon assembly, which may also involve contrapuntal associations of hydrophobic translocators. In all cases, sensory components in the target plasma membrane are indispensable for the membrane recognition of translocators and the functionality of the translocon. The conjectural sensors point to membrane lipids and proteins, and a phosphatidic acid and an aquaporin are able to interact with selected harpin-type translocators. Interactions between translocators and their sensors at the target plasma membrane are assumed to be critical for translocon assembly. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Virulence Factors of Streptococcus pneumoniae. Comparison between African and French Invasive Isolates and Implication for Future Vaccines.

PubMed

Blumental, Sophie; Granger-Farbos, Alexandra; Moïsi, Jennifer C; Soullié, Bruno; Leroy, Philippe; Njanpop-Lafourcade, Berthe-Marie; Yaro, Seydou; Nacro, Boubacar; Hallin, Marie; Koeck, Jean-Louis

2015-01-01

Many surface proteins thought to promote Streptocococcus pneumoniae virulence have recently been discovered and are currently being considered as future vaccine targets. We assessed the prevalence of 16 virulence genes among 435 S. pneumoniae invasive isolates from France and the "African meningitis belt" region, with particular focus on serotype 1 (Sp1), to compare their geographical distribution, assess their association with site of infection and evaluate their potential interest as new vaccine candidates. Detection by PCR of pspA (+families), pspC (+pspC.4), pavA, lytA, phtA,B,D,E, nanA,B,C, rrgA (Pilus-1), sipA (Pilus-2), pcpA and psrp was performed on all isolates, as well as antibiotic resistance testing and MLVA typing (+MLST on 54 representative strains). Determination of ply alleles was performed by sequencing (Sp1 isolates). MLVA and virulence genes profiles segregated Sp1 isolates into 2 groups that followed continent distribution. The ply allele 5 and most of the genes that were variable (nanC, Pilus-2, psrp, pcpA, phtD) were present in the French Sp1 isolates (PMEN clone Sweden(1)-28, ST306) but absent from the African ones. Whereas all African Sp1 isolates clustered into a single MLST CC (CC217), MLVA distinguished two CCs that followed temporal evolution. Pilus-2 and psrp were more prevalent in bacteraemic pneumonia yielded isolates and phtB in meningitis-related isolates. Considering vaccine candidates, phtD was less prevalent than anticipated (50%) and pcpA varied importantly between France and Africa (98% versus 34%). Pilus-1 was carried by 7-11% of isolates and associated with β-lactams resistance. Most virulence genes were carried by the European ST306 clone but were lacking on Sp1 isolates circulating in the African meningitis belt, where a more serious pattern of infection is observed. While virulence proteins are now considered as vaccine targets, the geographical differences in their prevalence could affect the efficacy expected from future vaccines.

Virulence Factors of Streptococcus pneumoniae. Comparison between African and French Invasive Isolates and Implication for Future Vaccines

PubMed Central

Blumental, Sophie; Granger-Farbos, Alexandra; Moïsi, Jennifer C.; Soullié, Bruno; Leroy, Philippe; Njanpop-Lafourcade, Berthe-Marie; Yaro, Seydou; Nacro, Boubacar; Hallin, Marie; Koeck, Jean-Louis

2015-01-01

Background Many surface proteins thought to promote Streptocococcus pneumoniae virulence have recently been discovered and are currently being considered as future vaccine targets. We assessed the prevalence of 16 virulence genes among 435 S. pneumoniae invasive isolates from France and the “African meningitis belt” region, with particular focus on serotype 1 (Sp1), to compare their geographical distribution, assess their association with site of infection and evaluate their potential interest as new vaccine candidates. Methods Detection by PCR of pspA (+families), pspC (+pspC.4), pavA, lytA, phtA,B,D,E, nanA,B,C, rrgA (Pilus-1), sipA (Pilus-2), pcpA and psrp was performed on all isolates, as well as antibiotic resistance testing and MLVA typing (+MLST on 54 representative strains). Determination of ply alleles was performed by sequencing (Sp1 isolates). Results MLVA and virulence genes profiles segregated Sp1 isolates into 2 groups that followed continent distribution. The ply allele 5 and most of the genes that were variable (nanC, Pilus-2, psrp, pcpA, phtD) were present in the French Sp1 isolates (PMEN clone Sweden1-28, ST306) but absent from the African ones. Whereas all African Sp1 isolates clustered into a single MLST CC (CC217), MLVA distinguished two CCs that followed temporal evolution. Pilus-2 and psrp were more prevalent in bacteraemic pneumonia yielded isolates and phtB in meningitis-related isolates. Considering vaccine candidates, phtD was less prevalent than anticipated (50%) and pcpA varied importantly between France and Africa (98% versus 34%). Pilus-1 was carried by 7-11% of isolates and associated with β-lactams resistance. Conclusions Most virulence genes were carried by the European ST306 clone but were lacking on Sp1 isolates circulating in the African meningitis belt, where a more serious pattern of infection is observed. While virulence proteins are now considered as vaccine targets, the geographical differences in their prevalence could affect the efficacy expected from future vaccines. PMID:26214695

Anti-Group B Streptococcus Glycan-Conjugate Vaccines Using Pilus Protein GBS80 As Carrier and Antigen: Comparing Lysine and Tyrosine-directed Conjugation.

PubMed

Nilo, Alberto; Morelli, Laura; Passalacqua, Irene; Brogioni, Barbara; Allan, Martin; Carboni, Filippo; Pezzicoli, Alfredo; Zerbini, Francesca; Maione, Domenico; Fabbrini, Monica; Romano, Maria Rosaria; Hu, Qi-Ying; Margarit, Immaculada; Berti, Francesco; Adamo, Roberto

2015-07-17

Gram-positive Streptococcus agalactiae or group B Streptococcus (GBS) is a leading cause of invasive infections in pregnant women, newborns, and elderly people. Vaccination of pregnant women represents the best strategy for prevention of neonatal disease, and GBS polysaccharide-based conjugate vaccines are currently under clinical testing. The potential of GBS pilus proteins selected by genome-based reverse vaccinology as protective antigens for anti-streptococcal vaccines has also been demonstrated. Dressing pilus proteins with surface glycan antigens could be an attractive approach to extend vaccine coverage. We have recently developed an efficient method for tyrosine-directed ligation of large glycans to proteins via copper-free azide-alkyne [3 + 2] cycloaddition. This method enables targeting of predetermined sites of the protein, ensuring that protein epitopes are preserved prior to glycan coupling and a higher consistency in glycoconjugate batches. Herein, we compared conjugates of the GBS type II polysaccharide (PSII) and the GBS80 pilus protein obtained by classic lysine random conjugation and by the recently developed tyrosine-directed ligation. PSII conjugated to CRM197, a carrier protein used for vaccines in the market, was used as a control. We found that the constructs made from PSII and GBS80 were able to elicit murine antibodies recognizing individually the glycan and protein epitopes on the bacterial surface. The generated antibodies were efficacious in mediating opsonophagocytic killing of strains expressing exclusively PSII or GBS80 proteins. The two glycoconjugates were also effective in protecting newborn mice against GBS infection following vaccination of the dams. Altogether, these results demonstrated that polysaccharide-conjugated GBS80 pilus protein functions as a carrier comparably to CRM197, while maintaining its properties of protective protein antigen. Glycoconjugation and reverse vaccinology can, therefore, be combined to design vaccines with broad coverage. This approach opens a path to a new generation of vaccines. Tyrosine-ligation allows creation of more homogeneous vaccines, correlation of the immune response to defined connectivity points, and fine-tuning of the conjugation site in glycan-protein conjugates.

Pili in Microspheres Protect Rabbits From Diarrhoea Induced by E. Coli Strain RDEC-1

DTIC Science & Technology

1993-01-01

tested whether pilus proteins of rabbit diarrhoeagenic Escherichia coi (RDEC- F,~ incorporated into biodegradable microspheres. could function as safe...McQueen t",’E.C. Boedekert’, R. Reidt’, D. Jarboet, M. Wolfr, M. Le+ /1 1 and W.R. Brown+ We tested whether pilus proteins of rabbit diarrhoeagenic...that has early and late phases’. posed of biodegradable, biocompatible lactide/glycolide The AF/RI pilus adhesin is a well described virulence polymers

Host-Associated Genomic Features of the Novel Uncultured Intracellular Pathogen Ca. Ichthyocystis Revealed by Direct Sequencing of Epitheliocysts

PubMed Central

Qi, Weihong; Vaughan, Lloyd; Katharios, Pantelis; Schlapbach, Ralph; Seth-Smith, Helena M.B.

2016-01-01

Advances in single-cell and mini-metagenome sequencing have enabled important investigations into uncultured bacteria. In this study, we applied the mini-metagenome sequencing method to assemble genome drafts of the uncultured causative agents of epitheliocystis, an emerging infectious disease in the Mediterranean aquaculture species gilthead seabream. We sequenced multiple cyst samples and constructed 11 genome drafts from a novel beta-proteobacterial lineage, Candidatus Ichthyocystis. The draft genomes demonstrate features typical of pathogenic bacteria with an obligate intracellular lifestyle: a reduced genome of up to 2.6 Mb, reduced G + C content, and reduced metabolic capacity. Reconstruction of metabolic pathways reveals that Ca. Ichthyocystis genomes lack all amino acid synthesis pathways, compelling them to scavenge from the fish host. All genomes encode type II, III, and IV secretion systems, a large repertoire of predicted effectors, and a type IV pilus. These are all considered to be virulence factors, required for adherence, invasion, and host manipulation. However, no evidence of lipopolysaccharide synthesis could be found. Beyond the core functions shared within the genus, alignments showed distinction into different species, characterized by alternative large gene families. These comprise up to a third of each genome, appear to have arisen through duplication and diversification, encode many effector proteins, and are seemingly critical for virulence. Thus, Ca. Ichthyocystis represents a novel obligatory intracellular pathogenic beta-proteobacterial lineage. The methods used: mini-metagenome analysis and manual annotation, have generated important insights into the lifestyle and evolution of the novel, uncultured pathogens, elucidating many putative virulence factors including an unprecedented array of novel gene families. PMID:27190004

Genetic Characterization of Escherichia coli Type 1 Pilus Adhesin Mutants and Identification of a Novel Binding Phenotype

PubMed Central

Hamrick, Terri S.; Harris, Sandra L.; Spears, Patricia A.; Havell, Edward A.; Horton, John R.; Russell, Perry W.; Orndorff, Paul E.

2000-01-01

Five Escherichia coli type 1 pilus mutants that had point mutations in fimH, the gene encoding the type 1 pilus adhesin FimH, were characterized. FimH is a minor component of type 1 pili that is required for the pili to bind and agglutinate guinea pig erythrocytes in a mannose-inhibitable manner. Point mutations were located by DNA sequencing and deletion mapping. All mutations mapped within the signal sequence or in the first 28% of the predicted mature protein. All mutations were missense mutations except for one, a frameshift lesion that was predicted to cause the loss of approximately 60% of the mature FimH protein. Bacterial agglutination tests with polyclonal antiserum raised to a LacZ-FimH fusion protein failed to confirm that parental amounts of FimH cross-reacting material were expressed in four of the five mutants. The remaining mutant, a temperature-sensitive (ts) fimH mutant that agglutinated guinea pig erythrocytes after growth at 31°C but not at 42°C, reacted with antiserum at both temperatures in a manner similar to the parent. Consequently, this mutant was chosen for further study. Temperature shift experiments revealed that new FimH biosynthesis was required for the phenotypic change. Guinea pig erythrocyte and mouse macrophage binding experiments using the ts mutant grown at the restrictive and permissive temperatures revealed that whereas erythrocyte binding was reduced to a level comparable to that of a fimH insertion mutant at the restrictive temperature, mouse peritoneal macrophages were bound with parental efficiency at both the permissive and restrictive temperatures. Also, macrophage binding by the ts mutant was insensitive to mannose inhibition after growth at 42°C but sensitive after growth at 31°C. The ts mutant thus binds macrophages with one receptor specificity at 31°C and another at 42°C. PMID:10869080

Synthetic polymer nanoparticles conjugated with FimH(A) from E. coli pili to emulate the bacterial mode of epithelial internalization.

PubMed

Lin, Lily Yun; Tiemann, Kristin M; Li, Yali; Pinkner, Jerome S; Walker, Jennifer N; Hultgren, Scott J; Hunstad, David A; Wooley, Karen L

2012-03-07

Amphiphilic block copolymer nanoparticles are conjugated with uropathogenic Escherichia coli type 1 pilus adhesin FimH(A) through amidation chemistry to enable bladder epithelial cell binding and internalization of the nanoparticles in vitro. © 2012 American Chemical Society

The Role of Chaperone-subunit Usher Domain Interactions in the Mechanism of Bacterial Pilus Biogenesis Revealed by ESI-MS*

PubMed Central

Morrissey, Bethny; Leney, Aneika C.; Toste Rêgo, Ana; Phan, Gilles; Allen, William J.; Verger, Denis; Waksman, Gabriel; Ashcroft, Alison E.; Radford, Sheena E.

2012-01-01

The PapC usher is a β-barrel outer membrane protein essential for assembly and secretion of P pili that are required for adhesion of pathogenic E. coli, which cause the development of pyelonephritis. Multiple protein subunits form the P pilus, the highly specific assembly of which is coordinated by the usher. Despite a wealth of structural knowledge, how the usher catalyzes subunit polymerization and orchestrates a correct and functional order of subunit assembly remain unclear. Here, the ability of the soluble N-terminal (UsherN), C-terminal (UsherC2), and Plug (UsherP) domains of the usher to bind different chaperone-subunit (PapDPapX) complexes is investigated using noncovalent electrospray ionization mass spectrometry. The results reveal that each usher domain is able to bind all six PapDPapX complexes, consistent with an active role of all three usher domains in pilus biogenesis. Using collision induced dissociation, combined with competition binding experiments and dissection of the adhesin subunit, PapG, into separate pilin and adhesin domains, the results reveal why PapG has a uniquely high affinity for the usher, which is consistent with this subunit always being displayed at the pilus tip. In addition, we show how the different soluble usher domains cooperate to coordinate and control efficient pilus assembly at the usher platform. As well as providing new information about the protein-protein interactions that determine pilus biogenesis, the results highlight the power of noncovalent MS to interrogate biological mechanisms, especially in complex mixtures of species. PMID:22371487

The role of chaperone-subunit usher domain interactions in the mechanism of bacterial pilus biogenesis revealed by ESI-MS.

PubMed

Morrissey, Bethny; Leney, Aneika C; Toste Rêgo, Ana; Phan, Gilles; Allen, William J; Verger, Denis; Waksman, Gabriel; Ashcroft, Alison E; Radford, Sheena E

2012-07-01

The PapC usher is a β-barrel outer membrane protein essential for assembly and secretion of P pili that are required for adhesion of pathogenic E. coli, which cause the development of pyelonephritis. Multiple protein subunits form the P pilus, the highly specific assembly of which is coordinated by the usher. Despite a wealth of structural knowledge, how the usher catalyzes subunit polymerization and orchestrates a correct and functional order of subunit assembly remain unclear. Here, the ability of the soluble N-terminal (UsherN), C-terminal (UsherC2), and Plug (UsherP) domains of the usher to bind different chaperone-subunit (PapDPapX) complexes is investigated using noncovalent electrospray ionization mass spectrometry. The results reveal that each usher domain is able to bind all six PapDPapX complexes, consistent with an active role of all three usher domains in pilus biogenesis. Using collision induced dissociation, combined with competition binding experiments and dissection of the adhesin subunit, PapG, into separate pilin and adhesin domains, the results reveal why PapG has a uniquely high affinity for the usher, which is consistent with this subunit always being displayed at the pilus tip. In addition, we show how the different soluble usher domains cooperate to coordinate and control efficient pilus assembly at the usher platform. As well as providing new information about the protein-protein interactions that determine pilus biogenesis, the results highlight the power of noncovalent MS to interrogate biological mechanisms, especially in complex mixtures of species.

Conjugative type IVb pilus recognizes lipopolysaccharide of recipient cells to initiate PAPI-1 pathogenicity island transfer in Pseudomonas aeruginosa

USDA-ARS?s Scientific Manuscript database

Pseudomonas aeruginosa pathogenicity island 1 (PAPI-1) is one of the largest genomic islands of this important opportunistic human pathogen. Previous studies have shown that PAPI-1 encodes several putative virulence factors, a major regulator of biofilm formation, and antibiotic-resistance traits, a...

Myxococcus xanthus Developmental Cell Fate Production: Heterogeneous Accumulation of Developmental Regulatory Proteins and Reexamination of the Role of MazF in Developmental Lysis

PubMed Central

Lee, Bongsoo; Holkenbrink, Carina; Treuner-Lange, Anke

2012-01-01

Myxococcus xanthus undergoes a starvation-induced multicellular developmental program during which cells partition into three known fates: (i) aggregation into fruiting bodies followed by differentiation into spores, (ii) lysis, or (iii) differentiation into nonaggregating persister-like cells, termed peripheral rods. As a first step to characterize cell fate segregation, we enumerated total, aggregating, and nonaggregating cells throughout the developmental program. We demonstrate that both cell lysis and cell aggregation begin with similar timing at approximately 24 h after induction of development. Examination of several known regulatory proteins in the separated aggregated and nonaggregated cell fractions revealed previously unknown heterogeneity in the accumulation patterns of proteins involved in type IV pilus (T4P)-mediated motility (PilC and PilA) and regulation of development (MrpC, FruA, and C-signal). As part of our characterization of the cell lysis fate, we set out to investigate the unorthodox MazF-MrpC toxin-antitoxin system which was previously proposed to induce programmed cell death (PCD). We demonstrate that deletion of mazF in two different wild-type M. xanthus laboratory strains does not significantly reduce developmental cell lysis, suggesting that MazF's role in promoting PCD is an adaption to the mutant background strain used previously. PMID:22493014

Dynamics of Flagellum- and Pilus-Mediated Association of Pseudomonas aeruginosa with Contact Lens Surfaces▿

PubMed Central

Tran, Victoria B.; Fleiszig, Suzanne M. J.; Evans, David J.; Radke, Clayton J.

2011-01-01

Flagella and pili are appendages that modulate attachment of Pseudomonas aeruginosa to solid surfaces. However, previous studies have mostly reported absolute attachment. Neither the dynamic roles of these appendages in surface association nor those of attachment phenotypes have been quantified. We used video microscopy to address this issue. Unworn, sterile, soft contact lenses were placed in a laminar-flow optical chamber. Initial lens association kinetics for P. aeruginosa strain PAK were assessed in addition to lens-surface association phenotypes. Comparisons were made to strains with mutations in flagellin (fliC) or pilin (pilA) or those in flagellum (motAB) or pilus (pilU) function. PAK and its mutants associated with the contact lens surface at a constant rate according to first-order kinetics. Nonswimming mutants associated ∼30 to 40 times slower than the wild type. PAK and its pilA mutant associated at similar rates, but each ∼4 times faster than the pilU mutant. Lens attachment by wild-type PAK induced multiple phenotypes (static, lateral, and rotational surface movement), each showing only minor detachment. Flagellin (fliC) and flagellar-motility (motAB) mutants did not exhibit surface rotation. Conversely, strains with mutations in pilin (pilA) and pilus retraction (pilU) lacked lateral-surface movement but displayed enhanced surface rotation. Slower surface association of swimming-incapable P. aeruginosa mutants was ascribed to lower convective-diffusion-arrival rates, not to an inability to adhere. Flagellum function (swimming) enhanced lens association, attachment, and rotation; hyperpiliation hindered lens association. P. aeruginosa bound through three different adhesion sites: flagellum, pili, and body. Reduction of bacterial attachment to contact lenses thus requires blockage of multiple adhesion phenotypes. PMID:21498762

Production of the Escherichia coli Common Pilus by Uropathogenic E. coli Is Associated with Adherence to HeLa and HTB-4 Cells and Invasion of Mouse Bladder Urothelium

PubMed Central

Carrillo-Casas, Erika Margarita; Durán, Laura; Zhang, Yushan; Hernández-Castro, Rigoberto; Puente, José L.; Daaka, Yehia; Girón, Jorge A.

2014-01-01

Uropathogenic Escherichia coli (UPEC) strains cause urinary tract infections and employ type 1 and P pili in colonization of the bladder and kidney, respectively. Most intestinal and extra-intestinal E. coli strains produce a pilus called E. coli common pilus (ECP) involved in cell adherence and biofilm formation. However, the contribution of ECP to the interaction of UPEC with uroepithelial cells remains to be elucidated. Here, we report that prototypic UPEC strains CFT073 and F11 mutated in the major pilin structural gene ecpA are significantly deficient in adherence to cultured HeLa (cervix) and HTB-4 (bladder) epithelial cells in vitro as compared to their parental strains. Complementation of the ecpA mutant restored adherence to wild-type levels. UPEC strains produce ECP upon growth in Luria-Bertani broth or DMEM tissue culture medium preferentially at 26°C, during incubation with cultured epithelial cells in vitro at 37°C, and upon colonization of mouse bladder urothelium ex vivo. ECP was demonstrated on and inside exfoliated bladder epithelial cells present in the urine of urinary tract infection patients. The ability of the CFT073 ecpA mutant to invade the mouse tissue was significantly reduced. The presence of ECP correlated with the architecture of the biofilms produced by UPEC strains on inert surfaces. These data suggest that ECP can potentially be produced in the bladder environment and contribute to the adhesive and invasive capabilities of UPEC during its interaction with the host bladder. We propose that along with other known adhesins, ECP plays a synergistic role in the multi-step infection of the urinary tract. PMID:25036370

Production of the Escherichia coli common pilus by uropathogenic E. coli is associated with adherence to HeLa and HTB-4 cells and invasion of mouse bladder urothelium.

PubMed

Saldaña, Zeus; De la Cruz, Miguel A; Carrillo-Casas, Erika Margarita; Durán, Laura; Zhang, Yushan; Hernández-Castro, Rigoberto; Puente, José L; Daaka, Yehia; Girón, Jorge A

2014-01-01

Uropathogenic Escherichia coli (UPEC) strains cause urinary tract infections and employ type 1 and P pili in colonization of the bladder and kidney, respectively. Most intestinal and extra-intestinal E. coli strains produce a pilus called E. coli common pilus (ECP) involved in cell adherence and biofilm formation. However, the contribution of ECP to the interaction of UPEC with uroepithelial cells remains to be elucidated. Here, we report that prototypic UPEC strains CFT073 and F11 mutated in the major pilin structural gene ecpA are significantly deficient in adherence to cultured HeLa (cervix) and HTB-4 (bladder) epithelial cells in vitro as compared to their parental strains. Complementation of the ecpA mutant restored adherence to wild-type levels. UPEC strains produce ECP upon growth in Luria-Bertani broth or DMEM tissue culture medium preferentially at 26°C, during incubation with cultured epithelial cells in vitro at 37°C, and upon colonization of mouse bladder urothelium ex vivo. ECP was demonstrated on and inside exfoliated bladder epithelial cells present in the urine of urinary tract infection patients. The ability of the CFT073 ecpA mutant to invade the mouse tissue was significantly reduced. The presence of ECP correlated with the architecture of the biofilms produced by UPEC strains on inert surfaces. These data suggest that ECP can potentially be produced in the bladder environment and contribute to the adhesive and invasive capabilities of UPEC during its interaction with the host bladder. We propose that along with other known adhesins, ECP plays a synergistic role in the multi-step infection of the urinary tract.

In vitro reconstitution of sortase-catalyzed pilus polymerization reveals structural elements involved in pilin cross-linking.

PubMed

Chang, Chungyu; Amer, Brendan R; Osipiuk, Jerzy; McConnell, Scott A; Huang, I-Hsiu; Hsieh, Van; Fu, Janine; Nguyen, Hong H; Muroski, John; Flores, Erika; Ogorzalek Loo, Rachel R; Loo, Joseph A; Putkey, John A; Joachimiak, Andrzej; Das, Asis; Clubb, Robert T; Ton-That, Hung

2018-06-12

Covalently cross-linked pilus polymers displayed on the cell surface of Gram-positive bacteria are assembled by class C sortase enzymes. These pilus-specific transpeptidases located on the bacterial membrane catalyze a two-step protein ligation reaction, first cleaving the LPXTG motif of one pilin protomer to form an acyl-enzyme intermediate and then joining the terminal Thr to the nucleophilic Lys residue residing within the pilin motif of another pilin protomer. To date, the determinants of class C enzymes that uniquely enable them to construct pili remain unknown. Here, informed by high-resolution crystal structures of corynebacterial pilus-specific sortase (SrtA) and utilizing a structural variant of the enzyme (SrtA 2M ), whose catalytic pocket has been unmasked by activating mutations, we successfully reconstituted in vitro polymerization of the cognate major pilin (SpaA). Mass spectrometry, electron microscopy, and biochemical experiments authenticated that SrtA 2M synthesizes pilus fibers with correct Lys-Thr isopeptide bonds linking individual pilins via a thioacyl intermediate. Structural modeling of the SpaA-SrtA-SpaA polymerization intermediate depicts SrtA 2M sandwiched between the N- and C-terminal domains of SpaA harboring the reactive pilin and LPXTG motifs, respectively. Remarkably, the model uncovered a conserved TP(Y/L)XIN(S/T)H signature sequence following the catalytic Cys, in which the alanine substitutions abrogated cross-linking activity but not cleavage of LPXTG. These insights and our evidence that SrtA 2M can terminate pilus polymerization by joining the terminal pilin SpaB to SpaA and catalyze ligation of isolated SpaA domains in vitro provide a facile and versatile platform for protein engineering and bio-conjugation that has major implications for biotechnology.

PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

DOE PAGES

McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.; ...

2016-03-28

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

Type IV Secretion and Signal Transduction of Helicobacter pylori CagA through Interactions with Host Cell Receptors

PubMed Central

Backert, Steffen; Tegtmeyer, Nicole

2017-01-01

Helicobacter pylori is a highly successful human bacterium, which is exceptionally equipped to persistently inhabit the human stomach. Colonization by this pathogen is associated with gastric disorders ranging from chronic gastritis and peptic ulcers to cancer. Highly virulent H. pylori strains express the well-established adhesins BabA/B, SabA, AlpA/B, OipA, and HopQ, and a type IV secretion system (T4SS) encoded by the cag pathogenicity island (PAI). The adhesins ascertain intimate bacterial contact to gastric epithelial cells, while the T4SS represents an extracellular pilus-like structure for the translocation of the effector protein CagA. Numerous T4SS components including CagI, CagL, CagY, and CagA have been shown to target the integrin-β1 receptor followed by translocation of CagA across the host cell membrane. The interaction of CagA with membrane-anchored phosphatidylserine and CagA-containing outer membrane vesicles may also play a role in the delivery process. Translocated CagA undergoes tyrosine phosphorylation in C-terminal EPIYA-repeat motifs by oncogenic Src and Abl kinases. CagA then interacts with an array of host signaling proteins followed by their activation or inactivation in phosphorylation-dependent and phosphorylation-independent fashions. We now count about 25 host cell binding partners of intracellular CagA, which represent the highest quantity of all currently known virulence-associated effector proteins in the microbial world. Here we review the research progress in characterizing interactions of CagA with multiple host cell receptors in the gastric epithelium, including integrin-β1, EGFR, c-Met, CD44, E-cadherin, and gp130. The contribution of these interactions to H. pylori colonization, signal transduction, and gastric pathogenesis is discussed. PMID:28338646

Functional Divergence of FimX in PilZ Binding and Type IV Pilus Regulation

PubMed Central

Qi, Yaning; Xu, Linghui; Dong, Xueming; Yau, Yin Hoe; Ho, Chun Loong; Koh, Siew Lee; Shochat, Susana Geifman; Chou, Shan-Ho; Tang, Kai

2012-01-01

Type IV pili (T4P) are polar surface structures that play important roles in bacterial motility, biofilm formation, and pathogenicity. The protein FimX and its orthologs are known to mediate T4P formation in the human pathogen Pseudomonas aeruginosa and some other bacterial species. It was reported recently that FimXXAC2398 from Xanthomonas axonopodis pv. citri interacts with PilZXAC1133 directly through the nonenzymatic EAL domain of FimXXAC2398. Here we present experimental data to reveal that the strong interaction between FimXXAC2398 and PilZXAC1133 is not conserved in P. aeruginosa and likely other Pseudomonas species. In vitro and in vivo binding experiments showed that the interaction between FimX and PilZ in P. aeruginosa is below the measurable limit. Surface plasmon resonance assays further confirmed that the interaction between the P. aeruginosa proteins is at least more than 3 orders of magnitude weaker than that between the X. axonopodis pv. citri pair. The N-terminal lobe region of FimXXAC2398 was identified as the binding surface for PilZXAC1133 by amide hydrogen-deuterium exchange and site-directed mutagenesis studies. Lack of several key residues in the N-terminal lobe region of the EAL domain of FimX is likely to account for the greatly reduced binding affinity between FimX and PilZ in P. aeruginosa. All together, the results suggest that the interaction between PilZ and FimX in Xanthomonas species is not conserved in P. aeruginosa due to the evolutionary divergence among the FimX orthologs. The precise roles of FimX and PilZ in bacterial motility and T4P biogenesis are likely to vary among bacterial species. PMID:22942245

Identification of an Extracellular Polysaccharide Network Essential for Cytochrome Anchoring and Biofilm Formation in Geobacter sulfurreducens▿ †

PubMed Central

Rollefson, Janet B.; Stephen, Camille S.; Tien, Ming; Bond, Daniel R.

2011-01-01

Transposon insertions in Geobacter sulfurreducens GSU1501, part of an ATP-dependent exporter within an operon of polysaccharide biosynthesis genes, were previously shown to eliminate insoluble Fe(III) reduction and use of an electrode as an electron acceptor. Replacement of GSU1501 with a kanamycin resistance cassette produced a similarly defective mutant, which could be partially complemented by expression of GSU1500 to GSU1505 in trans. The Δ1501 mutant demonstrated limited cell-cell agglutination, enhanced attachment to negatively charged surfaces, and poor attachment to positively charged poly-d-lysine- or Fe(III)-coated surfaces. Wild-type and mutant cells attached to graphite electrodes, but when electrodes were poised at an oxidizing potential inducing a positive surface charge (+0.24 V versus the standard hydrogen electrode [SHE]), Δ1501 mutant cells detached. Scanning electron microscopy revealed fibrils surrounding wild-type G. sulfurreducens which were absent from the Δ1501 mutant. Similar amounts of type IV pili and pilus-associated cytochromes were detected on both cell types, but shearing released a stable matrix of c-type cytochromes and other proteins bound to polysaccharides. The matrix from the mutant contained 60% less sugar and was nearly devoid of c-type cytochromes such as OmcZ. The addition of wild-type extracellular matrix to Δ1501 cultures restored agglutination and Fe(III) reduction. The polysaccharide binding dye Congo red preferentially bound wild-type cells and extracellular matrix material over mutant cells, and Congo red inhibited agglutination and Fe(III) reduction by wild-type cells. These results demonstrate a crucial role for the xap (extracellular anchoring polysaccharide) locus in metal oxide attachment, cell-cell agglutination, and localization of essential cytochromes beyond the Geobacter outer membrane. PMID:21169487

A Role for the Mannose-Sensitive Hemagglutinin in Biofilm Formation by Vibrio cholerae El Tor

PubMed Central

Watnick, Paula I.; Fullner, Karla Jean; Kolter, Roberto

1999-01-01

While much has been learned regarding the genetic basis of host-pathogen interactions, less is known about the molecular basis of a pathogen’s survival in the environment. Biofilm formation on abiotic surfaces represents a survival strategy utilized by many microbes. Here it is shown that Vibrio cholerae El Tor does not use the virulence-associated toxin-coregulated pilus to form biofilms on borosilicate but rather uses the mannose-sensitive hemagglutinin (MSHA) pilus, which plays no role in pathogenicity. In contrast, attachment of V. cholerae to chitin is shown to be independent of the MSHA pilus, suggesting divergent pathways for biofilm formation on nutritive and nonnutritive abiotic surfaces. PMID:10348878

FlaF is a β-sandwich protein that anchors the archaellum in the archaeal cell envelope by binding the S-layer protein

DOE PAGES

Banerjee, Ankan; Tsai, Chi -Lin; Chaudhury, Paushali; ...

2015-05-01

Archaea employ the archaellum, a type IV pilus-like nanomachine, for swimming motility. In the crenarchaeon Sulfolobus acidocaldarius, the archaellum consists of seven proteins: FlaB/X/G/F/H/I/J. FlaF is conserved and essential for archaellum assembly but no FlaF structures exist. Here, we truncated the FlaF N terminus and solved 1.5-Å and 1.65-Å resolution crystal structures of this monotopic membrane protein. Structures revealed an N-terminal α-helix and an eight-strand β-sandwich, immunoglobulin-like fold with striking similarity to S-layer proteins. Crystal structures, X-ray scattering, and mutational analyses suggest dimer assembly is needed for in vivo function. The sole cell envelope component of S. acidocaldarius is amore » paracrystalline S-layer, and FlaF specifically bound to S-layer protein, suggesting that its interaction domain is located in the pseudoperiplasm with its N-terminal helix in the membrane. From these data, FlaF may act as the previously unknown archaellum stator protein that anchors the rotating archaellum to the archaeal cell envelope.« less

The role of pili in Bacillus cereus intraocular infection.

PubMed

Callegan, Michelle C; Parkunan, Salai Madhumathi; Randall, C Blake; Coburn, Phillip S; Miller, Frederick C; LaGrow, Austin L; Astley, Roger A; Land, Craig; Oh, So-Young; Schneewind, Olaf

2017-06-01

Bacterial endophthalmitis is a potentially blinding intraocular infection. The bacterium Bacillus cereus causes a devastating form of this disease which progresses rapidly, resulting in significant inflammation and loss of vision within a few days. The outer surface of B. cereus incites the intraocular inflammatory response, likely through interactions with innate immune receptors such as TLRs. This study analyzed the role of B. cereus pili, adhesion appendages located on the bacterial surface, in experimental endophthalmitis. To test the hypothesis that the presence of pili contributed to intraocular inflammation and virulence, we analyzed the progress of experimental endophthalmitis in mouse eyes infected with wild type B. cereus (ATCC 14579) or its isogenic pilus-deficient mutant (ΔbcpA-srtD-bcpB or ΔPil). One hundred CFU were injected into the mid-vitreous of one eye of each mouse. Infections were analyzed by quantifying intraocular bacilli and retinal function loss, and by histology from 0 to 12 h postinfection. In vitro growth and hemolytic phenotypes of the infecting strains were also compared. There was no difference in hemolytic activity (1:8 titer), motility, or in vitro growth (p > 0.05, every 2 h, 0-18 h) between wild type B. cereus and the ΔPil mutant. However, infected eyes contained greater numbers of wild type B. cereus than ΔPil during the infection course (p ≤ 0.05, 3-12 h). Eyes infected with wild type B. cereus experienced greater losses in retinal function than eyes infected with the ΔPil mutant, but the differences were not always significant. Eyes infected with ΔPil or wild type B. cereus achieved similar degrees of severe inflammation. The results indicated that the intraocular growth of pilus-deficient B. cereus may have been better controlled, leading to a trend of greater retinal function in eyes infected with the pilus-deficient strain. Although this difference was not enough to significantly alter the severity of the inflammatory response, these results suggest a potential role for pili in protecting B. cereus from clearance during the early stages of endophthalmitis, which is a newly described virulence mechanism for this organism and this infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mechanistic stratification in electroactive biofilms of Geobacter sulfurreducens mediated by pilus nanowires

NASA Astrophysics Data System (ADS)

Steidl, Rebecca J.; Lampa-Pastirk, Sanela; Reguera, Gemma

2016-08-01

Electricity generation by Geobacter sulfurreducens biofilms grown on electrodes involves matrix-associated electron carriers, such as c-type cytochromes. Yet, the contribution of the biofilm's conductive pili remains uncertain, largely because pili-defective mutants also have cytochrome defects. Here we report that a pili-deficient mutant carrying an inactivating mutation in the pilus assembly motor PilB has no measurable defects in cytochrome expression, yet forms anode biofilms with reduced electroactivity and is unable to grow beyond a threshold distance (~10 μm) from the underlying electrode. The defects are similar to those of a Tyr3 mutant, which produces poorly conductive pili. The results support a model in which the conductive pili permeate the biofilms to wire the cells to the conductive biofilm matrix and the underlying electrode, operating coordinately with cytochromes until the biofilm reaches a threshold thickness that limits the efficiency of the cytochrome pathway but not the functioning of the conductive pili network.

Human Urine Decreases Function and Expression of Type 1 Pili in Uropathogenic Escherichia coli

PubMed Central

Greene, Sarah E.; Hibbing, Michael E.; Janetka, James; Chen, Swaine L.

2015-01-01

ABSTRACT Uropathogenic Escherichia coli (UPEC) is the primary cause of community-acquired urinary tract infections (UTIs). UPEC bind the bladder using type 1 pili, encoded by the fim operon in nearly all E. coli. Assembled type 1 pili terminate in the FimH adhesin, which specifically binds to mannosylated glycoproteins on the bladder epithelium. Expression of type 1 pili is regulated in part by phase-variable inversion of the genomic element containing the fimS promoter, resulting in phase ON (expressing) and OFF (nonexpressing) orientations. Type 1 pili are essential for virulence in murine models of UTI; however, studies of urine samples from human UTI patients demonstrate variable expression of type 1 pili. We provide insight into this paradox by showing that human urine specifically inhibits both expression and function of type 1 pili. Growth in urine induces the fimS phase OFF orientation, preventing fim expression. Urine also contains inhibitors of FimH function, and this inhibition leads to a further bias in fimS orientation toward the phase OFF state. The dual effect of urine on fimS regulation and FimH binding presents a potential barrier to type 1 pilus-mediated colonization and invasion of the bladder epithelium. However, FimH-mediated attachment to human bladder cells during growth in urine reverses these effects such that fim expression remains ON and/or turns ON. Interestingly, FimH inhibitors called mannosides also induce the fimS phase OFF orientation. Thus, the transduction of FimH protein attachment or inhibition into epigenetic regulation of type 1 pilus expression has important implications for the development of therapeutics targeting FimH function. PMID:26126855

Characterization of novel virulent broad-host-range phages of Xylella fastidiosa and Xanthomonas.

PubMed

Ahern, Stephen J; Das, Mayukh; Bhowmick, Tushar Suvra; Young, Ry; Gonzalez, Carlos F

2014-01-01

The xylem-limited bacterium Xylella fastidiosa is the causal agent of several plant diseases, most notably Pierce's disease of grape and citrus variegated chlorosis. We report the isolation and characterization of the first virulent phages for X. fastidiosa, siphophages Sano and Salvo and podophages Prado and Paz, with a host range that includes Xanthomonas spp. Phages propagated on homologous hosts had observed adsorption rate constants of ~4 × 10(-12) ml cell(-1) min(-1) for X. fastidiosa strain Temecula 1 and ~5 × 10(-10) to 7 × 10(-10) ml cell(-1) min(-1) for Xanthomonas strain EC-12. Sano and Salvo exhibit >80% nucleotide identity to each other in aligned regions and are syntenic to phage BcepNazgul. We propose that phage BcepNazgul is the founding member of a novel phage type, to which Sano and Salvo belong. The lysis genes of the Nazgul-like phage type include a gene that encodes an outer membrane lipoprotein endolysin and also spanin gene families that provide insight into the evolution of the lysis pathway for phages of Gram-negative hosts. Prado and Paz, although exhibiting no significant DNA homology to each other, are new members of the phiKMV-like phage type, based on the position of the single-subunit RNA polymerase gene. The four phages are type IV pilus dependent for infection of both X. fastidiosa and Xanthomonas. The phages may be useful as agents for an effective and environmentally responsible strategy for the control of diseases caused by X. fastidiosa.

Characterization of Novel Virulent Broad-Host-Range Phages of Xylella fastidiosa and Xanthomonas

PubMed Central

Ahern, Stephen J.; Das, Mayukh; Bhowmick, Tushar Suvra; Young, Ry

2014-01-01

The xylem-limited bacterium Xylella fastidiosa is the causal agent of several plant diseases, most notably Pierce's disease of grape and citrus variegated chlorosis. We report the isolation and characterization of the first virulent phages for X. fastidiosa, siphophages Sano and Salvo and podophages Prado and Paz, with a host range that includes Xanthomonas spp. Phages propagated on homologous hosts had observed adsorption rate constants of ∼4 × 10−12 ml cell−1 min−1 for X. fastidiosa strain Temecula 1 and ∼5 × 10−10 to 7 × 10−10 ml cell−1 min−1 for Xanthomonas strain EC-12. Sano and Salvo exhibit >80% nucleotide identity to each other in aligned regions and are syntenic to phage BcepNazgul. We propose that phage BcepNazgul is the founding member of a novel phage type, to which Sano and Salvo belong. The lysis genes of the Nazgul-like phage type include a gene that encodes an outer membrane lipoprotein endolysin and also spanin gene families that provide insight into the evolution of the lysis pathway for phages of Gram-negative hosts. Prado and Paz, although exhibiting no significant DNA homology to each other, are new members of the phiKMV-like phage type, based on the position of the single-subunit RNA polymerase gene. The four phages are type IV pilus dependent for infection of both X. fastidiosa and Xanthomonas. The phages may be useful as agents for an effective and environmentally responsible strategy for the control of diseases caused by X. fastidiosa. PMID:24214944

Electrostatic networks control plug stabilization in the PapC usher.

PubMed

Pham, Thieng; Henderson, Nadine S; Werneburg, Glenn T; Thanassi, David G; Delcour, Anne H

2015-01-01

The PapC usher, a β-barrel pore in the outer membrane of uropathogenic Escherichia coli, is used for assembly of the P pilus, a key virulence factor in bacterial colonization of human kidney cells. Each PapC protein is composed of a 24-stranded β-barrel channel, flanked by N- and C-terminal globular domains protruding into the periplasm, and occluded by a plug domain (PD). The PD is displaced from the channel towards the periplasm during pilus biogenesis, but the molecular mechanism for PD displacement remains unclear. Two structural features within the β-barrel, an α-helix and β5-6 hairpin loop, may play roles in controlling plug stabilization. Here we have tested clusters of residues at the interface of the plug, barrel, α-helix and hairpin, which participate in electrostatic networks. To assess the roles of these residues in plug stabilization, we used patch-clamp electrophysiology to compare the activity of wild-type and mutant PapC channels containing alanine substitutions at these sites. Mutations interrupting each of two salt bridge networks were relatively ineffective in disrupting plug stabilization. However, mutation of two pairs of arginines located at the inner and the outer surfaces of the PD resulted in an enhanced propensity for plug displacement. One arginine pair involved in a repulsive interaction between the linkers that tether the plug to the β-barrel was particularly sensitive to mutation. These results suggest that plug displacement, which is necessary for pilus assembly and translocation, may require a weakening of key electrostatic interactions between the plug linkers, and the plug and the α-helix.

Major antigenic determinants of F and ColB2 pili.

PubMed Central

Finlay, B B; Frost, L S; Paranchych, W; Parker, J M; Hodges, R S

1985-01-01

F-like conjugative pili are expressed by plasmids with closely related transfer systems. They are tubular filaments that are composed of repeating pilin subunits arranged in a helical array. Both F and ColB2 pilin have nearly identical protein sequences, and both contain an acetylated amino-terminal alanine residue. However, they differ by a few amino acid residues at their amino termini. Rabbit antisera raised against purified F and ColB2 pili are immunologically cross-reactive by only 25%, as measured by a competition enzyme-linked immunosorbent assay (ELISA). A tryptic peptide corresponding to the first 15 amino acid residues of ColB2 pilin was isolated and found to remove nearly 80% of ColB2 pilus-directed rabbit antibodies. The corresponding tryptic peptide from F pilin, which reacted with anti-F pilus antibodies to remove 80%, was less than 20% reactive with anti-ColB2 pilus antiserum. Cleavage of these peptides with cyanogen bromide (at a methionine residue approximately in the middle of the peptide) did not affect the antigenicity of these peptides. Synthetic N alpha-acetylated peptides corresponding to the first eight amino acids of F pilin (Ac-Ala-Gly-Ser-Ser-Gly-Gln-Asp-Leu-COOH) and the first six amino acids of ColB2 pilin (Ac-Ala-Gln-Gly-Gln-Asp-Leu-COOH) were prepared and tested by competition ELISA with homologous and heterologous anti-pilus antisera. The F peptide F(1-8) inhibited the interaction of F pili and anti-F pilus antiserum to 80%, while the ColB2 peptide ColB2(1-6) inhibited anti-ColB2 pilus antiserum reacting with ColB2 pili by greater than 60%. The two peptides F(1-8) and ColB2(1-6) were inactive by competition ELISAs with heterologous antisera. These results suggest that the major antigenic determinant of both F and ColB2 pili is at the amino terminus of the pilin subunit and that 80% of antibodies raised against these pili are specific for this region of the pilin molecule. PMID:2409073

Characterization of Escherichia coli Type 1 Pilus Mutants with Altered Binding Specificities

PubMed Central

Harris, Sandra L.; Spears, Patricia A.; Havell, Edward A.; Hamrick, Terri S.; Horton, John R.; Orndorff, Paul E.

2001-01-01

PCR mutagenesis and a unique enrichment scheme were used to obtain two mutants, each with a single lesion in fimH, the chromosomal gene that encodes the adhesin protein (FimH) of Escherichia coli type 1 pili. These mutants were noteworthy in part because both were altered in the normal range of cell types bound by FimH. One mutation altered an amino acid at a site previously shown to be involved in temperature-dependent binding, and the other altered an amino acid lining the predicted FimH binding pocket. PMID:11395476

Pili of oral Streptococcus sanguinis bind to fibronectin and contribute to cell adhesion.

PubMed

Okahashi, Nobuo; Nakata, Masanobu; Sakurai, Atsuo; Terao, Yutaka; Hoshino, Tomonori; Yamaguchi, Masaya; Isoda, Ryutaro; Sumitomo, Tomoko; Nakano, Kazuhiko; Kawabata, Shigetada; Ooshima, Takashi

2010-01-08

Streptococcus sanguinis is a predominant bacterium in the human oral cavity and occasionally causes infective endocarditis. We identified a unique cell surface polymeric structure named pili in this species and investigated its functions in regard to its potential virulence. Pili of S. sanguinis strain SK36 were shown to be composed of three distinctive pilus proteins (PilA, PilB, and PilC), and a pili-deficient mutant demonstrated reduced bacterial adherence to HeLa and human oral epithelial cells. PilC showed a binding ability to fibronectin, suggesting that pili are involved in colonization by this species. In addition, ATCC10556, a standard S. sanguinis strain, was unable to produce pili due to defective pilus genes, which indicates a diversity of pilus expression among various S. sanguinis strains. Copyright 2009 Elsevier Inc. All rights reserved.

A conserved tad pilus promotes Vibrio vulnificus oyster colonization.

PubMed

Pu, Meng; Duriez, Patrick; Arazi, Mattan; Rowe-Magnus, Dean A

2018-02-01

Vibrio vulnificus has the highest death rate (>35%) and per-case economic burden ($3.3 million) of any foodborne pathogen in the United States. Infections occur via open wounds or following ingestion of contaminated seafood, most infamously oysters. We isolated a 1000th generation descendant, designated NT that exhibited increased biofilm and aggregate formation relative to its parent. We identified two significant causal changes underlying these phenotypes. First, the entire 24-kb capsular polysaccharide biosynthesis locus, which is essential for virulence but inhibits biofilm formation, had been purged from the genome. However, NT formed more extensive biofilms and aggregates than a defined cps mutant, suggesting that additional factor(s) contributed to its phenotypes. Second, the expression of a tight adherence (tad) pilus locus was elevated in NT. Deletion of the associated pilin (flp) decreased NT biofilm and aggregate formation. Furthermore, NTΔflp strains were deficient relative to NT in an oyster colonization model, demonstrating a positive correlation between the biofilm and aggregation phenotypes associated with Tad pilus production and efficient bacterial retention by feeding oysters. Despite being widely distributed in the Vibrionaceae, this is the first demonstration of a bona fide physiological role for a Tad pilus in this bacterial family. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Genetic mapping of secretion and functional determinants of the Vibrio cholerae TcpF colonization factor.

PubMed

Krebs, Shelly J; Kirn, Thomas J; Taylor, Ronald K

2009-06-01

Colonization of the human small intestine by Vibrio cholerae requires the type IV toxin-coregulated pilus (TCP). TcpF, which is encoded within the tcp operon, is secreted from the bacterial cell by the TCP apparatus and is also essential for colonization. Bacteria lacking tcpF are deficient in colonization, and anti-TcpF antibodies are protective in the infant mouse cholera model. In order to elucidate the regions of the protein that are required for secretion through the TCP apparatus and for its function in colonization, random mutagenesis of tcpF was performed. Analysis of these mutants suggests that multiple regions throughout the protein influence extracellular secretion and that determinants near the C terminus are important for the function of TcpF in colonization. The TcpF proteins of certain environmental V. cholerae isolates with 31% to 66% identity to pathogenic V. cholerae TcpF showed higher similarity in regions identified as secretion determinants but diverged in regions found to be important for colonization. These environmental TcpF proteins are secreted from the pathogenic strain; however, they do not mediate colonization in the infant mouse model. Here we provide genetic evidence pointing toward regions of TcpF that influence secretion, as well as regions that play an important role in in vivo colonization.

Force generation by groups of migrating bacteria

PubMed Central

Koch, Matthias D.; Liu, Guannan; Stone, Howard A.; Shaevitz, Joshua W.

2017-01-01

From colony formation in bacteria to wound healing and embryonic development in multicellular organisms, groups of living cells must often move collectively. Although considerable study has probed the biophysical mechanisms of how eukaryotic cells generate forces during migration, little such study has been devoted to bacteria, in particular with regard to the question of how bacteria generate and coordinate forces during collective motion. This question is addressed here using traction force microscopy. We study two distinct motility mechanisms of Myxococcus xanthus, namely, twitching and gliding. For twitching, powered by type-IV pilus retraction, we find that individual cells exert local traction in small hotspots with forces on the order of 50 pN. Twitching bacterial groups also produce traction hotspots, but with forces around 100 pN that fluctuate rapidly on timescales of <1.5 min. Gliding, the second motility mechanism, is driven by lateral transport of substrate adhesions. When cells are isolated, gliding produces low average traction on the order of 1 Pa. However, traction is amplified approximately fivefold in groups. Advancing protrusions of gliding cells push, on average, in the direction of motion. Together, these results show that the forces generated during twitching and gliding have complementary characters, and both forces have higher values when cells are in groups. PMID:28655845

Force generation by groups of migrating bacteria.

PubMed

Sabass, Benedikt; Koch, Matthias D; Liu, Guannan; Stone, Howard A; Shaevitz, Joshua W

2017-07-11

From colony formation in bacteria to wound healing and embryonic development in multicellular organisms, groups of living cells must often move collectively. Although considerable study has probed the biophysical mechanisms of how eukaryotic cells generate forces during migration, little such study has been devoted to bacteria, in particular with regard to the question of how bacteria generate and coordinate forces during collective motion. This question is addressed here using traction force microscopy. We study two distinct motility mechanisms of Myxococcus xanthus , namely, twitching and gliding. For twitching, powered by type-IV pilus retraction, we find that individual cells exert local traction in small hotspots with forces on the order of 50 pN. Twitching bacterial groups also produce traction hotspots, but with forces around 100 pN that fluctuate rapidly on timescales of <1.5 min. Gliding, the second motility mechanism, is driven by lateral transport of substrate adhesions. When cells are isolated, gliding produces low average traction on the order of 1 Pa. However, traction is amplified approximately fivefold in groups. Advancing protrusions of gliding cells push, on average, in the direction of motion. Together, these results show that the forces generated during twitching and gliding have complementary characters, and both forces have higher values when cells are in groups.

Seventeen Sxy-Dependent Cyclic AMP Receptor Protein Site-Regulated Genes Are Needed for Natural Transformation in Haemophilus influenzae

PubMed Central

Mell, Joshua C.; Redfield, Rosemary J.

2012-01-01

Natural competence is the ability of bacteria to actively take up extracellular DNA. This DNA can recombine with the host chromosome, transforming the host cell and altering its genotype. In Haemophilus influenzae, natural competence is induced by energy starvation and the depletion of nucleotide pools. This induces a 26-gene competence regulon (Sxy-dependent cyclic AMP receptor protein [CRP-S] regulon) whose expression is controlled by two regulators, CRP and Sxy. The role of most of the CRP-S genes in DNA uptake and transformation is not known. We have therefore created in-frame deletions of each CRP-S gene and studied their competence phenotypes. All but one gene (ssb) could be deleted. Although none of the remaining CRP-S genes were required for growth in rich medium or survival under starvation conditions, DNA uptake and transformation were abolished or reduced in most of the mutants. Seventeen genes were absolutely required for transformation, with 14 of these genes being specifically required for the assembly and function of the type IV pilus DNA uptake machinery. Only five genes were dispensable for both competence and transformation. This is the first competence regulon for which all genes have been mutationally characterized. PMID:22821979

Oral vaccination against bubonic plague using a live avirulent Yersinia pseudotuberculosis strain.

PubMed

Blisnick, Thierry; Ave, Patrick; Huerre, Michel; Carniel, Elisabeth; Demeure, Christian E

2008-08-01

We evaluated the possibility of using Yersinia pseudotuberculosis as a live vaccine against plague because it shares high genetic identity with Y. pestis while being much less virulent, genetically much more stable, and deliverable orally. A total of 41 Y. pseudotuberculosis strains were screened by PCR for the absence of the high pathogenicity island, the superantigens YPM, and the type IV pilus and the presence of the pYV virulence plasmid. One strain (IP32680) fulfilled these criteria. This strain was avirulent in mice upon intragastric or subcutaneous inoculation and persisted for 2 months in the mouse intestine without clinical signs of disease. IP32680 reached the mesenteric lymph nodes, spleen, and liver without causing major histological lesions and was cleared after 13 days. The antibodies produced in vaccinated animals recognized both Y. pseudotuberculosis and Y. pestis antigens efficiently. After a subcutaneous challenge with Y. pestis CO92, bacteria were found in low amounts in the organs and rarely in the blood of vaccinated animals. One oral IP32680 inoculation protected 75% of the mice, and two inoculations induced much higher antibody titers and protected 88% of the mice. Our results thus validate the concept that an attenuated Y. pseudotuberculosis strain can be an efficient, inexpensive, safe, and easy-to-produce live vaccine for oral immunization against bubonic plague.

Seventeen Sxy-dependent cyclic AMP receptor protein site-regulated genes are needed for natural transformation in Haemophilus influenzae.

PubMed

Sinha, Sunita; Mell, Joshua C; Redfield, Rosemary J

2012-10-01

Natural competence is the ability of bacteria to actively take up extracellular DNA. This DNA can recombine with the host chromosome, transforming the host cell and altering its genotype. In Haemophilus influenzae, natural competence is induced by energy starvation and the depletion of nucleotide pools. This induces a 26-gene competence regulon (Sxy-dependent cyclic AMP receptor protein [CRP-S] regulon) whose expression is controlled by two regulators, CRP and Sxy. The role of most of the CRP-S genes in DNA uptake and transformation is not known. We have therefore created in-frame deletions of each CRP-S gene and studied their competence phenotypes. All but one gene (ssb) could be deleted. Although none of the remaining CRP-S genes were required for growth in rich medium or survival under starvation conditions, DNA uptake and transformation were abolished or reduced in most of the mutants. Seventeen genes were absolutely required for transformation, with 14 of these genes being specifically required for the assembly and function of the type IV pilus DNA uptake machinery. Only five genes were dispensable for both competence and transformation. This is the first competence regulon for which all genes have been mutationally characterized.

Role of the Emp Pilus Subunits of Enterococcus faecium in Biofilm Formation, Adherence to Host Extracellular Matrix Components, and Experimental Infection

PubMed Central

Montealegre, Maria Camila; Singh, Kavindra V.; Somarajan, Sudha R.; Yadav, Puja; Chang, Chungyu; Spencer, Robert; Sillanpää, Jouko; Ton-That, Hung

2016-01-01

Enterococcus faecium is an important cause of hospital-associated infections, including urinary tract infections (UTIs), bacteremia, and infective endocarditis. Pili have been shown to play a role in the pathogenesis of Gram-positive bacteria, including E. faecium. We previously demonstrated that a nonpiliated ΔempABC::cat derivative of E. faecium TX82 was attenuated in biofilm formation and in a UTI model. Here, we studied the contributions of the individual pilus subunits EmpA, EmpB, and EmpC to pilus architecture, biofilm formation, adherence to extracellular matrix (ECM) proteins, and infection. We identified EmpA as the tip of the pili and found that deletion of empA reduced biofilm formation to the same level as deletion of the empABC operon, a phenotype that was restored by reconstituting in situ the empA gene. Deletion of empB also caused a reduction in biofilm, while EmpC was found to be dispensable. Significant reductions in adherence to fibrinogen and collagen type I were observed with deletion of empA and empB, while deletion of empC had no adherence defect. Furthermore, we showed that each deletion mutant was significantly attenuated in comparison to the isogenic parental strain, TX82, in a mixed-inoculum UTI model (P < 0.001 to 0.048), that reconstitution of empA restored virulence in the UTI model, and that deletion of empA also resulted in attenuation in an infective endocarditis model (P = 0.0088). Our results indicate that EmpA and EmpB, but not EmpC, contribute to biofilm and adherence to ECM proteins; however, all the Emp pilins are important for E. faecium to cause infection in the urinary tract. PMID:26930703

Lactobacillus rhamnosus GG and its SpaC pilus adhesin modulate inflammatory responsiveness and TLR-related gene expression in the fetal human gut

PubMed Central

Ganguli, Kriston; Collado, Maria Carmen; Rautava, Jaana; Lu, Lei; Satokari, Reetta; von Ossowski, Ingemar; Reunanen, Justus; de Vos, Willem M.; Palva, Airi; Isolauri, Erika; Salminen, Seppo; Walker, W. Allan; Rautava, Samuli

2015-01-01

Background Bacterial contact in utero modulates fetal and neonatal immune responses. Maternal probiotic supplementation reduces the risk of immune-mediated disease in the infant. We investigated the immunomodulatory properties of live Lactobacillus rhamnosus GG and its SpaC pilus adhesin in human fetal intestinal models. Methods TNF-α mRNA expression was measured by qPCR in a human fetal intestinal organ culture model exposed to live L. rhamnosus GG and proinflammatory stimuli. Binding of recombinant SpaC pilus protein to intestinal epithelial cells was assessed in human fetal intestinal organ culture and the human fetal intestinal epithelial cell line H4 by immunohistochemistry and immunofluorescence, respectively. TLR-related gene expression in fetal ileal organ culture after exposure to recombinant SpaC was assessed by qPCR. Results Live L. rhamnosus GG significantly attenuates pathogen-induced TNF-α mRNA expression in the human fetal gut. Recombinant SpaC protein was found to adhere to the fetal gut and to modulate varying levels of TLR-related gene expression. Conclusion The human fetal gut is responsive to luminal microbes. L. rhamnosus GG significantly attenuates fetal intestinal inflammatory responses to pathogenic bacteria. The L. rhamnosus GG pilus adhesin SpaC binds to immature human intestinal epithelial cells and directly modulates intestinal epithelial cell innate immune gene expression. PMID:25580735

Binding of CFA/I Pili of Enterotoxigenic Escherichia coli to Asialo-GM1 Is Mediated by the Minor Pilin CfaE

PubMed Central

Madhavan, T. P. Vipin; Riches, James D.; Scanlon, Martin J.

2016-01-01

CFA/I pili are representatives of a large family of related pili that mediate the adherence of enterotoxigenic Escherichia coli to intestinal epithelial cells. They are assembled via the alternate chaperone-usher pathway and consist of two subunits, CfaB, which makes up the pilus shaft and a single pilus tip-associated subunit, CfaE. The current model of pilus-mediated adherence proposes that CFA/I has two distinct binding activities; the CfaE subunit is responsible for binding to receptors of unknown structure on erythrocyte and intestinal epithelial cell surfaces, while CfaB binds to various glycosphingolipids, including asialo-GM1. In this report, we present two independent lines of evidence that, contrary to the existing model, CfaB does not bind to asialo-GM1 independently of CfaE. Neither purified CfaB subunits nor CfaB assembled into pili bind to asialo-GM1. Instead, we demonstrate that binding activity toward asialo-GM1 resides in CfaE and this is essential for pilus binding to Caco-2 intestinal epithelial cells. We conclude that the binding activities of CFA/I pili for asialo-GM1, erythrocytes, and intestinal cells are inseparable, require the same amino acid residues in CfaE, and therefore depend on the same or very similar binding mechanisms. PMID:26975993

Binding of CFA/I Pili of Enterotoxigenic Escherichia coli to Asialo-GM1 Is Mediated by the Minor Pilin CfaE.

PubMed

Madhavan, T P Vipin; Riches, James D; Scanlon, Martin J; Ulett, Glen C; Sakellaris, Harry

2016-05-01

CFA/I pili are representatives of a large family of related pili that mediate the adherence of enterotoxigenic Escherichia coli to intestinal epithelial cells. They are assembled via the alternate chaperone-usher pathway and consist of two subunits, CfaB, which makes up the pilus shaft and a single pilus tip-associated subunit, CfaE. The current model of pilus-mediated adherence proposes that CFA/I has two distinct binding activities; the CfaE subunit is responsible for binding to receptors of unknown structure on erythrocyte and intestinal epithelial cell surfaces, while CfaB binds to various glycosphingolipids, including asialo-GM1. In this report, we present two independent lines of evidence that, contrary to the existing model, CfaB does not bind to asialo-GM1 independently of CfaE. Neither purified CfaB subunits nor CfaB assembled into pili bind to asialo-GM1. Instead, we demonstrate that binding activity toward asialo-GM1 resides in CfaE and this is essential for pilus binding to Caco-2 intestinal epithelial cells. We conclude that the binding activities of CFA/I pili for asialo-GM1, erythrocytes, and intestinal cells are inseparable, require the same amino acid residues in CfaE, and therefore depend on the same or very similar binding mechanisms. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Human Gut-Commensalic Lactobacillus ruminis ATCC 25644 Displays Sortase-Assembled Surface Piliation: Phenotypic Characterization of Its Fimbrial Operon through In Silico Predictive Analysis and Recombinant Expression in Lactococcus lactis

PubMed Central

Yu, Xia; Lyytinen, Outi; Kant, Ravi; Åvall-Jääskeläinen, Silja; von Ossowski, Ingemar; Palva, Airi

2015-01-01

Sortase-dependent surface pili (or fimbriae) in Gram-positive bacteria are well documented as a key virulence factor for certain harmful opportunistic pathogens. However, it is only recently known that these multi-subunit protein appendages are also belonging to the “friendly” commensals and now, with this new perspective, they have come to be categorized as a niche-adaptation factor as well. In this regard, it was shown earlier that sortase-assembled piliation is a native fixture of two human intestinal commensalics (i.e., Lactobacillus rhamnosus and Bifidobacterium bifidum), and correspondingly where the pili involved have a significant role in cellular adhesion and immunomodulation processes. We now reveal that intestinal indigenous (or autochthonous) Lactobacillus ruminis is another surface-piliated commensal lactobacillar species. Heeding to in silico expectations, the predicted loci for the LrpCBA-called pili are organized tandemly in the L. ruminis genome as a canonical fimbrial operon, which then encodes for three pilin-proteins and a single C-type sortase enzyme. Through electron microscopic means, we showed that these pilus formations are a surface assemblage of tip, basal, and backbone pilin subunits (respectively named LrpC, LrpB, and LrpA) in L. ruminis, and also when expressed recombinantly in Lactococcus lactis. As well, by using the recombinant-piliated lactococci, we could define certain ecologically relevant phenotypic traits, such as the ability to adhere to extracellular matrix proteins and gut epithelial cells, but also to effectuate an induced dampening on Toll-like receptor 2 signaling and interleukin-8 responsiveness in immune-related cells. Within the context of the intestinal microcosm, by wielding such niche-advantageous cell-surface properties the LrpCBA pilus would undoubtedly have a requisite functional role in the colonization dynamics of L. ruminis indigeneity. Our study provides only the second description of a native-piliated Lactobacillus species, but at the same time also involves the structural and functional characterization of a third type of lactobacillar pilus. PMID:26709916

Protein Export According to Schedule: Architecture, Assembly, and Regulation of Type III Secretion Systems from Plant- and Animal-Pathogenic Bacteria

PubMed Central

2012-01-01

Summary: Flagellar and translocation-associated type III secretion (T3S) systems are present in most Gram-negative plant- and animal-pathogenic bacteria and are often essential for bacterial motility or pathogenicity. The architectures of the complex membrane-spanning secretion apparatuses of both systems are similar, but they are associated with different extracellular appendages, including the flagellar hook and filament or the needle/pilus structures of translocation-associated T3S systems. The needle/pilus is connected to a bacterial translocon that is inserted into the host plasma membrane and mediates the transkingdom transport of bacterial effector proteins into eukaryotic cells. During the last 3 to 5 years, significant progress has been made in the characterization of membrane-associated core components and extracellular structures of T3S systems. Furthermore, transcriptional and posttranscriptional regulators that control T3S gene expression and substrate specificity have been described. Given the architecture of the T3S system, it is assumed that extracellular components of the secretion apparatus are secreted prior to effector proteins, suggesting that there is a hierarchy in T3S. The aim of this review is to summarize our current knowledge of T3S system components and associated control proteins from both plant- and animal-pathogenic bacteria. PMID:22688814

Carboxylic acid isosteres improve the activity of ring-fused 2-pyridones that inhibit pilus biogenesis in E. coli

PubMed Central

Åberg, Veronica; Das, Pralay; Chorell, Erik; Hedenström, Mattias; Pinkner, Jerome S.; Hultgren, Scott J.; Almqvist, Fredrik

2009-01-01

Ring-fused 2-pyridones, termed pilicides, are small synthetic compounds that inhibit pilus assembly in uropathogenic E. coli. Their biological activity is clearly dependent upon a carboxylic acid functionality. Here we present the synthesis and biological evaluation of carboxylic acid isosteres, including e.g. tetrazoles, acyl sulfonamides and hydroxamic acids, of two lead 2-pyridones. Two independent biological evaluations show that acyl sulfonamides and tetrazoles significantly improve pilicide activity against uropathogenic E. coli. PMID:18499455

Isopeptide bonds of the major pilin protein BcpA influence pilus structure and bundle formation on the surface of Bacillus cereus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hendrickx, Antoni P.A.; Poor, Catherine B.; Jureller, Justin E.

Bacillus cereus strains elaborate pili on their surface using a mechanism of sortase-mediated cross-linking of major and minor pilus components. Here we used a combination of electron microscopy and atomic force microscopy to visualize these structures. Pili occur as single, double or higher order assemblies of filaments formed from monomers of the major pilin, BcpA, capped by the minor pilin, BcpB. Previous studies demonstrated that within assembled pili, four domains of BcpA -- CNA{sub 1}, CNA{sub 2}, XNA and CNA{sub 3} -- each acquire intramolecular lysine-asparagine isopeptide bonds formed via catalytic glutamic acid or aspartic acid residues. Here we showedmore » that mutants unable to form the intramolecular isopeptide bonds in the CNA2 or CNA3 domains retain the ability to form pilus bundles. A mutant lacking the CNA{sub 1} isopeptide bond assembled deformed pilin subunits that failed to associate as bundles. X-ray crystallography revealed that the BcpA variant Asp{sup 312}Ala, lacking an aspartyl catalyst, did not generate the isopeptide bond within the jelly-roll structure of XNA. The Asp{sup 312}Ala mutant was also unable to form bundles and promoted the assembly of deformed pili. Thus, structural integrity of the CNA{sub 1} and XNA domains are determinants for the association of pili into higher order bundle structures and determine native pilus structure.« less

Antigen-antibody interaction. The immunodominant region of EDP208 pili.

PubMed

Worobec, E A; Paranchych, W; Parker, J M; Taneja, A K; Hodges, R S

1985-01-25

The EDP208 pilus contains a major antigenic determinant in the N-terminal dodecapeptide, as shown by E. A. Worobec, A. K. Taneja, R. S. Hodges, and W. Paranchych ((1983) J. Bacteriol. 153, 955-961). This peptide was chemically synthesized, coupled to bovine serum albumin with N-hydroxysuccinimidyl p-azido-benzoate, and used in immunoblot and enzyme-linked immunosorbent assays to show it was capable of reacting with anti-EDP208 pilus antibodies. Antibodies raised against the synthetic peptide conjugate were also capable of reacting with whole pili in these assays. To further examine the specific residues responsible for the antigenicity of this site, several peptide analogs were chemically synthesized. The relative affinity of these peptides for anti-EDP208 pilus antibodies was determined by a competitive enzyme-linked immunosorbent assay using the Fab fragment of anti-EDP208 pilus immunoglobulin G. From these results we established that the antigenic region of this peptide was the N-terminal pentapeptide, N-acetyl-Thr-Asp-Leu-Leu-Ala, and the key residues responsible for the antibody-antigen interaction are the N-acetyl-Thr1, Leu3, and Leu4. Hydrophobic interactions involving the methyl of the acetyl group and the leucine side chains make the largest contributions to the antigen-antibody interaction, while a lesser contribution is made by the Thr1 hydroxyl. The side chains of Asp2 and Ala5 contribute only weakly to the stabilization of the antigen-antibody complex.

Harnessing the power of microbial nanowires.

PubMed

Reguera, Gemma

2018-05-27

The reduction of iron oxide minerals and uranium in model metal reducers in the genus Geobacter is mediated by conductive pili composed primarily of a structurally divergent pilin peptide that is otherwise recognized, processed and assembled in the inner membrane by a conserved Type IVa pilus apparatus. Electronic coupling among the peptides is promoted upon assembly, allowing the discharge of respiratory electrons at rates that greatly exceed the rates of cellular respiration. Harnessing the unique properties of these conductive appendages and their peptide building blocks in metal bioremediation will require understanding of how the pilins assemble to form a protein nanowire with specialized sites for metal immobilization. Also important are insights into how cells assemble the pili to make an electroactive matrix and grow on electrodes as biofilms that harvest electrical currents from the oxidation of waste organic substrates. Genetic engineering shows promise to modulate the properties of the peptide building blocks, protein nanowires and current-harvesting biofilms for various applications. This minireview discusses what is known about the pilus material properties and reactions they catalyse and how this information can be harnessed in nanotechnology, bioremediation and bioenergy applications. © 2018 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Comparative proteomic analysis reveals that T3SS, Tfp, and xanthan gum are key factors in initial stages of Citrus sinensis infection by Xanthomonas citri subsp. citri.

PubMed

Facincani, Agda P; Moreira, Leandro M; Soares, Márcia R; Ferreira, Cristiano B; Ferreira, Rafael M; Ferro, Maria I T; Ferro, Jesus A; Gozzo, Fabio C; de Oliveira, Julio C F

2014-03-01

The bacteria Xanthomonas citri subsp. citri (Xac) is the causal agent of citrus canker. The disease symptoms are characterized by localized host cell hyperplasia followed by tissue necrosis at the infected area. An arsenal of bacterial pathogenicity- and virulence-related proteins is expressed to ensure a successful infection process. At the post-genomic stage of Xac, we used a proteomic approach to analyze the proteins that are displayed differentially over time when the pathogen attacks the host plant. Protein extracts were prepared from infectious Xac grown in inducing medium (XAM1) for 24 h or from host citrus plants for 3 or 5 days after infection, detached times to evaluate the adaptation and virulence of the pathogen. The protein extracts were proteolyzed, and the peptides derived from tryptic digestion were investigated using liquid chromatography and tandem mass spectrometry. Changes in the protein expression profile were compared with the Xac genome and the proteome recently described under non-infectious conditions. An analysis of the proteome of Xac under infectious conditions revealed proteins directly involved in virulence such as the type III secretion system (T3SS) and effector proteins (T3SS-e), the type IV pilus (Tfp), and xanthan gum biosynthesis. Moreover, four new mutants related to proteins detected in the proteome and with different functions exhibited reduced virulence relative to the wild-type proteins. The results of the proteome analysis of infectious Xac define the processes of adaptation to the host and demonstrate the induction of the virulence factors of Xac involved in plant-pathogen interactions.

The Legionella pneumophila PilT Homologue DotB Exhibits ATPase Activity That Is Critical for Intracellular Growth

PubMed Central

Sexton, Jessica A.; Pinkner, Jerome S.; Roth, Robyn; Heuser, John E.; Hultgren, Scott J.; Vogel, Joseph P.

2004-01-01

The ability of Legionella pneumophila to grow and cause disease in the host is completely dependent on a type IV secretion system known as the Dot/Icm complex. This membrane-spanning apparatus translocates effector molecules into host cells in a process that is poorly understood but that is known to require the putative ATPase DotB. One possible role for DotB is suggested by its similarity to the PilT family of proteins, which mediate pilus retraction. To better understand the molecular behavior of DotB, we have purified the protein and shown that it forms stable homohexameric rings and hydrolyzes ATP with a specific activity of 6.4 nmol of ATP/min/mg of protein. ATPase activity is critical to the function of DotB, as alteration of the conserved Walker box lysine residue resulted in a mutant protein, DotB K162Q, which failed to bind or hydrolyze ATP and which could not complement a ΔdotB strain for intracellular growth in macrophages. Consistent with the ability of DotB to interact with itself, the dotBK162Q allele exhibited transdominance over wild-type dotB, providing the first example of such a mutation in L. pneumophila. Finally, the DotB K162Q mutant protein had a significantly enhanced membrane localization in L. pneumophila compared to wild-type DotB, suggesting a relationship between nucleotide binding and membrane association. These results are consistent with a model in which DotB cycles between the cytoplasm and the Dot/Icm complex at the membrane, where it hydrolyzes nucleotides to provide energy to the complex. PMID:14996796

Electron transfer at the cell-uranium interface in Geobacter spp.

PubMed

Reguera, Gemma

2012-12-01

The in situ stimulation of Fe(III) oxide reduction in the subsurface stimulates the growth of Geobacter spp. and the precipitation of U(VI) from groundwater. As with Fe(III) oxide reduction, the reduction of uranium by Geobacter spp. requires the expression of their conductive pili. The pili bind the soluble uranium and catalyse its extracellular reductive precipitation along the pili filaments as a mononuclear U(IV) complexed by carbon-containing ligands. Although most of the uranium is immobilized by the pili, some uranium deposits are also observed in discreet regions of the outer membrane, consistent with the participation of redox-active foci, presumably c-type cytochromes, in the extracellular reduction of uranium. It is unlikely that cytochromes released from the outer membrane could associate with the pili and contribute to the catalysis, because scanning tunnelling microscopy spectroscopy did not reveal any haem-specific electronic features in the pili, but, rather, showed topographic and electronic features intrinsic to the pilus shaft. Pili not only enhance the rate and extent of uranium reduction per cell, but also prevent the uranium from traversing the outer membrane and mineralizing the cell envelope. As a result, pili expression preserves the essential respiratory activities of the cell envelope and the cell's viability. Hence the results support a model in which the conductive pili function as the primary mechanism for the reduction of uranium and cellular protection in Geobacter spp.

Analysis of complete genome sequence of Neorickettsia risticii: causative agent of Potomac horse fever

PubMed Central

Lin, Mingqun; Zhang, Chunbin; Gibson, Kathryn; Rikihisa, Yasuko

2009-01-01

Neorickettsia risticii is an obligate intracellular bacterium of the trematodes and mammals. Horses develop Potomac horse fever (PHF) when they ingest aquatic insects containing encysted N. risticii-infected trematodes. The complete genome sequence of N. risticii Illinois consists of a single circular chromosome of 879 977 bp and encodes 38 RNA species and 898 proteins. Although N. risticii has limited ability to synthesize amino acids and lacks many metabolic pathways, it is capable of making major vitamins, cofactors and nucleotides. Comparison with its closely related human pathogen N. sennetsu showed that 758 (88.2%) of protein-coding genes are conserved between N. risticii and N. sennetsu. Four-way comparison of genes among N. risticii and other Anaplasmataceae showed that most genes are either shared among Anaplasmataceae (525 orthologs that generally associated with housekeeping functions), or specific to each genome (>200 genes that are mostly hypothetical proteins). Genes potentially involved in the pathogenesis of N. risticii were identified, including those encoding putative outer membrane proteins, two-component systems and a type IV secretion system (T4SS). The bipolar localization of T4SS pilus protein VirB2 on the bacterial surface was demonstrated for the first time in obligate intracellular bacteria. These data provide insights toward genomic potential of N. risticii and intracellular parasitism, and facilitate our understanding of PHF pathogenesis. PMID:19661282

Analysis of complete genome sequence of Neorickettsia risticii: causative agent of Potomac horse fever.

PubMed

Lin, Mingqun; Zhang, Chunbin; Gibson, Kathryn; Rikihisa, Yasuko

2009-10-01

Neorickettsia risticii is an obligate intracellular bacterium of the trematodes and mammals. Horses develop Potomac horse fever (PHF) when they ingest aquatic insects containing encysted N. risticii-infected trematodes. The complete genome sequence of N. risticii Illinois consists of a single circular chromosome of 879 977 bp and encodes 38 RNA species and 898 proteins. Although N. risticii has limited ability to synthesize amino acids and lacks many metabolic pathways, it is capable of making major vitamins, cofactors and nucleotides. Comparison with its closely related human pathogen N. sennetsu showed that 758 (88.2%) of protein-coding genes are conserved between N. risticii and N. sennetsu. Four-way comparison of genes among N. risticii and other Anaplasmataceae showed that most genes are either shared among Anaplasmataceae (525 orthologs that generally associated with housekeeping functions), or specific to each genome (>200 genes that are mostly hypothetical proteins). Genes potentially involved in the pathogenesis of N. risticii were identified, including those encoding putative outer membrane proteins, two-component systems and a type IV secretion system (T4SS). The bipolar localization of T4SS pilus protein VirB2 on the bacterial surface was demonstrated for the first time in obligate intracellular bacteria. These data provide insights toward genomic potential of N. risticii and intracellular parasitism, and facilitate our understanding of PHF pathogenesis.

Oral Vaccination against Bubonic Plague Using a Live Avirulent Yersinia pseudotuberculosis Strain ▿

PubMed Central

Blisnick, Thierry; Ave, Patrick; Huerre, Michel; Carniel, Elisabeth; Demeure, Christian E.

2008-01-01

We evaluated the possibility of using Yersinia pseudotuberculosis as a live vaccine against plague because it shares high genetic identity with Y. pestis while being much less virulent, genetically much more stable, and deliverable orally. A total of 41 Y. pseudotuberculosis strains were screened by PCR for the absence of the high pathogenicity island, the superantigens YPM, and the type IV pilus and the presence of the pYV virulence plasmid. One strain (IP32680) fulfilled these criteria. This strain was avirulent in mice upon intragastric or subcutaneous inoculation and persisted for 2 months in the mouse intestine without clinical signs of disease. IP32680 reached the mesenteric lymph nodes, spleen, and liver without causing major histological lesions and was cleared after 13 days. The antibodies produced in vaccinated animals recognized both Y. pseudotuberculosis and Y. pestis antigens efficiently. After a subcutaneous challenge with Y. pestis CO92, bacteria were found in low amounts in the organs and rarely in the blood of vaccinated animals. One oral IP32680 inoculation protected 75% of the mice, and two inoculations induced much higher antibody titers and protected 88% of the mice. Our results thus validate the concept that an attenuated Y. pseudotuberculosis strain can be an efficient, inexpensive, safe, and easy-to-produce live vaccine for oral immunization against bubonic plague. PMID:18505804

The expression of Longus type 4 pilus of enterotoxigenic Escherichia coli is regulated by LngR and LngS and by H-NS, CpxR and CRP global regulators.

PubMed

De la Cruz, Miguel A; Ruiz-Tagle, Alejandro; Ares, Miguel A; Pacheco, Sabino; Yáñez, Jorge A; Cedillo, Lilia; Torres, Javier; Girón, Jorge A

2017-05-01

Enterotoxigenic Escherichia coli produces a long type 4 pilus called Longus. The regulatory elements and the environmental signals controlling the expression of Longus-encoding genes are unknown. We identified two genes lngR and lngS in the Longus operon, whose predicted products share homology with transcriptional regulators. Isogenic lngR and lngS mutants were considerably affected in transcription of lngA pilin gene. The expression of lngA, lngR and lngS genes was optimally expressed at 37°C at pH 7.5. The presence of glucose and sodium chloride had a positive effect on Longus expression. The presence of divalent ions, particularly calcium, appears to be an important stimulus for Longus production. In addition, we studied H-NS, CpxR and CRP global regulators, on Longus expression. The response regulator CpxR appears to function as a positive regulator of lng genes as the cpxR mutant showed reduced levels of lngRSA expression. In contrast, H-NS and CRP function as negative regulators since expression of lngA was up-regulated in isogenic hns and crp mutants. H-NS and CRP were required for salt- and glucose-mediated regulation of Longus. Our data suggest the existence of a complex regulatory network controlling Longus expression, involving both local and global regulators in response to different environmental signals. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Analysis of the contribution of MTP and the predicted Flp pilus genes to Mycobacterium tuberculosis pathogenesis

PubMed Central

Mann, Katherine M.; Pride, Aaron C.; Flentie, Kelly; Kimmey, Jacqueline M.; Weiss, Leslie A.; Stallings, Christina L.

2016-01-01

Mycobacterium tuberculosis (Mtb) is one of the world’s most successful pathogens. Millions of new cases of tuberculosis occur each year, emphasizing the need for better methods of treatment. The design of novel therapeutics is dependent on our understanding of factors that are essential for pathogenesis. Many bacterial pathogens use pili and other adhesins to mediate pathogenesis. The recently identified Mycobacterium tuberculosis pilus (MTP) and the hypothetical, widely conserved Flp pilus have been speculated to be important for Mtb virulence based on in vitro studies and homology to other pili, respectively. However, the roles for these pili during infection have yet to be tested. We addressed this gap in knowledge and found that neither MTP nor the hypothetical Flp pilus is required for Mtb survival in mouse models of infection, although MTP can contribute to biofilm formation and subsequent isoniazid tolerance. However, differences in mtp expression did affect lesion architecture in infected lungs. Deletion of mtp did not correlate with loss of cell-associated extracellular structures as visualized by transmission electron microscopy in Mtb Erdman and HN878 strains, suggesting that the phenotypes of the mtp mutants were not due to defects in production of extracellular structures. These findings highlight the importance of testing the virulence of adhesion mutants in animal models to assess the contribution of the adhesin to infection. This study also underscores the need for further investigation into additional strategies that Mtb may use to adhere to its host so that we may understand how this pathogen invades, colonizes and disseminates. PMID:27586540

Using Recombinant Lactococci as an Approach to Dissect the Immunomodulating Capacity of Surface Piliation in Probiotic Lactobacillus rhamnosus GG

PubMed Central

Nummenmaa, Elina; Mäkinen, Veli-Matti; Reunanen, Justus; Satokari, Reetta; de Vos, Willem M.; Palva, Ilkka; Palva, Airi

2013-01-01

Primarily arising from their well understood beneficial health effects, many lactobacilli strains are considered good candidates for use as probiotics in humans and animals. Lactobacillar probiosis can itself be best typified by the Lactobacillus rhamnosus GG strain, which, with its well-documented clinical benefits, has emerged as one of the most widely used probiotics in the food and health-supplement industries. Even so, many facets of its molecular mechanisms and limitations as a beneficial commensal bacterium still remain to be thoroughly explored and dissected. Because L. rhamnosus GG is one of only a few such strains exhibiting surface piliation (called SpaCBA), we sought to examine whether this particular type of cell-surface appendage has a discernible immunomodulating capacity and is able to trigger targeted responses in human immune-related cells. Thus, presented herein for this study, we recombinantly engineered Lactococcus lactis to produce native (and pilin-deleted) SpaCBA pili that were assembled in a structurally authentic form and anchored to the cell surface, and which had retained mucus-binding functionality. By using these recombinant lactococcal constructs, we were able to demonstrate that the SpaCBA pilus can be a contributory factor in the activation of Toll-like receptor 2-dependent signaling in HEK cells as well as in the modulation of pro- and anti-inflammatory cytokine (TNF-α, IL-6, IL-10, and IL-12) production in human monocyte-derived dendritic cells. From these data, we suggest that the recombinant-expressed and surface-anchored SpaCBA pilus, given its projected functioning in the gut environment, might be viewed as a new microbe-associated molecular pattern (MAMP)-like modulator of innate immunity. Accordingly, our study has brought some new insight to the molecular immunogenicity of the SpaCBA pilus, thus opening the way to a better understanding of its possible role in the multifaceted nature of L. rhamnosus GG probiosis within the human gut. PMID:23691212

Role of the Emp Pilus Subunits of Enterococcus faecium in Biofilm Formation, Adherence to Host Extracellular Matrix Components, and Experimental Infection.

PubMed

Montealegre, Maria Camila; Singh, Kavindra V; Somarajan, Sudha R; Yadav, Puja; Chang, Chungyu; Spencer, Robert; Sillanpää, Jouko; Ton-That, Hung; Murray, Barbara E

2016-05-01

Enterococcus faecium is an important cause of hospital-associated infections, including urinary tract infections (UTIs), bacteremia, and infective endocarditis. Pili have been shown to play a role in the pathogenesis of Gram-positive bacteria, including E. faecium We previously demonstrated that a nonpiliated ΔempABC::cat derivative of E. faecium TX82 was attenuated in biofilm formation and in a UTI model. Here, we studied the contributions of the individual pilus subunits EmpA, EmpB, and EmpC to pilus architecture, biofilm formation, adherence to extracellular matrix (ECM) proteins, and infection. We identified EmpA as the tip of the pili and found that deletion of empA reduced biofilm formation to the same level as deletion of the empABC operon, a phenotype that was restored by reconstituting in situ the empA gene. Deletion of empB also caused a reduction in biofilm, while EmpC was found to be dispensable. Significant reductions in adherence to fibrinogen and collagen type I were observed with deletion of empA and empB, while deletion of empC had no adherence defect. Furthermore, we showed that each deletion mutant was significantly attenuated in comparison to the isogenic parental strain, TX82, in a mixed-inoculum UTI model (P < 0.001 to 0.048), that reconstitution of empA restored virulence in the UTI model, and that deletion of empA also resulted in attenuation in an infective endocarditis model (P = 0.0088). Our results indicate that EmpA and EmpB, but not EmpC, contribute to biofilm and adherence to ECM proteins; however, all the Emp pilins are important for E. faecium to cause infection in the urinary tract. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

A Disulfide Bond-forming Machine Is Linked to the Sortase-mediated Pilus Assembly Pathway in the Gram-positive Bacterium Actinomyces oris.

PubMed

Reardon-Robinson, Melissa E; Osipiuk, Jerzy; Chang, Chungyu; Wu, Chenggang; Jooya, Neda; Joachimiak, Andrzej; Das, Asis; Ton-That, Hung

2015-08-28

Export of cell surface pilins in Gram-positive bacteria likely occurs by the translocation of unfolded precursor polypeptides; however, how the unfolded pilins gain their native conformation is presently unknown. Here, we present physiological studies to demonstrate that the FimA pilin of Actinomyces oris contains two disulfide bonds. Alanine substitution of cysteine residues forming the C-terminal disulfide bridge abrogates pilus assembly, in turn eliminating biofilm formation and polymicrobial interaction. Transposon mutagenesis of A. oris yielded a mutant defective in adherence to Streptococcus oralis, and revealed the essential role of a vitamin K epoxide reductase (VKOR) gene in pilus assembly. Targeted deletion of vkor results in the same defects, which are rescued by ectopic expression of VKOR, but not a mutant containing an alanine substitution in its conserved CXXC motif. Depletion of mdbA, which encodes a membrane-bound thiol-disulfide oxidoreductase, abrogates pilus assembly and alters cell morphology. Remarkably, overexpression of MdbA or a counterpart from Corynebacterium diphtheriae, rescues the Δvkor mutant. By alkylation assays, we demonstrate that VKOR is required for MdbA reoxidation. Furthermore, crystallographic studies reveal that A. oris MdbA harbors a thioredoxin-like fold with the conserved CXXC active site. Consistently, each MdbA enzyme catalyzes proper disulfide bond formation within FimA in vitro that requires the catalytic CXXC motif. Because the majority of signal peptide-containing proteins encoded by A. oris possess multiple Cys residues, we propose that MdbA and VKOR constitute a major folding machine for the secretome of this organism. This oxidative protein folding pathway may be a common feature in Actinobacteria. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

A Disulfide Bond-forming Machine Is Linked to the Sortase-mediated Pilus Assembly Pathway in the Gram-positive Bacterium Actinomyces oris*

PubMed Central

Reardon-Robinson, Melissa E.; Osipiuk, Jerzy; Chang, Chungyu; Wu, Chenggang; Jooya, Neda; Joachimiak, Andrzej; Das, Asis; Ton-That, Hung

2015-01-01

Export of cell surface pilins in Gram-positive bacteria likely occurs by the translocation of unfolded precursor polypeptides; however, how the unfolded pilins gain their native conformation is presently unknown. Here, we present physiological studies to demonstrate that the FimA pilin of Actinomyces oris contains two disulfide bonds. Alanine substitution of cysteine residues forming the C-terminal disulfide bridge abrogates pilus assembly, in turn eliminating biofilm formation and polymicrobial interaction. Transposon mutagenesis of A. oris yielded a mutant defective in adherence to Streptococcus oralis, and revealed the essential role of a vitamin K epoxide reductase (VKOR) gene in pilus assembly. Targeted deletion of vkor results in the same defects, which are rescued by ectopic expression of VKOR, but not a mutant containing an alanine substitution in its conserved CXXC motif. Depletion of mdbA, which encodes a membrane-bound thiol-disulfide oxidoreductase, abrogates pilus assembly and alters cell morphology. Remarkably, overexpression of MdbA or a counterpart from Corynebacterium diphtheriae, rescues the Δvkor mutant. By alkylation assays, we demonstrate that VKOR is required for MdbA reoxidation. Furthermore, crystallographic studies reveal that A. oris MdbA harbors a thioredoxin-like fold with the conserved CXXC active site. Consistently, each MdbA enzyme catalyzes proper disulfide bond formation within FimA in vitro that requires the catalytic CXXC motif. Because the majority of signal peptide-containing proteins encoded by A. oris possess multiple Cys residues, we propose that MdbA and VKOR constitute a major folding machine for the secretome of this organism. This oxidative protein folding pathway may be a common feature in Actinobacteria. PMID:26170452

Localization of the major antigenic determinant of EDP208 pili at the N-terminus of the pilus protein.

PubMed Central

Worobec, E A; Taneja, A K; Hodges, R S; Paranchych, W

1983-01-01

Trypsin digestion of pilin monomers from EDP208 conjugative pili causes cleavage of Lys12 to yield an N-terminal dodecapeptide, ET1 (Mr approximately equal to 1,500), and the remaining C-terminal fragment, ER (Mr approximately equal to 10,000). Using the amino acid sequence for ET1 provided by Frost et al. (J. Bacteriol. 153:950-954), we synthesized the N-terminal dodecapeptide chemically, conjugated it to bovine serum albumin, and subjected it to immunological studies. Antisera prepared against intact EDP208 pili as well as against the synthetic ET1-BSA conjugate were used in experiments involving an enzyme-linked immunosorbant assay and electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to nitrocellulose sheets. Both experimental approaches showed strong reactivity between the synthetic dodecapeptide and antiserum raised against whole pili. It was also found that antiserum raised against the synthetic peptide was reactive against intact pilus protein, indicating that the N-terminal dodecapeptide is an important antigenic determinant of the EDP208 pilus protein. Additional studies showed that the C-terminal fragment, ER, may contain one or two additional antigenic sites. Images PMID:6185467

Structural Model for Covalent Adhesion of the Streptococcus pyogenes Pilus through a Thioester Bond*

PubMed Central

Linke-Winnebeck, Christian; Paterson, Neil G.; Young, Paul G.; Middleditch, Martin J.; Greenwood, David R.; Witte, Gregor; Baker, Edward N.

2014-01-01

The human pathogen Streptococcus pyogenes produces pili that are essential for adhesion to host surface receptors. Cpa, the adhesin at the pilus tip, was recently shown to have a thioester-containing domain. The thioester bond is believed to be important in adhesion, implying a mechanism of covalent attachment analogous to that used by human complement factors. Here, we have characterized a second active thioester-containing domain on Cpa, the N-terminal domain of Cpa (CpaN). Expression of CpaN in Escherichia coli gave covalently linked dimers. These were shown by x-ray crystallography and mass spectrometry to comprise two CpaN molecules cross-linked by the polyamine spermidine following reaction with the thioester bonds. This cross-linked CpaN dimer provides a model for the covalent attachment of Cpa to target receptors and thus the streptococcal pilus to host cells. Similar thioester domains were identified in cell wall proteins of other Gram-positive pathogens, suggesting that thioester domains are more widely used and provide a mechanism of adhesion by covalent bonding to target molecules on host cells that mimics that used by the human complement system to eliminate pathogens. PMID:24220033

Localization of the major antigenic determinant of EDP208 pili at the N-terminus of the pilus protein.

PubMed

Worobec, E A; Taneja, A K; Hodges, R S; Paranchych, W

1983-02-01

Trypsin digestion of pilin monomers from EDP208 conjugative pili causes cleavage of Lys12 to yield an N-terminal dodecapeptide, ET1 (Mr approximately equal to 1,500), and the remaining C-terminal fragment, ER (Mr approximately equal to 10,000). Using the amino acid sequence for ET1 provided by Frost et al. (J. Bacteriol. 153:950-954), we synthesized the N-terminal dodecapeptide chemically, conjugated it to bovine serum albumin, and subjected it to immunological studies. Antisera prepared against intact EDP208 pili as well as against the synthetic ET1-BSA conjugate were used in experiments involving an enzyme-linked immunosorbant assay and electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to nitrocellulose sheets. Both experimental approaches showed strong reactivity between the synthetic dodecapeptide and antiserum raised against whole pili. It was also found that antiserum raised against the synthetic peptide was reactive against intact pilus protein, indicating that the N-terminal dodecapeptide is an important antigenic determinant of the EDP208 pilus protein. Additional studies showed that the C-terminal fragment, ER, may contain one or two additional antigenic sites.

Electronic properties of conductive pili of the metal-reducing bacterium Geobacter sulfurreducens probed by scanning tunneling microscopy.

PubMed

Veazey, Joshua P; Reguera, Gemma; Tessmer, Stuart H

2011-12-01

The metal-reducing bacterium Geobacter sulfurreducens produces conductive protein appendages known as "pilus nanowires" to transfer electrons to metal oxides and to other cells. These processes can be harnessed for the bioremediation of toxic metals and the generation of electricity in bioelectrochemical cells. Key to these applications is a detailed understanding of how these nanostructures conduct electrons. However, to the best of our knowledge, their mechanism of electron transport is not known. We used the capability of scanning tunneling microscopy (STM) to probe conductive materials with higher spatial resolution than other scanning probe methods to gain insights into the transversal electronic behavior of native, cell-anchored pili. Despite the presence of insulating cellular components, the STM topography resolved electronic molecular substructures with periodicities similar to those reported for the pilus shaft. STM spectroscopy revealed electronic states near the Fermi level, consistent with a conducting material, but did not reveal electronic states expected for cytochromes. Furthermore, the transversal conductance was asymmetric, as previously reported for assemblies of helical peptides. Our results thus indicate that the Geobacter pilus shaft has an intrinsic electronic structure that could play a role in charge transport.

Comparative Genomic and Phenotypic Characterization of Pathogenic and Non-Pathogenic Strains of Xanthomonas arboricola Reveals Insights into the Infection Process of Bacterial Spot Disease of Stone Fruits

PubMed Central

Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M.

2016-01-01

Xanthomonas arboricola pv. pruni is the causal agent of bacterial spot disease of stone fruits, a quarantinable pathogen in several areas worldwide, including the European Union. In order to develop efficient control methods for this disease, it is necessary to improve the understanding of the key determinants associated with host restriction, colonization and the development of pathogenesis. After an initial characterization, by multilocus sequence analysis, of 15 strains of X. arboricola isolated from Prunus, one strain did not group into the pathovar pruni or into other pathovars of this species and therefore it was identified and defined as a X. arboricola pv. pruni look-a-like. This non-pathogenic strain and two typical strains of X. arboricola pv. pruni were selected for a whole genome and phenotype comparative analysis in features associated with the pathogenesis process in Xanthomonas. Comparative analysis among these bacterial strains isolated from Prunus spp. and the inclusion of 15 publicly available genome sequences from other pathogenic and non-pathogenic strains of X. arboricola revealed variations in the phenotype associated with variations in the profiles of TonB-dependent transporters, sensors of the two-component regulatory system, methyl accepting chemotaxis proteins, components of the flagella and the type IV pilus, as well as in the repertoire of cell-wall degrading enzymes and the components of the type III secretion system and related effectors. These variations provide a global overview of those mechanisms that could be associated with the development of bacterial spot disease. Additionally, it pointed out some features that might influence the host specificity and the variable virulence observed in X. arboricola. PMID:27571391

Final Technical Report to proposal DE-FG02-95ER20187

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dangl, Jeff

Our long term aim over our many years of generous DOE-BES funding was to understand mechanisms by which the pathogen virulence factors (called ‘type III effectors’) AvrRpm1 and AvrB activate the plant NLR immune receptor RPM1. In general effectors are delivered from the infecting bacteria into host cells by the type III pilus, where they manipulate host machinery to help pathogens overcome host defense. Delivery of effectors to increase virulence is a general feature of all classes of plant pathogens, from fungi to insects to oomcyetes and bacteria. Hence, understanding the overall diversity of effectors, their myriad delivery systems andmore » their effectors on host cell biology, is of central importance in plant immunology.« less

The UbiI (VisC) Aerobic Ubiquinone Synthase Is Required for Expression of Type 1 Pili, Biofilm Formation, and Pathogenesis in Uropathogenic Escherichia coli

PubMed Central

Floyd, Kyle A.; Mitchell, Courtney A.; Eberly, Allison R.; Colling, Spencer J.; Zhang, Ellisa W.; DePas, William; Chapman, Matthew R.; Conover, Matthew; Rogers, Bridget R.; Hultgren, Scott J.

2016-01-01

ABSTRACT Uropathogenic Escherichia coli (UPEC), which causes the majority of urinary tract infections (UTI), uses pilus-mediated adherence to initiate biofilm formation in the urinary tract. Oxygen gradients within E. coli biofilms regulate expression and localization of adhesive type 1 pili. A transposon mutant screen for strains defective in biofilm formation identified the ubiI (formerly visC) aerobic ubiquinone synthase gene as critical for UPEC biofilm formation. In this study, we characterized a nonpolar ubiI deletion mutant and compared its behavior to that of wild-type bacteria grown under aerobic and anoxic conditions. Consistent with its function as an aerobic ubiquinone-8 synthase, deletion of ubiI in UPEC resulted in reduced membrane potential, diminished motility, and reduced expression of chaperone-usher pathway pili. Loss of aerobic respiration was previously shown to negatively impact expression of type 1 pili. To determine whether this reduction in type 1 pili was due to an energy deficit, wild-type UPEC and the ubiI mutant were compared for energy-dependent phenotypes under anoxic conditions, in which quinone synthesis is undertaken by anaerobic quinone synthases. Under anoxic conditions, the two strains exhibited wild-type levels of motility but produced diminished numbers of type 1 pili, suggesting that the reduction of type 1 pilus expression in the absence of oxygen is not due to a cellular energy deficit. Acute- and chronic-infection studies in a mouse model of UTI revealed a significant virulence deficit in the ubiI mutant, indicating that UPEC encounters enough oxygen in the bladder to induce aerobic ubiquinone synthesis during infection. IMPORTANCE The majority of urinary tract infections are caused by uropathogenic E. coli, a bacterium that can respire in the presence and absence of oxygen. The bladder environment is hypoxic, with oxygen concentrations ranging from 4% to 7%, compared to 21% atmospheric oxygen. This work provides evidence that aerobic ubiquinone synthesis must be engaged during bladder infection, indicating that UPEC bacteria sense and use oxygen as a terminal electron acceptor in the bladder and that this ability drives infection potential despite the fact that UPEC is a facultative anaerobe. PMID:27161114

The UbiI (VisC) Aerobic Ubiquinone Synthase Is Required for Expression of Type 1 Pili, Biofilm Formation, and Pathogenesis in Uropathogenic Escherichia coli.

PubMed

Floyd, Kyle A; Mitchell, Courtney A; Eberly, Allison R; Colling, Spencer J; Zhang, Ellisa W; DePas, William; Chapman, Matthew R; Conover, Matthew; Rogers, Bridget R; Hultgren, Scott J; Hadjifrangiskou, Maria

2016-10-01

Uropathogenic Escherichia coli (UPEC), which causes the majority of urinary tract infections (UTI), uses pilus-mediated adherence to initiate biofilm formation in the urinary tract. Oxygen gradients within E. coli biofilms regulate expression and localization of adhesive type 1 pili. A transposon mutant screen for strains defective in biofilm formation identified the ubiI (formerly visC) aerobic ubiquinone synthase gene as critical for UPEC biofilm formation. In this study, we characterized a nonpolar ubiI deletion mutant and compared its behavior to that of wild-type bacteria grown under aerobic and anoxic conditions. Consistent with its function as an aerobic ubiquinone-8 synthase, deletion of ubiI in UPEC resulted in reduced membrane potential, diminished motility, and reduced expression of chaperone-usher pathway pili. Loss of aerobic respiration was previously shown to negatively impact expression of type 1 pili. To determine whether this reduction in type 1 pili was due to an energy deficit, wild-type UPEC and the ubiI mutant were compared for energy-dependent phenotypes under anoxic conditions, in which quinone synthesis is undertaken by anaerobic quinone synthases. Under anoxic conditions, the two strains exhibited wild-type levels of motility but produced diminished numbers of type 1 pili, suggesting that the reduction of type 1 pilus expression in the absence of oxygen is not due to a cellular energy deficit. Acute- and chronic-infection studies in a mouse model of UTI revealed a significant virulence deficit in the ubiI mutant, indicating that UPEC encounters enough oxygen in the bladder to induce aerobic ubiquinone synthesis during infection. The majority of urinary tract infections are caused by uropathogenic E. coli, a bacterium that can respire in the presence and absence of oxygen. The bladder environment is hypoxic, with oxygen concentrations ranging from 4% to 7%, compared to 21% atmospheric oxygen. This work provides evidence that aerobic ubiquinone synthesis must be engaged during bladder infection, indicating that UPEC bacteria sense and use oxygen as a terminal electron acceptor in the bladder and that this ability drives infection potential despite the fact that UPEC is a facultative anaerobe. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

The Nanomechanical Properties of Lactococcus lactis Pili Are Conditioned by the Polymerized Backbone Pilin

PubMed Central

Castelain, Mickaël; Duviau, Marie-Pierre; Canette, Alexis; Schmitz, Philippe; Loubière, Pascal; Cocaign-Bousquet, Muriel; Piard, Jean-Christophe; Mercier-Bonin, Muriel

2016-01-01

Pili produced by Lactococcus lactis subsp. lactis are putative linear structures consisting of repetitive subunits of the major pilin PilB that forms the backbone, pilin PilA situated at the distal end of the pilus, and an anchoring pilin PilC that tethers the pilus to the peptidoglycan. We determined the nanomechanical properties of pili using optical-tweezers force spectroscopy. Single pili were exposed to optical forces that yielded force-versus-extension spectra fitted using the Worm-Like Chain model. Native pili subjected to a force of 0–200 pN exhibit an inextensible, but highly flexible ultrastructure, reflected by their short persistence length. We tested a panel of derived strains to understand the functional role of the different pilins. First, we found that both the major pilin PilB and sortase C organize the backbone into a full-length organelle and dictate the nanomechanical properties of the pili. Second, we found that both PilA tip pilin and PilC anchoring pilin were not essential for the nanomechanical properties of pili. However, PilC maintains the pilus on the bacterial surface and may play a crucial role in the adhesion- and biofilm-forming properties of L. lactis. PMID:27010408

Structure, Function, and Assembly of Adhesive Organelles by Uropathogenic Bacteria

PubMed Central

Chahales, Peter; Thanassi, David G.

2015-01-01

Bacteria assemble a wide range of adhesive proteins, termed adhesins, to mediate binding to receptors and colonization of surfaces. For pathogenic bacteria, adhesins are critical for early stages of infection, allowing the bacteria to initiate contact with host cells, colonize different tissues, and establish a foothold within the host. The adhesins expressed by a pathogen are also critical for bacterial-bacterial interactions and the formation of bacterial communities such as biofilms. The ability to adhere to host tissues is particularly important for bacteria that colonize sites such as the urinary tract, where the flow of urine functions to maintain sterility by washing away non-adherent pathogens. Adhesins vary from monomeric proteins that are directly anchored to the bacterial surface to polymeric, hairlike fibers that extend out from the cell surface. These latter fibers are termed pili or fimbriae, and were among the first identified virulence factors of uropathogenic Escherichia coli. Studies since then have identified a range of both pilus and non-pilus adhesins that contribute to bacterial colonization of the urinary tract, and have revealed molecular details of the structures, assembly pathways, and functions of these adhesive organelles. In this review, we describe the different types of adhesins expressed by both Gram-negative and Gram-positive uropathogens, what is known about their structures, how they are assembled on the bacterial surface, and the functions of specific adhesins in the pathogenesis of urinary tract infections. PMID:26542038

In situ structures of the genome and genome-delivery apparatus in a single-stranded RNA virus.

PubMed

Dai, Xinghong; Li, Zhihai; Lai, Mason; Shu, Sara; Du, Yushen; Zhou, Z Hong; Sun, Ren

2017-01-05

Packaging of the genome into a protein capsid and its subsequent delivery into a host cell are two fundamental processes in the life cycle of a virus. Unlike double-stranded DNA viruses, which pump their genome into a preformed capsid, single-stranded RNA (ssRNA) viruses, such as bacteriophage MS2, co-assemble their capsid with the genome; however, the structural basis of this co-assembly is poorly understood. MS2 infects Escherichia coli via the host 'sex pilus' (F-pilus); it was the first fully sequenced organism and is a model system for studies of translational gene regulation, RNA-protein interactions, and RNA virus assembly. Its positive-sense ssRNA genome of 3,569 bases is enclosed in a capsid with one maturation protein monomer and 89 coat protein dimers arranged in a T = 3 icosahedral lattice. The maturation protein is responsible for attaching the virus to an F-pilus and delivering the viral genome into the host during infection, but how the genome is organized and delivered is not known. Here we describe the MS2 structure at 3.6 Å resolution, determined by electron-counting cryo-electron microscopy (cryoEM) and asymmetric reconstruction. We traced approximately 80% of the backbone of the viral genome, built atomic models for 16 RNA stem-loops, and identified three conserved motifs of RNA-coat protein interactions among 15 of these stem-loops with diverse sequences. The stem-loop at the 3' end of the genome interacts extensively with the maturation protein, which, with just a six-helix bundle and a six-stranded β-sheet, forms a genome-delivery apparatus and joins 89 coat protein dimers to form a capsid. This atomic description of genome-capsid interactions in a spherical ssRNA virus provides insight into genome delivery via the host sex pilus and mechanisms underlying ssRNA-capsid co-assembly, and inspires speculation about the links between nucleoprotein complexes and the origins of viruses.

Positively selected FimH residues enhance virulence during urinary tract infection by altering FimH conformation.

PubMed

Schwartz, Drew J; Kalas, Vasilios; Pinkner, Jerome S; Chen, Swaine L; Spaulding, Caitlin N; Dodson, Karen W; Hultgren, Scott J

2013-09-24

Chaperone-usher pathway pili are a widespread family of extracellular, Gram-negative bacterial fibers with important roles in bacterial pathogenesis. Type 1 pili are important virulence factors in uropathogenic Escherichia coli (UPEC), which cause the majority of urinary tract infections (UTI). FimH, the type 1 adhesin, binds mannosylated glycoproteins on the surface of human and murine bladder cells, facilitating bacterial colonization, invasion, and formation of biofilm-like intracellular bacterial communities. The mannose-binding pocket of FimH is invariant among UPEC. We discovered that pathoadaptive alleles of FimH with variant residues outside the binding pocket affect FimH-mediated acute and chronic pathogenesis of two commonly studied UPEC strains, UTI89 and CFT073. In vitro binding studies revealed that, whereas all pathoadaptive variants tested displayed the same high affinity for mannose when bound by the chaperone FimC, affinities varied when FimH was incorporated into pilus tip-like, FimCGH complexes. Structural studies have shown that FimH adopts an elongated conformation when complexed with FimC, but, when incorporated into the pilus tip, FimH can adopt a compact conformation. We hypothesize that the propensity of FimH to adopt the elongated conformation in the tip corresponds to its mannose binding affinity. Interestingly, FimH variants, which maintain a high-affinity conformation in the FimCGH tip-like structure, were attenuated during chronic bladder infection, implying that FimH's ability to switch between conformations is important in pathogenesis. Our studies argue that positively selected residues modulate fitness during UTI by affecting FimH conformation and function, providing an example of evolutionary tuning of structural dynamics impacting in vivo survival.

Effects of lng Mutations on LngA Expression, Processing, and CS21 Assembly in Enterotoxigenic Escherichia coli E9034A

PubMed Central

Saldaña-Ahuactzi, Zeus; Rodea, Gerardo E.; Cruz-Córdova, Ariadnna; Rodríguez-Ramírez, Viridiana; Espinosa-Mazariego, Karina; González-Montalvo, Martín A.; Ochoa, Sara A.; González-Pedrajo, Bertha; Eslava-Campos, Carlos A.; López-Villegas, Edgar O.; Hernández-Castro, Rigoberto; Arellano-Galindo, José; Patiño-López, Genaro; Xicohtencatl-Cortes, Juan

2016-01-01

Enterotoxigenic Escherichia coli (ETEC) is a major cause of morbidity in children under 5 years of age in low- and middle-income countries and a leading cause of traveler's diarrhea worldwide. The ability of ETEC to colonize the intestinal epithelium is mediated by fimbrial adhesins, such as CS21 (Longus). This adhesin is a type IVb pilus involved in adherence to intestinal cells in vitro and bacterial self-aggregation. Fourteen open reading frames have been proposed to be involved in CS21 assembly, hitherto only the lngA and lngB genes, coding for the major (LngA) and minor (LngB) structural subunit, have been characterized. In this study, we investigated the role of the LngA, LngB, LngC, LngD, LngH, and LngP proteins in the assembly of CS21 in ETEC strain E9034A. The deletion of the lngA, lngB, lngC, lngD, lngH, or lngP genes, abolished CS21 assembly in ETEC strain E9034A and the adherence to HT-29 cells was reduced 90%, compared to wild-type strain. Subcellular localization prediction of CS21 proteins was similar to other well-known type IV pili homologs. We showed that LngP is the prepilin peptidase of LngA, and that ETEC strain E9034A has another peptidase capable of processing LngA, although with less efficiency. Additionally, we present immuno-electron microscopy images to show that the LngB protein could be localized at the tip of CS21. In conclusion, our results demonstrate that the LngA, LngB, LngC, LngD, LngH, and LngP proteins are essential for CS21 assembly, as well as for bacterial aggregation and adherence to HT-29 cells. PMID:27536289

Yersinia pestis caf1 variants and the limits of plague vaccine protection.

PubMed

Quenee, Lauriane E; Cornelius, Claire A; Ciletti, Nancy A; Elli, Derek; Schneewind, Olaf

2008-05-01

Yersinia pestis, the highly virulent agent of plague, is a biological weapon. Strategies that prevent plague have been sought for centuries, and immunization with live, attenuated (nonpigmented) strains or subunit vaccines with F1 (Caf1) antigen is considered effective. We show here that immunization with live, attenuated strains generates plague-protective immunity and humoral immune responses against F1 pilus antigen and LcrV. Y. pestis variants lacking caf1 (F1 pili) are not only fully virulent in animal models of bubonic and pneumonic plague but also break through immune responses generated with live, attenuated strains or F1 subunit vaccines. In contrast, immunization with purified LcrV, a protein at the tip of type III needles, generates protective immunity against the wild-type and the fully virulent caf1 mutant strain, in agreement with the notion that LcrV can elicit vaccine protection against both types of virulent plague strains.

A thiol-disulfide oxidoreductase of the Gram-positive pathogen Corynebacterium diphtheriae is essential for viability, pilus assembly, toxin production and virulence.

PubMed

Reardon-Robinson, Melissa E; Osipiuk, Jerzy; Jooya, Neda; Chang, Chungyu; Joachimiak, Andrzej; Das, Asis; Ton-That, Hung

2015-12-01

The Gram-positive pathogen Corynebacterium diphtheriae exports through the Sec apparatus many extracellular proteins that include the key virulence factors diphtheria toxin and the adhesive pili. How these proteins attain their native conformations after translocation as unfolded precursors remains elusive. The fact that the majority of these exported proteins contain multiple cysteine residues and that several membrane-bound oxidoreductases are encoded in the corynebacterial genome suggests the existence of an oxidative protein-folding pathway in this organism. Here we show that the shaft pilin SpaA harbors a disulfide bond in vivo and alanine substitution of these cysteines abrogates SpaA polymerization and leads to the secretion of degraded SpaA peptides. We then identified a thiol-disulfide oxidoreductase (MdbA), whose structure exhibits a conserved thioredoxin-like domain with a CPHC active site. Remarkably, deletion of mdbA results in a severe temperature-sensitive cell division phenotype. This mutant also fails to assemble pilus structures and is greatly defective in toxin production. Consistent with these defects, the ΔmdbA mutant is attenuated in a guinea pig model of diphtheritic toxemia. Given its diverse cellular functions in cell division, pilus assembly and toxin production, we propose that MdbA is a component of the general oxidative folding machine in C. diphtheriae. © 2015 John Wiley & Sons Ltd.

A thiol-disulfide oxidoreductase of the Gram-positive pathogen Corynebacterium diphtheriae is essential for viability, pilus assembly, toxin production and virulence

PubMed Central

Reardon-Robinson, Melissa E.; Osipiuk, Jerzy; Jooya, Neda; Chang, Chungyu; Joachimiak, Andrzej; Das, Asis; Ton-That, Hung

2016-01-01

Summary The Gram-positive pathogen Corynebacterium diphtheriae exports through the Sec apparatus many extracellular proteins that include the key virulence factors diphtheria toxin and the adhesive pili. How these proteins attain their native conformations after translocation as unfolded precursors remains elusive. The fact that the majority of these exported proteins contain multiple cysteine residues and that several membrane-bound oxidoreductases are encoded in the corynebacterial genome suggests the existence of an oxidative protein-folding pathway in this organism. Here we show that the shaft pilin SpaA harbors a disulfide bond in vivo and alanine substitution of these cysteines abrogates SpaA polymerization and leads to the secretion of degraded SpaA peptides. We then identified a thiol-disulfide oxidoreductase (MdbA), whose structure exhibits a conserved thioredoxin-like domain with a CPHC active site. Remarkably, deletion of mdbA results in a severe temperature-sensitive cell division phenotype. This mutant also fails to assemble pilus structures and is greatly defective in toxin production. Consistent with these defects, the ΔmdbA mutant is attenuated in a guinea pig model of diphtheritic toxemia. Given its diverse cellular functions in cell division, pilus assembly and toxin production, we propose that MdbA is a component of the general oxidative folding machine in C. diphtheriae. PMID:26294390

Ethylene Regulates the Physiology of the Cyanobacterium Synechocystis sp. PCC 6803 via an Ethylene Receptor.

PubMed

Lacey, Randy F; Binder, Brad M

2016-08-01

Ethylene is a plant hormone that plays a crucial role in the growth and development of plants. The ethylene receptors in plants are well studied, and it is generally assumed that they are found only in plants. In a search of sequenced genomes, we found that many bacterial species contain putative ethylene receptors. Plants acquired many proteins from cyanobacteria as a result of the endosymbiotic event that led to chloroplasts. We provide data that the cyanobacterium Synechocystis (Synechocystis sp. PCC 6803) has a functional receptor for ethylene, Synechocystis Ethylene Response1 (SynEtr1). We first show that SynEtr1 directly binds ethylene. Second, we demonstrate that application of ethylene to Synechocystis cells or disruption of the SynEtr1 gene affects several processes, including phototaxis, type IV pilus biosynthesis, photosystem II levels, biofilm formation, and spontaneous cell sedimentation. Our data suggest a model where SynEtr1 inhibits downstream signaling and ethylene inhibits SynEtr1. This is similar to the inverse-agonist model of ethylene receptor signaling proposed for plants and suggests a conservation of structure and function that possibly originated over 1 billion years ago. Prior research showed that SynEtr1 also contains a light-responsive phytochrome-like domain. Thus, SynEtr1 is a bifunctional receptor that mediates responses to both light and ethylene. To our knowledge, this is the first demonstration of a functional ethylene receptor in a nonplant species and suggests that that the perception of ethylene is more widespread than previously thought. © 2016 American Society of Plant Biologists. All Rights Reserved.

Ethylene Regulates the Physiology of the Cyanobacterium Synechocystis sp. PCC 6803 via an Ethylene Receptor1[OPEN

PubMed Central

2016-01-01

Ethylene is a plant hormone that plays a crucial role in the growth and development of plants. The ethylene receptors in plants are well studied, and it is generally assumed that they are found only in plants. In a search of sequenced genomes, we found that many bacterial species contain putative ethylene receptors. Plants acquired many proteins from cyanobacteria as a result of the endosymbiotic event that led to chloroplasts. We provide data that the cyanobacterium Synechocystis (Synechocystis sp. PCC 6803) has a functional receptor for ethylene, Synechocystis Ethylene Response1 (SynEtr1). We first show that SynEtr1 directly binds ethylene. Second, we demonstrate that application of ethylene to Synechocystis cells or disruption of the SynEtr1 gene affects several processes, including phototaxis, type IV pilus biosynthesis, photosystem II levels, biofilm formation, and spontaneous cell sedimentation. Our data suggest a model where SynEtr1 inhibits downstream signaling and ethylene inhibits SynEtr1. This is similar to the inverse-agonist model of ethylene receptor signaling proposed for plants and suggests a conservation of structure and function that possibly originated over 1 billion years ago. Prior research showed that SynEtr1 also contains a light-responsive phytochrome-like domain. Thus, SynEtr1 is a bifunctional receptor that mediates responses to both light and ethylene. To our knowledge, this is the first demonstration of a functional ethylene receptor in a nonplant species and suggests that that the perception of ethylene is more widespread than previously thought. PMID:27246094

Piliation of Lactobacillus rhamnosus GG Promotes Adhesion, Phagocytosis, and Cytokine Modulation in Macrophages

PubMed Central

Vargas García, Cynthia E.; Petrova, Mariya; Claes, Ingmar J. J.; De Boeck, Ilke; Verhoeven, Tine L. A.; Dilissen, Ellen; von Ossowski, Ingemar; Palva, Airi; Bullens, Dominique M.; Vanderleyden, Jos

2015-01-01

Recently, spaCBA-encoded pili on the cell surface of Lactobacillus rhamnosus GG were identified to be key molecules for binding to human intestinal mucus and Caco-2 intestinal epithelial cells. Here, we investigated the role of the SpaCBA pilus of L. rhamnosus GG in the interaction with macrophages in vitro by comparing the wild type with surface mutants. Our results show that SpaCBA pili play a significant role in the capacity for adhesion to macrophages and also promote bacterial uptake by these phagocytic cells. Interestingly, our data suggest that SpaCBA pili also mediate anti-inflammatory effects by induction of interleukin-10 (IL-10) mRNA and reduction of interleukin-6 (IL-6) mRNA in a murine RAW 264.7 macrophage cell line. These pili appear to mediate these effects indirectly by promoting close contact with the macrophages, facilitating the exertion of anti-inflammatory effects by other surface molecules via yet unknown mechanisms. Blockage of complement receptor 3 (CR3), previously identified to be a receptor for streptococcal pili, significantly decreased the uptake of pilus-expressing strains in RAW 264.7 cells, while the expression of IL-10 and IL-6 mRNA by these macrophages was not affected by this blocking. On the other hand, blockage of Toll-like receptor 2 (TLR2) significantly reduced the expression of IL-6 mRNA irrespective of the presence of pili. PMID:25576613

Transcriptional organization of the Escherichia coli pilus adhesin K99.

PubMed

Inoue, O J; Lee, J H; Isaacson, R E

1993-11-01

The production of the Escherichia coli pilus adhesin K99 requires the expression of eight unique proteins: FanA-H. The transcriptional organization of the K99 operon was investigated by Northern blot analysis. Four RNAs of 0.54, 1.4, 2.5 and 3.5 kb were detected. When a fanC probe was used all four RNAs were detected while the use of fanD, fanF and fanG probes detected two RNAs each. Using several deletion and TnphoA insertion mutants it was concluded that there were seven unique K99-specific transcripts, several of which were of the same approximate sizes (1.4 and 2.5 kb). It also was concluded that K99 was comprised of at least three complementation groups, two of which were regulated by catabolite repression.

Surface Structures Involved in Plant Stomata and Leaf Colonization by Shiga-Toxigenic Escherichia Coli O157:H7

PubMed Central

Saldaña, Zeus; Sánchez, Ethel; Xicohtencatl-Cortes, Juan; Puente, Jose Luis; Girón, Jorge A.

2011-01-01

Shiga-toxigenic Escherichia coli (STEC) O157:H7 uses a myriad of surface adhesive appendages including pili, flagella, and the type 3 secretion system (T3SS) to adhere to and inflict damage to the human gut mucosa. Consumption of contaminated ground beef, milk, juices, water, or leafy greens has been associated with outbreaks of diarrheal disease in humans due to STEC. The aim of this study was to investigate which of the known STEC O157:H7 adherence factors mediate colonization of baby spinach leaves and where the bacteria reside within tainted leaves. We found that STEC O157:H7 colonizes baby spinach leaves through the coordinated production of curli, the E. coli common pilus, hemorrhagic coli type 4 pilus, flagella, and T3SS. Electron microscopy analysis of tainted leaves revealed STEC bacteria in the internal cavity of the stomata, in intercellular spaces, and within vascular tissue (xylem and phloem), where the bacteria were protected from the bactericidal effect of gentamicin, sodium hypochlorite or ozonated water treatments. We confirmed that the T3S escN mutant showed a reduced number of bacteria within the stomata suggesting that T3S is required for the successful colonization of leaves. In agreement, non-pathogenic E. coli K-12 strain DH5α transformed with a plasmid carrying the locus of enterocyte effacement (LEE) pathogenicity island, harboring the T3SS and effector genes, internalized into stomata more efficiently than without the LEE. This study highlights a role for pili, flagella, and T3SS in the interaction of STEC with spinach leaves. Colonization of plant stomata and internal tissues may constitute a strategy by which STEC survives in a nutrient-rich microenvironment protected from external foes and may be a potential source for human infection. PMID:21887151

A light-regulated type I pilus contributes to Acinetobacter baumannii biofilm, motility and virulence functions.

PubMed

Wood, Cecily R; Ohneck, Emily J; Edelmann, Richard E; Actis, Luis A

2018-06-11

Transcriptional analyses of A. baumannii ATCC 17978 showed that the expression of A1S_2091 was enhanced in cells cultured in darkness at 24°C through a process that depended on the BlsA photoreceptor. Disruption of A1S_2091, a component of the A1S_2088-A1S_2091 polycistronic operon predicted to code for a type I chaperone/usher pilus assembly system, abolished surface motility and pellicle formation but significantly enhanced biofilm formation on plastic by bacteria cultured under darkness. Based on these observations, the A1S_2088-A1S_2091 operon was named the p hoto- r egulated p ilus ABCD ( prpABCD ) operon, with A1S_2091 coding for the PrpA pilin subunit. Unexpectedly, the comparative analyses of ATCC 17978 and prpA isogenic mutant cells cultured at 37°C showed the expression of light-regulated biofilm biogenesis and motility functions under a temperature condition that drastically affects BlsA production and its light sensing activity. These assays also suggest that 17978 cells produce alternative light-regulated adhesins and/or pili systems that enhance bacterial adhesion and biofilm formation both at 24°C and 37°C on plastic as well as on the surface of polarized A549 alveolar epithelial cells, where formation of bacterial filaments and cell chains was significantly enhanced. The inactivation of prpA also resulted in a significant reduction in virulence when tested using the Galleria mellonella virulence model. All these observations provide strong evidence showing the capacity of A. baumannii to sense light and interact with biotic and abiotic surfaces using undetermined alternative sensing and regulatory systems as well as alternative adherence and motility cellular functions that allow this pathogen to persist in different ecological niches. Copyright © 2018 American Society for Microbiology.

The Live Attenuated Cholera Vaccine CVD 103-HgR Primes Responses to the Toxin-Coregulated Pilus Antigen TcpA in Subjects Challenged with Wild-Type Vibrio cholerae.

PubMed

Mayo-Smith, Leslie M; Simon, Jakub K; Chen, Wilbur H; Haney, Douglas; Lock, Michael; Lyon, Caroline E; Calderwood, Stephen B; Kirkpatrick, Beth D; Cohen, Mitchell; Levine, Myron M; Gurwith, Marc; Harris, Jason B

2017-01-01

One potential advantage of live attenuated bacterial vaccines is the ability to stimulate responses to antigens which are only expressed during the course of infection. To determine whether the live attenuated cholera vaccine CVD 103-HgR (Vaxchora) results in antibody responses to the in vivo-induced toxin-coregulated pilus antigen TcpA, we measured IgA and IgG responses to Vibrio cholerae O1 El Tor TcpA in a subset of participants in a recently reported experimental challenge study. Participants were challenged with V. cholerae O1 El Tor Inaba N16961 either 10 days or 90 days after receiving the vaccine or a placebo. Neither vaccination nor experimental infection with V. cholerae alone resulted in a robust TcpA IgG or IgA response, but each did elicit a strong response to cholera toxin. However, compared to placebo recipients, vaccinees had a marked increase in IgG TcpA antibodies following the 90-day challenge, suggesting that vaccination with CVD 103-HgR resulted in priming for a subsequent response to TcpA. No such difference between vaccine and placebo recipients was observed for volunteers challenged 10 days after vaccination, indicating that this was insufficient time for vaccine-induced priming of the TcpA response. The priming of the response to TcpA and potentially other antigens expressed in vivo by attenuated V. cholerae may have relevance to the maintenance of immunity in areas where cholera is endemic. Copyright © 2017 American Society for Microbiology.

Extracellular reduction of uranium via Geobacter conductive pili as a protective cellular mechanism.

PubMed

Cologgi, Dena L; Lampa-Pastirk, Sanela; Speers, Allison M; Kelly, Shelly D; Reguera, Gemma

2011-09-13

The in situ stimulation of Fe(III) oxide reduction by Geobacter bacteria leads to the concomitant precipitation of hexavalent uranium [U(VI)] from groundwater. Despite its promise for the bioremediation of uranium contaminants, the biological mechanism behind this reaction remains elusive. Because Fe(III) oxide reduction requires the expression of Geobacter's conductive pili, we evaluated their contribution to uranium reduction in Geobacter sulfurreducens grown under pili-inducing or noninducing conditions. A pilin-deficient mutant and a genetically complemented strain with reduced outer membrane c-cytochrome content were used as controls. Pili expression significantly enhanced the rate and extent of uranium immobilization per cell and prevented periplasmic mineralization. As a result, pili expression also preserved the vital respiratory activities of the cell envelope and the cell's viability. Uranium preferentially precipitated along the pili and, to a lesser extent, on outer membrane redox-active foci. In contrast, the pilus-defective strains had different degrees of periplasmic mineralization matching well with their outer membrane c-cytochrome content. X-ray absorption spectroscopy analyses demonstrated the extracellular reduction of U(VI) by the pili to mononuclear tetravalent uranium U(IV) complexed by carbon-containing ligands, consistent with a biological reduction. In contrast, the U(IV) in the pilin-deficient mutant cells also required an additional phosphorous ligand, in agreement with the predominantly periplasmic mineralization of uranium observed in this strain. These findings demonstrate a previously unrecognized role for Geobacter conductive pili in the extracellular reduction of uranium, and highlight its essential function as a catalytic and protective cellular mechanism that is of interest for the bioremediation of uranium-contaminated groundwater.

The reduced genomes of Parcubacteria (OD1) contain signatures of a symbiotic lifestyle

PubMed Central

Nelson, William C.; Stegen, James C.

2015-01-01

Candidate phylum OD1 bacteria (also referred to as Parcubacteria) have been identified in a broad range of anoxic environments through community survey analysis. Although none of these species have been isolated in the laboratory, several genome sequences have been reconstructed from metagenomic sequence data and single-cell sequencing. The organisms have small (generally <1 Mb) genomes with severely reduced metabolic capabilities. We have reconstructed 8 partial to near-complete OD1 genomes from oxic groundwater samples, and compared them against existing genomic data. The conserved core gene set comprises 202 genes, or ~28% of the genomic complement. “Housekeeping” genes and genes for biosynthesis of peptidoglycan and Type IV pilus production are conserved. Gene sets for biosynthesis of cofactors, amino acids, nucleotides, and fatty acids are absent entirely or greatly reduced. The only aspects of energy metabolism conserved are the non-oxidative branch of the pentose-phosphate shunt and central glycolysis. These organisms also lack some activities conserved in almost all other known bacterial genomes, including signal recognition particle, pseudouridine synthase A, and FAD synthase. Pan-genome analysis indicates a broad genotypic diversity and perhaps a highly fluid gene complement, indicating historical adaptation to a wide range of growth environments and a high degree of specialization. The genomes were examined for signatures suggesting either a free-living, streamlined lifestyle, or a symbiotic lifestyle. The lack of biosynthetic capabilities and DNA repair, along with the presence of potential attachment and adhesion proteins suggest that the Parcubacteria are ectosymbionts or parasites of other organisms. The wide diversity of genes that potentially mediate cell-cell contact suggests a broad range of partner/prey organisms across the phylum. PMID:26257709

The reduced genomes of Parcubacteria (OD1) contain signatures of a symbiotic lifestyle

DOE PAGES

Nelson, William C.; Stegen, James C.

2015-07-21

Candidate phylum OD1 bacteria (also referred to as Parcubacteria) have been identified in a broad range of anoxic environments through community survey analysis. Although none of these species have been isolated in the laboratory, several genome sequences have been reconstructed from metagenomic sequence data and single-cell sequencing. The organisms have small (generally <1 Mb) genomes with severely reduced metabolic capabilities. We have reconstructed 8 partial to near-complete OD1 genomes from oxic groundwater samples, and compared them against existing genomic data. The conserved core gene set comprises 202 genes, or ~28% of the genomic complement. “Housekeeping” genes and genes for biosynthesismore » of peptidoglycan and Type IV pilus production are conserved. Gene sets for biosynthesis of cofactors, amino acids, nucleotides, and fatty acids are absent entirely or greatly reduced. The only aspects of energy metabolism conserved are the non-oxidative branch of the pentose-phosphate shunt and central glycolysis. These organisms also lack some activities conserved in almost all other known bacterial genomes, including signal recognition particle, pseudouridine synthase A, and FAD synthase. Pan-genome analysis indicates a broad genotypic diversity and perhaps a highly fluid gene complement, indicating historical adaptation to a wide range of growth environments and a high degree of specialization. The genomes were examined for signatures suggesting either a free-living, streamlined lifestyle, or a symbiotic lifestyle. The lack of biosynthetic capabilities and DNA repair, along with the presence of potential attachment and adhesion proteins suggest that the Parcubacteria are ectosymbionts or parasites of other organisms. The wide diversity of genes that potentially mediate cell-cell contact suggests a broad range of partner/prey organisms across the phylum.« less

Impact of maintenance immunosuppressive therapy on the fecal microbiome of renal transplant recipients: Comparison between an everolimus- and a standard tacrolimus-based regimen.

PubMed

Zaza, Gianluigi; Dalla Gassa, Alessandra; Felis, Giovanna; Granata, Simona; Torriani, Sandra; Lupo, Antonio

2017-01-01

The gut microbiome is the full set of microbes living in the gastrointestinal tract and is emerging as an important dynamic/fluid system that, if altered by environmental, dietetic or pharmacological factors, could considerably influence drug response. However, the immunosuppressive drug-induced modifications of this system are still poorly defined. We employed an innovative bioinformatics approach to assess differences in the whole-gut microbial metagenomic profile of 20 renal transplant recipients undergoing maintenance treatment with two different immunosuppressive protocols. Nine patients were treated with everolimus plus mycophenolate mofetil (EVE+MMF group), and 11 patients were treated with a standard therapy with tacrolimus plus mycophenolate mofetil (TAC+MMF group). A statistical analysis of comparative high-throughput data demonstrated that although similar according to the degree of Shannon diversity (alpha diversity) at the taxonomic level, three functional genes clearly discriminated EVE+MMF versus TAC+MMF (cutoff: log2 fold change≥1, FDR≤0.05). Flagellar motor switch protein (fliNY) and type IV pilus assembly protein pilM (pilM) were significantly enriched in TAC+MMF-treated patients, while macrolide transport system mrsA (msrA) was more abundant in patients treated with EVE+MMF. Finally, PERMANOVA revealed that among the variables analyzed and included in our model, only the consumption of sugar significantly influenced beta diversity. Our study, although performed on a relatively small number of patients, showed, for the first time, specific immunosuppressive-related effects on fecal microbiome of renal transplant recipients and it suggested that the analysis of the gut microbes community could represent a new tool to better understand the effects of drugs currently employed in organ transplantations. However, multicenter studies including healthy controls should be undertaken to better address this objective.

The reduced genomes of Parcubacteria (OD1) contain signatures of a symbiotic lifestyle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, William C.; Stegen, James C.

2015-07-21

Candidate phylum OD1 bacteria (also referred to as Parcubacteria) have been identified in broad range of anoxic environments through community survey analysis. Although none of these species have been isolated in the laboratory, several genome sequences have been reconstructed from metagenomic sequence data and single-cell sequencing. The organisms have small (generally <1 Mb) genomes with severely reduced metabolic capabilities. We have reconstructed 8 partial to near-complete OD1 genomes from oxic groundwater samples, and compared them against existing genomic data. The conserved core gene set comprises 202 genes, or ~28% of the genomic complement. ‘Housekeeping’ genes and genes for biosynthesis ofmore » peptidoglycan and Type IV pilus production are conserved. Gene sets for biosynthesis of cofactors, amino acids, nucleotides and fatty acids are absent entirely or greatly reduced. The only aspects of energy metabolism conserved are the non-oxidative branch of the pentose-phosphate shunt and central glycolysis. These organisms also lack some activities conserved in almost all other known bacterial genomes, including signal recognition particle, pseudouridine synthase A, and FAD synthase. Pan-genome analysis indicates a broad genotypic diversity and perhaps a highly fluid gene complement, indicating historical adaptation to a wide range of growth environments and a high degree of specialization. The genomes were examined for signatures suggesting either a free-living, streamlined lifestyle or a symbiotic lifestyle. The lack of biosynthetic capabilities and DNA repair, along with the presence of potential attachment and adhesion proteins suggest the Parcubacteria are ectosymbionts or parasites of other organisms. The wide diversity of genes that potentially mediate cell-cell contact suggests a broad range of partner/prey organisms across the phylum.« less

The iron stimulon of Xylella fastidiosa includes genes for type IV pilus and colicin V-like bacteriocins.

PubMed

Zaini, Paulo A; Fogaça, Andréa C; Lupo, Fernanda G N; Nakaya, Helder I; Vêncio, Ricardo Z N; da Silva, Aline M

2008-04-01

Xylella fastidiosa is the etiologic agent of a wide range of plant diseases, including citrus variegated chlorosis (CVC), a major threat to citrus industry. The genomes of several strains of this phytopathogen were completely sequenced, enabling large-scale functional studies. DNA microarrays representing 2,608 (91.6%) coding sequences (CDS) of X. fastidiosa CVC strain 9a5c were used to investigate transcript levels during growth with different iron availabilities. When treated with the iron chelator 2,2'-dipyridyl, 193 CDS were considered up-regulated and 216 were considered down-regulated. Upon incubation with 100 microM ferric pyrophosphate, 218 and 256 CDS were considered up- and down-regulated, respectively. Differential expression for a subset of 44 CDS was further evaluated by reverse transcription-quantitative PCR. Several CDS involved with regulatory functions, pathogenicity, and cell structure were modulated under both conditions assayed, suggesting that major changes in cell architecture and metabolism occur when X. fastidiosa cells are exposed to extreme variations in iron concentration. Interestingly, the modulated CDS include those related to colicin V-like bacteriocin synthesis and secretion and to functions of pili/fimbriae. We also investigated the contribution of the ferric uptake regulator Fur to the iron stimulon of X. fastidiosa. The promoter regions of the strain 9a5c genome were screened for putative Fur boxes, and candidates were analyzed by electrophoretic mobility shift assays. Taken together, our data support the hypothesis that Fur is not solely responsible for the modulation of the iron stimulon of X. fastidiosa, and they present novel evidence for iron regulation of pathogenicity determinants.

Virulence strategies for infecting phagocytes deduced from the in vivo transcriptional program of Legionella pneumophila.

PubMed

Brüggemann, Holger; Hagman, Arne; Jules, Matthieu; Sismeiro, Odile; Dillies, Marie-Agnès; Gouyette, Catherine; Kunst, Frank; Steinert, Michael; Heuner, Klaus; Coppée, Jean-Yves; Buchrieser, Carmen

2006-08-01

Adaptation to the host environment and exploitation of host cell functions are critical to the success of intracellular pathogens. Here, insight to these virulence mechanisms was obtained for the first time from the transcriptional program of the human pathogen Legionella pneumophila during infection of its natural host, Acanthamoeba castellanii. The biphasic life cycle of L. pneumophila was reflected by a major shift in gene expression from replicative to transmissive phase, concerning nearly half of the genes predicted in the genome. However, three different L. pneumophila strains showed similar in vivo gene expression patterns, indicating that common regulatory mechanisms govern the Legionella life cycle, despite the plasticity of its genome. During the replicative phase, in addition to components of aerobic metabolism and amino acid catabolism, the Entner-Doudoroff pathway, a NADPH producing mechanism used for sugar and/or gluconate assimilation, was expressed, suggesting for the first time that intracellular L. pneumophila may also scavenge host carbohydrates as nutrients and not only proteins. Identification of genes only upregulated in vivo but not in vitro, may explain higher virulence of in vivo grown L. pneumophila. Late in the life cycle, L. pneumophila upregulates genes predicted to promote transmission and manipulation of a new host cell, therewith priming it for the next attack. These including substrates of the Dot/Icm secretion system, other factors associated previously with invasion and virulence, the motility and the type IV pilus machineries, and > 90 proteins not characterized so far. Analysis of a fliA (sigma28) deletion mutant identified genes coregulated with the flagellar regulon, including GGDEF/EAL regulators and factors that promote host cell entry and survival.

Discrete and structurally unique proteins (tāpirins) mediate attachment of extremely thermophilic Caldicellulosiruptor species to cellulose.

PubMed

Blumer-Schuette, Sara E; Alahuhta, Markus; Conway, Jonathan M; Lee, Laura L; Zurawski, Jeffrey V; Giannone, Richard J; Hettich, Robert L; Lunin, Vladimir V; Himmel, Michael E; Kelly, Robert M

2015-04-24

A variety of catalytic and noncatalytic protein domains are deployed by select microorganisms to deconstruct lignocellulose. These extracellular proteins are used to attach to, modify, and hydrolyze the complex polysaccharides present in plant cell walls. Cellulolytic enzymes, often containing carbohydrate-binding modules, are key to this process; however, these enzymes are not solely responsible for attachment. Few mechanisms of attachment have been discovered among bacteria that do not form large polypeptide structures, called cellulosomes, to deconstruct biomass. In this study, bioinformatics and proteomics analyses identified unique, discrete, hypothetical proteins ("tāpirins," origin from Māori: to join), not directly associated with cellulases, that mediate attachment to cellulose by species in the noncellulosomal, extremely thermophilic bacterial genus Caldicellulosiruptor. Two tāpirin genes are located directly downstream of a type IV pilus operon in strongly cellulolytic members of the genus, whereas homologs are absent from the weakly cellulolytic Caldicellulosiruptor species. Based on their amino acid sequence, tāpirins are specific to these extreme thermophiles. Tāpirins are also unusual in that they share no detectable protein domain signatures with known polysaccharide-binding proteins. Adsorption isotherm and trans vivo analyses demonstrated the carbohydrate-binding module-like affinity of the tāpirins for cellulose. Crystallization of a cellulose-binding truncation from one tāpirin indicated that these proteins form a long β-helix core with a shielded hydrophobic face. Furthermore, they are structurally unique and define a new class of polysaccharide adhesins. Strongly cellulolytic Caldicellulosiruptor species employ tāpirins to complement substrate-binding proteins from the ATP-binding cassette transporters and multidomain extracellular and S-layer-associated glycoside hydrolases to process the carbohydrate content of lignocellulose. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Biofilm Formation by Clostridium ljungdahlii Is Induced by Sodium Chloride Stress: Experimental Evaluation and Transcriptome Analysis.

PubMed

Philips, Jo; Rabaey, Korneel; Lovley, Derek R; Vargas, Madeline

2017-01-01

The acetogen Clostridium ljungdahlii is capable of syngas fermentation and microbial electrosynthesis. Biofilm formation could benefit both these applications, but was not yet reported for C. ljungdahlii. Biofilm formation does not occur under standard growth conditions, but attachment or aggregation could be induced by different stresses. The strongest biofilm formation was observed with the addition of sodium chloride. After 3 days of incubation, the biomass volume attached to a plastic surface was 20 times higher with than without the addition of 200 mM NaCl to the medium. The addition of NaCl also resulted in biofilm formation on glass, graphite and glassy carbon, the latter two being often used electrode materials for microbial electrosynthesis. Biofilms were composed of extracellular proteins, polysaccharides, as well as DNA, while pilus-like appendages were observed with, but not without, the addition of NaCl. A transcriptome analysis comparing planktonic (no NaCl) and biofilm (NaCl addition) cells showed that C. ljungdahlii coped with the salt stress by the upregulation of the general stress response, Na+ export and osmoprotectant accumulation. A potential role for poly-N-acetylglucosamines and D-alanine in biofilm formation was found. Flagellar motility was downregulated, while putative type IV pili biosynthesis genes were not expressed. Moreover, the gene expression analysis suggested the involvement of the transcriptional regulators LexA, Spo0A and CcpA in stress response and biofilm formation. This study showed that NaCl addition might be a valuable strategy to induce biofilm formation by C. ljungdahlii, which can improve the efficacy of syngas fermentation and microbial electrosynthesis applications.

Biofilm Formation by Clostridium ljungdahlii Is Induced by Sodium Chloride Stress: Experimental Evaluation and Transcriptome Analysis

PubMed Central

Rabaey, Korneel; Lovley, Derek R.; Vargas, Madeline

2017-01-01

The acetogen Clostridium ljungdahlii is capable of syngas fermentation and microbial electrosynthesis. Biofilm formation could benefit both these applications, but was not yet reported for C. ljungdahlii. Biofilm formation does not occur under standard growth conditions, but attachment or aggregation could be induced by different stresses. The strongest biofilm formation was observed with the addition of sodium chloride. After 3 days of incubation, the biomass volume attached to a plastic surface was 20 times higher with than without the addition of 200 mM NaCl to the medium. The addition of NaCl also resulted in biofilm formation on glass, graphite and glassy carbon, the latter two being often used electrode materials for microbial electrosynthesis. Biofilms were composed of extracellular proteins, polysaccharides, as well as DNA, while pilus-like appendages were observed with, but not without, the addition of NaCl. A transcriptome analysis comparing planktonic (no NaCl) and biofilm (NaCl addition) cells showed that C. ljungdahlii coped with the salt stress by the upregulation of the general stress response, Na+ export and osmoprotectant accumulation. A potential role for poly-N-acetylglucosamines and D-alanine in biofilm formation was found. Flagellar motility was downregulated, while putative type IV pili biosynthesis genes were not expressed. Moreover, the gene expression analysis suggested the involvement of the transcriptional regulators LexA, Spo0A and CcpA in stress response and biofilm formation. This study showed that NaCl addition might be a valuable strategy to induce biofilm formation by C. ljungdahlii, which can improve the efficacy of syngas fermentation and microbial electrosynthesis applications. PMID:28118386

Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose*

PubMed Central

Blumer-Schuette, Sara E.; Alahuhta, Markus; Conway, Jonathan M.; Lee, Laura L.; Zurawski, Jeffrey V.; Giannone, Richard J.; Hettich, Robert L.; Lunin, Vladimir V.; Himmel, Michael E.; Kelly, Robert M.

2015-01-01

A variety of catalytic and noncatalytic protein domains are deployed by select microorganisms to deconstruct lignocellulose. These extracellular proteins are used to attach to, modify, and hydrolyze the complex polysaccharides present in plant cell walls. Cellulolytic enzymes, often containing carbohydrate-binding modules, are key to this process; however, these enzymes are not solely responsible for attachment. Few mechanisms of attachment have been discovered among bacteria that do not form large polypeptide structures, called cellulosomes, to deconstruct biomass. In this study, bioinformatics and proteomics analyses identified unique, discrete, hypothetical proteins (“tāpirins,” origin from Māori: to join), not directly associated with cellulases, that mediate attachment to cellulose by species in the noncellulosomal, extremely thermophilic bacterial genus Caldicellulosiruptor. Two tāpirin genes are located directly downstream of a type IV pilus operon in strongly cellulolytic members of the genus, whereas homologs are absent from the weakly cellulolytic Caldicellulosiruptor species. Based on their amino acid sequence, tāpirins are specific to these extreme thermophiles. Tāpirins are also unusual in that they share no detectable protein domain signatures with known polysaccharide-binding proteins. Adsorption isotherm and trans vivo analyses demonstrated the carbohydrate-binding module-like affinity of the tāpirins for cellulose. Crystallization of a cellulose-binding truncation from one tāpirin indicated that these proteins form a long β-helix core with a shielded hydrophobic face. Furthermore, they are structurally unique and define a new class of polysaccharide adhesins. Strongly cellulolytic Caldicellulosiruptor species employ tāpirins to complement substrate-binding proteins from the ATP-binding cassette transporters and multidomain extracellular and S-layer-associated glycoside hydrolases to process the carbohydrate content of lignocellulose. PMID:25720489

Domain activities of PapC usher reveal the mechanism of action of an Escherichia coli molecular machine.

PubMed

Volkan, Ender; Ford, Bradley A; Pinkner, Jerome S; Dodson, Karen W; Henderson, Nadine S; Thanassi, David G; Waksman, Gabriel; Hultgren, Scott J

2012-06-12

P pili are prototypical chaperone-usher pathway-assembled pili used by Gram-negative bacteria to adhere to host tissues. The PapC usher contains five functional domains: a transmembrane β-barrel, a β-sandwich Plug, an N-terminal (periplasmic) domain (NTD), and two C-terminal (periplasmic) domains, CTD1 and CTD2. Here, we delineated usher domain interactions between themselves and with chaperone-subunit complexes and showed that overexpression of individual usher domains inhibits pilus assembly. Prior work revealed that the Plug domain occludes the pore of the transmembrane domain of a solitary usher, but the chaperone-adhesin-bound usher has its Plug displaced from the pore, adjacent to the NTD. We demonstrate an interaction between the NTD and Plug domains that suggests a biophysical basis for usher gating. Furthermore, we found that the NTD exhibits high-affinity binding to the chaperone-adhesin (PapDG) complex and low-affinity binding to the major tip subunit PapE (PapDE). We also demonstrate that CTD2 binds with lower affinity to all tested chaperone-subunit complexes except for the chaperone-terminator subunit (PapDH) and has a catalytic role in dissociating the NTD-PapDG complex, suggesting an interplay between recruitment to the NTD and transfer to CTD2 during pilus initiation. The Plug domain and the NTD-Plug complex bound all of the chaperone-subunit complexes tested including PapDH, suggesting that the Plug actively recruits chaperone-subunit complexes to the usher and is the sole recruiter of PapDH. Overall, our studies reveal the cooperative, active roles played by periplasmic domains of the usher to initiate, grow, and terminate a prototypical chaperone-usher pathway pilus.

The Enterococcus faecalis EbpA Pilus Protein: Attenuation of Expression, Biofilm Formation, and Adherence to Fibrinogen Start with the Rare Initiation Codon ATT

PubMed Central

Montealegre, Maria Camila; La Rosa, Sabina Leanti; Roh, Jung Hyeob; Harvey, Barrett R.

2015-01-01

ABSTRACT The endocarditis and biofilm-associated pili (Ebp) are important in Enterococcus faecalis pathogenesis, and the pilus tip, EbpA, has been shown to play a major role in pilus biogenesis, biofilm formation, and experimental infections. Based on in silico analyses, we previously predicted that ATT is the EbpA translational start codon, not the ATG codon, 120 bp downstream of ATT, which is annotated as the translational start. ATT is rarely used to initiate protein synthesis, leading to our hypothesis that this codon participates in translational regulation of Ebp production. To investigate this possibility, site-directed mutagenesis was used to introduce consecutive stop codons in place of two lysines at positions 5 and 6 from the ATT, to replace the ATT codon in situ with ATG, and then to revert this ATG to ATT; translational fusions of ebpA to lacZ were also constructed to investigate the effect of these start codons on translation. Our results showed that the annotated ATG does not start translation of EbpA, implicating ATT as the start codon; moreover, the presence of ATT, compared to the engineered ATG, resulted in significantly decreased EbpA surface display, attenuated biofilm, and reduced adherence to fibrinogen. Corroborating these findings, the translational fusion with the native ATT as the initiation codon showed significantly decreased expression of β-galactosidase compared to the construct with ATG in place of ATT. Thus, these results demonstrate that the rare initiation codon of EbpA negatively regulates EbpA surface display and negatively affects Ebp-associated functions, including biofilm and adherence to fibrinogen. PMID:26015496

Oral Immunization with a Recombinant Lactococcus lactis-Expressing HIV-1 Antigen on Group A Streptococcus Pilus Induces Strong Mucosal Immunity in the Gut.

PubMed

Chamcha, Venkateswarlu; Jones, Andrew; Quigley, Bernard R; Scott, June R; Amara, Rama Rao

2015-11-15

The induction of a potent humoral and cellular immune response in mucosal tissue is important for the development of an effective HIV vaccine. Most of the current HIV vaccines under development use the i.m. route for immunization, which is relatively poor in generating potent and long-lived mucosal immune responses. In this article, we explore the ability of an oral vaccination with a probiotic organism, Lactococcus lactis, to elicit HIV-specific immune responses in the mucosal and systemic compartments of BALB/c mice. We expressed the HIV-1 Gag-p24 on the tip of the T3 pilus of Streptococcus pyogenes as a fusion to the Cpa protein (LL-Gag). After four monthly LL-Gag oral immunizations, we observed strong Gag-specific IgG and IgA responses in serum, feces, and vaginal secretions. However, the Gag-specific CD8 T cell responses in the blood were at or below our detection limit. After an i.m. modified vaccinia Ankara/Gag boost, we observed robust Gag-specific CD8 T cell responses both in systemic and in mucosal tissues, including intraepithelial and lamina propria lymphocytes of the small intestine, Peyer's patches, and mesenteric lymph nodes. Consistent with strong immunogenicity, the LL-Gag induced activation of CD11c(+) CD11b(+) dendritic cells in the Peyer's patches after oral immunization. Our results demonstrate that oral immunization with L. lactis expressing an Ag on the tip of the group A Streptococcus pilus serves as an excellent vaccine platform to induce strong mucosal humoral and cellular immunity against HIV. Copyright © 2015 by The American Association of Immunologists, Inc.

Syntrophic growth of Desulfovibrio alaskensis requires genes for H2 and formate metabolism as well as those for flagellum and biofilm formation.

PubMed

Krumholz, Lee R; Bradstock, Peter; Sheik, Cody S; Diao, Yiwei; Gazioglu, Ozcan; Gorby, Yuri; McInerney, Michael J

2015-04-01

In anaerobic environments, mutually beneficial metabolic interactions between microorganisms (syntrophy) are essential for oxidation of organic matter to carbon dioxide and methane. Syntrophic interactions typically involve a microorganism degrading an organic compound to primary fermentation by-products and sources of electrons (i.e., formate, hydrogen, or nanowires) and a partner producing methane or respiring the electrons via alternative electron accepting processes. Using a transposon gene mutant library of the sulfate-reducing Desulfovibrio alaskensis G20, we screened for mutants incapable of serving as the electron-accepting partner of the butyrate-oxidizing bacterium, Syntrophomonas wolfei. A total of 17 gene mutants of D. alaskensis were identified as incapable of serving as the electron-accepting partner. The genes identified predominantly fell into three categories: membrane surface assembly, flagellum-pilus synthesis, and energy metabolism. Among these genes required to serve as the electron-accepting partner, the glycosyltransferase, pilus assembly protein (tadC), and flagellar biosynthesis protein showed reduced biofilm formation, suggesting that each of these components is involved in cell-to-cell interactions. Energy metabolism genes encoded proteins primarily involved in H2 uptake and electron cycling, including a rhodanese-containing complex that is phylogenetically conserved among sulfate-reducing Deltaproteobacteria. Utilizing an mRNA sequencing approach, analysis of transcript abundance in wild-type axenic and cocultures confirmed that genes identified as important for serving as the electron-accepting partner were more highly expressed under syntrophic conditions. The results imply that sulfate-reducing microorganisms require flagellar and outer membrane components to effectively couple to their syntrophic partners; furthermore, H2 metabolism is essential for syntrophic growth of D. alaskensis G20. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Syntrophic Growth of Desulfovibrio alaskensis Requires Genes for H2 and Formate Metabolism as Well as Those for Flagellum and Biofilm Formation

PubMed Central

Bradstock, Peter; Sheik, Cody S.; Diao, Yiwei; Gazioglu, Ozcan; Gorby, Yuri; McInerney, Michael J.

2015-01-01

In anaerobic environments, mutually beneficial metabolic interactions between microorganisms (syntrophy) are essential for oxidation of organic matter to carbon dioxide and methane. Syntrophic interactions typically involve a microorganism degrading an organic compound to primary fermentation by-products and sources of electrons (i.e., formate, hydrogen, or nanowires) and a partner producing methane or respiring the electrons via alternative electron accepting processes. Using a transposon gene mutant library of the sulfate-reducing Desulfovibrio alaskensis G20, we screened for mutants incapable of serving as the electron-accepting partner of the butyrate-oxidizing bacterium, Syntrophomonas wolfei. A total of 17 gene mutants of D. alaskensis were identified as incapable of serving as the electron-accepting partner. The genes identified predominantly fell into three categories: membrane surface assembly, flagellum-pilus synthesis, and energy metabolism. Among these genes required to serve as the electron-accepting partner, the glycosyltransferase, pilus assembly protein (tadC), and flagellar biosynthesis protein showed reduced biofilm formation, suggesting that each of these components is involved in cell-to-cell interactions. Energy metabolism genes encoded proteins primarily involved in H2 uptake and electron cycling, including a rhodanese-containing complex that is phylogenetically conserved among sulfate-reducing Deltaproteobacteria. Utilizing an mRNA sequencing approach, analysis of transcript abundance in wild-type axenic and cocultures confirmed that genes identified as important for serving as the electron-accepting partner were more highly expressed under syntrophic conditions. The results imply that sulfate-reducing microorganisms require flagellar and outer membrane components to effectively couple to their syntrophic partners; furthermore, H2 metabolism is essential for syntrophic growth of D. alaskensis G20. PMID:25616787

Bacterial Pili exploit integrin machinery to promote immune activation and efficient blood-brain barrier penetration

PubMed Central

Banerjee, Anirban; Kim, Brandon J.; Carmona, Ellese M.; Cutting, Andrew S.; Gurney, Michael A.; Carlos, Chris; Feuer, Ralph; Prasadarao, Nemani V.; Doran, Kelly S.

2011-01-01

Group B Streptococcus (GBS) is the leading cause of meningitis in newborn infants. Bacterial cell surface appendages, known as pili, have been recently described in streptococcal pathogens, including GBS. The pilus tip adhesin, PilA, contributes to GBS adherence to blood-brain barrier (BBB) endothelium; however, the host receptor and the contribution of PilA in central nervous system (CNS) disease pathogenesis are unknown. Here we show that PilA binds collagen, which promotes GBS interaction with the α2β1 integrin resulting in activation of host chemokine expression and neutrophil recruitment during infection. Mice infected with the PilA-deficient mutant exhibit delayed mortality, a decrease in neutrophil infiltration and bacterial CNS dissemination. We find that PilA-mediated virulence is dependent on neutrophil influx as neutrophil depletion results in a decrease in BBB permeability and GBS–BBB penetration. Our results suggest that the bacterial pilus, specifically the PilA adhesin, has a dual role in immune activation and bacterial entry into the CNS. PMID:21897373

The ancillary protein 1 of Streptococcus pyogenes FCT-1 pili mediates cell adhesion and biofilm formation through heterophilic as well as homophilic interactions

PubMed Central

Becherelli, Marco; Manetti, Andrea G O; Buccato, Scilla; Viciani, Elisa; Ciucchi, Laura; Mollica, Giulia; Grandi, Guido; Margarit, Imma

2012-01-01

Summary Gram-positive pili are known to play a role in bacterial adhesion to epithelial cells and in the formation of biofilm microbial communities. In the present study we undertook the functional characterization of the pilus ancillary protein 1 (AP1_M6) from Streptococcus pyogenes isolates expressing the FCT-1 pilus variant, known to be strong biofilm formers. Cell binding and biofilm formation assays using S. pyogenes in-frame deletion mutants, Lactococcus expressing heterologous FCT-1 pili and purified recombinant AP1_M6, indicated that this pilin is a strong cell adhesin that is also involved in bacterial biofilm formation. Moreover, we show that AP1_M6 establishes homophilic interactions that mediate inter-bacterial contact, possibly promoting bacterial colonization of target epithelial cells in the form of three-dimensional microcolonies. Finally, AP1_M6 knockout mutants were less virulent in mice, indicating that this protein is also implicated in GAS systemic infection. PMID:22320452

The YvqE two-component system controls biofilm formation and acid production in Streptococcus pyogenes.

PubMed

Isaka, Masanori; Tatsuno, Ichiro; Maeyama, Jun-Ichi; Matsui, Hideyuki; Zhang, Yan; Hasegawa, Tadao

2016-07-01

In Streptococcus pyogenes, proteins involved in determining virulence are controlled by stand-alone response regulators and by two-component regulatory systems. Previous studies reported that, compared to the parental strain, the yvqE sensor knockout strain showed significantly reduced growth and lower virulence. To determine the function of YvqE, we performed biofilm analysis and pH assays on yvqE mutants, and site-directed mutagenesis of YvqE. The yvqE deletion mutant showed a slower acid production rate, indicating that YvqE regulates acid production from sugar fermentation. The mutant strain, in which the Asp(26) residue in YvqE was replaced with Asn, affected biofilm formation, suggesting that this amino acid senses hydrogen ions produced by fermentative sugar metabolism. Signals received by YvqE were directly or indirectly responsible for inducing pilus expression. This study shows that at low environmental pH, biofilm formation in S. pyogenes is mediated by YvqE and suggests that regulation of pilus expression by environmental acidification could be directly under the control of YvqE. © 2016 APMIS. Published by John Wiley & Sons Ltd.

Isolation and characterization of mutants with lesions affecting pellicle formation and erythrocyte agglutination by type 1 piliated Escherichia coli.

PubMed Central

Harris, S L; Elliott, D A; Blake, M C; Must, L M; Messenger, M; Orndorff, P E

1990-01-01

The product of the pilE (also called fimH) gene is a minor component of type 1 pili in Escherichia coli. Mutants that have insertions in the pilE gene are fully piliated but unable to bind to and agglutinate guinea pig erythrocytes, a characteristic of wild-type type 1 piliated E. coli. In this paper we describe the isolation of 48 mutants with point lesions that map to the pilE gene. Such mutants were isolated by using mutT mutagenesis and an enrichment procedure devised to favor the growth of individuals that could form a pellicle in static broth containing alpha-methylmannoside, an inhibitor of erythrocyte binding and pellicle formation. Results indicated that the enrichment favored mutants expressing pilE gene products that were defective in mediating erythrocyte binding. Characterization of 12 of the mutants in greater detail revealed that certain lesions affected pilus number and length. In addition, a mutant that was temperature sensitive for erythrocyte binding was isolated and used to provide evidence that pellicle formation relies on the intercellular interaction of pilE gene products. Our results suggest a molecular explanation for the old and paradoxical observations connecting pellicle formation and erythrocyte agglutination by type 1 piliated E. coli. Images PMID:1977736

Extension of the classical classification of β-turns

PubMed Central

de Brevern, Alexandre G.

2016-01-01

The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

Extension of the classical classification of β-turns.

PubMed

de Brevern, Alexandre G

2016-09-15

The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

PubMed

Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

2017-01-01

The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

PubMed

Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

2007-08-01

Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

[Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

PubMed

Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

1985-04-01

Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

PubMed

Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

2014-04-01

The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

Discrete and Structurally Unique Proteins (T$$\\bar{a}$$pirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose

DOE PAGES

Blumer-Schuette, S. E.; Alahuhta, M.; Conway, J. M.; ...

2015-04-24

A variety of catalytic and noncatalytic protein domains are deployed by select microorganisms to deconstruct lignocellulose. These extracellular proteins are used to attach to, modify, and hydrolyze the complex polysaccharides present in plant cell walls. Cellulolytic enzymes, often containing carbohydrate-binding modules, are key to this process; however, these enzymes are not solely responsible for attachment. Few mechanisms of attachment have been discovered among bacteria that do not form large polypeptide structures, called cellulosomes, to deconstruct biomass. In this study, bioinformatics and proteomics analyses identified unique, discrete, hypothetical proteins (“tmore » $$\\bar{a}$$pirins,” origin from M$$\\bar{a}$$ori: to join), not directly associated with cellulases, that mediate attachment to cellulose by species in the noncellulosomal, extremely thermophilic bacterial genus Caldicellulosiruptor. Two t$$\\bar{a}$$pirin genes are located directly downstream of a type IV pilus operon in strongly cellulolytic members of the genus, whereas homologs are absent from the weakly cellulolytic Caldicellulosiruptor species. Based on their amino acid sequence, t$$\\bar{a}$$pirins are specific to these extreme thermophiles. T$$\\bar{a}$$pirins are also unusual in that they share no detectable protein domain signatures with known polysaccharide-binding proteins. Adsorption isotherm and trans vivo analyses demonstrated the carbohydrate-binding module-like affinity of the t$$\\bar{a}$$pirins for cellulose. Crystallization of a cellulose-binding truncation from one t$$\\bar{a}$$pirin indicated that these proteins form a long β-helix core with a shielded hydrophobic face. In addition, they are structurally unique and define a new class of polysaccharide adhesins. Strongly cellulolytic Caldicellulosiruptor species employ t$$\\bar{a}$$pirins to complement substrate-binding proteins from the ATP-binding cassette transporters and multidomain extracellular and S-layer-associated glycoside hydrolases to process the carbohydrate content of lignocellulose.« less

Discrete and Structurally Unique Proteins (T$$\\bar{a}$$pirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blumer-Schuette, S. E.; Alahuhta, M.; Conway, J. M.

A variety of catalytic and noncatalytic protein domains are deployed by select microorganisms to deconstruct lignocellulose. These extracellular proteins are used to attach to, modify, and hydrolyze the complex polysaccharides present in plant cell walls. Cellulolytic enzymes, often containing carbohydrate-binding modules, are key to this process; however, these enzymes are not solely responsible for attachment. Few mechanisms of attachment have been discovered among bacteria that do not form large polypeptide structures, called cellulosomes, to deconstruct biomass. In this study, bioinformatics and proteomics analyses identified unique, discrete, hypothetical proteins (“tmore » $$\\bar{a}$$pirins,” origin from M$$\\bar{a}$$ori: to join), not directly associated with cellulases, that mediate attachment to cellulose by species in the noncellulosomal, extremely thermophilic bacterial genus Caldicellulosiruptor. Two t$$\\bar{a}$$pirin genes are located directly downstream of a type IV pilus operon in strongly cellulolytic members of the genus, whereas homologs are absent from the weakly cellulolytic Caldicellulosiruptor species. Based on their amino acid sequence, t$$\\bar{a}$$pirins are specific to these extreme thermophiles. T$$\\bar{a}$$pirins are also unusual in that they share no detectable protein domain signatures with known polysaccharide-binding proteins. Adsorption isotherm and trans vivo analyses demonstrated the carbohydrate-binding module-like affinity of the t$$\\bar{a}$$pirins for cellulose. Crystallization of a cellulose-binding truncation from one t$$\\bar{a}$$pirin indicated that these proteins form a long β-helix core with a shielded hydrophobic face. In addition, they are structurally unique and define a new class of polysaccharide adhesins. Strongly cellulolytic Caldicellulosiruptor species employ t$$\\bar{a}$$pirins to complement substrate-binding proteins from the ATP-binding cassette transporters and multidomain extracellular and S-layer-associated glycoside hydrolases to process the carbohydrate content of lignocellulose.« less

Genome sequence of Shimia str. SK013, a representative of the Roseobacter group isolated from marine sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanukollu, Saranya; Voget, Sonja; Pohlner, Marion

Shimia strain SK013 is an aerobic, Gram-negative, rod shaped alphaproteobacterium affiliated with the Roseobacter group within the family Rhodobacteraceae. The strain was isolated from surface sediment (0-1 cm) of the Skagerrak at 114 m below sea level. The 4,049,808 bp genome of Shimia str. SK013 comprises 3,981 protein-coding genes and 47 RNA genes. It contains one chromosome and no extrachromosomal elements. The genome analysis revealed the presence of genes for a dimethylsulfoniopropionate lyase, demethylase and the trimethylamine methyltransferase ( mttB) as well as genes for nitrate, nitrite and dimethyl sulfoxide reduction. This indicates that Shimia str. SK013 is able tomore » switch from aerobic to anaerobic metabolism and thus is capable of aerobic and anaerobic sulfur cycling at the seafloor. Among the ability to convert other sulfur compounds it has the genetic capacity to produce climatically active dimethyl sulfide. Growth on glutamate as a sole carbon source results in formation of cell-connecting filaments, a putative phenotypic adaptation of the surface-associated strain to the environmental conditions at the seafloor. Genome analysis revealed the presence of a flagellum ( fla1) and a type IV pilus biogenesis, which is speculated to be a prerequisite for biofilm formation. This is also related to genes responsible for signalling such as N-acyl homoserine lactones, as well as quip-genes responsible for quorum quenching and antibiotic biosynthesis. Pairwise similarities of 16S rRNA genes (98.56 % sequence similarity to the next relative S. haliotis) and the in silico DNA-DNA hybridization (21.20 % sequence similarity to S. haliotis) indicated Shimia str. SK013 to be considered as a new species. In conclusion, the genome analysis of Shimia str. SK013 offered first insights into specific physiological and phenotypic adaptation mechanisms of Roseobacter-affiliated bacteria to the benthic environment.« less

Phenotypic Variation in the Plant Pathogenic Bacterium Acidovorax citrulli

PubMed Central

Shrestha, Ram Kumar; Rosenberg, Tally; Makarovsky, Daria; Eckshtain-Levi, Noam; Zelinger, Einat; Kopelowitz, June; Sikorski, Johannes; Burdman, Saul

2013-01-01

Acidovorax citrulli causes bacterial fruit blotch (BFB) of cucurbits, a disease that threatens the cucurbit industry worldwide. Despite the economic importance of BFB, little is known about pathogenicity and fitness strategies of the bacterium. We have observed the phenomenon of phenotypic variation in A. citrulli. Here we report the characterization of phenotypic variants (PVs) of two strains, M6 and 7a1, isolated from melon and watermelon, respectively. Phenotypic variation was observed following growth in rich medium, as well as upon isolation of bacteria from inoculated plants or exposure to several stresses, including heat, salt and acidic conditions. When grown on nutrient agar, all PV colonies possessed a translucent appearance, in contrast to parental strain colonies that were opaque. After 72 h, PV colonies were bigger than parental colonies, and had a fuzzy appearance relative to parental strain colonies that are relatively smooth. A. citrulli colonies are generally surrounded by haloes detectable by the naked eye. These haloes are formed by type IV pilus (T4P)-mediated twitching motility that occurs at the edge of the colony. No twitching haloes could be detected around colonies of both M6 and 7a1 PVs, and microscopy observations confirmed that indeed the PVs did not perform twitching motility. In agreement with these results, transmission electron microscopy revealed that M6 and 7a1 PVs do not produce T4P under tested conditions. PVs also differed from their parental strain in swimming motility and biofilm formation, and interestingly, all assessed variants were less virulent than their corresponding parental strains in seed transmission assays. Slight alterations could be detected in some DNA fingerprinting profiles of 7a1 variants relative to the parental strain, while no differences at all could be seen among M6 variants and parental strain, suggesting that, at least in the latter, phenotypic variation is mediated by slight genetic and/or epigenetic alterations. PMID:24023830

Impact of maintenance immunosuppressive therapy on the fecal microbiome of renal transplant recipients: Comparison between an everolimus- and a standard tacrolimus-based regimen

PubMed Central

Dalla Gassa, Alessandra; Felis, Giovanna; Granata, Simona; Torriani, Sandra; Lupo, Antonio

2017-01-01

Background The gut microbiome is the full set of microbes living in the gastrointestinal tract and is emerging as an important dynamic/fluid system that, if altered by environmental, dietetic or pharmacological factors, could considerably influence drug response. However, the immunosuppressive drug-induced modifications of this system are still poorly defined. Methods We employed an innovative bioinformatics approach to assess differences in the whole-gut microbial metagenomic profile of 20 renal transplant recipients undergoing maintenance treatment with two different immunosuppressive protocols. Nine patients were treated with everolimus plus mycophenolate mofetil (EVE+MMF group), and 11 patients were treated with a standard therapy with tacrolimus plus mycophenolate mofetil (TAC+MMF group). Results A statistical analysis of comparative high-throughput data demonstrated that although similar according to the degree of Shannon diversity (alpha diversity) at the taxonomic level, three functional genes clearly discriminated EVE+MMF versus TAC+MMF (cutoff: log2 fold change≥1, FDR≤0.05). Flagellar motor switch protein (fliNY) and type IV pilus assembly protein pilM (pilM) were significantly enriched in TAC+MMF-treated patients, while macrolide transport system mrsA (msrA) was more abundant in patients treated with EVE+MMF. Finally, PERMANOVA revealed that among the variables analyzed and included in our model, only the consumption of sugar significantly influenced beta diversity. Conclusions Our study, although performed on a relatively small number of patients, showed, for the first time, specific immunosuppressive-related effects on fecal microbiome of renal transplant recipients and it suggested that the analysis of the gut microbes community could represent a new tool to better understand the effects of drugs currently employed in organ transplantations. However, multicenter studies including healthy controls should be undertaken to better address this objective. PMID:28542523

Genome sequence of Shimia str. SK013, a representative of the Roseobacter group isolated from marine sediment

DOE PAGES

Kanukollu, Saranya; Voget, Sonja; Pohlner, Marion; ...

2016-03-12

Shimia strain SK013 is an aerobic, Gram-negative, rod shaped alphaproteobacterium affiliated with the Roseobacter group within the family Rhodobacteraceae. The strain was isolated from surface sediment (0-1 cm) of the Skagerrak at 114 m below sea level. The 4,049,808 bp genome of Shimia str. SK013 comprises 3,981 protein-coding genes and 47 RNA genes. It contains one chromosome and no extrachromosomal elements. The genome analysis revealed the presence of genes for a dimethylsulfoniopropionate lyase, demethylase and the trimethylamine methyltransferase ( mttB) as well as genes for nitrate, nitrite and dimethyl sulfoxide reduction. This indicates that Shimia str. SK013 is able tomore » switch from aerobic to anaerobic metabolism and thus is capable of aerobic and anaerobic sulfur cycling at the seafloor. Among the ability to convert other sulfur compounds it has the genetic capacity to produce climatically active dimethyl sulfide. Growth on glutamate as a sole carbon source results in formation of cell-connecting filaments, a putative phenotypic adaptation of the surface-associated strain to the environmental conditions at the seafloor. Genome analysis revealed the presence of a flagellum ( fla1) and a type IV pilus biogenesis, which is speculated to be a prerequisite for biofilm formation. This is also related to genes responsible for signalling such as N-acyl homoserine lactones, as well as quip-genes responsible for quorum quenching and antibiotic biosynthesis. Pairwise similarities of 16S rRNA genes (98.56 % sequence similarity to the next relative S. haliotis) and the in silico DNA-DNA hybridization (21.20 % sequence similarity to S. haliotis) indicated Shimia str. SK013 to be considered as a new species. In conclusion, the genome analysis of Shimia str. SK013 offered first insights into specific physiological and phenotypic adaptation mechanisms of Roseobacter-affiliated bacteria to the benthic environment.« less

Genetics Home Reference: familial porencephaly

MedlinePlus

... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

A type IV burst associated with a coronal streamer disruption event

NASA Technical Reports Server (NTRS)

Kundu, M. R.

1987-01-01

A type IV burst was observed on February 17, 1985 with the Clark Lake Radio Observatory multifrequency radioheliograph operating in the frequency range 20-125 MHz. This burst was associated with a coronal streamer disruption event. From two-dimensional images produced at 50 MHz, evidence of a type II burst and a slow moving type IV burst are shown. The observations of the moving type IV burst suggests that a plasmoid containing energetic electrons can result from the disruption of a coronal streamer.

Structure-based discovery of glycomimetic FmlH ligands as inhibitors of bacterial adhesion during urinary tract infection.

PubMed

Kalas, Vasilios; Hibbing, Michael E; Maddirala, Amarendar Reddy; Chugani, Ryan; Pinkner, Jerome S; Mydock-McGrane, Laurel K; Conover, Matt S; Janetka, James W; Hultgren, Scott J

2018-03-20

Treatment of bacterial infections is becoming a serious clinical challenge due to the global dissemination of multidrug antibiotic resistance, necessitating the search for alternative treatments to disarm the virulence mechanisms underlying these infections. Uropathogenic Escherichia coli (UPEC) employs multiple chaperone-usher pathway pili tipped with adhesins with diverse receptor specificities to colonize various host tissues and habitats. For example, UPEC F9 pili specifically bind galactose or N -acetylgalactosamine epitopes on the kidney and inflamed bladder. Using X-ray structure-guided methods, virtual screening, and multiplex ELISA arrays, we rationally designed aryl galactosides and N -acetylgalactosaminosides that inhibit the F9 pilus adhesin FmlH. The lead compound, 29β-NAc, is a biphenyl N -acetyl-β-galactosaminoside with a K i of ∼90 nM, representing a major advancement in potency relative to the characteristically weak nature of most carbohydrate-lectin interactions. 29β-NAc binds tightly to FmlH by engaging the residues Y46 through edge-to-face π-stacking with its A-phenyl ring, R142 in a salt-bridge interaction with its carboxylate group, and K132 through water-mediated hydrogen bonding with its N-acetyl group. Administration of 29β-NAc in a mouse urinary tract infection (UTI) model significantly reduced bladder and kidney bacterial burdens, and coadministration of 29β-NAc and mannoside 4Z269, which targets the type 1 pilus adhesin FimH, resulted in greater elimination of bacteria from the urinary tract than either compound alone. Moreover, FmlH specifically binds healthy human kidney tissue in a 29β-NAc-inhibitable manner, suggesting a key role for F9 pili in human kidney colonization. Thus, these glycoside antagonists of FmlH represent a rational antivirulence strategy for UPEC-mediated UTI treatment. Copyright © 2018 the Author(s). Published by PNAS.

Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

MedlinePlus

... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

viking: identification and characterization of a second type IV collagen in Drosophila.

PubMed

Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

1997-10-01

We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

Genomic Characterization and Transcriptional Studies of the Starch-Utilizing Strain Bifidobacterium adolescentis 22L

PubMed Central

Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Milani, Christian; Viappiani, Alice; Mangifesta, Marta; Gioiosa, Laura; Palanza, Paola; van Sinderen, Douwe

2014-01-01

Bifidobacteria are members of the gut microbiota, but the genetic basis for their adaptation to the human gut is poorly understood. The analysis of the 2,203,222-bp genome of Bifidobacterium adolescentis 22L revealed a nutrient acquisition strategy that targets diet/plant-derived glycans, in particular starch and starch-like carbohydrates. Starch-like carbohydrates were shown to support the growth of B. adolescentis 22L. Transcriptome profiling of 22L cultures grown under in vitro conditions or during colonization of the murine gut by RNA sequencing and quantitative real-time PCR assays revealed the expression of a set of chromosomal loci responsible for starch metabolism as well as for pilus production. Such extracellular structures include so-called sortase-dependent and type IVb pili, which may be involved in gut colonization of 22L through adhesion to extracellular matrix proteins. PMID:25063659

Variability in biofilm formation correlates with hydrophobicity and quorum sensing among Vibrio parahaemolyticus isolates from food contact surfaces and the distribution of the genes involved in biofilm formation.

PubMed

Mizan, Md Furkanur Rahaman; Jahid, Iqbal Kabir; Kim, Minhui; Lee, Ki-Hoon; Kim, Tae Jo; Ha, Sang-Do

2016-01-01

Vibrio parahaemolyticus is one of the leading foodborne pathogens causing seafood contamination. Here, 22 V. parahaemolyticus strains were analyzed for biofilm formation to determine whether there is a correlation between biofilm formation and quorum sensing (QS), swimming motility, or hydrophobicity. The results indicate that the biofilm formation ability of V. parahaemolyticus is positively correlated with cell surface hydrophobicity, autoinducer (AI-2) production, and protease activity. Field emission scanning electron microscopy (FESEM) showed that strong-biofilm-forming strains established thick 3-D structures, whereas poor-biofilm-forming strains produced thin inconsistent biofilms. In addition, the distribution of the genes encoding pandemic clone factors, type VI secretion systems (T6SS), biofilm functions, and the type I pilus in the V. parahaemolyticus seafood isolates were examined. Biofilm-associated genes were present in almost all the strains, irrespective of other phenotypes. These results indicate that biofilm formation on/in seafood may constitute a major factor in the dissemination of V. parahaemolyticus and the ensuing diseases.

Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

PubMed Central

Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

1994-01-01

Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

MedlinePlus

... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

PubMed

McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

2014-10-01

The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

PubMed Central

McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

2014-01-01

The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

PubMed Central

Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

2014-01-01

Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM. PMID:26069692

Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

PubMed Central

Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

2011-01-01

Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological andmore » abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it could be implemented in similar systems where it has not been possible to obtain highly ordered crystals.« less

Consensus in controversy: The modified Delphi method applied to Gynecologic Oncology practice.

PubMed

Cohn, David E; Havrilesky, Laura J; Osann, Kathryn; Lipscomb, Joseph; Hsieh, Susie; Walker, Joan L; Wright, Alexi A; Alvarez, Ronald D; Karlan, Beth Y; Bristow, Robert E; DiSilvestro, Paul A; Wakabayashi, Mark T; Morgan, Robert; Mukamel, Dana B; Wenzel, Lari

2015-09-01

To determine the degree of consensus regarding the probabilities of outcomes associated with IP/IV and IV chemotherapy. A survey was administered to an expert panel using the Delphi method. Ten ovarian cancer experts were asked to estimate outcomes for patients receiving IP/IV or IV chemotherapy. The clinical estimates were: 1) probability of completing six cycles of chemotherapy, 2) probability of surviving five years, 3) median survival, and 4) probability of ER/hospital visits during treatment. Estimates for two patients, one with a low comorbidity index (patient 1) and the other with a moderate index (patient 2), were included. The survey was administered in three rounds, and panelists could revise their subsequent responses based on review of the anonymous opinions of their peers. The ranges were smaller for IV compared with IP/IV therapy. Ranges decreased with each round. Consensus converged around outcomes related to IP/IV chemotherapy for: 1) completion of 6 cycles of therapy (type 1 patient, 62%, type 2 patient, 43%); 2) percentage of patients surviving 5 years (type 1 patient, 66%, type 2 patient, 47%); and 3) median survival (type 1 patient, 83 months, type 2 patient, 58 months). The group required three rounds to achieve consensus on the probabilities of ER/hospital visits (type 1 patient, 24%, type 2 patient, 35%). Initial estimates of survival and adverse events associated with IP/IV chemotherapy differ among experts. The Delphi process works to build consensus and may be a pragmatic tool to inform patients of their expected outcomes. Copyright © 2015 Elsevier Inc. All rights reserved.

Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

PubMed

Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

2018-07-01

Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

PubMed

Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

2013-03-01

The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

2010-04-20

Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

A Putative O-Linked β-N-Acetylglucosamine Transferase Is Essential for Hormogonium Development and Motility in the Filamentous Cyanobacterium Nostoc punctiforme.

PubMed

Khayatan, Behzad; Bains, Divleen K; Cheng, Monica H; Cho, Ye Won; Huynh, Jessica; Kim, Rachelle; Omoruyi, Osagie H; Pantoja, Adriana P; Park, Jun Sang; Peng, Julia K; Splitt, Samantha D; Tian, Mason Y; Risser, Douglas D

2017-05-01

Most species of filamentous cyanobacteria are capable of gliding motility, likely via a conserved type IV pilus-like system that may also secrete a motility-associated polysaccharide. In a subset of these organisms, motility is achieved only after the transient differentiation of hormogonia, which are specialized filaments that enter a nongrowth state dedicated to motility. Despite the fundamental importance of hormogonia to the life cycles of many filamentous cyanobacteria, the molecular regulation of hormogonium development is largely undefined. To systematically identify genes essential for hormogonium development and motility in the model heterocyst-forming filamentous cyanobacterium Nostoc punctiforme , a forward genetic screen was employed. The first gene identified using this screen, designated ogtA , encodes a putative O-linked β- N -acetylglucosamine transferase (OGT). The deletion of ogtA abolished motility, while ectopic expression of ogtA induced hormogonium development even under hormogonium-repressing conditions. Transcription of ogtA is rapidly upregulated (1 h) following hormogonium induction, and an OgtA-GFPuv fusion protein localized to the cytoplasm. In developing hormogonia, accumulation of PilA but not HmpD is dependent on ogtA Reverse transcription-quantitative PCR (RT-qPCR) analysis indicated equivalent levels of pilA transcript in the wild-type and Δ ogtA mutant strains, while a reporter construct consisting of the intergenic region in the 5' direction of pilA fused to gfp produced lower levels of fluorescence in the Δ ogtA mutant strain than in the wild type. The production of hormogonium polysaccharide in the Δ ogtA mutant strain is reduced compared to that in the wild type but comparable to that in a pilA deletion strain. Collectively, these results imply that O -GlcNAc protein modification regulates the accumulation of PilA via a posttranscriptional mechanism in developing hormogonia. IMPORTANCE Filamentous cyanobacteria are among the most developmentally complex prokaryotes. Species such as Nostoc punctiforme develop an array of cell types, including nitrogen-fixing heterocysts, spore-like akinetes, and motile hormogonia, that function in dispersal as well as the establishment of nitrogen-fixing symbioses with plants and fungi. These symbioses are major contributors to global nitrogen fixation. Despite the fundamental importance of hormogonia to the life cycle of filamentous cyanobacteria and the establishment of symbioses, the molecular regulation of hormogonium development is largely undefined. We employed a genetic screen to identify genes essential for hormogonium development and motility in Nostoc punctiforme The first gene identified using this screen encodes a eukaryotic-like O-linked β- N -acetylglucosamine transferase that is required for accumulation of PilA in hormogonia. Copyright © 2017 American Society for Microbiology.

Essential core of the Hawking–Ellis types

NASA Astrophysics Data System (ADS)

Martín-Moruno, Prado; Visser, Matt

2018-06-01

The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

NopB, a type III secreted protein of Rhizobium sp. strain NGR234, is associated with pilus-like surface appendages.

PubMed

Saad, Maged M; Kobayashi, Hajime; Marie, Corinne; Brown, Ian R; Mansfield, John W; Broughton, William J; Deakin, William J

2005-02-01

Rhizobium sp. strain NGR234 possesses a functional type three secretion system (TTSS), through which a number of proteins, called nodulation outer proteins (Nops), are delivered to the outside of the cell. A major constraint to the identification of Nops is their low abundance in the supernatants of NGR234 strains grown in culture. To overcome this limitation, a more sensitive proteomics-based strategy was developed. Secreted proteins from wild-type NGR234 were separated by two-dimensional gel electrophoresis, and the gel was compared to similar gels containing the proteins from a TTSS mutant (NGROmegarhcN). To identify the proteins, spots unique to the NGR234 gels were analyzed by matrix-assisted laser desorption ionization-time of flight mass spectrometry and the data were compared to the sequence of the symbiotic plasmid of NGR234. A nonpolar mutant of one of these proteins was generated called NopB. NopB is required for Nop secretion but inhibits the interaction with Pachyrhizus tuberosus and augments nodulation of Tephrosia vogelii. Flavonoids and a functional TTSS are required for the formation of some surface appendages on NGR234. In situ immunogold labeling and isolation of these pili showed that they contain NopB.

NopB, a Type III Secreted Protein of Rhizobium sp. Strain NGR234, Is Associated with Pilus-Like Surface Appendages

PubMed Central

Saad, Maged M.; Kobayashi, Hajime; Marie, Corinne; Brown, Ian R.; Mansfield, John W.; Broughton, William J.; Deakin, William J.

2005-01-01

Rhizobium sp. strain NGR234 possesses a functional type three secretion system (TTSS), through which a number of proteins, called nodulation outer proteins (Nops), are delivered to the outside of the cell. A major constraint to the identification of Nops is their low abundance in the supernatants of NGR234 strains grown in culture. To overcome this limitation, a more sensitive proteomics-based strategy was developed. Secreted proteins from wild-type NGR234 were separated by two-dimensional gel electrophoresis, and the gel was compared to similar gels containing the proteins from a TTSS mutant (NGRΩrhcN). To identify the proteins, spots unique to the NGR234 gels were analyzed by matrix-assisted laser desorption ionization-time of flight mass spectrometry and the data were compared to the sequence of the symbiotic plasmid of NGR234. A nonpolar mutant of one of these proteins was generated called NopB. NopB is required for Nop secretion but inhibits the interaction with Pachyrhizus tuberosus and augments nodulation of Tephrosia vogelii. Flavonoids and a functional TTSS are required for the formation of some surface appendages on NGR234. In situ immunogold labeling and isolation of these pili showed that they contain NopB. PMID:15659692

Identification and characterization of a gene product that regulates type 1 piliation in Escherichia coli.

PubMed Central

Orndorff, P E; Falkow, S

1984-01-01

The recombinant plasmid pSH2 confers type 1 piliation (Pil+) on a nonpiliated (Pil-) strain of Escherichia coli K-12. At least four plasmid-encoded gene products are involved in pilus biosynthesis and expression. We present evidence which indicates that one gene encodes an inhibitor of piliation. Hyperpiliated (Hyp) mutants were isolated after Tn5 insertion mutagenesis of pSH2 and introduction of the plasmid DNA into a Pil- strain of E. coli as unique small, compact colonies. Also, Hyp mutants clumped during growth in static broth and were piliated under several cultural conditions that normally suppressed piliation. Electron microscopic examination of Hyp mutants associated an observed 40-fold increase in pilin antigen with an increase in the number and length of pili per cell. All Hyp mutants examined failed to produce a 23-kilodalton protein that was encoded by a gene adjacent to the structural (pilin) gene for type 1 pili, and all Tn5 insertion mutations that produced the Hyp phenotype mapped in this region (hyp). Piliation in Hyp mutants could be reduced to near parental levels by introducing a second plasmid containing a parental hyp gene. Thus the 23-kilodalton (hyp) protein appears to act in trans to regulate the level of piliation. Images PMID:6148338

Observational properties of decameter type IV bursts

NASA Astrophysics Data System (ADS)

Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

2013-04-01

Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

PubMed

Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

2007-01-01

Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

PubMed

Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

2014-01-01

Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

PubMed

Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

2017-08-01

SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

PubMed Central

Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

2009-01-01

Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

Importance of adhesins in the recurrence of pharyngeal infections caused by Streptococcus pyogenes.

PubMed

Wozniak, Aniela; Scioscia, Natalia; Geoffroy, Enrique; Ponce, Iván; García, Patricia

2017-04-01

Pharyngo-amygdalitis is the most common infection caused by Streptococcus pyogenes (S. pyogenes). Reinfection with strains of different M types commonly occurs. However, a second infection with a strain of the same M type can still occur and is referred to as recurrence. We aimed to assess whether recurrence of S. pyogenes could be associated to erythromycin resistance, biofilm formation or surface adhesins like fibronectin-binding proteins and pilus proteins, both located in the fibronectin-binding, collagen-binding, T-antigen (FCT) region. We analyed clinical isolates of S. pyogenes obtained from children with multiple positive cultures of throat swabs. We analysed potential associations between M types, clonal patterns, biofilm production and FCT types with their capacity of producing a recurrent infection. We genetically defined recurrence as an infection with the same M type (same strain) and reinfection as an infection with a different M type. No differences were observed between recurrent and reinfection isolates in relation to erythromycin resistance, presence and number of domains of prtF1 gene, and biofilm formation capacity; the only significant difference was the higher frequency of FCT-4 type among recurrent isolates. However, when all the factors that could contribute to recurrence (erythromycin resistance, biofilm production, presence of prtF1 gene and FCT-4 type) were analysed together, we observed that recurrent isolates have a higher number of factors than reinfection isolates. Recurrence seems not to be associated with biofilm formation. However, pili and fibronectin-binding proteins could be associated with recurrence because FCT-4 isolates which harbour two fibronectin-binding proteins are more frequent among recurrent isolates.

European Science Notes, Volume 39, Number 5.

DTIC Science & Technology

1985-05-01

sharpened. The Experimental Psychology Society: Notes on Auditory Perception, Working Memory, and Circadian Rhythm ...... Richard E. Snow 183 The...drag reduction of at most 5 percent experimentally to date. 1984 Ship-Hydrodynamics Meetings .......................... Choung M. Lee 206 Two important...1 SPECIALISTS designers of University trauninQ it) NIT . s s tSemns ) PIlus applied out of ,( Oi oul HvT es de[igners oft (In compainy trining InF

Joint Program on Molecular Biology of Marine Organisms

DTIC Science & Technology

1992-08-20

and lateral flagella formation in a marine vibrio (Belas and Colwell, 1982). Upon contact with a surface, the polar flagella of Vibrio ... parahemolyticus ceased to function. Shortl’ thereafter, lateral flagella formed around the cells, apparently mediating the "irreversible" attachment process. Pilus...Colwell. 1982. Adsorption kinetics of 18 Slaterally and polarly flagellated Vibrio . J. Bacteriol. 151:1568-1580. S-- Brown, C.M., D.C. Ellwood, and

Gordon Conference on Microbial Adhesion

DTIC Science & Technology

1988-07-01

00-11:45 a.m. * antigen A and dextranase in Streptococcus mutans colonization. B. Uhlin, Regulation of pilus-adhesin 11:45-12:30 p.m.expression in E...surfaces. In addition, the role of bacterium-bacterium co- aggregation processes was considered. Why does Streptococcus sanguis have such a high affinity...attachment of bacteria to saliva-coated surfaces? Why is S. mutans poorly adherent yet highly cariogenic? What are the characteri-tics of strcptococcal

Examination of Diverse Toxin-Coregulated Pilus-Positive Vibrio cholerae Strains Fails To Demonstrate Evidence for Vibrio Pathogenicity Island Phage

PubMed Central

Faruque, Shah M.; Zhu, Jun; Asadulghani; Kamruzzaman, M.; Mekalanos, John J.

2003-01-01

The major virulence factors of toxigenic Vibrio cholerae are cholera toxin, which is encoded by a lysogenic filamentous bacteriophage (CTXΦ), and toxin-coregulated pilus (TCP), an essential colonization factor that is also the receptor for CTXΦ. The genes involved in the biosynthesis of TCP reside in a pathogenicity island, which has been reported to correspond to the genome of another filamentous phage (designated VPIΦ) and to encode functions necessary for the production of infectious VPIΦ particles. We examined 46 V. cholerae strains having diverse origins and carrying different genetic variants of the TCP island for the production of the VPIΦ and CTXΦ in different culture conditions, including induction of prophages with mitomycin C and UV irradiation. Although 9 of 10 V. cholerae O139 strains and 12 of 15 toxigenic El Tor strains tested produced extracellular CTXΦ, none of the 46 TCP-positive strains produced detectable VPIΦ in repeated assays, which detected as few as 10 particles of a control CTX phage per ml. These results contradict the previous report regarding VPIΦ-mediated horizontal transfer of the TCP genes and suggest that the TCP island is unable to support the production of phage particles. Further studies are necessary to understand the mechanism of horizontal transfer of the TCP island. PMID:12761075

Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

USGS Publications Warehouse

Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

2005-01-01

Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

Plague vaccines and the molecular basis of immunity against Yersinia pestis.

PubMed

Quenee, Lauriane E; Schneewind, Olaf

2009-12-01

Yersinia pestis is the causative agent of bubonic and pneumonic plague, human diseases with high mortality. Due to the microbe's ability to spread rapidly, plague epidemics present a serious public health threat. A search for prophylactic measures was initially based on historical reports of bubonic plague survivors and their apparent immunity. Due to safety and efficacy concerns, killed whole-cell preparations or live-attenuated plague vaccines are no longer considered in the United States. Vaccine developers have focused on specific subunits of plague bacteria. LcrV, a protein at the tip of type III secretion needles, and F1, the capsular pilus antigen, are both recognized as plague protective antigens. Antibodies against LcrV and F1 interfere with Y. pestis type III injection of host cells. While LcrV is absolutely essential for Y. pestis virulence, expression of F1 is dispensable for plague pathogenesis in small animals, non-human primates and presumably also in humans. Several subunit vaccines, for example rF1+rV (rYP002), rF1V or rV10, are being developed to generate plague protection in humans. Efficacy testing and licensure for human use requires the establishment of correlates for plague immunity.

Structure of the heterotrimeric complex that regulates type III secretion needle formation

PubMed Central

Quinaud, Manuelle; Plé, Sophie; Job, Viviana; Contreras-Martel, Carlos; Simorre, Jean-Pierre; Attree, Ina; Dessen, Andréa

2007-01-01

Type III secretion systems (T3SS), found in several Gram-negative pathogens, are nanomachines involved in the transport of virulence effectors directly into the cytoplasm of target cells. T3SS are essentially composed of basal membrane-embedded ring-like structures and a hollow needle formed by a single polymerized protein. Within the bacterial cytoplasm, the T3SS needle protein requires two distinct chaperones for stabilization before its secretion, without which the entire T3SS is nonfunctional. The 2.0-Å x-ray crystal structure of the PscE-PscF55–85-PscG heterotrimeric complex from Pseudomonas aeruginosa reveals that the C terminus of the needle protein PscF is engulfed within the hydrophobic groove of the tetratricopeptide-like molecule PscG, indicating that the macromolecular scaffold necessary to stabilize the T3SS needle is totally distinct from chaperoned complexes between pilus- or flagellum-forming molecules. Disruption of specific PscG–PscF interactions leads to impairment of bacterial cytotoxicity toward macrophages, indicating that this essential heterotrimer, which possesses homologs in a wide variety of pathogens, is a unique attractive target for the development of novel antibacterials. PMID:17470796

Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

PubMed

Zachariae, R; Bjerring, P; Arendt-Nielsen, L

1989-11-01

Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

PubMed

Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

2018-05-30

The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

The Crystal Structure Analysis of Group B Streptococcus Sortase C1: A Model for the ;Lid; Movement upon Substrate Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khare, Baldeep; Fu, Zheng-Qing; Huang, I-Hsiu

2012-02-07

A unique feature of the class-C-type sortases, enzymes essential for Gram-positive pilus biogenesis, is the presence of a flexible 'lid' anchored in the active site. However, the mechanistic details of the 'lid' displacement, suggested to be a critical prelude for enzyme catalysis, are not yet known. This is partly due to the absence of enzyme-substrate and enzyme-inhibitor complex crystal structures. We have recently described the crystal structures of the Streptococcus agalactiae SAG2603 V/R sortase SrtC1 in two space groups (type II and type III) and that of its 'lid' mutant and proposed a role of the 'lid' as a protectormore » of the active-site hydrophobic environment. Here, we report the crystal structures of SAG2603 V/R sortase C1 in a different space group (type I) and that of its complex with a small-molecule cysteine protease inhibitor. We observe that the catalytic Cys residue is covalently linked to the small-molecule inhibitor without lid displacement. However, the type I structure provides a view of the sortase SrtC1 lid displacement while having structural elements similar to a substrate sorting motif suitably positioned in the active site. We propose that these major conformational changes seen in the presence of a substrate mimic in the active site may represent universal features of class C sortase substrate recognition and enzyme activation.« less

Antivirulence C-Mannosides as Antibiotic-Sparing, Oral Therapeutics for Urinary Tract Infections.

PubMed

Mydock-McGrane, Laurel; Cusumano, Zachary; Han, Zhenfu; Binkley, Jana; Kostakioti, Maria; Hannan, Thomas; Pinkner, Jerome S; Klein, Roger; Kalas, Vasilios; Crowley, Jan; Rath, Nigam P; Hultgren, Scott J; Janetka, James W

2016-10-27

Gram-negative uropathogenic Escherichia coli (UPEC) bacteria are a causative pathogen of urinary tract infections (UTIs). Previously developed antivirulence inhibitors of the type 1 pilus adhesin, FimH, demonstrated oral activity in animal models of UTI but were found to have limited compound exposure due to the metabolic instability of the O-glycosidic bond (O-mannosides). Herein, we disclose that compounds having the O-glycosidic bond replaced with carbon linkages had improved stability and inhibitory activity against FimH. We report on the design, synthesis, and in vivo evaluation of this promising new class of carbon-linked C-mannosides that show improved pharmacokinetic (PK) properties relative to O-mannosides. Interestingly, we found that FimH binding is stereospecifically modulated by hydroxyl substitution on the methylene linker, where the R-hydroxy isomer has a 60-fold increase in potency. This new class of C-mannoside antagonists have significantly increased compound exposure and, as a result, enhanced efficacy in mouse models of acute and chronic UTI.

Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

PubMed

Gulubova, M V

1996-07-01

Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

PubMed

Wang, Chao; Zhai, Wanying; Shan, Baoqing

2016-05-01

Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

PubMed Central

Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

2014-01-01

Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

PubMed

Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

2014-02-01

Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

PubMed

Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

2008-01-01

To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

Ultraviolet properties of IRAS-selected Be stars

NASA Technical Reports Server (NTRS)

Bjorkman, Karen S.; Snow, Theodore P.

1988-01-01

New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

Genetics Home Reference: congenital insensitivity to pain with anhidrosis

MedlinePlus

... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

Collagen type IV at the fetal-maternal interface.

PubMed

Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

2015-01-01

Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2012 CFR

2012-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2013 CFR

2013-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2014 CFR

2014-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2011 CFR

2011-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Xiu-Li, E-mail: usually.158@163.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, No 169 Donghu Road, Wuchang District, Wuhan 430071; Peng, Chun-Wei, E-mail: pqc278@163.com

Highlights: {yields} HER2 level is closely related to the biologic behaviors of breast cancer cells. {yields} A new method to simultaneously image HER2 and type IV collagen was established. {yields} HER2 status and type IV collagen degradation predict breast cancer invasion. {yields} The complex interactions between tumor and its environment were revealed. -- Abstract: It has been well recognized that human epidermal growth factor receptor 2 (HER2) level in breast cancer (BC) is closely related to the malignant biologic behaviors of the tumor, including invasion and metastasis. Yet, there has been a lack of directly observable evidence to support suchmore » notion. Here we report a quantum dots (QDs)-based double-color imaging technique to simultaneously show the HER2 level on BC cells and the type IV collagen in the tumor matrix. In benign breast tumor, the type IV collagen was intact. With the increasing of HER2 expression level, there has been a progressive decrease in type IV collagen around the cancer nest. At HER2 (3+) expression level, there has virtually been a total destruction of type IV collagen. Moreover, HER2 (3+) BC cells also show direct invasion into the blood vessels. This novel imaging method provides direct observable evidence to support the theory that the HER2 expression level is directly related to BC invasion.« less

On the Directivity of Low-Frequency Type IV Radio Bursts

NASA Technical Reports Server (NTRS)

Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

2016-01-01

An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

PubMed

Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

2012-06-01

Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

PubMed

Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

2007-01-01

Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

PubMed

Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

2015-04-02

Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

PubMed

Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

2005-04-01

The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

DTIC Science & Technology

1999-05-01

Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

PubMed

Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

2018-06-01

The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

2008-01-15

We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

PubMed

de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

2007-10-01

The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

PubMed

Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

2016-07-01

To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

Virulence and the Environment: a Novel Role for Vibrio cholerae Toxin-Coregulated Pili in Biofilm Formation on Chitin

PubMed Central

Reguera, Gemma; Kolter, Roberto

2005-01-01

The toxin-coregulated pilus (TCP) of Vibrio cholerae is required for intestinal colonization and cholera toxin acquisition. Here we report that TCP mediates bacterial interactions required for biofilm differentiation on chitinaceous surfaces. We also show that undifferentiated TCP− biofilms have reduced ecological fitness and, thus, that chitin colonization may represent an ecological setting outside the host in which selection for a host colonization factor may take place. PMID:15866944

Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

PubMed

Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

2013-10-01

To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Molecular Epidemiology of Cholera Outbreaks during the Rainy Season in Mandalay, Myanmar.

PubMed

Roobthaisong, Amonrattana; Okada, Kazuhisa; Htun, Nilar; Aung, Wah Wah; Wongboot, Warawan; Kamjumphol, Watcharaporn; Han, Aye Aye; Yi, Yi; Hamada, Shigeyuki

2017-11-01

Cholera, caused by Vibrio cholerae , remains a global threat to public health. In Myanmar, the availability of published information on the occurrence of the disease is scarce. We report here that cholera incidence in Mandalay generally exhibited a single annual peak, with an annual average of 312 patients with severe dehydration over the past 5 years (since 2011) and was closely associated with the rainy season. We analyzed cholera outbreaks, characterized 67 isolates of V. cholerae serogroup O1 in 2015 from patients from Mandalay, and compared them with 22 V. cholerae O1 isolates (12 from Mandalay and 10 from Yangon) in 2014. The isolates carried the classical cholera toxin B subunit ( ctxB ), the toxin-coregulated pilus A ( tcpA ) of Haitian type, and repeat sequence transcriptional regulator ( rstR ) of El Tor type. Two molecular typing methods, pulsed-field gel electrophoresis and multiple-locus variable-number tandem repeat analysis (MLVA), differentiated the 89 isolates into seven pulsotypes and 15 MLVA profiles. Pulsotype Y15 and one MLVA profile (11, 7, 7, 16, 7) were predominantly found in the isolates from cholera outbreaks in Mandalay, 2015. Pulsotypes Y11, Y12, and Y15 with some MLVA profiles were detected in the isolates from two remote areas, Mandalay and Yangon, with temporal changes. These data suggested that cholera spread from the seaside to the inland area in Myanmar.

46 CFR 164.019-3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

2011-04-15

Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

Interstellar C IV and Si IV column densities toward early-type stars

NASA Technical Reports Server (NTRS)

Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

1980-01-01

Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

Serotype IV and invasive group B Streptococcus disease in neonates, Minnesota, USA, 2000-2010.

PubMed

Ferrieri, Patricia; Lynfield, Ruth; Creti, Roberta; Flores, Aurea E

2013-04-01

Group B Streptococcus (GBS) is a major cause of invasive disease in neonates in the United States. Surveillance of invasive GBS disease in Minnesota, USA, during 2000-2010 yielded 449 isolates from 449 infants; 257 had early-onset (EO) disease (by age 6 days) and 192 late-onset (LO) disease (180 at age 7-89 days, 12 at age 90-180 days). Isolates were characterized by capsular polysaccharide serotype and surface-protein profile; types III and Ia predominated. However, because previously uncommon serotype IV constitutes 5/31 EO isolates in 2010, twelve type IV isolates collected during 2000-2010 were studied further. By pulsed-field gel electrophoresis, they were classified into 3 profiles; by multilocus sequence typing, representative isolates included new sequence type 468. Resistance to clindamycin or erythromycin was detected in 4/5 serotype IV isolates. Emergence of serotype IV GBS in Minnesota highlights the need for serotype prevalence monitoring to detect trends that could affect prevention strategies.

The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

DOT National Transportation Integrated Search

1989-11-01

The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

DTIC Science & Technology

1994-09-01

wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

PubMed Central

Cosgrove, Dominic; Liu, Shiguang

2016-01-01

Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

PubMed

Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

2015-06-01

The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

Genetics Home Reference: glycogen storage disease type IV

MedlinePlus

... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

PubMed

Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

1970-12-01

Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

Alport Syndrome Diagnosis

MedlinePlus

... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

PubMed

Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

2010-08-01

Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

PubMed

Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

2018-05-17

Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

PubMed

Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

2012-01-01

Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

PubMed Central

Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

2015-01-01

Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

Root canal morphology of South Asian Indian maxillary molar teeth

PubMed Central

Singh, Shishir; Pawar, Mansing

2015-01-01

Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

Native structure of a type IV secretion system core complex essential for Legionella pathogenesis.

PubMed

Kubori, Tomoko; Koike, Masafumi; Bui, Xuan Thanh; Higaki, Saori; Aizawa, Shin-Ichi; Nagai, Hiroki

2014-08-12

Bacterial type IV secretion systems are evolutionarily related to conjugation systems and play a pivotal role in infection by delivering numerous virulence factors into host cells. Using transmission electron microscopy, we report the native molecular structure of the core complex of the Dot/Icm type IV secretion system encoded by Legionella pneumophila, an intracellular human pathogen. The biochemically isolated core complex, composed of at least five proteins--DotC, DotD, DotF, DotG, and DotH--has a ring-shaped structure. Intriguingly, morphologically distinct premature complexes are formed in the absence of DotG or DotF. Our data suggest that DotG forms a central channel spanning inner and outer membranes. DotF, a component dispensable for type IV secretion, plays a role in efficient embedment of DotG into the functional core complex. These results highlight a common scheme for the biogenesis of transport machinery.

Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

PubMed

Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

2009-06-01

Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

Evidence for rare capsular switching in Streptococcus agalactiae.

PubMed

Martins, Elisabete Raquel; Melo-Cristino, José; Ramirez, Mário

2010-03-01

The polysaccharide capsule is a major antigenic factor in Streptococcus agalactiae (Lancefield group B streptococcus [GBS]). Previous observations suggest that exchange of capsular loci is likely to occur rather frequently in GBS, even though GBS is not known to be naturally transformable. We sought to identify and characterize putative capsular switching events, by means of a combination of phenotypic and genotypic methods, including pulsed-field gel electrophoretic profiling, multilocus sequence typing, and surface protein and pilus gene profiling. We show that capsular switching by horizontal gene transfer is not as frequent as previously suggested. Serotyping errors may be the main reason behind the overestimation of capsule switching, since phenotypic techniques are prone to errors of interpretation. The identified putative capsular transformants involved the acquisition of the entire capsular locus and were not restricted to the serotype-specific central genes, the previously suggested main mechanism underlying capsular switching. Our data, while questioning the frequency of capsular switching, provide clear evidence for in vivo capsular transformation in S. agalactiae, which may be of critical importance in planning future vaccination strategies against this pathogen.

Evidence for Rare Capsular Switching in Streptococcus agalactiae▿

PubMed Central

Martins, Elisabete Raquel; Melo-Cristino, José; Ramirez, Mário

2010-01-01

The polysaccharide capsule is a major antigenic factor in Streptococcus agalactiae (Lancefield group B streptococcus [GBS]). Previous observations suggest that exchange of capsular loci is likely to occur rather frequently in GBS, even though GBS is not known to be naturally transformable. We sought to identify and characterize putative capsular switching events, by means of a combination of phenotypic and genotypic methods, including pulsed-field gel electrophoretic profiling, multilocus sequence typing, and surface protein and pilus gene profiling. We show that capsular switching by horizontal gene transfer is not as frequent as previously suggested. Serotyping errors may be the main reason behind the overestimation of capsule switching, since phenotypic techniques are prone to errors of interpretation. The identified putative capsular transformants involved the acquisition of the entire capsular locus and were not restricted to the serotype-specific central genes, the previously suggested main mechanism underlying capsular switching. Our data, while questioning the frequency of capsular switching, provide clear evidence for in vivo capsular transformation in S. agalactiae, which may be of critical importance in planning future vaccination strategies against this pathogen. PMID:20023016

Protein secretion and surface display in Gram-positive bacteria

PubMed Central

Schneewind, Olaf; Missiakas, Dominique M.

2012-01-01

The cell wall peptidoglycan of Gram-positive bacteria functions as a surface organelle for the transport and assembly of proteins that interact with the environment, in particular, the tissues of an infected host. Signal peptide-bearing precursor proteins are secreted across the plasma membrane of Gram-positive bacteria. Some precursors carry C-terminal sorting signals with unique sequence motifs that are cleaved by sortase enzymes and linked to the cell wall peptidoglycan of vegetative forms or spores. The sorting signals of pilin precursors are cleaved by pilus-specific sortases, which generate covalent bonds between proteins leading to the assembly of fimbrial structures. Other precursors harbour surface (S)-layer homology domains (SLH), which fold into a three-pronged spindle structure and bind secondary cell wall polysaccharides, thereby associating with the surface of specific Gram-positive microbes. Type VII secretion is a non-canonical secretion pathway for WXG100 family proteins in mycobacteria. Gram-positive bacteria also secrete WXG100 proteins and carry unique genes that either contribute to discrete steps in secretion or represent distinctive substrates for protein transport reactions. PMID:22411983

Localization, cloning, and sequence determination of the conjugative plasmid ColB2 pilin gene.

PubMed Central

Finlay, B B; Frost, L S; Paranchych, W

1984-01-01

ColB2 is a colicin-producing, 96-kilobase plasmid which encodes a conjugative system that is similar, but not identical, to F. A restriction map of this plasmid was generated, and DNA homology studies between F and ColB2 plasmids revealed homology only between their transfer operons. The locations of the ColB2 transfer operon and ColB2 pilin gene were localized on this restriction map. The gene encoding ColB2 pilin, traA, was cloned and sequenced. The pilin protein of ColB2 is identical to F, except at the amino terminus, where ala-gln of ColB2 pilin corresponds to Ala-Gly-Ser-Ser of F pilin. This is due to a 6-base-pair deletion in the ColB2 pilin gene. Biochemical studies on tryptic peptides derived from ColB2 pilin demonstrate the location of this gene to be correct. There is a putative signal peptidase cleavage site after the sequence Ala-Met-Ala, giving a signal peptide of 51 amino acids and a mature pilin protein of 68 amino acids (7,000 daltons). The amino terminus is blocked, probably with an acetyl group. A chimera containing the ColB2 pilin gene was able to complement an F traA mutant, demonstrating that the pilus assembly proteins of F can utilize the ColB2 pilin protein to form a pilus. Images PMID:6090427

Crystal structure of Spy0129, a Streptococcus pyogenes class B sortase involved in pilus assembly.

PubMed

Kang, Hae Joo; Coulibaly, Fasséli; Proft, Thomas; Baker, Edward N

2011-01-11

Sortase enzymes are cysteine transpeptidases that mediate the covalent attachment of substrate proteins to the cell walls of gram-positive bacteria, and thereby play a crucial role in virulence, infection and colonisation by pathogens. Many cell-surface proteins are anchored by the housekeeping sortase SrtA but other more specialised sortases exist that attach sub-sets of proteins or function in pilus assembly. The sortase Spy0129, or SrtC1, from the M1 SF370 strain of Streptococcus pyogenes is responsible for generating the covalent linkages between the pilin subunits in the pili of this organism. The crystal structure of Spy0129 has been determined at 2.3 Å resolution (R = 20.4%, Rfree  = 26.0%). The structure shows that Spy0129 is a class B sortase, in contrast to other characterised pilin polymerases, which belong to class C. Spy0129 lacks a flap believed to function in substrate recognition in class C enzymes and instead has an elaborated β6/β7 loop. The two independent Spy0129 molecules in the crystal show differences in the positions and orientations of the catalytic Cys and His residues, Cys221 and His126, correlated with movements of the β7/β8 and β4/β5 loops that respectively follow these residues. Bound zinc ions stabilise these alternative conformations in the crystal. This conformational variability is likely to be important for function although there is no evidence that zinc is involved in vivo.

Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

2012-08-15

Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

Neurons of human nucleus accumbens.

PubMed

Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

2011-08-01

Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

PubMed

Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

2006-08-01

The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

Population Structure and Antimicrobial Resistance Profiles of Streptococcus suis Serotype 2 Sequence Type 25 Strains.

PubMed

Athey, Taryn B T; Teatero, Sarah; Takamatsu, Daisuke; Wasserscheid, Jessica; Dewar, Ken; Gottschalk, Marcelo; Fittipaldi, Nahuel

2016-01-01

Strains of serotype 2 Streptococcus suis are responsible for swine and human infections. Different serotype 2 genetic backgrounds have been defined using multilocus sequence typing (MLST). However, little is known about the genetic diversity within each MLST sequence type (ST). Here, we used whole-genome sequencing to test the hypothesis that S. suis serotype 2 strains of the ST25 lineage are genetically heterogeneous. We evaluated 51 serotype 2 ST25 S. suis strains isolated from diseased pigs and humans in Canada, the United States of America, and Thailand. Whole-genome sequencing revealed numerous large-scale rearrangements in the ST25 genome, compared to the genomes of ST1 and ST28 S. suis strains, which result, among other changes, in disruption of a pilus island locus. We report that recombination and lateral gene transfer contribute to ST25 genetic diversity. Phylogenetic analysis identified two main and distinct Thai and North American clades grouping most strains investigated. These clades also possessed distinct patterns of antimicrobial resistance genes, which correlated with acquisition of different integrative and conjugative elements (ICEs). Some of these ICEs were found to be integrated at a recombination hot spot, previously identified as the site of integration of the 89K pathogenicity island in serotype 2 ST7 S. suis strains. Our results highlight the limitations of MLST for phylogenetic analysis of S. suis, and the importance of lateral gene transfer and recombination as drivers of diversity in this swine pathogen and zoonotic agent.

Population Structure and Antimicrobial Resistance Profiles of Streptococcus suis Serotype 2 Sequence Type 25 Strains

PubMed Central

Athey, Taryn B. T.; Teatero, Sarah; Takamatsu, Daisuke; Wasserscheid, Jessica; Dewar, Ken; Gottschalk, Marcelo; Fittipaldi, Nahuel

2016-01-01

Strains of serotype 2 Streptococcus suis are responsible for swine and human infections. Different serotype 2 genetic backgrounds have been defined using multilocus sequence typing (MLST). However, little is known about the genetic diversity within each MLST sequence type (ST). Here, we used whole-genome sequencing to test the hypothesis that S. suis serotype 2 strains of the ST25 lineage are genetically heterogeneous. We evaluated 51 serotype 2 ST25 S. suis strains isolated from diseased pigs and humans in Canada, the United States of America, and Thailand. Whole-genome sequencing revealed numerous large-scale rearrangements in the ST25 genome, compared to the genomes of ST1 and ST28 S. suis strains, which result, among other changes, in disruption of a pilus island locus. We report that recombination and lateral gene transfer contribute to ST25 genetic diversity. Phylogenetic analysis identified two main and distinct Thai and North American clades grouping most strains investigated. These clades also possessed distinct patterns of antimicrobial resistance genes, which correlated with acquisition of different integrative and conjugative elements (ICEs). Some of these ICEs were found to be integrated at a recombination hot spot, previously identified as the site of integration of the 89K pathogenicity island in serotype 2 ST7 S. suis strains. Our results highlight the limitations of MLST for phylogenetic analysis of S. suis, and the importance of lateral gene transfer and recombination as drivers of diversity in this swine pathogen and zoonotic agent. PMID:26954687

Proposal for a histopathological consensus classification of the periprosthetic interface membrane

PubMed Central

Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

2006-01-01

Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

PubMed

Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

2006-06-01

The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

Environmentally Safe and Effective Processes for Paint Removal

DTIC Science & Technology

1995-04-01

Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

Ehlers-Danlos syndrome type IV

PubMed Central

Germain, Dominique P

2007-01-01

Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

PubMed

Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

2016-01-01

Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

PubMed

Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

2016-05-01

To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

[Elective reconstruction of thoracoabdominal aortic aneurysm type IV by transabdominal approach].

PubMed

Marjanović, Ivan; Jevtić, Miodrag; Misović, Sidor; Sarac, Momir

2012-01-01

Thoracoabdominal aortic aneurysm (TAAA) type IV represents an aortic dilatation from the level of the diaphragmatic hiatus to the iliac arteries branches, including visceral branches of the aorta. In the traditional procedure of TAAA type IV repair, the body is opened using thoractomy and laparotomy in order to provide adequate exposure of the descending thoracic and abdominal aorta for safe aortic reconstruction. We reported a 71-year-old man with elective reconstruction of the TAAA type IV performed by transabdominal approach. Computed tomography scans angiography revealed a TAAA type IV with diameter of 62 mm in the region of celiac trunk andsuperior mesenteric artery branching, and the largest diameter of 75 mm in the infrarenal aortic level. The patient comorbidity included a chronic obstructive pulmonary disease and hypertension, therefore he was treated for a prolonged period. In preparation for the planned aortic reconstruction asymptomatic carotid disease (occlusion of the left internal carotid artery and subtotal stenosis of the right internal carotid artery) was diagnosed. Within the same intervention percutaneous transluminal angioplasty with stent placement in right internal carotid artery was made. In general, under endotracheal anesthesia and epidural analgesia, with transabdominal approach performed aortic reconstruction with tubular dakron graft 24 mm were, and reimplantation of visceral aortic branches into the graft performed. Postoperative course was uneventful, and the patient was discharged on the postoperative day 17. Control computed tomography scan angiography performed three months after the operation showed vascular state of the patient to be in order. Complete transabdominal approach to TAAA type IV represents an appropriate substitute for thoracoabdominal approach, without compromising safety of the patient. This approach is less traumatic, especially in patients with impaired pulmonary function, because there is no thoracotomy and any complications that could follow this approach.

Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

PubMed Central

Miyakawa, T; Kojima, M; Ui, M

1998-01-01

Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

PubMed

Miyakawa, T; Kojima, M; Ui, M

1998-01-01

Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

PubMed

Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

2007-01-01

Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

Mechanisms of chiral discrimination by topoisomerase IV

PubMed Central

Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

2009-01-01

Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

PubMed

Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

2016-11-01

To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

PubMed Central

Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

2011-01-01

Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

PubMed

Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

2016-02-28

Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

Atypical hereditary sensory and autonomic neuropathy type IV with neither mental retardation nor pain insensitivity.

PubMed

Jung, Chae Lim; Ki, Chang-Seok; Kim, Byoung Joon; Lee, Jong-Hyuck; Sung, Ki-Sun; Kim, Jong-Won; Park, Youn-Soo

2013-12-01

Hereditary sensory and autonomic neuropathy type IV is an autosomal recessive disorder characterized by severe mental retardation and self-mutilation-related complications. Recently, we investigated a 16-year-old Korean boy with normal intelligence. He had preserved pain sensation but was suspected of having hereditary sensory and autonomic neuropathy type IV because of the recurrent bone fractures and painless joint destruction in the absence of any predisposing medical conditions. Genetic analysis of the NTRK1 gene revealed compound heterozygous mutations including c.851-33T>A and c.2303C>T (p.Pro768Leu) in the NTRK1 gene. The p.Pro768Leu mutation has been identified in 2 Japanese patients with a mild phenotype. Therefore, although it is rare, hereditary sensory and autonomic neuropathy type IV should be considered in patients with recurrent bone fractures and painless joint destruction who do not have any predisposing conditions even when they do not have typical clinical features such as mental retardation or pain insensitivity.

Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

PubMed

Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

2017-05-04

Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

[Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

PubMed

Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

2014-10-01

To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

Accentuated hyperparathyroidism in type II Bartter syndrome.

PubMed

Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

2016-07-01

Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

NASA Technical Reports Server (NTRS)

Savage, Blair D.; Sembach, K. R.

1994-01-01

Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

PubMed

Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

2009-06-01

Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

NASA Astrophysics Data System (ADS)

Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

1996-08-01

Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

PubMed Central

Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

2005-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

(2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, D.; Wang, L.; Beconi, M.

2010-11-10

A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

Genetics Home Reference: mucolipidosis type IV

MedlinePlus

... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

Mass loss in the interacting semi-detached binary delta librae

NASA Technical Reports Server (NTRS)

Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

1995-01-01

The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

Structural studies of a bifunctional inhibitor of neprilysin and DPP-IV.

PubMed

Oefner, Christian; Pierau, Sabine; Schulz, Henk; Dale, Glenn E

2007-09-01

Neutral endopeptidase (NEP) is the major enzyme involved in the metabolic inactivation of a number of bioactive peptides including the enkephalins, substance P, endothelin, bradykinin and atrial natriuretic factor, as well as the incretin hormone glucagon-like peptide 1 (GLP-1), which is a potent stimulator of insulin secretion. The activity of GLP-1 is also rapidly abolished by the serine protease dipeptidyl peptidase IV (DPP-IV), which led to an elevated interest in inhibitors of this enzyme for the treatment of type II diabetes. A dual NEP/DPP-IV inhibitor concept is proposed, offering an alternative strategy for the treatment of type 2 diabetes. Here, the synthesis and crystal structures of the soluble extracellular domain of human NEP (residues 52-749) complexed with the NEP, competitive and potent dual NEP/DPP-IV inhibitor MCB3937 are described.

[Mucolipidoses type IV in a patient with mapuche ancestry].

PubMed

Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

2008-07-01

We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

PubMed

Mak, Ki M; Mei, Rena

2017-08-01

Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Comprehensive mutagenesis of the fimS promoter regulatory switch reveals novel regulation of type 1 pili in uropathogenic Escherichia coli

PubMed Central

Zhang, Huibin; Susanto, Teodorus T.; Wan, Yue

2016-01-01

Type 1 pili (T1P) are major virulence factors for uropathogenic Escherichia coli (UPEC), which cause both acute and recurrent urinary tract infections. T1P expression therefore is of direct relevance for disease. T1P are phase variable (both piliated and nonpiliated bacteria exist in a clonal population) and are controlled by an invertible DNA switch (fimS), which contains the promoter for the fim operon encoding T1P. Inversion of fimS is stochastic but may be biased by environmental conditions and other signals that ultimately converge at fimS itself. Previous studies of fimS sequences important for T1P phase variation have focused on laboratory-adapted E. coli strains and have been limited in the number of mutations or by alteration of the fimS genomic context. We surmounted these limitations by using saturating genomic mutagenesis of fimS coupled with accurate sequencing to detect both mutations and phase status simultaneously. In addition to the sequences known to be important for biasing fimS inversion, our method also identifies a previously unknown pair of 5′ UTR inverted repeats that act by altering the relative fimA levels to control phase variation. Thus we have uncovered an additional layer of T1P regulation potentially impacting virulence and the coordinate expression of multiple pilus systems. PMID:27035967

Comprehensive mutagenesis of the fimS promoter regulatory switch reveals novel regulation of type 1 pili in uropathogenic Escherichia coli.

PubMed

Zhang, Huibin; Susanto, Teodorus T; Wan, Yue; Chen, Swaine L

2016-04-12

Type 1 pili (T1P) are major virulence factors for uropathogenic Escherichia coli (UPEC), which cause both acute and recurrent urinary tract infections. T1P expression therefore is of direct relevance for disease. T1P are phase variable (both piliated and nonpiliated bacteria exist in a clonal population) and are controlled by an invertible DNA switch (fimS), which contains the promoter for the fim operon encoding T1P. Inversion of fimS is stochastic but may be biased by environmental conditions and other signals that ultimately converge at fimS itself. Previous studies of fimS sequences important for T1P phase variation have focused on laboratory-adapted E coli strains and have been limited in the number of mutations or by alteration of the fimS genomic context. We surmounted these limitations by using saturating genomic mutagenesis of fimS coupled with accurate sequencing to detect both mutations and phase status simultaneously. In addition to the sequences known to be important for biasing fimS inversion, our method also identifies a previously unknown pair of 5' UTR inverted repeats that act by altering the relative fimA levels to control phase variation. Thus we have uncovered an additional layer of T1P regulation potentially impacting virulence and the coordinate expression of multiple pilus systems.

Odorant transfer characteristics of white bread during baking.

PubMed

Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

2011-01-01

The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

PubMed

Busek, P; Stremenová, J; Krepela, E; Sedo, A

2008-01-01

Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

PubMed

Pakravan, Nafiseh; Hassan, Zuhair Mohammad

2018-03-01

Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

PubMed Central

Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

1932-01-01

The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

PubMed

Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

2004-06-01

We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

Escherichia coli Common Pilus (ECP) Targets Arabinosyl Residues in Plant Cell Walls to Mediate Adhesion to Fresh Produce Plants*

PubMed Central

Rossez, Yannick; Holmes, Ashleigh; Lodberg-Pedersen, Henriette; Birse, Louise; Marshall, Jacqueline; Willats, William G. T.; Toth, Ian K.; Holden, Nicola J.

2014-01-01

Outbreaks of verotoxigenic Escherichia coli are often associated with fresh produce. However, the molecular basis to adherence is unknown beyond ionic lipid-flagellum interactions in plant cell membranes. We demonstrate that arabinans present in different constituents of plant cell walls are targeted for adherence by E. coli common pilus (ECP; or meningitis-associated and temperature-regulated (Mat) fimbriae) for E. coli serotypes O157:H7 and O18:K1:H7. l-Arabinose is a common constituent of plant cell wall that is rarely found in other organisms, whereas ECP is widespread in E. coli and other environmental enteric species. ECP bound to oligosaccharides of at least arabinotriose or longer in a glycan array, plant cell wall pectic polysaccharides, and plant glycoproteins. Recognition overlapped with the antibody LM13, which binds arabinanase-sensitive pectic epitopes, and showed a preferential affinity for (1→5)-α-linked l-arabinosyl residues and longer chains of arabinan as demonstrated with the use of arabinan-degrading enzymes. Functional adherence in planta was mediated by the adhesin EcpD in combination with the structural subunit, EcpA, and expression was demonstrated with an ecpR–GFP fusion and ECP antibodies. Spinach was found to be enriched for ECP/LM13 targets compared with lettuce. Specific recognition of arabinosyl residues may help explain the persistence of E. coli in the wider environment and association of verotoxigenic E. coli with some fresh produce plants by exploitation of a glycan found only in plant, not animal, cells. PMID:25320086

Products of three accessory genes, pilB, pilC, and pilD, are required for biogenesis of Pseudomonas aeruginosa pili.

PubMed Central

Nunn, D; Bergman, S; Lory, S

1990-01-01

The polar pili of Pseudomonas aeruginosa are composed of monomers of the pilin structural subunits. The biogenesis of pili involves the synthesis of pilin precursor, cleavage of a six-amino-acid leader peptide, membrane translocation, and assembly of monomers into a filamentous structure extending from the bacterial surface. This report describes three novel genes necessary for the formation of pili. DNA sequences adjacent to pilA, the pilin structural gene, were cloned and mutagenized with transposon Tn5. Each of the insertions were introduced into the chromosome of P. aeruginosa PAK by gene replacement. The effect of the Tn5 insertions in the bacterial chromosome on pilus assembly was assessed by electron microscopy and sensitivity of mutants to a pilus-specific bacteriophage. The resultant mutants were also tested for synthesis and membrane localization of the pilin antigen in order to define the genes required for maturation, export, and assembly of pilin. A 4.0-kilobase-pair region of DNA adjacent to the pilin structural gene was found to be essential for formation of pili. This region was sequenced and found to contain three open reading frames coding for 62-, 38- to 45-, and 28- to 32-kilodalton proteins (pilB, pilC, and pilD, respectively). Three proteins of similar molecular weight were expressed in Escherichia coli from the 4.0-kilobase-pair fragment flanking pilA with use of a T7 promoter-polymerase expression system. The results of the analyses of the three genes and the implications for pilin assembly and maturation are discussed. Images PMID:1971619

Structural conservation, variability, and immunogenicity of the T6 backbone pilin of serotype M6 Streptococcus pyogenes.

PubMed

Young, Paul G; Moreland, Nicole J; Loh, Jacelyn M; Bell, Anita; Atatoa Carr, Polly; Proft, Thomas; Baker, Edward N

2014-07-01

Group A streptococcus (GAS; Streptococcus pyogenes) is a Gram-positive human pathogen that causes a broad range of diseases ranging from acute pharyngitis to the poststreptococcal sequelae of acute rheumatic fever. GAS pili are highly diverse, long protein polymers that extend from the cell surface. They have multiple roles in infection and are promising candidates for vaccine development. This study describes the structure of the T6 backbone pilin (BP; Lancefield T-antigen) from the important M6 serotype. The structure reveals a modular arrangement of three tandem immunoglobulin-like domains, two with internal isopeptide bonds. The T6 pilin lysine, essential for polymerization, is located in a novel VAKS motif that is structurally homologous to the canonical YPKN pilin lysine in other three- and four-domain Gram-positive pilins. The T6 structure also highlights a conserved pilin core whose surface is decorated with highly variable loops and extensions. Comparison to other Gram-positive BPs shows that many of the largest variable extensions are found in conserved locations. Studies with sera from patients diagnosed with GAS-associated acute rheumatic fever showed that each of the three T6 domains, and the largest of the variable extensions (V8), are targeted by IgG during infection in vivo. Although the GAS BP show large variations in size and sequence, the modular nature of the pilus proteins revealed by the T6 structure may aid the future design of a pilus-based vaccine. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

PubMed

Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

2011-01-01

Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

The Haemophilus influenzae Hap autotransporter mediates microcolony formation and adherence to epithelial cells and extracellular matrix via binding regions in the C-terminal end of the passenger domain.

PubMed

Fink, Doran L; Buscher, Amy Z; Green, Bruce; Fernsten, Phillip; St Geme, Joseph W

2003-03-01

The pathogenesis of non-typable Haemophilus influenzae disease begins with colonization of the nasopharynx and is facilitated by bacterial adherence to respiratory mucosa. The H. influenzae Hap autotransporter is a non-pilus adhesin that promotes adherence to epithelial cells and selected extracellular matrix proteins and mediates bacterial aggregation and microcolony formation. In addition, Hap has serine protease activity. Hap contains a 110 kDa internal passenger domain called HapS and a 45 kDa C-terminal translocator domain called Hapbeta. In the present study, we sought to define the structural basis for Hap adhesive activities. Based on experiments using a panel of monoclonal antibodies against HapS, a deletion derivative lacking most of HapS and a purified fragment of HapS, we established that adherence to epithelial cells is mediated by sequences within the C-terminal 311 residues of HapS. In additional experiments, we discovered that bacterial aggregation is also mediated by sequences within the C-terminal 311 residues of HapS and occurs via HapS-HapS interaction between molecules on neighbouring organisms. Finally, we found that adherence to fibronectin, laminin and collagen IV is mediated in part by sequences within the C-terminal 311 residues of HapS and in full by sequences within the C-terminal 511 residues of HapS. Taken together, these results demonstrate that all Hap adhesive activities reside in the C-terminal portion of HapS. Coupled with earlier observations, the current results establish that HapS adhesive activities and HapS protease activity are contained in separate modules of the protein.

Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

NASA Astrophysics Data System (ADS)

Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

2018-03-01

We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

NASA Technical Reports Server (NTRS)

Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

2001-01-01

Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

PubMed

Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

2017-04-15

Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

PubMed Central

Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

2017-01-01

ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

Comparative genomic analysis of four representative plant growth-promoting rhizobacteria in Pseudomonas.

PubMed

Shen, Xuemei; Hu, Hongbo; Peng, Huasong; Wang, Wei; Zhang, Xuehong

2013-04-22

Some Pseudomonas strains function as predominant plant growth-promoting rhizobacteria (PGPR). Within this group, Pseudomonas chlororaphis and Pseudomonas fluorescens are non-pathogenic biocontrol agents, and some Pseudomonas aeruginosa and Pseudomonas stutzeri strains are PGPR. P. chlororaphis GP72 is a plant growth-promoting rhizobacterium with a fully sequenced genome. We conducted a genomic analysis comparing GP72 with three other pseudomonad PGPR: P. fluorescens Pf-5, P. aeruginosa M18, and the nitrogen-fixing strain P. stutzeri A1501. Our aim was to identify the similarities and differences among these strains using a comparative genomic approach to clarify the mechanisms of plant growth-promoting activity. The genome sizes of GP72, Pf-5, M18, and A1501 ranged from 4.6 to 7.1 M, and the number of protein-coding genes varied among the four species. Clusters of Orthologous Groups (COGs) analysis assigned functions to predicted proteins. The COGs distributions were similar among the four species. However, the percentage of genes encoding transposases and their inactivated derivatives (COG L) was 1.33% of the total genes with COGs classifications in A1501, 0.21% in GP72, 0.02% in Pf-5, and 0.11% in M18. A phylogenetic analysis indicated that GP72 and Pf-5 were the most closely related strains, consistent with the genome alignment results. Comparisons of predicted coding sequences (CDSs) between GP72 and Pf-5 revealed 3544 conserved genes. There were fewer conserved genes when GP72 CDSs were compared with those of A1501 and M18. Comparisons among the four Pseudomonas species revealed 603 conserved genes in GP72, illustrating common plant growth-promoting traits shared among these PGPR. Conserved genes were related to catabolism, transport of plant-derived compounds, stress resistance, and rhizosphere colonization. Some strain-specific CDSs were related to different kinds of biocontrol activities or plant growth promotion. The GP72 genome contained the cus operon (related to heavy metal resistance) and a gene cluster involved in type IV pilus biosynthesis, which confers adhesion ability. Comparative genomic analysis of four representative PGPR revealed some conserved regions, indicating common characteristics (metabolism of plant-derived compounds, heavy metal resistance, and rhizosphere colonization) among these pseudomonad PGPR. Genomic regions specific to each strain provide clues to its lifestyle, ecological adaptation, and physiological role in the rhizosphere.

Genes Activated by Vibrio cholerae upon Exposure to Caenorhabditis elegans Reveal the Mannose-Sensitive Hemagglutinin To Be Essential for Colonization.

PubMed

List, Cornelia; Grutsch, Andreas; Radler, Claudia; Cakar, Fatih; Zingl, Franz G; Schild-Prüfert, Kristina; Schild, Stefan

2018-01-01

During its life cycle, the facultative human pathogen Vibrio cholerae , which is the causative agent of the diarrheal disease cholera, needs to adapt to a variety of different conditions, such as the human host or the aquatic environment. Importantly, cholera infections originate from the aquatic reservoir where V. cholerae persists between the outbreaks. In the aquatic environment, bacteria are constantly threatened by predatory protozoa and nematodes, but our knowledge of the response pathways and adaptation strategies of V. cholerae to such stressors is limited. Using a temporally controlled reporter system of transcription, we identified more than 100 genes of V. cholerae induced upon exposure to the nematode Caenorhabditis elegans , which emerged recently as a valuable model for environmental predation during the aquatic lifestyle of V. cholerae Besides others, we identified and validated the genes encoding the mannose-sensitive hemagglutinin (MSHA) type IV pilus to be significantly induced upon exposure to the nematode. Subsequent analyses demonstrated that the mannose-sensitive hemagglutinin is crucial for attachment of V. cholerae in the pharynx of the worm and initiation of colonization, which results in growth retardation and developmental delay of C. elegans Thus, the surface adhesion factor MSHA could be linked to a fitness advantage of V. cholerae upon contact with bacterium-grazing nematodes. IMPORTANCE The waterborne diarrheal disease cholera is caused by the bacterium Vibrio cholerae The facultative human pathogen persists as a natural inhabitant in the aquatic ecosystem between outbreaks. In contrast to the human host, V. cholerae requires a different set of genes to survive in this hostile environment. For example, predatory micrograzers are commonly found in the aquatic environment and use bacteria as a nutrient source, but knowledge of the interaction between bacterivorous grazers and V. cholerae is limited. In this study, we successfully adapted a genetic reporter technology and identified more than 100 genes activated by V. cholerae upon exposure to the bacterium-grazing nematode Caenorhabditis elegans This screen provides a first glimpse into responses and adaptational strategies of the bacterial pathogen against such natural predators. Subsequent phenotypic characterization revealed the mannose-sensitive hemagglutinin to be crucial for colonization of the worm, which causes developmental delay and growth retardation. Copyright © 2018 List et al.

Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

PubMed

Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

2013-11-01

Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

USDA-ARS?s Scientific Manuscript database

The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

PubMed

Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

2018-03-09

Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

Colorectal laterally spreading tumors show characteristic expression of cell polarity factors, including atypical protein kinase C λ/ι, E-cadherin, β-catenin and basement membrane component.

PubMed

Ichikawa, Yasushi; Nagashima, Yoji; Morioka, Kaori; Akimoto, Kazunori; Kojima, Yasuyuki; Ishikawa, Takashi; Goto, Ayumu; Kobayashi, Noritoshi; Watanabe, Kazuteru; Ota, Mitsuyoshi; Fujii, Shoichi; Kawamata, Mayumi; Takagawa, Ryo; Kunizaki, Chikara; Takahashi, Hirokazu; Nakajima, Atsushi; Maeda, Shin; Shimada, Hiroshi; Inayama, Yoshiaki; Ohno, Shigeo; Endo, Itaru

2014-09-01

Colorectal flat-type tumors include laterally spreading tumors (LSTs) and flat depressed-type tumors. The former of which shows a predominant lateral spreading growth rather than an invasive growth. The present study examined the morphological characteristics of LSTs, in comparison with polypoid- or flat depressed-type tumors, along with the expression of atypical protein kinase C (aPKC) λ/ι, a pivotal cell polarity regulator, and the hallmarks of cell polarity, as well as with type IV collagen, β-catenin and E-cadherin. In total, 37 flat-type (24 LSTs and 13 flat depressed-type tumors) and 20 polypoid-type colorectal tumors were examined. The LSTs were classified as 15 LST adenoma (LST-A) and nine LST cancer in adenoma (LST-CA). An immunohistochemical examination was performed on aPKC λ/ι, type IV collagen, β-catenin and E-cadherin. The LST-A and -CA showed a superficial replacing growth pattern, with expression of β-catenin and E-cadherin in the basolateral membrane and type IV collagen along the basement membrane. In addition, 86.6% of LST-A and 55.6% of LST-CA showed aPKC λ/ι expression of 1+ (weak to normal intensity staining in the cytoplasm compared with the normal epithelium). Furthermore, ~45% of the polypoid-type adenomas showed 2+ (moderate intensity staining in the cytoplasm and/or nucleus) and 66.7% of the polypoid-type cancer in adenoma were 3+ (strong intensity staining in the cytoplasm and nucleus). A statistically significant positive correlation was observed between the expression of aPKC λ/ι and β-catenin (r=0.842; P<0.001), or type IV collagen (r=0.823; P<0.001). The LSTs showed a unique growth pattern, different from the expanding growth pattern presented by a polypoid tumor and invasive cancer. The growth characteristics of LST appear to be caused by adequate coexpression of β-catenin, type IV collagen and aPKC λ/ι.

Exploring new classification criteria for the earliest type stars: the 3400 Aregion

NASA Astrophysics Data System (ADS)

Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

2002-02-01

We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

NASA Astrophysics Data System (ADS)

Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

2018-04-01

A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

PubMed

Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

2014-04-01

There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

A study of lip print pattern in Goan dental students - A digital approach.

PubMed

Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

2012-10-01

To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

PubMed

Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

2006-12-01

Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

Anomalous ionization seen in the spectra of B supergiants

NASA Technical Reports Server (NTRS)

Cassinelli, J. P.; Abbott, D. C.

1981-01-01

An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

SOME COMMENTS ON TYPE IV BURSTS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, H.; Kakinuma, T.

1962-01-01

It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

Singular cosmological evolution using canonical and ghost scalar fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

2015-09-01

We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

PubMed

Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

2018-02-06

Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

A molecular surveillance reveals the prevalence of Vibrio cholerae O139 isolates in China from 1993 to 2012.

PubMed

Zhang, Ping; Zhou, Haijian; Diao, Baowei; Li, Fengjuan; Du, Pengcheng; Li, Jie; Kan, Biao; Morris, J Glenn; Wang, Duochun

2014-04-01

Vibrio cholerae serogroup O139 was first identified in 1992 in India and Bangladesh, in association with major epidemics of cholera in both countries; cases were noted shortly thereafter in China. We characterized 211 V. cholerae O139 isolates that were isolated at multiple sites in China between 1993 and 2012 from patients (n = 92) and the environment (n = 119). Among clinical isolates, 88 (95.7%) of 92 were toxigenic, compared with 47 (39.5%) of 119 environmental isolates. Toxigenic isolates carried the El Tor CTX prophage and toxin-coregulated pilus A gene (tcpA), as well as the Vibrio seventh pandemic island I (VSP-I) and VSP-II. Among a subset of 42 toxigenic isolates screened by multilocus sequence typing (MLST), all were in the same sequence type as a clinical isolate (MO45) from the original Indian outbreak. Nontoxigenic isolates, in contrast, generally lacked VSP-I and -II, and fell within 13 additional sequence types in two clonal complexes distinct from the toxigenic isolates. In further pulsed-field gel electrophoresis (PFGE) (with NotI digestion) studies, toxigenic isolates formed 60 pulsotypes clustered in one group, while the nontoxigenic isolates formed 43 pulsotypes which clustered into 3 different groups. Our data suggest that toxigenic O139 isolates from widely divergent geographic locations, while showing some diversity, have maintained a relatively tight clonal structure across a 20-year time span. Nontoxigenic isolates, in contrast, exhibited greater diversity, with multiple clonal lineages, than did their toxigenic counterparts.

Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

PubMed

Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

2002-09-01

With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

Pros and Cons While Looking Through an Asian Window on the Rome IV Criteria for Irritable Bowel Syndrome: Pros.

PubMed

Ghoshal, Uday C

2017-07-30

A decade after Rome III, in 2016, Rome IV criteria were published. There are major differences between Rome IV and the earlier iteration, some of which are in line with Asian viewpoints. The clinical applicability of the Rome IV criteria of irritable bowel syndrome (IBS) in Asian perspective is reviewed here. Instead of considering functional gastrointestinal disorders (FGIDs) to be largely psychogenic, Rome IV suggested the importance of the gut over brain ("disorders of gut-brain interaction" not "brain-gut interaction"). The word "functional" is underplayed. Multi-dimensional clinical profile attempts to recognize micro-organic nature, like slow colon transit and fecal evacuation disorders in constipation and dietary intolerance including that of lactose and fructose, bile acid malabsorption, non-celiac wheat sensitivity, small intestinal bacterial overgrowth, and gastrointestinal infection in diarrhea. Overlap between different FGIDs has been recognized as Rome IV suggests these to be a spectrum rather than discrete disorders. Bloating, common in Asia, received attention, though less. Sub-typing of IBS may be more clinician-friendly now as the patient-reported stool form may be used than a diary. However, a few issues, peculiar to Asia, need consideration; Rome IV, like Rome III, suggests that Bristol type I-II stool to denote constipation though Asian experts include type III as well. Work-up for physiological factors should be given greater importance. Language issue is important. Bloating, common in IBS, should be listed in the criteria. Threshold values for symptoms in Rome IV criteria are based on Western data. Post-infectious malabsorption (tropical sprue) should be excluded to diagnose post-infectious IBS, particularly in Asia.

Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

PubMed

Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

2017-10-17

Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

PubMed

Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

2008-05-01

Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

NASA Technical Reports Server (NTRS)

Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

1985-01-01

Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

NASA Astrophysics Data System (ADS)

Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

1985-08-01

Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

PubMed

Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

2003-03-01

Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

Biotype-specific tcpA genes in Vibrio cholerae.

PubMed

Iredell, J R; Manning, P A

1994-08-01

The tcpA gene, encoding the structural subunit of the toxin-coregulated pilus, has been isolated from a variety of clinical isolates of Vibrio cholerae, and the nucleotide sequence determined. Strict biotype-specific conservation within both the coding and putative regulatory regions was observed, with important differences between the El Tor and classical biotypes. V. cholerae O139 Bengal strains appear to have El Tor-type tcpA genes. Environmental O1 and non-O1 isolates have sequences that bind an El Tor-specific tcpA DNA probe and that are weakly and variably amplified by tcpA-specific polymerase chain reaction primers, under conditions of reduced stringency. The data presented allow the selection of primer pairs to help distinguish between clinical and environmental isolates, and to distinguish El Tor (and Bengal) biotypes from classical biotypes of V. cholerae. While the role of TcpA in cholera vaccine preparations remains unclear, the data strongly suggest that TcpA-containing vaccines directed at O1 strains need include only the two forms of TcpA, and that such vaccines directed at (O139) Bengal strains should include the TcpA of El Tor biotype.

Adhesive interactions between milk fat globule membrane and Lactobacillus rhamnosus GG inhibit bacterial attachment to Caco-2 TC7 intestinal cell.

PubMed

Guerin, Justine; Soligot, Claire; Burgain, Jennifer; Huguet, Marion; Francius, Gregory; El-Kirat-Chatel, Sofiane; Gomand, Faustine; Lebeer, Sarah; Le Roux, Yves; Borges, Frederic; Scher, Joël; Gaiani, Claire

2018-07-01

Milk is the most popular matrix for the delivery of lactic acid bacteria, but little is known about how milk impacts bacterial functionality. Here, the adhesion mechanisms of Lactobacillus rhamnosus GG (LGG) surface mutants to a milk component, the milk fat globule membrane (MFGM), were compared using atomic force microscopy (AFM). AFM results revealed the key adhesive role of the LGG SpaCBA pilus in relation to MFGM. A LGG mutant without exopolysaccharides but with highly exposed pili improved the number of adhesive events between LGG and MFGM compared to LGG wild type (WT). In contrast, the number of adhesive events decreased significantly for a LGG mutant without SpaCBA pili. Moreover, the presence of MFGM in the dairy matrix was found to decrease significantly the bacterial attachment ability to Caco-2 TC7 cells. This work thus demonstrated a possible competition between LGG adhesion to MFGM and to epithelial intestinal cells. This competition could negatively impact the adhesion capacity of LGG to intestinal cells in vivo, but requires further substantiation. Copyright © 2018 Elsevier B.V. All rights reserved.

Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

PubMed

Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

2013-04-01

Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

PubMed

Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

2017-12-01

The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

PubMed

Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

2017-08-01

We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

DOE PAGES

Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

2015-03-01

Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

PubMed

Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

2015-10-01

Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

ClinicalTrials.gov

2014-02-14

Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

Specific Phobia among U.S. Adolescents: Phenomenology and Typology

PubMed Central

Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

2014-01-01

Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

PubMed

Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

2002-12-06

Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

NASA Technical Reports Server (NTRS)

Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

1994-01-01

High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

PubMed

Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

2006-04-01

A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

PubMed

Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

2013-11-22

Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

PubMed

Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

2016-10-01

The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

PubMed

Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

2012-06-01

The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

PubMed Central

Watanabe, Ikuya; Wallace, Cameron

2008-01-01

The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

PubMed Central

Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

2007-01-01

Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

PubMed Central

Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

2014-01-01

Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

PubMed

Breadon, Jonith Y; Barnes, Chad A

2007-01-01

Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

PubMed

Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

2017-09-01

Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

ERIC Educational Resources Information Center

Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

2015-01-01

In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

PubMed

Lees, George E

2013-01-01

To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

Expression of toxin co-regulated pilus subunit A (TCPA) of Vibrio cholerae and its immunogenic epitopes fused to cholera toxin B subunit in transgenic tomato (Solanum lycopersicum).

PubMed

Sharma, Manoj Kumar; Singh, Nirmal Kumar; Jani, Dewal; Sisodia, Rama; Thungapathra, M; Gautam, J K; Meena, L S; Singh, Yogendra; Ghosh, Amit; Tyagi, Akhilesh Kumar; Sharma, Arun Kumar

2008-02-01

For protection against cholera, it is important to develop efficient vaccine capable of inducing anti-toxin as well as anti-colonizing immunity against Vibrio cholerae infections. Earlier, expression of cholera toxin B subunit (CTB) in tomato was reported by us. In the present investigation, toxin co-regulated pilus subunit A (TCPA), earlier reported to be an antigen capable of providing anti-colonization immunity, has been expressed in tomato. Further, to generate more potent combinatorial antigens, nucleotides encoding P4 or P6 epitope of TCPA were fused to cholera toxin B subunit gene (ctxB) and expressed in tomato. Presence of transgenes in the tomato genome was confirmed by PCR and expression of genes was confirmed at transcript and protein level. TCPA, chimeric CTB-P4 and CTB-P6 proteins were also expressed in E. coli. TCPA protein expressed in E. coli was purified to generate anti-TCPA antibodies in rabbit. Immunoblot and G(M1)-ELISA verified the synthesis and assembly of pentameric chimeric proteins in fruit tissue of transgenic tomato plants. The chimeric protein CTB-P4 and CTB-P6 accumulated up to 0.17 and 0.096% of total soluble protein (TSP), respectively, in tomato fruits. Whereas expression of TCPA, CTB-P4 and CTB-P6 in E. coli can be utilized for development of conventional vaccine, expression of these antigens which can provide both anti-toxin as well as anti-colonization immunity, has been demonstrated in plants, in a form which is potentially capable of inducing immune response against cholera infection.

Escherichia coli common pilus (ECP) targets arabinosyl residues in plant cell walls to mediate adhesion to fresh produce plants.

PubMed

Rossez, Yannick; Holmes, Ashleigh; Lodberg-Pedersen, Henriette; Birse, Louise; Marshall, Jacqueline; Willats, William G T; Toth, Ian K; Holden, Nicola J

2014-12-05

Outbreaks of verotoxigenic Escherichia coli are often associated with fresh produce. However, the molecular basis to adherence is unknown beyond ionic lipid-flagellum interactions in plant cell membranes. We demonstrate that arabinans present in different constituents of plant cell walls are targeted for adherence by E. coli common pilus (ECP; or meningitis-associated and temperature-regulated (Mat) fimbriae) for E. coli serotypes O157:H7 and O18:K1:H7. l-Arabinose is a common constituent of plant cell wall that is rarely found in other organisms, whereas ECP is widespread in E. coli and other environmental enteric species. ECP bound to oligosaccharides of at least arabinotriose or longer in a glycan array, plant cell wall pectic polysaccharides, and plant glycoproteins. Recognition overlapped with the antibody LM13, which binds arabinanase-sensitive pectic epitopes, and showed a preferential affinity for (1→5)-α-linked l-arabinosyl residues and longer chains of arabinan as demonstrated with the use of arabinan-degrading enzymes. Functional adherence in planta was mediated by the adhesin EcpD in combination with the structural subunit, EcpA, and expression was demonstrated with an ecpR-GFP fusion and ECP antibodies. Spinach was found to be enriched for ECP/LM13 targets compared with lettuce. Specific recognition of arabinosyl residues may help explain the persistence of E. coli in the wider environment and association of verotoxigenic E. coli with some fresh produce plants by exploitation of a glycan found only in plant, not animal, cells. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Expression of the gene cluster associated with the Escherichia coli pilus adhesin K99.

PubMed

Lee, J H; Isaacson, R E

1995-10-01

The biogenesis of the pilus adhesin K99 is dependent on the expression of eight contiguous genes, fanA to fanH. Transposon mutants were prepared by using TnlacZ and TnphoA, and selected transposon mutants were used to measure expression of each K99 gene. Expression of the K99 genes is likely controlled at the transcription level, since in general, there were no differences between the results obtained with the two transposons. fanC was the most highly expressed, and fanD was expressed at very low levels. The expression of TnlacZ fusions in fanA and fanB fusions was high. Deletion of fanA, fanB, and part of fanC abolished the expression of fanD but had no effect on the distal genes fanE to fanH. To locate the DNA regions required for expression of fanE to fanH, deletion mutations were prepared and the effects on expression of fanE to fanH were determined. The deletion of a segment between fanD and fanE abolished fanE and fanF expression but did not affect fanG and fanH. The deletion of a portion of fanF (approximately 1 kb proximal to fanG) abolished the expression of fanG and fanH. These results indicate the presence of regulatory elements proximal to fanE and to fanG. Putative promoters were identified in these regions by DNA homology and by primer extension. A stem-loop structure that may act as a transcriptional attenuator of fanF was also found at the beginning of fanF. These data confirm our previous model of K99 transcriptional organization.

Expression of the gene cluster associated with the Escherichia coli pilus adhesin K99.

PubMed Central

Lee, J H; Isaacson, R E

1995-01-01

The biogenesis of the pilus adhesin K99 is dependent on the expression of eight contiguous genes, fanA to fanH. Transposon mutants were prepared by using TnlacZ and TnphoA, and selected transposon mutants were used to measure expression of each K99 gene. Expression of the K99 genes is likely controlled at the transcription level, since in general, there were no differences between the results obtained with the two transposons. fanC was the most highly expressed, and fanD was expressed at very low levels. The expression of TnlacZ fusions in fanA and fanB fusions was high. Deletion of fanA, fanB, and part of fanC abolished the expression of fanD but had no effect on the distal genes fanE to fanH. To locate the DNA regions required for expression of fanE to fanH, deletion mutations were prepared and the effects on expression of fanE to fanH were determined. The deletion of a segment between fanD and fanE abolished fanE and fanF expression but did not affect fanG and fanH. The deletion of a portion of fanF (approximately 1 kb proximal to fanG) abolished the expression of fanG and fanH. These results indicate the presence of regulatory elements proximal to fanE and to fanG. Putative promoters were identified in these regions by DNA homology and by primer extension. A stem-loop structure that may act as a transcriptional attenuator of fanF was also found at the beginning of fanF. These data confirm our previous model of K99 transcriptional organization. PMID:7558331

Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

PubMed

Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

2014-05-01

Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

PubMed

Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

2010-08-01

A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

Level III and IV Ecoregions by State

EPA Pesticide Factsheets

Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Level III and IV Ecoregions by EPA Region

EPA Pesticide Factsheets

Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

PubMed

Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

2010-11-01

Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

PubMed Central

Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

2013-01-01

Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

PubMed

Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

2005-03-01

To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

PubMed

Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

2016-03-01

The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

NASA Astrophysics Data System (ADS)

Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

2018-04-01

We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

A genomic island in Vibrio cholerae with VPI-1 site-specific recombination characteristics contains CRISPR-Cas and type VI secretion modules

PubMed Central

Labbate, Maurizio; Orata, Fabini D.; Petty, Nicola K.; Jayatilleke, Nathasha D.; King, William L.; Kirchberger, Paul C.; Allen, Chris; Mann, Gulay; Mutreja, Ankur; Thomson, Nicholas R.; Boucher, Yan; Charles, Ian G.

2016-01-01

Cholera is a devastating diarrhoeal disease caused by certain strains of serogroup O1/O139 Vibrio cholerae. Mobile genetic elements such as genomic islands (GIs) have been pivotal in the evolution of O1/O139 V. cholerae. Perhaps the most important GI involved in cholera disease is the V. cholerae pathogenicity island 1 (VPI-1). This GI contains the toxin-coregulated pilus (TCP) gene cluster that is necessary for colonization of the human intestine as well as being the receptor for infection by the cholera-toxin bearing CTX phage. In this study, we report a GI (designated GIVchS12) from a non-O1/O139 strain of V. cholerae that is present in the same chromosomal location as VPI-1, contains an integrase gene with 94% nucleotide and 100% protein identity to the VPI-1 integrase, and attachment (att) sites 100% identical to those found in VPI-1. However, instead of TCP and the other accessory genes present in VPI-1, GIVchS12 contains a CRISPR-Cas element and a type VI secretion system (T6SS). GIs similar to GIVchS12 were identified in other V. cholerae genomes, also containing CRISPR-Cas elements and/or T6SS’s. This study highlights the diversity of GIs circulating in natural V. cholerae populations and identifies GIs with VPI-1 recombination characteristics as a propagator of CRISPR-Cas and T6SS modules. PMID:27845364

Discovery of Plant Phenolic Compounds That Act as Type III Secretion System Inhibitors or Inducers of the Fire Blight Pathogen, Erwinia amylovora

PubMed Central

Khokhani, Devanshi; Zhang, Chengfang; Li, Yan; Wang, Qi; Zeng, Quan; Yamazaki, Akihiro; Hutchins, William; Zhou, Shan-Shan

2013-01-01

Erwinia amylovora causes a devastating disease called fire blight in rosaceous plants. The type III secretion system (T3SS) is one of the important virulence factors utilized by E. amylovora in order to successfully infect its hosts. By using a green fluorescent protein (GFP) reporter construct combined with a high-throughput flow cytometry assay, a library of phenolic compounds and their derivatives was studied for their ability to alter the expression of the T3SS. Based on the effectiveness of the compounds on the expression of the T3SS pilus, the T3SS inhibitors 4-methoxy-cinnamic acid (TMCA) and benzoic acid (BA) and one T3SS inducer, trans-2-(4-hydroxyphenyl)-ethenylsulfonate (EHPES), were chosen for further study. Both the T3SS inhibitors (TMCA and BA) and the T3SS inducer (EHPES) were found to alter the expression of T3SS through the HrpS-HrpL pathway. Additionally, TMCA altered T3SS expression through the rsmBEa-RsmAEa system. Finally, we found that TMCA and BA weakened the hypersensitive response (HR) in tobacco by suppressing the T3SS of E. amylovora. In our study, we identified phenolic compounds that specifically targeted the T3SS. The T3SS inhibitor may offer an alternative approach to antimicrobial therapy by targeting virulence factors of bacterial pathogens. PMID:23770912

Genome sequencing and analysis of a highly virulent Vibrio parahaemolyticus strain isolated from the marine environment

NASA Astrophysics Data System (ADS)

Parks, M. C.; Moreno, E.

2016-02-01

Vibrio parahaemolyticus [Vp] is a Gram-negative bacterium and a natural inhabitant of coastal marine ecosystems worldwide. Vp is also a coincidental pathogen of humans. Virulent strains are commonly identified by the presence of the thermostable direct (tdh) or tdh-related (trh) hemolysin genes. However, virulence is multifaceted and many clinical Vp isolates do not carry tdh or trh. In this study, we sequenced and assembled the draft genome of a tdh- and trh-negative environmental isolate (805) shown previously to be highly virulent in zebrafish. To investigate potential mechanisms of virulence, we compared 805 to the clinical V. parahaemolyticus type strain (RIMD2210633). Pairwise comparison revealed the presence of multiple genomic regions including an IncF conjugative pilus (1.3 Kb) and a colicin V plasmid (1.49 Kb). These features are homologous to genomic regions present in clinical V. vulnificus and V. cholerae strains. Genome comparison also revealed the presence of five toxin-antitoxin systems. Isolate 805 likely attained these new features through the lateral acquisition of mobile genomic material - a hypothesis supported by the aberrant GC content of these regions. Colicin V plasmids are a diverse group of IncF plasmids found in invasive bacterial strains. Similarly, an abundance of toxin-antitoxin systems have been linked to virulence in Gram-negative bacteria. Current efforts are focused on characterizing 142 coding features present in 805 but absent from the type strain.

Discovery of plant phenolic compounds that act as type III secretion system inhibitors or inducers of the fire blight pathogen, Erwinia amylovora.

PubMed

Khokhani, Devanshi; Zhang, Chengfang; Li, Yan; Wang, Qi; Zeng, Quan; Yamazaki, Akihiro; Hutchins, William; Zhou, Shan-Shan; Chen, Xin; Yang, Ching-Hong

2013-09-01

Erwinia amylovora causes a devastating disease called fire blight in rosaceous plants. The type III secretion system (T3SS) is one of the important virulence factors utilized by E. amylovora in order to successfully infect its hosts. By using a green fluorescent protein (GFP) reporter construct combined with a high-throughput flow cytometry assay, a library of phenolic compounds and their derivatives was studied for their ability to alter the expression of the T3SS. Based on the effectiveness of the compounds on the expression of the T3SS pilus, the T3SS inhibitors 4-methoxy-cinnamic acid (TMCA) and benzoic acid (BA) and one T3SS inducer, trans-2-(4-hydroxyphenyl)-ethenylsulfonate (EHPES), were chosen for further study. Both the T3SS inhibitors (TMCA and BA) and the T3SS inducer (EHPES) were found to alter the expression of T3SS through the HrpS-HrpL pathway. Additionally, TMCA altered T3SS expression through the rsmBEa-RsmAEa system. Finally, we found that TMCA and BA weakened the hypersensitive response (HR) in tobacco by suppressing the T3SS of E. amylovora. In our study, we identified phenolic compounds that specifically targeted the T3SS. The T3SS inhibitor may offer an alternative approach to antimicrobial therapy by targeting virulence factors of bacterial pathogens.

Acute pancreatitis complicating choledochal cysts in children.

PubMed

Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

2017-03-01

To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

PubMed

Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

2012-07-01

Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

The diagnostic accuracy of multiparametric MRI to determine pediatric brain tumor grades and types.

PubMed

Koob, Mériam; Girard, Nadine; Ghattas, Badih; Fellah, Slim; Confort-Gouny, Sylviane; Figarella-Branger, Dominique; Scavarda, Didier

2016-04-01

Childhood brain tumors show great histological variability. The goal of this retrospective study was to assess the diagnostic accuracy of multimodal MR imaging (diffusion, perfusion, MR spectroscopy) in the distinction of pediatric brain tumor grades and types. Seventy-six patients (range 1 month to 18 years) with brain tumors underwent multimodal MR imaging. Tumors were categorized by grade (I-IV) and by histological type (A-H). Multivariate statistical analysis was performed to evaluate the diagnostic accuracy of single and combined MR modalities, and of single imaging parameters to distinguish the different groups. The highest diagnostic accuracy for tumor grading was obtained with diffusion-perfusion (73.24%) and for tumor typing with diffusion-perfusion-MR spectroscopy (55.76%). The best diagnostic accuracy was obtained for tumor grading in I and IV and for tumor typing in embryonal tumor and pilocytic astrocytoma. Poor accuracy was seen in other grades and types. ADC and rADC were the best parameters for tumor grading and typing followed by choline level with an intermediate echo time, CBV for grading and Tmax for typing. Multiparametric MR imaging can be accurate in determining tumor grades (primarily grades I and IV) and types (mainly pilocytic astrocytomas and embryonal tumors) in children.

[Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

PubMed

Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

2003-01-01

The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

PubMed

Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

2017-12-28

The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

Specific phobia among U.S. adolescents: phenomenology and typology.

PubMed

Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

2012-12-01

Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

PubMed Central

Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

1996-01-01

We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

PubMed

Hidaka, Yoshie; Suzuki, Masakazu

2004-06-01

Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

Level III and IV Ecoregions of the Continental United States

EPA Pesticide Factsheets

Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

PubMed Central

Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

2014-01-01

Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

PubMed

Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

2007-06-01

Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

2006-10-15

Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

PubMed

Dickens, J C; Prestwich, G D

1989-02-01

For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

PubMed

Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

2017-03-01

We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

PubMed

Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

2015-10-01

To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

2006-12-15

We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

PubMed

Hardy, Christine D; Cozzarelli, Nicholas R

2003-03-01

DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

PubMed Central

Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

2016-01-01

Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

Lesch typology and temperament in opioid dependence: a cross-sectional study.

PubMed

Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

2014-08-01

The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis.

PubMed

Luvan, M; Kanthan, S R; Roshan, G; Saw, A

2015-11-01

Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy.

A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

PubMed

Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

2009-05-01

Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

Application of MLST and Pilus Gene Sequence Comparisons to Investigate the Population Structures of Actinomyces naeslundii and Actinomyces oris

PubMed Central

Henssge, Uta; Do, Thuy; Gilbert, Steven C.; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A. J. M.; Radford, David R.; Beighton, David

2011-01-01

Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established. PMID:21738661

Application of MLST and pilus gene sequence comparisons to investigate the population structures of Actinomyces naeslundii and Actinomyces oris.

PubMed

Henssge, Uta; Do, Thuy; Gilbert, Steven C; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A J M; Radford, David R; Beighton, David

2011-01-01

Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established.

A repetitive mutation and selection system for bacterial evolution to increase the specific affinity to pancreatic cancer cells.

PubMed

Osawa, Masaki

2018-01-01

It is difficult to target and kill cancer cells. One possible approach is to mutate bacteria to enhance their binding to cancer cells. In the present study, Gram-negative Escherichia coli and Gram-positive Bacillus subtilis were randomly mutated, and then were positively and negatively selected for binding cancer vs normal cells. With repetitive mutation and selection both bacteria successfully evolved to increase affinity to the pancreatic cancer cell line (Mia PaCa-2) but not normal cells (HPDE: immortalized human pancreatic ductal epithelial cells). The mutant E. coli and B. subtilis strains bound to Mia PaCa-2 cells about 10 and 25 times more than to HPDE cells. The selected E. coli strain had mutations in biofilm-related genes and the regulatory region for a type I pilus gene. Consistent with type I pili involvement, mannose could inhibit the binding to cells. The results suggest that weak but specific binding is involved in the initial step of adhesion. To test their ability to kill Mia PaCa-2 cells, hemolysin was expressed in the mutant strain. The hemolysin released from the mutant strain was active and could kill Mia PaCa-2 cells. In the case of B. subtilis, the initial binding to the cells was a weak interaction of the leading pole of the motile bacteria. The frequency of this interaction to Mia PaCa-2 cells dramatically increased in the evolved mutant strain. This mutant strain could also specifically invade beneath Mia PaCa-2 cells and settle there. This type of mutation/selection strategy may be applicable to other combinations of cancer cells and bacterial species.

[Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

PubMed

Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

2010-01-01

Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

Adult presentation of Bartter syndrome type IV with erythrocytosis.

PubMed

Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

2015-01-01

Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis.

Audiological findings in children with mucopolysaccharidoses type i-iv.

PubMed

Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

PubMed

Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

2002-04-02

The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

Risk evaluation for in-vehicle sign information.

DOT National Transportation Integrated Search

2016-05-01

The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

Nonstatic radiating spheres in general relativity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krori, K.D.; Borgohain, P.; Sarma, R.

1985-02-15

The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

DTIC Science & Technology

2010-05-01

Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

NASA Astrophysics Data System (ADS)

Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

2013-09-01

Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

PubMed

Satya, Ramadass; Vijayakumar, Vani

2006-10-01

A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

PubMed

Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

2014-06-01

The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

Biomarker for Glycogen Storage Diseases

ClinicalTrials.gov

2017-07-03

Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

PubMed Central

Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

2014-01-01

Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

Self aligned hysteresis free carbon nanotube field-effect transistors

NASA Astrophysics Data System (ADS)

Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

2016-04-01

Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

PubMed

Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

2018-05-01

Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

PubMed

Boos, A

2000-01-01

Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

PubMed Central

Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

2017-01-01

The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

PubMed

Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

2016-01-01

Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

PubMed Central

Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

2016-01-01

Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

PubMed Central

Harastani, Houda H.; Tokajian, Sima T.

2014-01-01

Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

DTIC Science & Technology

1983-12-01

2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

PubMed

Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

2017-01-01

Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasanth, V.; Chen, Yao; Feng, Shiwei

2016-10-10

Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

PubMed

Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

2015-07-01

In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

[Alcohol-related cognitive impairment and the DSM-5].

PubMed

Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

2016-01-01

It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis

PubMed Central

Luvan, M; Roshan, G; Saw, A

2015-01-01

Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy. PMID:28611907

The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

PubMed Central

Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

2012-01-01

In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

An outbreak of pneumonia associated with S. pneumoniae at a military training facility in Finland in 2006.

PubMed

Vainio, Anni; Lyytikäinen, Outi; Sihvonen, Reetta; Kaijalainen, Tarja; Teirilä, Laura; Rantala, Merja; Lehtinen, Pirkko; Ruuska, Pekka; Virolainen, Anni

2009-07-01

Streptococcus pneumoniae is a well-known cause of community-acquired bacterial pneumonia. The purpose of this study was to assess the cause and extent of the outbreak of pneumonia which occurred among military recruits following a 1-week hard encampment in Finland. We also assessed the carriage rate and molecular characteristics of the S. pneumoniae isolates. All pneumococcal isolates were studied for antibiotic susceptibility, serotyped, genotyped by multilocus sequence typing (MLST), and the presence of pneumococcal rlrA pilus islet was detected. The genotype results defined by MLST corresponded with the serotype results. S. pneumoniae serotype 7F, ST2331, seemed to be associated with an outbreak of pneumonia and nasopharyngeal carriage among 43 military recruits. Of the 43 military recruits, five (12%) were hospitalized with pneumonia and two (40%) of them were positive for S. pneumoniae serotype 7F, ST2331 by blood culture. Eighteen (42%) of the 43 men were found to be positive for S. pneumoniae by nasopharyngeal culture, and nine (50%) of them carried pneumococcal serotype 7F, ST2331. The outbreak strain covered 55% of all the pneumococcal findings. Outbreaks of invasive pneumococcal disease seem to occur in a crowded environment such as a military training facility even among previously healthy young men.

Himar1 Transposon for Efficient Random Mutagenesis in Aggregatibacter actinomycetemcomitans

PubMed Central

Ding, Qinfeng; Tan, Kai Soo

2017-01-01

Aggregatibacter actinomycetemcomitans is the primary etiological agent of aggressive periodontal disease. Identification of novel virulence factors at the genome-wide level is hindered by lack of efficient genetic tools to perform mutagenesis in this organism. The Himar1 mariner transposon is known to yield a random distribution of insertions in an organism’s genome with requirement for only a TA dinucleotide target and is independent of host-specific factors. However, the utility of this system in A. actinomycetemcomitans is unknown. In this study, we found that Himar1 transposon mutagenesis occurs at a high frequency (×10-4), and can be universally applied to wild-type A. actinomycetemcomitans strains of serotypes a, b, and c. The Himar1 transposon inserts were stably inherited in A. actinomycetemcomitans transconjugants in the absence of antibiotics. A library of 16,000 mutant colonies of A. actinomycetemcomitans was screened for reduced biofilm formation. Mutants with transposon inserts in genes encoding pilus, putative ion transporters, multidrug resistant proteins, transcription regulators and enzymes involved in the synthesis of extracellular polymeric substance, bacterial metabolism and stress response were discovered in this screen. Our results demonstrated the utility of the Himar1 mutagenesis system as a novel genetic tool for functional genomic analysis in A. actinomycetemcomitans. PMID:29018421

Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

PubMed

Madabhushi, Ram; Marians, Kenneth J

2009-01-30

In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

PubMed

Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

2015-01-01

A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

PubMed

Hardie, Andrew D; Kereshi, Borko

2014-06-01

Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

DTIC Science & Technology

2017-05-17

490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

PubMed

Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

2017-01-01

The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

Adult presentation of Bartter syndrome type IV with erythrocytosis

PubMed Central

Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

2015-01-01

Abstract Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis. PMID:26537508

An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

PubMed Central

MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

2012-01-01

SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

PubMed

Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

2018-01-09

Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

PubMed Central

Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

2017-01-01

Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

PubMed Central

Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

2004-01-01

NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

PubMed Central

Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

2015-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

Validity of DSM-IV attention–deficit/hyperactivity disorder symptom dimensions and subtypes

PubMed Central

Willcutt, Erik G.; Nigg, Joel T.; Pennington, Bruce F.; Solanto, Mary V.; Rohde, Luis A.; Tannock, Rosemary; Loo, Sandra K.; Carlson, Caryn L.; McBurnett, Keith; Lahey, Benjamin B.

2013-01-01

DSM-IV criteria for ADHD specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision-making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the validity of the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, it is concluded that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. PMID:22612200

Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

PubMed

Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

2013-11-01

The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

Influence of hospital type on survival in stage IV colorectal cancer.

PubMed

Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

2016-08-01

Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.