Sample records for type iv restriction

  1. [Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

    PubMed

    Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

    2003-01-01

    The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

  2. [Mucolipidoses type IV in a patient with mapuche ancestry].

    PubMed

    Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

    2008-07-01

    We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

  3. 9 CFR 93.910 - General restrictions; exceptions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... (type IV) strain of VHS virus under natural (i.e., non-controlled) conditions of exposure and from which... World Health Organization for Animal Health by the country's competent authority for aquatic animal...

  4. 9 CFR 93.910 - General restrictions; exceptions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... (type IV) strain of VHS virus under natural (i.e., non-controlled) conditions of exposure and from which... World Health Organization for Animal Health by the country's competent authority for aquatic animal...

  5. 9 CFR 93.910 - General restrictions; exceptions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... (type IV) strain of VHS virus under natural (i.e., non-controlled) conditions of exposure and from which... World Health Organization for Animal Health by the country's competent authority for aquatic animal...

  6. 9 CFR 93.910 - General restrictions; exceptions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... (type IV) strain of VHS virus under natural (i.e., non-controlled) conditions of exposure and from which... World Health Organization for Animal Health by the country's competent authority for aquatic animal...

  7. 9 CFR 93.910 - General restrictions; exceptions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... (type IV) strain of VHS virus under natural (i.e., non-controlled) conditions of exposure and from which... World Health Organization for Animal Health by the country's competent authority for aquatic animal...

  8. Proteolysis breaks tolerance toward intact α345(IV) collagen, eliciting novel anti-GBM autoantibodies specific for α345NC1 hexamers

    PubMed Central

    Olaru, Florina; Wang, Xu-Ping; Luo, Wentian; Ge, Linna; Miner, Jeffrey H; Kleinau, Sandra; Geiger, Xochiquetzal J.; Wasiluk, Andrew; Heidet, Laurence; Kitching, A. Richard; Borza, Dorin-Bogdan

    2012-01-01

    Goodpasture disease is an autoimmune kidney disease mediated by autoAbs against NC1 monomers of α3(IV) collagen that bind to the glomerular basement membrane (GBM), usually causing rapidly progressive glomerulonephritis. We identified a novel type of human IgG4-restricted anti-GBM autoAbs associated with mild non-progressive glomerulonephritis, which specifically targeted α345NC1 hexamers but not α3NC1 monomers. The mechanisms eliciting these anti-GBM autoAbs were investigated in mouse models recapitulating this phenotype. Wild type and FcγRIIB−/− mice immunized with autologous murine GBM NC1 hexamers produced mouse IgG1-restricted autoAbs specific for α345NC1 hexamers, which bound to the GBM in vivo but did not cause glomerulonephritis. In these mice, intact collagen IV from murine GBM was not immunogenic. However, in Col4a3−/− Alport mice, both intact collagen IV and NC1 hexamers from murine GBM elicited IgG antibodies specific for α3α4α5NC1 hexamers, which were not subclass restricted. As heterologous antigen in COL4A3-humanized mice, murine GBM NC1 hexamers elicited mouse IgG1, IgG2a and IgG2b autoAbs specific for α345NC1 hexamers and induced anti-GBM Ab glomerulonephritis. These findings indicate that tolerance toward autologous intact α3α4α5(IV) collagen is established in hosts expressing this antigen, even though autoreactive B cells specific for α345NC1 hexamers are not purged from their repertoire. Proteolysis selectively breaches this tolerance by generating autoimmunogenic α3α4α5NC1 hexamers. This provides a mechanism eliciting autoAbs specific for α345NC1 hexamers, which are restricted to non-inflammatory IgG subclasses and non-nephritogenic. In Alport syndrome, lack of tolerance toward α3α4α5(IV) collagen promotes production of alloantibodies to α345NC1 hexamers, including pro-inflammatory IgG subclasses which mediate post-transplant anti-GBM nephritis. PMID:23303673

  9. Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

    PubMed

    Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

    2012-01-01

    Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

  10. Highlights of the DNA cutters: a short history of the restriction enzymes

    PubMed Central

    Loenen, Wil A. M.; Dryden, David T. F.; Raleigh, Elisabeth A.; Wilson, Geoffrey G.; Murray, Noreen E.

    2014-01-01

    In the early 1950’s, ‘host-controlled variation in bacterial viruses’ was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine. PMID:24141096

  11. Highlights of the DNA cutters: a short history of the restriction enzymes.

    PubMed

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G; Murray, Noreen E

    2014-01-01

    In the early 1950's, 'host-controlled variation in bacterial viruses' was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine.

  12. Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

    PubMed

    McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

    2014-10-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

  13. Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

    PubMed Central

    McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

    2014-01-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

  14. Ferritin and body mass index predict cardiac dysfunction in female adolescents with anorexia of the restrictive type.

    PubMed

    Docx, Martine K F; Weyler, Joost; Simons, Annik; Ramet, José; Mertens, Luc

    2015-08-01

    Decreased left ventricular mass index in anorexia nervosa is amply reported. The aim of this study is to identify non-burdensome predictors of reduced left yentricular mass/height (cLVM) in a cohort of adolescent restrictive anorexic girls. This is a retrospective study of all anorexic girls of the restrictive type referred to our tertiary eating disorder unit between September 2002 and December 2012, for somatic assessment of weig ht loss. All subjects fulfilled DMS-IV criteria, without a family history of cardiac or cardiovascular diseases. In all, 283 restrictive anorexic girls (age: 14.63 +/- 1.65 y; body mass index: 15.72 +/- 1.81 kg/m2) were included. Ferritin and body mass index were independent, statistically significant predictors of the corrected left ventricular mass (P <0.05). Decreased cLVM is very common in anorexia nervosa of the restrictive type. Two factors predicted decreased cLVM in our population: ferritin and BMI.

  15. Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

    PubMed

    Madabhushi, Ram; Marians, Kenneth J

    2009-01-30

    In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

  16. The lateral mobility of cell adhesion molecules is highly restricted at septate junctions in Drosophila.

    PubMed

    Laval, Monique; Bel, Christophe; Faivre-Sarrailh, Catherine

    2008-07-18

    A complex of three cell adhesion molecules (CAMs) Neurexin IV(Nrx IV), Contactin (Cont) and Neuroglian (Nrg) is implicated in the formation of septate junctions between epithelial cells in Drosophila. These CAMs are interdependent for their localization at septate junctions and e.g. null mutation of nrx IV or cont induces the mislocalization of Nrg to the baso-lateral membrane. These mutations also result in ultrastructural alteration of the strands of septate junctions and breakdown of the paracellular barrier. Varicose (Vari) and Coracle (Cora), that both interact with the cytoplasmic tail of Nrx IV, are scaffolding molecules required for the formation of septate junctions. We conducted photobleaching experiments on whole living Drosophila embryos to analyze the membrane mobility of CAMs at septate junctions between epithelial cells. We show that GFP-tagged Nrg and Nrx IV molecules exhibit very stable association with septate junctions in wild-type embryos. Nrg-GFP is mislocalized to the baso-lateral membrane in nrx IV or cont null mutant embryos, and displays increased mobile fraction. Similarly, Nrx IV-GFP becomes distributed to the baso-lateral membrane in null mutants of vari and cora, and its mobile fraction is strongly increased. The loss of Vari, a MAGUK protein that interacts with the cytoplasmic tail of Nrx IV, has a stronger effect than the null mutation of nrx IV on the lateral mobility of Nrg-GFP. The strands of septate junctions display a stable behavior in vivo that may be correlated with their role of paracellular barrier. The membrane mobility of CAMs is strongly limited when they take part to the multimolecular complex forming septate junctions. This restricted lateral diffusion of CAMs depends on both adhesive interactions and clustering by scaffolding molecules. The lateral mobility of CAMs is strongly increased in embryos presenting alteration of septate junctions. The stronger effect of vari by comparison with nrx IV null mutation supports the hypothesis that this scaffolding molecule may cross-link different types of CAMs and play a crucial role in stabilizing the strands of septate junctions.

  17. Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

    PubMed

    Hidaka, Yoshie; Suzuki, Masakazu

    2004-06-01

    Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

  18. Clinical presentations of Ehlers Danlos syndrome type IV.

    PubMed Central

    Pope, F M; Narcisi, P; Nicholls, A C; Liberman, M; Oorthuys, J W

    1988-01-01

    Ehlers Danlos syndrome type IV is an often lethal disease caused by various mutations of type III collagen genes. It presents in infancy and childhood in several ways, and the symptoms and signs include low birth weight, prematurity, congenital dislocation of the hips, easy inappropriate bruising (sometimes suspected as child battering), and a diagnostic facial phenotype. These features predict a lethal adult disease often complicated by fatal arterial rupture in early or middle adult life. Most affected patients can be diagnosed from radiolabelled collagen protein profiles by polyacrylamide gel electrophoresis. Prenatal diagnosis by specific type III collagen restriction fragment length polymorphisms is possible in some families, and will become increasingly important. Prenatal diagnosis and prevention of the disease in selected families is already possible and will be widely available in the future. Images Fig 1 Fig 2 Fig 3 Fig 4 Fig 5 Fig 6 Fig 7 Fig 8 Fig 9 Fig 10 Fig 11 PMID:3178263

  19. A Novel Tool for Microbial Genome Editing Using the Restriction-Modification System.

    PubMed

    Bai, Hua; Deng, Aihua; Liu, Shuwen; Cui, Di; Qiu, Qidi; Wang, Laiyou; Yang, Zhao; Wu, Jie; Shang, Xiuling; Zhang, Yun; Wen, Tingyi

    2018-01-19

    Scarless genetic manipulation of genomes is an essential tool for biological research. The restriction-modification (R-M) system is a defense system in bacteria that protects against invading genomes on the basis of its ability to distinguish foreign DNA from self DNA. Here, we designed an R-M system-mediated genome editing (RMGE) technique for scarless genetic manipulation in different microorganisms. For bacteria with Type IV REase, an RMGE technique using the inducible DNA methyltransferase gene, bceSIIM (RMGE-bceSIIM), as the counter-selection cassette was developed to edit the genome of Escherichia coli. For bacteria without Type IV REase, an RMGE technique based on a restriction endonuclease (RMGE-mcrA) was established in Bacillus subtilis. These techniques were successfully used for gene deletion and replacement with nearly 100% counter-selection efficiencies, which were higher and more stable compared to conventional methods. Furthermore, precise point mutation without limiting sites was achieved in E. coli using RMGE-bceSIIM to introduce a single base mutation of A128C into the rpsL gene. In addition, the RMGE-mcrA technique was applied to delete the CAN1 gene in Saccharomyces cerevisiae DAY414 with 100% counter-selection efficiency. The effectiveness of the RMGE technique in E. coli, B. subtilis, and S. cerevisiae suggests the potential universal usefulness of this technique for microbial genome manipulation.

  20. Follow up investigation of workers in synthetic fibre plants with humidifier disease and work related asthma.

    PubMed

    Pal, T M; de Monchy, J G; Groothoff, J W; Post, D

    1999-06-01

    To investigate the clinical and sociomedical outcome in patients with various clinical manifestations of humidifier disease and work related asthma after removal from further exposure. Follow up investigation (range 1-13 years) of respiratory symptoms, spirometry, airway responsiveness, sickness absence, and working situation in patients with (I) humidifier fever (n = 12), (II) obstructive type of humidifier lung (n = 8), (III) restrictive type of humidifier lung (n = 4), and (IV) work related asthma (n = 22). All patients were working at departments in synthetic fibre plants with microbiological exposure from contaminated humidification systems or exposure to small particles (< 1 micron) of oil mist. At follow up patients with work related asthma were less often symptom free (37%, 7/19) than patients with humidifier disease (I, II, III) (67%, 16/24). Mean forced expiratory volume in one second (FEV1) of patients with obstructive impairment had been increased significantly at follow up but still remained below the predicted value. Mean forced vital capacity (FVC) of patients with initially restrictive impairment had returned to normal values at follow up. Airway hyperresponsiveness at diagnosis persisted in patients with obstructive impairment (II + IV 14/17, but disappeared in patients with humidifier fever (3/3) and restrictive type of humidifier lung (2/2). In patients with obstructive impairment (II + IV), FVC and FEV1 at diagnosis were negatively associated with the duration between onset of symptoms and diagnosis and the number of years of exposure. Those with positive pre-employment history of respiratory disease had a lower FEV1 at diagnosis. Sickness absence due to respiratory symptoms decreased in all groups of patients after removal from further exposure, but this was most impressive in patients with the humidifier lung (II, III) and patients with work related asthma (IV). At follow up 83% of the patients were still at work at the same production site, whereas 11% received a disability pension because of respiratory disease. In patients with work related respiratory disease caused by exposure from contaminated humidification systems or oil mist, removal from further exposure resulted in clinical improvement, although, especially in those with obstructive impairment, signs persisted. Because of the possibility of transferring patients to exposure-free departments most patients could be kept at work.

  1. Proposal of a novel system for the staging of thymic epithelial tumors.

    PubMed

    Bedini, Amedeo Vittorio; Andreani, Stefano Michele; Tavecchio, Luca; Fabbri, Alessandra; Giardini, Roberto; Camerini, Tiziana; Bufalino, Rosaria; Morabito, Alberto; Rosai, Juan

    2005-12-01

    We designed and assessed a new TNM staging system (herein called the INT [Istituto Nazionale Tumori] system) for thymic epithelial tumors in order to overcome the perceived drawbacks of Masaoka's system, which represents the current standard. In all, 123 cases were evaluated. The histologic types according to the World Health Organization (WHO) classification were as follows: subtype A: 5 cases; AB: 40; B1: 16; B2: 29; B3: 16; and C: 17 cases. There were 45 Masaoka's stage I, 33 stage II, 26 stage III, and 19 stage IV cases. A total of 11 INT definitions were grouped into three stages: locally restricted disease (75 cases), which included Masaoka's stage I and selected stage II cases (no pleural invasion); locally advanced disease (37 cases), which included Masaoka's stage III cases plus those staged II owing to pleural invasion and those staged IV owing to intrathoracic nodal or limited pleuropericardial involvement; and systemic disease (11 cases), which included the remaining Masaoka's stage IV cases. Completeness of resection, WHO types, and both staging systems were significant prognostic factors (p < 0.0001) on univariate analysis. The 95-month progression-free survival rates according to Masaoka's system were stage I: 100%; II: 93.6%; III: 46.3%; and IV: 23.2%. The INT system corresponding figures were as follows: locally restricted disease: 98.6%; locally advanced disease: 46.9%; and systemic disease: 11.7%. The INT system was the prognostic factor with the greatest impact (p = 0.0218) on multivariate analysis (Masaoka's system: p = 0.2012; completeness of resection: p = 0.6855; histology: p = 0.9386). The INT system allows finer disease descriptions than Masaoka's system, resulting in a stage grouping with higher prognostic distinctiveness.

  2. The lesser of two adverse reactions.

    PubMed

    Chakraborti, Chayan; Egan, John

    2010-01-01

    Fundamental to complex systems are interconnected processes involved in providing high-quality patient care. A case study and a root cause analysis (RCA) illustrate a patient safety effort with unintended consequences. A 38-year-old woman presented to the hospital for odynophagia and vomiting. The patient developed Mobitz type 2, second-degree heart block temporally associated with the administration of intravenous ondansetron. RESPONSE TO THE EVENT: An Ishikawa, or fishbone, diagram conducted to enumerate potential contributing factors indicated that a key factor appeared to be an institutional restriction against using intravenous (i.v.) promethazine, which resulted in ondansetron being the only readily available i.v. anti-emetic on formulary. The anesthesia department requested that i.v. promethazine be removed from all operating and recovery room automated medication dispensing machines. The pharmacy department, given the realization that individual departments were taking independent action regarding promethazine, discussed the matter with the medical director, who issued a memo banning the use of i.v. promethazine. An institutional ban on i.v. anti-emetics such as promethazine may have resulted in an increase in the use of ondansetron and contributed to this adverse reaction. The reason to restrict promethazine is not well reported in the literature. In limiting the use of promethazine for patient safety concerns, the inadvertent increase in adverse reactions of the alternative medication, ondansetron, may have been overlooked. The resultant RCA underscores the need for careful cataloguing of adverse medication effects. Stakeholders should anticipate as many "downstream effects" of quality and patient safety improvements as possible. Comprehensive reporting of adverse medication effects will augment the emerging science of patient safety.

  3. 46 CFR 390.12 - Liquidated damages.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... restrictions applicable to the vessel is 20 years in accordance with paragraph (b)(1)(i) of this section; (B... accordance with paragraphs (b)(1) (ii), (iii) or (iv) of this section; or (C) for 5 years, if the duration of the trading restrictions applicable to the vessel is 5 years in accordance with paragraph (b)(1)(iv...

  4. Genetic typing of feline rabies virus isolated in greater Bangkok, Thailand.

    PubMed

    Kasempimolporn, Songsri; Saengseesom, Wachiraporn; Tirawatnapong, Thaweesak; Puempumpanich, Sununta; Sitprija, Visith

    2004-01-01

    To study the molecular epidemiology of rabies virus that is prevalent among cats in greater Bangkok, Thailand, a total of 17 rabies virus isolates from cats were characterized and compared with 120 rabies virus isolates from dogs. Analyses were performed on the genetic polymorphism in the rabies virus nucleoprotein (N) gene. Rabies virus N gene of isolates was amplified by reverse transcriptionpolymerase chain reaction. The diversity of N gene was revealed by the restriction fragment length polymorphism (RFLP) method. The rabies virus isolates from cats could be classified into 5 types, designated as Dd I-Hf I, Dd II-Hf II, Dd III-Hf I, Dd IV-Hf I, and Dd IV-Hf III. Type Dd I-Hf I was encountered more frequently than the others. It was apparent that no less than five rabies virus types presented in the areas of Bangkok. Moreover, all five RFLP patterns were typical of those which had been observed in dogs. Our findings suggest that there had been viral transmission between the dogs and the cats.

  5. [Effects of restrictions on use of vancomycin in a German university hospital].

    PubMed

    Glück, T; Linde, H J; Wiegrebe, E; Lehn, N; Reng, M; Schölmerich, J

    2000-02-15

    Recently, increasing antibiotic resistance has been observed among gram-positive bacteria. However, only few isolates were found to be resistant against glycopeptides. Therefore, internationally accepted guidelines recommend a restricted use of vancomycin and other glycopeptide antibiotics in order to prevent the development of resistance against these clinically important antibiotics. In many countries, the hospital pharmacies play a key role in control and reinforcement of antibiotic formulary restrictions. In Germany, however, the hospital pharmacies usually do not take over such control functions, and most wards keep a stock of regularly used drugs including antibiotics, which makes reinforcement of restrictions difficult. In an attempt to achieve a restriction of vancomycin use, the pharmacy of our university hospital was advised to deliver vancomycin to the wards only on request with a special order form signed by an attending, individually for every patient who should receive vancomycin. The efficacy of this restriction measure was evaluated in 3-month periods before and after the restriction became effective. Hospitalwide, this led to a 20.1% reduction of i.v. vancomycin and an 85.7% reduction of oral vancomycin use per 1000 patient days. If the hematology/oncology units were not considered, the reduction of i.v. vancomycin use was 41.8%, and the total use after the restriction 24.2 g per 1000 patient days. Microbiology results which justified the use of vancomycin decreased by 8.3% (10.9% hematology/oncology units not considered) between the 2 observation periods. Assuming a 7-day mean course of i.v. vancomycin therapy, the empirical use of i.v. vancomycin decreased from 39.9% to 8% after the restriction had been instituted. Allowing only experienced physicians (attendings) to decide on the use of vancomycin therapy, proved in our experience to be an effective measure to reduce unnecessary vancomycin use.

  6. Relation between induced labour indications and neonatal morbidity.

    PubMed

    Hernández-Martínez, Antonio; Pascual-Pedreño, Ana Isabel; Baño-Garnés, Ana Belén; Del Rocío Melero-Jiménez, Maria; Molina-Alarcón, Milagros

    2014-12-01

    To assess the main neonatal morbidity results in relation to induced labour indications. Historical groups from a total of 3,817 deliveries over a three year period (2009, 2010 and 2011) in "Mancha-Centro" Hospital (Alcázar de San Juan) formed the study group. All programmed and non-avoidable caesarean sections and pregnancies under 35 weeks were excluded. The main variable result was a neonatal morbidity variable made up of the Apgar score after 5 min, pH of umbilical artery <7.10 and the neonatal need for resuscitation type III-V. Multivariate analysis was used to control confounding variables. The incidence of induced labour was 22.6 % (862). The highest indication was premature rupture of membranes for more than 12 h 22.8 % (190), poorly controlled diabetes 22.6 % (189) and oligoamnios 16.2 % (135). The rate of pH lower than 7.10 was 2.8 % (22), the rate of the Apgar score lower than 7 after 5 min was 0.2 % (2) and the neonatal need for resuscitation type III-IV was 5.7 % (48) for induced labour. The relation between induced labour and neonatal morbidity indicators were not statistically significant. 10.1 % (4) of induced labour for suspected intrauterine growth restriction and 8.6 % (10) of postterm pregnancies required neonatal resuscitation type III-IV. No relation was found between induced labour and the neonatal morbidity indicators. The highest neonatal risk indicator is when a intrauterine growth restriction, hypertensión/preeclampsia or a postterm pregnancy is suspected.

  7. Controlling postoperative use of i.v. acetaminophen at an academic medical center.

    PubMed

    Vincent, William R; Huiras, Paul; Empfield, Jennifer; Horbowicz, Kevin J; Lewis, Keith; McAneny, David; Twitchell, David

    2018-04-15

    Results of an interprofessional formulary initiative to decrease postoperative prescribing of i.v. acetaminophen are reported. After a medical center added i.v. acetaminophen to its formulary, increased prescribing of the i.v. formulation and a 3-fold price increase resulted in monthly spending of more than $40,000, prompting an organizationwide effort to curtail that cost while maintaining effective pain management. The surgery, anesthesia, and pharmacy departments applied the Institute for Healthcare Improvement's Model for Improvement to implement (1) pharmacist-led enforcement of prescribing restrictions, (2) retrospective evaluation of i.v. acetaminophen's impact on rates of opioid-related adverse effects, (3) restriction of prescribing of the drug to 1 postoperative dose on select patient care services, and (4) guideline-driven pain management according to an enhanced recovery after surgery (ERAS) protocol. Monitored metrics included the monthly i.v. acetaminophen prescribing rate, the proportion of i.v. acetaminophen orders requiring pharmacist intervention to enforce prescribing restrictions, and prescribing rates for select adjunctive analgesics. Within a year of project implementation, the mean monthly i.v. acetaminophen prescribing rate decreased by 83% from baseline to about 6 doses per 100 patient-days, with a decline in the monthly drug cost to about $4,000. Documented pharmacist interventions increased 2.7-fold, and use of oral acetaminophen, ketorolac, and gabapentin in ERAS areas increased by 18% overall. An interprofessional initiative at a large medical center reduced postoperative use of i.v. acetaminophen by more than 80% and yielded over $400,000 in annual cost savings. Copyright © 2018 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

  8. Oxide Structure Dependence of SiO2/SiOx/3C-SiC/n-Type Si Nonvolatile Resistive Memory on Memory Operation Characteristics

    NASA Astrophysics Data System (ADS)

    Yamaguchi, Yuichiro; Shouji, Masatsugu; Suda, Yoshiyuki

    2012-11-01

    We have investigated the dependence of the oxide layer structure of our previously proposed metal/SiO2/SiOx/3C-SiC/n-Si/metal metal-insulator-semiconductor (MIS) resistive memory device on the memory operation characteristics. The current-voltage (I-V) measurement and X-ray photoemission spectroscopy results suggest that SiOx defect states mainly caused by the oxidation of 3C-SiC at temperatures below 1000 °C are related to the hysteresis memory behavior in the I-V curve. By restricting the SiOx interface region, the number of switching cycles and the on/off current ratio are more enhanced. Compared with a memory device formed by one-step or two-step oxidation of 3C-SiC, a memory device formed by one-step oxidation of Si/3C-SiC exhibits a more restrictive SiOx interface with a more definitive SiO2 layer and higher memory performances for both the endurance switching cycle and on/off current ratio.

  9. Identification of novel mammalian hosts and Brazilian biome geographic distribution of Trypanosoma cruzi TcIII and TcIV.

    PubMed

    Barros, Juliana Helena S; Xavier, Samanta Cristina C; Bilac, Daniele; Lima, Valdirene Santos; Dario, Maria Augusta; Jansen, Ana Maria

    2017-08-01

    Trypanosoma cruzi is a parasitic protozoan responsible for Chagas disease. Seven different Discrete Typing Units (DTUs) of T. cruzi are currently identified in nature: TcI-TcVI, and TcBat whose distribution patterns in nature, hosts/reservoirs and eco-epidemiological importance are still little known. Here, we present novel data on the geographic distribution and diversity of mammalian hosts and vectors of T. cruzi DTUs TcIII and TcIV. In this study, we analyzed 61 T. cruzi isolates obtained from 18 species of mammals (five orders) and two Hemiptera genera. Samples were collected from five Brazilian biomes (Pantanal, Caatinga, Cerrado, Atlantic Rainforest, and Amazon) previously characterized as Z3 or mixed infection (TcI-Z3) by mini-exon gene PCR. To identify TcIII and TcIV genotypes, we applied restriction fragment length polymorphism analysis to the PCR-amplified histone 3 gene. DTUs TcIII and TcIV were identified in single and mixed infections from wide dispersion throughout five Brazilian biomes studied, with TcIV being the most common. Pantanal was the biome that displayed the largest number of samples characterized as TcIII and TcIV in single and mixed infections, followed by Atlantic Rainforest and Amazon. Species from the Didelphimorphia order displayed the highest frequency of infection and were found in all five biomes. We report, for the first time, the infection of a species of the Artiodactyla order by DTU TcIII. In addition, we describe new host species: five mammals (marsupials and rodents) and two genera of Hemiptera. Our data indicate that DTUs TcIII and TcIV are more widespread and infect a larger number of mammalian species than previously thought. In addition, they are transmitted in restricted foci and cycles, but in different microhabitats and areas with distinct ecological profiles. Finally, we show that DTUs TcIII and TcIV do not present any specific association with biomes or host species. Copyright © 2017. Published by Elsevier B.V.

  10. Primary Role for Toll-Like Receptor-Driven Tumor Necrosis Factor Rather than Cytosolic Immune Detection in Restricting Coxiella burnetii Phase II Replication within Mouse Macrophages

    PubMed Central

    Bradley, William P.; Boyer, Mark A.; Nguyen, Hieu T.; Birdwell, L. Dillon; Yu, Janet; Ribeiro, Juliana M.; Roy, Craig R.

    2016-01-01

    Coxiella burnetii replicates within permissive host cells by employing a Dot/Icm type IV secretion system (T4SS) to translocate effector proteins that direct the formation of a parasitophorous vacuole. C57BL/6 mouse macrophages restrict the intracellular replication of the C. burnetii Nine Mile phase II (NMII) strain. However, eliminating Toll-like receptor 2 (TLR2) permits bacterial replication, indicating that the restriction of bacterial replication is immune mediated. Here, we examined whether additional innate immune pathways are employed by C57BL/6 macrophages to sense and restrict NMII replication. In addition to the known role of TLR2 in detecting and restricting NMII infection, we found that TLR4 also contributes to cytokine responses but is not required to restrict bacterial replication. Furthermore, the TLR signaling adaptors MyD88 and Trif are required for cytokine responses and restricting bacterial replication. The C. burnetii NMII T4SS translocates bacterial products into C57BL/6 macrophages. However, there was little evidence of cytosolic immune sensing of NMII, as there was a lack of inflammasome activation, T4SS-dependent cytokine responses, and robust type I interferon (IFN) production, and these pathways were not required to restrict bacterial replication. Instead, endogenous tumor necrosis factor (TNF) produced upon TLR sensing of C. burnetii NMII was required to control bacterial replication. Therefore, our findings indicate a primary role for TNF produced upon immune detection of C. burnetii NMII by TLRs, rather than cytosolic PRRs, in enabling C57BL/6 macrophages to restrict bacterial replication. PMID:26787725

  11. Bidirectional associations between binge eating and restriction in anorexia nervosa. An ecological momentary assessment study☆

    PubMed Central

    De Young, Kyle P.; Lavender, Jason M.; Crosby, Ross D.; Wonderlich, Stephen A.; Engel, Scott G.; Mitchell, James E.; Crow, Scott J.; Peterson, Carol B.; Le Grange, Daniel

    2014-01-01

    This study examined the association between restrictive eating behaviors and binge eating in anorexia nervosa (AN) using data collected in the natural environment. Women (N = 118) with DSM-IV full or sub-threshold AN reported eating disorder behaviors, including binge eating episodes, going ≥ 8 waking hours without eating, and skipping meals, during 2 weeks of ecological momentary assessment (EMA). Time-lagged generalized estimating equations tested the following hypotheses: 1) dietary restriction would predict binge eating while controlling for binge eating the previous day; 2) binge eating would predict restriction the subsequent day while controlling for restriction the previous day. After controlling for relevant covariates, the hypotheses were not supported; however, there appeared to be a cumulative effect of repeatedly going 8 consecutive hours without eating (i.e. fasting) on the risk of binge eating among individuals who recently engaged in binge eating. In addition, skipping meals was associated with a lower risk of same day binge eating. The relationship between binge eating and dietary restriction appears to be complex and may vary by type of restrictive eating behavior. Future research should aim to further clarify the nature of the interaction of binge eating and restrictive eating among individuals with AN in order to effectively eliminate these behaviors in treatment. PMID:25134738

  12. CHEK2 1100delC, IVS2+1G>A and I157T mutations are not present in colorectal cancer cases from Turkish population.

    PubMed

    Bayram, Süleyman; Topaktaş, Mehmet; Akkız, Hikmet; Bekar, Aynur; Akgöllü, Ersin

    2012-10-01

    The cell cycle checkpoint kinase 2 (CHEK2) protein participates in the DNA damage response in many cell types. Germline mutations in CHEK2 (1100delC, IVS2+1G>A and I157T) have been impaired serine/threonine kinase activity and associated with a range of cancer types. This hospital-based case-control study aimed to investigate whether CHEK2 1100delC, IVS2+1G>A and I157T mutations play an important role in the development of colorectal cancer (CRC) in Turkish population. A total of 210 CRC cases and 446 cancer-free controls were genotyped for CHEK2 mutations by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific-polymerase chain reaction (AS-PCR) methods. We did not find the CHEK2 1100delC, IVS2+1G>A and I157T mutations in any of the Turkish subjects. Our result demonstrate for the first time that CHEK2 1100delC, IVS2+1G>A and I157T mutations have not been agenetic susceptibility factor for CRC in the Turkish population. Overall, our data suggest that genotyping of CHEK2 mutations in clinical settings in the Turkish population should not be recommended. However, independent studies are need to validate our findings in a larger series, as well as in patients of different ethnic origins. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Phylogenomics and sequence-structure-function relationships in the GmrSD family of Type IV restriction enzymes.

    PubMed

    Machnicka, Magdalena A; Kaminska, Katarzyna H; Dunin-Horkawicz, Stanislaw; Bujnicki, Janusz M

    2015-10-23

    GmrSD is a modification-dependent restriction endonuclease that specifically targets and cleaves glucosylated hydroxymethylcytosine (glc-HMC) modified DNA. It is encoded either as two separate single-domain GmrS and GmrD proteins or as a single protein carrying both domains. Previous studies suggested that GmrS acts as endonuclease and NTPase whereas GmrD binds DNA. In this work we applied homology detection, sequence conservation analysis, fold recognition and homology modeling methods to study sequence-structure-function relationships in the GmrSD restriction endonucleases family. We also analyzed the phylogeny and genomic context of the family members. Results of our comparative genomics study show that GmrS exhibits similarity to proteins from the ParB/Srx fold which can have both NTPase and nuclease activity. In contrast to the previous studies though, we attribute the nuclease activity also to GmrD as we found it to contain the HNH endonuclease motif. We revealed residues potentially important for structure and function in both domains. Moreover, we found that GmrSD systems exist predominantly as a fused, double-domain form rather than as a heterodimer and that their homologs are often encoded in regions enriched in defense and gene mobility-related elements. Finally, phylogenetic reconstructions of GmrS and GmrD domains revealed that they coevolved and only few GmrSD systems appear to be assembled from distantly related GmrS and GmrD components. Our study provides insight into sequence-structure-function relationships in the yet poorly characterized family of Type IV restriction enzymes. Comparative genomics allowed to propose possible role of GmrD domain in the function of the GmrSD enzyme and possible active sites of both GmrS and GmrD domains. Presented results can guide further experimental characterization of these enzymes.

  14. Ecological fitness and strategies of adaptation of Bartonella species to their hosts and vectors☆

    PubMed Central

    Chomel, Bruno B.; Boulouis, Henri-Jean; Breitschwerdt, Edward B.; Kasten, Rickie W.; Vayssier-Taussat, Muriel; Birtles, Richard J.; Koehler, Jane E.; Dehio, Christoph

    2009-01-01

    Bartonella spp. are facultative intracellular bacteria that cause characteristic host-restricted hemotropic infections in mammals and are typically transmitted by blood-sucking arthropods. In the mammalian reservoir, these bacteria initially infect a yet unrecognized primary niche, which seeds organisms into the blood stream leading to the establishment of a long-lasting intra-erythrocytic bacteremia as the hall-mark of infection. Bacterial type IV secretion systems, which are supra-molecular transporters ancestrally related to bacterial conjugation systems, represent crucial pathogenicity factors that have contributed to a radial expansion of the Bartonella lineage in nature by facilitating adaptation to unique mammalian hosts. On the molecular level, the type IV secretion system VirB/VirD4 is known to translocate a cocktail of different effector proteins into host cells, which subvert multiple cellular functions to the benefit of the infecting pathogen. Furthermore, bacterial adhesins mediate a critical, early step in the pathogenesis of the bartonellae by binding to extracellular matrix components of host cells, which leads to firm bacterial adhesion to the cell surface as a prerequisite for the efficient translocation of type IV secretion effector proteins. The best-studied adhesins in bartonellae are the orthologous trimeric autotransporter adhesins, BadA in Bartonella henselae and the Vomp family in Bartonella quintana. Genetic diversity and strain variability also appear to enhance the ability of bartonellae to invade not only specific reservoir hosts, but also accidental hosts, as shown for B. henselae. Bartonellae have been identified in many different blood-sucking arthropods, in which they are typically found to cause extracellular infections of the mid-gut epithelium. Adaptation to specific vectors and reservoirs seems to be a common strategy of bartonellae for transmission and host diversity. However, knowledge regarding arthropod specificity/restriction, the mode of transmission, and the bacterial factors involved in arthropod infection and transmission is still limited. PMID:19284965

  15. Rib Cage Deformities Alter Respiratory Muscle Action and Chest Wall Function in Patients with Severe Osteogenesis Imperfecta

    PubMed Central

    LoMauro, Antonella; Pochintesta, Simona; Romei, Marianna; D'Angelo, Maria Grazia; Pedotti, Antonio; Turconi, Anna Carla; Aliverti, Andrea

    2012-01-01

    Background Osteogenesis imperfecta (OI) is an inherited connective tissue disorder characterized by bone fragility, multiple fractures and significant chest wall deformities. Cardiopulmonary insufficiency is the leading cause of death in these patients. Methods Seven patients with severe OI type III, 15 with moderate OI type IV and 26 healthy subjects were studied. In addition to standard spirometry, rib cage geometry, breathing pattern and regional chest wall volume changes at rest in seated and supine position were assessed by opto-electronic plethysmography to investigate if structural modifications of the rib cage in OI have consequences on ventilatory pattern. One-way or two-way analysis of variance was performed to compare the results between the three groups and the two postures. Results Both OI type III and IV patients showed reduced FVC and FEV1 compared to predicted values, on condition that updated reference equations are considered. In both positions, ventilation was lower in OI patients than control because of lower tidal volume (p<0.01). In contrast to OI type IV patients, whose chest wall geometry and function was normal, OI type III patients were characterized by reduced (p<0.01) angle at the sternum (pectus carinatum), paradoxical inspiratory inward motion of the pulmonary rib cage, significant thoraco-abdominal asynchronies and rib cage distortions in supine position (p<0.001). Conclusions In conclusion, the restrictive respiratory pattern of Osteogenesis Imperfecta is closely related to the severity of the disease and to the sternal deformities. Pectus carinatum characterizes OI type III patients and alters respiratory muscles coordination, leading to chest wall and rib cage distortions and an inefficient ventilator pattern. OI type IV is characterized by lower alterations in the respiratory function. These findings suggest that functional assessment and treatment of OI should be differentiated in these two forms of the disease. PMID:22558284

  16. Rare Late-Onset Presentation of Glutaric Aciduria Type I in a 16-Year-Old Woman with a Novel GCDH Mutation.

    PubMed

    Fraidakis, M J; Liadinioti, C; Stefanis, L; Dinopoulos, A; Pons, R; Papathanassiou, M; Garcia-Villoria, J; Ribes, A

    2015-01-01

    Glutaric acidemia type I (GA-I) is a treatable autosomal recessive disorder of lysine, hydroxylysine, and tryptophan metabolism caused by glutaryl-CoA dehydrogenase (GCDH) deficiency. Presentation and progression of disease are variable ranging from asymptomatic carrier state to catastrophic encephalopathy. GA-I usually presents before age 18 months, usually triggered by childhood infection, with mild or severe acute encephalopathy, striatal degeneration, and movement disorder, most often acute dystonia. At a presymptomatic stage diagnosis is suggested clinically by macrocephaly, radiologically by widened Sylvian fissures and biochemically by the presence of excess 3-hydroxyglutaric acid and glutaric acid in urine. Treatment consists of lysine-restricted diet and carnitine supplementation, specific diet restrictions, as well as symptomatic and anticatabolic treatment of intercurrent illness. Presymptomatic diagnosis and treatment are essential to prognosis. We report the case of 16-year-old macrocephalic female with late-onset GA-I and unusual paucisymptomatic presentation with fainting after exercise and widespread white matter signal changes at MRI. She was compound heterozygote for a novel mutation (IVS10-2A>G) affecting splicing at GCDH and a common missense mutation (c. 1240C>T; p.Arg402Trp, R402W). Interestingly, the site of the novel mutation is the nucleotide position of a common mutation found almost exclusively in patients of Chinese/Taiwanese origin (IVS10-2A>C).

  17. [Personality disorders in adolescent patients with anorexia and bulimia nervosa].

    PubMed

    Bottin, Julia; Salbach-Andrae, Harriet; Schneider, Nora; Pfeiffer, Ernst; Lenz, Klaus; Lehmkuhl, Ulrike

    2010-09-01

    The present study aimed to ascertain the occurrence of personality disorders (PD) in adolescent patients with anorexia (AN) and bulimia nervosa (BN) by means of the Structured Clinical Interview for DSM-IV Personality Disorders (SCID-II). 99 female adolescent patients (57 AN - restrictive type, 17 AN - binge-purging type, 25 BN; M(age) = 16.3 +/- 1.6) were consecutively assessed by means of SCID-II. Furthermore, the influence of age, axis-I-comorbidities, and type of treatment according to PD were examined. 30.3% of the patients met the criteria for PD according to SCID-II. AN patients of the binge-purging type showed higher prevalences of PD and higher dimensional scores than the other eating disorder groups. Moreover, our findings indicate that age and axis-I-comorbidities are associated with the development of PD. Significant differences in the occurrence of PD in the three eating disorder groups were found. Patients of the AN binge-purging type are more often affected than restricting AN or BN patients are. This, and also the influence of age and axis-I-comorbidities, should be taken into account in the treatment of patients with eating disorders.

  18. 76 FR 62303 - California: Final Authorization of State Hazardous Waste Management Program Revision

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-07

    ...) Land Disposal Restrictions Phase IV--Treatment Standards for Wood Preserving Wastes, Paperwork... the Carbamate Land Disposal Restrictions; (5) Clarification of Standards for Hazardous Waste LDR...) Emergency Revision of the Land Disposal Restrictions (LDR) Treatment Standards for Listed Hazardous Wastes...

  19. Phase IV Land Disposal Restrictions Rule - Clarification of Effective Dates

    EPA Pesticide Factsheets

    Memo to clarify the effective dates for the major provisions of the Phase IV rule. It is supplemental to the final rule preamble at page 28556 (“Effective Dates”) and pages 28634-5 (“State Authority”).

  20. 26 CFR 1.61-15 - Options received as payment of income.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...). For rules relating to the taxation of options described in this subdivision, see section 1234 and the...) Restrictions (if any) on exercise or transfer of option; (iv) Restrictions (if any) on transfer of securities...

  1. Neutralisation of a single voltage sensor affects gating determinants in all four pore-forming S6 segments of Ca(V)1.2: a cooperative gating model.

    PubMed

    Beyl, Stanislav; Depil, Katrin; Hohaus, Annette; Stary-Weinzinger, Anna; Linder, Tobias; Timin, Eugen; Hering, Steffen

    2012-10-01

    Voltage sensors trigger the closed-open transitions in the pore of voltage-gated ion channels. To probe the transmission of voltage sensor signalling to the channel pore of Ca(V)1.2, we investigated how elimination of positive charges in the S4 segments (charged residues were replaced by neutral glutamine) modulates gating perturbations induced by mutations in pore-lining S6 segments. Neutralisation of all positively charged residues in IIS4 produced a functional channel (IIS4(N)), while replacement of the charged residues in IS4, IIIS4 and IVS4 segments resulted in nonfunctional channels. The IIS4(N) channel displayed activation kinetics similar to wild type. Mutations in a highly conserved structure motif on S6 segments ("GAGA ring": G432W in IS6, A780T in IIS6, G1193T in IIIS6 and A1503G in IVS6) induce strong left-shifted activation curves and decelerated channel deactivation kinetics. When IIS4(N) was combined with these mutations, the activation curves were shifted back towards wild type and current kinetics were accelerated. In contrast, 12 other mutations adjacent to the GAGA ring in IS6-IVS6, which also affect activation gating, were not rescued by IIS4(N). Thus, the rescue of gating distortions in segments IS6-IVS6 by IIS4(N) is highly position-specific. Thermodynamic cycle analysis supports the hypothesis that IIS4 is energetically coupled with the distantly located GAGA residues. We speculate that conformational changes caused by neutralisation of IIS4 are not restricted to domain II (IIS6) but are transmitted to gating structures in domains I, III and IV via the GAGA ring.

  2. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 28 2013-07-01 2013-07-01 false Wastes Excluded From Lab Packs Under...

  3. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 28 2012-07-01 2012-07-01 false Wastes Excluded From Lab Packs Under...

  4. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 27 2011-07-01 2011-07-01 false Wastes Excluded From Lab Packs Under...

  5. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Wastes Excluded From Lab Packs Under...

  6. 40 CFR Appendix IV to Part 268 - Wastes Excluded From Lab Packs Under the Alternative Treatment Standards of § 268.42(c)

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Pt. 268, App. IV Appendix IV to Part 268—Wastes Excluded From Lab Packs Under the Alternative Treatment... 40 Protection of Environment 27 2014-07-01 2014-07-01 false Wastes Excluded From Lab Packs Under...

  7. A type IV translocated Legionella cysteine phytase counteracts intracellular growth restriction by phytate.

    PubMed

    Weber, Stephen; Stirnimann, Christian U; Wieser, Mara; Frey, Daniel; Meier, Roger; Engelhardt, Sabrina; Li, Xiaodan; Capitani, Guido; Kammerer, Richard A; Hilbi, Hubert

    2014-12-05

    The causative agent of Legionnaires' pneumonia, Legionella pneumophila, colonizes diverse environmental niches, including biofilms, plant material, and protozoa. In these habitats, myo-inositol hexakisphosphate (phytate) is prevalent and used as a phosphate storage compound or as a siderophore. L. pneumophila replicates in protozoa and mammalian phagocytes within a unique "Legionella-containing vacuole." The bacteria govern host cell interactions through the Icm/Dot type IV secretion system (T4SS) and ∼300 different "effector" proteins. Here we characterize a hitherto unrecognized Icm/Dot substrate, LppA, as a phytate phosphatase (phytase). Phytase activity of recombinant LppA required catalytically essential cysteine (Cys(231)) and arginine (Arg(237)) residues. The structure of LppA at 1.4 Å resolution revealed a mainly α-helical globular protein stabilized by four antiparallel β-sheets that binds two phosphate moieties. The phosphates localize to a P-loop active site characteristic of dual specificity phosphatases or to a non-catalytic site, respectively. Phytate reversibly abolished growth of L. pneumophila in broth, and growth inhibition was relieved by overproduction of LppA or by metal ion titration. L. pneumophila lacking lppA replicated less efficiently in phytate-loaded Acanthamoeba castellanii or Dictyostelium discoideum, and the intracellular growth defect was complemented by the phytase gene. These findings identify the chelator phytate as an intracellular bacteriostatic component of cell-autonomous host immunity and reveal a T4SS-translocated L. pneumophila phytase that counteracts intracellular bacterial growth restriction by phytate. Thus, bacterial phytases might represent therapeutic targets to combat intracellular pathogens. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. DSM-IV diagnosis in depressed primary care patients with previous psychiatric ICD-10 bipolar disorder.

    PubMed

    Angst, Jules; Hantouche, Elie; Caci, Hervé; Gaillard, Raphael; Lancrenon, Sylvie; Azorin, Jean-Michel

    2014-01-01

    In the past 20 years, much evidence has accumulated against the overly restrictive diagnostic concepts of hypomania in DSM-IV and DSM-IV-TR. We tested DSM-IV-TR and a broader modified version (DSM-IV-TRm) for their ability to detect bipolarity in patients who had been treated for bipolar disorders (BD) in psychiatric settings, and who now consulted general practitioners (GPs) for new major depressive episodes (MDE). Bipolact II was an observational, single-visit survey involving 390 adult patients attending primary care for MDE (DSM-IV-TR criteria) in 201 GP offices in France. The participating GPs (53.3 ± 6.5 years old, 80.1% male) were trained by the Bipolact Educational Program, and were familiar with the medical care of depressive patients. Of the 390 patients with MDE, 129 (33.1%) were previously known as bipolar patients (ICD-10 criteria). Most of the latter bipolar patients (89.7%) had previously been treated with antidepressants. Only 9.3% of them met DMS-IV-TR criteria for BD. Conversely, 79.1% of the 129 bipolar patients met DMS-IV-TRm criteria for BD and showed strong associations with impulse control disorders and manic/hypomanic switches during antidepressant treatment. Limited training of participating GPs, recall bias of patients, and the study not being representative for untreated bipolar patients. Very few ICD-10 bipolar patients consulting French GPs for MDE met DSM-IV-TR criteria for bipolar diagnosis, which suggests that DSM-IV-TR criteria are insufficient and too restrictive for the diagnosis of BD. DSM-IV-TRm was more sensitive, but 20% of bipolar patients were undetected. © 2013 Elsevier B.V. All rights reserved.

  9. Structural characterization of ribosome recruitment and translocation by type IV IRES.

    PubMed

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-05-09

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation.

  10. 45 CFR 233.107 - Restriction in payment to households headed by a minor parent.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 2 2010-10-01 2010-10-01 false Restriction in payment to households headed by a... Restriction in payment to households headed by a minor parent. (a) State plan requirements. A State in its... for assistance paid under the State plan to a pregnant woman as provided in § 233.90(c)(2)(iv) of this...

  11. Constrained-pairing mean-field theory. IV. Inclusion of corresponding pair constraints and connection to unrestricted Hartree-Fock theory.

    PubMed

    Tsuchimochi, Takashi; Henderson, Thomas M; Scuseria, Gustavo E; Savin, Andreas

    2010-10-07

    Our previously developed constrained-pairing mean-field theory (CPMFT) is shown to map onto an unrestricted Hartree-Fock (UHF) type method if one imposes a corresponding pair constraint to the correlation problem that forces occupation numbers to occur in pairs adding to one. In this new version, CPMFT has all the advantages of standard independent particle models (orbitals and orbital energies, to mention a few), yet unlike UHF, it can dissociate polyatomic molecules to the correct ground-state restricted open-shell Hartree-Fock atoms or fragments.

  12. 48 CFR 952.204-2 - Security.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ..., including with respect to pre- and post-offer of employment disability related questioning. (iv) In addition... Information. (d) Definition of restricted data. The term Restricted Data means all data concerning design... employee, and must test the individual for illegal drugs, prior to selecting the individual for a position...

  13. 48 CFR 952.204-2 - Security.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ..., including with respect to pre- and post-offer of employment disability related questioning. (iv) In addition... Information. (d) Definition of restricted data. The term Restricted Data means all data concerning design... employee, and must test the individual for illegal drugs, prior to selecting the individual for a position...

  14. 48 CFR 952.204-2 - Security.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ..., including with respect to pre- and post-offer of employment disability related questioning. (iv) In addition... Information. (d) Definition of restricted data. The term Restricted Data means all data concerning design... employee, and must test the individual for illegal drugs, prior to selecting the individual for a position...

  15. 48 CFR 952.204-2 - Security.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ..., including with respect to pre- and post-offer of employment disability related questioning. (iv) In addition... Information. (d) Definition of restricted data. The term Restricted Data means all data concerning design... employee, and must test the individual for illegal drugs, prior to selecting the individual for a position...

  16. 48 CFR 952.204-2 - Security.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ..., including with respect to pre- and post-offer of employment disability related questioning. (iv) In addition... Information. (d) Definition of restricted data. The term Restricted Data means all data concerning design... employee, and must test the individual for illegal drugs, prior to selecting the individual for a position...

  17. Assessment of the effects of feed restriction and amino acid supplementation on glucose tolerance in llamas.

    PubMed

    Cebra, Christopher K; Tornquist, Susan J; Jester, Rebecca M; Stelletta, Calogero

    2004-07-01

    To assess the effects of prolonged feed deprivation on glucose tolerance, insulin secretion, and lipid homeostasis in llamas. 9 adult female llamas. On each of 2 consecutive days, food was withheld from the llamas for 8 hours. Blood samples were collected before and 5, 15, 30, 45, 60, 120, and 240 minutes after IV injection of dextrose (0.5 g/kg) for determination of plasma insulin and serum glucose, triglyceride, and nonesterified fatty acid concentrations. Between experimental periods, the llamas received supplemental amino acids IV (185 mg/kg in solution). The llamas were then fed a limited diet (grass hay, 0.25% of body weight daily) for 23 days, after which the experimental procedures were repeated. Feed restriction decreased glucose tolerance and had slight effects on insulin secretion in llamas. Basal lipid fractions were higher after feed restriction, but dextrose administration resulted in similar reductions in serum lipid concentrations with and without feed restriction. Insulin secretion was decreased on the second day of each study period, which lessened reduction of serum lipid concentrations but did not affect glucose tolerance. Despite having a comparatively competent pancreatic response, feed-restricted llamas assimilated dextrose via an IV bolus more slowly than did llamas on full rations. However, repeated administration of dextrose reduced insulin secretion and could promote hyperglycemia and fat mobilization. These findings suggested that veterinarians should use alternative methods of supplying energy to camelids with long-term reduced feed intake or consider administering agents to improve the assimilation of glucose.

  18. 3C 57 as an atypical radio-loud quasar: implications for the radio-loud/radio-quiet dichotomy

    NASA Astrophysics Data System (ADS)

    Sulentic, J. W.; Martínez-Carballo, M. A.; Marziani, P.; del Olmo, A.; Stirpe, G. M.; Zamfir, S.; Plauchu-Frayn, I.

    2015-06-01

    Lobe-dominated radio-loud (LD RL) quasars occupy a restricted domain in the 4D Eigenvector 1 (4DE1) parameter space which implies restricted geometry/physics/kinematics for this subclass compared to the radio-quiet (RQ) majority of quasars. We discuss how this restricted domain for the LD RL parent population supports the notion for a RQ-RL dichotomy among type 1 sources. 3C 57 is an atypical RL quasar that shows both uncertain radio morphology and falls in a region of 4DE1 space where RL quasars are rare. We present new radio flux and optical spectroscopic measures designed to verify its atypical optical/UV spectroscopic behaviour and clarify its radio structure. The former data confirms that 3C 57 falls off the 4DE1 quasar `main sequence' with both extreme optical Fe II emission (R_{Fe II} ˜ 1) and a large C IV λ1549 profile blueshift (˜-1500 km s-1). These parameter values are typical of extreme Population A sources which are almost always RQ. New radio measures show no evidence for flux change over a 50+ year time-scale consistent with compact steep-spectrum (or young LD) over core-dominated morphology. In the 4DE1 context where LD RL are usually low L/LEdd quasars, we suggest that 3C 57 is an evolved RL quasar (i.e. large blackhole mass) undergoing a major accretion event leading to a rejuvenation reflected by strong Fe II emission, perhaps indicating significant heavy metal enrichment, high bolometric luminosity for a low-redshift source and resultant unusually high Eddington ratio giving rise to the atypical C IV λ1549.

  19. Parallel evolution of a type IV secretion system in radiating lineages of the host-restricted bacterial pathogen Bartonella.

    PubMed

    Engel, Philipp; Salzburger, Walter; Liesch, Marius; Chang, Chao-Chin; Maruyama, Soichi; Lanz, Christa; Calteau, Alexandra; Lajus, Aurélie; Médigue, Claudine; Schuster, Stephan C; Dehio, Christoph

    2011-02-10

    Adaptive radiation is the rapid origination of multiple species from a single ancestor as the result of concurrent adaptation to disparate environments. This fundamental evolutionary process is considered to be responsible for the genesis of a great portion of the diversity of life. Bacteria have evolved enormous biological diversity by exploiting an exceptional range of environments, yet diversification of bacteria via adaptive radiation has been documented in a few cases only and the underlying molecular mechanisms are largely unknown. Here we show a compelling example of adaptive radiation in pathogenic bacteria and reveal their genetic basis. Our evolutionary genomic analyses of the α-proteobacterial genus Bartonella uncover two parallel adaptive radiations within these host-restricted mammalian pathogens. We identify a horizontally-acquired protein secretion system, which has evolved to target specific bacterial effector proteins into host cells as the evolutionary key innovation triggering these parallel adaptive radiations. We show that the functional versatility and adaptive potential of the VirB type IV secretion system (T4SS), and thereby translocated Bartonella effector proteins (Beps), evolved in parallel in the two lineages prior to their radiations. Independent chromosomal fixation of the virB operon and consecutive rounds of lineage-specific bep gene duplications followed by their functional diversification characterize these parallel evolutionary trajectories. Whereas most Beps maintained their ancestral domain constitution, strikingly, a novel type of effector protein emerged convergently in both lineages. This resulted in similar arrays of host cell-targeted effector proteins in the two lineages of Bartonella as the basis of their independent radiation. The parallel molecular evolution of the VirB/Bep system displays a striking example of a key innovation involved in independent adaptive processes and the emergence of bacterial pathogens. Furthermore, our study highlights the remarkable evolvability of T4SSs and their effector proteins, explaining their broad application in bacterial interactions with the environment.

  20. Parallel Evolution of a Type IV Secretion System in Radiating Lineages of the Host-Restricted Bacterial Pathogen Bartonella

    PubMed Central

    Engel, Philipp; Salzburger, Walter; Liesch, Marius; Chang, Chao-Chin; Maruyama, Soichi; Lanz, Christa; Calteau, Alexandra; Lajus, Aurélie; Médigue, Claudine; Schuster, Stephan C.; Dehio, Christoph

    2011-01-01

    Adaptive radiation is the rapid origination of multiple species from a single ancestor as the result of concurrent adaptation to disparate environments. This fundamental evolutionary process is considered to be responsible for the genesis of a great portion of the diversity of life. Bacteria have evolved enormous biological diversity by exploiting an exceptional range of environments, yet diversification of bacteria via adaptive radiation has been documented in a few cases only and the underlying molecular mechanisms are largely unknown. Here we show a compelling example of adaptive radiation in pathogenic bacteria and reveal their genetic basis. Our evolutionary genomic analyses of the α-proteobacterial genus Bartonella uncover two parallel adaptive radiations within these host-restricted mammalian pathogens. We identify a horizontally-acquired protein secretion system, which has evolved to target specific bacterial effector proteins into host cells as the evolutionary key innovation triggering these parallel adaptive radiations. We show that the functional versatility and adaptive potential of the VirB type IV secretion system (T4SS), and thereby translocated Bartonella effector proteins (Beps), evolved in parallel in the two lineages prior to their radiations. Independent chromosomal fixation of the virB operon and consecutive rounds of lineage-specific bep gene duplications followed by their functional diversification characterize these parallel evolutionary trajectories. Whereas most Beps maintained their ancestral domain constitution, strikingly, a novel type of effector protein emerged convergently in both lineages. This resulted in similar arrays of host cell-targeted effector proteins in the two lineages of Bartonella as the basis of their independent radiation. The parallel molecular evolution of the VirB/Bep system displays a striking example of a key innovation involved in independent adaptive processes and the emergence of bacterial pathogens. Furthermore, our study highlights the remarkable evolvability of T4SSs and their effector proteins, explaining their broad application in bacterial interactions with the environment. PMID:21347280

  1. Structural characterization of ribosome recruitment and translocation by type IV IRES

    PubMed Central

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts the otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: http://dx.doi.org/10.7554/eLife.13567.001 PMID:27159451

  2. 5 CFR 2641.201 - Permanent restriction on any former employee's representations to United States concerning...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... GOVERNMENT ETHICS POST-EMPLOYMENT CONFLICT OF INTEREST RESTRICTIONS Prohibitions § 2641.201 Permanent... environmental compliance issues. She prepared a report for one of her clients, which she knew would be presented... return of another person as preparer; (iv) Signing an assurance that one will be responsible as principal...

  3. 5 CFR 2641.201 - Permanent restriction on any former employee's representations to United States concerning...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... GOVERNMENT ETHICS POST-EMPLOYMENT CONFLICT OF INTEREST RESTRICTIONS Prohibitions § 2641.201 Permanent... environmental compliance issues. She prepared a report for one of her clients, which she knew would be presented... return of another person as preparer; (iv) Signing an assurance that one will be responsible as principal...

  4. 5 CFR 2641.201 - Permanent restriction on any former employee's representations to United States concerning...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... GOVERNMENT ETHICS POST-EMPLOYMENT CONFLICT OF INTEREST RESTRICTIONS Prohibitions § 2641.201 Permanent... environmental compliance issues. She prepared a report for one of her clients, which she knew would be presented... return of another person as preparer; (iv) Signing an assurance that one will be responsible as principal...

  5. 5 CFR 2641.201 - Permanent restriction on any former employee's representations to United States concerning...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... GOVERNMENT ETHICS POST-EMPLOYMENT CONFLICT OF INTEREST RESTRICTIONS Prohibitions § 2641.201 Permanent... environmental compliance issues. She prepared a report for one of her clients, which she knew would be presented... return of another person as preparer; (iv) Signing an assurance that one will be responsible as principal...

  6. 5 CFR 2641.201 - Permanent restriction on any former employee's representations to United States concerning...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... GOVERNMENT ETHICS POST-EMPLOYMENT CONFLICT OF INTEREST RESTRICTIONS Prohibitions § 2641.201 Permanent... environmental compliance issues. She prepared a report for one of her clients, which she knew would be presented... return of another person as preparer; (iv) Signing an assurance that one will be responsible as principal...

  7. 50 CFR 648.85 - Special management programs.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... assessment of the U.S./Canada shared resources for GB cod, haddock and yellowtail flounder shall occur. (C... comply with the restrictions and conditions in paragraphs (a)(3)(ii)(A) through (C) of this section... trip (e.g., the possession restrictions specified in paragraph (a)(3)(iv)(C)(4) of this section), and...

  8. Investigating the Structure of the Restricted, Repetitive Behaviours and Interests Domain of Autism

    ERIC Educational Resources Information Center

    Szatmari, Peter; Georgiades, Stelios; Bryson, Susan; Zwaigenbaum, Lonnie; Roberts, Wendy; Mahoney, William; Goldberg, Jeremy; Tuff, Lawrence

    2006-01-01

    Background: The Restricted, Repetitive Behaviours and Interests (RRBIs) are represented in the DSM-IV and measured by the Autism Diagnostic Interview-Revised (ADI-R) as one of the three homogeneous symptom categories of Pervasive Developmental Disorders. Although this conceptualisation is well accepted in the field, the grouping of symptoms is…

  9. Localization of extracellular matrix components in developing mouse salivary glands by confocal microscopy

    NASA Technical Reports Server (NTRS)

    Hardman, P.; Spooner, B. S.

    1992-01-01

    The importance of the extracellular matrix (ECM) in epithelial-mesenchymal interactions in developing organisms is well established. Proteoglycans and interstitial collagens are required for the growth, morphogenesis, and differentiation of epithelial organs and the distribution of these molecules has been described. However, much less is known about other ECM macromolecules in developing epithelial organs. We used confocal microscopy to examine the distribution of laminin, heparan sulfate (BM-1) proteoglycan, fibronectin, and collagen types I, IV, and V, in mouse embryonic salivary glands. Organ rudiments were isolated from gestational day 13 mouse embryos and cultured for 24, 48, or 72 hours. Whole mounts were stained by indirect immunofluorescence and then examined using a Zeiss Laser Scan Microscope. We found that each ECM component examined had a distinct distribution and that the distribution of some molecules varied with culture time. Laminin was mainly restricted to the basement membrane. BM-1 proteoglycan was concentrated in the basement membrane and also formed a fine network throughout the mesenchyme. Type IV collagen was mainly located in the basement membrane of the epithelium, but it was also present throughout the mesenchyme. Type V collagen was distributed throughout the mesenchyme at 24 hours, but at 48 hours was principally located in the basement membrane. Type I collagen was distributed throughout the mesenchyme at all culture times, and accumulated in the clefts and particularly at the epithelial-mesenchymal interface as time in culture increased. Fibronectin was observed throughout the mesenchyme at all times.

  10. Factor Structure of the Restricted Academic Situation Scale: Implications for ADHD

    ERIC Educational Resources Information Center

    Karama, Sherif; Amor, Leila Ben; Grizenko, Natalie; Ciampi, Antonio; Mbekou, Valentin; Ter-Stepanian, Marina; Lageix, Philippe; Baron, Chantal; Schwartz, George; Joober, Ridha

    2009-01-01

    Background: To study the factor structure of the Restricted Academic Situation Scale (RASS), a psychometric tool used to assess behavior in children with ADHD, 117 boys and 21 girls meeting "Diagnostic and Statistical Manual of Mental Disorders" (4th ed.; "DSM-IV") criteria for ADHD and aged between 6 and 12 years were recruited. Assessments were…

  11. Bias and Bias Correction in Multisite Instrumental Variables Analysis of Heterogeneous Mediator Effects

    ERIC Educational Resources Information Center

    Reardon, Sean F.; Unlu, Fatih; Zhu, Pei; Bloom, Howard S.

    2014-01-01

    We explore the use of instrumental variables (IV) analysis with a multisite randomized trial to estimate the effect of a mediating variable on an outcome in cases where it can be assumed that the observed mediator is the only mechanism linking treatment assignment to outcomes, an assumption known in the IV literature as the exclusion restriction.…

  12. 40 CFR 152.170 - Criteria for restriction to use by certified applicators.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., has an acute inhalation LC50 of 0.5 mg/liter or less, based upon a 4-hour exposure period; (iv) The... less; (iv) The pesticide, as formulated, has an acute inhalation LC50 of 0.05 mg/liter or less, based... consider evidence such as field studies, use history, accident data, monitoring data, or other pertinent...

  13. 40 CFR 152.170 - Criteria for restriction to use by certified applicators.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., has an acute inhalation LC50 of 0.5 mg/liter or less, based upon a 4-hour exposure period; (iv) The... less; (iv) The pesticide, as formulated, has an acute inhalation LC50 of 0.05 mg/liter or less, based... consider evidence such as field studies, use history, accident data, monitoring data, or other pertinent...

  14. Evidence for an apical Na-Cl cotransporter involved in ion uptake in a teleost fish

    USGS Publications Warehouse

    Hiroi, J.; Yasumasu, S.; McCormick, S.D.; Hwang, P.-P.; Kaneko, T.

    2008-01-01

    Cation-chloride cotransporters, such as the Na+/K +/2Cl- cotransporter (NKCC) and Na+/Cl - cotransporter (NCC), are localized to the apical or basolateral plasma membranes of epithelial cells and are involved in active ion absorption or secretion. The objectives of this study were to clone and identify 'freshwater-type' and 'seawater-type' cation-chloride cotransporters of euryhaline Mozambique tilapia (Oreochromis mossambicus) and to determine their intracellular localization patterns within mitochondria-rich cells (MRCs). From tilapia gills, we cloned four full-length cDNAs homologous to human cation-chloride cotransporters and designated them as tilapia NKCC1a, NKCC1b, NKCC2 and NCC. Out of the four candidates, the mRNA encoding NKCC1a was highly expressed in the yolk-sac membrane and gills (sites of the MRC localization) of seawater-acclimatized fish, whereas the mRNA encoding NCC was exclusively expressed in the yolk-sac membrane and gills of freshwater-acclimatized fish. We then generated antibodies specific for tilapia NKCC1a and NCC and conducted whole-mount immunofluorescence staining for NKCC1a and NCC, together with Na+/K+-ATPase, cystic fibrosis transmembrane conductance regulator (CFTR) and Na+/H+ exchanger 3 (NHE3), on the yolk-sac membrane of tilapia embryos acclimatized to freshwater or seawater. The simultaneous quintuple-color immunofluorescence staining allowed us to classify MRCs clearly into four types: types I, II, III and IV. The NKCC1a immunoreactivity was localized to the basolateral membrane of seawater-specific type-IV MRCs, whereas the NCC immunoreactivity was restricted to the apical membrane of freshwater-specific type-II MRCs. Taking account of these data at the level of both mRNA and protein, we deduce that NKCC1a is the seawater-type cotransporter involved in ion secretion by type-IV MRCs and that NCC is the freshwater-type cotransporter involved in ion absorption by type-II MRCs. We propose a novel ion-uptake model by MRCs in freshwater that incorporates apically located NCC. We also reevaluate a traditional ion-uptake model incorporating NHE3; the mRNA was highly expressed in freshwater, and the immunoreactivity was found at the apical membrane of other freshwater-specific MRCs.

  15. Drosophila type IV collagen mutation associates with immune system activation and intestinal dysfunction.

    PubMed

    Kiss, Márton; Kiss, András A; Radics, Monika; Popovics, Nikoletta; Hermesz, Edit; Csiszár, Katalin; Mink, Mátyás

    2016-01-01

    The basal lamina (BM) contains numerous components with a predominance of type IV collagens. Clinical manifestations associated with mutations of the human COL4A1 gene include perinatal cerebral hemorrhage and porencephaly, hereditary angiopathy, nephropathy, aneurysms and muscle cramps (HANAC), ocular dysgenesis, myopathy, Walker–Warburg syndrome and systemic tissue degeneration. In Drosophila, the phenotype associated with dominant temperature sensitive mutations of col4a1 include severe myopathy resulting from massive degradation of striated muscle fibers, and in the gut, degeneration of circular visceral muscle cells and epithelial cells following detachment from the BM. In order to determine the consequences of altered BMfunctions due to aberrant COL4A1 protein, we have carried out a series of tests using Drosophila DTS-L3 mutants from our allelic series of col4a1 mutations with confirmed degeneration of various cell types and lowest survival rate among the col4a1 mutant lines at restrictive temperature. Results demonstrated epithelial cell degeneration in the gut, shortened gut, enlarged midgut with multiple diverticulae, intestinal dysfunction and shortened life span. Midgut immunohistochemistry analyses confirmed altered expression and distribution of BM components integrin PSI and PSII alpha subunits, laminin gamma 1, and COL4A1 both in larvae and adults. Global gene expression analysis revealed activation of the effector AMP genes of the primary innate immune system including Metchnikowin, Diptericin, Diptericin B, and edin that preceded morphological changes. Attacin::GFP midgut expression pattern further supported these changes. An increase in ROS production and changes in gut bacterial flora were also noted and may have further enhanced an immune response. The phenotypic features of Drosophila col4a1 mutants confirmed an essential role for type IV collagen in maintaining epithelial integrity, gut morphology and intestinal function and suggest that aberrant structure and function of the COL4A1 protein may also be a significant factor in modulating immunity.

  16. Extension of the classical classification of β-turns

    PubMed Central

    de Brevern, Alexandre G.

    2016-01-01

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

  17. Extension of the classical classification of β-turns.

    PubMed

    de Brevern, Alexandre G

    2016-09-15

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

  18. Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

    PubMed

    Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

    2017-01-01

    The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  19. AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

    PubMed

    Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

    2007-08-01

    Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

  20. [Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

    PubMed

    Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

    1985-04-01

    Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

  1. Stage of perinatal development regulates skeletal muscle mitochondrial biogenesis and myogenic regulatory factor genes with little impact of growth restriction or cross-fostering.

    PubMed

    Laker, R C; Wadley, G D; McConell, G K; Wlodek, M E

    2012-02-01

    Foetal growth restriction impairs skeletal muscle development and adult muscle mitochondrial biogenesis. We hypothesized that key genes involved in muscle development and mitochondrial biogenesis would be altered following uteroplacental insufficiency in rat pups, and improving postnatal nutrition by cross-fostering would ameliorate these deficits. Bilateral uterine vessel ligation (Restricted) or sham (Control) surgery was performed on day 18 of gestation. Males and females were investigated at day 20 of gestation (E20), 1 (PN1), 7 (PN7) and 35 (PN35) days postnatally. A separate cohort of Control and Restricted pups were cross-fostered onto a different Control or Restricted mother and examined at PN7. In both sexes, peroxisome proliferator-activated receptor (PPAR)-γ coactivator-1α (PGC-1α), cytochrome c oxidase subunits 3 and 4 (COX III and IV) and myogenic regulatory factor 4 expression increased from late gestation to postnatal life, whereas mitochondrial transcription factor A, myogenic differentiation 1 (MyoD), myogenin and insulin-like growth factor I (IGF-I) decreased. Foetal growth restriction increased MyoD mRNA in females at PN7, whereas in males IGF-I mRNA was higher at E20 and PN1. Cross-fostering Restricted pups onto a Control mother significantly increased COX III mRNA in males and COX IV mRNA in both sexes above controls with little effect on other genes. Developmental age appears to be a major factor regulating skeletal muscle mitochondrial and developmental genes, with growth restriction and cross-fostering having only subtle effects. It therefore appears that reductions in adult mitochondrial biogenesis markers likely develop after weaning.

  2. Implications of HLA-allele associations for the study of type IV drug hypersensitivity reactions.

    PubMed

    Sullivan, A; Watkinson, J; Waddington, J; Park, B K; Naisbitt, D J

    2018-03-01

    Type IV drug hypersensitivity remains an important clinical problem and an obstacle to the development of new drugs. Several forms of drug hypersensitivity are associated with expression of specific HLA alleles. Furthermore, drug-specific T-lymphocytes have been isolated from patients with reactions. Despite this, controversy remains as to how drugs interact with immune receptors to stimulate a T-cell response. Areas covered: This article reviews the pathways of T-cell activation by drugs and how the ever increasing number of associations between expression of HLA alleles and susceptibility to hypersensitivity is impacting on our research effort to understanding this form of iatrogenic disease. Expert opinion: For a drug to activate a T-cell, a complex is formed between HLA molecules, an HLA binding peptide, the drug and the T-cell receptor. T-cell responses can involve drugs and stable or reactive metabolites bound covalently or non-covalently to any component of this complex. Recent research has linked the HLA associations to the disease through the characterization of drug-specific T-cell responses restricted to specific alleles. However, there is now a need to identify the additional genetic or environment factors that determine susceptibility and use our increased knowledge to develop predictive immunogenicity tests that offer benefit to Pharma developing new drugs.

  3. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

    PubMed

    Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

    2014-04-01

    The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

  4. Vitamin D Deficiency and Secondary Hyperparathyroidism Are Common Complications in Patients with Peripheral Arterial Disease

    PubMed Central

    Fahrleitner, Astrid; Dobnig, Harald; Obernosterer, Andrea; Pilger, Ernst; Leb, Georg; Weber, Kurt; Kudlacek, Stefan; Obermayer-Pietsch, Barbara M

    2002-01-01

    OBJECTIVE To investigate via the vitamin D status whether patients with peripheral arterial disease (PAD) tend to develop vitamin D deficiency that in turn influences their clinical symptoms. DESIGN Cross-sectional. SETTING University hospital. PATIENTS AND PARTICIPANTS Three hundred twenty-seven patients were evaluated; subjects with secondary causes of bone disease or bone active medication were excluded. One hundred sixty-one patients with either PAD stage II (n = 84) or stage IV (n = 77) were enrolled and compared to 45 age- and sex-matched healthy controls. MEASUREMENTS AND MAIN RESULTS All patients underwent determinations of serum chemistry, 25-hydroxyvitamin D (vitamin D3) intact parathyroid hormone (iPTH), alkaline phosphatase (ALP), and osteocalcin and were further stratified according to an individual restriction score into 3 groups: mildly, moderately, or severely restricted in daily life due to the underlying disease. Patients with PAD IV showed significantly lower vitamin D3 (P = .0001), and calcium (P = .0001) values and significantly higher iPTH (P = .0001), osteocalcin (P = .0001) and ALP (P = .02) levels as compared to patients with PAD II. Patients considering themselves as severely restricted due to the underlying disease showed lower vitamin D3 and higher iPTH levels than those who described only a moderate (vitamin D3: P < .001; iPTH: P < .01) or mild (vitamin D3: P < .001; iPTH: P < .001) restriction in daily life. CONCLUSION Patients with PAD IV, especially those who feel severely restricted due to the disease, are at high risk of developing vitamin D deficiency, secondary hyperparathyroidism, and ultimately osteomalacia due to immobilization and subsequent lack of exposure to sunlight, all of which in turn lead to further deterioration. Monitoring of vitamin D metabolism and vitamin D replacement therapy could be a simple, inexpensive approach to mitigating clinical symptoms and improving quality of life in patients with advanced PAD. PMID:12220361

  5. Genetics Home Reference: familial porencephaly

    MedlinePlus

    ... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  6. A type IV burst associated with a coronal streamer disruption event

    NASA Technical Reports Server (NTRS)

    Kundu, M. R.

    1987-01-01

    A type IV burst was observed on February 17, 1985 with the Clark Lake Radio Observatory multifrequency radioheliograph operating in the frequency range 20-125 MHz. This burst was associated with a coronal streamer disruption event. From two-dimensional images produced at 50 MHz, evidence of a type II burst and a slow moving type IV burst are shown. The observations of the moving type IV burst suggests that a plasmoid containing energetic electrons can result from the disruption of a coronal streamer.

  7. 40 CFR 1065.695 - Data requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... restriction. (v) Charge air cooler volume. (vi) Charge air cooler outlet temperature, specified engine.... (iii) “Dry-to-wet” correction. (iv) NMHC, CH4, and contamination correction. (v) NOX humidity...

  8. Right ventricular and pulmonary arterial dimensions in adults with osteogenesis imperfecta.

    PubMed

    Radunovic, Zoran; Wekre, Lena L; Steine, Kjetil

    2012-06-15

    We examined right ventricular (RV) and ascending pulmonary artery (PA1) dimensions in adults with osteogenesis imperfecta (OI). The survey included 99 adults with OI divided in 3 clinical types (I, III, and IV) and 52 controls. RV and PA1 dimensions were measured by echocardiography and indexed for body surface area. Scoliosis was registered, and spirometry was performed in 75 patients with OI. All RV dimensions indexed by body surface area were significantly larger in the OI group compared to controls (RV basal dimension 1.9 ± 0.5 vs 1.7 ± 0.3 cm/m(2), p <0.05; RV midcavity dimension 1.7 ± 0.5 vs 1.5 ± 0.3 cm/m(2), p <0.05; RV longitudinal dimension 4.3 ± 1.1 vs 4.0 ± 0.9 cm/m(2), p <0.05). RV outflow tract (RVOT) proximal diameter (1.8 ± 0.4 vs 1.5 ± 0.2 cm/m(2), p <0.05), RVOT distal diameter (1.2 ± 0.2 vs 1.0 ± 0.1 cm/m(2), p <0.05), and PA1 (1.2 ± 0.3 vs 1.0 ± 0.2 cm/m(2), p <0.05) were also significantly larger in the OI group. Furthermore, all RV dimensions and PA1 were significantly larger in patients with OI type III compared to patients with OI types I and IV and controls. There were no differences in RV, RVOT, or PA1 dimensions between patients presenting a restrictive ventilatory pattern (n = 11) and patients a normal ventilatory pattern. Scoliosis was registered in 42 patients. Patients with OI type III had greater RV and PA1 dimensions compared to controls and patients with OI types I and IV. Impaired ventilatory patterns and scoliosis did not have any impact on RV dimensions in these patients. In conclusion, patients with OI had increased RV and PA1 dimensions compared to the control group. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Modulation of caspases and their non-apoptotic functions by Legionella pneumophila.

    PubMed

    Amer, Amal O

    2010-02-01

    Legionella pneumophila has become a model system to decipher the non-apoptotic functions of caspases and their role in immunity. In permissive cells, the L. pneumophila-containing vacuole evades endosomal traffic and is remodelled by the endoplasmic reticulum. Evasion of the endosomes is mediated by the Dot/Icm type IV secretion system. Upon L. pneumophila infection of genetically restrictive cells such as wild-type (WT) C57Bl/6J murine macrophages, flagellin is sensed by the NOD-like receptor Nlrc4 leading to caspase-1 activation by the inflammasome complex. Then, caspase-7 is activated downstream of the Nlrc4 inflammasome, promoting non-apoptotic functions such as L. pneumophila-containing phagosome maturation and bacterial degradation. Interestingly, caspase-3 is activated in permissive cells during early stages of infection. However, caspase-3 activation does not lead to apoptosis until late stages of infection because it is associated with potent Dot/Icm-mediated anti-apoptotic stimuli that render the infected cells resistant to external apoptotic inducers. Therefore, the role of caspase-1 and non-apoptotic functions of executioner caspases are temporally and spatially modulated during infection by L. pneumophila, which determine permissiveness to intracellular bacterial proliferation. This review will examine the novel activation pathways of caspases by L. pneumophila and discuss their role in genetic restriction and permissiveness to infection.

  10. Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

    MedlinePlus

    ... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

  11. viking: identification and characterization of a second type IV collagen in Drosophila.

    PubMed

    Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

    1997-10-01

    We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

  12. Restriction and Sequence Alterations Affect DNA Uptake Sequence-Dependent Transformation in Neisseria meningitidis

    PubMed Central

    Ambur, Ole Herman; Frye, Stephan A.; Nilsen, Mariann; Hovland, Eirik; Tønjum, Tone

    2012-01-01

    Transformation is a complex process that involves several interactions from the binding and uptake of naked DNA to homologous recombination. Some actions affect transformation favourably whereas others act to limit it. Here, meticulous manipulation of a single type of transforming DNA allowed for quantifying the impact of three different mediators of meningococcal transformation: NlaIV restriction, homologous recombination and the DNA Uptake Sequence (DUS). In the wildtype, an inverse relationship between the transformation frequency and the number of NlaIV restriction sites in DNA was observed when the transforming DNA harboured a heterologous region for selection (ermC) but not when the transforming DNA was homologous with only a single nucleotide heterology. The influence of homologous sequence in transforming DNA was further studied using plasmids with a small interruption or larger deletions in the recombinogenic region and these alterations were found to impair transformation frequency. In contrast, a particularly potent positive driver of DNA uptake in Neisseria sp. are short DUS in the transforming DNA. However, the molecular mechanism(s) responsible for DUS specificity remains unknown. Increasing the number of DUS in the transforming DNA was here shown to exert a positive effect on transformation. Furthermore, an influence of variable placement of DUS relative to the homologous region in the donor DNA was documented for the first time. No effect of altering the orientation of DUS was observed. These observations suggest that DUS is important at an early stage in the recognition of DNA, but does not exclude the existence of more than one level of DUS specificity in the sequence of events that constitute transformation. New knowledge on the positive and negative drivers of transformation may in a larger perspective illuminate both the mechanisms and the evolutionary role(s) of one of the most conserved mechanisms in nature: homologous recombination. PMID:22768309

  13. 21 CFR 516.1684 - Paclitaxel.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ..., IV, or V mammary carcinoma in dogs that have not received previous chemotherapy or radiotherapy. For... previous chemotherapy or radiotherapy. (3) Limitations. Federal law restricts this drug to use by or on the...

  14. 21 CFR 520.1780 - Pimobendan.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... severe (modified New York Heart Association Class II, III, or IV) congestive heart failure due to... heart failure as appropriate on a case-by-case basis. (3) Limitations. Federal law restricts this drug...

  15. 40 CFR 1065.695 - Data requirements.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... restriction. (v) Charge air cooler volume. (vi) Charge air cooler outlet temperature, specified engine... following: (i) Drift correction. (ii) Noise correction. (iii) “Dry-to-wet” correction. (iv) NMHC, CH4, and...

  16. 40 CFR 1065.695 - Data requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... restriction. (v) Charge air cooler volume. (vi) Charge air cooler outlet temperature, specified engine... following: (i) Drift correction. (ii) Noise correction. (iii) “Dry-to-wet” correction. (iv) NMHC, CH4, and...

  17. 40 CFR 1065.695 - Data requirements.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... restriction. (v) Charge air cooler volume. (vi) Charge air cooler outlet temperature, specified engine... following: (i) Drift correction. (ii) Noise correction. (iii) “Dry-to-wet” correction. (iv) NMHC, CH4, and...

  18. 21 CFR 520.1780 - Pimobendan.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... severe (modified New York Heart Association Class II, III, or IV) congestive heart failure due to... heart failure as appropriate on a case-by-case basis. (3) Limitations. Federal law restricts this drug...

  19. 21 CFR 520.1780 - Pimobendan.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... severe (modified New York Heart Association Class II, III, or IV) congestive heart failure due to... heart failure as appropriate on a case-by-case basis. (3) Limitations. Federal law restricts this drug...

  20. 21 CFR 520.1780 - Pimobendan.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... severe (modified New York Heart Association Class II, III, or IV) congestive heart failure due to... heart failure as appropriate on a case-by-case basis. (3) Limitations. Federal law restricts this drug...

  1. 21 CFR 520.1780 - Pimobendan.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... severe (modified New York Heart Association Class II, III, or IV) congestive heart failure due to... heart failure as appropriate on a case-by-case basis. (3) Limitations. Federal law restricts this drug...

  2. Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

    PubMed Central

    Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

    1994-01-01

    Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

  3. Linkage mapping of a mouse gene, iv, that controls left-right asymmetry of the heart and viscera.

    PubMed Central

    Brueckner, M; D'Eustachio, P; Horwich, A L

    1989-01-01

    Inherited single gene defects have been identified in both humans and mice that lead to loss of developmental control over the left-right asymmetry of the heart and viscera. In mice the recessively inherited mutation iv leads to such apparent loss of control over situs: 50% of iv/iv mice exhibit situs inversus and 50% exhibit normal situs. The affected gene product has not been identified in these animals. To study the normal function of iv, we have taken an approach directed to the gene itself. As a first step, we have mapped iv genetically, by examining its segregation in backcrosses with respect to markers defined by restriction fragment length polymorphisms. The iv locus lies 3 centimorgans (cM) from the immunoglobulin heavy-chain constant-region gene complex (Igh-C) on chromosome 12. A multilocus map of the region suggests the gene order centromere-Aat (alpha 1-antitrypsin gene complex)-(11 cM)-iv-(3 cM)-Igh-C-(1 cM)-Igh-V (immunoglobulin heavy-chain variable-region gene complex). Images PMID:2740340

  4. Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

    MedlinePlus

    ... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  5. [Infant botulism].

    PubMed

    Falk, Absalom; Afriat, Amichay; Hubary, Yechiel; Herzog, Lior; Eisenkraft, Arik

    2014-01-01

    Infant botulism is a paralytic syndrome which manifests as a result of ingesting spores of the toxin secreting bacterium Clostridium botulinum by infants. As opposed to botulism in adults, treating infant botulism with horse antiserum was not approved due to several safety issues. This restriction has led to the development of Human Botulism Immune Globulin Intravenous (BIG-IV; sells under BabyBIG). In this article we review infant botulism and the advantages of treating it with BIG-IV.

  6. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

    PubMed Central

    Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

    2014-01-01

    Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM. PMID:26069692

  7. Differential expression of extracellular matrix molecules and the alpha 6-integrins in the normal and neoplastic prostate.

    PubMed Central

    Knox, J. D.; Cress, A. E.; Clark, V.; Manriquez, L.; Affinito, K. S.; Dalkin, B. L.; Nagle, R. B.

    1994-01-01

    The epithelial basal lamina composition and integrin expression profile of normal and neoplastic human prostate was characterized using immunohistochemical analysis of frozen samples. The major components of the basal lamina surrounding normal acini were laminin, type IV collagen, entactin, and type VII collagen with variable amounts of tenascin. The basal lamina of neoplastic acini had a similar composition, except for the loss of type VII collagen, which was observed in all grades of carcinoma. The basal cells of the normal prostate express the alpha 6-, beta 1-, and beta 4-integrin subunits, suggesting that both the alpha 6 beta 1- and alpha 6 beta 4-integrin complexes are formed. In prostate carcinoma there is a complete loss of beta 4 expression and the alpha 6- and beta 1-integrin subunits, which are restricted to the basal and basal lateral surfaces of basal cells, are distributed diffusely throughout the cytoplasmic membrane. The differential expression of type VII collagen and beta 4 are discussed in relationship to their possible role in tumor progression. Images Figure 1 Figure 2 Figure 3 PMID:8030747

  8. Summary of Resource Conservation and Recovery Act State Authorization Rule Checklist 179

    EPA Pesticide Factsheets

    Land Disposal Restrictions -- Phase IV: Treatment Standards for Wood Preserving Wastes, Treatment Standards for Metal Wastes, Zinc Micronutrient Fertilizers, Carbamate Treatment Standards, and K088 Treatment Standards

  9. Vapor Grown Perovskite Solar Cells

    NASA Astrophysics Data System (ADS)

    Abdussamad Abbas, Hisham

    Perovskite solar cells has been the fastest growing solar cell material till date with verified efficiencies of over 22%. Most groups in the world focuses their research on solution based devices that has residual solvent in the material bulk. This work focuses extensively on the fabrication and properties of vapor based perovskite devices that is devoid of solvents. The initial part of my work focuses on the detailed fabrication of high efficiency consistent sequential vapor NIP devices made using P3HT as P-type Type II heterojunction. The sequential vapor devices experiences device anomalies like voltage evolution and IV hysteresis owing to charge trapping in TiO2. Hence, sequential PIN devices were fabricated using doped Type-II heterojunctions that had no device anomalies. The sequential PIN devices has processing restriction, as organic Type-II heterojunction materials cannot withstand high processing temperature, hence limiting device efficiency. Thereby bringing the need of co-evaporation for fabricating high efficiency consistent PIN devices, the approach has no-restriction on substrates and offers stoichiometric control. A comprehensive description of the fabrication, Co-evaporator setup and how to build it is described. The results of Co-evaporated devices clearly show that grain size, stoichiometry and doped transport layers are all critical for eliminating device anomalies and in fabricating high efficiency devices. Finally, Formamidinium based perovskite were fabricated using sequential approach. A thermal degradation study was conducted on Methyl Ammonium Vs. Formamidinium based perovskite films, Formamidinium based perovskites were found to be more stable. Lastly, inorganic films such as CdS and Nickel oxide were developed in this work.

  10. Low-protein diet supplemented with ketoacids reduces the severity of renal disease in 5/6 nephrectomized rats: a role for KLF15.

    PubMed

    Gao, Xiang; Huang, Lianghu; Grosjean, Fabrizio; Esposito, Vittoria; Wu, Jianxiang; Fu, Lili; Hu, Huimin; Tan, Jiangming; He, Cijian; Gray, Susan; Jain, Mukesh K; Zheng, Feng; Mei, Changlin

    2011-05-01

    Dietary protein restriction is an important treatment for chronic kidney disease. Herein, we tested the effect of low-protein or low-protein plus ketoacids (KA) diet in a remnant kidney model. Rats with a remnant kidney were randomized to receive normal protein diet (22%), low-protein (6%) diet (LPD), or low-protein (5%) plus KA (1%) diet for 6 months. Protein restriction prevented proteinuria, decreased blood urea nitrogen levels, and renal lesions; however, the LPD retarded growth and decreased serum albumin levels. Supplementation with KA corrected these abnormalities and provided superior renal protection compared with protein restriction alone. The levels of Kruppel-like factor-15 (KLF15), a transcription factor shown to reduce cardiac fibrosis, were decreased in remnant kidneys. Protein restriction, which increased KLF15 levels in the normal kidney, partially recovered the levels of KLF15 in remnant kidney. The expression of KLF15 in mesangial cells was repressed by oxidative stress, transforming growth factor-β, and tumor necrosis factor (TNF)-α. The suppressive effect of TNF-α on KLF15 expression was mediated by TNF receptor-1 and nuclear factor-κB. Overexpression of KLF15 in mesangial and HEK293 cells significantly decreased fibronectin and type IV collagen mRNA levels. Furthermore, KLF15 knockout mice developed glomerulosclerosis following uninephrectomy. Thus, KLF15 may be an antifibrotic factor in the kidney, and its decreased expression may contribute to the progression of kidney disease.

  11. The evidence for clumpy accretion in the Herbig Ae star HR 5999

    NASA Technical Reports Server (NTRS)

    Perez, M. R.; Grady, C. A.; The, P. S.

    1993-01-01

    Analysis of IUE high- and low-dispersion spectra of the young Herbig Ae star HR 5999 (HD 144668) covering 1978-1992 revealed dramatic changes in the Mg II h and k (2795.5, 2802.7 A) emission profiles, changes in the column density and distribution in radial velocity of accreting gas, and flux in the Ly(alpha), O I, and C IV emission lines, which are correlated with the UV excess luminosity. Variability in the spectral type inferred from the UV spectral energy distribution, ranging from A5 IV-III in high state to A7 III in the low state, was also observed. The trend of earlier inferred spectral type with decreasing wavelength and with increasing UV continuum flux has previously been noted as a signature of accretion disks in lower mass pre-main sequence stars (PMS) and in systems undergoing FU Orionis-type outbursts. Our data represent the first detection of similar phenomena in an intermediate mass (M greater than or equal to 2 solar mass) PMS star. Recent IUE spectra show gas accreting toward the star with velocities as high as plus 300 km/s, much as is seen toward beta Pic, and suggest that we also view this system through the debris disk. The absence of UV lines with the rotational broadening expected given the optical data (A7 IV, V sini=180 plus or minus 20 km/s for this system) also suggests that most of the UV light originates in the disk, even in the low continuum state. The dramatic variability in the column density of accreting gas, is consistent with clumpy accretion, such as has been observed toward beta Pic, is a hallmark of accretion onto young stars, and is not restricted to the clearing phase, since detectable amounts of accretion are present for stars with 0.5 Myr less than t(sub age) less than 2.8 Myr. The implications for models of beta Pic and similar systems are briefly discussed.

  12. Delivery of two-step transcription amplification exendin-4 plasmid system with arginine-grafted bioreducible polymer in type 2 diabetes animal model

    PubMed Central

    Kim, Pyung-Hwan; Lee, Minhyung; Kim, Sung Wan

    2012-01-01

    Exendin-4, glucagon-like peptide 1 (GLP-1) receptor agonist, is an exocrine hormone, which has potent insulinotropic actions similar to GLP-1 such as stimulating insulin biosynthesis, facilitating glucose-concentration dependent insulin secretion, slowing gastric emptying, reducing food intake and stimulating β-cell proliferation. Exendin-4, also, has a longer half-life than GLP-1, due to itsresistance to degradation by dipeptidyl peptidase IV (DPP-IV). In spite of its many advantages as a therapeutic agent for diabetes, its clinical application is still restricted. Thus, to improve the activity of exendin-4 in vivo, gene therapy system was developed as an alternative method. An exendin-4 expression system was constructed using the two-step transcription amplification (TSTA) system, which is composed of pβ-Gal4-p65 and pUAS-SP-exendin-4 with combining the advantages of signal peptide (SP) in order to facilitate its secretion in ectopic cells or tissue. Arginine-grafted cyctaminebisacrylamide-diaminohexane polymer (ABP) was used as a gene carrier. Increased expression of exendin-4, glucose dependent insulin secretion in NIT-1 insulinoma cells, and high insulin expression in the presence of DPP-IV were evaluated in vitro after delivery of ABP/TSTA-SP-exendin-4. Blood glucose levels in diabetic mice were decreased dramatically from the third day for experimental period after single intravenous administration with ABP/TSTA-SP-exendin-4. The highest insulinotropic effect of exendin-4 was also observed in the ABP/TSTA/SP-exendin-4-treated mice groups, compared with the others groups from the 3rd day after injection. TSTA exendin-4 expression system with SP and ABP polymer has a potential gene therapy for the treatment of type 2 diabetes. PMID:22705459

  13. Comparative analyses of Xanthomonas and Xylella complete genomes.

    PubMed

    Moreira, Leandro M; De Souza, Robson F; Digiampietri, Luciano A; Da Silva, Ana C R; Setubal, João C

    2005-01-01

    Computational analyses of four bacterial genomes of the Xanthomonadaceae family reveal new unique genes that may be involved in adaptation, pathogenicity, and host specificity. The Xanthomonas genus presents 3636 unique genes distributed in 1470 families, while Xylella genus presents 1026 unique genes distributed in 375 families. Among Xanthomonas-specific genes, we highlight a large number of cell wall degrading enzymes, proteases, and iron receptors, a set of energy metabolism genes, second copy of the type II secretion system, type III secretion system, flagella and chemotactic machinery, and the xanthomonadin synthesis gene cluster. Important genes unique to the Xylella genus are an additional copy of a type IV pili gene cluster and the complete machinery of colicin V synthesis and secretion. Intersections of gene sets from both genera reveal a cluster of genes homologous to Salmonella's SPI-7 island in Xanthomonas axonopodis pv citri and Xylella fastidiosa 9a5c, which might be involved in host specificity. Each genome also presents important unique genes, such as an HMS cluster, the kdgT gene, and O-antigen in Xanthomonas axonopodis pv citri; a number of avrBS genes and a distinct O-antigen in Xanthomonas campestris pv campestris, a type I restriction-modification system and a nickase gene in Xylella fastidiosa 9a5c, and a type II restriction-modification system and two genes related to peptidoglycan biosynthesis in Xylella fastidiosa temecula 1. All these differences imply a considerable number of gene gains and losses during the divergence of the four lineages, and are associated with structural genome modifications that may have a direct relation with the mode of transmission, adaptation to specific environments and pathogenicity of each organism.

  14. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    PubMed Central

    Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph

    2013-01-01

    The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993

  15. Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

    PubMed Central

    Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

    2011-01-01

    Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

  16. Refeeding syndrome in a young woman with argininosuccinate lyase deficiency.

    PubMed

    Stuy, M; Chen, G-F; Masonek, J M; Scharschmidt, B F

    2015-09-01

    A severely chronically protein and calorie restricted young woman with argininosuccinate lyase deficiency developed transient refeeding syndrome (RFS) and hyperammonemia after modest diet liberalization following initiation of glycerol phenylbutyrate (GPB). The patient required IV supportive care and supplementation with potassium, magnesium and calcium. She is now doing well on GPB and an appropriate maintenance diet. Susceptibility to RFS should be considered in chronically nutritionally restricted patients with metabolic disorders after liberalization of diet.

  17. Consensus in controversy: The modified Delphi method applied to Gynecologic Oncology practice.

    PubMed

    Cohn, David E; Havrilesky, Laura J; Osann, Kathryn; Lipscomb, Joseph; Hsieh, Susie; Walker, Joan L; Wright, Alexi A; Alvarez, Ronald D; Karlan, Beth Y; Bristow, Robert E; DiSilvestro, Paul A; Wakabayashi, Mark T; Morgan, Robert; Mukamel, Dana B; Wenzel, Lari

    2015-09-01

    To determine the degree of consensus regarding the probabilities of outcomes associated with IP/IV and IV chemotherapy. A survey was administered to an expert panel using the Delphi method. Ten ovarian cancer experts were asked to estimate outcomes for patients receiving IP/IV or IV chemotherapy. The clinical estimates were: 1) probability of completing six cycles of chemotherapy, 2) probability of surviving five years, 3) median survival, and 4) probability of ER/hospital visits during treatment. Estimates for two patients, one with a low comorbidity index (patient 1) and the other with a moderate index (patient 2), were included. The survey was administered in three rounds, and panelists could revise their subsequent responses based on review of the anonymous opinions of their peers. The ranges were smaller for IV compared with IP/IV therapy. Ranges decreased with each round. Consensus converged around outcomes related to IP/IV chemotherapy for: 1) completion of 6 cycles of therapy (type 1 patient, 62%, type 2 patient, 43%); 2) percentage of patients surviving 5 years (type 1 patient, 66%, type 2 patient, 47%); and 3) median survival (type 1 patient, 83 months, type 2 patient, 58 months). The group required three rounds to achieve consensus on the probabilities of ER/hospital visits (type 1 patient, 24%, type 2 patient, 35%). Initial estimates of survival and adverse events associated with IP/IV chemotherapy differ among experts. The Delphi process works to build consensus and may be a pragmatic tool to inform patients of their expected outcomes. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

    PubMed

    Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

    2018-07-01

    Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  19. Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

    PubMed

    Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

    2013-03-01

    The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

  20. The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

    2010-04-20

    Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

  1. Type-IV antifreeze proteins are essential for epiboly and convergence in gastrulation of zebrafish embryos.

    PubMed

    Xiao, Qing; Xia, Jian-Hong; Zhang, Xiao-Juan; Li, Zhi; Wang, Yang; Zhou, Li; Gui, Jian-Fang

    2014-01-01

    Many organisms in extremely cold environments such as the Antarctic Pole have evolved antifreeze molecules to prevent ice formation. There are four types of antifreeze proteins (AFPs). Type-IV antifreeze proteins (AFP4s) are present also in certain temperate and even tropical fish, which has raised a question as to whether these AFP4s have important functions in addition to antifreeze activity. Here we report the identification and functional analyses of AFP4s in cyprinid fish. Two genes, namely afp4a and afp4b coding for AFP4s, were identified in gibel carp (Carassius auratus gibelio) and zebrafish (Danio rerio). In both species, afp4a and afp4b display a head-to-tail tandem arrangement and share a common 4-exonic gene structure. In zebrafish, both afp4a and afp4b were found to express specifically in the yolk syncytial layer (YSL). Interestingly, afp4a expression continues in YSL and digestive system from early embryos to adults, whereas afp4b expression is restricted to embryogenesis. Importantly, we have shown by using afp4a-specific and afp4b-specifc morpholino knockdown and cell lineage tracing approaches that AFP4a participates in epiboly progression by stabilizing yolk cytoplasmic layer microtubules, and AFP4b is primarily related to convergence movement. Therefore, both AFP4 proteins are essential for gastrulation of zebrafish embryos. Our current results provide first evidence that AFP such as AFP4 has important roles in regulating developmental processes besides its well-known function as antifreeze factors.

  2. 12 CFR 325.105 - Mandatory and discretionary supervisory actions under section 38.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... this subpart (section 38(e)(2)); (iv) Restricting the growth of the bank's assets (section 38(e)(3... in the usual course of business, including any investment, expansion, acquisition, sale of assets, or...

  3. Essential core of the Hawking–Ellis types

    NASA Astrophysics Data System (ADS)

    Martín-Moruno, Prado; Visser, Matt

    2018-06-01

    The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

  4. Refeeding syndrome in a young woman with argininosuccinate lyase deficiency☆

    PubMed Central

    Stuy, M.; Chen, G.-F.; Masonek, J.M.; Scharschmidt, B.F.

    2015-01-01

    A severely chronically protein and calorie restricted young woman with argininosuccinate lyase deficiency developed transient refeeding syndrome (RFS) and hyperammonemia after modest diet liberalization following initiation of glycerol phenylbutyrate (GPB). The patient required IV supportive care and supplementation with potassium, magnesium and calcium. She is now doing well on GPB and an appropriate maintenance diet. Susceptibility to RFS should be considered in chronically nutritionally restricted patients with metabolic disorders after liberalization of diet. PMID:26937403

  5. Observational properties of decameter type IV bursts

    NASA Astrophysics Data System (ADS)

    Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

    2013-04-01

    Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

  6. Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

    PubMed

    Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

    2007-01-01

    Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

  7. Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

    PubMed

    Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

    2014-01-01

    Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

    PubMed

    Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

    2017-08-01

    SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

  9. Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

    PubMed Central

    Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

    2009-01-01

    Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

  10. Soil quality succession of mudflat in coastal area of China under different types of man-made land uses

    NASA Astrophysics Data System (ADS)

    Lu, Haiying; Shao, Hongbo; Xu, Zhaolong; Peng, Cheng

    2017-04-01

    Marshy reclamation in coastal area is becoming an important strategy for food safety security and economic development in China. After the reclamation of mudflat, the nutrient concentration in soil is one of the dominated factors restricting the development of marshy agriculture. However, little information is available for soil nutrient dynamics and its driving mechanisms under different types of man-made land uses. In this review, we summarized the soil nutrient dynamics under different types of man-made land uses (bare mudflat soil, rice-wheat rotation soil, aquaculture soil, and forest soil), including the change of physical and chemical features of the reclaimed soil; ii) the dynamics of soil organic matters and its driving mechanism in marshy land; iii) the migration of N, P, and K in marshy soil; and iv) the oriented cultivation and improvement for soil nutrient in marshy soil. This study contributes not only to understanding the soil nutrient cycling in marshy land, but also to providing valuable information for the sustainable development of salt-soil agriculture in marshy land along seaside cities of China.

  11. Regulation profiles of e-cigarettes in the United States: a critical review with qualitative synthesis.

    PubMed

    Tremblay, Marie-Claude; Pluye, Pierre; Gore, Genevieve; Granikov, Vera; Filion, Kristian B; Eisenberg, Mark J

    2015-06-03

    Electronic cigarettes (e-cigarettes) have been steadily increasing in popularity since their introduction to US markets in 2007. Debates surrounding the proper regulatory mechanisms needed to mitigate potential harms associated with their use have focused on youth access, their potential for nicotine addiction, and the renormalization of a smoking culture. The objective of this study was to describe the enacted and planned regulations addressing this novel public health concern in the US. We searched LexisNexis Academic under Federal Regulations and Registers, as well as State Administrative Codes and Registers. This same database was also used to find information about planned regulations in secondary sources. The search was restricted to US documents produced between January 1(st), 2004, and July 14(th), 2014. We found two planned regulations at the federal level, and 74 enacted and planned regulations in 44 states. We identified six state-based regulation types, including i) access, ii) usage, iii) marketing and advertisement, iv) packaging, v) taxation, and vi) licensure. These were further classified into 10 restriction subtypes: sales, sale to minors, use in indoor public places, use in limited venues, use by minors, licensure, marketing and advertising, packaging, and taxation. Most enacted restrictions aimed primarily to limit youth access, while few regulations enforced comprehensive restrictions on product use and availability. Current regulations targeting e-cigarettes in the US are varied in nature and scope. There is greater consensus surrounding youth protection (access by minors and/or use by minors, and/or use in limited venues), with little consensus on multi-level regulations, including comprehensive use bans in public spaces.

  12. Secretion of TcpF by the Vibrio cholerae Toxin-Coregulated Pilus Biogenesis Apparatus Requires an N-Terminal Determinant

    PubMed Central

    Megli, Christina J.

    2013-01-01

    Type IV pili are important for microcolony formation, biofilm formation, twitching motility, and attachment. We and others have shown that type IV pili are important for protein secretion across the outer membrane, similar to type II secretion systems. This study explored the relationship between protein secretion and pilus formation in Vibrio cholerae. The toxin-coregulated pilus (TCP), a type IV pilus required for V. cholerae pathogenesis, is necessary for the secretion of the colonization factor TcpF (T. J. Kirn, N. Bose, and R. K. Taylor, Mol. Microbiol. 49:81–92, 2003). This phenomenon is not unique to V. cholerae; secreted virulence factors that are dependent on the presence of components of the type IV pilus biogenesis apparatus for secretion have been reported with Dichelobacter nodosus (R. M. Kennan, O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I. Rood, J. Bacteriol. 183:4451–4458, 2001) and Francisella tularensis (A. J. Hager et al., Mol. Microbiol. 62:227–237, 2006). Using site-directed mutagenesis, we demonstrated that the secretion of TcpF is dependent on the presence of selected amino acid R groups at position five. We were unable to find other secretion determinants, suggesting that Y5 is the major secretion determinant within TcpF. We also report that proteins secreted in a type IV pilus biogenesis apparatus-dependent manner have a YXS motif within the first 15 amino acids following the Sec cleavage site. The YXS motif is not present in proteins secreted by type II secretion systems, indicating that this is unique to type IV pilus-mediated secretion. Moreover, we show that TcpF interacts with the pilin TcpA, suggesting that these proteins are secreted by the type IV pilus biogenesis system. These data provide a starting point for understanding how type IV pili can mediate secretion of virulence factors important for bacterial pathogenesis. PMID:23564177

  13. Gross Instability After Hip Arthroscopy: An Analysis of Case Reports Evaluating Surgical and Patient Factors.

    PubMed

    Yeung, Marco; Memon, Muzammil; Simunovic, Nicole; Belzile, Etienne; Philippon, Marc J; Ayeni, Olufemi R

    2016-06-01

    Gross hip instability is a rare complication after hip arthroscopy, and there is limited literature surrounding this topic. This systematic review investigates cases of gross hip instability after arthroscopy and discusses the risk factors associated with this complication. A systematic search was performed in duplicate for studies investigating gross hip instability after hip arthroscopy up to October 2015. Study parameters including sample size, mechanism and type of dislocation, surgical procedure details, patient characteristics, postoperative rehabilitation protocol, and level of evidence were analyzed. The systematic review identified 9 case reports investigating gross hip instability after hip arthroscopy (10 patients). Anterior dislocation occurred in 66.7% of patients, and most injuries occurred with a low-energy mechanism. Common surgical factors cited included unrepaired capsulotomy (77.8%) and iliopsoas release (33.3%), whereas patient factors included female gender (77.8%), acetabular dysplasia (22.2%), and general ligamentous laxity (11.1%). Postoperative restrictions and protocols were variable and inconsistently reported, and their relation to post-arthroscopy instability was difficult to ascertain. This systematic review discussed various patient, surgical, and postoperative risk factors of gross hip instability after arthroscopy. Patient characteristics such as female gender, hip dysplasia, and ligamentous laxity may be risk factors for post-arthroscopy dislocation. Similarly, surgical risk factors for iatrogenic hip instability may include unrepaired capsulotomies and iliopsoas debridement, although the role of capsular closure in iatrogenic instability is not clear. The influences of postoperative restrictions and protocols on dislocation are also unclear in the current literature. Surgeons should be cognizant of these risk factors when performing hip arthroscopy and be mindful that these factors appear to occur in combination. Level IV, systematic review of Level IV studies. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  14. Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

    PubMed

    Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

    2015-06-16

    Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

  15. Military Psychology. Volume 9, Number 4, 1997. Effects of Chemical Protective Clothing on Military Performance

    DTIC Science & Technology

    1997-01-01

    restrict limb movement and impede tactile, visual, auditory , and olfactory functioning. When worn at the MOPP IV level, CPC becomes an encapsulated...gas mask. This index was less than the level of acceptability of voice communication of 75% (Bensel, 1997/this issue). This finding is of concern...because even the two voice resonators in the M40 facepiece, compared to one in the M17, do not produce quality speech. Restricted and optically

  16. Physiological and glycomic characterization of N-acetylglucosaminyltransferase-IVa and -IVb double deficient mice

    PubMed Central

    Takamatsu, Shinji; Antonopoulos, Aristotelis; Ohtsubo, Kazuaki; Ditto, David; Chiba, Yasunori; Le, Dzung T.; Morris, Howard R.; Haslam, Stuart M.; Dell, Anne; Marth, Jamey D.; Taniguchi, Naoyuki

    2010-01-01

    N-Acetylglucosaminyltransferase-IV (GnT-IV) has two isoenzymes, GnT-IVa and GnT-IVb, which initiate the GlcNAcβ1-4 branch synthesis on the Manα1-3 arm of the N-glycan core thereby increasing N-glycan branch complexity and conferring endogenous lectin binding epitopes. To elucidate the physiological significance of GnT-IV, we engineered and characterized GnT-IVb-deficient mice and further generated GnT-IVa/-IVb double deficient mice. In wild-type mice, GnT-IVa expression is restricted to gastrointestinal tissues, whereas GnT-IVb is broadly expressed among organs. GnT-IVb deficiency induced aberrant GnT-IVa expression corresponding to the GnT-IVb distribution pattern that might be attributed to increased Ets-1, which conceivably activates the Mgat4a promoter, and thereafter preserved apparent GnT-IV activity. The compensative GnT-IVa expression might contribute to amelioration of the GnT-IVb-deficient phenotype. GnT-IVb deficiency showed mild phenotypic alterations in hematopoietic cell populations and hemostasis. GnT-IVa/-IVb double deficiency completely abolished GnT-IV activity that resulted in the disappearance of the GlcNAcβ1-4 branch on the Manα1-3 arm that was confirmed by MALDI-TOF MS and GC-MS linkage analyses. Comprehensive glycomic analyses revealed that the abundance of terminal moieties was preserved in GnT-IVa/-IVb double deficiency that was due to the elevated expression of glycosyltransferases regarding synthesis of terminal moieties. Thereby, this may maintain the expression of glycan ligands for endogenous lectins and prevent cellular dysfunctions. The fact that the phenotype of GnT-IVa/-IVb double deficiency largely overlapped that of GnT-IVa single deficiency can be attributed to the induced glycomic compensation. This is the first report that mammalian organs have highly organized glycomic compensation systems to preserve N-glycan branch complexity. PMID:20015870

  17. Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

    USGS Publications Warehouse

    Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

    2005-01-01

    Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

  18. Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

    PubMed

    Zachariae, R; Bjerring, P; Arendt-Nielsen, L

    1989-11-01

    Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

  19. [The genotype analysis of glucose-6-phosphate dehydrogenase deficiency in Yunnan province].

    PubMed

    Yang, Z; Chu, J; Ban, G; Huang, X; Xu, S; Li, M

    2001-08-01

    To identify glucose-6-phosphate dehydrogenase (G6PD) gene mutations in 23 patients with G6PD deficiency and to gain further understanding of the molecular and genetic background of G6PD gene in Yunnan province, China. The mutations located in exons 2-12 and in parts of introns of G6PD gene were analyzed by amplification refractory mutation system(ARMS), natural and mis-match primer PCR/restrict enzyme, polymerase chain reaction-single strand conformation polymorphism(PCR-SSCP ) analysis and automatic DNA sequencing. Among these 23 samples, 5 different point mutations in G6PD gene were identified, and they constituted 5 genotypes. There were 7 Han and 3 Dai patients with G487A mutation, 7 cases with both intron 11 T93C and C1311T mutations, 4 cases with intron 5 636 or 637 T-->del mutation, 1 case with G871A mutation, and 1 case with G487A/T93C/C1311T mutation. Two haplotypes, 93C/1311T and 93C/1311T/487A were identified in Yunnan. A strong association was observed between C1311T and the Nla III restriction site produced by intron 11 T93C. The findings of the investigators on IVS-5 636 or 637T-->del in Chinese, on G871A in mainland of China, and on G487A in the Han people of Yunnan have not been reported previously. G6PD deficiency is very heterogenous in Yunnan; G487A is one of the common mutations in that province and may be of different origins. Possibly IVS-11 T93C mutation is of non-African origin. IVS-11 T93C and C1311T might jointly result in G6PD deficiency. The above data on G6PD gene mutation types could be useful for clinical diagnosis, prevention of G6PD deficiency, and researches in the origin and migration of minorities in Yunnan or other regions.

  20. Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

    PubMed

    Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

    2018-05-30

    The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Hypermineralization and High Osteocyte Lacunar Density in Osteogenesis Imperfecta Type V Bone Indicate Exuberant Primary Bone Formation.

    PubMed

    Blouin, Stéphane; Fratzl-Zelman, Nadja; Glorieux, Francis H; Roschger, Paul; Klaushofer, Klaus; Marini, Joan C; Rauch, Frank

    2017-09-01

    In contrast to "classical" forms of osteogenesis imperfecta (OI) types I to IV, caused by a mutation in COL1A1/A2, OI type V is due to a gain-of-function mutation in the IFITM5 gene, encoding the interferon-induced transmembrane protein 5, or bone-restricted interferon-inducible transmembrane (IFITM)-like protein (BRIL). Its phenotype distinctly differs from OI types I to IV by absence of blue sclerae and dentinogenesis imperfecta, by the occurrence of ossification disorders such as hyperplastic callus and forearm interosseous membrane ossification. Little is known about the impact of the mutation on bone tissue/material level in untreated and bisphosphonate-treated patients. Therefore, investigations of transiliac bone biopsy samples from a cohort of OI type V children (n = 15, 8.7 ± 4 years old) untreated at baseline and a subset (n = 8) after pamidronate treatment (2.6 years in average) were performed. Quantitative backscattered electron imaging (qBEI) was used to determine bone mineralization density distribution (BMDD) as well as osteocyte lacunar density. The BMDD of type V OI bone was distinctly shifted toward a higher degree of mineralization. The most frequently occurring calcium concentration (CaPeak) in cortical (Ct) and cancellous (Cn) bone was markedly increased (+11.5%, +10.4%, respectively, p < 0.0001) compared to healthy reference values. Treatment with pamidronate resulted in only a slight enhancement of mineralization. The osteocyte lacunar density derived from sectioned bone area was elevated in OI type V Ct and Cn bone (+171%, p < 0.0001; +183.3%, p < 0.01; respectively) versus controls. The high osteocyte density was associated with an overall immature primary bone structure ("mesh-like") as visualized by polarized light microscopy. In summary, the bone material from OI type V patients is hypermineralized, similar to other forms of OI. The elevated osteocyte lacunar density in connection with lack of regular bone lamellation points to an exuberant primary bone formation and an alteration of the bone remodeling process in OI type V. © 2017 American Society for Bone and Mineral Research. © 2017 American Society for Bone and Mineral Research.

  2. 48 CFR 252.209-7002 - Disclosure of ownership or control by a foreign government.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... unclassified keys; (iii) Restricted Data as defined in the U.S. Atomic Energy Act of 1954, as amended; (iv... following format: Offeror's Point of Contact for Questions about Disclosure (Name and Phone Number with...

  3. 50 CFR 21.52 - Public health control order for resident Canada geese.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... to human health. (c) What is a direct threat to human health? A direct threat to human health is one... use must comply with any labeling restrictions. (iv) Persons using shotguns must use nontoxic shot, as...

  4. 50 CFR 21.52 - Public health control order for resident Canada geese.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... to human health. (c) What is a direct threat to human health? A direct threat to human health is one... use must comply with any labeling restrictions. (iv) Persons using shotguns must use nontoxic shot, as...

  5. 50 CFR 21.52 - Public health control order for resident Canada geese.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... to human health. (c) What is a direct threat to human health? A direct threat to human health is one... use must comply with any labeling restrictions. (iv) Persons using shotguns must use nontoxic shot, as...

  6. 50 CFR 21.52 - Public health control order for resident Canada geese.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... to human health. (c) What is a direct threat to human health? A direct threat to human health is one... use must comply with any labeling restrictions. (iv) Persons using shotguns must use nontoxic shot, as...

  7. Inhibition of CD26/dipeptidyl peptidase IV enhances CCL11/eotaxin-mediated recruitment of eosinophils in vivo.

    PubMed

    Forssmann, Ulf; Stoetzer, Carsten; Stephan, Michael; Kruschinski, Carsten; Skripuletz, Thomas; Schade, Jutta; Schmiedl, Andreas; Pabst, Reinhard; Wagner, Leona; Hoffmann, Torsten; Kehlen, Astrid; Escher, Sylvia E; Forssmann, Wolf-Georg; Elsner, Jörn; von Hörsten, Stephan

    2008-07-15

    Chemokines mediate the recruitment of leukocytes to the sites of inflammation. N-terminal truncation of chemokines by the protease dipeptidyl peptidase IV (DPPIV) potentially restricts their activity during inflammatory processes such as allergic reactions, but direct evidence in vivo is very rare. After demonstrating that N-terminal truncation of the chemokine CCL11/eotaxin by DPPIV results in a loss of CCR3-mediated intracellular calcium mobilization and CCR3 internalization in human eosinophils, we focused on the in vivo role of CCL11 and provide direct evidence for specific kinetic and rate-determining effects by DPPIV-like enzymatic activity on CCL11-mediated responses of eosinophils. Namely, it is demonstrated that i.v. administration of CCL11 in wild-type F344 rats leads to mobilization of eosinophils into the blood, peaking at 30 min. This mobilization is significantly increased in DPPIV-deficient F344 rats. Intradermal administration of CCL11 is followed by a dose-dependent recruitment of eosinophils into the skin and is significantly more effective in DPPIV-deficient F344 mutants as well as after pharmacological inhibition of DPPIV. Interestingly, CCL11 application leads to an up-regulation of DPPIV, which is not associated with negative feedback inhibition via DPPIV-cleaved CCL11((3-74)). These findings demonstrate regulatory effects of DPPIV for the recruitment of eosinophils. Furthermore, they illustrate that inhibitors of DPPIV have the potential to interfere with chemokine-mediated effects in vivo including but not limited to allergy.

  8. Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

    PubMed

    Gulubova, M V

    1996-07-01

    Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

  9. Basement Membrane Defects in Genetic Kidney Diseases

    PubMed Central

    Chew, Christine; Lennon, Rachel

    2018-01-01

    The glomerular basement membrane (GBM) is a specialized structure with a significant role in maintaining the glomerular filtration barrier. This GBM is formed from the fusion of two basement membranes during development and its function in the filtration barrier is achieved by key extracellular matrix components including type IV collagen, laminins, nidogens, and heparan sulfate proteoglycans. The characteristics of specific matrix isoforms such as laminin-521 (α5β2γ1) and the α3α4α5 chain of type IV collagen are essential for the formation of a mature GBM and the restricted tissue distribution of these isoforms makes the GBM a unique structure. Detailed investigation of the GBM has been driven by the identification of inherited abnormalities in matrix proteins and the need to understand pathogenic mechanisms causing severe glomerular disease. A well-described hereditary GBM disease is Alport syndrome, associated with a progressive glomerular disease, hearing loss, and lens defects due to mutations in the genes COL4A3, COL4A4, or COL4A5. Other proteins associated with inherited diseases of the GBM include laminin β2 in Pierson syndrome and LMX1B in nail patella syndrome. The knowledge of these genetic mutations associated with GBM defects has enhanced our understanding of cell–matrix signaling pathways affected in glomerular disease. This review will address current knowledge of GBM-associated abnormalities and related signaling pathways, as well as discussing the advances toward disease-targeted therapies for patients with glomerular disease. PMID:29435440

  10. Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

    PubMed

    Wang, Chao; Zhai, Wanying; Shan, Baoqing

    2016-05-01

    Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

  11. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

    PubMed Central

    Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

    2014-01-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

  12. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

    PubMed

    Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

    2014-02-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

  13. A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

    PubMed

    Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

    2008-01-01

    To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

  14. Effects of long-term heat stress and dietary restriction on the expression of genes of steroidogenic pathway and small heat-shock proteins in rat testicular tissue.

    PubMed

    Bozkaya, F; Atli, M O; Guzeloglu, A; Kayis, S A; Yildirim, M E; Kurar, E; Yilmaz, R; Aydilek, N

    2017-08-01

    The aim was to investigate the effects of long-term heat stress and dietary restriction on the expression of certain genes involving in steroidogenic pathway and small heat-shock proteins (sHSPs) in rat testis. Sprague Dawley rats (n = 24) were equally divided into four groups. Group I and II were kept at an ambient temperature of 22°C, while Groups III and IV were reared at 38°C for 9 weeks. Feed was freely available for Group I and Group III, while Group II and Group IV were fed 60% of the diet consumed by their ad libitum counterparts. At the end of 9 weeks, testicles were collected under euthanasia. Total RNA was isolated from testis tissue samples. Expression profiles of the genes encoding androgen-binding protein, follicle-stimulating hormone receptor, androgen receptor, luteinising hormone receptor, steroidogenic acute regulatory protein (StAR), cyclooxygenase-2 and sHSP genes were assessed at mRNA levels using qPCR. Long-term heat stress decreased the expression of StAR and HspB10 genes while dietary restriction upregulated StAR gene expression. The results suggested that long-term heat stress negatively affected the expression of StAR and HspB10 genes and the dietary restriction was able to reverse negative effect of heat stress on the expression of StAR gene in rat testis. © 2016 Blackwell Verlag GmbH.

  15. Ultraviolet properties of IRAS-selected Be stars

    NASA Technical Reports Server (NTRS)

    Bjorkman, Karen S.; Snow, Theodore P.

    1988-01-01

    New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

  16. Genetics Home Reference: congenital insensitivity to pain with anhidrosis

    MedlinePlus

    ... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

  17. Collagen type IV at the fetal-maternal interface.

    PubMed

    Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

    2015-01-01

    Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  19. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  20. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  1. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Xiu-Li, E-mail: usually.158@163.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, No 169 Donghu Road, Wuchang District, Wuhan 430071; Peng, Chun-Wei, E-mail: pqc278@163.com

    Highlights: {yields} HER2 level is closely related to the biologic behaviors of breast cancer cells. {yields} A new method to simultaneously image HER2 and type IV collagen was established. {yields} HER2 status and type IV collagen degradation predict breast cancer invasion. {yields} The complex interactions between tumor and its environment were revealed. -- Abstract: It has been well recognized that human epidermal growth factor receptor 2 (HER2) level in breast cancer (BC) is closely related to the malignant biologic behaviors of the tumor, including invasion and metastasis. Yet, there has been a lack of directly observable evidence to support suchmore » notion. Here we report a quantum dots (QDs)-based double-color imaging technique to simultaneously show the HER2 level on BC cells and the type IV collagen in the tumor matrix. In benign breast tumor, the type IV collagen was intact. With the increasing of HER2 expression level, there has been a progressive decrease in type IV collagen around the cancer nest. At HER2 (3+) expression level, there has virtually been a total destruction of type IV collagen. Moreover, HER2 (3+) BC cells also show direct invasion into the blood vessels. This novel imaging method provides direct observable evidence to support the theory that the HER2 expression level is directly related to BC invasion.« less

  3. On the Directivity of Low-Frequency Type IV Radio Bursts

    NASA Technical Reports Server (NTRS)

    Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

    2016-01-01

    An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

  4. Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

    PubMed

    Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

    2012-06-01

    Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Monoanionic molybdenum and tungsten tris(dithiolene) complexes: a multifrequency EPR study.

    PubMed

    Sproules, Stephen; Banerjee, Priyabrata; Weyhermüller, Thomas; Yan, Yong; Donahue, James P; Wieghardt, Karl

    2011-08-01

    Numerous Mo and W tris(dithiolene) complexes in varying redox states have been prepared and representative examples characterized crystallographically: [M(S(2)C(2)R(2))(3)](z) [M = Mo, R = Ph, z = 0 (1) or 1- (2); M = W, R = Ph, z = 0 (4) or 1- (5); R = CN, z = 2-, M = Mo (3) or W (6)]. Changes in dithiolene C-S and C-C bond lengths for 1 versus 2 and 4 versus 5 are indicative of ligand reduction. Trigonal twist angles (Θ) and dithiolene fold angles (α) increase and decrease, respectively, for 2 versus 1, 5 versus 4. Cyclic voltammetry reveals generally two reversible couples corresponding to 0/1- and 1-/2- reductions. The electronic structures of monoanionic molybdenum tris(dithiolene) complexes have been analyzed by multifrequency (S-, X-, Q-band) EPR spectroscopy. Spin-Hamiltonian parameters afforded by spectral simulation for each complex demonstrate the existence of two distinctive electronic structure types. The first is [Mo(IV)((A)L(3)(5-•))](1-) ((A)L = olefinic dithiolene, type A), which has the unpaired electron restricted to the tris(dithiolene) unit and is characterized by isotropic g-values and small molybdenum superhyperfine coupling. The second is formulated as [Mo(V)((B)L(3)(6-))](1-) ((B)L = aromatic dithiolene, type B) with spectra distinguished by a prominent g-anisotropy and hyperfine coupling consistent with the (d(z(2)))(1) paramagnet. The electronic structure disparity is also manifested in their electronic absorption spectra. The compound [W(bdt)(3)](1-) exhibits spin-Hamiltonian parameters similar to those of [Mo(bdt)(3)](1-) and thus is formulated as [W(V)((B)L(3)(6-))](1-). The EPR spectra of [W((A)L(3))](1-) display spin-Hamiltonian parameters that suggest their electronic structure is best represented by two resonance forms {[W(IV)((A)L(3)(5-•))](1-) ↔ [W(V)((A)L(3)(6-))](1-)}. The contrast with the corresponding [Mo(IV)((A)L(3)(5-•))](1-) complexes highlights tungsten's preference for higher oxidation states. © 2011 American Chemical Society

  6. Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

    PubMed

    Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

    2007-01-01

    Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

  7. Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

    PubMed

    Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

    2015-04-02

    Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

  8. 76 FR 18073 - Track Safety Standards; Concrete Crossties

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-01

    ... metrics would be undesirable and restrict certain fastener assembly designs and capabilities to control... Track Safety Standards Working Group IV. FRA's Approach to Concrete Crossties A. Rail Cant B. Automated... and non-compliant track geometry can cause high- concentrated non-uniform dynamic loading, usually...

  9. 48 CFR 3006.303-270 - Content.

    Code of Federal Regulations, 2010 CFR

    2017-10-01

    ... 48 Federal Acquisition Regulations System 7 2017-10-01 2017-10-01 false Content. 3006.303-270 Section 3006.303-270 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND... Open Competition 3006.303-270 Content. (a)(9)(iv) For a proposed contract subject to the restrictions...

  10. 77 FR 76606 - Community Development Financial Institutions Fund

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-28

    ... form, with pre-set text limits and font size restrictions. Applicants must submit their narrative responses by using the FY 2013 CDFI Program Application narrative template document. This Word document...) A-133 Narrative Report; (iv) Institution Level Report; (v) Transaction Level Report (for Awardees...

  11. Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

    PubMed

    Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

    2005-04-01

    The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

  12. The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

    DTIC Science & Technology

    1999-05-01

    Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

  13. Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

    PubMed

    Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

    2018-06-01

    The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

  14. Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

    2008-01-15

    We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

  15. Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

    PubMed

    de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

    2007-10-01

    The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

  16. Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

    PubMed

    Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

    2016-07-01

    To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

  17. Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

    PubMed

    Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

    2013-10-01

    To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. 46 CFR 164.019-3 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

  19. Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

    2011-04-15

    Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

  20. Graduate Training Program for Research Methodologists. Final Report.

    ERIC Educational Resources Information Center

    Millman, Jason

    This paper provides documentation of the Elementary and Secondary Education Act Title IV-supported fellowship program for educational research methodologists developed at Cornell University. The program was characterized as interdisciplinary in nature with few course restrictions. This resulted in great diversity among the programs of the…

  1. 33 CFR 106.265 - Security measures for restricted areas.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...) Telecommunications; (iii) Power distribution system; (iv) Access points for ventilation and air-conditioning systems... security areas within the OCS facility; (6) Protect security and surveillance equipment and systems; and (7... security and surveillance equipment and systems and their controls, and lighting system controls; and (3...

  2. Social Network Types and Mental Health Among LGBT Older Adults

    PubMed Central

    Kim, Hyun-Jun; Fredriksen-Goldsen, Karen I.; Bryan, Amanda E. B.; Muraco, Anna

    2017-01-01

    Purpose of the Study: This study was designed to identify social network types among lesbian, gay, bisexual, and transgender (LGBT) older adults and examine the relationship between social network type and mental health. Design and Methods: We analyzed the 2014 survey data of LGBT adults aged 50 and older (N = 2,450) from Aging with Pride: National Health, Aging, and Sexuality/Gender Study. Latent profile analyses were conducted to identify clusters of social network ties based on 11 indicators. Multiple regression analysis was performed to examine the association between social network types and mental health. Results: We found five social network types. Ordered from greatest to least access to family, friend, and other non-family network ties, they were diverse, diverse/no children, immediate family-focused, friend-centered/restricted, and fully restricted. The friend-centered/restricted (33%) and diverse/no children network types (31%) were the most prevalent. Among individuals with the friend-centered/restricted type, access to social networks was limited to friends, and across both types children were not present. The least prevalent type was the fully restricted network type (6%). Social network type was significantly associated with mental health, after controlling for background characteristics and total social network size; those with the fully restricted type showed the poorest mental health. Implications: Unique social network types (diverse/no children and friend-centered/restricted) emerge among LGBT older adults. Moreover, individuals with fully restricted social networks are at particular risk due to heightened health needs and limited social resources. This study highlights the importance of understanding heterogeneous social relations and developing tailored interventions to promote social connectedness and mental health in LGBT older adults. PMID:28087798

  3. Social Network Types and Mental Health Among LGBT Older Adults.

    PubMed

    Kim, Hyun-Jun; Fredriksen-Goldsen, Karen I; Bryan, Amanda E B; Muraco, Anna

    2017-02-01

    This study was designed to identify social network types among lesbian, gay, bisexual, and transgender (LGBT) older adults and examine the relationship between social network type and mental health. We analyzed the 2014 survey data of LGBT adults aged 50 and older (N = 2,450) from Aging with Pride: National Health, Aging, and Sexuality/Gender Study. Latent profile analyses were conducted to identify clusters of social network ties based on 11 indicators. Multiple regression analysis was performed to examine the association between social network types and mental health. We found five social network types. Ordered from greatest to least access to family, friend, and other non-family network ties, they were diverse, diverse/no children, immediate family-focused, friend-centered/restricted, and fully restricted. The friend-centered/restricted (33%) and diverse/no children network types (31%) were the most prevalent. Among individuals with the friend-centered/restricted type, access to social networks was limited to friends, and across both types children were not present. The least prevalent type was the fully restricted network type (6%). Social network type was significantly associated with mental health, after controlling for background characteristics and total social network size; those with the fully restricted type showed the poorest mental health. Unique social network types (diverse/no children and friend-centered/restricted) emerge among LGBT older adults. Moreover, individuals with fully restricted social networks are at particular risk due to heightened health needs and limited social resources. This study highlights the importance of understanding heterogeneous social relations and developing tailored interventions to promote social connectedness and mental health in LGBT older adults. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Interstellar C IV and Si IV column densities toward early-type stars

    NASA Technical Reports Server (NTRS)

    Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

    1980-01-01

    Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

  5. Serotype IV and invasive group B Streptococcus disease in neonates, Minnesota, USA, 2000-2010.

    PubMed

    Ferrieri, Patricia; Lynfield, Ruth; Creti, Roberta; Flores, Aurea E

    2013-04-01

    Group B Streptococcus (GBS) is a major cause of invasive disease in neonates in the United States. Surveillance of invasive GBS disease in Minnesota, USA, during 2000-2010 yielded 449 isolates from 449 infants; 257 had early-onset (EO) disease (by age 6 days) and 192 late-onset (LO) disease (180 at age 7-89 days, 12 at age 90-180 days). Isolates were characterized by capsular polysaccharide serotype and surface-protein profile; types III and Ia predominated. However, because previously uncommon serotype IV constitutes 5/31 EO isolates in 2010, twelve type IV isolates collected during 2000-2010 were studied further. By pulsed-field gel electrophoresis, they were classified into 3 profiles; by multilocus sequence typing, representative isolates included new sequence type 468. Resistance to clindamycin or erythromycin was detected in 4/5 serotype IV isolates. Emergence of serotype IV GBS in Minnesota highlights the need for serotype prevalence monitoring to detect trends that could affect prevention strategies.

  6. The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

    DOT National Transportation Integrated Search

    1989-11-01

    The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

  7. An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

    DTIC Science & Technology

    1994-09-01

    wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

  8. Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

    PubMed Central

    Cosgrove, Dominic; Liu, Shiguang

    2016-01-01

    Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

  9. Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

    PubMed

    Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

    2015-06-01

    The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

  10. Sensorimotor restriction affects complex movement topography and reachable space in the rat motor cortex.

    PubMed

    Budri, Mirco; Lodi, Enrico; Franchi, Gianfranco

    2014-01-01

    Long-duration intracortical microstimulation (ICMS) studies with 500 ms of current pulses suggest that the forelimb area of the motor cortex is organized into several spatially distinct functional zones that organize movements into complex sequences. Here we studied how sensorimotor restriction modifies the extent of functional zones, complex movements, and reachable space representation in the rat forelimb M1. Sensorimotor restriction was achieved by means of whole-forelimb casting of 30 days duration. Long-duration ICMS was carried out 12 h and 14 days after cast removal. Evoked movements were measured using a high-resolution 3D optical system. Long-term cast caused: (i) a reduction in the number of sites where complex forelimb movement could be evoked; (ii) a shrinkage of functional zones but no change in their center of gravity; (iii) a reduction in movement with proximal/distal coactivation; (iv) a reduction in maximal velocity, trajectory and vector length of movement, but no changes in latency or duration; (v) a large restriction of reachable space. Fourteen days of forelimb freedom after casting caused: (i) a recovery of the number of sites where complex forelimb movement could be evoked; (ii) a recovery of functional zone extent and movement with proximal/distal coactivation; (iii) an increase in movement kinematics, but only partial restoration of control rat values; (iv) a slight increase in reachability parameters, but these remained far below baseline values. We pose the hypothesis that specific aspects of complex movement may be stored within parallel motor cortex re-entrant systems.

  11. Sensorimotor restriction affects complex movement topography and reachable space in the rat motor cortex

    PubMed Central

    Budri, Mirco; Lodi, Enrico; Franchi, Gianfranco

    2014-01-01

    Long-duration intracortical microstimulation (ICMS) studies with 500 ms of current pulses suggest that the forelimb area of the motor cortex is organized into several spatially distinct functional zones that organize movements into complex sequences. Here we studied how sensorimotor restriction modifies the extent of functional zones, complex movements, and reachable space representation in the rat forelimb M1. Sensorimotor restriction was achieved by means of whole-forelimb casting of 30 days duration. Long-duration ICMS was carried out 12 h and 14 days after cast removal. Evoked movements were measured using a high-resolution 3D optical system. Long-term cast caused: (i) a reduction in the number of sites where complex forelimb movement could be evoked; (ii) a shrinkage of functional zones but no change in their center of gravity; (iii) a reduction in movement with proximal/distal coactivation; (iv) a reduction in maximal velocity, trajectory and vector length of movement, but no changes in latency or duration; (v) a large restriction of reachable space. Fourteen days of forelimb freedom after casting caused: (i) a recovery of the number of sites where complex forelimb movement could be evoked; (ii) a recovery of functional zone extent and movement with proximal/distal coactivation; (iii) an increase in movement kinematics, but only partial restoration of control rat values; (iv) a slight increase in reachability parameters, but these remained far below baseline values. We pose the hypothesis that specific aspects of complex movement may be stored within parallel motor cortex re-entrant systems. PMID:25565987

  12. Genetics Home Reference: glycogen storage disease type IV

    MedlinePlus

    ... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

  13. Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

    PubMed

    Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

    2017-07-01

    The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  14. 10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

  15. 49 CFR 225.19 - Primary groups of accidents/incidents.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... or loss of consciousness of any person; or (iii) Loss of consciousness; (3) Injury to a railroad... result in death, medical treatment, loss of consciousness, a day away from work, restricted work activity... consciousness; or (iv) Medical treatment; (5) Significant illness of a railroad employee diagnosed by a...

  16. 26 CFR 301.6331-2 - Procedures and restrictions on levies.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... certified mail to the taxpayer's last known address. For further guidance regarding the definition of last...— (i) The Internal Revenue Code provisions and the procedures relating to levy and sale of property... (including the use of an installment agreement under section 6159); and (iv) The Internal Revenue Code...

  17. 26 CFR 301.6331-2 - Procedures and restrictions on levies.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... certified mail to the taxpayer's last known address. For further guidance regarding the definition of last...— (i) The Internal Revenue Code provisions and the procedures relating to levy and sale of property... (including the use of an installment agreement under section 6159); and (iv) The Internal Revenue Code...

  18. 26 CFR 301.6331-2 - Procedures and restrictions on levies.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... certified mail to the taxpayer's last known address. For further guidance regarding the definition of last...— (i) The Internal Revenue Code provisions and the procedures relating to levy and sale of property... (including the use of an installment agreement under section 6159); and (iv) The Internal Revenue Code...

  19. 26 CFR 301.6331-2 - Procedures and restrictions on levies.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... certified mail to the taxpayer's last known address. For further guidance regarding the definition of last...— (i) The Internal Revenue Code provisions and the procedures relating to levy and sale of property... (including the use of an installment agreement under section 6159); and (iv) The Internal Revenue Code...

  20. LOGWAR 15: Analysis Report

    DTIC Science & Technology

    2016-04-01

    Sanitation, and Hygiene WFP World Food Programme WHO World Health Organization Unclassified Unclassified xii This page intentionally left blank...Insurgency Natural Disaster Contamination Visibility Disposition Distribution Sourcing Prioritization Security Financial U.S. Military Services Combatant...supply; restrictions on sourcing; contamination concerns (IV solutions) Small in size; multiple variants with limited interchangeability; requires

  1. 21 CFR 520.2345e - Tetracycline oral liquid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.2345e Tetracycline oral... animals which are raised for food production; Federal law restricts this drug to use by or on the order of a licensed veterinarian. (iv) National Academy of Sciences/National Research Council (NAS/NRC...

  2. 21 CFR 520.2345e - Tetracycline oral liquid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.2345e Tetracycline oral... animals which are raised for food production; Federal law restricts this drug to use by or on the order of a licensed veterinarian. (iv) National Academy of Sciences/National Research Council (NAS/NRC...

  3. 21 CFR 520.2345e - Tetracycline oral liquid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.2345e Tetracycline oral... animals which are raised for food production; Federal law restricts this drug to use by or on the order of a licensed veterinarian. (iv) National Academy of Sciences/National Research Council (NAS/NRC...

  4. Hypochondriasis and health anxiety in the German population.

    PubMed

    Bleichhardt, G; Hiller, W

    2007-11-01

    Epidemiologic studies on hypochondriasis are very rare and have not been included in large North American community surveys until now. In order to gain information on the prevalence as well as the socio-demographic characteristics of hypochondriasis, the following community study was carried out. Analyses are based on an assessment of 1575 subjects selected by socio-demographic representation criteria for the German community. All subjects completed the Illness Attitude Scales (IAS) and responded to several additional questions on sociodemographics and diagnostic criteria pertaining to Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV) hypochondriasis. The IAS is internationally one of the best-established self-rating questionnaires for the assessment of hypochondriasis and health anxiety. Results reveal a 0.4% point prevalence rate of DSM-IV hypochondriasis. In contrast to that, 6% of the German population suffers from severe health anxiety. There are small positive effects for female gender, higher age and lower school education on health anxiety. Subjects with high health anxiety report a much lower health-related quality of life and a higher risk for a type of psychotherapeutic or psychiatric treatment. These results support the development of less restrictive criteria for hypochondriasis and place emphasis on the clinical and socio-economic relevance of health anxiety.

  5. Bacterial-Mediated Knockdown of Tumor Resistance to an Oncolytic Virus Enhances Therapy

    PubMed Central

    Cronin, Michelle; Le Boeuf, Fabrice; Murphy, Carola; Roy, Dominic G; Falls, Theresa; Bell, John C; Tangney, Mark

    2014-01-01

    Oncolytic viruses (OVs) and bacteria share the property of tumor-selective replication following systemic administration. In the case of nonpathogenic bacteria, tumor selectivity relates to their ability to grow extracellularly within tumor stroma and is therefore ideally suited to restricting the production of bacterially produced therapeutic agents to tumors. We have previously shown the ability of the type 1 interferon antagonist B18R to enhance the replication and spread of vesicular stomatitis virus (VSV) by overcoming related cellular innate immunity. In this study, we utilized nonpathogenic bacteria (E. coli) expressing B18R to facilitate tumor-specific production of B18R, resulting in a microenvironment depleted of bioactive antiviral cytokine, thus “preconditioning” the tumor to enhance subsequent tumor destruction by the OV. Both in vitro and in vivo infection by VSVΔ51 was greatly enhanced by B18R produced from E. coli. Moreover, a significant increase in therapeutic efficacy resulted from intravenous (IV) injection of bacteria to tumor-bearing mice 5 days prior to IV VSVΔ51 administration, as evidenced by a significant reduction in tumor growth and increased survival in mice. Our strategy is the first example where two such diverse microorganisms are rationally combined and demonstrates the feasibility of combining complementary microorganisms to improve therapeutic outcome. PMID:24569832

  6. Treatment of Stage IV Non-small Cell Lung Cancer

    PubMed Central

    Evans, Tracey; Gettinger, Scott; Hensing, Thomas A.; VanDam Sequist, Lecia; Ireland, Belinda; Stinchcombe, Thomas E.

    2013-01-01

    Background: Stage IV non-small cell lung cancer (NSCLC) is a treatable, but not curable, clinical entity in patients given the diagnosis at a time when their performance status (PS) remains good. Methods: A systematic literature review was performed to update the previous edition of the American College of Chest Physicians Lung Cancer Guidelines. Results: The use of pemetrexed should be restricted to patients with nonsquamous histology. Similarly, bevacizumab in combination with chemotherapy (and as continuation maintenance) should be restricted to patients with nonsquamous histology and an Eastern Cooperative Oncology Group (ECOG) PS of 0 to 1; however, the data now suggest it is safe to use in those patients with treated and controlled brain metastases. Data at this time are insufficient regarding the safety of bevacizumab in patients receiving therapeutic anticoagulation who have an ECOG PS of 2. The role of cetuximab added to chemotherapy remains uncertain and its routine use cannot be recommended. Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors as first-line therapy are the recommended treatment of those patients identified as having an EGFR mutation. The use of maintenance therapy with either pemetrexed or erlotinib should be considered after four cycles of first-line therapy in those patients without evidence of disease progression. The use of second- and third-line therapy in stage IV NSCLC is recommended in those patients retaining a good PS; however, the benefit of therapy beyond the third-line setting has not been demonstrated. In the elderly and in patients with a poor PS, the use of two-drug, platinum-based regimens is preferred. Palliative care should be initiated early in the course of therapy for stage IV NSCLC. Conclusions: Significant advances continue to be made, and the treatment of stage IV NSCLC has become nuanced and specific for particular histologic subtypes and clinical patient characteristics and according to the presence of specific genetic mutations. PMID:23649446

  7. Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

    PubMed

    Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

    1970-12-01

    Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

  8. Alport Syndrome Diagnosis

    MedlinePlus

    ... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

  9. Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

    PubMed

    Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

    2010-08-01

    Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  10. Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation.

    PubMed

    Shime-Hattori, Akiko; Iida, Tetsuya; Arita, Michiko; Park, Kwon-Sam; Kodama, Toshio; Honda, Takeshi

    2006-11-01

    Vibrio parahaemolyticus RIMD2210633 has two sets of type IV-A pilus genes. One set is similar to that found in other Gram-negative bacteria, such as Pseudomonas aeruginosa, Vibrio cholerae (chitin-regulated pilus; ChiRP), and Vibrio vulnificus. The other is homologous to the genes for the mannose-sensitive hemagglutinin (MSHA) pilus. In this study, we analyzed the effects of the deletions in the pilin genes for each type IV pilus (the ChiRP and the MSHA pilus) on biofilm formation. Although the MSHA pilin mutant formed aggregates, the number of bacteria that attached directly to the coverslip was reduced, suggesting that this pilus contributes to the bacterial attachment to the surface of the coverslip. In contrast, the ChiRP mutant attached to the surface of the coverslip, but did not form aggregates, suggesting that ChiRP plays a role in bacterial agglutination during biofilm formation. These results suggest that the two type IV pili of V. parahaemolyticus contribute to biofilm formation in different ways. Both mutants showed a lower fitness for adsorption onto chitin particles than that of the wild type. Collectively, these data suggest that the use of two type IV pili is a refined strategy of V. parahaemolyticus for survival in natural environments.

  11. A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

    PubMed

    Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

    2018-05-17

    Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Treatment with chemotherapy and dendritic cells pulsed with multiple Wilms' tumor 1 (WT1)-specific MHC class I/II-restricted epitopes for pancreatic cancer.

    PubMed

    Koido, Shigeo; Homma, Sadamu; Okamoto, Masato; Takakura, Kazuki; Mori, Masako; Yoshizaki, Shinji; Tsukinaga, Shintaro; Odahara, Shunichi; Koyama, Seita; Imazu, Hiroo; Uchiyama, Kan; Kajihara, Mikio; Arakawa, Hiroshi; Misawa, Takeyuki; Toyama, Yoichi; Yanagisawa, Satoru; Ikegami, Masahiro; Kan, Shin; Hayashi, Kazumi; Komita, Hideo; Kamata, Yuko; Ito, Masaki; Ishidao, Takefumi; Yusa, Sei-Ichi; Shimodaira, Shigetaka; Gong, Jianlin; Sugiyama, Haruo; Ohkusa, Toshifumi; Tajiri, Hisao

    2014-08-15

    We performed a phase I trial to investigate the safety, clinical responses, and Wilms' tumor 1 (WT1)-specific immune responses following treatment with dendritic cells (DC) pulsed with a mixture of three types of WT1 peptides, including both MHC class I and II-restricted epitopes, in combination with chemotherapy. Ten stage IV patients with pancreatic ductal adenocarcinoma (PDA) and 1 patient with intrahepatic cholangiocarcinoma (ICC) who were HLA-positive for A*02:01, A*02:06, A*24:02, DRB1*04:05, DRB1*08:03, DRB1*15:01, DRB1*15:02, DPB1*05:01, or DPB1*09:01 were enrolled. The patients received one course of gemcitabine followed by biweekly intradermal vaccinations with mature DCs pulsed with MHC class I (DC/WT1-I; 2 PDA and 1 ICC), II (DC/WT1-II; 1 PDA), or I/II-restricted WT1 peptides (DC/WT1-I/II; 7 PDA), and gemcitabine. The combination therapy was well tolerated. WT1-specific IFNγ-producing CD4(+) T cells were significantly increased following treatment with DC/WT1-I/II. WT1 peptide-specific delayed-type hypersensitivity (DTH) was detected in 4 of the 7 patients with PDA vaccinated with DC/WT1-I/II and in 0 of the 3 patients with PDA vaccinated with DC/WT1-I or DC/WT1-II. The WT1-specific DTH-positive patients showed significantly improved overall survival (OS) and progression-free survival (PFS) compared with the negative control patients. In particular, all 3 patients with PDA with strong DTH reactions had a median OS of 717 days. The activation of WT1-specific immune responses by DC/WT1-I/II combined with chemotherapy may be associated with disease stability in advanced pancreatic cancer. ©2014 American Association for Cancer Research.

  13. Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

    PubMed Central

    Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

    2015-01-01

    Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

  14. Root canal morphology of South Asian Indian maxillary molar teeth

    PubMed Central

    Singh, Shishir; Pawar, Mansing

    2015-01-01

    Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

  15. Estimating the effects of wages on obesity.

    PubMed

    Kim, DaeHwan; Leigh, John Paul

    2010-05-01

    To estimate the effects of wages on obesity and body mass. Data on household heads, aged 20 to 65 years, with full-time jobs, were drawn from the Panel Study of Income Dynamics for 2003 to 2007. The Panel Study of Income Dynamics is a nationally representative sample. Instrumental variables (IV) for wages were created using knowledge of computer software and state legal minimum wages. Least squares (linear regression) with corrected standard errors were used to estimate the equations. Statistical tests revealed both instruments were strong and tests for over-identifying restrictions were favorable. Wages were found to be predictive (P < 0.05) of obesity and body mass in regressions both before and after applying IVs. Coefficient estimates suggested stronger effects in the IV models. Results are consistent with the hypothesis that low wages increase obesity prevalence and body mass.

  16. Native structure of a type IV secretion system core complex essential for Legionella pathogenesis.

    PubMed

    Kubori, Tomoko; Koike, Masafumi; Bui, Xuan Thanh; Higaki, Saori; Aizawa, Shin-Ichi; Nagai, Hiroki

    2014-08-12

    Bacterial type IV secretion systems are evolutionarily related to conjugation systems and play a pivotal role in infection by delivering numerous virulence factors into host cells. Using transmission electron microscopy, we report the native molecular structure of the core complex of the Dot/Icm type IV secretion system encoded by Legionella pneumophila, an intracellular human pathogen. The biochemically isolated core complex, composed of at least five proteins--DotC, DotD, DotF, DotG, and DotH--has a ring-shaped structure. Intriguingly, morphologically distinct premature complexes are formed in the absence of DotG or DotF. Our data suggest that DotG forms a central channel spanning inner and outer membranes. DotF, a component dispensable for type IV secretion, plays a role in efficient embedment of DotG into the functional core complex. These results highlight a common scheme for the biogenesis of transport machinery.

  17. Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

    PubMed

    Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

    2009-06-01

    Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

  18. A new highly specialized cave harvestman from Brazil and the first blind species of the genus: Iandumoema smeagol sp. n. (Arachnida, Opiliones, Gonyleptidae)

    PubMed Central

    Pinto-da-Rocha, Ricardo; da Fonseca-Ferreira, Rafael; Bichuette, Maria Elina

    2015-01-01

    Abstract A new species of troglobitic harvestman, Iandumoema smeagol sp. n., is described from Toca do Geraldo, Monjolos municipality, Minas Gerais state, Brazil. Iandumoema smeagol sp. n. is distinguished from the other two species of the genus by four exclusive characteristics – dorsal scutum areas with conspicuous tubercles, enlarged retrolateral spiniform tubercle on the distal third of femur IV, eyes absent and the penial ventral process slender and of approximately the same length of the stylus. The species is the most highly modified in the genus and its distribution is restricted only to caves in that particular area of Minas Gerais state. The type locality is not inside a legally protected area, and there are anthropogenic impacts in its surroundings. Therefore, Iandumoema smeagol sp. n. is vulnerable and it must be considered in future conservation projects. PMID:26798238

  19. 78 FR 17680 - Information Collection Request; Chemical Facility Anti-Terrorism Standards Personnel Surety Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-22

    ... visitors with access to restricted areas or critical assets, including, (i) Measures designed to verify and validate identity; (ii) Measures designed to check criminal history; (iii) Measures designed to verify and validate legal authorization to work; and (iv) Measures designed to identify people with terrorist ties...

  20. 29 CFR 530.12 - Special provisions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... certificate issued to an industrial homeworker by the New York State Department of Labor under paragraph II of Home Work Order No. 4 Restricting Industrial Homework in the Glove Industry, dated June 28, 1941, will... under 19 years of age. (iv) Description of work performed. (v) Amount of cash wage payments made to the...

  1. 48 CFR 52.212-3 - Offeror Representations and Certifications-Commercial Items.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... that is to be used specifically— (i) To restrict the free flow of unbiased information in Iran; or (ii... End Products: Line Item No.: Country of Origin: (List as necessary) (3) The Government will evaluate... necessary) (iv) The Government will evaluate offers in accordance with the policies and procedures of FAR...

  2. Brief Report: Comparability of DSM-IV and DSM-5 ASD Research Samples

    ERIC Educational Resources Information Center

    Mazefsky, C. A.; McPartland, J. C.; Gastgeb, H. Z.; Minshew, N. J.

    2013-01-01

    Diagnostic and Statistical Manual (DSM-5) criteria for ASD have been criticized for being too restrictive, especially for more cognitively-able individuals. It is unclear, however, if high-functioning individuals deemed eligible for research via standardized diagnostic assessments would meet DSM-5 criteria. This study investigated the impact of…

  3. Two Boys with 47, XXY and Autism

    ERIC Educational Resources Information Center

    Merhar, S. L.; Manning-Courtney, P.

    2007-01-01

    Two children with autism and Klinefelter syndrome (KS) (47, XXY) are presented. Both qualify for the diagnosis of autism based on DSM-IV with severely delayed and disordered language, difficulties with social interaction, and a restricted range of interests and activities. Both also have abnormal EEGs, and one patient has had what appear to be…

  4. 21 CFR 520.540c - Dexamethasone chewable tablets.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... crumble over food. Administer 0.25 to 1.25 milligrams daily in single or two divided doses until response... infections. Anti-inflammatory action of corticosteriods may mask signs of infection. Do not use in animals... therapy.1 (iv) Federal law restricts this drug to use by or on the order of a licensed veterinarian. [44...

  5. 21 CFR 520.540c - Dexamethasone chewable tablets.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... crumble over food. Administer 0.25 to 1.25 milligrams daily in single or two divided doses until response... infections. Anti-inflammatory action of corticosteriods may mask signs of infection. Do not use in animals... therapy.1 (iv) Federal law restricts this drug to use by or on the order of a licensed veterinarian. [44...

  6. 75 FR 26025 - Regulation of Fuels and Fuel Additives: Modifications to Renewable Fuel Standard Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-10

    ... information whose disclosure is restricted by statute. Certain other material, such as copyrighted material, will be publicly available only in hard copy. Publicly available docket materials are available either... materials, as provided in 40 CFR part 2. IV. Renewable Fuel Standard (RFS2) Program Amendments EPA is taking...

  7. LOGWAR 15: Analysis Report

    DTIC Science & Technology

    2016-04-01

    Vertical Replenishment VTC Video Teleconference WASH Water, Sanitation, and Hygiene WFP World Food Programme WHO World Health Organization...issues Pa rt ic ip an ts Contexts Combat Disease Refugees Insurgency Natural Disaster Contamination Visibility Disposition Distribution Sourcing...requirements; limited shelf life; used by many actors; often in short supply; restrictions on sourcing; contamination concerns (IV solutions) Small in

  8. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli*

    PubMed Central

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-01-01

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. PMID:26324721

  9. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli.

    PubMed

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-10-23

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Measurement of Daily Activity in Restrictive Type Anorexia Nervosa

    PubMed Central

    Harris, Ann M.; McAlpine, Donald E.; Shirbhate, Rashmi; Manohar, Chinmay U.; Levine, James A.

    2009-01-01

    Objective The assessment of daily activity in patients with restrictive type anorexia nervosa is limited by an absence of accurate and precise technology. We wanted to test a daily activity detecting device named, the Physical Activity Monitoring System (PAMS). Method Women participants with restrictive type anorexia nervosa (n = 8, 36 ± 11 years, 17 ± 2 kg/m2) and healthy women participants (n = 8, 30 ± 11 years, 27 ± 7 kg/m2) were asked to lie, sit and stand motionless, and walk at 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0 mph whilst wearing PAMS. Results For all restrictive type anorexia nervosa and healthy participants, body posture was correctly detected for all measurements (300/300). There was excellent correlation of an individual’s body acceleration with walking velocity and walking energy expenditure (r2> 0.99). Conclusions The PAMS technology could serve as a tool for lending insight into the pathophysiology of restrictive type anorexia nervosa; and potentially measuring compliance with activity recommendations for medical professionals treating individuals with restrictive type anorexia nervosa. PMID:18004719

  11. Modulation of B16-BL6 murine melanoma metastatic phenotype by tyrosine and phenylalanine restriction in the absence of host selection pressures.

    PubMed

    Elstad, C A; Meadows, G G

    1993-01-01

    We previously showed that restriction of tyrosine (Tyr) and phenylalanine (Phe) in vivo dramatically suppresses the metastatic phenotype of B16-BL6 (BL6) murine melanoma. Present results indicate a direct effect of Tyr and Phe restriction on the tumor in the absence of host selection pressures. Lung colonizing ability of BL6 is dramatically suppressed after one passage in vitro in media containing low levels of Tyr and Phe. This antimetastatic effect is immediate, stable for at least 5 in vitro passages in Tyr and Phe restricted media, and evident event after levels of Tyr and Phe are restored to normal. Heterogeneity for lung colonizing ability is suppressed, as evidence by fewer tumor colonies formed by clones following i.v. inoculation into mice fed normal diet. This suppression of BL6 metastatic phenotype is not due to differential clearance and retention in the lung or to decreased growth, but is specific for these two amino acids. As the mechanism(s) for the antitumor effects of Tyr and Phe restriction are detailed, the relevance of Tyr and Phe restriction as an early adjuvant to effective cancer treatment can be explored.

  12. Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

    2012-08-15

    Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

  13. Quantitative Analysis Method of Output Loss due to Restriction for Grid-connected PV Systems

    NASA Astrophysics Data System (ADS)

    Ueda, Yuzuru; Oozeki, Takashi; Kurokawa, Kosuke; Itou, Takamitsu; Kitamura, Kiyoyuki; Miyamoto, Yusuke; Yokota, Masaharu; Sugihara, Hiroyuki

    Voltage of power distribution line will be increased due to reverse power flow from grid-connected PV systems. In the case of high density grid connection, amount of voltage increasing will be higher than the stand-alone grid connection system. To prevent the over voltage of power distribution line, PV system's output will be restricted if the voltage of power distribution line is close to the upper limit of the control range. Because of this interaction, amount of output loss will be larger in high density case. This research developed a quantitative analysis method for PV systems output and losses to clarify the behavior of grid connected PV systems. All the measured data are classified into the loss factors using 1 minute average of 1 second data instead of typical 1 hour average. Operation point on the I-V curve is estimated to quantify the loss due to the output restriction using module temperature, array output voltage, array output current and solar irradiance. As a result, loss due to output restriction is successfully quantified and behavior of output restriction is clarified.

  14. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes.

    PubMed

    Fu, Yong-Bi; Peterson, Gregory W; Dong, Yibo

    2016-04-07

    Genotyping-by-sequencing (GBS) has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and report a new set of 21 restriction enzyme combinations that can be applied to enhance GBS applications. These enzyme combinations were developed through an application of IgCoverage on 22 plant, animal, and fungus species with sequenced genomes, and some of them were empirically evaluated with different runs of Illumina MiSeq sequencing in 12 plant species. The in silico analysis of 22 organisms revealed up to eight times more genome coverage for the new combinations consisted of pairing four- or five-cutter restriction enzymes than the commonly used enzyme combination PstI + MspI. The empirical evaluation of the new enzyme combination (HinfI + HpyCH4IV) in 12 plant species showed 1.7-6 times more genome coverage than PstI + MspI, and 2.3 times more genome coverage in dicots than monocots. Also, the SNP genotyping in 12 Arabidopsis and 12 rice plants revealed that HinfI + HpyCH4IV generated 7 and 1.3 times more SNPs (with 0-16.7% missing observations) than PstI + MspI, respectively. These findings demonstrate that these novel enzyme combinations can be utilized to increase genome sampling and improve SNP genotyping in various GBS applications. Copyright © 2016 Fu et al.

  15. Neurons of human nucleus accumbens.

    PubMed

    Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

    2011-08-01

    Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

  16. Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

    PubMed

    Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

    2006-08-01

    The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

  17. Proposal for a histopathological consensus classification of the periprosthetic interface membrane

    PubMed Central

    Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-01-01

    Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

  18. Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

    PubMed

    Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-06-01

    The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

  19. Brief Report: Investigating the Implications of Applying the New DSM-5 Criteria for Diagnosing Autism Spectrum Disorder in a Preschool Population in Singapore.

    PubMed

    Wong, Chui Mae; Koh, Hwan Cui

    2016-09-01

    Diagnostic reports for 206 children who underwent an assessment for autism spectrum disorder (ASD) using the DSM-IV-TR criteria, were re-evaluated using the DSM-5 criteria. Mean age of the children at time of diagnosis was 3 years 10 months. Of the 202 children diagnosed with ASD on the DSM-IV-TR, 184 (91.1 %) also met the DSM-5 criteria for ASD. The overall concordance rate of ASD diagnosis on the DSM-IV-TR and DSM-5 was higher than that reported in other studies. Of the 18 children who did not meet DSM-5 criteria for ASD, 16 children met all social communication criteria but did not fulfil at least two restricted and repetitive behaviour (RRB) criteria. Six of those children had further RRBs emerging later on follow-up.

  20. A Deep Search for Faint Galaxies Associated with Very Low Redshift C IV Absorbers. III. The Mass- and Environment-dependent Circumgalactic Medium

    NASA Astrophysics Data System (ADS)

    Burchett, Joseph N.; Tripp, Todd M.; Bordoloi, Rongmon; Werk, Jessica K.; Prochaska, J. Xavier; Tumlinson, Jason; Willmer, C. N. A.; O'Meara, John; Katz, Neal

    2016-12-01

    Using Hubble Space Telescope Cosmic Origins Spectrograph observations of 89 QSO sightlines through the Sloan Digital Sky Survey footprint, we study the relationships between C IV absorption systems and the properties of nearby galaxies, as well as the large-scale environment. To maintain sensitivity to very faint galaxies, we restrict our sample to 0.0015\\lt z\\lt 0.015, which defines a complete galaxy survey to L≳ 0.01 L\\ast or stellar mass {M}* ≳ {10}8 {M}⊙ . We report two principal findings. First, for galaxies with impact parameter ρ \\lt 1 {r}{vir}, C IV detection strongly depends on the luminosity/stellar mass of the nearby galaxy. C IV is preferentially associated with galaxies with {M}* \\gt {10}9.5 {M}⊙ ; lower-mass galaxies rarely exhibit significant C IV absorption (covering fraction {f}C={9}-6+12 % for 11 galaxies with {M}* \\lt {10}9.5 {M}⊙ ). Second, C IV detection within the {M}* \\gt {10}9.5 {M}⊙ population depends on environment. Using a fixed-aperture environmental density metric for galaxies with ρ < 160 kpc at z\\lt 0.055, we find that {57}-13+12 % (8/14) of galaxies in low-density regions (regions with fewer than seven L\\gt 0.15 L\\ast galaxies within 1.5 Mpc) have affiliated C IV absorption; however, none (0/7) of the galaxies in denser regions show C IV. Similarly, the C IV detection rate is lower for galaxies residing in groups with dark matter halo masses of {M}{halo}\\gt {10}12.5 {M}⊙ . In contrast to C IV, H I is pervasive in the circumgalactic medium without regard to mass or environment. These results indicate that C IV absorbers with {log} N({{C}} {{IV}})≳ 13.5 {{cm}}-2 trace the halos of {M}* \\gt {10}9.5 {M}⊙ galaxies but also reflect larger-scale environmental conditions.

  1. Thermoregulation and stress hormone recovery after exercise dehydration: comparison of rehydration methods.

    PubMed

    McDermott, Brendon P; Casa, Douglas J; Lee, Elaine; Yamamoto, Linda; Beasley, Kathleen; Emmanuel, Holly; Anderson, Jeffrey; Pescatello, Linda; Armstrong, Lawrence E; Maresh, Carl

    2013-01-01

    Athletic trainers recommend and use a multitude of rehydration (REHY) methods with their patients. The REHY modality that most effectively facilitates recovery is unknown. To compare 5 common REHY methods for thermoregulatory and stress hormone recovery after exercise dehydration (EXDE) in trained participants. Randomized, cross-over, controlled study. Twelve physically active, non-heat-acclimatized men (age = 23 ± 4 years, height = 180 ± 6 cm, mass = 81.3 ± 3.7 kg, VO2max = 56.9 ± 4.4 mL·min(-1)·kg(-1), body fat = 7.9% ± 3%) participated. Participants completed 20-hour fluid restriction and 2-hour EXDE; they then received no fluid (NF) or REHY (half-normal saline) via ad libitum (AL), oral (OR), intravenous (IV), or combination IV and OR (IV + OR) routes for 30 minutes; and then were observed for another 30 minutes. Body mass, rectal temperature, 4-site mean weighted skin temperature, plasma stress hormone concentrations, and environmental symptoms questionnaire (ESQ) score. Participants were hypohydrated (body mass -4.23% ± 0.22%) post-EXDE. Rectal temperature for the NF group was significantly greater than for the IV group (P = .023) at 30 minutes after beginning REHY (REHY30) and greater than OR, IV, and IV + OR (P ≤ .009) but not AL (P = .068) at REHY60. Mean weighted skin temperature during AL was less than during IV + OR at REHY5 (P = .019). The AL participants demonstrated increased plasma cortisol concentrations compared with IV + OR, independent of time (P = .015). No differences existed between catecholamine concentrations across treatments (P > .05). The ESQ score was increased at REHY60 for NF, AL, OR, and IV (P < .05) but not for IV + OR (P = .217). The NF ESQ score was greater than that of IV + OR at REHY60 (P = .012). Combination IV + OR REHY reduced body temperature to a greater degree than OR and AL REHY when compared with NF. Future studies addressing clinical implications are needed.

  2. Ion temperature fluctuation measurements using a retarding field analyzer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nedzelskiy, I. S.; Silva, C.; Duarte, P.

    2011-04-15

    The retarding field analyzer (RFA) is a widely used diagnostic tool for the ion temperature measurement in the scrape-off-layer (SOL) of the thermonuclear plasma devices. However, the temporal resolution in the standard RFA application is restricted to the ms timescale. In this paper, a dc operation of the RFA is considered, which allows for the measurement of the plasma ion temperature fluctuations. The method is based on the relation for the RFA current-voltage (I-V) characteristic resulted from a common RFA model of shifted Maxwellian distribution of the analyzed ions, and the measurements of two points on the exponentially decaying regionmore » of the I-V characteristic with two differently dc biased RFA electrodes. The method has been tested and compared with conventional RFA measurements of the ion temperature in the tokamak ISTTOK SOL plasma. An ion temperature of T{sub i}= 17 eV is obtained near the limiter position. The agreement between the results of the two methods is within {approx}25%. The amplitude of the ion temperature fluctuations is found to be around 5 eV at this location. The method has been validated by taking into account the effect of fluctuations in the plasma potential and the noise contamination, proving the reliability of the results obtained. Finally, constrains to the method application are discussed that include a negligible electron emission from the RFA grids and the restriction to operate in the exponentially decaying region of the I-V characteristic.« less

  3. Environmentally Safe and Effective Processes for Paint Removal

    DTIC Science & Technology

    1995-04-01

    Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

  4. Novel USH2A compound heterozygous mutations cause RP/USH2 in a Chinese family.

    PubMed

    Liu, Xiaowen; Tang, Zhaohui; Li, Chang; Yang, Kangjuan; Gan, Guanqi; Zhang, Zibo; Liu, Jingyu; Jiang, Fagang; Wang, Qing; Liu, Mugen

    2010-03-17

    To identify the disease-causing gene in a four-generation Chinese family affected with retinitis pigmentosa (RP). Linkage analysis was performed with a panel of microsatellite markers flanking the candidate genetic loci of RP. These loci included 38 known RP genes. The complete coding region and exon-intron boundaries of Usher syndrome 2A (USH2A) were sequenced with the proband DNA to screen the disease-causing gene mutation. Restriction fragment length polymorphism (RFLP) analysis and direct DNA sequence analysis were done to demonstrate co-segregation of the USH2A mutations with the family disease. One hundred normal controls were used without the mutations. The disease-causing gene in this Chinese family was linked to the USH2A locus on chromosome 1q41. Direct DNA sequence analysis of USH2A identified two novel mutations in the patients: one missense mutation p.G1734R in exon 26 and a splice site mutation, IVS32+1G>A, which was found in the donor site of intron 32 of USH2A. Neither the p.G1734R nor the IVS32+1G>A mutation was found in the unaffected family members or the 100 normal controls. One patient with a homozygous mutation displayed only RP symptoms until now, while three patients with compound heterozygous mutations in the family of study showed both RP and hearing impairment. This study identified two novel mutations: p.G1734R and IVS32+1G>A of USH2A in a four-generation Chinese RP family. In this study, the heterozygous mutation and the homozygous mutation in USH2A may cause Usher syndrome Type II or RP, respectively. These two mutations expand the mutant spectrum of USH2A.

  5. Critical Role of Interdomain Interactions in the Conformational Change and Catalytic Mechanism of Endoplasmic Reticulum Aminopeptidase 1.

    PubMed

    Stamogiannos, Athanasios; Maben, Zachary; Papakyriakou, Athanasios; Mpakali, Anastasia; Kokkala, Paraskevi; Georgiadis, Dimitris; Stern, Lawrence J; Stratikos, Efstratios

    2017-03-14

    Endoplasmic reticulum aminopeptidase 1 (ERAP1) is an intracellular enzyme that is important for the generation of antigenic epitopes and major histocompatibility class I-restricted adaptive immune responses. ERAP1 processes a vast variety of different peptides but still shows length and sequence selectivity, although the mechanism behind these properties is poorly understood. X-ray crystallographic analysis has revealed that ERAP1 can assume at least two distinct conformations in which C-terminal domain IV is either proximal or distal to active site domain II. To improve our understanding of the role of this conformational change in the catalytic mechanism of ERAP1, we used site-directed mutagenesis to perturb key salt bridges between domains II and IV. Enzymatic analysis revealed that these mutations, although located away from the catalytic site, greatly reduce the catalytic efficiency and change the allosteric kinetic behavior. The variants were more efficiently activated by small peptides and bound a competitive inhibitor with weaker affinity and faster dissociation kinetics. Molecular dynamics analysis suggested that the mutations affect the conformational distribution of ERAP1, reducing the population of closed states. Small-angle X-ray scattering indicated that both the wild type and the ERAP1 variants are predominantly in an open conformational state in solution. Overall, our findings suggest that electrostatic interactions between domains II and IV in ERAP1 are crucial for driving a conformational change that regulates the structural integrity of the catalytic site. The extent of domain opening in ERAP1 probably underlies its specialization for antigenic peptide precursors and should be taken into account in inhibitor development efforts.

  6. Ehlers-Danlos syndrome type IV

    PubMed Central

    Germain, Dominique P

    2007-01-01

    Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

  7. Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

    PubMed

    Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

    2016-01-01

    Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

  8. Avoidant/Restrictive Food Intake Disorder (ARFID).

    PubMed

    Zimmerman, Jacqueline; Fisher, Martin

    2017-04-01

    Avoidant/restrictive food intake disorder (ARFID) is an entirely new diagnosis in the DSM-5. ARFID replaces "feeding disorder of infancy or early childhood," which was a diagnosis in the DSM-IV restricted to children 6 years of age or younger; ARFID has no such age limitations and it is distinct from anorexia nervosa and bulimia nervosa in that there is no body image disturbance. ARFID involves a complex and heterogenous etiology, which is reviewed herein. What is known to date regarding the characteristics and medical and psychiatric comorbidities of this patient population are described and compared to other eating disorders. Evaluation and management strategies are also discussed. No data yet exist regarding ARFID׳s prognosis and prevention; however, recommendations to guide parents in establishing appropriate infant and child feeding practices are provided. Copyright © 2017 Mosby, Inc. All rights reserved.

  9. Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

    PubMed

    Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

    2016-05-01

    To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  10. [Elective reconstruction of thoracoabdominal aortic aneurysm type IV by transabdominal approach].

    PubMed

    Marjanović, Ivan; Jevtić, Miodrag; Misović, Sidor; Sarac, Momir

    2012-01-01

    Thoracoabdominal aortic aneurysm (TAAA) type IV represents an aortic dilatation from the level of the diaphragmatic hiatus to the iliac arteries branches, including visceral branches of the aorta. In the traditional procedure of TAAA type IV repair, the body is opened using thoractomy and laparotomy in order to provide adequate exposure of the descending thoracic and abdominal aorta for safe aortic reconstruction. We reported a 71-year-old man with elective reconstruction of the TAAA type IV performed by transabdominal approach. Computed tomography scans angiography revealed a TAAA type IV with diameter of 62 mm in the region of celiac trunk andsuperior mesenteric artery branching, and the largest diameter of 75 mm in the infrarenal aortic level. The patient comorbidity included a chronic obstructive pulmonary disease and hypertension, therefore he was treated for a prolonged period. In preparation for the planned aortic reconstruction asymptomatic carotid disease (occlusion of the left internal carotid artery and subtotal stenosis of the right internal carotid artery) was diagnosed. Within the same intervention percutaneous transluminal angioplasty with stent placement in right internal carotid artery was made. In general, under endotracheal anesthesia and epidural analgesia, with transabdominal approach performed aortic reconstruction with tubular dakron graft 24 mm were, and reimplantation of visceral aortic branches into the graft performed. Postoperative course was uneventful, and the patient was discharged on the postoperative day 17. Control computed tomography scan angiography performed three months after the operation showed vascular state of the patient to be in order. Complete transabdominal approach to TAAA type IV represents an appropriate substitute for thoracoabdominal approach, without compromising safety of the patient. This approach is less traumatic, especially in patients with impaired pulmonary function, because there is no thoracotomy and any complications that could follow this approach.

  11. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed Central

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

  12. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

  13. Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

    PubMed

    Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

    2007-01-01

    Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

  14. 45 CFR 264.1 - What restrictions apply to the length of time Federal TANF assistance may be provided?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... individual; (ii) Sexual abuse; (iii) Sexual activity involving a dependent child; (iv) Being forced as the caretaker relative of a dependent child to engage in nonconsensual sexual acts or activities; (v) Threats of, or attempts at, physical or sexual abuse; (vi) Mental abuse; or (vii) Neglect or deprivation of...

  15. 45 CFR 264.1 - What restrictions apply to the length of time Federal TANF assistance may be provided?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES OTHER ACCOUNTABILITY PROVISIONS What Specific Rules Apply for Other... individual; (ii) Sexual abuse; (iii) Sexual activity involving a dependent child; (iv) Being forced as the caretaker relative of a dependent child to engage in nonconsensual sexual acts or activities; (v) Threats of...

  16. 45 CFR 264.1 - What restrictions apply to the length of time Federal TANF assistance may be provided?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES OTHER ACCOUNTABILITY PROVISIONS What Specific Rules Apply for Other... individual; (ii) Sexual abuse; (iii) Sexual activity involving a dependent child; (iv) Being forced as the caretaker relative of a dependent child to engage in nonconsensual sexual acts or activities; (v) Threats of...

  17. 45 CFR 264.1 - What restrictions apply to the length of time Federal TANF assistance may be provided?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES OTHER ACCOUNTABILITY PROVISIONS What Specific Rules Apply for Other... individual; (ii) Sexual abuse; (iii) Sexual activity involving a dependent child; (iv) Being forced as the caretaker relative of a dependent child to engage in nonconsensual sexual acts or activities; (v) Threats of...

  18. 45 CFR 264.1 - What restrictions apply to the length of time Federal TANF assistance may be provided?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ..., DEPARTMENT OF HEALTH AND HUMAN SERVICES OTHER ACCOUNTABILITY PROVISIONS What Specific Rules Apply for Other... individual; (ii) Sexual abuse; (iii) Sexual activity involving a dependent child; (iv) Being forced as the caretaker relative of a dependent child to engage in nonconsensual sexual acts or activities; (v) Threats of...

  19. Comparison of Students Classified ED in Self-Contained Classrooms and a Self-Contained School

    ERIC Educational Resources Information Center

    Mattison, Richard E.

    2011-01-01

    Middle school students classified with Emotional Disturbance in two levels of least restrictive environments (LRE)--self-contained classes (SCC) and a self-contained school (SCS)--were compared at the beginning and the end of a school year, using demographics, IQ and achievement testing, a teacher checklist for DSM-IV psychopathology, and standard…

  20. 75 FR 51150 - Notice of Solicitation of Public Comment on Consideration of Incorporating IFRS Into the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-18

    ... reporting system for U.S. issuers? IV. Statutory Distribution Restrictions and Other Legal Standards Tied to... Solicitation of Public Comment on Consideration of Incorporating IFRS Into the Financial Reporting System for U...'') into the financial reporting system for U.S. issuers. These three topics, derived from the staff's Work...

  1. Congenital cardiac anomalies in an English bulldog.

    PubMed

    McConkey, Marina J

    2011-11-01

    A 4-year-old male castrated English bulldog was referred to the Atlantic Veterinary College for evaluation of exercise intolerance, multiple syncopal episodes, and a grade IV/VI heart murmur. The dog was shown to have 3 congenital cardiac anomalies: atrial septal defect, mitral valve dysplasia, and subaortic stenosis. Medical management consisted of exercise restriction, atenolol, pimobendan, and taurine.

  2. 77 FR 56528 - Airworthiness Directives; Various Restricted Category Helicopters

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-13

    ... use the phrase ``cracks in the bond lines between doublers or grip plates'' to describe a separation... defined as a separation of the detail parts along an edge. Note 3 to paragraph (e)(1)(iv): A crack in the..., doubler, or skin is cracked. If any parent material is removed during the sanding operation, replace the M...

  3. 5 CFR 2641.202 - Two-year restriction on any former employee's representations to United States concerning...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    .... 3345(a); and (iv) Whether there are any other circumstances indicating that, given the temporary nature... official to clarify his role in the matter. See § 2641.105 concerning advice. Example 1 to paragraph (j... public relations. When contacted by an employee of his former office for advice concerning a matter...

  4. 12 CFR 591.5 - Limitation on exercise of due-on-sale clauses.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... penalties and forfeitures, equitable restrictions and state law dealing with equitable transfers. (b..., or operation of law on the death of a joint tenant or tenant by the entirety; (iv) The granting of a... occupy the property, which is: (A) A transfer to a relative resulting from the death of the borrower; (B...

  5. Mechanisms of chiral discrimination by topoisomerase IV

    PubMed Central

    Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

    2009-01-01

    Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

  6. Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

    PubMed

    Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

    2016-11-01

    To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

  7. Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

    PubMed Central

    Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

    2011-01-01

    Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

  8. Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

    PubMed

    Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

    2016-02-28

    Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

  9. Atypical hereditary sensory and autonomic neuropathy type IV with neither mental retardation nor pain insensitivity.

    PubMed

    Jung, Chae Lim; Ki, Chang-Seok; Kim, Byoung Joon; Lee, Jong-Hyuck; Sung, Ki-Sun; Kim, Jong-Won; Park, Youn-Soo

    2013-12-01

    Hereditary sensory and autonomic neuropathy type IV is an autosomal recessive disorder characterized by severe mental retardation and self-mutilation-related complications. Recently, we investigated a 16-year-old Korean boy with normal intelligence. He had preserved pain sensation but was suspected of having hereditary sensory and autonomic neuropathy type IV because of the recurrent bone fractures and painless joint destruction in the absence of any predisposing medical conditions. Genetic analysis of the NTRK1 gene revealed compound heterozygous mutations including c.851-33T>A and c.2303C>T (p.Pro768Leu) in the NTRK1 gene. The p.Pro768Leu mutation has been identified in 2 Japanese patients with a mild phenotype. Therefore, although it is rare, hereditary sensory and autonomic neuropathy type IV should be considered in patients with recurrent bone fractures and painless joint destruction who do not have any predisposing conditions even when they do not have typical clinical features such as mental retardation or pain insensitivity.

  10. Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

    PubMed

    Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

    2017-05-04

    Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

  11. [Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

    PubMed

    Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

    2014-10-01

    To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

  12. Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

    PubMed Central

    Roos, David S.; Pohlschröder, Mechthild

    2011-01-01

    Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV pilus-like structures. Its use in combination with other currently available computational tools should improve the accuracy of predicting the subcellular localization of bacterial proteins. PMID:22216142

  13. Accentuated hyperparathyroidism in type II Bartter syndrome.

    PubMed

    Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

    2016-07-01

    Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

  14. Structure of the human type IV collagen COL4A6 gene, which is mutated in Alport syndrome-associated leiomyomatosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Xu; Zhou, Jing; Reeders, S.T.

    1996-05-01

    Basement membrane (type IV) collagen, a subfamily of the collagen protein family, is encoded by six distinct genes in mammals. Three of those, COL4A3, COL4A4, and COL4A5, are linked with Alport syndrome (hereditary nephritis). Patients with leimoyomatosis associated with Alport syndrome have been shown to have deletions in the 5{prime} end of the COL4A6 gene, in addition to having deletions in COL4A6. The human COL4A6 gene is reported to be 425 kb as determined by mapping of overlapping YAC clones by probes for its 5{prime} and 3{prime} ends. In the present study we describe the complete exon/intron size pattern ofmore » the human COL4A6 gene. The 12 {lambda} phage clones characterized in the study spanned a total of 110 kb, including 85 kb of the actual gene and 25 kb of flanking sequences. The overlapping clones contained all 46 exons of the gene and all introns, except for intron 2. Since the total size of the exons and all introns except for intron 2 is about 85 kb, intron 2 must be about 340 kb. All exons of the gene were assigned to EcoRI restriction fragments to facilitate analysis of the gene in patients with leiomyomatosis associated with Alport syndrome. The exon size pattern of COL4A6 is highly homologous with that of the human and mouse COL4A2 genes, with 27 of the 46 exons of COL4A6 being identical in size between the genes. 42 refs., 2 figs., 3 tabs.« less

  15. The Trw Type IV Secretion System of Bartonella Mediates Host-Specific Adhesion to Erythrocytes

    PubMed Central

    Vayssier-Taussat, Muriel; Le Rhun, Danielle; Deng, Hong Kuan; Biville, Francis; Cescau, Sandra; Danchin, Antoine; Marignac, Geneviève; Lenaour, Evelyne; Boulouis, Henri Jean; Mavris, Maria; Arnaud, Lionel; Yang, Huanming; Wang, Jing; Quebatte, Maxime; Engel, Philipp; Saenz, Henri; Dehio, Christoph

    2010-01-01

    Bacterial pathogens typically infect only a limited range of hosts; however, the genetic mechanisms governing host-specificity are poorly understood. The α-proteobacterial genus Bartonella comprises 21 species that cause host-specific intraerythrocytic bacteremia as hallmark of infection in their respective mammalian reservoirs, including the human-specific pathogens Bartonella quintana and Bartonella bacilliformis that cause trench fever and Oroya fever, respectively. Here, we have identified bacterial factors that mediate host-specific erythrocyte colonization in the mammalian reservoirs. Using mouse-specific Bartonella birtlesii, human-specific Bartonella quintana, cat-specific Bartonella henselae and rat-specific Bartonella tribocorum, we established in vitro adhesion and invasion assays with isolated erythrocytes that fully reproduce the host-specificity of erythrocyte infection as observed in vivo. By signature-tagged mutagenesis of B. birtlesii and mutant selection in a mouse infection model we identified mutants impaired in establishing intraerythrocytic bacteremia. Among 45 abacteremic mutants, five failed to adhere to and invade mouse erythrocytes in vitro. The corresponding genes encode components of the type IV secretion system (T4SS) Trw, demonstrating that this virulence factor laterally acquired by the Bartonella lineage is directly involved in adherence to erythrocytes. Strikingly, ectopic expression of Trw of rat-specific B. tribocorum in cat-specific B. henselae or human-specific B. quintana expanded their host range for erythrocyte infection to rat, demonstrating that Trw mediates host-specific erythrocyte infection. A molecular evolutionary analysis of the trw locus further indicated that the variable, surface-located TrwL and TrwJ might represent the T4SS components that determine host-specificity of erythrocyte parasitism. In conclusion, we show that the laterally acquired Trw T4SS diversified in the Bartonella lineage to facilitate host-restricted adhesion to erythrocytes in a wide range of mammals. PMID:20548954

  16. Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, K. R.

    1994-01-01

    Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

  17. Sex-specific effect of endothelin in the blood pressure response to acute angiotensin II in growth-restricted rats

    PubMed Central

    Intapad, Suttira; Ojeda, Norma B.; Varney, Elliott; Royals, Thomas P.; Alexander, Barbara T.

    2015-01-01

    The renal endothelin system contributes to sex differences in blood pressure with males demonstrating greater endothelin type-A receptor-mediated responses relative to females. Intrauterine growth restriction programs hypertension and enhanced renal sensitivity to acute angiotensin II in male growth-restricted rats. Endothelin is reported to work synergistically with angiotensin II. Thus, this study tested the hypothesis that endothelin augments the blood pressure response to acute angiotensin II in male growth-restricted rats. Systemic and renal hemodynamics were determined in response to acute angiotensin II (100 nanogram/kilogram/minute for 30 minutes) with and without the endothelin type-A receptor antagonist, ABT 627(10 nanogram/kilogram/minute for 30 minutes), in rats pretreated with enalapril (250 milligram/Liter for one week) to normalize the endogenous renin angiotensin system. Endothelin type-A receptor blockade reduced angiotensin II-mediated increases in blood pressure in male control and male growth-restricted rats. Endothelin type-A receptor blockade also abolished hyper-responsiveness to acute angiotensin II in male growth-restricted rats. Yet, blood pressure remained significantly elevated above baseline following endothelin type-A receptor blockade suggesting that factors in addition to endothelin contribute to the basic angiotensin II-induced pressor response in male rats. We also determined sex-specific effects of endothelin on acute angiotensin II-mediated hemodynamic responses. Endothelin type-A receptor blockade did not reduce acute angiotensin II-mediated increases in blood pressure in female control or growth-restricted rats, intact or ovariectomized. Thus, these data suggest that endothelin type-A receptor blockade contributes to hypersensitivity to acute angiotensin II in male growth-restricted rats and further supports the sex-specific effect of endothelin on blood pressure. PMID:26459423

  18. Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

    PubMed

    Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

    2009-06-01

    Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

  19. Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

    NASA Astrophysics Data System (ADS)

    Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

    1996-08-01

    Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

  20. [Risk of type 2 diabetes mellitus in the Kyrgyz population in the presence of ADIPOQ (G276T), KCNJ11 (Glu23Lys), TCF7L2 (IVS3C>T) gene polymorphisms].

    PubMed

    Isakova, Zh T; Talaibekova, E T; Asambaeva, D A; Kerimkulova, A S; Lunegova, O S; Aldasheva, N M; Aldashev, A A

    To analyze the association of genotype combinations of the polymorphic markers G276T in the ADIPOQ gene, Glu23Lys in the KCNJ11 gene, and IVS3C>T in the TCF7L2 gene with the development of type 2 diabetes mellitus (T2DM) in the Kyrgyz population. The investigation enrolled 23 Kyrgyz people, of whom there were 114 patients with T2DM and 109 without T2DM (a control group). T2DM was diagnosed in accordance with the WHO criteria (1999). The genotypes of ADIPOQ (G276T), KCNJ11 (Glu23Lys), and TCF7L2 (IVS3C>T) gene polymorphisms were identified using the restriction fragment length polymorphism analysis. When typing at the polymorphic loci G276T in the ADIPOQ gene, Glu23Lys in the KCNJ11 gene, and IVS3C>T in the TCF7L2 gene, the development of T2DM in the Kyrgyz population was associated with the T allele (odds ratio (OR), 1.68; p=0.025), the heterozygous G276T genotype (OR 1,8; p=0.036) in the ADIPOQ gene; the 23Lys allele (OR, 1.62; p=0.019) in the KCNJ11 gene; a two-locus genotype combination in the genes ADIPOQ/KCNJ11: G276T/Glu23Lys (OR, 4.88; p=0.0013), G276G/Lys23Lys (OR, 4.65; p=0.019), G276T/Glu23Glu (OR, 3.10; p=0.022), a two-locus genotype combination in the genes ADIPOQ/TCF7L2: G276T/СС (OR, 1.97; p=0.04); two-locus genotype combinations in the genes KCNJ11/TCF7L2: Lys23Lys/CC (ОR, 2.65; p=0.042), Glu23Lys/CT (OR, 3.88; p=0.027); and a three-locus genotype combination in the genes ADIPOQ/KCNJ11/TCF7L2: G276T/Glu23Lys/CT (OR, 14.48; p=0.02). The development of T2DM in the Kyrgyz population is genetically determined by ADIPOQ (G276T) gene, KCNJ11 (Glu23Lys), and TCF7L (IVS3C>T) gene polymorphisms with the predisposing value of the T allele of the heterozygous G276T genotype in the ADIPOQ gene; the 23Lys allele in the KCNJ1 gene; as well as by genotype combinations in the genes ADIPOQ/KCNJ11 (G276T/Glu23Lys, G276G/Lys23Lys, G276T/Glu23Glu); ADIPOQ/TCF7L2 (G276T/SS); KCNJ11/TCF7L2 (Lys23Lys/CC, Glu23Lys/CT); ADIPOQ/KCNJ11/TCF7L2 (G276T/Glu23Lys /CT). The IVS3C>T locus in the TCF7L2 gene is not independently statistically significantly associated with the development of T2DM; however, its predisposing effect has been identified in its combination with the variant genotypes of the polymorphic loci G276T in the ADIPOQ gene and Glu23Lys in the KCNJ11 gene.

  1. The impacts of the rise of Paragraph IV challenges on startup alliance formation and firm value in the pharmaceutical industry.

    PubMed

    Filson, Darren; Oweis, Ahmed

    2010-07-01

    Court decisions in 1998 encouraged generic producers to pursue Paragraph IV patent challenges. A follow-up decision in 2000 marked the first successful challenge involving a blockbuster and brought further attention to this pathway for generic entry. We consider the impacts of these decisions on R&D-based startups, and we focus on the propensity to form alliances as a primary channel of impact. We find substantial negative impacts on alliance formation and firm value, and only the first event's impacts are restricted to small molecules. The results suggest that policy analyses in settings with R&D-based startups should consider impacts on alliance formation.

  2. Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

    PubMed Central

    Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

    2005-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

  3. An experimental test of blunting using sleep-restriction as an acute stressor in Type D and non-Type D women.

    PubMed

    O'Leary, Éanna D; Howard, Siobhán; Hughes, Brian M; James, Jack E

    2013-10-01

    Recent years have seen a growing interest in evidence indicating that a low, or blunted, cardiovascular response to stress may predict increased risk for a range of adverse health outcomes. Type D personality has been associated with poor health in cardiac patients, and more recently, has been associated with lower reactivity to laboratory stress in healthy individuals, underpinned by an increase in vascular responding. Previous findings have also demonstrated that partial sleep restriction is characterised by a robust vascular profile. However, despite the fact that a vascular response profile underpins both reactivity in sleep restricted adults and blunted reactivity in healthy Type D adults, limited empirical work has examined the correlates of sleep restriction and Type D. The present study sought to investigate if manipulation of sleep duration in healthy Type D and non-Type D individuals would alter cardiovascular reactivity to stress, and in particular whether such manipulation could elucidate the comparative nature of blunting. Seventy female university students completed a laboratory social stress task while undergoing continuous hemodynamic monitoring, after either a night of partial sleep restriction or a full night's rest. In both groups, Type D participants exhibited relatively low SBP stress responses, consistent with the view that at-risk groups show blunting in (some indices of) cardiovascular reactivity. For non-Type D participants, low SBP responses were observed only in participants who had undergone sleep restriction, suggesting that sleep-restriction served as an environmental stressor which precipitated in non-Type D persons a cardiovascular stress response resembling that ordinarily seen in Type D persons. This blunted response was associated with an increase in vascular responding. Thus, the findings suggest that blunting is characterised not only by reductions in some (frequently studied) cardiovascular parameters, but also by increases in others. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. hisT is part of a multigene operon in Escherichia coli K-12.

    PubMed Central

    Marvel, C C; Arps, P J; Rubin, B C; Kammen, H O; Penhoet, E E; Winkler, M E

    1985-01-01

    The Escherichia coli K-12 hisT gene has been cloned, and its organization and expression have been analyzed on multicopy plasmids. The hisT gene, which encodes tRNA pseudouridine synthase I (PSUI), was isolated on a Clarke-Carbon plasmid known to contain the purF gene. The presence of the hisT gene on this plasmid was suggested by its ability to restore both production of PSUI enzymatic activity and suppression of amber mutations in a hisT mutant strain. A 2.3-kilobase HindIII-ClaI restriction fragment containing the hisT gene was subcloned into plasmid pBR322, and the resulting plasmid (designated psi 300) was mapped with restriction enzymes. Complementation analysis with different kinds of hisT mutations and tRNA structural analysis confirmed that plasmid psi 300 contained the hisT structural gene. Enzyme assays showed that plasmid psi 300 overproduced PSUI activity by ca. 20-fold compared with the wild-type level. Subclones containing restriction fragments from plasmid psi 300 inserted downstream from the lac promoter established that the hisT gene is oriented from the HindIII site toward the ClaI site. Other subclones and derivatives of plasmid psi 300 containing insertion or deletion mutations were constructed and assayed for production of PSUI activity and production of proteins in minicells. These experiments showed that: (i) the proximal 1.3-kilobase HindIII-BssHII restriction fragment contains a promoter for the hisT gene and encodes a 45,000-dalton polypeptide that is not PSUI; (ii) the distal 1.0-kilobase BssHII-ClaI restriction fragment encodes the 31,000-dalton PSUI polypeptide; (iii) the 45,000-dalton polypeptide is synthesized in an approximately eightfold excess compared with PSUI; and (iv) synthesis of the two polypeptides is coupled, suggesting that the two genes are part of an operon. Insertion of mini-Mu d1 (lac Km) phage into plasmid psi 300 confirmed that the hisT gene is the downstream gene in the operon. Images PMID:2981810

  5. (2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, D.; Wang, L.; Beconi, M.

    2010-11-10

    A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

  6. Genetics Home Reference: mucolipidosis type IV

    MedlinePlus

    ... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

  7. Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

    PubMed

    Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

    2014-01-01

    The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

  8. Mass loss in the interacting semi-detached binary delta librae

    NASA Technical Reports Server (NTRS)

    Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

    1995-01-01

    The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

  9. Structural studies of a bifunctional inhibitor of neprilysin and DPP-IV.

    PubMed

    Oefner, Christian; Pierau, Sabine; Schulz, Henk; Dale, Glenn E

    2007-09-01

    Neutral endopeptidase (NEP) is the major enzyme involved in the metabolic inactivation of a number of bioactive peptides including the enkephalins, substance P, endothelin, bradykinin and atrial natriuretic factor, as well as the incretin hormone glucagon-like peptide 1 (GLP-1), which is a potent stimulator of insulin secretion. The activity of GLP-1 is also rapidly abolished by the serine protease dipeptidyl peptidase IV (DPP-IV), which led to an elevated interest in inhibitors of this enzyme for the treatment of type II diabetes. A dual NEP/DPP-IV inhibitor concept is proposed, offering an alternative strategy for the treatment of type 2 diabetes. Here, the synthesis and crystal structures of the soluble extracellular domain of human NEP (residues 52-749) complexed with the NEP, competitive and potent dual NEP/DPP-IV inhibitor MCB3937 are described.

  10. Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

    PubMed

    Mak, Ki M; Mei, Rena

    2017-08-01

    Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  11. Odorant transfer characteristics of white bread during baking.

    PubMed

    Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

    2011-01-01

    The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

  12. Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

    PubMed

    Busek, P; Stremenová, J; Krepela, E; Sedo, A

    2008-01-01

    Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

  13. Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

    PubMed

    Pakravan, Nafiseh; Hassan, Zuhair Mohammad

    2018-03-01

    Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

  14. THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

    PubMed Central

    Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

    1932-01-01

    The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

  15. Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

    PubMed

    Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

    2004-06-01

    We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

  16. Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

    PubMed

    Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

    2011-01-01

    Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

  17. Doxorubicin: Comparison between 3-h continuous and bolus intravenous administration paradigms on cardio-renal axis, mitochondrial sphingolipids and pathology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kamendi, Harriet, E-mail: harriet_kamendi@kandih.com; Zhou, Ying, E-mail: yingzhou526@gmail.com; Crosby, Meredith, E-mail: Meredith.crosby@astrazeneca.com

    Doxorubicin (DOX) is a potent and effective broad-spectrum anthracycline antitumor agent, but its clinical usefulness is restricted by cardiotoxicity. This study compared pharmacokinetic, functional, structural and biochemical effects of single dose DOX bolus or 3-h continuous iv infusion (3-h iv) in the Han–Wistar rat to characterize possible treatment-related differences in drug safety over a 72 h observation period. Both DOX dosing paradigms significantly altered blood pressure, core body temperature and QA interval (indirect measure of cardiac contractility); however, there was no recovery observed in the bolus iv treatment group. Following the 3-h iv treatment, blood pressures and QA interval normalizedmore » by 36 h then rose above baseline levels over 72 h. Both treatments induced biphasic changes in heart rate with initial increases followed by sustained decreases. Cardiac injury biomarkers in plasma were elevated only in the bolus iv treatment group. Tissue cardiac injury biomarkers, cardiac mitochondrial complexes I, III and V and cardiac mitochondrial sphingolipids were decreased only in the bolus iv treatment group. Results indicate that each DOX dosing paradigm deregulates sinus rhythm. However, slowing the rate of infusion allows for functional compensation of blood pressure and may decrease the likelihood of cardiac myocyte necrosis via a mechanism associated with reduced mitochondrial damage. - Highlights: • Despite damaging cardiomyocytes, continuous iv doxorubicin improves cardiovascular outcomes. • This study supports administration of doxorubicin via slow continuous iv infusion limits acute cardio-toxicity. • This study supports use of metabolomic-derived lipid biomarkers for improved quantification of cardiovascular risk. • This study supports systems-based physiological approach to generate a data that can greatly inform risk assessments.« less

  18. Serine proteases in rodent hippocampus.

    PubMed

    Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R

    1998-09-04

    Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.

  19. The 80-hour work week: will we have less-experienced graduating surgeons?

    PubMed

    Jarman, Benjamin T; Miller, Marcus R; Brown, R Shane; Armen, Scott B; Bozaan, Anthony G; Ho, George T; Hartranft, Thomas H

    2004-01-01

    Our primary concern when modifying the Mount Carmel Medical Center surgical residency to comply with the "80-hour work week" was the effect on operative experience. Our goal was to measure the impact that work-hour restrictions have on operative volumes and to evaluate the potential benefit of a night rotation to minimize the number of "lost operations." Categorical surgical residents (PGY I-IV) recorded missed surgical procedures on post-call days from September 1, 2002 to March 31, 2004. The data collection is split between the pre-night rotation (September 1, 2002 to March 31, 2003) and post-night rotation (April 1, 2003 to March 31, 2004) periods. The post-night rotation period is further divided to account for the end of the academic year. Previous graduate operative logs were reviewed for comparison. Mount Carmel Health System is a tertiary referral, community-based hospital in Columbus, Ohio. Categorical general surgery residents (Postgraduate Years I to V). In the 7-month period, extending from September 1, 2002 to March 31, 2003, the average number of missed cases for successive levels was PGY I: 21, PGY II: 31, PGY III: 26, and PGY IV: 40. From April 1, 2003 to June 30, 2003, the average number of missed cases for successive levels was PGY I: 3, PGY II: 7, PGY III: 5, and PGY IV: 6. From July 1, 2003 to March 31, 2004, the average number of missed cases for successive levels was PGY I: 34, PGY II: 8, PGY III: 14, and PGY IV: 30. Before the implementation of a night rotation, residents were projected to miss an average of 202 operations over 4 years. After implementation of a night rotation, the projected loss would drop to 107 operations over 4 years. Work-hour restrictions result in a significant decrease in operative experience. This detriment can be partially alleviated with the institution of a night rotation to better regulate in-house call.

  20. Effects of restricting perioperative use of intravenous chloride on kidney injury in patients undergoing cardiac surgery: the LICRA pragmatic controlled clinical trial.

    PubMed

    McIlroy, David; Murphy, Deirdre; Kasza, Jessica; Bhatia, Dhiraj; Wutzlhofer, Lisa; Marasco, Silvana

    2017-06-01

    The administration of chloride-rich intravenous (IV) fluid and hyperchloraemia have been associated with perioperative renal injury. The aim of this study was to determine whether a comprehensive perioperative protocol for the administration of chloride-limited IV fluid would reduce perioperative renal injury in adults undergoing cardiac surgery. From February 2014 through to December 2015, all adult patients undergoing cardiac surgery within a single academic medical center received IV fluid according to the study protocol. The perioperative protocol governed all fluid administration from commencement of anesthesia through to discharge from the intensive care unit and varied over four sequential periods, each lasting 5 months. In periods 1 and 4 a chloride-rich strategy, consisting of 0.9% saline and 4% albumin, was adopted; in periods 2 and 3, a chloride-limited strategy, consisting of a buffered salt solution and 20% albumin, was used. Co-primary outcomes were peak delta serum creatinine (∆S Cr ) within 5 days after the operation and KDIGO-defined stage 2 or stage 3 acute kidney injury (AKI) within 5 days after the operation. We enrolled and analysed data from 1136 patients, with 569 patients assigned to a chloride-rich fluid strategy and 567 to a chloride-limited one. Compared with a chloride-limited strategy and adjusted for prespecified covariates, there was no association between a chloride-rich perioperative fluid strategy and either peak ∆S Cr , transformed to satisfy the assumptions of multivariable linear regression [regression coefficient 0.03, 95% confidence interval (CI) -0.03 to 0.08); p = 0.39], or stage 2 or 3 AKI (adjusted odds ratio 0.97, 95% CI 0.65-1.47; p = 0.90]. A perioperative fluid strategy to restrict IV chloride administration was not associated with an altered incidence of AKI or other metrics of renal injury in adult patients undergoing cardiac surgery. Clinicaltrials.gov Identifier: NCT02020538.

  1. Multilocus PCR-RFLP profiling in Trypanosoma cruzi I highlights an intraspecific genetic variation pattern.

    PubMed

    Ramírez, Juan David; Duque, María Clara; Montilla, Marleny; Cucunubá, Zulma M; Guhl, Felipe

    2012-12-01

    Chagas disease represents a serious problem in public health. This zoonotic pathology is caused by the kinetoplastid Trypanosoma cruzi which displays a high genetic diversity falling into six Discrete Typing Units (TcI-TcVI). In Colombia, the prevalent DTU is TcI with findings of TcII, TcIII and TcIV in low proportions. The aim of this work was to observe the genetic variability within TcI using a multilocus PCR-RFLP strategy. We analyzed 70 single-celled clones from triatomines, reservoirs and humans that were amplified and restricted via ten PCR-RFLPs targets across TcI genome, the restriction fragments were used to construct phylograms according to calculated genetic distances. We obtained five polymorphic targets (1f8, HSP60, HSP70, SAPA and H1) and the consensus tree constructed according to these regions allowed us to observe two well-defined groups with close association to the transmission cycles (domestic/peridomestic and sylvatic) of Chagas disease in Colombia. Our findings allowed us to corroborate the previous reported genotypes based on the intergenic region of mini-exon gene. More studies examining the genetic diversity among T. cruzi I populations must be conducted in order to obtain a better understanding in regions where this DTU is endemic. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Affective temperament in the eating disorders.

    PubMed

    Ramacciotti, C E; Paoli, R A; Ciapparelli, A; Marcacci, G; Placidi, G E; Dell'Osso, L; Garfinkel, P E

    2004-06-01

    In this study, we investigate the affective temperamental characteristics in a sample of ED (eating disorder) patients. 49 ED patients diagnosed by the SCID (Structured Clinical Interview for DSM-IV), were divided into two groups on the basis of the presence or absence of Binge Eating (restricting-anorexia nervosa [R-AN]= 16; Binge Eaters= 33). All patients were administered the TEMPS-I (Temperament Evaluation Memphis Pisa Semistructured - Interview), to assess affective temperament. A third group of controls (N= 1010), derived from a study with the TEMPS-I on normal subjects, was included for comparison. A full affective temperament was not found in patients of the restricting group. By contrast 24% of the binge eating group had a full affective temperament of one of three types. Comparing the three temperaments for the three groups, only cyclothymic temperament proved to be significant, with higher levels in the binge eating group (p<0.01). In this study, people with R-AN do not show a full affective temperament. However, people with binge eating, had depressive and hyperthymic temperament, and displayed higher level of cyclothymic temperament than the normal population. The findings of this study add to a growing literature on temperament in people with ED; particularly, they add to the view that may be various paths leading to R-AN, and these may differ from those of binge eating.

  3. Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

    NASA Astrophysics Data System (ADS)

    Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

    2018-03-01

    We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

  4. Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

    NASA Technical Reports Server (NTRS)

    Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

    2001-01-01

    Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

  5. From DSM-IV to DSM-5 alcohol use disorder: an overview of epidemiological data.

    PubMed

    Bartoli, Francesco; Carrà, Giuseppe; Crocamo, Cristina; Clerici, Massimo

    2015-02-01

    The fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) has made several changes to criteria for alcohol use disorder (AUD). The objective of this systematic review is to assess if new DSM-5 diagnostic criteria will increase the prevalence rates of AUD in clinical and non-clinical samples as compared with DSM-IV criteria. We searched PubMed, Scopus, and PsycINFO (via ProQuest) electronic databases, with no language restrictions. We included studies with data available on both DSM-IV (and DSM-IV-TR) and DSM-5 AUD in samples of adults, estimating from each study an expected increase in prevalence rates with relevant 95% confidence intervals (CIs). Twelve studies were included in this review. Seven studies showed an increase, two no substantial difference, and three a decrease in AUD prevalence according to DSM-5 diagnostic criteria, with differences in rates (95% CIs) varying between -12.4% (-27.4 to +5.6%) and +61.3% (+46.7 to +77.3%). Additional analyses provided confirmatory results. DSM-5 diagnostic criteria seem to inflate prevalence rates of AUD as compared with DSM-IV. The increasing likelihood of a DSM-5 AUD diagnosis may be explained by the amount of DSM-IV 'diagnostic orphans' which are more prevalent than DSM-IV single-criterion alcohol abuse individuals. Further research should be aimed to study if similar trends are detectable also for other substance use disorders that experienced similar changes in DSM-5 diagnostic criteria. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

    PubMed

    Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

    2017-04-15

    Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

  7. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

    PubMed Central

    Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

    2017-01-01

    ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

  8. Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

    PubMed

    Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

    2013-11-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  9. Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

    USDA-ARS?s Scientific Manuscript database

    The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

  10. A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

    PubMed

    Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

    2018-03-09

    Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

  11. Colorectal laterally spreading tumors show characteristic expression of cell polarity factors, including atypical protein kinase C λ/ι, E-cadherin, β-catenin and basement membrane component.

    PubMed

    Ichikawa, Yasushi; Nagashima, Yoji; Morioka, Kaori; Akimoto, Kazunori; Kojima, Yasuyuki; Ishikawa, Takashi; Goto, Ayumu; Kobayashi, Noritoshi; Watanabe, Kazuteru; Ota, Mitsuyoshi; Fujii, Shoichi; Kawamata, Mayumi; Takagawa, Ryo; Kunizaki, Chikara; Takahashi, Hirokazu; Nakajima, Atsushi; Maeda, Shin; Shimada, Hiroshi; Inayama, Yoshiaki; Ohno, Shigeo; Endo, Itaru

    2014-09-01

    Colorectal flat-type tumors include laterally spreading tumors (LSTs) and flat depressed-type tumors. The former of which shows a predominant lateral spreading growth rather than an invasive growth. The present study examined the morphological characteristics of LSTs, in comparison with polypoid- or flat depressed-type tumors, along with the expression of atypical protein kinase C (aPKC) λ/ι, a pivotal cell polarity regulator, and the hallmarks of cell polarity, as well as with type IV collagen, β-catenin and E-cadherin. In total, 37 flat-type (24 LSTs and 13 flat depressed-type tumors) and 20 polypoid-type colorectal tumors were examined. The LSTs were classified as 15 LST adenoma (LST-A) and nine LST cancer in adenoma (LST-CA). An immunohistochemical examination was performed on aPKC λ/ι, type IV collagen, β-catenin and E-cadherin. The LST-A and -CA showed a superficial replacing growth pattern, with expression of β-catenin and E-cadherin in the basolateral membrane and type IV collagen along the basement membrane. In addition, 86.6% of LST-A and 55.6% of LST-CA showed aPKC λ/ι expression of 1+ (weak to normal intensity staining in the cytoplasm compared with the normal epithelium). Furthermore, ~45% of the polypoid-type adenomas showed 2+ (moderate intensity staining in the cytoplasm and/or nucleus) and 66.7% of the polypoid-type cancer in adenoma were 3+ (strong intensity staining in the cytoplasm and nucleus). A statistically significant positive correlation was observed between the expression of aPKC λ/ι and β-catenin (r=0.842; P<0.001), or type IV collagen (r=0.823; P<0.001). The LSTs showed a unique growth pattern, different from the expanding growth pattern presented by a polypoid tumor and invasive cancer. The growth characteristics of LST appear to be caused by adequate coexpression of β-catenin, type IV collagen and aPKC λ/ι.

  12. Exploring new classification criteria for the earliest type stars: the 3400 Aregion

    NASA Astrophysics Data System (ADS)

    Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

    2002-02-01

    We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

  13. A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

    2018-04-01

    A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

  14. Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

    PubMed

    Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

    2014-04-01

    There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

  15. A study of lip print pattern in Goan dental students - A digital approach.

    PubMed

    Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

    2012-10-01

    To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

  16. Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

    PubMed

    Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

    2006-12-01

    Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

  17. Anomalous ionization seen in the spectra of B supergiants

    NASA Technical Reports Server (NTRS)

    Cassinelli, J. P.; Abbott, D. C.

    1981-01-01

    An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

  18. Thermoregulation and Stress Hormone Recovery After Exercise Dehydration: Comparison of Rehydration Methods

    PubMed Central

    McDermott, Brendon P.; Casa, Douglas J.; Lee, Elaine; Yamamoto, Linda; Beasley, Kathleen; Emmanuel, Holly; Anderson, Jeffrey; Pescatello, Linda; Armstrong, Lawrence E.; Maresh, Carl

    2013-01-01

    Context: Athletic trainers recommend and use a multitude of rehydration (REHY) methods with their patients. The REHY modality that most effectively facilitates recovery is unknown. Objective: To compare 5 common REHY methods for thermoregulatory and stress hormone recovery after exercise dehydration (EXDE) in trained participants. Design: Randomized, cross-over, controlled study. Patients or Other Participants: Twelve physically active, non–heat-acclimatized men (age = 23 ± 4 years, height = 180 ± 6 cm, mass = 81.3 ± 3.7 kg, V̇o2max = 56.9 ± 4.4 mL·min−1·kg−1, body fat = 7.9% ± 3%) participated. Intervention(s): Participants completed 20-hour fluid restriction and 2-hour EXDE; they then received no fluid (NF) or REHY (half-normal saline) via ad libitum (AL), oral (OR), intravenous (IV), or combination IV and OR (IV + OR) routes for 30 minutes; and then were observed for another 30 minutes. Main Outcome Measure(s): Body mass, rectal temperature, 4-site mean weighted skin temperature, plasma stress hormone concentrations, and environmental symptoms questionnaire (ESQ) score. Results: Participants were hypohydrated (body mass −4.23% ± 0.22%) post-EXDE. Rectal temperature for the NF group was significantly greater than for the IV group (P = .023) at 30 minutes after beginning REHY (REHY30) and greater than OR, IV, and IV + OR (P ≤ .009) but not AL (P = .068) at REHY60. Mean weighted skin temperature during AL was less than during IV + OR at REHY5 (P = .019). The AL participants demonstrated increased plasma cortisol concentrations compared with IV + OR, independent of time (P = .015). No differences existed between catecholamine concentrations across treatments (P > .05). The ESQ score was increased at REHY60 for NF, AL, OR, and IV (P < .05) but not for IV + OR (P = .217). The NF ESQ score was greater than that of IV + OR at REHY60 (P = .012). Conclusions: Combination IV + OR REHY reduced body temperature to a greater degree than OR and AL REHY when compared with NF. Future studies addressing clinical implications are needed. PMID:24143900

  19. SOME COMMENTS ON TYPE IV BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, H.; Kakinuma, T.

    1962-01-01

    It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

  20. Singular cosmological evolution using canonical and ghost scalar fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

    2015-09-01

    We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

  1. Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

    PubMed

    Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

    2018-02-06

    Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

  2. Memory assessment and depression: testing for factor structure and measurement invariance of the Wechsler Memory Scale-Fourth Edition across a clinical and matched control sample.

    PubMed

    Pauls, Franz; Petermann, Franz; Lepach, Anja Christina

    2013-01-01

    Between-group comparisons are permissible and meaningfully interpretable only if diagnostic instruments are proved to measure the same latent dimensions across different groups. Addressing this issue, the present study was carried out to provide a rigorous test of measurement invariance. Confirmatory factor analyses were used to determine which model solution could best explain memory performance as measured by the Wechsler Memory Scale-Fourth Edition (WMS-IV) in a clinical depression sample and in healthy controls. Multigroup confirmatory factor analysis was conducted to evaluate the evidence for measurement invariance. A three-factor model solution including the dimensions of auditory memory, visual memory, and visual working memory was identified to best fit the data in both samples, and measurement invariance was partially satisfied. The results supported clinical utility of the WMS-IV--that is, auditory and visual memory performances of patients with depressive disorders are interpretable on the basis of the WMS-IV standardization data. However, possible differences in visual working memory functions between healthy and depressed individuals could restrict comparisons of the WMS-IV working memory index.

  3. Creation of a type IIS restriction endonuclease with a long recognition sequence

    PubMed Central

    Lippow, Shaun M.; Aha, Patti M.; Parker, Matthew H.; Blake, William J.; Baynes, Brian M.; Lipovšek, Daša

    2009-01-01

    Type IIS restriction endonucleases cleave DNA outside their recognition sequences, and are therefore particularly useful in the assembly of DNA from smaller fragments. A limitation of type IIS restriction endonucleases in assembly of long DNA sequences is the relative abundance of their target sites. To facilitate ligation-based assembly of extremely long pieces of DNA, we have engineered a new type IIS restriction endonuclease that combines the specificity of the homing endonuclease I-SceI with the type IIS cleavage pattern of FokI. We linked a non-cleaving mutant of I-SceI, which conveys to the chimeric enzyme its specificity for an 18-bp DNA sequence, to the catalytic domain of FokI, which cuts DNA at a defined site outside the target site. Whereas previously described chimeric endonucleases do not produce type IIS-like precise DNA overhangs suitable for ligation, our chimeric endonuclease cleaves double-stranded DNA exactly 2 and 6 nt from the target site to generate homogeneous, 5′, four-base overhangs, which can be ligated with 90% fidelity. We anticipate that these enzymes will be particularly useful in manipulation of DNA fragments larger than a thousand bases, which are very likely to contain target sites for all natural type IIS restriction endonucleases. PMID:19304757

  4. Goodpasture's autoimmune disease - A collagen IV disorder.

    PubMed

    Pedchenko, Vadim; Richard Kitching, A; Hudson, Billy G

    2018-05-12

    Goodpasture's (GP) disease is an autoimmune disorder characterized by the deposition of pathogenic autoantibodies in basement membranes of kidney and lung eliciting rapidly progressive glomerulonephritis and pulmonary hemorrhage. The principal autoantigen is the α345 network of collagen IV, which expression is restricted to target tissues. Recent discoveries include a key role of chloride and bromide for network assembly, a novel posttranslational modification of the antigen, a sulfilimine bond that crosslinks the antigen, and the mechanistic role of HLA in genetic susceptibility and resistance to GP disease. These advances provide further insights into molecular mechanisms of initiation and progression of GP disease and serve as a basis for developing of novel diagnostic tools and therapies for treatment of Goodpasture's disease. Copyright © 2017. Published by Elsevier B.V.

  5. Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

    PubMed

    Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

    2002-09-01

    With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

  6. Pros and Cons While Looking Through an Asian Window on the Rome IV Criteria for Irritable Bowel Syndrome: Pros.

    PubMed

    Ghoshal, Uday C

    2017-07-30

    A decade after Rome III, in 2016, Rome IV criteria were published. There are major differences between Rome IV and the earlier iteration, some of which are in line with Asian viewpoints. The clinical applicability of the Rome IV criteria of irritable bowel syndrome (IBS) in Asian perspective is reviewed here. Instead of considering functional gastrointestinal disorders (FGIDs) to be largely psychogenic, Rome IV suggested the importance of the gut over brain ("disorders of gut-brain interaction" not "brain-gut interaction"). The word "functional" is underplayed. Multi-dimensional clinical profile attempts to recognize micro-organic nature, like slow colon transit and fecal evacuation disorders in constipation and dietary intolerance including that of lactose and fructose, bile acid malabsorption, non-celiac wheat sensitivity, small intestinal bacterial overgrowth, and gastrointestinal infection in diarrhea. Overlap between different FGIDs has been recognized as Rome IV suggests these to be a spectrum rather than discrete disorders. Bloating, common in Asia, received attention, though less. Sub-typing of IBS may be more clinician-friendly now as the patient-reported stool form may be used than a diary. However, a few issues, peculiar to Asia, need consideration; Rome IV, like Rome III, suggests that Bristol type I-II stool to denote constipation though Asian experts include type III as well. Work-up for physiological factors should be given greater importance. Language issue is important. Bloating, common in IBS, should be listed in the criteria. Threshold values for symptoms in Rome IV criteria are based on Western data. Post-infectious malabsorption (tropical sprue) should be excluded to diagnose post-infectious IBS, particularly in Asia.

  7. Lessons Learned on Bioaugmentation of DNAPL Source Zone Areas

    DTIC Science & Technology

    2007-10-01

    but rather have stringers, ganglia or blobs that can create an “effective pool length”. As the leading edge of these discontinuous DNAPL free-phases...terminal restriction fragment length polymorphism (T-RFLP), denaturing gradient gel electrophoresis (DGGE), and fluorescent in situ hybridization ( FISH ...question of interest (e.g. PCR, FISH , DGGE); (ii) sampling location(s); (iii) an appropriate sampling procedure; and (iv) an appropriate sample handling

  8. 45 CFR 233.107 - Restriction in payment to households headed by a minor parent.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... responsibility for the care and control of the minor parent and dependent child or the provision of supportive... title IV-A State plan may provide that a minor parent and the dependent child in his or her care must... parent or legal guardian for a period of at least one year before either the birth of the dependent child...

  9. 45 CFR 233.107 - Restriction in payment to households headed by a minor parent.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... responsibility for the care and control of the minor parent and dependent child or the provision of supportive... title IV-A State plan may provide that a minor parent and the dependent child in his or her care must... parent or legal guardian for a period of at least one year before either the birth of the dependent child...

  10. 45 CFR 233.107 - Restriction in payment to households headed by a minor parent.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... responsibility for the care and control of the minor parent and dependent child or the provision of supportive... title IV-A State plan may provide that a minor parent and the dependent child in his or her care must... parent or legal guardian for a period of at least one year before either the birth of the dependent child...

  11. 45 CFR 233.107 - Restriction in payment to households headed by a minor parent.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... responsibility for the care and control of the minor parent and dependent child or the provision of supportive... title IV-A State plan may provide that a minor parent and the dependent child in his or her care must... parent or legal guardian for a period of at least one year before either the birth of the dependent child...

  12. 46 CFR 27.211 - What are the specifications for fuel systems on towing vessels whose construction was contracted...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... construction was contracted for on or after January 18, 2000? (a) You must ensure that, except for the... restrictions. Neither you nor the master or person in charge may use fuel other than bunker C or diesel, except...; (iv) Is fabricated with an inner tube and a cover of synthetic rubber or other suitable material...

  13. Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

    PubMed

    Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

    2017-10-17

    Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  14. Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

    PubMed

    Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

    2008-05-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

  15. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Technical Reports Server (NTRS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-01-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  16. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Astrophysics Data System (ADS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-08-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  17. Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

    PubMed

    Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

    2003-03-01

    Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

  18. Electron microscopic studies of bacteriophage M13 DNA replication. [Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Allison, D.P.; Ganesan, A.T.; Olson, A.C.

    Intracellular forms of M13 phage DNA isolated after infection of Escherichia coli with wild-type phage have been studied by electron microscopy and ultracentrifugation. The data indicate the involvement of rolling-circle intermediates in single-stranded DNA synthesis. In addition to single-stranded, circular DNA, we observed covalently closed and nicked replicative-form (RF) DNAs, dimer RF DNAs, concatenated RF DNAs, RF DNAs with single-stranded tails (sigma, rolling circles), and, occasionally, RF DNAs with theta structures. The tails in sigma molecules are always single stranded and are never longer than the DNA from mature phage; the proportion of sigma to other RF molecules does notmore » change significantly with time after infection. The origin of single-stranded DNA synthesis has been mapped by electron microscopy at a unique location on RF DNA by use of partial denaturation mapping and restriction endonuclease digestion. This location is between gene IV and gene II, and synthesis proceeds in a counterclockwise direction on the conventional genetic map.« less

  19. Prenatal diagnosis of xeroderma pigmentosum group A in Japan.

    PubMed

    Moriwaki, Shinichi; Yamashita, Yoshiki; Nakamura, Sachiko; Fujita, Daisuke; Kohyama, Jun; Takigawa, Masahiro; Ohmichi, Masahide

    2012-06-01

    We performed a prenatal diagnosis for 10 fetuses from nine unrelated Japanese xeroderma pigmentosum complementation group A (XP-A) families. All parents had at least one XP-A child (proband) with a homozygous founder mutation (IVS3-1G>C) in the XPA gene. A genetic analysis was performed by a restriction enzyme; AlwNI fragment length polymorphism of polymerase chain reaction (PCR)-amplified DNA, mostly from amniotic fluid (AF) and cultured cells established from AF. However, for the first family, we tried amniocentesis as well as chorionic villus sampling (CVS). Among the 10 cases, we confirmed the results of PCR-based genetic diagnosis by post-ultraviolet survival of amniotic cells in eight cases. Unfortunately, 6 weeks after CVS and 4 days after the amniocentesis in the first case we examined, the fetus died in utero, the reason for which remains unexplained. We prenatally determined two XP-A cases, six XP-A carriers and two wild-type fetuses, which appears to be consistent with Mendel's law. © 2011 Japanese Dermatological Association.

  20. Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

    PubMed

    Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

    2013-04-01

    Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

  1. A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

    PubMed

    Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

    2017-12-01

    The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  2. Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

    PubMed

    Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

    2017-08-01

    We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. A comparison of outcomes according to different diagnostic systems for delirium (DSM-5, DSM-IV, CAM, and DRS-R98).

    PubMed

    Adamis, Dimitrios; Meagher, David; Rooney, Siobhan; Mulligan, Owen; McCarthy, Geraldine

    2018-04-01

    ABSTRACTStudies indicate that DSM-5 criteria for delirium are relatively restrictive, and identify different cases of delirium compared with previous systems. We evaluate four outcomes of delirium (mortality, length of hospital stay, institutionalization, and cognitive improvement) in relation to delirium defined by different DSM classification systems.Prospective, longitudinal study of patients aged 70+ admitted to medical wards of a general hospital. Participants were assessed up to a maximum of four times during two weeks, using DSM-5 and DSM-IV criteria, DRS-R98 and CAM scales as proxies for DSM III-R and DSM III.Of the 200 assessed patients (mean age 81.1, SD = 6.5; and 50% female) during hospitalization, delirium was identified in 41 (20.5%) using DSM-5, 45 (22.5%) according to DSM-IV, 46 (23%) with CAM positive, and 37 (18.5%) with DRS-R98 severity score >15. Mortality was significantly associated with delirium according to any classification system, but those identified with DSM-5 were at greater risk. Length of stay was significantly longer for those with DSM-IV delirium. Discharge to a care home was associated only with DRS-R98 defined delirium. Cognitive improvement was only associated with CAM and DSM-IV. Different classification systems for delirium identify populations with different outcomes.

  4. Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

    DOE PAGES

    Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

    2015-03-01

    Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

  5. Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

    PubMed

    Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

    2015-10-01

    Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  6. Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

    ClinicalTrials.gov

    2014-02-14

    Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

  7. Specific Phobia among U.S. Adolescents: Phenomenology and Typology

    PubMed Central

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2014-01-01

    Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

  8. Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

    PubMed

    Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

    2002-12-06

    Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

  9. On the interrelation of multiplication and division in secondary school children.

    PubMed

    Huber, Stefan; Fischer, Ursula; Moeller, Korbinian; Nuerk, Hans-Christoph

    2013-01-01

    Each division problem can be transformed into as a multiplication problem and vice versa. Recent research has indicated strong developmental parallels between multiplication and division in primary school children. In this study, we were interested in (i) whether these developmental parallels persist into secondary school, (ii) whether similar developmental parallels can be observed for simple and complex problems, (iii) whether skill level modulates this relationship, and (iv) whether the correlations are specific and not driven by general cognitive or arithmetic abilities. Therefore, we assessed performance of 5th and 6th graders attending two secondary school types of the German educational system in simple and complex multiplication as well as division while controlling for non-verbal intelligence, short-term memory, and other arithmetic abilities. Accordingly, we collected data from students differing in skills levels due to either age (5th < 6th grade) or school type (general < intermediate secondary school). We observed moderate to strong bivariate and partial correlations between multiplication and division with correlations being higher for simple tasks but nevertheless reliable for complex tasks. Moreover, the association between simple multiplication and division depended on students' skill levels as reflected by school types, but not by age. Partial correlations were higher for intermediate than for general secondary school children. In sum, these findings emphasize the importance of the inverse relationship between multiplication and division which persists into later developmental stages. However, evidence for skill-related differences in the relationship between multiplication and division was restricted to the differences for school types.

  10. Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

    1994-01-01

    High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

  11. Functional cooperation between exonucleases and endonucleases—basis for the evolution of restriction enzymes

    PubMed Central

    Raghavendra, Nidhanapathi K.; Rao, Desirazu N.

    2003-01-01

    Many types of restriction enzymes cleave DNA away from their recognition site. Using the type III restriction enzyme, EcoP15I, which cleaves DNA 25–27 bp away from its recognition site, we provide evidence to show that an intact recognition site on the cleaved DNA sequesters the restriction enzyme and decreases the effective concentration of the enzyme. EcoP15I restriction enzyme is shown here to perform only a single round of DNA cleavage. Significantly, we show that an exonuclease activity is essential for EcoP15I restriction enzyme to perform multiple rounds of DNA cleavage. This observation may hold true for all restriction enzymes cleaving DNA sufficiently far away from their recognition site. Our results highlight the importance of functional cooperation in the modulation of enzyme activity. Based on results presented here and other data on well-characterised restriction enzymes, a functional evolutionary hierarchy of restriction enzymes is discussed. PMID:12655005

  12. Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

    PubMed

    Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

    2006-04-01

    A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

  13. Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

    PubMed

    Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

    2013-11-22

    Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. A comparison of delirium diagnosis in elderly medical inpatients using the CAM, DRS-R98, DSM-IV and DSM-5 criteria.

    PubMed

    Adamis, Dimitrios; Rooney, Siobhan; Meagher, David; Mulligan, Owen; McCarthy, Geraldine

    2015-06-01

    The recently published DSM-5 criteria for delirium may lead to different case identification and rates of delirium than previous classifications. The aims of this study are to determine how the new DSM-5 criteria compare with DSM-IV in identification of delirium in elderly medical inpatients and to investigate the agreement between different methods, using CAM, DRS-R98, DSM-IV, and DSM-5 criteria. Prospective, observational study of elderly patients aged 70+ admitted under the acute medical teams in a regional general hospital. Each participant was assessed within 3 days of admission using the DSM-5, and DSM-IV criteria plus the DRS-R98, and CAM scales. We assessed 200 patients [mean age 81.1±6.5; 50% female; pre-existing cognitive impairment in 63%]. The prevalence rates of delirium for each diagnostic method were: 13.0% (n = 26) for DSM-5; 19.5% (n = 39) for DSM-IV; 13.5% (n = 27) for DRS-R98 and 17.0%, (n = 34) for CAM. Using tetrachoric correlation coefficients the agreement between DSM-5 and DSM-IV was statistically significant (ρtetr = 0.64, SE = 0.1, p < 0.0001). Similar significant agreement was found between the four methods. DSM-IV is the most inclusive diagnostic method for delirium, while DSM-5 is the most restrictive. In addition, these classification systems identify different cases of delirium. This could have clinical, financial, and research implications. However, both classification systems have significant agreement in the identification of the same concept (delirium). Clarity of diagnosis is required for classification but also further research considering the relevance in predicting outcomes can allow for more detailed evaluation of the DSM-5 criteria.

  15. Psychological characteristics of eating disorders as evidenced by the combined administration of questionnaires and two projective methods: the Tree Drawing Test (Baum Test) and the Sentence Completion Test.

    PubMed

    Mizuta, Ichiro; Inoue, Yoichi; Fukunaga, Tomoko; Ishi, Ryohei; Ogawa, Asao; Takeda, Masatoshi

    2002-02-01

    The objective of this study is to examine psychological/psychopathological characteristics of eating disorders and their subtypes through a combined administration of questionnaires and projective tests. Three questionnaires (Eating Disorder Inventory - 2, Social Adaptation Scale, Southern California University Eating Disorder Inventory - Revised) and two projective tests (the Tree Drawing Test [TDT, Baum Test], and the Sentence Completion Test [SCT]) were administered to 126 female patients between the ages of 15 and 30 years, with eating disorders according to DSM-IV criteria at our outpatient clinic, and to 54 sex- and age-matched control subjects. The purging subtypes of eating disorders (anorexia nervosa - binge-eating/purging type [ANBP] and bulimia nervosa - purging type [BNP]) were clearly differentiated from the controls, both by the questionnaires and the projective tests. Compared with the controls, ANBP/BNP showed more problematic profiles across the three questionnaires, drew smaller and poorer trees in TDT to a more left location on the drawing paper, and gave fewer positive, and more negative responses in SCT. In contrast, few significant differences were found between anorexia nervosa- restricting type (ANR) and the controls, and between ANBP and BNP. As a trend, however, ANR was consistently located between the controls and ANBP/BNP across the whole questionnaires and projective tests.

  16. 36 CFR 292.45 - Use of motorized and non-motorized rivercraft.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... practicable, conflicts between motorized and non-motorized rivercraft users and between both types of...-motorized rivercraft may be permitted subject to restrictions on size, type of craft, numbers, duration... Service where such activity may be permitted subject to restrictions on size, type of craft, numbers...

  17. Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

    PubMed

    Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

    2016-10-01

    The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

  18. The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

    PubMed

    Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

    2012-06-01

    The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

  19. Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

    PubMed Central

    Watanabe, Ikuya; Wallace, Cameron

    2008-01-01

    The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

  20. Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

    PubMed Central

    Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

    2007-01-01

    Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

  1. Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

    PubMed Central

    Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

    2014-01-01

    Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

  2. Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

    PubMed

    Breadon, Jonith Y; Barnes, Chad A

    2007-01-01

    Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

  3. Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

    PubMed

    Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

    2017-09-01

    Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. definitions.xsd

    MedlinePlus

    ... name="title" use="required">

  5. Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

    ERIC Educational Resources Information Center

    Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

    2015-01-01

    In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

  6. Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

    PubMed

    Lees, George E

    2013-01-01

    To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

  7. ACGME case logs: Surgery resident experience in operative trauma for two decades

    PubMed Central

    Drake, Frederick Thurston; Van Eaton, Erik G.; Huntington, Ciara R.; Jurkovich, Gregory J.; Aarabi, Shahram; Gow, Kenneth W.

    2014-01-01

    BACKGROUND Surgery resident education is based on experiential training, which is influenced by changes in clinical management strategies, technical and technologic advances, and administrative regulations. Trauma care has been exposed to each of these factors, prompting concerns about resident experience in operative trauma. The current study analyzed the reported volume of operative trauma for the last two decades; to our knowledge, this is the first evaluation of nationwide trends during such an extended time line. METHODS The Accreditation Council for Graduate Medical Education (ACGME) database of operative logs was queried from academic year (AY) 1989–1990 to 2009–2010 to identify shifts in trauma operative experience. Annual case log data for each cohort of graduating surgery residents were combined into approximately 5-year blocks, designated Period I (AY1989–1990 to AY1993–1994), Period II (AY1994–1995 to AY1998–1999), Period III (AY1999–2000 to AY2002–2003), and Period IV (AY2003–2004 to AY2009–2010). The latter two periods were delineated by the year in which duty hour restrictions were implemented. RESULTS Overall general surgery caseload increased from Period I to Period II (p < 0.001), remained stable from Period II to Period III, and decreased from Period III to Period IV (p < 0.001). However, for ACGME-designated trauma cases, there were significant declines from Period I to Period II (75.5 vs. 54.5 cases, p < 0.001) and Period II to Period III (54.5 vs. 39.3 cases, p < 0.001) but no difference between Period III and Period IV (39.3 vs. 39.4 cases). Graduating residents in Period I performed, on average, 31 intra-abdominal trauma operations, including approximately five spleen and four liver operations. Residents in Period IV performed 17 intra-abdominal trauma operations, including three spleen and approximately two liver operations. CONCLUSION Recent general surgery trainees perform fewer trauma operations than previous trainees. The majority of this decline occurred before implementation of work-hour restrictions. Although these changes reflect concurrent changes in management of trauma, surgical educators must meet the challenge of training residents in procedures less frequently performed. LEVEL OF EVIDENCE Epidemiologic study, level III; therapeutic study, level IV. PMID:23188243

  8. Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

    PubMed

    Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

    2014-05-01

    Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Placentomal differentiation may compensate for maternal nutrient restriction in ewes adapted to harsh range conditions.

    PubMed

    Vonnahme, K A; Hess, B W; Nijland, M J; Nathanielsz, P W; Ford, S P

    2006-12-01

    Maternal nutrient restriction from early to midgestation can lead to fetal growth retardation, with long-term impacts on offspring growth, physiology, and metabolism. We hypothesized that ewes from flocks managed under markedly different environmental conditions and levels of nutrition might differ in their ability to protect their own fetus from a bout of maternal nutrient restriction. We utilized multiparous ewes of similar breeding, age, and parity from 2 flocks managed as 1) ewes adapted to a nomadic existence and year-long, limited nutrition near Baggs, WY (Baggs ewes), and 2) University of Wyoming ewes with a sedentary lifestyle and continuous provision of more than adequate nutrition (UW ewes). Groups of Baggs ewes and UW ewes were fed 50 (nutrient restricted) or 100% (control fed) of National Research Council recommendations from d 28 to 78 of gestation, then necropsied, and fetal and placental data were obtained. Although there was a marked decrease (P < 0.05) in fetal weight and blood glucose concentrations in nutrient-restricted vs. control fed UW ewes, there was no difference in these fetal measurements between nutrient-restricted and control-fed Baggs ewes. Nutrient-restricted and control-fed UW ewes exhibited predominantly type A placentomes on d 78, but there were fewer (P c0.05) type A and greater (P < 0.05) numbers of type B, C, and D placentomes in nutrient-restricted than control-fed Baggs ewes. Placental efficiency (fetal weight/placentomal weight) was reduced (P = 0.04) in d 78 nutrient-restricted UW ewes when compared with control-fed UW ewes. In contrast, nutrient-restricted and control-fed Baggs ewes exhibited similar placental efficiencies on d 78. This is the first report of different placental responses to a nutritional challenge during pregnancy when ewes were selected under different management systems. These data are consistent with the concept that Baggs ewes or their conceptuses, which were adapted to both harsh environments and limited nutrition, initiated conversion of type A placentomes to other placentomal types when subjected to an early to mid-gestational nutrient restriction, whereas this conversion failed to occur in UW ewes. This early placentomal conversion in the Baggs ewes may function to maintain normal nutrient delivery to their developing fetuses during maternal nutrient restriction.

  10. Under-armed, Overtorqued, Unafraid: A Study of the Aeroscout Employment Evolution in Vietnam

    DTIC Science & Technology

    2011-06-10

    General Staff College or any other governmental agency. (References to this study should include the foregoing statement.) iv ABSTRACT UNDER...regarding the development and fielding of new equipment, and personal and government accounts of application in combat, no narratives bridge the gap and...arguments over the separate Air Force to the agreements between services that early on served to restrict Army rotary-wing aviation. Government

  11. Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

    PubMed

    Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

    2010-08-01

    A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

  12. Switching to the bingeing/purging subtype of anorexia nervosa is frequently associated with suicidal attempts.

    PubMed

    Foulon, C; Guelfi, J D; Kipman, A; Adès, J; Romo, L; Houdeyer, K; Marquez, S; Mouren, M C; Rouillon, F; Gorwood, P

    2007-11-01

    Anorexia nervosa has the highest suicide mortality ratio of psychiatric disorders, suicide being associated with many factors. We assessed the first lifetime occurrence of these factors taking into account their possible overlap. Three hundred and four in- and out-patients with anorexia nervosa (DSM-IV) were systematically recruited in three hospitals of Paris suburbs, between December 1999 and January 2003. Patients were assessed by a face-to-face interview (DIGS). Current eating disorder dimensions were measured, and patients interviewed by a trained clinician to assess minimal BMI and, retrospectively, the age at which anorexia nervosa, major depressive disorder, anxiety disorders and switch to bingeing/purging type occurred for the first time, if applicable. Major depressive disorder (p<0.001) and subtype switch from the restrictive to the bingeing/purging type (p<0.001) were the two factors significantly more frequently occurring before suicidal attempts, and remained involved when a multivariate analysis is performed, whether syndromic or dimensional measures are being used. Taking into account lifetime occurrence with a survival analysis, the switch to bingeing/purging type of anorexia appears as a major predictive factor, with a large increase of the frequency of suicidal attempts (OR=15) when compared to patients with neither major depressive disorder nor bingeing/purging type. Bingeing/purging type of anorexia nervosa is largely associated with suicidal attempts, and may deserve specific attention. If confirmed on a prospectively designed study, these results would argue for early detection and/or more intensive and specific therapeutic intervention on this aspect of bingeing and purging behaviors.

  13. Level III and IV Ecoregions by State

    EPA Pesticide Factsheets

    Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  14. Level III and IV Ecoregions by EPA Region

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  15. Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

    PubMed

    Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

    2010-11-01

    Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  16. Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

    PubMed Central

    Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

    2013-01-01

    Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

  17. A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

    PubMed

    Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

    2005-03-01

    To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

  18. A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

    PubMed

    Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

    2016-03-01

    The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  19. Assessing Restrictiveness: A Closer Look at the Foster Care Placements and Perceptions of Youth With and Without Disabilities Aging Out of Care

    PubMed Central

    Cunningham, Miranda; Dalton, Lawrence D.; Powers, Laurie E.; Geenen, Sarah; Orozco, Claudia Guadalupe

    2014-01-01

    The aim of the study was to examine the experience of restrictiveness among transition-aged youth with disabilities in foster care. Utilizing a sample of 207 youth, placement types were explored for differences in disability status, race and sex. Further, youth perceptions of restriction around communication, movement around one’s home, and access to the community were examined for youth receiving special education services (SPED), youth receiving developmental disability services (DD), and youth without disabilities. Youth with disabilities were more likely to be placed in more restrictive placement types and had significantly higher levels of perceived restriction around communication, movement, and community when compared to youth without disabilities. Additionally, males with disabilities experienced higher levels of restrictiveness, particularly those who received DD services, while White youth with disabilities also experienced greater community restrictiveness. PMID:24489523

  20. Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

    NASA Astrophysics Data System (ADS)

    Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

    2018-04-01

    We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

  1. The effects of graded levels of calorie restriction: IV. Non-linear change in behavioural phenotype of mice in response to short-term calorie restriction.

    PubMed

    Lusseau, David; Mitchell, Sharon E; Barros, Ceres; Derous, Davina; Green, Cara; Chen, Luonan; Han, Jing-Dong Jackie; Wang, Yingchun; Promislow, Daniel E L; Douglas, Alex; Speakman, John R

    2015-08-25

    Animals have to adjust their activities when faced with caloric restriction (CR) to deal with reduced energy intake. If CR is pronounced, allostasis can push individuals into alternate physiological states which can result in important health benefits across a wide range of taxa. Here we developed a new approach to determine the changes in behavioural phenotype associated with different levels of CR. We exposed C57BL/6 male mice to graded CR (from 0 to 40%) for three months and defined their behavioural phenotype using hidden Markov models of their movement and body temperature. All 40% CR mice exhibited a state-shift in behavioural phenotype and only some exposed to 30% CR did. We show for the first time that mice changed their activity characteristics rather than changed their activities. This new phenotyping approach provides an avenue to determine the mechanisms linking CR to healthspan.

  2. The influence of rehydration mode after exercise dehydration on cardiovascular function.

    PubMed

    McDermott, Brendon P; Casa, Douglas J; Lee, Elaine C; Yamamoto, Linda M; Beasley, Kathleen N; Emmanuel, Holly; Pescatello, Linda S; Kraemer, William J; Anderson, Jeffrey M; Armstrong, Lawrence E; Maresh, Carl M

    2013-08-01

    Our purpose was to compare the common modes of rehydration (REHY) on cardiovascular and fluid regulation recovery after exercise dehydration (EXDE). Twelve nonheat-acclimatized trained subjects (age: 23 ± 4 years, weight: 81.3 ± 3.7 kg, height: 180 ± 6 cm, V[Combining Dot Above]O2max: 56.9 ± 4.4 ml·min·kg , and body fat: 7.8 ± 3.0%) completed 20-hour fluid restriction and 2-hour EXDE to -4% body mass, and then were rehydrated to -2% body mass in a randomized, crossover design. The REHY methods included no fluid (NF), ad libitum, oral (OR), intravenous (IV), and a combination of IV and OR (IV + OR) of 1/2-normal saline (0.45% NaCl). The REHY occurred for 30 minutes, and the subjects were observed during rest for 30 minutes. Seated, standing, and mean arterial pressure (MAP) and blood pressure (BP) were measured every 15 minutes throughout REHY. Heart rate (HR), plasma arginine vasopressin concentration [AVP], and thirst perception were measured throughout REHY. The EXDE resulted in a body mass loss of 4.32 ± 0.22%. The REHY returned the subjects to -2.13 ± 0.47% body mass for controlled trials. Seated systolic BP was greater for IV + OR compared with that for OR (p = 0.015). Seated systolic BP and MAP during REHY showed that IV + OR was greater than OR, independent of time (p ≤ 0.011). Upon standing, IV + OR demonstrated a greater BP than both NF (p = 0.012) and OR (p = 0.031) did. The HR was reduced by IV and IV + OR to a greater extent than NF at REHY30 and REHY60 (p < 0.05). The IV + OR [AVP] demonstrated a strong trend for decreasing over time (p = 0.054) and was significantly less than NF at REHY60 (p = 0.003). Practical application seeking to restore cardiovascular function after EXDE, the combined use of IV + OR rather than a single REHY method seems to be most expedient.

  3. Momentary Predictors of Insulin Restriction Among Adults With Type 1 Diabetes and Eating Disorder Symptomatology

    PubMed Central

    Dmitrieva, Natalia O.; Honeycutt, Lisa K.; Moskovich, Ashley A.; Lane, James D.; Zucker, Nancy L.; Surwit, Richard S.; Feinglos, Mark; Kuo, Jennifer

    2015-01-01

    OBJECTIVE Individuals with type 1 diabetes who restrict insulin to control weight are at high risk for diabetes-related complications and premature death. However, little is known about this behavior or how to effectively intervene. The aim of the current study was to identify predictors of insulin restriction in the natural environment that might inform new treatment directions. RESEARCH DESIGN AND METHODS Eighty-three adults with type 1 diabetes and a range of eating disorder symptomatology completed 3 days of ecological momentary assessment. Participants reported emotions, eating, and insulin dosing throughout the day using their cellular telephone. Linear mixed models were used to estimate the effects of heightened negative affect (e.g., anxiety) before eating and characteristics of the eating episode (e.g., eating a large amount of food) on the risk of insulin restriction. RESULTS Individuals who reported greater-than-average negative affect (general negative affect and negative affect specifically about diabetes) during the study period were more likely to restrict insulin. Momentary increases in anxiety/nervousness and guilt/disgust with self before eating (relative to an individual’s typical level) further increased the odds of restricting insulin at the upcoming meal. Insulin restriction was more likely when individuals reported that they broke a dietary rule (e.g., “no desserts”). CONCLUSIONS Results suggest that insulin restriction might be decreased by helping patients with type 1 diabetes respond effectively to heightened negative affect (e.g., anxiety, guilt) and encouraging patients to take a less rigid, punitive approach to diabetes management. PMID:26384389

  4. Acute pancreatitis complicating choledochal cysts in children.

    PubMed

    Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

    2017-03-01

    To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  5. Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

    PubMed

    Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

    2012-07-01

    Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

  6. The diagnostic accuracy of multiparametric MRI to determine pediatric brain tumor grades and types.

    PubMed

    Koob, Mériam; Girard, Nadine; Ghattas, Badih; Fellah, Slim; Confort-Gouny, Sylviane; Figarella-Branger, Dominique; Scavarda, Didier

    2016-04-01

    Childhood brain tumors show great histological variability. The goal of this retrospective study was to assess the diagnostic accuracy of multimodal MR imaging (diffusion, perfusion, MR spectroscopy) in the distinction of pediatric brain tumor grades and types. Seventy-six patients (range 1 month to 18 years) with brain tumors underwent multimodal MR imaging. Tumors were categorized by grade (I-IV) and by histological type (A-H). Multivariate statistical analysis was performed to evaluate the diagnostic accuracy of single and combined MR modalities, and of single imaging parameters to distinguish the different groups. The highest diagnostic accuracy for tumor grading was obtained with diffusion-perfusion (73.24%) and for tumor typing with diffusion-perfusion-MR spectroscopy (55.76%). The best diagnostic accuracy was obtained for tumor grading in I and IV and for tumor typing in embryonal tumor and pilocytic astrocytoma. Poor accuracy was seen in other grades and types. ADC and rADC were the best parameters for tumor grading and typing followed by choline level with an intermediate echo time, CBV for grading and Tmax for typing. Multiparametric MR imaging can be accurate in determining tumor grades (primarily grades I and IV) and types (mainly pilocytic astrocytomas and embryonal tumors) in children.

  7. Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

    PubMed

    Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

    2017-12-28

    The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

  8. Specific phobia among U.S. adolescents: phenomenology and typology.

    PubMed

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2012-12-01

    Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  9. Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

    Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

  10. Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

    PubMed Central

    Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

    1996-01-01

    We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

  11. Social network types and well-being among South Korean older adults.

    PubMed

    Park, Sojung; Smith, Jacqui; Dunkle, Ruth E

    2014-01-01

    The social networks of older individuals reflect personal life history and cultural factors. Despite these two sources of variation, four similar network types have been identified in Europe, North America, Japan, and China: namely 'restricted', 'family', 'friend', and 'diverse'. This study identified the social network types of Korean older adults and examined differential associations of the network types with well-being. The analysis used data from the 2008 wave of the Korean Longitudinal Study of Aging (KLoSA: N = 4251, age range 65-108). We used a two-step cluster analytical approach to identify network types from seven indicators of network structure and function. Regression models determined associations between network types and well-being outcomes, including life satisfaction and depressive symptomatology. Cluster analysis of indicators of network structure and function revealed four types, including the restricted, friend, and diverse types. Instead of a family type, we found a couple-focused type. The young-old (age 65-74) were more likely to be in the couple-focused type and more of the oldest old (age 85+) belonged to the restricted type. Compared with the restricted network, older adults in all other networks were more likely to report higher life satisfaction and lower depressive symptomatology. Life course and cohort-related factors contribute to similarities across societies in network types and their associations with well-being. Korean-specific life course and socio-historical factors, however, may contribute to our unique findings about network types.

  12. House again passes ban on abortions at military facilities.

    PubMed

    1996-05-31

    Voting 192-225 on May 14, the House defeated an effort to reverse the current prohibition on privately funded abortions at military facilities except in cases of life endangerment, rape, or incest. Introduced by pro-choice Representatives Rosa DeLauro (D-CT), Jane Harman (D-CA), and Mike Ward (D-KY) and mixed record Representative Peter Torkildsen (R-MA), the amendment to the National Defense Authorization Act (HR 3230) would have repealed restrictive language in the statute that governs the Department of Defense (DOD). Floor action on the provision of non-government-funded abortions mirrored Representative DeLauro's failed attempts to strike the onerous provision during the mark-up process for HR 3230, which received final House approval in a 272-153 vote on May 15. The House National Security Committee voted 26-20 against removing the abortion restriction on May 1, six days after a similar 11-5 vote by the Subcommittee on Military Personnel. The near ban on abortion services has been in effect since December of last year, when the DOD spending bill was implemented; President Clinton signed the legislation permanently encoding the restriction into law in February (see RFN IV/22, V/3-4). Upon taking office in January 1993, President Clinton had issued an executive memorandum directing the Secretary of Defense to reverse the ban on the performance of non-lifesaving, privately funded abortions at military facilities, which had been instituted through agency action in mid-1988 (see RFN II/3, IV/13). The DOD authorization statute has prohibited the use of federal funds for abortions except in cases of life endangerment for more than a decade. full text

  13. Six and 12 Weeks of Caloric Restriction Increases β Cell Function and Lowers Fasting and Postprandial Glucose Concentrations in People with Type 2 Diabetes123

    PubMed Central

    Sathananthan, Matheni; Shah, Meera; Edens, Kim L; Grothe, Karen B; Piccinini, Francesca; Farrugia, Luca P; Micheletto, Francesco; Man, Chiara Dalla; Cobelli, Claudio; Rizza, Robert A; Camilleri, Michael; Vella, Adrian

    2015-01-01

    Background: Caloric restriction alone has been shown to improve insulin action and fasting glucose metabolism; however, the mechanism by which this occurs remains uncertain. Objective: We sought to quantify the effect of caloric restriction on β cell function and glucose metabolism in people with type 2 diabetes. Methods: Nine subjects (2 men, 7 women) with type 2 diabetes [BMI (in kg/m2): 40.6 ± 1.4; age: 58 ± 3 y; glycated hemoglobin: 6.9% ± 0.2%] were studied using a triple-tracer mixed meal after withdrawal of oral diabetes therapy. The oral minimal model was used to measure β cell function. Caloric restriction limited subjects to a pureed diet (<900 kcal/d) for the 12 wk of study. The studies were repeated after 6 and 12 wk of caloric restriction. Results: Fasting glucose concentrations decreased significantly from baseline after 6 wk of caloric restriction with no further reduction after a further 6 wk of caloric restriction (9.8 ± 1.3, 5.9 ± 0.2, and 6.2 ± 0.3 mmol/L at baseline and after 6 and 12 wk of caloric restriction, respectively; P = 0.01) because of decreased fasting endogenous glucose production (EGP: 20.4 ± 1.1, 16.2 ± 0.8, and 17.4 ± 1.1 μmol · kg−1 · min−1 at baseline and after 6 and 12 wk of caloric restriction, respectively; P = 0.03). These changes were accompanied by an improvement in β cell function measured by the disposition index (189 ± 51, 436 ± 68, and 449 ± 67 10−14 dL · kg−1 · min−2 · pmol−1 at baseline and after 6 and 12 wk of caloric restriction, respectively; P = 0.01). Conclusions: Six weeks of caloric restriction lowers fasting glucose and EGP with accompanying improvements in β cell function in people with type 2 diabetes. An additional 6 wk of caloric restriction maintained the improvement in glucose metabolism. This trial was registered at clinicaltrials.gov as NCT01094054. PMID:26246321

  14. In Silico Analysis of Six Known Leishmania major Antigens and In Vitro Evaluation of Specific Epitopes Eliciting HLA-A2 Restricted CD8 T Cell Response

    PubMed Central

    Seyed, Negar; Zahedifard, Farnaz; Safaiyan, Shima; Gholami, Elham; Doustdari, Fatemeh; Azadmanesh, Kayhan; Mirzaei, Maryam; Saeedi Eslami, Nasir; Khadem Sadegh, Akbar; Eslami far, Ali; Sharifi, Iraj; Rafati, Sima

    2011-01-01

    Background As a potent CD8+ T cell activator, peptide vaccine has found its way in vaccine development against intracellular infections and cancer, but not against leishmaniasis. The first step toward a peptide vaccine is epitope mapping of different proteins according to the most frequent HLA types in a population. Methods and Findings Six Leishmania (L.) major-related candidate antigens (CPB,CPC,LmsTI-1,TSA,LeIF and LPG-3) were screened for potential CD8+ T cell activating 9-mer epitopes presented by HLA-A*0201 (the most frequent HLA-A allele). Online software including SYFPEITHI, BIMAS, EpiJen, Rankpep, nHLApred, NetCTL and Multipred were used. Peptides were selected only if predicted by almost all programs, according to their predictive scores. Pan-A2 presentation of selected peptides was confirmed by NetMHCPan1.1. Selected peptides were pooled in four peptide groups and the immunogenicity was evaluated by in vitro stimulation and intracellular cytokine assay of PBMCs from HLA-A2+ individuals recovered from L. major. HLA-A2− individuals recovered from L. major and HLA-A2+ healthy donors were included as control groups. Individual response of HLA-A2+ recovered volunteers as percent of CD8+/IFN-γ+ T cells after in vitro stimulation against peptide pools II and IV was notably higher than that of HLA-A2− recovered individuals. Based on cutoff scores calculated from the response of HLA-A2− recovered individuals, 31.6% and 13.3% of HLA-A2+ recovered persons responded above cutoff in pools II and IV, respectively. ELISpot and ELISA results confirmed flow cytometry analysis. The response of HLA-A2− recovered individuals against peptide pools I and III was detected similar and even higher than HLA-A2+ recovered individuals. Conclusion Using in silico prediction we demonstrated specific response to LmsTI-1 (pool II) and LPG-3- (pool IV) related peptides specifically presented in HLA-A*0201 context. This is among the very few reports mapping L. major epitopes for human HLA types. Studies like this will speed up polytope vaccine idea towards leishmaniasis. PMID:21909442

  15. Level III and IV Ecoregions of the Continental United States

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  16. Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

    PubMed Central

    Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

    2014-01-01

    Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

  17. Integrable Rosochatius deformations of the restricted soliton flows

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou Ruguang

    2007-10-15

    A method to construct integrable Rosochatius deformations of the restricted soliton flows in the setup of Lax formulation is presented. The integrable Rosochatius deformations of the restricted soliton flows such as the restricted Ablowitz-Kaup-Newell-Segur flow, the restricted Tu-Meng flow, the restricted Tu flow with Neumann-type constraints, and the restricted modified Korteweg-de Vries flow, together with their Lax representations, are presented. In addition, a Lax representation of the Jacobi-Rosochatius system is obtained.

  18. The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

    PubMed

    Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

    2007-06-01

    Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

  19. Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

    2006-10-15

    Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

  20. Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

    PubMed

    Dickens, J C; Prestwich, G D

    1989-02-01

    For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

  1. Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

    PubMed

    Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

    2017-03-01

    We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

  2. Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

    PubMed

    Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

    2015-10-01

    To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  3. The structure of the KlcA and ArdB proteins reveals a novel fold and antirestriction activity against Type I DNA restriction systems in vivo but not in vitro

    PubMed Central

    Serfiotis-Mitsa, Dimitra; Herbert, Andrew P.; Roberts, Gareth A.; Soares, Dinesh C.; White, John H.; Blakely, Garry W.; Uhrín, Dušan; Dryden, David T. F.

    2010-01-01

    Plasmids, conjugative transposons and phage frequently encode anti-restriction proteins to enhance their chances of entering a new bacterial host that is highly likely to contain a Type I DNA restriction and modification (RM) system. The RM system usually destroys the invading DNA. Some of the anti-restriction proteins are DNA mimics and bind to the RM enzyme to prevent it binding to DNA. In this article, we characterize ArdB anti-restriction proteins and their close homologues, the KlcA proteins from a range of mobile genetic elements; including an ArdB encoded on a pathogenicity island from uropathogenic Escherichia coli and a KlcA from an IncP-1b plasmid, pBP136 isolated from Bordetella pertussis. We show that all the ArdB and KlcA act as anti-restriction proteins and inhibit the four main families of Type I RM systems in vivo, but fail to block the restriction endonuclease activity of the archetypal Type I RM enzyme, EcoKI, in vitro indicating that the action of ArdB is indirect and very different from that of the DNA mimics. We also present the structure determined by NMR spectroscopy of the pBP136 KlcA protein. The structure shows a novel protein fold and it is clearly not a DNA structural mimic. PMID:20007596

  4. Mass constraints to Sco X-1 from Bowen fluorescence and deep near-infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Mata Sánchez, D.; Muñoz-Darias, T.; Casares, J.; Steeghs, D.; Ramos Almeida, C.; Acosta Pulido, J. A.

    2015-04-01

    More than 50 years after the dawn of X-ray astronomy, the dynamical parameters of the prototypical X-ray binary Sco X-1 are still unknown. We combine a Monte Carlo analysis, which includes all the previously known orbital parameters of the system, along with the K-correction to set dynamical constraints to the masses of the compact object (M1 < 1.73 M⊙) and the companion star (0.28 M⊙ < M2 < 0.70 M⊙). For the case of a canonical neutron star mass of M1 ˜ 1.4 M⊙, the orbital inclination is found to be lower than 40°. We also present the best near-infrared spectrum of the source to date. There is no evidence of donor star features on it, but we are able to constrain the veiling factor as a function of the spectral type of the secondary star. The combination of both techniques restricts the spectral type of the donor to be later than K4 and luminosity class IV. It also constrains the contribution of the companion light to the infrared emission of Sco X-1 to be lower than 33 per cent. This implies that the accretion related luminosity of the system in the K band is larger than ˜4 × 1035 erg s-1.

  5. The DNA-mimic antirestriction proteins ArdA ColIB-P9, Arn T4, and Ocr T7 as activators of H-NS-dependent gene transcription.

    PubMed

    Melkina, Olga E; Goryanin, Ignatiy I; Zavilgelsky, Gennadii B

    2016-11-01

    The antirestriction proteins ArdA ColIb-P9, Arn T4 and Ocr T7 specifically inhibit type I and type IV restriction enzymes and belong to the family of DNA-mimic proteins because their three-dimensional structure is similar to the double-helical B-form DNA. It is proposed that the DNA-mimic proteins are able to bind nucleoid protein H-NS and alleviate H-NS-silencing of the transcription of bacterial genes. Escherichia coli lux biosensors were constructed by inserting H-NS-dependent promoters into a vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE operon. It was demonstrated that the DNA-mimic proteins ArdA, Arn and Ocr activate the transcription of H-NS-dependent promoters of the lux operon of marine luminescent bacteria (mesophilic Aliivibrio fischeri and psychrophilic Aliivibrio logei), and the dps gene from E. coli. It was also demonstrated that the ArdA antirestriction protein, the genes of which are located on transmissive plasmids ColIb-P9, R64, PK101, decreases levels of H-NS silencing of the PluxC promoter during conjugation in the recipient bacteria. Copyright © 2016 Elsevier GmbH. All rights reserved.

  6. Placental weight and birth weight to placental weight ratio in monochorionic and dichorionic growth-restricted and non-growth-restricted twins

    PubMed Central

    Souza, Mariângela Alves; de Lourdes Brizot, Maria; Biancolin, Sckarlet Ernandes; Schultz, Regina; de Carvalho, Mário Henrique Burlacchini; Francisco, Rossana Pulcineli Vieira; Zugaib, Marcelo

    2017-01-01

    OBJECTIVE: The aim of the present study was to compare the placental weight and birth weight/placental weight ratio for intrauterine growth-restricted and non-intrauterine growth-restricted monochorionic and dichorionic twins. METHODS: This was a retrospective analysis of placentas from twin pregnancies. Placental weight and the birth weight/placental weight ratio were compared in intrauterine growth-restricted and non-intrauterine growth-restricted monochorionic and dichorionic twins. The association between cord insertion type and placental lesions in intrauterine growth-restricted and non-intrauterine growth-restricted monochorionic and dichorionic twins was also investigated. RESULTS: A total of 105 monochorionic (intrauterine growth restriction=40; non-intrauterine growth restriction=65) and 219 dichorionic (intrauterine growth restriction=57; non-intrauterine growth restriction=162) placentas were analyzed. A significantly lower placental weight was observed in intrauterine growth-restricted monochorionic (p=0.022) and dichorionic (p<0.001) twins compared to non-intrauterine growth-restricted twins. There was no difference in the birth weight/placental weight ratio between the intrauterine growth restriction and non-intrauterine growth restriction groups for either monochorionic (p=0.36) or dichorionic (p=0.68) twins. Placental weight and the birth weight/placental weight ratio were not associated with cord insertion type or with placental lesions. CONCLUSION: Low placental weight, and consequently reduced functional mass, appears to be involved in fetal growth restriction in monochorionic and dichorionic twins. The mechanism by which low placental weight influences the birth weight/placental weight ratio in intrauterine growth-restricted monochorionic and dichorionic twins needs to be determined in larger prospective studies. PMID:28591337

  7. Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

    2006-12-15

    We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

  8. Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius

    PubMed Central

    Henche, Anna-Lena; Ghosh, Abhrajyoti; Yu, Xiong; Jeske, Torsten; Egelman, Edward; Albers, Sonja-Verena

    2014-01-01

    Archaea display a variety of type IV pili on their surface and employ them in different physiological functions. In the crenarchaeon Sulfolobus acidocaldarius the most abundant surface structure is the aap pilus (archaeal adhesive pilus). The construction of in frame deletions of the aap genes revealed that all the five genes (aapA, aapX, aapE, aapF, aapB) are indispensible for assembly of the pilus and an impact on surface motility and biofilm formation was observed. Our analyses revealed that there exists a regulatory cross-talk between the expression of aap genes and archaella (formerly archaeal flagella) genes during different growth phases. The structure of the aap pilus is entirely different from the known bacterial type IV pili as well as other archaeal type IV pili. An aap pilus displayed 3 stranded helices where there is a rotation per subunit of ~ 138° and a rise per subunit of ~ 5.7 Å. The filaments have a diameter of ~ 110 Å and the resolution was judged to be ~ 9 Å. We concluded that small changes in sequence might be amplified by large changes in higher-order packing. Our finding of an extraordinary stability of aap-pili possibly represents an adaptation to harsh environments that S. acidocaldarius encounters. PMID:23078543

  9. Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

    PubMed

    Hardy, Christine D; Cozzarelli, Nicholas R

    2003-03-01

    DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

  10. The interferon-induced antiviral protein PML (TRIM19) promotes the restriction and transcriptional silencing of lentiviruses in a context-specific, isoform-specific fashion.

    PubMed

    Masroori, Nasser; Merindol, Natacha; Berthoux, Lionel

    2016-03-22

    The promyelocytic leukemia (PML) protein, a type I interferon (IFN-I)-induced gene product and a member of the tripartite motif (TRIM) family, modulates the transcriptional activity of viruses belonging to various families. Whether PML has an impact on the replication of HIV-1 has not been fully addressed, but recent studies point to its possible involvement in the restriction of HIV-1 in human cells and in the maintenance of transcriptional latency in human cell lines in which HIV-1 is constitutively repressed. We investigated further the restriction of HIV-1 and a related lentivirus, SIVmac, by PML in murine cells and in a lymphocytic human cell line. In particular, we studied the relevance of PML to IFN-I-mediated inhibition and the role of individual human isoforms. We demonstrate that both human PML (hPML) and murine PML (mPML) inhibit the early post-entry stages of the replication of HIV-1 and a related lentivirus, SIVmac. In addition, HIV-1 was transcriptionally silenced by mPML and by hPML isoforms I, II, IV and VI in MEFs. This PML-mediated transcriptional repression was attenuated in presence of the histone deacetylase inhibitor SAHA. In contrast, depletion of PML had no effect on HIV-1 gene expression in a human T cell line. PML was found to contribute to the inhibition of HIV-1 by IFN-I. Specifically, IFN-α and IFN-β treatments of MEFs enhanced the PML-dependent inhibition of HIV-1 early replication stages. We show that PML can inhibit HIV-1 and other lentiviruses as part of the IFN-I-mediated response. The restriction takes place at two distinct steps, i.e. reverse transcription and transcription, and in an isoform-specific, cellular context-specific fashion. Our results support a model in which PML activates innate immune antilentiviral effectors. These data are relevant to the development of latency reversal-inducing pharmacological agents, since PML was previously proposed as a pharmacological target for such inhibitors. This study also has implications for the development of murine models of HIV-1.

  11. Impact of Intended Mode of Delivery on Outcomes in Preterm Growth-Restricted Fetuses.

    PubMed

    Baalbaki, Sima H; Kuper, Spencer G; Wang, Michelle J; Steele, Robin A; Biggio, Joseph R; Harper, Lorie M

    2018-06-01

     Scheduled cesarean is frequently performed for fetal growth restriction due to concerns for fetal intolerance of labor.  We compared neonatal outcomes in preterm growth-restricted fetuses by intended mode of delivery.  We performed a retrospective cohort study of indicated preterm births with prenatally diagnosed growth restriction from 2011 to 2014 at a single institution. Patients were classified by intended mode of delivery. The primary outcome was a composite of adverse neonatal outcomes, including perinatal death, cord blood acidemia, chest compressions during neonatal resuscitation, seizures, culture-proven sepsis, necrotizing enterocolitis, and grade III-IV intraventricular hemorrhage. Secondary analysis was performed examining the impact of umbilical artery Dopplers.  Of 101 fetuses with growth restriction, 75 underwent planned cesarean deliveries. Of those induced, 46.2% delivered vaginally. Delivery by scheduled cesarean was not associated with a decreased risk of the composite outcome (adjusted odds ratio [aOR], 1.61; 95% confidence interval [CI], 0.45-5.78), even when only those with abnormal umbilical artery Dopplers were considered (aOR, 2.8; 95% CI, 0.40-20.2).  In this cohort, planned cesarean was not associated with a reduction in neonatal morbidity, even when considering only those with abnormal umbilical artery Dopplers. In otherwise appropriate candidates for vaginal delivery, fetal growth restriction should not be considered a contraindication to trial of labor. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  12. First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

    PubMed Central

    Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

    2016-01-01

    Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

  13. Taller height as a risk factor for venous thromboembolism: a Mendelian randomization meta-analysis.

    PubMed

    Roetker, N S; Armasu, S M; Pankow, J S; Lutsey, P L; Tang, W; Rosenberg, M A; Palmer, T M; MacLehose, R F; Heckbert, S R; Cushman, M; de Andrade, M; Folsom, A R

    2017-07-01

    Essentials Observational data suggest taller people have a higher risk of venous thromboembolism (VTE). We used Mendelian randomization techniques to further explore this association in three studies. Risk of VTE increased by 30-40% for each 10 cm increment in height. Height was more strongly associated with deep vein thrombosis than with pulmonary embolism. Background Taller height is associated with a greater risk of venous thromboembolism (VTE). Objectives To use instrumental variable (IV) techniques (Mendelian randomization) to further explore this relationship. Methods Participants of European ancestry were included from two cohort studies (Atherosclerosis Risk in Communities [ARIC] study and Cardiovascular Health Study [CHS]) and one case-control study (Mayo Clinic VTE Study [Mayo]). We created two weighted genetic risk scores (GRSs) for height; the full GRS included 668 single-nucleotide polymorphisms (SNPs) from a previously published meta-analysis, and the restricted GRS included a subset of 362 SNPs not associated with weight independently of height. Standard logistic regression and IV models were used to estimate odds ratios (ORs) for VTE per 10-cm increment in height. ORs were pooled across the three studies by the use of inverse variance-weighted random effects meta-analysis. Results Among 9143 ARIC and 3180 CHS participants free of VTE at baseline, there were 367 and 109 incident VTE events. There were 1143 VTE cases and 1292 controls included from Mayo. The pooled ORs from non-IV models and models using the full and restricted GRSs as IVs were 1.27 (95% confidence interval [CI] 1.11-1.46), 1.34 (95% CI 1.04-1.73) and 1.45 (95% CI 1.04-2.01) per 10-cm greater height, respectively. Conclusions Taller height is associated with an increased risk of VTE in adults of European ancestry. Possible explanations for this association, including taller people having a greater venous surface area, a higher number of venous valves, or greater hydrostatic pressure, need to be explored further. © 2017 International Society on Thrombosis and Haemostasis.

  14. Review of State Laws Restricting Local Authority to Impose Alcohol Taxes in the United States

    PubMed Central

    Mosher, James F.; Adler, Sabrina S.; Pamukcu, Aysha M.; Treffers, Ryan D.

    2017-01-01

    Objective: Building on the extensive research literature demonstrating that increasing alcohol prices reduces excessive alcohol consumption and related harms, this article presents the results of a 50-state review of local authority to tax alcohol in the United States. Method: Between 2013 and 2015, legal databases and government websites were reviewed to collect and analyze relevant statutes, ordinances, and case law. Results reflect laws in effect as of January 1, 2015. Results: Nineteen states allow local alcohol taxation, although 15 of those have one or more major restrictions on local authority to tax. The types of major restrictions are (a) restrictions on the type of beverage and alcohol content that can be taxed, (b) caps on local alcohol taxes, (c) restrictions on the type of retailer where taxes can be imposed,(a) restrictions on jurisdictions within the state that can levy taxes, and (b) requirements for how tax revenue can be spent. Conclusions: The number and severity of restrictions on local authority to tax alcohol vary across states. Previous research has shown that increases in alcohol taxes can lead to reduced excessive alcohol consumption, which provides public health and economic benefits. Taxes can also provide funds to support local prevention and treatment services. Local alcohol taxes therefore present an important policy opportunity, both in states that restrict local authority and in states where local authority exists but is underused. PMID:28317504

  15. Review of State Laws Restricting Local Authority to Impose Alcohol Taxes in the United States.

    PubMed

    Mosher, James F; Adler, Sabrina S; Pamukcu, Aysha M; Treffers, Ryan D

    2017-03-01

    Building on the extensive research literature demonstrating that increasing alcohol prices reduces excessive alcohol consumption and related harms, this article presents the results of a 50-state review of local authority to tax alcohol in the United States. Between 2013 and 2015, legal databases and government websites were reviewed to collect and analyze relevant statutes, ordinances, and case law. Results reflect laws in effect as of January 1, 2015. Nineteen states allow local alcohol taxation, although 15 of those have one or more major restrictions on local authority to tax. The types of major restrictions are (a) restrictions on the type of beverage and alcohol content that can be taxed, (b) caps on local alcohol taxes, (c) restrictions on the type of retailer where taxes can be imposed, (d) restrictions on jurisdictions within the state that can levy taxes, and (e) requirements for how tax revenue can be spent. The number and severity of restrictions on local authority to tax alcohol vary across states. Previous research has shown that increases in alcohol taxes can lead to reduced excessive alcohol consumption, which provides public health and economic benefits. Taxes can also provide funds to support local prevention and treatment services. Local alcohol taxes therefore present an important policy opportunity, both in states that restrict local authority and in states where local authority exists but is underused.

  16. Lesch typology and temperament in opioid dependence: a cross-sectional study.

    PubMed

    Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

    2014-08-01

    The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis.

    PubMed

    Luvan, M; Kanthan, S R; Roshan, G; Saw, A

    2015-11-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy.

  18. 49 CFR 383.95 - Restrictions.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... person is restricted from operating a CMV equipped with any type of air brakes. (2) For the purposes of... person is restricted from operating a CMV equipped with any braking system operating fully on the air... restricted from operating a CMV equipped with a manual transmission. (2) For the purposes of the skills test...

  19. 49 CFR 383.95 - Restrictions.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... person is restricted from operating a CMV equipped with any type of air brakes. (2) For the purposes of... person is restricted from operating a CMV equipped with any braking system operating fully on the air... restricted from operating a CMV equipped with a manual transmission. (2) For the purposes of the skills test...

  20. 49 CFR 383.95 - Restrictions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... person is restricted from operating a CMV equipped with any type of air brakes. (2) For the purposes of... person is restricted from operating a CMV equipped with any braking system operating fully on the air... restricted from operating a CMV equipped with a manual transmission. (2) For the purposes of the skills test...

  1. Portable Intravenous Fluid Production Device for Ground Use

    NASA Technical Reports Server (NTRS)

    Scarpa, Philip J.; Scheuer, Wolfgang K.

    2012-01-01

    There are several medical conditions that require intravenous (IV) fluids. Limitations of mass, volume, storage space, shelf-life, transportation, and local resources can restrict the availability of such important fluids. These limitations are expected in long-duration space exploration missions and in remote or austere environments on Earth. Current IV fluid production requires large factory-based processes. Easy, portable, on-site production of IV fluids can eliminate these limitations. Based on experience gained in developing a device for spaceflight, a ground-use device was developed. This design uses regular drinking water that is pumped through two filters to produce, in minutes, sterile, ultrapure water that meets the stringent quality standards of the United States Pharmacopeia for Water for Injection (Total Bacteria, Conductivity, Endotoxins, Total Organic Carbon). The device weighs 2.2 lb (1 kg) and is 10 in. long, 5 in. wide, and 3 in. high (.25, 13, and 7.5 cm, respectively) in its storage configuration. This handheld device produces one liter of medical-grade water in 21 minutes. Total production capacity for this innovation is expected to be in the hundreds of liters.

  2. A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

    PubMed

    Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

    2009-05-01

    Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

  3. A zebrafish model for Waardenburg syndrome type IV reveals diverse roles for Sox10 in the otic vesicle.

    PubMed

    Dutton, Kirsten; Abbas, Leila; Spencer, Joanne; Brannon, Claire; Mowbray, Catriona; Nikaido, Masataka; Kelsh, Robert N; Whitfield, Tanya T

    2009-01-01

    In humans, mutations in the SOX10 gene are a cause of the auditory-pigmentary disorder Waardenburg syndrome type IV (WS4) and related variants. SOX10 encodes an Sry-related HMG box protein essential for the development of the neural crest; deafness in WS4 and other Waardenburg syndromes is usually attributed to loss of neural-crest-derived melanocytes in the stria vascularis of the cochlea. However, SOX10 is strongly expressed in the developing otic vesicle and so direct roles for SOX10 in the otic epithelium might also be important. Here, we examine the otic phenotype of zebrafish sox10 mutants, a model for WS4. As a cochlea is not present in the fish ear, the severe otic phenotype in these mutants cannot be attributed to effects on this tissue. In zebrafish sox10 mutants, we see abnormalities in all otic placodal derivatives. Gene expression studies indicate deregulated expression of several otic genes, including fgf8, in sox10 mutants. Using a combination of mutant and morphant data, we show that the three sox genes belonging to group E (sox9a, sox9b and sox10) provide a link between otic induction pathways and subsequent otic patterning: they act redundantly to maintain sox10 expression throughout otic tissue and to restrict fgf8 expression to anterior macula regions. Single-cell labelling experiments indicate a small and transient neural crest contribution to the zebrafish ear during normal development, but this is unlikely to account for the strong defects seen in the sox10 mutant. We discuss the implication that the deafness in WS4 patients with SOX10 mutations might reflect a haploinsufficiency for SOX10 in the otic epithelium, resulting in patterning and functional abnormalities in the inner ear.

  4. [Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

    PubMed

    Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

    2010-01-01

    Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

  5. Momentary Predictors of Insulin Restriction Among Adults With Type 1 Diabetes and Eating Disorder Symptomatology.

    PubMed

    Merwin, Rhonda M; Dmitrieva, Natalia O; Honeycutt, Lisa K; Moskovich, Ashley A; Lane, James D; Zucker, Nancy L; Surwit, Richard S; Feinglos, Mark; Kuo, Jennifer

    2015-11-01

    Individuals with type 1 diabetes who restrict insulin to control weight are at high risk for diabetes-related complications and premature death. However, little is known about this behavior or how to effectively intervene. The aim of the current study was to identify predictors of insulin restriction in the natural environment that might inform new treatment directions. Eighty-three adults with type 1 diabetes and a range of eating disorder symptomatology completed 3 days of ecological momentary assessment. Participants reported emotions, eating, and insulin dosing throughout the day using their cellular telephone. Linear mixed models were used to estimate the effects of heightened negative affect (e.g., anxiety) before eating and characteristics of the eating episode (e.g., eating a large amount of food) on the risk of insulin restriction. Individuals who reported greater-than-average negative affect (general negative affect and negative affect specifically about diabetes) during the study period were more likely to restrict insulin. Momentary increases in anxiety/nervousness and guilt/disgust with self before eating (relative to an individual's typical level) further increased the odds of restricting insulin at the upcoming meal. Insulin restriction was more likely when individuals reported that they broke a dietary rule (e.g., "no desserts"). Results suggest that insulin restriction might be decreased by helping patients with type 1 diabetes respond effectively to heightened negative affect (e.g., anxiety, guilt) and encouraging patients to take a less rigid, punitive approach to diabetes management. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  6. Adult presentation of Bartter syndrome type IV with erythrocytosis.

    PubMed

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis.

  7. Audiological findings in children with mucopolysaccharidoses type i-iv.

    PubMed

    Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

    The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

  8. Restrictions on surgical resident shift length does not impact type of medical errors.

    PubMed

    Anderson, Jamie E; Goodman, Laura F; Jensen, Guy W; Salcedo, Edgardo S; Galante, Joseph M

    2017-05-15

    In 2011, resident duty hours were restricted in an attempt to improve patient safety and resident education. With the goal of reducing fatigue, shorter shift length leads to more patient handoffs, raising concerns about adverse effects on patient safety. This study seeks to determine whether differences in duty-hour restrictions influence types of errors made by residents. This is a nested retrospective cohort study at a surgery department in an academic medical center. During 2013-14, standard 2011 duty hours were in place for residents. In 2014-15, duty-hour restrictions at the study site were relaxed ("flexible") with no restrictions on shift length. We reviewed all morbidity and mortality submissions from July 1, 2013-June 30, 2015 and compared differences in types of errors between these periods. A total of 383 patients experienced adverse events, including 59 deaths (15.4%). Comparing standard versus flexible periods, there was no difference in mortality (15.7% versus 12.6%, P = 0.479) or complication rates (2.6% versus 2.5%, P = 0.696). There was no difference in types of errors between periods (P = 0.050-0.808). The most number of errors were due to cognitive failures (229, 59.6%), whereas the fewest number of errors were due to team failure (127, 33.2%). By subset, technical errors resulted in the highest number of errors (169, 44.1%). There were no differences between types of errors of cases that were nonelective, at night, or involving residents. Among adverse events reported in this departmental surgical morbidity and mortality, there were no differences in types of errors when resident duty hours were less restrictive. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

    PubMed

    Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

    2002-04-02

    The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

  10. Risk evaluation for in-vehicle sign information.

    DOT National Transportation Integrated Search

    2016-05-01

    The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

  11. Influenza A viruses escape from MxA restriction at the expense of efficient nuclear vRNP import.

    PubMed

    Götz, Veronika; Magar, Linda; Dornfeld, Dominik; Giese, Sebastian; Pohlmann, Anne; Höper, Dirk; Kong, Byung-Whi; Jans, David A; Beer, Martin; Haller, Otto; Schwemmle, Martin

    2016-03-18

    To establish a new lineage in the human population, avian influenza A viruses (AIV) must overcome the intracellular restriction factor MxA. Partial escape from MxA restriction can be achieved when the viral nucleoprotein (NP) acquires the critical human-adaptive amino acid residues 100I/V, 283P, and 313Y. Here, we show that introduction of these three residues into the NP of an avian H5N1 virus renders it genetically unstable, resulting in viruses harboring additional single mutations, including G16D. These substitutions restored genetic stability yet again yielded viruses with varying degrees of attenuation in mammalian and avian cells. Additionally, most of the mutant viruses lost the capacity to escape MxA restriction, with the exception of the G16D virus. We show that MxA escape is linked to attenuation by demonstrating that the three substitutions promoting MxA escape disturbed intracellular trafficking of incoming viral ribonucleoprotein complexes (vRNPs), thereby resulting in impaired nuclear import, and that the additional acquired mutations only partially compensate for this import block. We conclude that for adaptation to the human host, AIV must not only overcome MxA restriction but also an associated block in nuclear vRNP import. This inherent difficulty may partially explain the frequent failure of AIV to become pandemic.

  12. Nonstatic radiating spheres in general relativity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krori, K.D.; Borgohain, P.; Sarma, R.

    1985-02-15

    The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

  13. Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

    DTIC Science & Technology

    2010-05-01

    Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

  14. Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

    NASA Astrophysics Data System (ADS)

    Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

    2013-09-01

    Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

  15. Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

    PubMed

    Satya, Ramadass; Vijayakumar, Vani

    2006-10-01

    A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

  16. Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

    PubMed

    Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

    2014-06-01

    The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

  17. N-Acetylcysteine (NAC)-Induced Hyponatremia Caused by an Electronic Medical Record (EMR) Order Error.

    PubMed

    Furmaga, Jakub; Wax, Paul; Kleinschmidt, Kurt

    2015-09-01

    Intravenous N-acetylcysteine (NAC) causes few adverse drug events, with mild anaphylactoid reactions being the most common. Hyponatremia as a complication of hypoosmolar NAC solution has been reported. We describe how a locally constructed electronic medical record (EMR) order set for IV NAC resulted in a seizure from hyponatremia due to excess free water administration. A 13-month-old female with no past medical history presented to a hospital after ingesting an unknown number of acetaminophen 500 mg tablets. The 4-h acetaminophen concentration was 343 mcg/mL, and she was started on IV NAC. 8.2 h into her 21-h IV NAC protocol, she developed a tonic-clonic seizure. Repeat serum sodium was 124 mEq/L, a decrease from 142 mEq/L at the time of admission. She was treated with hypertonic saline, lorazepam, and levetiracetam and had no further seizures. A brain MRI and EEG were both normal. After the seizure was stabilized, the providers noticed that the patient had receive a total of 900 mL of D5W (112.5 mL/kg) in the first 9 h of hospitalization. This was caused by a poorly constructed, restrictive, EMR order set that did not allow customization of the IV NAC preparation. Because the 21-h IV NAC administration involves preparation of 3 different doses infused over 3 different time intervals, an order set was developed to reduce ordering errors. However, error in its construction caused the pharmacist to prepare a solution containing too much free water, decreasing patient's intravascular sodium and resulting in a seizure. The purposes of our case report were to highlight the dangers of overreliance on EMR order sets and to recognize hyponatremic seizures as an adverse reaction of an inappropriately prepared IV NAC.

  18. Managing acute acetaminophen poisoning with oral versus intravenous N-acetylcysteine: a provider-perspective cost analysis.

    PubMed

    Marchetti, Albert; Rossiter, Richard

    2009-01-01

    Acetaminophen (APAP) overdose, which can lead to hepatotoxicity, is the most commonly reported poisoning in the United States and has the highest rate of mortality, with more than 100,000 exposures and 300 deaths reported annually (1) . The treatment of choice, N-acetylcysteine (NAC), is effective in both oral (PO) and intravenous (IV) formulations. The main difference in therapies, other than administration route, is time to complete delivery--72 hours for PO NAC versus 21 hours for IV NAC, according to full prescribing information. This distinction is the primary basis for variation in management costs for hospitalized patients receiving these products. To quantify and compare full treatment costs from the provider perspective to manage acute APAP poisoning with either PO or IV NAC in a standard treatment regimen. A cost model was developed and populated with published data comprising probabilities of potential clinical outcomes and the costs of resources consumed during patient care. For patients who present <10 hours post-ingestion, the estimated total cost of care with PO NAC in the treatment regimen is $5,817 (ICU patients) or $3,850, (ward patients) compared with $3,765 and $2,768 for similar care with IV NAC. Potential cost savings equal - $2,052 (-35%) or -$1,083 (-28%), respectively, in favor of IV NAC. Similar potential savings were estimated for patients presenting 10-24 hours post-ingestion. IV NAC is the less costly therapeutic option for APAP poisonings, based on simulation modeling and retrospective data. The current economic evaluation is restricted by the absence of comparative data from head-to-head, matched-cohort studies and the limitations common to retrospective APAP toxicology datasets. Additional research could refine these results.

  19. Clinical value of DSM IV and DSM 5 criteria for diagnosing the most prevalent somatoform disorders in patients with medically unexplained physical symptoms (MUPS).

    PubMed

    van Dessel, Nikki Claassen-; van der Wouden, Johannes C; Dekker, Joost; van der Horst, Henriette E

    2016-03-01

    This study aimed (1) to describe frequencies of DSM IV somatisation disorder, undifferentiated somatoform disorder and pain disorder versus DSM 5 somatic symptom disorder (SSD) in a multi-setting population of patients with medically unexplained physical symptoms (MUPS), (2) to investigate differences in sociodemographic and (psycho)pathological characteristics between these diagnostic groups and (3) to explore the clinical relevance of the distinction between mild and moderate DSM 5 SSD. We used baseline data of a cohort of 325 MUPS patients. Measurements included questionnaires about symptom severity, physical functioning, anxiety, depression, health anxiety and illness perceptions. These questionnaires were used as proxy measures for operationalization of DSM IV and DSM 5 diagnostic criteria. 92.9% of participants fulfilled criteria of a DSM IV somatoform disorder, while 45.5% fulfilled criteria of DSM 5 SSD. Participants fulfilling criteria of DSM 5 SSD suffered from more severe symptoms than those only fulfilling criteria of a DSM IV somatoform disorder(mean PHQ-15 score of 13.98 (SD 5.17) versus 11.23 (SD 4.71), P-value<0.001). Furthermore their level of physical functioning was significantly lower. Compared to patients with mild SSD, patients with moderate SSD suffered from significantly lower physical functioning and higher levels of depression. Within a population of MUPS patients DSM 5 SSD criteria are more restrictive than DSM IV criteria for somatoform disorders. They are associated with higher symptom severity and lower physical functioning. However, further specification of the positive psychological criteria of DSM 5 SSD may improve utility in research and practice. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Biomarker for Glycogen Storage Diseases

    ClinicalTrials.gov

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  1. Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

    PubMed Central

    Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

    2014-01-01

    Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

  2. Self aligned hysteresis free carbon nanotube field-effect transistors

    NASA Astrophysics Data System (ADS)

    Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

    2016-04-01

    Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

  3. The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

    PubMed

    Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

    2018-05-01

    Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

  4. Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

    PubMed

    Boos, A

    2000-01-01

    Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

  5. Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

    PubMed Central

    Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

    2017-01-01

    The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

  6. Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

    PubMed

    Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

    2016-01-01

    Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

  7. Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

    PubMed Central

    Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

    2016-01-01

    Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

  8. Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

    PubMed Central

    Harastani, Houda H.; Tokajian, Sima T.

    2014-01-01

    Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

  9. Cardiac remodeling in response to chronic iron deficiency: role of the erythropoietin receptor.

    PubMed

    Naito, Yoshiro; Sawada, Hisashi; Oboshi, Makiko; Iwasaku, Toshihiro; Okuhara, Yoshitaka; Morisawa, Daisuke; Eguchi, Akiyo; Hirotani, Shinichi; Mano, Toshiaki; Tsujino, Takeshi; Masuyama, Tohru

    2015-06-01

    Anemia is a common comorbidity of patients with heart failure, and iron deficiency is known as one of the causes of anemia in heart failure. Recent studies have shown that iron deficiency alone, without overt anemia, is associated with poor outcomes in patients with heart failure. Thus, to minimize the mortality in patients with heart failure, it is important to understand the link between iron deficiency and cardiac function. Chronic untreated iron deficiency results in cardiac remodeling, and we have previously reported that erythropoietin (Epo) and cardiac Epo receptor (EpoR) signaling may be associated with its remodeling. However, the link between EpoR signaling and its remodeling remains to be elucidated. Herein, we investigated the role of EpoR signaling on cardiac remodeling in response to chronic iron deficiency. Wild-type mice and transgene-rescued EpoR-null mutant mice, which express EpoR only in the hematopoietic lineage (EpoR-restricted mice), were fed with either a normal or an iron-restricted diet, and the molecular mechanisms were investigated. Dietary iron restriction gradually induced anemia, Epo secretion, and cardiac hypertrophy in wild-type mice. In contrast, EpoR-restricted mice fed with an iron-restricted diet exhibited anemia, left ventricular dilatation, and cardiac dysfunction compared with wild-type mice. Interestingly, altered cardiac mitochondrial biogenesis was observed in EpoR-restricted mice following iron deficiency. Moreover, cardiac p53 expression was increased in EpoR-restricted mice compared with wild-type mice following iron deficiency. These data indicate that EpoR signaling is associated with cardiac remodeling following chronic iron deficiency.

  10. Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

    DTIC Science & Technology

    1983-12-01

    2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

  11. The epidemiologic transition of thalassemia and associated hemoglobinopathies in southern Taiwan.

    PubMed

    Wang, Hui-Ching; Hsieh, Li-Ling; Liu, Yi-Chang; Hsiao, Hui-Hua; Lin, Shu-Kai; Tsai, Wen-Chan; Liu, Ta-Chih

    2017-02-01

    Since 1993, following the National Thalassemia Major Prevention Program and an increase in immigration and interracial marriages, especially in southern Taiwan, the distribution of hemoglobinopathies may have changed. This study investigates the epidemiologic transition of hemoglobinopathies. We analyzed 1870 specimens collected between 2003 and 2012 in southern Taiwan, used gap-polymerase chain reaction and PCR-restriction fragment length polymorphism-based methods, and confirmed genotypes of hemoglobinopathies by DNA sequencing. We found a 91% reduction in the incidence of thalassemia major compared with samples from between 1986 and 1995. The most common genotypes of α-thalassemia and α Hb variants were the SEA type (69.4%) and Hb Quong Sze (1.54%). The most common genotypes of β-thalassemia and β Hb variants were IVS-II-654 (46.2%) and Hb E (2.2%), respectively. Compared with studies performed in different areas of and time intervals in Taiwan, a higher prevalence of -α 3.7 , Hb Quong Sze, and Hb E and a lower prevalence of the SEA type were found in this study. However, the SEA type remained the most common genotype observed. In addition, an increasing number of cases with an -α 3.7 type carrier, Hb Quong Sze carrier, and G γ (A γ δβ)° were identified following a peak of interracial marriages between 2003 and 2005, reflecting a regional difference and the impact of interracial marriage. In conclusion, global migration and international marriage have changed the distribution of hemoglobinopathies in Taiwan. A more comprehensive prenatal screening for new immigrants with a longer follow-up is warranted.

  12. On the interrelation of multiplication and division in secondary school children

    PubMed Central

    Huber, Stefan; Fischer, Ursula; Moeller, Korbinian; Nuerk, Hans-Christoph

    2013-01-01

    Multiplication and division are conceptually inversely related: Each division problem can be transformed into as a multiplication problem and vice versa. Recent research has indicated strong developmental parallels between multiplication and division in primary school children. In this study, we were interested in (i) whether these developmental parallels persist into secondary school, (ii) whether similar developmental parallels can be observed for simple and complex problems, (iii) whether skill level modulates this relationship, and (iv) whether the correlations are specific and not driven by general cognitive or arithmetic abilities. Therefore, we assessed performance of 5th and 6th graders attending two secondary school types of the German educational system in simple and complex multiplication as well as division while controlling for non-verbal intelligence, short-term memory, and other arithmetic abilities. Accordingly, we collected data from students differing in skills levels due to either age (5th < 6th grade) or school type (general < intermediate secondary school). We observed moderate to strong bivariate and partial correlations between multiplication and division with correlations being higher for simple tasks but nevertheless reliable for complex tasks. Moreover, the association between simple multiplication and division depended on students' skill levels as reflected by school types, but not by age. Partial correlations were higher for intermediate than for general secondary school children. In sum, these findings emphasize the importance of the inverse relationship between multiplication and division which persists into later developmental stages. However, evidence for skill-related differences in the relationship between multiplication and division was restricted to the differences for school types. PMID:24133476

  13. Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

    PubMed

    Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

    2017-01-01

    Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

  14. AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasanth, V.; Chen, Yao; Feng, Shiwei

    2016-10-10

    Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

  15. Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

    PubMed

    Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

    2015-07-01

    In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

  16. 40 CFR 35.6575 - Restrictions on types of contracts.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 1 2014-07-01 2014-07-01 false Restrictions on types of contracts. 35.6575 Section 35.6575 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Cooperative Agreements and Superfund State Contracts for Superfund...

  17. 14 CFR 21.25 - Issue of type certificate: Restricted category aircraft.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Issue of type certificate: Restricted category aircraft. 21.25 Section 21.25 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF...; (3) Aerial surveying (photography, mapping, and oil and mineral exploration); (4) Patrolling...

  18. 14 CFR 21.25 - Issue of type certificate: Restricted category aircraft.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Issue of type certificate: Restricted category aircraft. 21.25 Section 21.25 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF...; (3) Aerial surveying (photography, mapping, and oil and mineral exploration); (4) Patrolling...

  19. 14 CFR 21.25 - Issue of type certificate: Restricted category aircraft.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Issue of type certificate: Restricted category aircraft. 21.25 Section 21.25 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF...; (3) Aerial surveying (photography, mapping, and oil and mineral exploration); (4) Patrolling...

  20. Autoimmune gastritis: histology phenotype and OLGA staging.

    PubMed

    Rugge, M; Fassan, M; Pizzi, M; Zorzetto, V; Maddalo, G; Realdon, S; De Bernard, M; Betterle, C; Cappellesso, R; Pennelli, G; de Boni, M; Farinati, F

    2012-06-01

    Among Western populations, the declining incidence of Helicobacter pylori infection coincides with a growing clinical impact of autoimmune gastritis. To describe the histological phenotype of autoimmune gastritis, also to test the prognostic impact of OLGA staging in the autoimmune setting. A single-institutional series (spanning the years 2003-2011) of 562 consecutive patients (M:F ratio: 1:3.7; mean age = 57.6 ± 14.4 years) with serologically confirmed autoimmune gastritis underwent histology review and OLGA staging. Helicobacter pylori infection was ascertained histologically in 44/562 cases (7.8%). Forty six biopsy sets (8.2%) featured OLGA stages III-IV; they included all four cases of incidental epithelial neoplasia (three intraepithelial and one invasive; three of these four cases had concomitant H. pylori infection). There were 230 (40.9%) and 139 (24.7%) cases, respectively, of linear and micro-nodular enterochromaffin-like cell hyperplasia; 19 (3.4%) type I carcinoids were detected. The series included 116 patients who underwent repeated endoscopy/biopsy sampling (mean time elapsing between the two procedures = 54 months; range 24-108). Paired histology showed a significant (P = 0.009) trend towards a stage progression [the stage increased in 25/116 cases (22%); it remained unchanged in 87/116 cases (75%)]. In autoimmune gastritis, the cancer risk is restricted to high-risk gastritis stages (III-IV), and is associated mainly with concomitant H. pylori infection. OLGA staging consistently depicts the time-dependent organic progression of the autoimmune disease and provides key information for secondary gastric cancer prevention strategies. © 2012 Blackwell Publishing Ltd.

  1. Survey of Non-Rigid Registration Tools in Medicine.

    PubMed

    Keszei, András P; Berkels, Benjamin; Deserno, Thomas M

    2017-02-01

    We catalogue available software solutions for non-rigid image registration to support scientists in selecting suitable tools for specific medical registration purposes. Registration tools were identified using non-systematic search in Pubmed, Web of Science, IEEE Xplore® Digital Library, Google Scholar, and through references in identified sources (n = 22). Exclusions are due to unavailability or inappropriateness. The remaining (n = 18) tools were classified by (i) access and technology, (ii) interfaces and application, (iii) living community, (iv) supported file formats, and (v) types of registration methodologies emphasizing the similarity measures implemented. Out of the 18 tools, (i) 12 are open source, 8 are released under a permissive free license, which imposes the least restrictions on the use and further development of the tool, 8 provide graphical processing unit (GPU) support; (ii) 7 are built on software platforms, 5 were developed for brain image registration; (iii) 6 are under active development but only 3 have had their last update in 2015 or 2016; (iv) 16 support the Analyze format, while 7 file formats can be read with only one of the tools; and (v) 6 provide multiple registration methods and 6 provide landmark-based registration methods. Based on open source, licensing, GPU support, active community, several file formats, algorithms, and similarity measures, the tools Elastics and Plastimatch are chosen for the platform ITK and without platform requirements, respectively. Researchers in medical image analysis already have a large choice of registration tools freely available. However, the most recently published algorithms may not be included in the tools, yet.

  2. Validation of cell-based fluorescence assays: practice guidelines from the ICSH and ICCS - part IV - postanalytic considerations.

    PubMed

    Barnett, David; Louzao, Raaul; Gambell, Peter; De, Jitakshi; Oldaker, Teri; Hanson, Curtis A

    2013-01-01

    Flow cytometry and other technologies of cell-based fluorescence assays are as a matter of good laboratory practice required to validate all assays, which when in clinical practice may pass through regulatory review processes using criteria often defined with a soluble analyte in plasma or serum samples in mind. Recently the U.S. Food and Drug Administration (FDA) has entered into a public dialogue in the U.S. regarding their regulatory interest in laboratory developed tests (LDTs) or so-called home brew assays performed in clinical laboratories. The absence of well-defined guidelines for validation of cell-based assays using fluorescence detection has thus become a subject of concern for the International Council for Standardization of Haematology (ICSH) and International Clinical Cytometry Society (ICCS). Accordingly, a group of over 40 international experts in the areas of test development, test validation, and clinical practice of a variety of assay types using flow cytometry and/or morphologic image analysis were invited to develop a set of practical guidelines useful to in vitro diagnostic (IVD) innovators, clinical laboratories, regulatory scientists, and laboratory inspectors. The focus of the group was restricted to fluorescence reporter reagents, although some common principles are shared by immunohistochemistry or immunocytochemistry techniques and noted where appropriate. The work product of this two year effort is the content of this special issue of this journal, which is published as 5 separate articles, this being Validation of Cell-based Fluorescence Assays: Practice Guidelines from the ICSH and ICCS - Part IV - Postanalytic considerations. © 2013 International Clinical Cytometry Society.

  3. [Alcohol-related cognitive impairment and the DSM-5].

    PubMed

    Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

    2016-01-01

    It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

  4. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis

    PubMed Central

    Luvan, M; Roshan, G; Saw, A

    2015-01-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy. PMID:28611907

  5. The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

    PubMed Central

    Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

    2012-01-01

    In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

  6. Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

    PubMed

    Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

    2015-01-01

    A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

  7. Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

    PubMed

    Hardie, Andrew D; Kereshi, Borko

    2014-06-01

    Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

  8. Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

    DTIC Science & Technology

    2017-05-17

    490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

  9. Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

    PubMed

    Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

    2017-01-01

    The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

  10. Correcting for Indirect Range Restriction in Meta-Analysis: Testing a New Meta-Analytic Procedure

    ERIC Educational Resources Information Center

    Le, Huy; Schmidt, Frank L.

    2006-01-01

    Using computer simulation, the authors assessed the accuracy of J. E. Hunter, F. L. Schmidt, and H. Le's (2006) procedure for correcting for indirect range restriction, the most common type of range restriction, in comparison with the conventional practice of applying the Thorndike Case II correction for direct range restriction. Hunter et…

  11. 14 CFR 21.25 - Issue of type certificate: Restricted category aircraft.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Issue of type certificate: Restricted category aircraft. 21.25 Section 21.25 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... conservation; (3) Aerial surveying (photography, mapping, and oil and mineral exploration); (4) Patrolling...

  12. 14 CFR 21.25 - Issue of type certificate: Restricted category aircraft.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Issue of type certificate: Restricted category aircraft. 21.25 Section 21.25 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... conservation; (3) Aerial surveying (photography, mapping, and oil and mineral exploration); (4) Patrolling...

  13. The 116G > A MSH6 and IVS1-1121C > T PMS2 Genes Polymorphisms Modulate the Risk of the Sporadic Colorectal Cancer Development in Polish Population.

    PubMed

    Zelga, Piotr; Przybyłowska-Sygut, Karolina; Zelga, Marta; Dziki, Adam; Majsterek, Ireneusz

    2018-04-01

    Colorectal cancer (CRC) is one of the most common cancers worldwide. DNA mismatch repair (MMR) is an evolutionarily conserved process that corrects mismatches generated during DNA replication. MMR defects were found to be associated with hereditary non-polyposis colorectal cancer (HNPCC) and a subset of sporadic colon cancers. The inheritance of common variations in MMR genes may influences individual susceptibility to the development of colorectal cancer. The purpose of the study was to evaluate the association between gene polymorphisms Glu39Gly (c.116G > A) of MSH6 gene and IVS1-1121C > T of PMS2 gene and sporadic colorectal cancer risk, in a case-control study comprising 200 patients and 200 controls origination from polish population. DNA was isolated from peripheral blood lymphocytes of enrolled patients, and gene polymorphisms were analysed by restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) for MSH6 and TaqMan for PMS2. G/A variant of Glu39Gly (c.116G > A) genotype was associated with an increased risk of colorectal cancer (OR 1,65 95%CI:1,01-2,69 p = 0.44). Presence of A allele was also significantly higher in patient with CRC (OR 1,57 95% CI: 1,04-2,38 p = 0.032). Prevalence of this genotype was also markedly higher in females and patients above 60 years in CRC group (OR 2.25 95%CI: 1.22-4.14 p = 0.0098 and OR 2.74 95% CI: 1.27-5.93 p = 0.0097 respectively). None of such correlations was observed for genotype variants of IVS1-1121C > T PMS2. In conclusion, our data suggests thatMSH6 Glu39Gly polymorphism is associated with the risk of developing sporadic colorectal cancer in polish population. Linkage to the female gender, onset above 60 years old and further increase of risk when combined with wild-type allele of PMS2 IVS1-1121C > T polymorphism indicates defective mismatch repair system.

  14. Characterization of potential fire regimes: applying landscape ecology to fire management in Mexico

    NASA Astrophysics Data System (ADS)

    Jardel, E.; Alvarado, E.; Perez-Salicrup, D.; Morfín-Rios, J.

    2013-05-01

    Knowledge and understanding of fire regimes is fundamental to design sound fire management practices. The high ecosystem diversity of Mexico offers a great challenge to characterize the fire regime variation at the landscape level. A conceptual model was developed considering the main factors controlling fire regimes: climate and vegetation cover. We classified landscape units combining bioclimatic zones from the Holdridge life-zone system and actual vegetation cover. Since bioclimatic conditions control primary productivity and biomass accumulation (potential fuel), each landscape unit was considered as a fuel bed with a particular fire intensity and behavior potential. Climate is also a determinant factor of post-fire recovery rates of fuel beds, and climate seasonality (length of the dry and wet seasons) influences fire probability (available fuel and ignition efficiency). These two factors influence potential fire frequency. Potential fire severity can be inferred from fire frequency, fire intensity and behavior, and vegetation composition and structure. Based in the conceptual model, an exhaustive literature review and expert opinion, we developed rules to assign a potential fire regime (PFR) defined by frequency, intensity and severity (i.e. fire regime) to each bioclimatic-vegetation landscape unit. Three groups and eight types of potential fire regimes were identified. In Group A are fire-prone ecosystems with frequent low severity surface fires in grasslands (PFR type I) or forests with long dry season (II) and infrequent high-severity fires in chaparral (III), wet temperate forests (IV, fire restricted by humidity), and dry temperate forests (V, fire restricted by fuel recovery rate). Group B includes fire-reluctant ecosystems with very infrequent or occasional mixed severity surface fires limited by moisture in tropical rain forests (VI) or fuel availability in seasonally dry tropical forests (VII). Group C and PFR VIII include fire-free environments that correspond to deserts. Application of PFR model to fire management is discussed.

  15. The 'Sydney Principles' for reducing the commercial promotion of foods and beverages to children.

    PubMed

    Swinburn, Boyd; Sacks, Gary; Lobstein, Tim; Rigby, Neville; Baur, Louise A; Brownell, Kelly D; Gill, Tim; Seidell, Jaap; Kumanyika, Shiriki

    2008-09-01

    A set of seven principles (the 'Sydney Principles') was developed by an International Obesity Taskforce (IOTF) Working Group to guide action on changing food and beverage marketing practices that target children. The aim of the present communication is to present the Sydney Principles and report on feedback received from a global consultation (November 2006 to April 2007) on the Principles. The Principles state that actions to reduce marketing to children should: (i) support the rights of children; (ii) afford substantial protection to children; (iii) be statutory in nature; (iv) take a wide definition of commercial promotions; (v) guarantee commercial-free childhood settings; (vi) include cross-border media; and (vii) be evaluated, monitored and enforced. The draft principles were widely disseminated and 220 responses were received from professional and scientific associations, consumer bodies, industry bodies, health professionals and others. There was virtually universal agreement on the need to have a set of principles to guide action in this contentious area of marketing to children. Apart from industry opposition to the third principle calling for a statutory approach and several comments about the implementation challenges, there was strong support for each of the Sydney Principles. Feedback on two specific issues of contention related to the age range to which restrictions should apply (most nominating age 16 or 18 years) and the types of products to be included (31% nominating all products, 24% all food and beverages, and 45% energy-dense, nutrient-poor foods and beverages). The Sydney Principles, which took a children's rights-based approach, should be used to benchmark action to reduce marketing to children. The age definition for a child and the types of products which should have marketing restrictions may better suit a risk-based approach at this stage. The Sydney Principles should guide the formation of an International Code on Food and Beverage Marketing to Children.

  16. Adult presentation of Bartter syndrome type IV with erythrocytosis

    PubMed Central

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Abstract Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis. PMID:26537508

  17. An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

    PubMed Central

    MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

    2012-01-01

    SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

  18. Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

    PubMed

    Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

    2018-01-09

    Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

  19. Effectiveness and cost-effectiveness of an integrated care program for schizophrenia: an analysis of routine data.

    PubMed

    Kerkemeyer, Linda; Wasem, Jürgen; Neumann, Anja; Brannath, Werner; Mester, Benjamin; Timm, Jürgen; Wobrock, Thomas; Bartels, Claudia; Falkai, Peter; Biermann, Janine

    2017-08-08

    In Germany, a regional social health insurance fund provides an integrated care program for patients with schizophrenia (IVS). Based on routine data of the social health insurance, this evaluation examined the effectiveness and cost-effectiveness of the IVS compared to the standard care (control group, CG). The primary outcome was the reduction of psychiatric inpatient treatment (days in hospital), and secondary outcomes were schizophrenia-related inpatient treatment, readmission rates, and costs. To reduce selection bias, a propensity score matching was performed. The matched sample included 752 patients. Mean number of psychiatric and schizophrenia-related hospital days of patients receiving IVS (2.3 ± 6.5, 1.7 ± 5.0) per quarter was reduced, but did not differ statistically significantly from CG (2.7 ± 7.6, 1.9 ± 6.2; p = 0.772, p = 0.352). Statistically significant between-group differences were found in costs per quarter per person caused by outpatient treatment by office-based psychiatrists (IVS: €74.18 ± 42.30, CG: €53.20 ± 47.96; p < 0.001), by psychiatric institutional outpatient departments (IVS: €4.83 ± 29.57, CG: €27.35 ± 76.48; p < 0.001), by medication (IVS: €471.75 ± 493.09, CG: €429.45 ± 532.73; p = 0.015), and by psychiatric outpatient nursing (IVS: €3.52 ± 23.83, CG: €12.67 ± 57.86, p = 0.045). Mean total psychiatric costs per quarter per person in IVS (€1117.49 ± 1662.73) were not significantly lower than in CG (€1180.09 ± 1948.24; p = 0.150). No statistically significant differences in total schizophrenia-related costs per quarter per person were detected between IVS (€979.46 ± 1358.79) and CG (€989.45 ± 1611.47; p = 0.084). The cost-effectiveness analysis showed cost savings of €148.59 per reduced psychiatric and €305.40 per reduced schizophrenia-related hospital day. However, limitations, especially non-inclusion of costs related to management of the IVS and additional home treatment within the IVS, restrict the interpretation of the results. Therefore, the long-term impact of this IVS deserves further evaluation.

  20. The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

    PubMed Central

    Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

    2017-01-01

    Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

  1. Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

    PubMed Central

    Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

    2004-01-01

    NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

  2. Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

    PubMed Central

    Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

    2015-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

  3. Validity of DSM-IV attention–deficit/hyperactivity disorder symptom dimensions and subtypes

    PubMed Central

    Willcutt, Erik G.; Nigg, Joel T.; Pennington, Bruce F.; Solanto, Mary V.; Rohde, Luis A.; Tannock, Rosemary; Loo, Sandra K.; Carlson, Caryn L.; McBurnett, Keith; Lahey, Benjamin B.

    2013-01-01

    DSM-IV criteria for ADHD specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision-making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the validity of the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, it is concluded that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. PMID:22612200

  4. Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

    PubMed

    Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

    2013-11-01

    The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

  5. Influence of hospital type on survival in stage IV colorectal cancer.

    PubMed

    Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

    2016-08-01

    Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

  6. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  7. Identification of type IV collagen exposure as a molecular imaging target for early detection of thoracic aortic dissection

    PubMed Central

    Xu, Ke; Xu, Chen; Zhang, Yanzhenzi; Qi, Feiran; Yu, Bingran; Li, Ping; Jia, Lixin; Li, Yulin; Xu, Fu-jian; Du, Jie

    2018-01-01

    Thoracic aortic dissection (TAD) is an aggressive and life-threatening vascular disease and there is no effective means of early diagnosis of dissection. Type IV collagen (Col-IV) is a major component of the sub-endothelial basement membrane, which is initially exposed followed by endothelial injury as early-stage event of TAD. So, we want to build a noninvasive diagnostic method to detect early dissection by identifying the exposed Col-IV via MRI. Methods: Col-IV-targeted magnetic resonance/ fluorescence dual probe (Col-IV-DOTA-Gd-rhodamine B; CDR) was synthesized by amide reaction and coordination reaction. Flow cytometry analysis was used to evaluate the cell viability of SMC treated with CDR and fluorescence assays were used to assess the Col-IV targeting ability of CDR in vitro. We then examined the sensitivity and specificity of CDR at different stages of TAD via MRI and bioluminescence imaging in vivo. Results: The localization of Col-IV (under the intima) was observed by histology images. CDR bound specifically to Col-IV-expressing vascular smooth muscle cells and BAPN-induced dissected aorta. The CDR signal was co-detected by magnetic resonance imaging (MRI) and bioluminescence imaging as early as 2 weeks after BAPN administration (pre-dissection stage). The ability to detect rupture of dissected aorta was indicated by a strong normalized signal enhancement (NSE) in vivo. Moreover, NSE was negatively correlated with the time of dissection rupture after BAPN administration (r2 = 0.8482). Conclusion: As confirmed by in vivo studies, the CDR can identify the exposed Col-IV in degenerated aorta to monitor the progress of aortic dissection from the early stage to the rupture via MRI. Thus, CDR-enhanced MRI proposes a potential method for dissection screening, and for monitoring disease progression and therapeutic response. PMID:29290819

  8. Porphyromonas endodontalis: prevalence and distribution of restriction enzyme patterns in families.

    PubMed

    Petit, M D; van Winkelhoff, A J; van Steenbergen, T J; de Graaff, J

    1993-08-01

    In this study we determined the prevalence and distribution of Porphyromonas endodontalis in 26 families consisting of 107 subjects. P. endodontalis was present in 24% of the investigated subjects and was recovered most often from the dorsum of the tongue (50%). Isolation was also possible from the tonsils, the buccal mucosa, the saliva and the periodontal pocket. The usefulness of restriction endonuclease analysis as a typing method for this particular species was investigated by typing 19 isolates from unrelated individuals. All these isolates had unique restriction endonuclease patterns. The observed heterogeneity indicates that restriction endonuclease analysis is a sensitive measure of genetic dissimilarity between P. endodontalis isolates and is able to characterize individual isolates. Application of restriction endonuclease analysis to the obtained clinical isolates in this study shows the possibility of the presence of multiple clonal types within one subject. The DNA patterns of all P. endodontalis isolates from unrelated individuals were found to be distinct. In 3 families the DNA patterns of isolates from the mother and her child were indistinguishable. These data indicate the possibility of intrafamilial transmission of P. endodontalis.

  9. The Extended Family of CD1d-Restricted NKT Cells: Sifting through a Mixed Bag of TCRs, Antigens, and Functions

    PubMed Central

    Macho-Fernandez, Elodie; Brigl, Manfred

    2015-01-01

    Natural killer T (NKT) cells comprise a family of specialized T cells that recognize lipid antigens presented by CD1d. Based on their T cell receptor (TCR) usage and antigen specificities, CD1d-restricted NKT cells have been divided into two main subsets: type I NKT cells that use a canonical invariant TCR α-chain and recognize α-galactosylceramide (α-GalCer), and type II NKT cells that use a more diverse αβ TCR repertoire and do not recognize α-GalCer. In addition, α-GalCer-reactive NKT cells that use non-canonical αβ TCRs and CD1d-restricted T cells that use γδ or δ/αβ TCRs have recently been identified, revealing further diversity among CD1d-restricted T cells. Importantly, in addition to their distinct antigen specificities, functional differences are beginning to emerge between the different members of the CD1d-restricted T cell family. In this review, while using type I NKT cells as comparison, we will focus on type II NKT cells and the other non-invariant CD1d-restricted T cell subsets, and discuss our current understanding of the antigens they recognize, the formation of stimulatory CD1d/antigen complexes, the modes of TCR-mediated antigen recognition, and the mechanisms and consequences of their activation that underlie their function in antimicrobial responses, anti-tumor immunity, and autoimmunity. PMID:26284062

  10. Simultaneous detection of Hb constant spring (α142, TAA>CAA, α2) and the α2 IVS-I donor site (-TGAGG) deletion by a simple polymerase chain reaction-based method in Iran.

    PubMed

    Akhavan-Niaki, Haleh; Banihashemi, Ali; Mostafazadeh, Amrollah; Kholghi Oskooei, Vahid; Azizi, Mandana; Youssefi Kamangar, Reza; Elmi, Maryam Mitra

    2012-01-01

    Hb Constant Spring (Hb CS, codon 142, TAA>CAA, α2) (HBA2:c.427T>C) and α2 IVS-I donor site (GAGGTGAGG>GAGG - - - - -) (HBA2:c.95+2_95+6delTGAGG) are nondeletional α-thalassemia (α-thal) mutations found all over the world. Identification of α-thal genotypes in at-risk couples for severe anemia or in highly heterogeneous populations requires rapid, accurate and cost-effective genotyping methods. In this study, a pair of primers were used to specifically amplify an 883 bp fragment from the α2-globin gene in order to simultaneously identify these two mutations by a PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method. We determined the genotypic frequencies of Hb CS and the α2 IVS-I donor site mutations after amplification and enzymatic digestion with Tru9I in 238 northern Iranian samples referred for α-thal testing. Hb CS and the α2 IVS-I donor site mutations accounted for 21 (8.8%) and 29 (12.2%) of the nondeletional cases. This genotyping assay has proven to be a rapid, reliable and useful diagnostic tool for simultaneous detection of these two anomalies for genetic counseling or further prenatal diagnosis.

  11. Lung Cancer Diagnosis and Treatment as a Traumatic Stressor in DSM-IV and DSM-5: Prevalence and Relationship to Mental Health Outcomes.

    PubMed

    Andrykowski, Michael A; Steffens, Rachel F; Bush, Heather M; Tucker, Thomas C

    2015-06-01

    Little research has examined how lung cancer survivors whose cancer experience met the Diagnostic and Statistical Manual of Mental Disorders (DSM) traumatic stressor criterion differ with regard to posttreatment mental health status from survivors whose cancer experience did not. No research of which we are aware has examined the impact of the revised DSM-5 traumatic stressor criterion on this question. Non-small-cell (NSC) lung cancer survivors (N = 189) completed a telephone interview and questionnaire assessing distress and growth/benefit-finding. Survivors were categorized into Trauma and No Trauma groups using both the DSM-IV and DSM-5 stressor criterion. Using the DSM-IV criterion, the Trauma group (n = 70) reported poorer status than the No Trauma group (n = 119) on 10 of 10 distress indices (mean ES = 0.57 SD) and better status on all 7 growth/benefit-finding indices (mean ES = 0.30 SD). Using the DSM-5 stressor criterion, differences between the Trauma (n = 108) and No Trauma (n = 81) groups for indices of distress (mean ES = 0.26 SD) and growth/benefit-finding (mean ES = 0.17 SD) were less pronounced. Those who experience cancer as a traumatic stressor show greater distress and growth/benefit-finding, particularly when the more restrictive DSM-IV stressor criterion defines trauma exposure. Copyright © 2015 Wiley Periodicals, Inc., A Wiley Company.

  12. Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression

    PubMed Central

    SUNAMOTO, MASAAKI; KUZE, KOGO; IEHARA, NORIYUKI; TAKEOKA, HIROYA; NAGATA, KAZUHIRO; KITA, TORU; DOI, TOSHIO

    1998-01-01

    Glomerulosclerosis is characterized by accumulation of the mesangial extracellular matrix, including type I and IV collagen. The processing for the collagens in the glomeruli may play a critical role for development of glomerulosclerosis. We examined the expression of heat shock protein 47 (HSP47), a collagen-binding molecular chaperone in the progresive glomerulosclerosis model. Subtotally nephrectomized rats, unlike sham-operated rats, developed focal and segmental glomerulosclerosis. Immunological staining demonstrated an increased expression of HSP47 which paralleled the expression of type I and IV collagen in the glomeruli of the nephrectomized rats as the glomerulosclerosis developed. The mRNA levels encoding type I and type IV collagen and HSP47 were increased 3.4 fold, 3.6 fold and 2.8 fold, respectively, at week 7 after nephrectomy. By in situ hybridization, the expression of HSP47 mRNA was determined to be localized to the glomeruli with segmental sclerosis. These results suggest that HSP47 may play a central role in the process of extracellular matrix accumulation during the development of glomerulosclerosis. PMID:9741355

  13. Social networks and links to isolation and loneliness among elderly HCBS clients.

    PubMed

    Medvene, Louis J; Nilsen, Kari M; Smith, Rachel; Ofei-Dodoo, Samuel; DiLollo, Anthony; Webster, Noah; Graham, Annette; Nance, Anita

    2016-01-01

    The purpose of this study was to explore the network types of HCBS clients based on the structural characteristics of their social networks. We also examined how the network types were associated with social isolation, relationship quality and loneliness. Forty personal interviews were carried out with HCBS clients to assess the structure of their social networks as indicated by frequency of contact with children, friends, family and participation in religious and community organizations. Hierarchical cluster analysis was conducted to identify network types. Four network types were found including: family (n = 16), diverse (n = 8), restricted (n = 8) and religious (n = 7). Family members comprised almost half of participants' social networks, and friends comprised less than one-third. Clients embedded in family, diverse and religious networks had significantly more positive relationships than clients embedded in restricted networks. Clients embedded in restricted networks had significantly higher social isolation scores and were lonelier than clients in diverse and family networks. The findings suggest that HCBS clients' isolation and loneliness are linked to the types of social networks in which they are embedded. The findings also suggest that clients embedded in restricted networks are at high risk for negative outcomes.

  14. Chondroitin sulphates A, B and C, collagen types I-IV and fibronectin in venous sinus of the red pulp in human spleen.

    PubMed

    Rovenská, E; Michalka, P; Papincák, J; Durdík, S; Jakubovský, J

    2005-01-01

    The morphological relationship of chondroitin sulphates A, B, and C, collagen types I-IV and fibronectin in the wall of venous sinuses of the red pulp in human spleen has not been a focus of interest among morphologists. Regarding the hypothesis that the structure of the spleen lends it the function of a blood filter the substances described in our study might play a significant role in the functional morphology. Of 146 human spleen surgical specimens, groups of 12 specimens each were examined under a light microscope using the method of antibodies against fibronectin, against collagen types I-IV and against chondroitin sulphates A, B, and C. The sections of the red pulp of human spleen stained with hematoxylin and eosin provided limited information about the wall of the sinuses. Chondroitin sulphates A and B were observed on the surface of sinus-lining cells (SLC), and fibronectin was detected on the surface of the annular fibers. Collagen type 11 was observed almost in the same places as chondroitin sulphates A and B. Collagen type IV was present in annular fibers of the wall of the sinus and in the basement membrane, like fibronectin. Chondroitin sulphate was not present in the walls of sinuses. Binding of antibodies against chondroitin sulphate A and against chondroitin sulphate B indicates the presence of chondroitin sulfates on the surface of SLC, where they probably play a role in helping the human organism to recognize alien and self substances. The presence of chondroitin,sulphates A and B probably affects inhibition of binding of cells with collagen type I, but not with fibronectin.

  15. Association of history of allergies and influenza-like infections with laryngeal cancer in a case-control study.

    PubMed

    Filippidis, Filippos T; Schwartz, Stephen M; Becker, Nikolaus; Dyckhoff, Gerhard; Kirschfink, Michael; Dietz, Andreas; Becher, Heiko; Ramroth, Heribert

    2015-08-01

    Prior studies suggest that history of allergy and infections early in life might be inversely associated with cancer. We explored the association between allergies, recent influenza infections and laryngeal cancer risk. We used data from a case-control study which included 229 cases of laryngeal cancer and 769 population controls matched for age and sex. History of a physician-diagnosed allergy, influenza-like infections in the past 5 years, smoking, alcohol consumption and occupational exposure to carcinogens were self-reported. Allergies were classified into two groups (Type I and Type IV), according to the underlying immunologic mechanism. Conditional logistic regression models were fitted using laryngeal cancer as the outcome, adjusting for smoking, alcohol consumption and occupational exposure and stratified for age and sex. Having any allergy was not associated significantly with laryngeal cancer. Although Type I and Type IV allergies were non-significantly associated with laryngeal cancer, Type IV allergies showed a strong inverse association after adjusting for smoking and alcohol (OR 0.50, 95 % CI 0.22-1.2). Participants who reported at least one influenza-like infection during the past 5 years were significantly less likely to have laryngeal cancer (OR 0.57, 95 % CI 0.39-0.81). After considering fever (≥38.5 °C) as a criterion for influenza infection, the association between influenza infection and laryngeal cancer was even stronger (OR 0.29, 95 % CI 0.13-0.63). We found no significant association between any allergy and laryngeal cancer, some indication of an inverse association between Type IV allergy and laryngeal cancer, whereas recent influenza infections were inversely associated with laryngeal cancer risk.

  16. Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

    PubMed Central

    Charvin, G.; Bensimon, D.; Croquette, V.

    2003-01-01

    Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

  17. L-arginine mediated renaturation enhances yield of human, α6 type IV collagen non-collagenous domain from bacterial inclusion bodies

    PubMed Central

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Akul Sudhakar, Yakkanti

    2012-01-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated. PMID:22512648

  18. L-arginine mediated renaturation enhances yield of human, α6 Type IV collagen non-collagenous domain from bacterial inclusion bodies.

    PubMed

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul

    2012-10-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.

  19. [Joint endoprosthesis pathology. Histopathological diagnostics and classification].

    PubMed

    Krenn, V; Morawietz, L; Jakobs, M; Kienapfel, H; Ascherl, R; Bause, L; Kuhn, H; Matziolis, G; Skutek, M; Gehrke, T

    2011-05-01

    Prosthesis durability has steadily increased with high 10-year rates of 88-95%. However, four pathogenetic groups of diseases can decrease prosthesis durability: (1) periprosthetic wear particle disease (aseptic loosening) (2) bacterial infection (septic loosening) (3) periprosthetic ossification, and (4) arthrofibrosis. The histopathological "extended consensus classification of periprosthetic membranes" includes four types of membranes, arthrofibrosis, and osseous diseases of endoprosthetics: The four types of neosynovia are: wear particle-induced type (type I), mean prosthesis durability (MPD) in years 12.0; infectious type (type II), MPD 2.5; combined type (type III) MPD 4.2; and indeterminate type (type IV), MPD 5.5. Arthrofibrosis can be determined in three grades: grade 1 needs clinical information to be differentiated from a type IV membrane, and grades 2 & 3 can be diagnosed histopathologically. Periprosthetic ossification, osteopenia-induced fractures, and aseptic osteonecrosis can be histopathologically diagnosed safely with clinical information. The extended consensus classification of periprosthetic membranes may be a diagnostic groundwork for a future national endoprosthesis register.

  20. Periodontal soft tissue root coverage procedures: a systematic review from the AAP Regeneration Workshop.

    PubMed

    Chambrone, Leandro; Tatakis, Dimitris N

    2015-02-01

    This paper aims to create a "bridge" between research and practice by developing a practical, extensive, and clinically relevant study that translates evidence-based findings on soft tissue root coverage (RC) of recession-type defects to daily clinical practice. This review is prepared in accordance with the PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) statement based on the proposed focused questions. A literature search with no restrictions regarding status or the language of publication was performed for MEDLINE and EMBASE databases up to and including June 2013. Systematic reviews (SRs), randomized clinical trials, controlled clinical trials, case series, and case reports evaluating recession areas that were treated by means of RC procedures were considered eligible for inclusion through the three parts of the study (part I, an overview of the base of SRs; part II, an alternative random-effects meta-analyses on mean percentage of RC and sites exhibiting complete RC; and part III, an SR of non-randomized trials exploring other conditions not extensively evaluated by previous SRs). Data on Class I, II, III, and IV recessions, type of histologic attachment achieved with treatment, recipient- and donor-site anatomic characteristics, smoking-related outcomes, root surface conditions, tooth type and location, long-term effectiveness outcomes, unusual conditions that may be reported during conventional daily practice, and patient-centered outcomes were assessed as well. Of the 2,456 potentially eligible trials, 234 were included. Data on Class I, II, III, and IV gingival recessions, histologic attachment achieved after treatment, recipient- and donor-site anatomic characteristics, smoking-related outcomes, root surface conditions/biomodification, tooth type and location, long-term effectiveness outcomes and unusual conditions that may be reported during conventional daily practice, and patient-centered outcomes (i.e., esthetic, visual analog scale, complications, hypersensitivity, patients perceptions) were assessed. Subepithelial connective tissue (CT)-based procedures and coronally advanced flap plus acellular dermal matrix grafts, enamel matrix derivative, or collagen matrix led to the best improvements of recession depth, clinical attachment level (CAL) gain, and keratinized tissue (KT). Some conditions, such as smoking and use of magnification, may affect RC outcomes. All RC procedures can provide significant reduction in recession depth and CAL gain for Miller Class I and II recession-type defects. Subepithelial CT graft-based procedures provided the best outcomes for clinical practice because of their superior percentages of mean and complete RC, as well as significant increase of KT.

Top