Mutation-adapted U1 snRNA corrects a splicing error of the dopa decarboxylase gene.
Lee, Ni-Chung; Lee, Yu-May; Chen, Pin-Wen; Byrne, Barry J; Hwu, Wuh-Liang
2016-12-01
Aromatic l-amino acid decarboxylase (AADC) deficiency is an inborn error of monoamine neurotransmitter synthesis, which results in dopamine, serotonin, epinephrine and norepinephrine deficiencies. The DDC gene founder mutation IVS6 + 4A > T is highly prevalent in Chinese patients with AADC deficiency. In this study, we designed several U1 snRNA vectors to adapt U1 snRNA binding sequences of the mutated DDC gene. We found that only the modified U1 snRNA (IVS-AAA) that completely matched both the intronic and exonic U1 binding sequences of the mutated DDC gene could correct splicing errors of either the mutated human DDC minigene or the mouse artificial splicing construct in vitro. We further injected an adeno-associated viral (AAV) vector to express IVS-AAA in the brain of a knock-in mouse model. This treatment was well tolerated and improved both the survival and brain dopamine and serotonin levels of mice with AADC deficiency. Therefore, mutation-adapted U1 snRNA gene therapy can be a promising method to treat genetic diseases caused by splicing errors, but the efficiency of such a treatment still needs improvements. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Transcription boundaries of U1 small nuclear RNA.
Kunkel, G R; Pederson, T
1985-01-01
Transcription-proximal stages of U1 small nuclear RNA biosynthesis were studied by 32P labeling of nascent chains in isolated HeLa cell nuclei. Labeled RNA was hybridized to nitrocellulose-immobilized, single-stranded M13 DNA clones corresponding to regions within or flanking a human U1 RNA gene. Transcription of U1 RNA was inhibited by greater than 95% by alpha-amanitin at 1 microgram/ml, consistent with previous evidence that it is synthesized by RNA polymerase II. No hybridization to DNA immediately adjacent to the 5' end of mature U1 RNA (-6 to -105 nucleotides) was detected, indicating that, like all studied polymerase II initiation, transcription of U1 RNA starts at or very near the cap site. However, in contrast to previously described transcription units for mRNA, in which equimolar transcription occurs for hundreds or thousands of nucleotides beyond the mature 3' end of the mRNA, labeled U1 RNA hybridization dropped off sharply within a very short region (approximately 60 nucleotides) immediately downstream from the 3' end of mature U1 RNA. Also in contrast to pre-mRNA, which is assembled into ribonucleoprotein (RNP) particles while still nascent RNA chains, the U1 RNA transcribed in isolated nuclei did not form RNP complexes by the criterion of reaction with a monoclonal antibody for the small nuclear RNP Sm proteins. This suggests that, unlike pre-mRNA-RNP particle formation, U1 small nuclear RNP assembly does not occur until after the completion of transcription. These results show that, despite their common synthesis by RNA polymerase II, mRNA and U1 small nuclear RNA differ markedly both in their extents of 3' processing and their temporal patterns of RNP assembly. Images PMID:2942763
Properties of a U1 RNA enhancer-like sequence.
Ciliberto, G; Palla, F; Tebb, G; Mattaj, I W; Philipson, L
1987-01-01
The properties of a X.laevis U1B snRNA gene enhancer have been studied by microinjection in Xenopus oocytes. The enhancer-like sequence, defined as a short DNA stretch that is able to activate transcription in an orientation independent manner, is interchangeable between different U snRNA genes. The enhancer sequence alone does not, however, efficiently activate transcription from an SV40 pol II promoter but regains its activity when combined with the U-gene specific proximal sequence element. DNase I protection experiments show that the X.laevis U1B enhancer can interact specifically with a nuclear factor present in mammalian cells. Images PMID:3031597
Organization and transient expression of the gene for human U11 snRNA
Clemens, Suter-Crazzolara; Walter, Keller
1991-01-01
The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214
Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.
Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R
2008-09-15
Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.
Das, G; Henning, D; Wright, D; Reddy, R
1988-01-01
Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121
Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.
Ahuja, Richa; Kumar, Vijay
2017-07-01
RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.
U6 small nuclear RNA is transcribed by RNA polymerase III.
Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T
1986-01-01
A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970
Preußer, Christian; Rossbach, Oliver; Hung, Lee-Hsueh; Li, Dan; Bindereif, Albrecht
2014-01-01
Trans-splicing in trypanosomes adds a 39-nucleotide mini-exon from the spliced leader (SL) RNA to the 5′ end of each protein-coding sequence. On the other hand, cis-splicing of the few intron-containing genes requires the U1 small nuclear ribonucleoprotein (snRNP) particle. To search for potential new functions of the U1 snRNP in Trypanosoma brucei, we applied genome-wide individual-nucleotide resolution crosslinking-immunoprecipitation (iCLIP), focusing on the U1 snRNP-specific proteins U1C and U1-70K. Surprisingly, U1C and U1-70K interact not only with the U1, but also with U6 and SL RNAs. In addition, mapping of crosslinks to the cis-spliced PAP [poly(A) polymerase] pre-mRNA indicate an active role of these proteins in 5′ splice site recognition. In sum, our results demonstrate that the iCLIP approach provides insight into stable and transient RNA–protein contacts within the spliceosomal network. We propose that the U1 snRNP may represent an evolutionary link between the cis- and trans-splicing machineries, playing a dual role in 5′ splice site recognition on the trans-spliceosomal SL RNP as well as on pre-mRNA cis-introns. PMID:24748659
Transient overexpression of exogenous APOBEC3A causes C-to-U RNA editing of thousands of genes.
Sharma, Shraddha; Patnaik, Santosh K; Kemer, Zeynep; Baysal, Bora E
2017-05-04
APOBEC3A cytidine deaminase induces site-specific C-to-U RNA editing of hundreds of genes in monocytes exposed to hypoxia and/or interferons and in pro-inflammatory macrophages. To examine the impact of APOBEC3A overexpression, we transiently expressed APOBEC3A in HEK293T cell line and performed RNA sequencing. APOBEC3A overexpression induces C-to-U editing at more than 4,200 sites in transcripts of 3,078 genes resulting in protein recoding of 1,110 genes. We validate recoding RNA editing of genes associated with breast cancer, hematologic neoplasms, amyotrophic lateral sclerosis, Alzheimer disease and primary pulmonary hypertension. These results highlight the fundamental impact of APOBEC3A overexpression on human transcriptome by widespread RNA editing.
The role of RNA structure in the interaction of U1A protein with U1 hairpin II RNA
Law, Michael J.; Rice, Andrew J.; Lin, Patti; Laird-Offringa, Ite A.
2006-01-01
The N-terminal RNA Recognition Motif (RRM1) of the spliceosomal protein U1A interacting with its target U1 hairpin II (U1hpII) has been used as a paradigm for RRM-containing proteins interacting with their RNA targets. U1A binds to U1hpII via direct interactions with a 7-nucleotide (nt) consensus binding sequence at the 5′ end of a 10-nt loop, and via hydrogen bonds with the closing C–G base pair at the top of the RNA stem. Using surface plasmon resonance (Biacore), we have examined the role of structural features of U1hpII in binding to U1A RRM1. Mutational analysis of the closing base pair suggests it plays a minor role in binding and mainly prevents “breathing” of the loop. Lengthening the stem and nontarget part of the loop suggests that the increased negative charge of the RNA might slightly aid association. However, this is offset by an increase in dissociation, which may be caused by attraction of the RRM to nontarget parts of the RNA. Studies of a single stranded target and RNAs with untethered loops indicate that structure is not very relevant for association but is important for complex stability. In particular, breaking the link between the stem and the 5′ side of the loop greatly increases complex dissociation, presumably by hindering simultaneous contacts between the RRM and stem and loop nucleotides. While binding of U1A to a single stranded target is much weaker than to U1hpII, it occurs with nanomolar affinity, supporting recent evidence that binding of unstructured RNA by U1A has physiological significance. PMID:16738410
The role of RNA structure in the interaction of U1A protein with U1 hairpin II RNA.
Law, Michael J; Rice, Andrew J; Lin, Patti; Laird-Offringa, Ite A
2006-07-01
The N-terminal RNA Recognition Motif (RRM1) of the spliceosomal protein U1A interacting with its target U1 hairpin II (U1hpII) has been used as a paradigm for RRM-containing proteins interacting with their RNA targets. U1A binds to U1hpII via direct interactions with a 7-nucleotide (nt) consensus binding sequence at the 5' end of a 10-nt loop, and via hydrogen bonds with the closing C-G base pair at the top of the RNA stem. Using surface plasmon resonance (Biacore), we have examined the role of structural features of U1hpII in binding to U1A RRM1. Mutational analysis of the closing base pair suggests it plays a minor role in binding and mainly prevents "breathing" of the loop. Lengthening the stem and nontarget part of the loop suggests that the increased negative charge of the RNA might slightly aid association. However, this is offset by an increase in dissociation, which may be caused by attraction of the RRM to nontarget parts of the RNA. Studies of a single stranded target and RNAs with untethered loops indicate that structure is not very relevant for association but is important for complex stability. In particular, breaking the link between the stem and the 5' side of the loop greatly increases complex dissociation, presumably by hindering simultaneous contacts between the RRM and stem and loop nucleotides. While binding of U1A to a single stranded target is much weaker than to U1hpII, it occurs with nanomolar affinity, supporting recent evidence that binding of unstructured RNA by U1A has physiological significance.
A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.
Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L
2017-07-15
Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.
Pavelitz, Thomas; Bailey, Arnold D.; Elco, Christopher P.; Weiner, Alan M.
2008-01-01
In mammals, small multigene families generate spliceosomal U snRNAs that are nearly as abundant as rRNA. Using the tandemly repeated human U2 genes as a model, we show by footprinting with DNase I and permanganate that nearly all sequences between the enhancer-like distal sequence element and the initiation site are protected during interphase whereas the upstream half of the U2 snRNA coding region is exposed. We also show by chromatin immunoprecipitation that the SNAPc complex, which binds the TATA-like proximal sequence element, is removed at metaphase but remains bound under conditions that induce locus-specific metaphase fragility of the U2 genes, such as loss of CSB, BRCA1, or BRCA2 function, treatment with actinomycin D, or overexpression of the tetrameric p53 C terminus. We propose that the U2 snRNA promoter establishes a persistently open state to facilitate rapid reinitiation and perhaps also to bypass TFIIH-dependent promoter melting; this open state would then be disassembled to allow metaphase chromatin condensation. PMID:18378697
Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia
Kojima, Kenji K.
2015-01-01
Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an “archaeal” RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes. PMID:26556480
Box C/D small nucleolar RNA (snoRNA) U60 regulates intracellular cholesterol trafficking.
Brandis, Katrina A; Gale, Sarah; Jinn, Sarah; Langmade, Stephen J; Dudley-Rucker, Nicole; Jiang, Hui; Sidhu, Rohini; Ren, Aileen; Goldberg, Anna; Schaffer, Jean E; Ory, Daniel S
2013-12-13
Mobilization of plasma membrane (PM) cholesterol to the endoplasmic reticulum is essential for cellular cholesterol homeostasis. The mechanisms regulating this retrograde, intermembrane cholesterol transfer are not well understood. Because mutant cells with defects in PM to endoplasmic reticulum cholesterol trafficking can be isolated on the basis of resistance to amphotericin B, we conducted an amphotericin B loss-of-function screen in Chinese hamster ovary (CHO) cells using insertional mutagenesis to identify genes that regulate this trafficking mechanism. Mutant line A1 displayed reduced cholesteryl ester formation from PM-derived cholesterol and increased de novo cholesterol synthesis, indicating a deficiency in retrograde cholesterol transport. Genotypic analysis revealed that the A1 cell line contained one disrupted allele of the U60 small nucleolar RNA (snoRNA) host gene, resulting in haploinsufficiency of the box C/D snoRNA U60. Complementation and mutational studies revealed the U60 snoRNA to be the essential feature from this locus that affects cholesterol trafficking. Lack of alteration in predicted U60-mediated site-directed methylation of 28 S rRNA in the A1 mutant suggests that the U60 snoRNA modulates cholesterol trafficking by a mechanism that is independent of this canonical function. Our study adds to a growing body of evidence for participation of small noncoding RNAs in cholesterol homeostasis and is the first to implicate a snoRNA in this cellular function.
C to U RNA editing mediated by APOBEC1 requires RNA-binding protein RBM47.
Fossat, Nicolas; Tourle, Karin; Radziewic, Tania; Barratt, Kristen; Liebhold, Doreen; Studdert, Joshua B; Power, Melinda; Jones, Vanessa; Loebel, David A F; Tam, Patrick P L
2014-08-01
Cytidine (C) to Uridine (U) RNA editing is a post-transcriptional modification that is accomplished by the deaminase APOBEC1 and its partnership with the RNA-binding protein A1CF. We identify and characterise here a novel RNA-binding protein, RBM47, that interacts with APOBEC1 and A1CF and is expressed in tissues where C to U RNA editing occurs. RBM47 can substitute for A1CF and is necessary and sufficient for APOBEC1-mediated editing in vitro. Editing is further impaired in Rbm47-deficient mutant mice. These findings suggest that RBM47 and APOBEC1 constitute the basic machinery for C to U RNA editing. © 2014 The Authors.
Miyazaki, Saori; Sato, Yutaka; Asano, Tomoya; Nagamura, Yoshiaki; Nonomura, Ken-Ichi
2015-10-01
Post-transcriptional gene regulation by RNA recognition motif (RRM) proteins through binding to cis-elements in the 3'-untranslated region (3'-UTR) is widely used in eukaryotes to complete various biological processes. Rice MEIOSIS ARRESTED AT LEPTOTENE2 (MEL2) is the RRM protein that functions in the transition to meiosis in proper timing. The MEL2 RRM preferentially associated with the U-rich RNA consensus, UUAGUU[U/A][U/G][A/U/G]U, dependently on sequences and proportionally to MEL2 protein amounts in vitro. The consensus sequences were located in the putative looped structures of the RNA ligand. A genome-wide survey revealed a tendency of MEL2-binding consensus appearing in 3'-UTR of rice genes. Of 249 genes that conserved the consensus in their 3'-UTR, 13 genes spatiotemporally co-expressed with MEL2 in meiotic flowers, and included several genes whose function was supposed in meiosis; such as Replication protein A and OsMADS3. The proteome analysis revealed that the amounts of small ubiquitin-related modifier-like protein and eukaryotic translation initiation factor3-like protein were dramatically altered in mel2 mutant anthers. Taken together with transcriptome and gene ontology results, we propose that the rice MEL2 is involved in the translational regulation of key meiotic genes on 3'-UTRs to achieve the faithful transition of germ cells to meiosis.
Choi, Hyun-Woo; Kim, Hye-Ran; Baek, Hee-Jo; Kook, Hoon; Cho, Duck; Shin, Jong-Hee; Suh, Soon-Pal; Ryang, Dong-Wook; Shin, Myung-Geun
2015-01-01
Recurrent somatic SET-binding protein 1 (SETBP1) and splicing pathway gene mutations have recently been found in atypical chronic myeloid leukemia and other hematologic malignancies. These mutations have been comprehensively analyzed in adult AML, but not in childhood AML. We investigated possible alteration of the SETBP1, splicing factor 3B subunit 1 (SF3B1), U2 small nuclear RNA auxiliary factor 1 (U2AF1), and serine/arginine-rich splicing factor 2 (SRSF2) genes in childhood AML. Cytogenetic and molecular analyses were performed to reveal chromosomal and genetic alterations. Sequence alterations in the SETBP1, SF3B1, U2AF1, and SRSF2 genes were examined by using direct sequencing in a cohort of 53 childhood AML patients. Childhood AML patients did not harbor any recurrent SETBP1 gene mutations, although our study did identify a synonymous mutation in one patient. None of the previously reported aberrations in the mutational hotspot of SF3B1, U2AF1, and SRSF2 were identified in any of the 53 patients. Alterations of the SETBP1 gene or SF3B1, U2AF1, and SRSF2 genes are not common genetic events in childhood AML, implying that the mutations are unlikely to exert a driver effect in myeloid leukemogenesis during childhood.
Fan, Hui-Min; Wu, Ling-Jie; Hu, Feng-Yu; Yang, Zhan
2012-08-01
To study the gene copy number, mRNA transcription and protien expression of programmed cell death 1 (PD-1) gene in primary hepatocellular carcinoma (PHC) patients and normal control individuals (NC) who are anti-HBs positive, and to investigate the variations in PD-1 gene copy numbers and its relationship with PHC. Real-time PCR was adopted to detect the PD-1 gene copy numbers and their mRNA expressions in peripheral blood mononuclear cells (PBMCs) from 24 samples of PHC patients and 26 of NC. Protein expression level of PD-1 on CD8+ T was analyzed by flow cytometry. In terms of number of PD-1 gene copy numbers, the percentage of cases of haploid (single) was 34.62% and 4.17% in PHC group and control group respectively while the percentage of cases of diploid (double) was 61.54% and 95.83% respectively. The difference between the two was statistically significant (chi2 = 7.639, P = 0.006). The rate of cases with double PD-1 gene copy numbers was found to be higher in patients with PHC than in control group. It was also found that the average expression of PD-1 mRNA was 2.35E-03 in control group and 1.23E-03 in PHC group. The expression level was significant lower in PHC group than that in control group when compared by using Mann-whitey technic (U = 153, P = 0.009). Furthermore, the frequency of PD-1 protein expression on CD8+ T cells was 3.72 +/- 0.32 in control group and 16.13 +/- 1.68 in PHC group. The level of PD-1 mRNA expression was higher in PHC and significant differences was shown between two groups (t = -7.073, P = 0.000). Our study suggests that the variation in PD-1 gene copy number may trigger primary hepatocellular carcinoma to HBV carriers. The relationship between the variation of PD-1 gene copy numbers and its association with primary hepatocellular carcinoma is worth further focus.
U1 small nuclear RNA variants differentially form ribonucleoprotein particles in vitro.
Somarelli, Jason A; Mesa, Annia; Rodriguez, Carol E; Sharma, Shalini; Herrera, Rene J
2014-04-25
The U1 small nuclear (sn)RNA participates in splicing of pre-mRNAs by recognizing and binding to 5' splice sites at exon/intron boundaries. U1 snRNAs associate with 5' splice sites in the form of ribonucleoprotein particles (snRNPs) that are comprised of the U1 snRNA and 10 core components, including U1A, U1-70K, U1C and the 'Smith antigen', or Sm, heptamer. The U1 snRNA is highly conserved across a wide range of taxa; however, a number of reports have identified the presence of expressed U1-like snRNAs in multiple species, including humans. While numerous U1-like molecules have been shown to be expressed, it is unclear whether these variant snRNAs have the capacity to form snRNPs and participate in splicing. The purpose of the present study was to further characterize biochemically the ability of previously identified human U1-like variants to form snRNPs and bind to U1 snRNP proteins. A bioinformatics analysis provided support for the existence of multiple expressed variants. In vitro gel shift assays, competition assays, and immunoprecipitations (IPs) revealed that the variants formed high molecular weight assemblies to varying degrees and associated with core U1 snRNP proteins to a lesser extent than the canonical U1 snRNA. Together, these data suggest that the human U1 snRNA variants analyzed here are unable to efficiently bind U1 snRNP proteins. The current work provides additional biochemical insights into the ability of the variants to assemble into snRNPs. Copyright © 2014 Elsevier B.V. All rights reserved.
Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.
Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S
2017-09-29
Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
The Treacher Collins syndrome (TCOF1) gene product is involved in pre-rRNA methylation.
Gonzales, Bianca; Henning, Dale; So, Rolando B; Dixon, Jill; Dixon, Michael J; Valdez, Benigno C
2005-07-15
Treacher Collins syndrome (TCS) is characterized by defects in craniofacial development, which results from mutations in the TCOF1 gene. TCOF1 encodes the nucleolar phosphoprotein treacle, which interacts with upstream binding factor (UBF) and affects transcription of the ribosomal DNA gene. The present study shows participation of treacle in the 2'-O-methylation of pre-rRNA. Antisense-mediated down-regulation of treacle expression in Xenopus laevis oocytes reduced 2'-O-methylation of pre-rRNA. Analysis of RNA isolated from wild-type and Tcof1+/- heterozygous mice embryos from strains that exhibit a lethal phenotype showed significant reduction in 2'-O-methylation at nucleotide C463 of 18S rRNA. The level of pseudouridylation of U1642 of 18S rRNA from the same RNA samples was not affected suggesting specificity. There is no significant difference in rRNA methylation between wild-type and heterozygous embryos of DBA x BALB/c mice, which have no obvious craniofacial phenotype. The function of treacle in pre-rRNA methylation is most likely mediated by its direct physical interaction with NOP56, a component of the ribonucleoprotein methylation complex. Although treacle co-localizes with UBF throughout mitosis, it co-localizes with NOP56 and fibrillarin, a putative methyl transferase, only during telophase when rDNA gene transcription and pre-rRNA methylation are known to commence. These observations suggest that treacle might link RNA polymerase I-catalyzed transcription and post-transcriptional modification of pre-rRNA. We hypothesize that haploinsufficiency of treacle in TCS patients results in inhibition of production of properly modified mature rRNA in addition to inhibition of rDNA gene transcription, which consequently affects proliferation and proper differentiation of specific embryonic cells during development.
A New Class of SINEs with snRNA Gene-Derived Heads.
Kojima, Kenji K
2015-05-27
Eukaryotic genomes are colonized by various transposons including short interspersed elements (SINEs). The 5' region (head) of the majority of SINEs is derived from one of the three types of RNA genes--7SL RNA, transfer RNA (tRNA), or 5S ribosomal RNA (rRNA)--and the internal promoter inside the head promotes the transcription of the entire SINEs. Here I report a new group of SINEs whose heads originate from either the U1 or U2 small nuclear RNA gene. These SINEs, named SINEU, are distributed among crocodilians and classified into three families. The structures of the SINEU-1 subfamilies indicate the recurrent addition of a U1- or U2-derived sequence onto the 5' end of SINEU-1 elements. SINEU-1 and SINEU-3 are ancient and shared among alligators, crocodiles, and gharials, while SINEU-2 is absent in the alligator genome. SINEU-2 is the only SINE family that was active after the split of crocodiles and gharials. All SINEU families, especially SINEU-3, are preferentially inserted into a family of Mariner DNA transposon, Mariner-N4_AMi. A group of Tx1 non-long terminal repeat retrotransposons designated Tx1-Mar also show target preference for Mariner-N4_AMi, indicating that SINEU was mobilized by Tx1-Mar. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Dron, M; Hameau, L; Benboudjema, L; Guymarho, J; Cajean-Feroldi, C; Rizza, P; Godard, C; Jasmin, C; Tovey, M G; Lang, M C
1999-01-01
To identify the pathways involved in HIV-1 modification of cellular gene expression, chronically infected U937 cells were screened by mRNA differential display. A chimeric transcript consisting of the 3' end of the LTR of a HIV-1 provirus, followed by 3.7 kb of cellular RNA was identified suggesting that long readthrough transcription might be one of the mechanisms by which gene expression could be modified in individual infected cells. Such a phenomenon may also be the first step towards the potential transduction of cellular sequences. Furthermore, the mRNA encoding for the transcription factor Egr-1 was detected as an over-represented transcript in infected cells. Northern blot analysis confirmed the increase of Egr-1 mRNA content in both HIV-1 infected promonocytic U937 cells and T cell lines such as Jurkat and CEM. Interestingly a similar increase of Egr-1 mRNA has previously been reported to occur in HTLV-1 and HTLV-2 infected T cell lines. Despite the consistent increase in the level of Egr-1 mRNA, the amount of the encoded protein did not appear to be modified in HIV-1 infected cells, suggesting an increased turn over of the protein in chronically infected cells.
snoU6 and 5S RNAs are not reliable miRNA reference genes in neuronal differentiation.
Lim, Q E; Zhou, L; Ho, Y K; Wan, G; Too, H P
2011-12-29
Accurate profiling of microRNAs (miRNAs) is an essential step for understanding the functional significance of these small RNAs in both physiological and pathological processes. Quantitative real-time PCR (qPCR) has gained acceptance as a robust and reliable transcriptomic method to profile subtle changes in miRNA levels and requires reference genes for accurate normalization of gene expression. 5S and snoU6 RNAs are commonly used as reference genes in microRNA quantification. It is currently unknown if these small RNAs are stably expressed during neuronal differentiation. Panels of miRNAs have been suggested as alternative reference genes to 5S and snoU6 in various physiological contexts. To test the hypothesis that miRNAs may serve as stable references during neuronal differentiation, the expressions of eight miRNAs, 5S and snoU6 RNAs in five differentiating neuronal cell types were analyzed using qPCR. The stabilities of the expressions were evaluated using two complementary statistical approaches (geNorm and Normfinder). Expressions of 5S and snoU6 RNAs were stable under some but not all conditions of neuronal differentiation and thus are not suitable reference genes. In contrast, a combination of three miRNAs (miR-103, miR-106b and miR-26b) allowed accurate expression normalization across different models of neuronal differentiation. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.
Patton, J R; Habets, W; van Venrooij, W J; Pederson, T
1989-01-01
The U1 small nuclear ribonucleoprotein particle (U1 snRNP), a cofactor in pre-mRNA splicing, contains three proteins, termed 70K, A, and C, that are not present in the other spliceosome-associated snRNPs. We studied the binding of the A and C proteins to U1 RNA, using a U1 snRNP reconstitution system and an antibody-induced nuclease protection technique. Antibodies that reacted with the A and C proteins induced nuclease protection of the first two stem-loops of U1 RNA in reconstituted U1 snRNP. Detailed analysis of the antibody-induced nuclease protection patterns indicated the existence of relatively long-range protein-protein interactions in the U1 snRNP, with the 5' end of U1 RNA and its associated specific proteins interacting with proteins bound to the Sm domain near the 3' end. UV cross-linking experiments in conjunction with an A-protein-specific antibody demonstrated that the A protein bound directly to the U1 RNA rather than assembling in the U1 snRNP exclusively via protein-protein interactions. This conclusion was supported by additional experiments revealing that the A protein could bind to U1 RNA in the absence of bound 70K and Sm core proteins. Images PMID:2529425
Borisenko, A S; Kotus, E V; Kaloshin, A A
2008-01-01
Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.
Structural and functional analyses of Saccharomyces cerevisiae wild-type and mutant RNA1 genes.
Traglia, H M; Atkinson, N S; Hopper, A K
1989-01-01
The yeast gene RNA1 has been defined by the thermosensitive rna1-1 lesion. This lesion interferes with the processing and production of all major classes of RNA. Each class of RNA is affected at a distinct and presumably unrelated step. Furthermore, RNA does not appear to exit the nucleus. To investigate how the RNA1 gene product can pleiotropically affect disparate processes, we undertook a structural analysis of wild-type and mutant RNA1 genes. The wild-type gene was found to contain a 407-amino-acid open reading frame that encodes a hydrophilic protein. No clue regarding the function of the RNA1 protein was obtained by searching banks for similarity to other known gene products. Surprisingly, the rna1-1 lesion was found to code for two amino acid differences from wild type. We found that neither single-amino-acid change alone resulted in temperature sensitivity. The carboxy-terminal region of the RNA1 open reading frame contains a highly acidic domain extending from amino acids 334 to 400. We generated genomic deletions that removed C-terminal regions of this protein. Deletion of amino acids 397 to 407 did not appear to affect cell growth. Removal of amino acids 359 to 397, a region containing 24 acidic residues, caused temperature-sensitive growth. This allele, rna1-delta 359-397, defines a second conditional lesion of the RNA1 locus. We found that strains possessing the rna1-delta 359-397 allele did not show thermosensitive defects in pre-rRNA or pre-tRNA processing. Removal of amino acids 330 to 407 resulted in loss of viability. Images PMID:2674676
A New Class of SINEs with snRNA Gene-Derived Heads
Kojima, Kenji K.
2015-01-01
Eukaryotic genomes are colonized by various transposons including short interspersed elements (SINEs). The 5′ region (head) of the majority of SINEs is derived from one of the three types of RNA genes—7SL RNA, transfer RNA (tRNA), or 5S ribosomal RNA (rRNA)—and the internal promoter inside the head promotes the transcription of the entire SINEs. Here I report a new group of SINEs whose heads originate from either the U1 or U2 small nuclear RNA gene. These SINEs, named SINEU, are distributed among crocodilians and classified into three families. The structures of the SINEU-1 subfamilies indicate the recurrent addition of a U1- or U2-derived sequence onto the 5′ end of SINEU-1 elements. SINEU-1 and SINEU-3 are ancient and shared among alligators, crocodiles, and gharials, while SINEU-2 is absent in the alligator genome. SINEU-2 is the only SINE family that was active after the split of crocodiles and gharials. All SINEU families, especially SINEU-3, are preferentially inserted into a family of Mariner DNA transposon, Mariner-N4_AMi. A group of Tx1 non-long terminal repeat retrotransposons designated Tx1-Mar also show target preference for Mariner-N4_AMi, indicating that SINEU was mobilized by Tx1-Mar. PMID:26019167
Long noncoding RNA EWSAT1-mediated gene repression facilitates Ewing sarcoma oncogenesis
Marques Howarth, Michelle; Simpson, David; Ngok, Siu P.; Nieves, Bethsaida; Chen, Ron; Siprashvili, Zurab; Vaka, Dedeepya; Breese, Marcus R.; Crompton, Brian D.; Alexe, Gabriela; Hawkins, Doug S.; Jacobson, Damon; Brunner, Alayne L.; West, Robert; Mora, Jaume; Stegmaier, Kimberly; Khavari, Paul; Sweet-Cordero, E. Alejandro
2014-01-01
Chromosomal translocation that results in fusion of the genes encoding RNA-binding protein EWS and transcription factor FLI1 (EWS-FLI1) is pathognomonic for Ewing sarcoma. EWS-FLI1 alters gene expression through mechanisms that are not completely understood. We performed RNA sequencing (RNAseq) analysis on primary pediatric human mesenchymal progenitor cells (pMPCs) expressing EWS-FLI1 in order to identify gene targets of this oncoprotein. We determined that long noncoding RNA-277 (Ewing sarcoma–associated transcript 1 [EWSAT1]) is upregulated by EWS-FLI1 in pMPCs. Inhibition of EWSAT1 expression diminished the ability of Ewing sarcoma cell lines to proliferate and form colonies in soft agar, whereas EWSAT1 inhibition had no effect on other cell types tested. Expression of EWS-FLI1 and EWSAT1 repressed gene expression, and a substantial fraction of targets that were repressed by EWS-FLI1 were also repressed by EWSAT1. Analysis of RNAseq data from primary human Ewing sarcoma further supported a role for EWSAT1 in mediating gene repression. We identified heterogeneous nuclear ribonucleoprotein (HNRNPK) as an RNA-binding protein that interacts with EWSAT1 and found a marked overlap in HNRNPK-repressed genes and those repressed by EWS-FLI1 and EWSAT1, suggesting that HNRNPK participates in EWSAT1-mediated gene repression. Together, our data reveal that EWSAT1 is a downstream target of EWS-FLI1 that facilitates the development of Ewing sarcoma via the repression of target genes. PMID:25401475
Sierant, Malgorzata; Leszczynska, Grazyna; Sadowska, Klaudia; Komar, Patrycja; Radzikowska-Cieciura, Ewa; Sochacka, Elzbieta; Nawrot, Barbara
2018-06-04
To date the only tRNAs containing nucleosides modified with a selenium (5-carboxymethylaminomethyl-2-selenouridine and 5-methylaminomethyl-2-selenouridine) have been found in bacteria. By using tRNA anticodon-stem-loop fragments containing S2U, Se2U, or geS2U, we found that in vitro tRNA 2-selenouridine synthase (SelU) converts S2U-RNA to Se2U-RNA in a two-step process involving S2U-RNA geranylation (with ppGe) and subsequent selenation of the resulting geS2U-RNA (with SePO 3 3- ). No 'direct' S2U-RNA→Se2U-RNA replacement is observed in the presence of SelU/SePO 3 3- only (without ppGe). These results suggest that the in vivo S2U→Se2U and S2U→geS2U transformations in tRNA, so far claimed to be the elementary reactions occurring independently in the same domain of the SelU enzyme, should be considered a combination of two consecutive events - geranylation (S2U→geS2U) and selenation (geS2U→Se2U). © 2018 Federation of European Biochemical Societies.
Ludwig, Linda B; Ambrus, Julian L; Krawczyk, Kristie A; Sharma, Sanjay; Brooks, Stephen; Hsiao, Chiu-Bin; Schwartz, Stanley A
2006-01-01
Background While viruses have long been shown to capitalize on their limited genomic size by utilizing both strands of DNA or complementary DNA/RNA intermediates to code for viral proteins, it has been assumed that human retroviruses have all their major proteins translated only from the plus or sense strand of RNA, despite their requirement for a dsDNA proviral intermediate. Several studies, however, have suggested the presence of antisense transcription for both HIV-1 and HTLV-1. More recently an antisense transcript responsible for the HTLV-1 bZIP factor (HBZ) protein has been described. In this study we investigated the possibility of an antisense gene contained within the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR). Results Inspection of published sequences revealed a potential transcription initiator element (INR) situated downstream of, and in reverse orientation to, the usual HIV-1 promoter and transcription start site. This antisense initiator (HIVaINR) suggested the possibility of an antisense gene responsible for RNA and protein production. We show that antisense transcripts are generated, in vitro and in vivo, originating from the TAR DNA of the HIV-1 LTR. To test the possibility that protein(s) could be translated from this novel HIV-1 antisense RNA, recombinant HIV antisense gene-FLAG vectors were designed. Recombinant protein(s) were produced and isolated utilizing carboxy-terminal FLAG epitope (DYKDDDDK) sequences. In addition, affinity-purified antisera to an internal peptide derived from the HIV antisense protein (HAP) sequences identified HAPs from HIV+ human peripheral blood lymphocytes. Conclusion HIV-1 contains an antisense gene in the U3-R regions of the LTR responsible for both an antisense RNA transcript and proteins. This antisense transcript has tremendous potential for intrinsic RNA regulation because of its overlap with the beginning of all HIV-1 sense RNA transcripts by 25 nucleotides. The novel HAPs are
Sadik, Christian D; Bachmann, Malte; Pfeilschifter, Josef; Mühl, Heiko
2009-08-01
U1-snRNA is an integral part of the U1 ribonucleoprotein pivotal for pre-mRNA splicing. Toll-like receptor (TLR) signaling has recently been associated with immunoregulatory capacities of U1-snRNA. Using lung A549 epithelial/carcinoma cells, we report for the first time on interferon regulatory factor (IRF)-3 activation initiated by endosomally delivered U1-snRNA. This was associated with expression of the IRF3-inducible genes interferon-beta (IFN-beta), CXCL10/IP-10 and indoleamine 2,3-dioxygenase. Mutational analysis of the U1-snRNA-activated IFN-beta promoter confirmed the crucial role of the PRDIII element, previously proven pivotal for promoter activation by IRF3. Notably, expression of these parameters was suppressed by bafilomycin A(1), an inhibitor of endosomal acidification, implicating endosomal TLR activation. Since resiquimod, an agonist of TLR7/8, failed to stimulate A549 cells, data suggest TLR3 to be of prime relevance for cellular activation. To assess the overall regulatory potential of U1-snRNA-activated epithelial cells on cytokine production, co-cultivation with peripheral blood mononuclear cells (PBMC) was performed. Interestingly, A549 cells activated by U1-snRNA reinforced phytohemagglutinin-induced interleukin-10 release by PBMC but suppressed that of tumor necrosis factor-alpha, indicating an anti-inflammatory potential of U1-snRNA. Since U1-snRNA is enriched in apoptotic bodies and epithelial cells are capable of performing efferocytosis, the present data in particular connect to immunobiological aspects of apoptosis at host/environment interfaces.
BRAKER1: Unsupervised RNA-Seq-Based Genome Annotation with GeneMark-ET and AUGUSTUS.
Hoff, Katharina J; Lange, Simone; Lomsadze, Alexandre; Borodovsky, Mark; Stanke, Mario
2016-03-01
Gene finding in eukaryotic genomes is notoriously difficult to automate. The task is to design a work flow with a minimal set of tools that would reach state-of-the-art performance across a wide range of species. GeneMark-ET is a gene prediction tool that incorporates RNA-Seq data into unsupervised training and subsequently generates ab initio gene predictions. AUGUSTUS is a gene finder that usually requires supervised training and uses information from RNA-Seq reads in the prediction step. Complementary strengths of GeneMark-ET and AUGUSTUS provided motivation for designing a new combined tool for automatic gene prediction. We present BRAKER1, a pipeline for unsupervised RNA-Seq-based genome annotation that combines the advantages of GeneMark-ET and AUGUSTUS. As input, BRAKER1 requires a genome assembly file and a file in bam-format with spliced alignments of RNA-Seq reads to the genome. First, GeneMark-ET performs iterative training and generates initial gene structures. Second, AUGUSTUS uses predicted genes for training and then integrates RNA-Seq read information into final gene predictions. In our experiments, we observed that BRAKER1 was more accurate than MAKER2 when it is using RNA-Seq as sole source for training and prediction. BRAKER1 does not require pre-trained parameters or a separate expert-prepared training step. BRAKER1 is available for download at http://bioinf.uni-greifswald.de/bioinf/braker/ and http://exon.gatech.edu/GeneMark/ katharina.hoff@uni-greifswald.de or borodovsky@gatech.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Gene expression analysis upon lncRNA DDSR1 knockdown in human fibroblasts
Jia, Li; Sun, Zhonghe; Wu, Xiaolin; Misteli, Tom; Sharma, Vivek
2015-01-01
Long non-coding RNAs (lncRNAs) play important roles in regulating diverse biological processes including DNA damage and repair. We have recently reported that the DNA damage inducible lncRNA DNA damage-sensitive RNA1 (DDSR1) regulates DNA repair by homologous recombination (HR). Since lncRNAs also modulate gene expression, we identified gene expression changes upon DDSR1 knockdown in human fibroblast cells. Gene expression analysis after RNAi treatment targeted against DDSR1 revealed 119 genes that show differential expression. Here we provide a detailed description of the microarray data (NCBI GEO accession number GSE67048) and the data analysis procedure associated with the publication by Sharma et al., 2015 in EMBO Reports [1]. PMID:26697398
Qiu, Zhicheng R; Schwer, Beate; Shuman, Stewart
2015-04-24
The trimethylguanosine (TMG) caps of small nuclear (sn) RNAs are synthesized by the enzyme Tgs1 via sequential methyl additions to the N2 atom of the m(7)G cap. Whereas TMG caps are inessential for Saccharomyces cerevisiae vegetative growth at 25° to 37°, tgs1∆ cells that lack TMG caps fail to thrive at 18°. The cold-sensitive defect correlates with ectopic stoichiometric association of nuclear cap-binding complex (CBC) with the residual m(7)G cap of the U1 snRNA and is suppressed fully by Cbc2 mutations that weaken cap binding. Here, we show that normal growth of tgs1∆ cells at 18° is also restored by a C-terminal deletion of 77 amino acids from the Snp1 subunit of yeast U1 snRNP. These results underscore the U1 snRNP as a focal point for TMG cap function in vivo. Casting a broader net, we conducted a dosage suppressor screen for genes that allowed survival of tgs1∆ cells at 18°. We thereby recovered RPO26 (encoding a shared subunit of all three nuclear RNA polymerases) and RPO31 (encoding the largest subunit of RNA polymerase III) as moderate and weak suppressors of tgs1∆ cold sensitivity, respectively. A structure-guided mutagenesis of Rpo26, using rpo26∆ complementation and tgs1∆ suppression as activity readouts, defined Rpo26-(78-155) as a minimized functional domain. Alanine scanning identified Glu89, Glu124, Arg135, and Arg136 as essential for rpo26∆ complementation. The E124A and R135A alleles retained tgs1∆ suppressor activity, thereby establishing a separation-of-function. These results illuminate the structure activity profile of an essential RNA polymerase component. Copyright © 2015 Qiu et al.
The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.
Fujii, Yoichi Robertus
2013-01-01
MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.
Whisenant, Thomas C; Peralta, Eigen R; Aarreberg, Lauren D; Gao, Nina J; Head, Steven R; Ordoukhanian, Phillip; Williamson, Jamie R; Salomon, Daniel R
2015-01-01
Activation of CD4 T cells is a reaction to challenges such as microbial pathogens, cancer and toxins that defines adaptive immune responses. The roles of T cell receptor crosslinking, intracellular signaling, and transcription factor activation are well described, but the importance of post-transcriptional regulation by RNA-binding proteins (RBPs) has not been considered in depth. We describe a new model expanding and activating primary human CD4 T cells and applied this to characterizing activation-induced assembly of splicing factors centered on U2AF2. We immunoprecipitated U2AF2 to identify what mRNA transcripts were bound as a function of activation by TCR crosslinking and costimulation. In parallel, mass spectrometry revealed the proteins incorporated into the U2AF2-centered RNA/protein interactome. Molecules that retained interaction with the U2AF2 complex after RNAse treatment were designated as "central" interactome members (CIMs). Mass spectrometry also identified a second class of activation-induced proteins, "peripheral" interactome members (PIMs), that bound to the same transcripts but were not in physical association with U2AF2 or its partners. siRNA knockdown of two CIMs and two PIMs caused changes in activation marker expression, cytokine secretion, and gene expression that were unique to each protein and mapped to pathways associated with key aspects of T cell activation. While knocking down the PIM, SYNCRIP, impacts a limited but immunologically important set of U2AF2-bound transcripts, knockdown of U2AF1 significantly impairs assembly of the majority of protein and mRNA components in the activation-induced interactome. These results demonstrated that CIMs and PIMs, either directly or indirectly through RNA, assembled into activation-induced U2AF2 complexes and play roles in post-transcriptional regulation of genes related to cytokine secretion. These data suggest an additional layer of regulation mediated by the activation-induced assembly of RNA
Aarreberg, Lauren D.; Gao, Nina J.; Head, Steven R.; Ordoukhanian, Phillip; Williamson, Jamie R.; Salomon, Daniel R.
2015-01-01
Activation of CD4 T cells is a reaction to challenges such as microbial pathogens, cancer and toxins that defines adaptive immune responses. The roles of T cell receptor crosslinking, intracellular signaling, and transcription factor activation are well described, but the importance of post-transcriptional regulation by RNA-binding proteins (RBPs) has not been considered in depth. We describe a new model expanding and activating primary human CD4 T cells and applied this to characterizing activation-induced assembly of splicing factors centered on U2AF2. We immunoprecipitated U2AF2 to identify what mRNA transcripts were bound as a function of activation by TCR crosslinking and costimulation. In parallel, mass spectrometry revealed the proteins incorporated into the U2AF2-centered RNA/protein interactome. Molecules that retained interaction with the U2AF2 complex after RNAse treatment were designated as “central” interactome members (CIMs). Mass spectrometry also identified a second class of activation-induced proteins, “peripheral” interactome members (PIMs), that bound to the same transcripts but were not in physical association with U2AF2 or its partners. siRNA knockdown of two CIMs and two PIMs caused changes in activation marker expression, cytokine secretion, and gene expression that were unique to each protein and mapped to pathways associated with key aspects of T cell activation. While knocking down the PIM, SYNCRIP, impacts a limited but immunologically important set of U2AF2-bound transcripts, knockdown of U2AF1 significantly impairs assembly of the majority of protein and mRNA components in the activation-induced interactome. These results demonstrated that CIMs and PIMs, either directly or indirectly through RNA, assembled into activation-induced U2AF2 complexes and play roles in post-transcriptional regulation of genes related to cytokine secretion. These data suggest an additional layer of regulation mediated by the activation-induced assembly
Law, Michael J.; Linde, Michael E.; Chambers, Eric J.; Oubridge, Chris; Katsamba, Phinikoula S.; Nilsson, Lennart; Haworth, Ian S.; Laird-Offringa, Ite A.
2006-01-01
Previous kinetic investigations of the N-terminal RNA recognition motif (RRM) domain of spliceosomal protein U1A, interacting with its RNA target U1 hairpin II, provided experimental evidence for a ‘lure and lock’ model of binding in which electrostatic interactions first guide the RNA to the protein, and close range interactions then lock the two molecules together. To further investigate the ‘lure’ step, here we examined the electrostatic roles of two sets of positively charged amino acids in U1A that do not make hydrogen bonds to the RNA: Lys20, Lys22 and Lys23 close to the RNA-binding site, and Arg7, Lys60 and Arg70, located on ‘top’ of the RRM domain, away from the RNA. Surface plasmon resonance-based kinetic studies, supplemented with salt dependence experiments and molecular dynamics simulation, indicate that Lys20 predominantly plays a role in association, while nearby residues Lys22 and Lys23 appear to be at least as important for complex stability. In contrast, kinetic analyses of residues away from the RNA indicate that they have a minimal effect on association and stability. Thus, well-positioned positively charged residues can be important for both initial complex formation and complex maintenance, illustrating the multiple roles of electrostatic interactions in protein–RNA complexes. PMID:16407334
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lalioti, M.D.; Rossier, C.; Antonarakis, S.E.
1996-04-15
We used targeted exon trapping to clone portions of genes from human chromosome 21q22.3. One trapped sequence showed complete homology with the cDNA of human U2AF{sup 35} (M96982; HGM-approved nomenclature U2AF1), which encodes for the small 35-kDa subunit of the U2 snRNP auxiliary factor. Using the U2AF1 cDNA as a probe, we mapped this gene to cosmid Q15D2, a P1, and YAC 350F7 of the Chumakov et al. contig, close to the cystathionine-{beta}-synthase gene (CBS) on 21q22.3. This localization was confirmed by PCR using oligonucleotides from the 3{prime} UTR and by FISH. As U2AF1 associated with a number of differentmore » factors during mRNA splicing, overexpression in trisomy 21 individuals could contribute to some Down syndrome phenotypes by interfering with the splicing process. Furthermore, because this gene maps in the critical region for the progressive myoclonus epilepsy I locus (EPM1), mutation analysis will be carried out in patients to evaluate the potential role of U2AF1 as a candidate for EPM1. 24 refs., 1 fig.« less
Jafarlou, Mahdi; Shanehbandi, Dariush; Dehghan, Parvin; Mansoori, Behzad; Othman, F; Baradaran, Behzad
2017-11-07
Acute myeloid leukaemia (AML) is a genetically heterogeneous, severe and rapidly progressing disease triggered by blocking granulocyte or monocyte differentiation and maturation. Overexpression of myeloid cell leukaemia-1 (Mcl-1) and Survivin is associated with drug resistance, tumour progression and inhibition of apoptotic mechanisms in leukaemia and several cancers. In the present study, we examined the combined effect of etoposide and dual siRNA-mediated silencing of Mcl-1 and Survivin on U-937 AML cells. The AML cells were co-transfected with Mcl-1 and Survivin-specific siRNAs and genes silencing were confirmed by quantitative real-time PCR and Western blotting. Subsequently, MTT assay was used for the evaluation of cytotoxic effects by dual siRNA and etoposide on their own and in combination. For the studying of apoptosis, DNA-histone ELISA and annexin-V/FITC assays were performed. Co-transfection of Mcl-1 and Survivin siRNA significantly blocked their expression at the mRNA and protein levels, leading to the induction of apoptosis and strong inhibition of growth (p < .05). Besides, combined treatment of etoposide with Mcl-1 and Survivin siRNAs co-transfection leads to synergistically enhance etoposide-induced cytotoxic and apoptotic effects (p < .05). The results showed that Mcl-1 and Survivin play a major role in the U937 cells survival and their resistance relative to etoposide. Thus, Mcl-1 and Survivin can be considered as promising molecular targets for the treatment of AML. The combination treatment with etoposide, and siRNA-mediated silencing of corresponding genes may be a novel strategy in chemoresistance AML treatment.
1990-01-01
The yeast RNA1 gene is required for RNA processing and nuclear transport of RNA. The rna1-1 mutation of this locus causes defects in pre-tRNA splicing, processing of the primary pre-rRNA transcript, production of mRNA and export of RNA from the nucleus to the cytosol. To understand how this gene product can pleiotropically affect these processes, we sought to determine the intracellular location of the RNA1 protein. As determined by indirect immunofluorescence localization and organelle fractionation, the RNA1 antigen is found exclusively or primarily in the cytoplasm. Only a tiny fraction of the endogenous protein could be localized to and functional in the nucleus. Furthermore, the RNA1 antigen does not localize differently under stress conditions. These findings suggest that the RNA1 protein is not directly involved in RNA processing but may modify nuclear proteins or otherwise transmit a signal from the cytosol to the nucleus or play a role in maintaining the integrity of the nucleus. PMID:2116418
Verma, Neha; Hung, Ko-Hsuan; Kang, Jin Joo; Barakat, Nermeen H; Stumph, William E
2013-09-20
In the fruit fly Drosophila melanogaster, RNA polymerase III transcription was found to be dependent not upon the canonical TATA box-binding protein (TBP) but instead upon the TBP-related factor 1 (TRF1) (Takada, S., Lis, J. T., Zhou, S., and Tjian, R. (2000) Cell 101, 459-469). Here we confirm that transcription of fly tRNA genes requires TRF1. However, we unexpectedly find that U6 snRNA gene promoters are occupied primarily by TBP in cells and that knockdown of TBP, but not TRF1, inhibits U6 transcription in cells. Moreover, U6 transcription in vitro effectively utilizes TBP, whereas TBP cannot substitute for TRF1 to promote tRNA transcription in vitro. Thus, in fruit flies, different classes of RNA polymerase III promoters differentially utilize TBP and TRF1 for the initiation of transcription.
2013-01-01
Background During reverse transcription, retroviruses duplicate the long terminal repeats (LTRs). These identical LTRs carry both promoter regions and functional polyadenylation sites. To express full-length transcripts, retroviruses have to suppress polyadenylation in the 5′LTR and activate polyadenylation in the 3′LTR. Foamy viruses have a unique LTR structure with respect to the location of the major splice donor (MSD), which is located upstream of the polyadenylation signal. Results Here, we describe the mechanisms of foamy viruses regulating polyadenylation. We show that binding of the U1 small nuclear ribonucleoprotein (U1snRNP) to the MSD suppresses polyadenylation at the 5′LTR. In contrast, polyadenylation at the 3′LTR is achieved by adoption of a different RNA structure at the MSD region, which blocks U1snRNP binding and furthers RNA cleavage and subsequent polyadenylation. Conclusion Recently, it was shown that U1snRNP is able to suppress the usage of intronic cryptic polyadenylation sites in the cellular genome. Foamy viruses take advantage of this surveillance mechanism to suppress premature polyadenylation at the 5’end of their RNA. At the 3’end, Foamy viruses use a secondary structure to presumably block access of U1snRNP and thereby activate polyadenylation at the end of the genome. Our data reveal a contribution of U1snRNP to cellular polyadenylation site selection and to the regulation of gene expression. PMID:23718736
Cloning and characterization of LOS1, a Saccharomyces cerevisiae gene that affects tRNA splicing.
Hurt, D J; Wang, S S; Lin, Y H; Hopper, A K
1987-03-01
Saccharomyces cerevisiae strains carrying los1-1 mutations are defective in tRNA processing; at 37 degrees C, such strains accumulate tRNA precursors which have mature 5' and 3' ends but contain intervening sequences. Strains bearing los1-1 and an intron-containing ochre-suppressing tRNA gene, SUP4(0), also fail to suppress the ochre mutations ade2-1(0) and can1-100(0) at 34 degrees C. To understand the role of the LOS1 product in tRNA splicing, we initiated a molecular study of the LOS1 gene. Two plasmids, YEpLOS1 and YCpLOS1, that complement the los1-1 phenotype were isolated from the YEp24 and YCp50 libraries, respectively. YEpLOS1 and YCpLOS1 had overlapping restriction maps, indicating that the DNA in the overlapping segment could complement los1-1 when present in multiple or single copy. Integration of plasmid DNA at the LOS1 locus confirmed that these clones contained authentic LOS1 sequences. Southern analyses showed that LOS1 is a single copy gene. The locations of the LOS1 gene within YEpLOS1 and YCpLOS1 were determined by deletion and gamma-delta mapping. Two genomic disruptions of the LOS1 gene were constructed, i.e., an insertion of a 1.2-kilobase fragment carrying the yeast URA3 gene, los1::URA3, and a 2.4-kilobase deletion from the LOS1 gene, los1-delta V. Disruption or deletion of most of the LOS1 gene was not lethal; cells carrying the disrupted los1 alleles were viable and had phenotypes similar to those of cells carrying the los1-1 allele. Thus, it appears that the los1 gene product expedites tRNA splicing at elevated temperatures but is not essential for this process.
Yang, Lijun; Cui, Hong; Cao, Ting
2014-03-01
Oligodendrocyte lineage gene 1 plays a key role in hypoxic-ischemic brain damage and myelin repair. miRNA-9 is involved in the occurrence of many related neurological disorders. Bioinformatics analysis demonstrated that miRNA-9 complementarily, but incompletely, bound oligodendrocyte lineage gene 1, but whether miRNA-9 regulates oligodendrocyte lineage gene 1 remains poorly understood. Whole brain slices of 3-day-old Sprague-Dawley rats were cultured and divided into four groups: control group; oxygen-glucose deprivation group (treatment with 8% O2 + 92% N2 and sugar-free medium for 60 minutes); transfection control group (after oxygen and glucose deprivation for 60 minutes, transfected with control plasmid) and miRNA-9 transfection group (after oxygen and glucose deprivation for 60 minutes, transfected with miRNA-9 plasmid). From the third day of transfection, and with increasing culture days, oligodendrocyte lineage gene 1 expression increased in each group, peaked at 14 days, and then decreased at 21 days. Real-time quantitative PCR results, however, demonstrated that oligodendrocyte lineage gene 1 expression was lower in the miRNA-9 transfection group than that in the transfection control group at 1, 3, 7, 14, 21 and 28 days after transfection. Results suggested that miRNA-9 possibly negatively regulated oligodendrocyte lineage gene 1 in brain tissues during hypoxic-ischemic brain damage.
Stress induction of Bm1 RNA in silkworm larvae: SINEs, an unusual class of stress genes
Kimura, Richard H.; Choudary, Prabhakara V.; Stone, Koni K.; Schmid, Carl W.
2001-01-01
This study surveys the induction of RNA polymerase III (Pol III)–directed expression of short interspersed element (SINE) transcripts by various stresses in an animal model, silkworm larvae. Sublethal heat shock and exposure to several toxic compounds increase the level of Bm1 RNA, the silkworm SINE transcript, while also transiently increasing expression of a well-characterized stress-induced transcript, Hsp70 messenger RNA (mRNA). In certain cases, the Bm1 RNA response coincides with that of Hsp70 mRNA, but more often Bm1 RNA responds later in recovery. Baculovirus infection and exposure to certain toxic compounds increase Bm1 RNA but not Hsp70 mRNA, showing that SINE induction is not necessarily coupled to transcription of this particular heat shock gene. SINEs behave as an additional class of stress-inducible genes in living animals but are unusual as stress genes because of their high copy number, genomic dispersion, and Pol III–directed transcription. PMID:11599568
Gambone, Julia E.; Dusaban, Stephanie S.; Loperena, Roxana; Nakata, Yuji
2011-01-01
The requirement of c-Myb during erythropoiesis spurred an interest in identifying c-Myb target genes that are important for erythroid development. Here, we determined that the neuropeptide neuromedin U (NmU) is a c-Myb target gene. Silencing NmU, c-myb, or NmU's cognate receptor NMUR1 expression in human CD34+ cells impaired burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) formation compared with control. Exogenous addition of NmU peptide to NmU or c-myb siRNA-treated CD34+ cells rescued BFU-E and yielded a greater number of CFU-E than observed with control. No rescue of BFU-E and CFU-E growth was observed when NmU peptide was exogenously added to NMUR1 siRNA-treated cells compared with NMUR1 siRNA-treated cells cultured without NmU peptide. In K562 and CD34+ cells, NmU activated protein kinase C-βII, a factor associated with hematopoietic differentiation-proliferation. CD34+ cells cultured under erythroid-inducing conditions, with NmU peptide and erythropoietin added at day 6, revealed an increase in endogenous NmU and c-myb gene expression at day 8 and a 16% expansion of early erythroblasts at day 10 compared to cultures without NmU peptide. Combined, these data strongly support that the c-Myb target gene NmU functions as a novel cofactor for erythropoiesis and expands early erythroblasts. PMID:21378276
Cloning and characterization of LOS1, a Saccharomyces cerevisiae gene that affects tRNA splicing.
Hurt, D J; Wang, S S; Lin, Y H; Hopper, A K
1987-01-01
Saccharomyces cerevisiae strains carrying los1-1 mutations are defective in tRNA processing; at 37 degrees C, such strains accumulate tRNA precursors which have mature 5' and 3' ends but contain intervening sequences. Strains bearing los1-1 and an intron-containing ochre-suppressing tRNA gene, SUP4(0), also fail to suppress the ochre mutations ade2-1(0) and can1-100(0) at 34 degrees C. To understand the role of the LOS1 product in tRNA splicing, we initiated a molecular study of the LOS1 gene. Two plasmids, YEpLOS1 and YCpLOS1, that complement the los1-1 phenotype were isolated from the YEp24 and YCp50 libraries, respectively. YEpLOS1 and YCpLOS1 had overlapping restriction maps, indicating that the DNA in the overlapping segment could complement los1-1 when present in multiple or single copy. Integration of plasmid DNA at the LOS1 locus confirmed that these clones contained authentic LOS1 sequences. Southern analyses showed that LOS1 is a single copy gene. The locations of the LOS1 gene within YEpLOS1 and YCpLOS1 were determined by deletion and gamma-delta mapping. Two genomic disruptions of the LOS1 gene were constructed, i.e., an insertion of a 1.2-kilobase fragment carrying the yeast URA3 gene, los1::URA3, and a 2.4-kilobase deletion from the LOS1 gene, los1-delta V. Disruption or deletion of most of the LOS1 gene was not lethal; cells carrying the disrupted los1 alleles were viable and had phenotypes similar to those of cells carrying the los1-1 allele. Thus, it appears that the los1 gene product expedites tRNA splicing at elevated temperatures but is not essential for this process. Images PMID:3031485
Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.
Calvet, J P; Meyer, L M; Pederson, T
1982-07-30
Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.
Zheng, Xiaomei; Zheng, Ping; Sun, Jibin; Kun, Zhang; Ma, Yanhe
2018-01-01
U6 promoters have been used for single guide RNA (sgRNA) transcription in the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR/Cas9) genome editing system. However, no available U6 promoters have been identified in Aspergillus niger, which is an important industrial platform for organic acid and protein production. Two CRISPR/Cas9 systems established in A. niger have recourse to the RNA polymerase II promoter or in vitro transcription for sgRNA synthesis, but these approaches generally increase cloning efforts and genetic manipulation. The validation of functional RNA polymerase II promoters is therefore an urgent need for A. niger . Here, we developed a novel CRISPR/Cas9 system in A. niger for sgRNA expression, based on one endogenous U6 promoter and two heterologous U6 promoters. The three tested U6 promoters enabled sgRNA transcription and the disruption of the polyketide synthase albA gene in A. niger . Furthermore, this system enabled highly efficient gene insertion at the targeted genome loci in A. niger using donor DNAs with homologous arms as short as 40-bp. This study demonstrated that both heterologous and endogenous U6 promoters were functional for sgRNA expression in A. niger . Based on this result, a novel and simple CRISPR/Cas9 toolbox was established in A. niger, that will benefit future gene functional analysis and genome editing.
Sardana, Richa; Liu, Xin; Granneman, Sander; Zhu, Jieyi; Gill, Michael; Papoulas, Ophelia; Marcotte, Edward M; Tollervey, David; Correll, Carl C; Johnson, Arlen W
2015-02-01
In eukaryotes, the highly conserved U3 small nucleolar RNA (snoRNA) base-pairs to multiple sites in the pre-ribosomal RNA (pre-rRNA) to promote early cleavage and folding events. Binding of the U3 box A region to the pre-rRNA is mutually exclusive with folding of the central pseudoknot (CPK), a universally conserved rRNA structure of the small ribosomal subunit essential for protein synthesis. Here, we report that the DEAH-box helicase Dhr1 (Ecm16) is responsible for displacing U3. An active site mutant of Dhr1 blocked release of U3 from the pre-ribosome, thereby trapping a pre-40S particle. This particle had not yet achieved its mature structure because it contained U3, pre-rRNA, and a number of early-acting ribosome synthesis factors but noticeably lacked ribosomal proteins (r-proteins) that surround the CPK. Dhr1 was cross-linked in vivo to the pre-rRNA and to U3 sequences flanking regions that base-pair to the pre-rRNA including those that form the CPK. Point mutations in the box A region of U3 suppressed a cold-sensitive mutation of Dhr1, strongly indicating that U3 is an in vivo substrate of Dhr1. To support the conclusions derived from in vivo analysis we showed that Dhr1 unwinds U3-18S duplexes in vitro by using a mechanism reminiscent of DEAD box proteins.
Granneman, Sander; Zhu, Jieyi; Gill, Michael; Papoulas, Ophelia; Marcotte, Edward M.; Tollervey, David; Correll, Carl C.; Johnson, Arlen W.
2015-01-01
In eukaryotes, the highly conserved U3 small nucleolar RNA (snoRNA) base-pairs to multiple sites in the pre-ribosomal RNA (pre-rRNA) to promote early cleavage and folding events. Binding of the U3 box A region to the pre-rRNA is mutually exclusive with folding of the central pseudoknot (CPK), a universally conserved rRNA structure of the small ribosomal subunit essential for protein synthesis. Here, we report that the DEAH-box helicase Dhr1 (Ecm16) is responsible for displacing U3. An active site mutant of Dhr1 blocked release of U3 from the pre-ribosome, thereby trapping a pre-40S particle. This particle had not yet achieved its mature structure because it contained U3, pre-rRNA, and a number of early-acting ribosome synthesis factors but noticeably lacked ribosomal proteins (r-proteins) that surround the CPK. Dhr1 was cross-linked in vivo to the pre-rRNA and to U3 sequences flanking regions that base-pair to the pre-rRNA including those that form the CPK. Point mutations in the box A region of U3 suppressed a cold-sensitive mutation of Dhr1, strongly indicating that U3 is an in vivo substrate of Dhr1. To support the conclusions derived from in vivo analysis we showed that Dhr1 unwinds U3-18S duplexes in vitro by using a mechanism reminiscent of DEAD box proteins. PMID:25710520
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lodes, M.J.; Merlin, G.; DeVos, T.
1995-12-01
This report investigates the duplication of two LD1 genes into the rRNA locus and the resultant transcription by RNA polymerase I, which has a faster transcription rate than that of RNA polymerase II. This was conducted using a 2.2-Mb chromosome in Leishmania donovani. 55 refs., 6 figs.
A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.
Rogalski, T M; Riddle, D L
1988-01-01
The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.
Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.
Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping
2015-02-01
Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.
Seligmann, Hervé
2013-03-01
Usual DNA→RNA transcription exchanges T→U. Assuming different systematic symmetric nucleotide exchanges during translation, some GenBank RNAs match exactly human mitochondrial sequences (exchange rules listed in decreasing transcript frequencies): C↔U, A↔U, A↔U+C↔G (two nucleotide pairs exchanged), G↔U, A↔G, C↔G, none for A↔C, A↔G+C↔U, and A↔C+G↔U. Most unusual transcripts involve exchanging uracil. Independent measures of rates of rare replicational enzymatic DNA nucleotide misinsertions predict frequencies of RNA transcripts systematically exchanging the corresponding misinserted nucleotides. Exchange transcripts self-hybridize less than other gene regions, self-hybridization increases with length, suggesting endoribonuclease-limited elongation. Blast detects stop codon depleted putative protein coding overlapping genes within exchange-transcribed mitochondrial genes. These align with existing GenBank proteins (mainly metazoan origins, prokaryotic and viral origins underrepresented). These GenBank proteins frequently interact with RNA/DNA, are membrane transporters, or are typical of mitochondrial metabolism. Nucleotide exchange transcript frequencies increase with overlapping gene densities and stop densities, indicating finely tuned counterbalancing regulation of expression of systematic symmetric nucleotide exchange-encrypted proteins. Such expression necessitates combined activities of suppressor tRNAs matching stops, and nucleotide exchange transcription. Two independent properties confirm predicted exchanged overlap coding genes: discrepancy of third codon nucleotide contents from replicational deamination gradients, and codon usage according to circular code predictions. Predictions from both properties converge, especially for frequent nucleotide exchange types. Nucleotide exchanging transcription apparently increases coding densities of protein coding genes without lengthening genomes, revealing unsuspected functional DNA
A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.
Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona
2012-01-01
Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.
Rösel-Hillgärtner, Tanja Dorothe; Hung, Lee-Hsueh; Khrameeva, Ekaterina; Le Querrec, Patrick; Gelfand, Mikhail S.; Bindereif, Albrecht
2013-01-01
The U1 small nuclear ribonucleoprotein (snRNP)-specific U1C protein participates in 5′ splice site recognition and regulation of pre-mRNA splicing. Based on an RNA-Seq analysis in HeLa cells after U1C knockdown, we found a conserved, intra-U1 snRNP cross-regulation that links U1C and U1-70K expression through alternative splicing and U1 snRNP assembly. To investigate the underlying regulatory mechanism, we combined mutational minigene analysis, in vivo splice-site blocking by antisense morpholinos, and in vitro binding experiments. Alternative splicing of U1-70K pre-mRNA creates the normal (exons 7–8) and a non-productive mRNA isoform, whose balance is determined by U1C protein levels. The non-productive isoform is generated through a U1C-dependent alternative 3′ splice site, which requires an adjacent cluster of regulatory 5′ splice sites and binding of intact U1 snRNPs. As a result of nonsense-mediated decay (NMD) of the non-productive isoform, U1-70K mRNA and protein levels are down-regulated, and U1C incorporation into the U1 snRNP is impaired. U1-70K/U1C-deficient particles are assembled, shifting the alternative splicing balance back towards productive U1-70K splicing, and restoring assembly of intact U1 snRNPs. Taken together, we established a novel feedback regulation that controls U1-70K/U1C homeostasis and ensures correct U1 snRNP assembly and function. PMID:24146627
The DNA damage response activates HPV16 late gene expression at the level of RNA processing.
Nilsson, Kersti; Wu, Chengjun; Kajitani, Naoko; Yu, Haoran; Tsimtsirakis, Efthymios; Gong, Lijing; Winquist, Ellenor B; Glahder, Jacob; Ekblad, Lars; Wennerberg, Johan; Schwartz, Stefan
2018-06-01
We show that the alkylating cancer drug melphalan activated the DNA damage response and induced human papillomavirus type 16 (HPV16) late gene expression in an ATM- and Chk1/2-dependent manner. Activation of HPV16 late gene expression included inhibition of the HPV16 early polyadenylation signal that resulted in read-through into the late region of HPV16. This was followed by activation of the exclusively late, HPV16 splice sites SD3632 and SA5639 and production of spliced late L1 mRNAs. Altered HPV16 mRNA processing was paralleled by increased association of phosphorylated BRCA1, BARD1, BCLAF1 and TRAP150 with HPV16 DNA, and increased association of RNA processing factors U2AF65 and hnRNP C with HPV16 mRNAs. These RNA processing factors inhibited HPV16 early polyadenylation and enhanced HPV16 late mRNA splicing, thereby activating HPV16 late gene expression.
Hackett, Justin B; Lu, Yan
2017-05-04
In land plants, plastid and mitochondrial RNAs are subject to post-transcriptional C-to-U RNA editing. T-DNA insertions in the ORGANELLE RNA RECOGNITION MOTIF PROTEIN6 gene resulted in reduced photosystem II (PSII) activity and smaller plant and leaf sizes. Exon coverage analysis of the ORRM6 gene showed that orrm6-1 and orrm6-2 are loss-of-function mutants. Compared to other ORRM proteins, ORRM6 affects a relative small number of RNA editing sites. Sanger sequencing of reverse transcription-PCR products of plastid transcripts revealed 2 plastid RNA editing sites that are substantially affected in the orrm6 mutants: psbF-C77 and accD-C794. The psbF gene encodes the β subunit of cytochrome b 559 , an essential component of PSII. The accD gene encodes the β subunit of acetyl-CoA carboxylase, a protein required in plastid fatty acid biosynthesis. Whole-transcriptome RNA-seq demonstrated that editing at psbF-C77 is nearly absent and the editing extent at accD-C794 was significantly reduced. Gene set enrichment pathway analysis showed that expression of multiple gene sets involved in photosynthesis, especially photosynthetic electron transport, is significantly upregulated in both orrm6 mutants. The upregulation could be a mechanism to compensate for the reduced PSII electron transport rate in the orrm6 mutants. These results further demonstrated that Organelle RNA Recognition Motif protein ORRM6 is required in editing of specific RNAs in the Arabidopsis (Arabidopsis thaliana) plastid.
Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun
2012-01-01
To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (p<0.01) and the expressions of MMP-2 and MMP-9 were inhibited. Recombinant expression plasmid integrin-β1- shRNA can inhibit the expression of integrin-β1 gene and suppress the invasion of PANC-1 cells in vitro significantly.
U2AF1 mutations alter splice site recognition in hematological malignancies.
Ilagan, Janine O; Ramakrishnan, Aravind; Hayes, Brian; Murphy, Michele E; Zebari, Ahmad S; Bradley, Philip; Bradley, Robert K
2015-01-01
Whole-exome sequencing studies have identified common mutations affecting genes encoding components of the RNA splicing machinery in hematological malignancies. Here, we sought to determine how mutations affecting the 3' splice site recognition factor U2AF1 alter its normal role in RNA splicing. We find that U2AF1 mutations influence the similarity of splicing programs in leukemias, but do not give rise to widespread splicing failure. U2AF1 mutations cause differential splicing of hundreds of genes, affecting biological pathways such as DNA methylation (DNMT3B), X chromosome inactivation (H2AFY), the DNA damage response (ATR, FANCA), and apoptosis (CASP8). We show that U2AF1 mutations alter the preferred 3' splice site motif in patients, in cell culture, and in vitro. Mutations affecting the first and second zinc fingers give rise to different alterations in splice site preference and largely distinct downstream splicing programs. These allele-specific effects are consistent with a computationally predicted model of U2AF1 in complex with RNA. Our findings suggest that U2AF1 mutations contribute to pathogenesis by causing quantitative changes in splicing that affect diverse cellular pathways, and give insight into the normal function of U2AF1's zinc finger domains. © 2015 Ilagan et al.; Published by Cold Spring Harbor Laboratory Press.
Re-editing the paradigm of Cytidine (C) to Uridine (U) RNA editing.
Fossat, Nicolas; Tam, Patrick P L
2014-01-01
Cytidine (C) to Uridine (U) RNA editing is a post-trancriptional modification that until recently was known to only affect Apolipoprotein b (Apob) RNA and minimally require 2 components of the C to U editosome, the deaminase APOBEC1 and the RNA-binding protein A1CF. Our latest work has identified a novel RNA-binding protein, RBM47, as a core component of the editosome, which can substitute A1CF for the editing of ApoB mRNA. In addition, new RNA species that are subjected to C to U editing have been identified. Here, we highlight these recent discoveries and discuss how they change our view of the composition of the C to U editing machinery and expand our knowledge of the functional attributes of C to U RNA editing.
Los1p, involved in yeast pre-tRNA splicing, positively regulates members of the SOL gene family.
Shen, W C; Stanford, D R; Hopper, A K
1996-06-01
To understand the role of Los1p in pre-tRNA splicing, we sought los1 multicopy suppressors. We found SOL1 that suppresses both point and null LOS1 mutations. Since, when fused to the Ga14p DNA-binding domain, Los1p activates transcription, we tested whether Los1p regulates SOL1. We found that las1 mutants have depleted levels of SOL1 mRNA and Sol1p. Thus, LOS1 appears to positively regulate SOL1. SOL1 belongs to a multigene family with at least two additional members, SOL2 and SOL3. Sol proteins have extensive similarity to an unusual group of glucose-6-phosphate dehydrogenases. As the similarities are restricted to areas separate from the catalytic domain, these G6PDs may have more than one function. The SOL family appears to be unessential since cells with a triple disruption of all three SOL genes are viable. SOL gene disruptions negatively affect tRNA-mediated nonsense suppression and the severity increases with the number of mutant SOL genes. However, tRNA levels do not vary with either multicopy SOL genes or with SOL disruptions. Therefore, the Sol proteins affect tRNA expression/ function at steps other than transcription or splicing. We propose that LOS1 regulates gene products involved in tRNA expression/function as well as pre-tRNA splicing.
van der Woerd, Wendy L; Mulder, Johanna; Pagani, Franco; Beuers, Ulrich; Houwen, Roderick H J; van de Graaf, Stan F J
2015-04-01
ATP8B1 deficiency is a severe autosomal recessive liver disease resulting from mutations in the ATP8B1 gene characterized by a continuous phenotypical spectrum from intermittent (benign recurrent intrahepatic cholestasis; BRIC) to progressive familial intrahepatic cholestasis (PFIC). Current therapeutic options are insufficient, and elucidating the molecular consequences of mutations could lead to personalized mutation-specific therapies. We investigated the effect on pre-messenger RNA splicing of 14 ATP8B1 mutations at exon-intron boundaries using an in vitro minigene system. Eleven mutations, mostly associated with a PFIC phenotype, resulted in aberrant splicing and a complete absence of correctly spliced product. In contrast, three mutations led to partially correct splicing and were associated with a BRIC phenotype. These findings indicate an inverse correlation between the level of correctly spliced product and disease severity. Expression of modified U1 small nuclear RNAs (snRNA) complementary to the splice donor sites strongly improved or completely rescued splicing for several ATP8B1 mutations located at donor, as well as acceptor, splice sites. In one case, we also evaluated exon-specific U1 snRNAs that, by targeting nonconserved intronic sequences, might reduce possible off-target events. Although very effective in correcting exon skipping, they also induced retention of the short downstream intron. We systematically characterized the molecular consequences of 14 ATP8B1 mutations at exon-intron boundaries associated with ATP8B1 deficiency and found that the majority resulted in total exon skipping. The amount of correctly spliced product inversely correlated with disease severity. Compensatory modified U1 snRNAs, complementary to mutated donor splice sites, were able to improve exon definition very efficiently and could be a novel therapeutic strategy in ATP8B1 deficiency as well as other genetic diseases. © 2014 by the American Association for the Study
Los1p, involved in yeast pre-tRNA splicing, positively regulates members of the SOL gene family
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shen, W.C.; Stanford, D.R.; Hopper, A.K.
1996-06-01
To understand the role of Los1p in pre-tRNA splicing, we sought los1 multicopy suppressors. We found SOL1 that suppresses both point and null LOS1 mutations. Since, when fused to the Gal4p DNA-binding domain, Los1p activates transcription, we tested whether Los1p regulates SOL1. We found that los1 mutants have depleted levels of SOL1 mRNA and Sol1p. Thus, LOS1 appears to positively regulate SOL1. SOL1 belongs to a multigene family with at least two additional members, SOL2 and SOL3. Sol proteins have extensive similarity to an unusual group of glucose-6-phosphate dehydrogenases (G6PDs). As the similarities are restricted to areas separate from themore » catalytic domain, these G6PDs may have more than one function. The SOL gene disruptions negatively affect tRNA-mediated nonsense suppression and the severity increases with the number of mutant SOL genes. However, tRNA levels do not vary with either multicopy SOL genes or with SOL disruptions. Therefore, the Sol proteins affect tRNA expression/function at steps other than transcription or splicing. We propose that LOS1 regulates gene products involved in tRNA expression/function as well as pre-tRNA splicing. 64 refs., 6 figs., 6 tabs.« less
Transcription factor trapping by RNA in gene regulatory elements.
Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A
2015-11-20
Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.
Fu, Cheng-Jie; Sheikh, Sanea; Miao, Wei; Andersson, Siv G E; Baldauf, Sandra L
2014-08-21
Discoba (Excavata) is an ancient group of eukaryotes with great morphological and ecological diversity. Unlike the other major divisions of Discoba (Jakobida and Euglenozoa), little is known about the mitochondrial DNAs (mtDNAs) of Heterolobosea. We have assembled a complete mtDNA genome from the aggregating heterolobosean amoeba, Acrasis kona, which consists of a single circular highly AT-rich (83.3%) molecule of 51.5 kb. Unexpectedly, A. kona mtDNA is missing roughly 40% of the protein-coding genes and nearly half of the transfer RNAs found in the only other sequenced heterolobosean mtDNAs, those of Naegleria spp. Instead, over a quarter of A. kona mtDNA consists of novel open reading frames. Eleven of the 16 protein-coding genes missing from A. kona mtDNA were identified in its nuclear DNA and polyA RNA, and phylogenetic analyses indicate that at least 10 of these 11 putative nuclear-encoded mitochondrial (NcMt) proteins arose by direct transfer from the mitochondrion. Acrasis kona mtDNA also employs C-to-U type RNA editing, and 12 homologs of DYW-type pentatricopeptide repeat (PPR) proteins implicated in plant organellar RNA editing are found in A. kona nuclear DNA. A mapping of mitochondrial gene content onto a consensus phylogeny reveals a sporadic pattern of relative stasis and rampant gene loss in Discoba. Rampant loss occurred independently in the unique common lineage leading to Heterolobosea + Tsukubamonadida and later in the unique lineage leading to Acrasis. Meanwhile, mtDNA gene content appears to be remarkably stable in the Acrasis sister lineage leading to Naegleria and in their distant relatives Jakobida. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng
2017-10-01
RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most
Sharma, Kishor; Tollervey, David
1999-01-01
The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548
LIM-domain proteins, LIMD1, Ajuba, and WTIP are required for microRNA-mediated gene silencing
James, Victoria; Zhang, Yining; Foxler, Daniel E.; de Moor, Cornelia H.; Kong, Yi Wen; Webb, Thomas M.; Self, Tim J.; Feng, Yungfeng; Lagos, Dimitrios; Chu, Chia-Ying; Rana, Tariq M.; Morley, Simon J.; Longmore, Gregory D.; Bushell, Martin; Sharp, Tyson V.
2010-01-01
In recent years there have been major advances with respect to the identification of the protein components and mechanisms of microRNA (miRNA) mediated silencing. However, the complete and precise repertoire of components and mechanism(s) of action remain to be fully elucidated. Herein we reveal the identification of a family of three LIM domain-containing proteins, LIMD1, Ajuba and WTIP (Ajuba LIM proteins) as novel mammalian processing body (P-body) components, which highlight a novel mechanism of miRNA-mediated gene silencing. Furthermore, we reveal that LIMD1, Ajuba, and WTIP bind to Ago1/2, RCK, Dcp2, and eIF4E in vivo, that they are required for miRNA-mediated, but not siRNA-mediated gene silencing and that all three proteins bind to the mRNA 5′ m7GTP cap–protein complex. Mechanistically, we propose the Ajuba LIM proteins interact with the m7GTP cap structure via a specific interaction with eIF4E that prevents 4EBP1 and eIF4G interaction. In addition, these LIM-domain proteins facilitate miRNA-mediated gene silencing by acting as an essential molecular link between the translationally inhibited eIF4E-m7GTP-5′cap and Ago1/2 within the miRISC complex attached to the 3′-UTR of mRNA, creating an inhibitory closed-loop complex. PMID:20616046
Massive Gene Transfer and Extensive RNA Editing of a Symbiotic Dinoflagellate Plastid Genome
Mungpakdee, Sutada; Shinzato, Chuya; Takeuchi, Takeshi; Kawashima, Takeshi; Koyanagi, Ryo; Hisata, Kanako; Tanaka, Makiko; Goto, Hiroki; Fujie, Manabu; Lin, Senjie; Satoh, Nori; Shoguchi, Eiichi
2014-01-01
Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8–3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine types of RNA editing, including a novel G/U type, were discovered in minicircle transcripts but not in genes transferred to the nucleus. In contrast to DNA editing sites in dinoflagellate mitochondria, which tend to be highly conserved across all taxa, editing sites employed in DNA minicircles are highly variable from species to species. Editing is crucial for core photosystem protein function. It restores evolutionarily conserved amino acids and increases peptidyl hydropathy. It also increases protein plasticity necessary to initiate photosystem complex assembly. PMID:24881086
Maniar, Jay M.; Fire, Andrew Z.
2011-01-01
SUMMARY Background The development of the germline in Caenorhabditis elegans is a complex process involving the regulation of thousands of genes in a coordinated manner. Several genes required for small RNA biogenesis and function are among those required for the proper organization of the germline. EGO-1 is a putative RNA-directed RNA polymerase (RdRP) that is required for multiple aspects of C. elegans germline development and efficient RNAi of germline-expressed genes. RdRPs have been proposed to act through a variety of mechanisms including the post-transcriptional targeting of specific mRNAs as well as through a direct interaction with chromatin. Despite extensive investigation, the molecular role of EGO-1 has remained enigmatic. Results Here we use high-throughput small RNA and messenger RNA sequencing to investigate EGO-1 function. We found that EGO-1 is required to produce a distinct pool of small RNAs antisense to a number of germline-expressed mRNAs through several developmental stages. These potential mRNA targets fall into distinct classes, including genes required for kinetochore and nuclear pore assembly, histone-modifying activities and centromeric proteins. We also found several RNAi-related genes to be targets of EGO-1. Finally, we show a strong association between the loss of small RNAs and the rise of mRNA levels in ego-1(−) animals. Conclusions Our data support the conclusion that EGO-1 produces triphosphorylated small RNAs derived from mRNA templates and that these small RNAs modulate gene expression through the targeting of their cognate mRNAs. PMID:21396820
Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M
1999-01-01
In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
Identification of suitable reference genes for hepatic microRNA quantitation.
Lamba, Vishal; Ghodke-Puranik, Yogita; Guan, Weihua; Lamba, Jatinder K
2014-03-07
MicroRNAs (miRNAs) are short (~22 nt) endogenous RNAs that play important roles in regulating expression of a wide variety of genes involved in different cellular processes. Alterations in microRNA expression patterns have been associated with a number of human diseases. Accurate quantitation of microRNA levels is important for their use as biomarkers and in determining their functions. Real time PCR is the gold standard and the most frequently used technique for miRNA quantitation. Real time PCR data analysis includes normalizing the amplification data to suitable endogenous control/s to ensure that microRNA quantitation is not affected by the variability that is potentially introduced at different experimental steps. U6 (RNU6A) and RNU6B are two commonly used endogenous controls in microRNA quantitation. The present study was designed to investigate inter-individual variability and gender differences in hepatic microRNA expression as well as to identify the best endogenous control/s that could be used for normalization of real-time expression data in liver samples. We used Taqman based real time PCR to quantitate hepatic expression levels of 22 microRNAs along with U6 and RNU6B in 50 human livers samples (25 M, 25 F). To identify the best endogenous controls for use in data analysis, we evaluated the amplified candidates for their stability (least variability) in expression using two commonly used software programs: Normfinder and GeNormplus, Both Normfinder and GeNormplus identified U6 to be among the least stable of all the candidates analyzed, and RNU6B was also not among the top genes in stability. mir-152 and mir-23b were identified to be the two most stable candidates by both Normfinder and GeNormplus in our analysis, and were used as endogenous controls for normalization of hepatic miRNA levels. Measurements of microRNA stability indicate that U6 and RNU6B are not suitable for use as endogenous controls for normalizing microRNA relative quantitation
Pan, Yue; Lu, Lingyun; Chen, Junquan; Zhong, Yong; Dai, Zhehao
2018-01-01
This study aimed to identify potential crucial genes and construction of microRNA-mRNA negative regulatory networks in osteosarcoma by comprehensive bioinformatics analysis. Data of gene expression profiles (GSE28424) and miRNA expression profiles (GSE28423) were downloaded from GEO database. The differentially expressed genes (DEGs) and miRNAs (DEMIs) were obtained by R Bioconductor packages. Functional and enrichment analyses of selected genes were performed using DAVID database. Protein-protein interaction (PPI) network was constructed by STRING and visualized in Cytoscape. The relationships among the DEGs and module in PPI network were analyzed by plug-in NetworkAnalyzer and MCODE seperately. Through the TargetScan and comparing target genes with DEGs, the miRNA-mRNA regulation network was established. Totally 346 DEGs and 90 DEMIs were found to be differentially expressed. These DEGs were enriched in biological processes and KEGG pathway of inflammatory immune response. 25 genes in the PPI network were selected as hub genes. Top 10 hub genes were TYROBP, HLA-DRA, VWF, PPBP, SERPING1, HLA-DPA1, SERPINA1, KIF20A, FERMT3, HLA-E. PPI network of DEGs followed a pattern of power law network and met the characteristics of small-world network. MCODE analysis identified 4 clusters and the most significant cluster consisted of 11 nodes and 55 edges. SEPP1, CKS2, TCAP, BPI were identified as the seed genes in their own clusters, respectively. The miRNA-mRNA regulation network which was composed of 89 pairs was established. MiR-210 had the highest connectivity with 12 target genes. Among the predicted target of MiR-96, HLA-DPA1 and TYROBP were the hub genes. Our study indicated possible differentially expressed genes and miRNA, and microRNA-mRNA negative regulatory networks in osteosarcoma by bioinformatics analysis, which may provide novel insights for unraveling pathogenesis of osteosarcoma.
Methylation of miRNA genes and oncogenesis.
Loginov, V I; Rykov, S V; Fridman, M V; Braga, E A
2015-02-01
Interaction between microRNA (miRNA) and messenger RNA of target genes at the posttranscriptional level provides fine-tuned dynamic regulation of cell signaling pathways. Each miRNA can be involved in regulating hundreds of protein-coding genes, and, conversely, a number of different miRNAs usually target a structural gene. Epigenetic gene inactivation associated with methylation of promoter CpG-islands is common to both protein-coding genes and miRNA genes. Here, data on functions of miRNAs in development of tumor-cell phenotype are reviewed. Genomic organization of promoter CpG-islands of the miRNA genes located in inter- and intragenic areas is discussed. The literature and our own results on frequency of CpG-island methylation in miRNA genes from tumors are summarized, and data regarding a link between such modification and changed activity of miRNA genes and, consequently, protein-coding target genes are presented. Moreover, the impact of miRNA gene methylation on key oncogenetic processes as well as affected signaling pathways is discussed.
Effects of MicroRNA-23a on Differentiation and Gene Expression Profiles in 3T3-L1 Adipocytes
Huang, Yong; Huang, Jinxiu; Qi, Renli; Wang, Qi; Wu, Yongjiang; Wang, Jing
2016-01-01
MicroRNAs (miRNAs) are small non-coding RNA molecules that regulate growth, development, and programmed death of cells. A newly-published study has shown that miRNA-23a could regulate 3T3-L1 adipocyte differentiation. Here, we identified miRNA-23a as a negative regulator of 3T3-L1 adipocyte differentiation again. Over-expression of miRNA-23a inhibited differentiation and decreased lipogenesis as well as down-regulated mRNA and protein expression of both peroxisome proliferator-activated receptor (PPAR) γ and fatty acid binding protein (FABP) 4, whereas knock down of miRNA-23a showed the opposite effects on differentiation as well as increasing the number of apoptotic cells. Additionally, digital gene expression profiling sequencing (DGE-Seq) was used to assay changes in gene expression profiles following alterations in the level of miR-23a. In total, over-expression or knock down of miRNA-23a significantly changed the expression of 313 and 425 genes, respectively. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses indicated that these genes were mainly involved in the stress response, immune system, metabolism, cell cycle, among other pathways. Additionally, the signal transducer and activator of transcription 1 (Stat1) was shown to be a target of miRNA-23a by computational and dual-luciferase reporter assays that indicated Janus Kinase (Jak)-Stat signal pathway was implicated in regulating adipogenesis mediated by miRNA-23a in adipocytes. PMID:27783036
A conserved intronic U1 snRNP-binding sequence promotes trans-splicing in Drosophila
Gao, Jun-Li; Fan, Yu-Jie; Wang, Xiu-Ye; Zhang, Yu; Pu, Jia; Li, Liang; Shao, Wei; Zhan, Shuai; Hao, Jianjiang
2015-01-01
Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5′ intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5′ intron finds the 3′ introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5′ intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing. PMID:25838544
Mollusk genes encoding lysine tRNA (UUU) contain introns.
Matsuo, M; Abe, Y; Saruta, Y; Okada, N
1995-11-20
New intron-containing genes encoding tRNAs were discovered when genomic DNA isolated from various animal species was amplified by the polymerase chain reaction (PCR) with primers based on sequences of rabbit tRNA(Lys). From sequencing analysis of the products of PCR, we found that introns are present in several genes encoding tRNA(Lys) in mollusks, such as Loligo bleekeri (squid) and Octopus vulgaris (octopus). These introns were specific to genes encoding tRNA(Lys)(CUU) and were not present in genes encoding tRNA(Lys)(CUU). In addition, the sequences of the introns were different from one another. To confirm the results of our initial experiments, we isolated and sequenced genes encoding tRNA(Lys)(CUU) and tRNA(Lys)(UUU). The gene for tRNA(Lys)(UUU) from squid contained an intron, whose sequence was the same as that identified by PCR, and the gene formed a cluster with a corresponding pseudogene. Several DNA regions of 2.1 kb containing this cluster appeared to be tandemly arrayed in the squid genome. By contrast, the gene encoding tRNA(Lys)(CUU) did not contain an intron, as shown also by PCR. The tRNA(Lys)(UUU) that corresponded to the analyzed gene was isolated and characterized. The present study provides the first example of an intron-containing gene encoding a tRNA in mollusks and suggests the universality of introns in such genes in higher eukaryotes.
U14 small nucleolar RNA makes multiple contacts with the pre-ribosomal RNA.
Morrissey, J P; Tollervey, D
1997-06-01
The small nucleolar RNA (snoRNA) U14 has two regions of extended primary sequence complementarity to the 18S rRNA. The 3' region (domain B) shows the consensus structure for the methylation guide class of snoRNAs, whereas base-pairing between the 5' region (domain A) and the 18S rRNA sequence is required for the formation of functional ribosomes. Between domains A and B lies another essential region (domain Y). Here we report that yeast U14 can be cross-linked in vivo to the pre-rRNA; cross-linking is detected exclusively with the 35S primary transcript. Many nucleotides in U14 that lie outside of domains A and B are cross-linked to the pre-rRNA; in particular the essential domain Y region is cross-linked at several sites. U14 is, therefore, in far more extensive contact with the pre-rRNA than predicted from simple base-pairing models. Moreover, U14 can be cross-linked to other small RNA species. The functional interactions made by U14 during ribosome synthesis are likely to be very complex.
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
NASA Astrophysics Data System (ADS)
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
Massive gene transfer and extensive RNA editing of a symbiotic dinoflagellate plastid genome.
Mungpakdee, Sutada; Shinzato, Chuya; Takeuchi, Takeshi; Kawashima, Takeshi; Koyanagi, Ryo; Hisata, Kanako; Tanaka, Makiko; Goto, Hiroki; Fujie, Manabu; Lin, Senjie; Satoh, Nori; Shoguchi, Eiichi
2014-05-31
Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8-3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine types of RNA editing, including a novel G/U type, were discovered in minicircle transcripts but not in genes transferred to the nucleus. In contrast to DNA editing sites in dinoflagellate mitochondria, which tend to be highly conserved across all taxa, editing sites employed in DNA minicircles are highly variable from species to species. Editing is crucial for core photosystem protein function. It restores evolutionarily conserved amino acids and increases peptidyl hydropathy. It also increases protein plasticity necessary to initiate photosystem complex assembly. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Rumyantsev, A M; Zakharov, G A; Zhuravlev, A V; Padkina, M V; Savvateeva-Popova, E V; Sambuk, E V
2014-06-01
The stability of mRNA and its translation efficacy in higher eukaryotes are influenced by the interaction of 3'-untranscribed regions (3'-UTRs) with microRNAs and RNA-binding proteins. Since Saccharomyces cerevisiae lack microRNAs, it is possible to evaluate the contribution of only 3'-UTRs' and RNA-binding proteins' interaction in post-transcriptional regulation. For this, the post-transcriptional regulation of Drosophila limk1 gene encoding for the key enzyme of actin remodeling was studied in yeast. Analysis of limkl mRNA 3'-UTRs revealed the potential sites of yeast transcriptional termination. Computer remodeling demonstrated the possibility of secondary structure formation in limkl mRNA 3'-UTRs. For an evaluation of the functional activity of Drosophila 3'-UTRs in yeast, the reporter gene PHO5 encoding for yeast acid phosphatase (AP) fused to different variants of Drosophila limk1 mRNA 3'-UTRs (513, 1075, 1554 bp) was used. Assessments of AP activity and RT-PCR demonstrated that Drosophila limkl gene 3'-UTRs were functionally active and recognized in yeast. Therefore, yeast might be used as an appropriate model system for studies of 3'-UTR's role in post-transcriptional regulation.
Abdel-Hadi, Ahmed M; Caley, Daniel P; Carter, David R F; Magan, Naresh
2011-06-01
Aspergillus flavus and Aspergillus parasiticus are important pathogens of cotton, corn, peanuts and other oil-seed crops, producing toxins both in the field and during storage. We have designed three siRNA sequences (Nor-Ia, Nor-Ib, Nor-Ic) to target the mRNA sequence of the aflD gene to examine the potential for using RNA silencing technology to control aflatoxin production. Thus, the effect of siRNAs targeting of two key genes in the aflatoxin biosynthetic pathway, aflD (structural) and aflR (regulatory gene) and on aflatoxin B(1 )(AFB(1)), and aflatoxin G(1) (AFG(1)) production was examined. The study showed that Nor-Ib gave a significant decrease in aflD mRNA, aflR mRNA abundance, and AFB(1) production (98, 97 and 97% when compared to the controls) in A. flavus NRRL3357, respectively. Reduction in aflD and aflR mRNA abundance and AFB(1 )production increased with concentration of siRNA tested. There was a significant inhibition in aflD and AFB(1) production by A. flavus EGP9 and AFG(1 )production by A. parasiticus NRRL 13005. However, there was no significant decrease in AFG(1) production by A. parasiticus SSWT 2999. Changes in AFB(1) production in relation to mRNA levels of aflD showed a good correlation (R = 0.88; P = 0.00001); changes in aflR mRNA level in relation to mRNA level of aflD also showed good correlation (R = 0.82; P = 0.0001). The correlations between changes in aflR and aflD gene expression suggests a strong relationship between these structural and regulatory genes, and that aflD could be used as a target gene to develop efficient means for aflatoxin control using RNA silencing technology.
Anadón, C; Guil, S; Simó-Riudalbas, L; Moutinho, C; Setien, F; Martínez-Cardús, A; Moran, S; Villanueva, A; Calaf, M; Vidal, A; Lazo, P A; Zondervan, I; Savola, S; Kohno, T; Yokota, J; Ribas de Pouplana, L; Esteller, M
2016-08-18
The introduction of new therapies against particular genetic mutations in non-small-cell lung cancer is a promising avenue for improving patient survival, but the target population is small. There is a need to discover new potential actionable genetic lesions, to which end, non-conventional cancer pathways, such as RNA editing, are worth exploring. Herein we show that the adenosine-to-inosine editing enzyme ADAR1 undergoes gene amplification in non-small cancer cell lines and primary tumors in association with higher levels of the corresponding mRNA and protein. From a growth and invasion standpoint, the depletion of ADAR1 expression in amplified cells reduces their tumorigenic potential in cell culture and mouse models, whereas its overexpression has the opposite effects. From a functional perspective, ADAR1 overexpression enhances the editing frequencies of target transcripts such as NEIL1 and miR-381. In the clinical setting, patients with early-stage lung cancer, but harboring ADAR1 gene amplification, have poor outcomes. Overall, our results indicate a role for ADAR1 as a lung cancer oncogene undergoing gene amplification-associated activation that affects downstream RNA editing patterns and patient prognosis.
Design and interpretation of microRNA-reporter gene activity.
Carroll, Adam P; Tooney, Paul A; Cairns, Murray J
2013-06-15
MicroRNAs (miRNAs) are small noncoding RNA molecules that act as sequence specificity guides to direct post-transcriptional gene silencing. In doing so, miRNAs regulate many critical developmental processes, including cellular proliferation, differentiation, migration, and apoptosis, as well as more specialized biological functions such as dendritic spine development and synaptogenesis. Interactions between miRNAs and their miRNA recognition elements occur via partial complementarity, rendering tremendous redundancy in targeting such that miRNAs are predicted to regulate 60% of the genome, with each miRNA estimated to regulate more than 200 genes. Because these predictions are prone to false positives and false negatives, there is an ever present need to provide material support to these assertions to firmly establish the biological function of specific miRNAs in both normal and pathophysiological contexts. Using schizophrenia-associated miR-181b as an example, we present detailed guidelines and novel insights for the rapid establishment of a streamlined miRNA-reporter gene assay and explore various design concepts for miRNA-reporter gene applications, including bidirectional miRNA modulation. In exemplifying this approach, we report seven novel miR-181b target sites for five schizophrenia candidate genes (DISC1, BDNF, ENKUR, GRIA1, and GRIK1) and dissect a number of vital concepts regarding future developments for miRNA-reporter gene assays and the interpretation of their results. Copyright © 2013 Elsevier Inc. All rights reserved.
uAUG-mediated translational initiations are responsible for human mu opioid receptor gene expression
Song, Kyu Young; Kim, Chun Sung; Hwang, Cheol Kyu; Choi, Hack Sun; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H
2010-01-01
Abstract Mu opioid receptor (MOR) is the main site of interaction for major clinical analgesics, particularly morphine. MOR expression is regulated at the transcriptional and post-transcriptional levels. However, the protein expression of the MOR gene is relatively low and the translational control of MOR gene has not been well studied. The 5′-untranslated region (UTR) of the human MOR (OPRM1) mRNA contains four upstream AUG codons (uAUG) preceding the main translation initiation site. We mutated the four uAUGs individually and in combination. Mutations of the third uAUG, containing the same open reading frame, had the strongest inhibitory effect. The inhibitory effect caused by the third in-frame uAUG was confirmed by in vitro translation and receptor-binding assays. Toeprinting results showed that OPRM1 ribosomes initiated efficiently at the first uAUG, and subsequently re-initiated at the in-frame #3 uAUG and the physiological AUG site. This re-initiation resulted in negative expression of OPRM1 under normal conditions. These results indicate that re-initiation in MOR gene expression could play an important role in OPRM1 regulation. PMID:19438807
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
Shi, Stephanie T.; Schiller, Jennifer J.; Kanjanahaluethai, Amornrat; Baker, Susan C.; Oh, Jong-Won; Lai, Michael M. C.
1999-01-01
Murine hepatitis virus (MHV) gene 1, the 22-kb polymerase (pol) gene, is first translated into a polyprotein and subsequently processed into multiple proteins by viral autoproteases. Genetic complementation analyses suggest that the majority of the gene 1 products are required for viral RNA synthesis. However, there is no physical evidence supporting the association of any of these products with viral RNA synthesis. We have now performed immunofluorescent-staining studies with four polyclonal antisera to localize various MHV-A59 gene 1 products in virus-infected cells. Immunoprecipitation experiments showed that these antisera detected proteins representing the two papain-like proteases and the 3C-like protease encoded by open reading frame (ORF) 1a, the putative polymerase (p100) and a p35 encoded by ORF 1b, and their precursors. De novo-synthesized viral RNA was labeled with bromouridine triphosphate in lysolecithin-permeabilized MHV-infected cells. Confocal microscopy revealed that all of the viral proteins detected by these antisera colocalized with newly synthesized viral RNA in the cytoplasm, particularly in the perinuclear region of infected cells. Several cysteine and serine protease inhibitors, i.e., E64d, leupeptin, and zinc chloride, inhibited viral RNA synthesis without affecting the localization of viral proteins, suggesting that the processing of the MHV gene 1 polyprotein is tightly associated with viral RNA synthesis. Dual labeling with antibodies specific for cytoplasmic membrane structures showed that MHV gene 1 products and RNA colocalized with the Golgi apparatus in HeLa cells. However, in murine 17CL-1 cells, the viral proteins and viral RNA did not colocalize with the Golgi apparatus but, instead, partially colocalized with the endoplasmic reticulum. Our results provide clear physical evidence that several MHV gene 1 products, including the proteases and the polymerase, are associated with the viral RNA replication-transcription machinery
Whalen, Courtney; Tuohy, Christine; Tallo, Thomas; Kaufman, James W; Moore, Claire; Kuehner, Jason N
2018-04-23
Termination of RNA Polymerase II (Pol II) activity serves a vital cellular function by separating ubiquitous transcription units and influencing RNA fate and function. In the yeast Saccharomyces cerevisiae , Pol II termination is carried out by cleavage and polyadenylation factor (CPF-CF) and Nrd1-Nab3-Sen1 (NNS) complexes, which operate primarily at mRNA and non-coding RNA genes, respectively. Premature Pol II termination (attenuation) contributes to gene regulation, but there is limited knowledge of its prevalence and biological significance. In particular, it is unclear how much crosstalk occurs between CPF-CF and NNS complexes and how Pol II attenuation is modulated during stress adaptation. In this study, we have identified an attenuator in the DEF1 DNA repair gene, which includes a portion of the 5'-untranslated region (UTR) and upstream open reading frame (ORF). Using a plasmid-based reporter gene system, we conducted a genetic screen of 14 termination mutants and their ability to confer Pol II read-through defects. The DEF1 attenuator behaved as a hybrid terminator, relying heavily on CPF-CF and Sen1 but without Nrd1 and Nab3 involvement. Our genetic selection identified 22 cis -acting point mutations that clustered into four regions, including a polyadenylation site efficiency element that genetically interacts with its cognate binding-protein Hrp1. Outside of the reporter gene context, a DEF1 attenuator mutant increased mRNA and protein expression, exacerbating the toxicity of a constitutively active Def1 protein. Overall, our data support a biologically significant role for transcription attenuation in regulating DEF1 expression, which can be modulated during the DNA damage response. Copyright © 2018, G3: Genes, Genomes, Genetics.
Wang, Ningning; Zhang, Di; Wang, Zhenhui; Xun, Hongwei; Ma, Jian; Wang, Hui; Huang, Wei; Liu, Ying; Lin, Xiuyun; Li, Ning; Ou, Xiufang; Zhang, Chunyu; Wang, Ming-Bo; Liu, Bao
2014-06-30
Endogenous small (sm) RNAs (primarily si- and miRNAs) are important trans/cis-acting regulators involved in diverse cellular functions. In plants, the RNA-dependent RNA polymerases (RDRs) are essential for smRNA biogenesis. It has been established that RDR2 is involved in the 24 nt siRNA-dependent RNA-directed DNA methylation (RdDM) pathway. Recent studies have suggested that RDR1 is involved in a second RdDM pathway that relies mostly on 21 nt smRNAs and functions to silence a subset of genomic loci that are usually refractory to the normal RdDM pathway in Arabidopsis. Whether and to what extent the homologs of RDR1 may have similar functions in other plants remained unknown. We characterized a loss-of-function mutant (Osrdr1) of the OsRDR1 gene in rice (Oryza sativa L.) derived from a retrotransposon Tos17 insertion. Microarray analysis identified 1,175 differentially expressed genes (5.2% of all expressed genes in the shoot-tip tissue of rice) between Osrdr1 and WT, of which 896 and 279 genes were up- and down-regulated, respectively, in Osrdr1. smRNA sequencing revealed regional alterations in smRNA clusters across the rice genome. Some of the regions with altered smRNA clusters were associated with changes in DNA methylation. In addition, altered expression of several miRNAs was detected in Osrdr1, and at least some of which were associated with altered expression of predicted miRNA target genes. Despite these changes, no phenotypic difference was identified in Osrdr1 relative to WT under normal condition; however, ephemeral phenotypic fluctuations occurred under some abiotic stress conditions. Our results showed that OsRDR1 plays a role in regulating a substantial number of endogenous genes with diverse functions in rice through smRNA-mediated pathways involving DNA methylation, and which participates in abiotic stress response.
Habu, Yuichiro; Miyano-Kurosaki, Naoko; Kitano, Michiko; Endo, Yumihiko; Yukita, Masakazu; Ohira, Shigeru; Takaku, Hiroaki; Nashimoto, Masayuki; Takaku, Hiroshi
2005-01-01
The tRNA 3′-processing endoribonuclease (tRNase Z or 3′ tRNase; EC 3.1.26.11) is an essential enzyme that removes the 3′ trailer from pre-tRNA. The long form (tRNase ZL) can cleave a target RNA in vitro at the site directed by an appropriate small-guide RNA (sgRNA). Here, we investigated whether this sgRNA/tRNase ZL strategy could be applied to gene therapy for AIDS. We tested the ability of four sgRNA-expression plasmids to inhibit HIV-1 gene expression in COS cells, using a transient-expression assay. The three sgRNAs guide inhibition of HIV-1 gene expression in cultured COS cells. Analysis of the HIV-1 mRNA levels suggested that sgRNA directed the tRNase ZL to mediate the degradation of target RNA. The observation that sgRNA was localized primarily in nuclei suggests that tRNase ZL cleaves the HIV-1 mRNA when complexed with sgRNA in this location. We also examined the ability of two retroviral vectors expressing sgRNA to suppress HIV-1 expression in HIV-1-infected Jurkat T cells. sgRNA-SL4 suppressed HIV-1 expression almost completely in infected cells for up to 18 days. These results suggest that the sgRNA/tRNase ZL approach is effective in downregulating HIV-1 gene expression. PMID:15647506
Yan, Dong; Perriman, Rhonda; Igel, Haller; Howe, Kenneth J.; Neville, Megan; Ares, Manuel
1998-01-01
A screen for suppressors of a U2 snRNA mutation identified CUS2, an atypical member of the RNA recognition motif (RRM) family of RNA binding proteins. CUS2 protein is associated with U2 RNA in splicing extracts and interacts with PRP11, a subunit of the conserved splicing factor SF3a. Absence of CUS2 renders certain U2 RNA folding mutants lethal, arguing that a normal activity of CUS2 is to help refold U2 into a structure favorable for its binding to SF3b and SF3a prior to spliceosome assembly. Both CUS2 function in vivo and the in vitro RNA binding activity of CUS2 are disrupted by mutation of the first RRM, suggesting that rescue of misfolded U2 involves the direct binding of CUS2. Human Tat-SF1, reported to stimulate Tat-specific, transactivating region-dependent human immunodeficiency virus transcription in vitro, is structurally similar to CUS2. Anti-Tat-SF1 antibodies coimmunoprecipitate SF3a66 (SAP62), the human homolog of PRP11, suggesting that Tat-SF1 has a parallel function in splicing in human cells. PMID:9710584
Hartmann, Linda; Neveling, Kornelia; Borkens, Stephanie; Schneider, Hildegard; Freund, Marcel; Grassman, Elke; Theiss, Stephan; Wawer, Angela; Burdach, Stefan; Auerbach, Arleen D.; Schindler, Detlev; Hanenberg, Helmut; Schaal, Heiner
2010-01-01
The U1 small nuclear RNA (U1 snRNA) as a component of the major U2-dependent spliceosome recognizes 5′ splice sites (5′ss) containing GT as the canonical dinucleotide in the intronic positions +1 and +2. The c.165+1G>T germline mutation in the 5′ss of exon 2 of the Fanconi anemia C (FANCC) gene commonly predicted to prevent correct splicing was identified in nine FA patients from three pedigrees. RT-PCR analysis of the endogenous FANCC mRNA splicing pattern of patient-derived fibroblasts revealed aberrant mRNA processing, but surprisingly also correct splicing at the TT dinucleotide, albeit with lower efficiency. This consequently resulted in low levels of correctly spliced transcript and minute levels of normal posttranslationally processed FANCD2 protein, indicating that this naturally occurring TT splicing might contribute to the milder clinical manifestations of the disease in these patients. Functional analysis of this FANCC 5′ss within splicing reporters revealed that both the noncanonical TT dinucleotide and the genomic context of FANCC were required for the residual correct splicing at this mutant 5′ss. Finally, use of lentiviral vectors as a delivery system to introduce expression cassettes for TT-adapted U1 snRNAs into primary FANCC patient fibroblasts allowed the correction of the DNA-damage-induced G2 cell-cycle arrest in these cells, thus representing an alternative transcript-targeting approach for genetic therapy of inherited splice-site mutations. PMID:20869034
Liao, Wei; Jordaan, Gwen; Nham, Phillipp; Phan, Ryan T; Pelegrini, Matteo; Sharma, Sanjai
2015-10-16
To determine differentially expressed and spliced RNA transcripts in chronic lymphocytic leukemia specimens a high throughput RNA-sequencing (HTS RNA-seq) analysis was performed. Ten CLL specimens and five normal peripheral blood CD19+ B cells were analyzed by HTS RNA-seq. The library preparation was performed with Illumina TrueSeq RNA kit and analyzed by Illumina HiSeq 2000 sequencing system. An average of 48.5 million reads for B cells, and 50.6 million reads for CLL specimens were obtained with 10396 and 10448 assembled transcripts for normal B cells and primary CLL specimens respectively. With the Cuffdiff analysis, 2091 differentially expressed genes (DEG) between B cells and CLL specimens based on FPKM (fragments per kilobase of transcript per million reads and false discovery rate, FDR q < 0.05, fold change >2) were identified. Expression of selected DEGs (n = 32) with up regulated and down regulated expression in CLL from RNA-seq data were also analyzed by qRT-PCR in a test cohort of CLL specimens. Even though there was a variation in fold expression of DEG genes between RNA-seq and qRT-PCR; more than 90 % of analyzed genes were validated by qRT-PCR analysis. Analysis of RNA-seq data for splicing alterations in CLL and B cells was performed by Multivariate Analysis of Transcript Splicing (MATS analysis). Skipped exon was the most frequent splicing alteration in CLL specimens with 128 significant events (P-value <0.05, minimum inclusion level difference >0.1). The RNA-seq analysis of CLL specimens identifies novel DEG and alternatively spliced genes that are potential prognostic markers and therapeutic targets. High level of validation by qRT-PCR for a number of DEG genes supports the accuracy of this analysis. Global comparison of transcriptomes of B cells, IGVH non-mutated CLL (U-CLL) and mutated CLL specimens (M-CLL) with multidimensional scaling analysis was able to segregate CLL and B cell transcriptomes but the M-CLL and U-CLL transcriptomes
Structure, dynamics and RNA binding of the multi-domain splicing factor TIA-1
Wang, Iren; Hennig, Janosch; Jagtap, Pravin Kumar Ankush; Sonntag, Miriam; Valcárcel, Juan; Sattler, Michael
2014-01-01
Alternative pre-messenger ribonucleic acid (pre-mRNA) splicing is an essential process in eukaryotic gene regulation. The T-cell intracellular antigen-1 (TIA-1) is an apoptosis-promoting factor that modulates alternative splicing of transcripts, including the pre-mRNA encoding the membrane receptor Fas. TIA-1 is a multi-domain ribonucleic acid (RNA) binding protein that recognizes poly-uridine tract RNA sequences to facilitate 5′ splice site recognition by the U1 small nuclear ribonucleoprotein (snRNP). Here, we characterize the RNA interaction and conformational dynamics of TIA-1 by nuclear magnetic resonance (NMR), isothermal titration calorimetry (ITC) and small angle X-ray scattering (SAXS). Our NMR-derived solution structure of TIA-1 RRM2–RRM3 (RRM2,3) reveals that RRM2 adopts a canonical RNA recognition motif (RRM) fold, while RRM3 is preceded by an non-canonical helix α0. NMR and SAXS data show that all three RRMs are largely independent structural modules in the absence of RNA, while RNA binding induces a compact arrangement. RRM2,3 binds to pyrimidine-rich FAS pre-mRNA or poly-uridine (U9) RNA with nanomolar affinities. RRM1 has little intrinsic RNA binding affinity and does not strongly contribute to RNA binding in the context of RRM1,2,3. Our data unravel the role of binding avidity and the contributions of the TIA-1 RRMs for recognition of pyrimidine-rich RNAs. PMID:24682828
Marck, Christian; Kachouri-Lafond, Rym; Lafontaine, Ingrid; Westhof, Eric; Dujon, Bernard; Grosjean, Henri
2006-01-01
We present the first comprehensive analysis of RNA polymerase III (Pol III) transcribed genes in ten yeast genomes. This set includes all tRNA genes (tDNA) and genes coding for SNR6 (U6), SNR52, SCR1 and RPR1 RNA in the nine hemiascomycetes Saccharomyces cerevisiae, Saccharomyces castellii, Candida glabrata, Kluyveromyces waltii, Kluyveromyces lactis, Eremothecium gossypii, Debaryomyces hansenii, Candida albicans, Yarrowia lipolytica and the archiascomycete Schizosaccharomyces pombe. We systematically analysed sequence specificities of tRNA genes, polymorphism, variability of introns, gene redundancy and gene clustering. Analysis of decoding strategies showed that yeasts close to S.cerevisiae use bacterial decoding rules to read the Leu CUN and Arg CGN codons, in contrast to all other known Eukaryotes. In D.hansenii and C.albicans, we identified a novel tDNA-Leu (AAG), reading the Leu CUU/CUC/CUA codons with an unusual G at position 32. A systematic ‘p-distance tree’ using the 60 variable positions of the tRNA molecule revealed that most tDNAs cluster into amino acid-specific sub-trees, suggesting that, within hemiascomycetes, orthologous tDNAs are more closely related than paralogs. We finally determined the bipartite A- and B-box sequences recognized by TFIIIC. These minimal sequences are nearly conserved throughout hemiascomycetes and were satisfactorily retrieved at appropriate locations in other Pol III genes. PMID:16600899
Gene expression profile after activation of RIG-I in 5'ppp-dsRNA challenged DF1.
Chen, Yang; Xu, Qi; Li, Yang; Liu, Ran; Huang, Zhengyang; Wang, Bin; Chen, Guohong
2016-12-01
Retinoic acid inducible gene I (RIG-I) can recognize influenza viruses and evoke the innate immune response. RIG-I is absent in the chicken genome, but is conserved in the genome of ducks. Lack of RIG-I renders chickens more susceptible to avian influenza infection, and the clinical symptoms are more prominent than in other poultry. It is unknown whether introduction of duck RIG-I into chicken cells can establish the immunity as is seen in ducks and the role of RIG-I in established immunity is unknown. In this study, a chicken cell strain with stable expression of duRIG-I was established by lentiviral infection, giving DF1/LV5-RIG-I, and a control strain DF1/LV5 was established in parallel. To verify stable, high level expression of duRIG-I in DF1 cells, the levels of duRIG-I mRNA and protein were determined by real-time RT-PCR and Western blot, respectively. Further, 5'triphosphate double stranded RNA (5'ppp-dsRNA) was used to mimic an RNA virus infection and the infected DF1/LV5-RIG-I and DF1/LV5 cells were subjected to high-throughput RNA-sequencing, which yielded 193.46 M reads and 39.07 G bases. A total of 278 differentially expressed genes (DEGs), i.e., duRIG-I-mediated responsive genes, were identified by RNA-seq. Among the 278 genes, 120 DEGs are annotated in the KEGG database, and the most reliable KEGG pathways are likely to be the signaling pathways of RIG-I like receptors. Functional analysis by Gene ontology (GO) indicates that the functions of these DEGs are primarily related to Type I interferon (IFN) signaling, IFN-β-mediated cellular responses and up-regulation of the RIG-I signaling pathway. Based on the shared genes among different pathways, a network representing crosstalk between RIG-I and other signaling pathways was constructed using Cytoscape software. The network suggests that RIG-mediated pathway may crosstalk with the Jak-STAT signaling pathway, Toll-like receptor signaling pathway, Wnt signaling pathway, ubiquitin-mediated proteolysis
Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.
Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter
2004-02-11
In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.
Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase
Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter
2004-01-01
In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727
Johansen, Ilona; Andreassen, Rune
2014-12-23
MicroRNAs (miRNAs) are an abundant class of endogenous small RNA molecules that downregulate gene expression at the post-transcriptional level. They play important roles by regulating genes that control multiple biological processes, and recent years there has been an increased interest in studying miRNA genes and miRNA gene expression. The most common method applied to study gene expression of single genes is quantitative PCR (qPCR). However, before expression of mature miRNAs can be studied robust qPCR methods (miRNA-qPCR) must be developed. This includes identification and validation of suitable reference genes. We are particularly interested in Atlantic salmon (Salmo salar). This is an economically important aquaculture species, but no reference genes dedicated for use in miRNA-qPCR methods has been validated for this species. Our aim was, therefore, to identify suitable reference genes for miRNA-qPCR methods in Salmo salar. We used a systematic approach where we utilized similar studies in other species, some biological criteria, results from deep sequencing of small RNAs and, finally, experimental validation of candidate reference genes by qPCR to identify the most suitable reference genes. Ssa-miR-25-3p was identified as most suitable single reference gene. The best combinations of two reference genes were ssa-miR-25-3p and ssa-miR-455-5p. These two genes were constitutively and stably expressed across many different tissues. Furthermore, infectious salmon anaemia did not seem to affect their expression levels. These genes were amplified with high specificity, good efficiency and the qPCR assays showed a good linearity when applying a simple cybergreen miRNA-PCR method using miRNA gene specific forward primers. We have identified suitable reference genes for miRNA-qPCR in Atlantic salmon. These results will greatly facilitate further studies on miRNA genes in this species. The reference genes identified are conserved genes that are identical in their mature
Kotani, Hirokazu; Hiraoka, Nobutsugu; Obayashi, Akira
1991-01-01
SP6 bacteriophage RNA polymerase is produced by cultivating a new microorganism (particularly new strains of Escherichia coli) harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene and recovering SP6 bacteriophage RNA polymerase from the culture broth. SP6 bacteriophage RNA polymerase gene is provided as are new microorganisms harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene.
Gu, Jinbao; Xia, Zhiqiang; Luo, Yuehua; Jiang, Xingyu; Qian, Bilian; Xie, He; Zhu, Jian-Kang; Xiong, Liming; Zhu, Jianhua; Wang, Zhen-Yu
2018-01-01
Abstract Soil salinity is a significant threat to sustainable agricultural production worldwide. Plants must adjust their developmental and physiological processes to cope with salt stress. Although the capacity for adaptation ultimately depends on the genome, the exceptional versatility in gene regulation provided by the spliceosome-mediated alternative splicing (AS) is essential in these adaptive processes. However, the functions of the spliceosome in plant stress responses are poorly understood. Here, we report the in-depth characterization of a U1 spliceosomal protein, AtU1A, in controlling AS of pre-mRNAs under salt stress and salt stress tolerance in Arabidopsis thaliana. The atu1a mutant was hypersensitive to salt stress and accumulated more reactive oxygen species (ROS) than the wild-type under salt stress. RNA-seq analysis revealed that AtU1A regulates AS of many genes, presumably through modulating recognition of 5′ splice sites. We showed that AtU1A is associated with the pre-mRNA of the ROS detoxification-related gene ACO1 and is necessary for the regulation of ACO1 AS. ACO1 is important for salt tolerance because ectopic expression of ACO1 in the atu1a mutant can partially rescue its salt hypersensitive phenotype. Our findings highlight the critical role of AtU1A as a regulator of pre-mRNA processing and salt tolerance in plants. PMID:29228330
Shen, Yun; Ruan, Qingxia; Chai, Haoxi; Yuan, Yongze; Yang, Wannian; Chen, Junping; Xin, Zhanguo; Shi, Huazhong
2016-12-01
Polyamines involve in gene regulation by interacting with and modulating the functions of various anionic macromolecules such as DNA, RNA and proteins. In this study, we identified an important function of the polyamine transporter LHR1 (LOWER EXPRESSION OF HEAT RESPONSIVE GENE1) in heat-inducible gene expression in Arabidopsis thaliana. The lhr1 mutant was isolated through a forward genetic screening for altered expression of the luciferase reporter gene driven by the promoter from the heat-inducible gene AtHSP18.2. The lhr1 mutant showed reduced induction of the luciferase gene in response to heat stress and was more sensitive to high temperature than the wild type. Map-based cloning identified that the LHR1 gene encodes the polyamine transporter PUT3 (POLYAMINE UPTAKE TRANSPORTER 3) localized in the plasma membrane. The LHR1/PUT3 is required for the uptake of extracellular polyamines and plays an important role in stabilizing the mRNAs of several crucial heat stress responsive genes under high temperature. Genome-wide gene expression analysis using RNA-seq identified an array of differentially expressed genes, among which the transcript levels of some of the heat shock protein genes significantly reduced in response to prolonged heat stress in the lhr1 mutant. Our findings revealed an important heat stress response and tolerance mechanism involving polyamine influx which modulates mRNA stability of heat-inducible genes under heat stress conditions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Liu, Zhihong; Xiang, Yang; Wei, Zhun; Yu, Bo; Shao, Yong; Zhang, Jie; Yang, Hong; Li, Manmei; Guan, Ming; Wan, Jun; Zhang, Wei
2013-11-01
HSV-1-based vectors have been widely used to achieve targeted delivery of genes into the nervous system. In the current study, we aim to use shRNA-containing HSV-1-based gene delivery system for the therapy of HSV-2 infection. Guinea pigs were infected intravaginally with HSV-2 and scored daily for 100 days for the severity of vaginal disease. HSV-2 shRNA-containing HSV-1 was applied intravaginally daily between 8 and 14 days after HSV-2 challenge. Delivery of HSV-2 shRNA-containing HSV-1 had no effect on the onset of disease and acute virus shedding in animals, but resulted in a significant reduction in both the cumulative recurrent lesion days and the number of days with recurrent disease. Around half of the animals in the HSV-2 shRNA group did not develop recurrent disease 100 days post HSV-2 infection. In conclusion, HSV-2 shRNA-containing HSV-1 particles are effective in reducing the recurrence of genital herpes caused by HSV-2. Copyright © 2013 Elsevier B.V. All rights reserved.
The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate
Mooers, Blaine H.M.; Singh, Amritanshu
2011-01-01
Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548
Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier
2016-05-01
Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.
Horiuchi, Keiko; Perez-Cerezales, Serafín; Papasaikas, Panagiotis; Ramos-Ibeas, Priscila; López-Cardona, Angela Patricia; Laguna-Barraza, Ricardo; Fonseca Balvís, Noelia; Pericuesta, Eva; Fernández-González, Raul; Planells, Benjamín; Viera, Alberto; Suja, Jose Angel; Ross, Pablo Juan; Alén, Francisco; Orio, Laura; Rodriguez de Fonseca, Fernando; Pintado, Belén; Valcárcel, Juan; Gutiérrez-Adán, Alfonso
2018-04-03
The U2AF35-like ZRSR1 has been implicated in the recognition of 3' splice site during spliceosome assembly, but ZRSR1 knockout mice do not show abnormal phenotypes. To analyze ZRSR1 function and its precise role in RNA splicing, we generated ZRSR1 mutant mice containing truncating mutations within its RNA-recognition motif. Homozygous mutant mice exhibited severe defects in erythrocytes, muscle stretch, and spermatogenesis, along with germ cell sloughing and apoptosis, ultimately leading to azoospermia and male sterility. Testis RNA sequencing (RNA-seq) analyses revealed increased intron retention of both U2- and U12-type introns, including U12-type intron events in genes with key functions in spermatogenesis and spermatid development. Affected U2 introns were commonly found flanking U12 introns, suggesting functional cross-talk between the two spliceosomes. The splicing and tissue defects observed in mutant mice attributed to ZRSR1 loss of function suggest a physiological role for this factor in U12 intron splicing. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Functional analysis of U1-70K interacting SR proteins in pre-mRNA splicing in Arabidopsis
DOE Office of Scientific and Technical Information (OSTI.GOV)
A.S.N. Reddy
Proteins of a serine/arginine-rich (SR) family are part of the spliceosome and are implicated in both constitutive and alternative splicing of pre-mRNAs. With the funding from DOE we have been studying alternative of splicing of genes encoding serine/arginine-rich (SR) proteins and the roles of SR proteins that interact with U1-70K in regulating basic and alternative splicing. Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins and its regulation by hormones and stresses: We analyzed the splicing of all 19 Arabidopsis genes in different tissues, during different seedling stages and in response to various hormonal and stress treatments. Remarkably, about 90 differentmore » transcripts are produced from 15 SR genes, thereby increasing the transcriptome complexity of SR genes by about five fold. Using the RNA isolated from polysomes we have shown that most of the splice variants are recruited for translation. Alternative splicing of some SR genes is controlled in a developmental and tissue-specific manner (Palusa et al., 2007). Interestingly, among the various hormones and abiotic stresses tested, temperature stress (cold and heat) and ultraviolet light dramatically altered alternative splicing of pre-mRNAs of several SR genes whereas hormones altered the splicing of only two SR genes (Palusa et al., 2007). Localization and dynamics of a novel serine/arginine-rich protein that interacts with U1-70K: We analyzed the intranuclear movement of SR45 fused to GFP by fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP). We demonstrate that the movement of GFP-SR45 is ATP-dependent. Interestingly, inhibition of transcription or phosphorylation slowed the mobility of GFP-SR45 (Ali et al., 2006). Our studies have revealed that the nuclear localization signals are located in arg/ser-rich domains (RS) 1 and 2, whereas the speckle targeting signals are exclusively present in RS2 (Ali et al., 2006). The
Kanai, Akio; Oida, Hanako; Matsuura, Nana; Doi, Hirofumi
2003-01-01
We systematically screened a genomic DNA library to identify proteins of the hyperthermophilic archaeon Pyrococcus furiosus using an expression cloning method. One gene product, which we named FAU-1 (P. furiosus AU-binding), demonstrated the strongest binding activity of all the genomic library-derived proteins tested against an AU-rich RNA sequence. The protein was purified to near homogeneity as a 54 kDa single polypeptide, and the gene locus corresponding to this FAU-1 activity was also sequenced. The FAU-1 gene encoded a 472-amino-acid protein that was characterized by highly charged domains consisting of both acidic and basic amino acids. The N-terminal half of the gene had a degree of similarity (25%) with RNase E from Escherichia coli. Five rounds of RNA-binding-site selection and footprinting analysis showed that the FAU-1 protein binds specifically to the AU-rich sequence in a loop region of a possible RNA ligand. Moreover, we demonstrated that the FAU-1 protein acts as an oligomer, and mainly as a trimer. These results showed that the FAU-1 protein is a novel heat-stable protein with an RNA loop-binding characteristic. PMID:12614195
Isolation of ripening-related genes from ethylene/1-MCP treated papaya through RNA-seq.
Shen, Yan Hong; Lu, Bing Guo; Feng, Li; Yang, Fei Ying; Geng, Jiao Jiao; Ming, Ray; Chen, Xiao Jing
2017-08-31
Since papaya is a typical climacteric fruit, exogenous ethylene (ETH) applications can induce premature and quicker ripening, while 1-methylcyclopropene (1-MCP) slows down the ripening processes. Differential gene expression in ETH or 1-MCP-treated papaya fruits accounts for the ripening processes. To isolate the key ripening-related genes and better understand fruit ripening mechanisms, transcriptomes of ETH or 1-MCP-treated, and non-treated (Control Group, CG) papaya fruits were sequenced using Illumina Hiseq2500. A total of 18,648 (1-MCP), 19,093 (CG), and 15,321 (ETH) genes were detected, with the genes detected in the ETH-treatment being the least. This suggests that ETH may inhibit the expression of some genes. Based on the differential gene expression (DGE) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, 53 fruit ripening-related genes were selected: 20 cell wall-related genes, 18 chlorophyll and carotenoid metabolism-related genes, four proteinases and their inhibitors, six plant hormone signal transduction pathway genes, four transcription factors, and one senescence-associated gene. Reverse transcription quantitative PCR (RT-qPCR) analyses confirmed the results of RNA-seq and verified that the expression pattern of six genes is consistent with the fruit senescence process. Based on the expression profiling of genes in carbohydrate metabolic process, chlorophyll metabolism pathway, and carotenoid metabolism pathway, the mechanism of pulp softening and coloration of papaya was deduced and discussed. We illustrate that papaya fruit softening is a complex process with significant cell wall hydrolases, such as pectinases, cellulases, and hemicellulases involved in the process. Exogenous ethylene accelerates the coloration of papaya changing from green to yellow. This is likely due to the inhibition of chlorophyll biosynthesis and the α-branch of carotenoid metabolism. Chy-b may play an important role in the yellow color of papaya
Characterization of Two Cysteine Transfer RNA Genes from Xenopus Laevis
1984-07-12
containing amino acids glycine, alanine and serine, are produced by the posterior silk gland of Bombyx mori and therefore high level of tRNAgly, tRNA^Ia...1979) Studies on tRNA adaptation, tRNA turnover, precursor tRNA and tRNA gene distribution in Bombyx mori by using two-dimensional polyacrylamlde gel...Nucleic Acids Research, 1^, 8537-8546. 26. Garber, R.L. and Gage, L.P. (1979) Transcription of a cloned Bombyx mori tRNA^2 gene: Nucleotide sequence of
Wu, Bolin; Liang, Xitian; Jing, Hui; Han, Xue; Sun, Yixin; Guo, Cunli; Liu, Ying; Cheng, Wen
2018-01-01
The present study evaluated the effect of NET-1 siRNA-conjugated sub-micron bubble (SMB) complexes combined with low-frequency ultrasound exposure in gene transfection. The NET-1 gene was highly expressed level in SMMC-7721 human hepatocellular carcinoma cell line. The cells were divided into seven groups and treated with different conditions. The groups with or without low-frequency ultrasound exposure, groups of adherent cells, and suspension cells were separated. The NET-1 siRNA-conjugated SMB complexes were made in the laboratory and tested by Zetasizer Nano ZS90 analyzer. Flow cytometry was used to estimate the transfection efficiency and cellular apoptosis. Western blot and quantitative real-time polymerase chain reaction (qPCR) were used for the estimation of the protein and mRNA expressions, respectively. Transwell analysis determined the migration and invasion capacities of the tumor cells. The results did not show any difference in the transfection efficiency between adherent and suspension cells. However, the NET-1 siRNA-SMB complexes combined with low-frequency ultrasound exposure could enhance the gene transfection effectively. In summary, the NET-1 siRNA-SMB complexes appeared to be promising gene vehicle. PMID:29423111
Weber, Barbara; Lindell, Kristoffer; El Qaidi, Samir; Hjerde, Erik; Willassen, Nils-Peder
2011-01-01
Vibrio anguillarum utilizes quorum sensing to regulate stress responses required for survival in the aquatic environment. Like other Vibrio species, V. anguillarum contains the gene qrr1, which encodes the ancestral quorum regulatory RNA Qrr1, and phosphorelay quorum-sensing systems that modulate the expression of small regulatory RNAs (sRNAs) that destabilize mRNA encoding the transcriptional regulator VanT. In this study, three additional Qrr sRNAs were identified. All four sRNAs were positively regulated by σ54 and the σ54-dependent response regulator VanO, and showed a redundant activity. The Qrr sRNAs, together with the RNA chaperone Hfq, destabilized vanT mRNA and modulated expression of VanT-regulated genes. Unexpectedly, expression of all four qrr genes peaked at high cell density, and exogenously added N-acylhomoserine lactone molecules induced expression of the qrr genes at low cell density. The phosphotransferase VanU, which phosphorylates and activates VanO, repressed expression of the Qrr sRNAs and stabilized vanT mRNA. A model is presented proposing that VanU acts as a branch point, aiding cross-regulation between two independent phosphorelay systems that activate or repress expression of the Qrr sRNAs, giving flexibility and precision in modulating VanT expression and inducing a quorum-sensing response to stresses found in a constantly changing aquatic environment. PMID:21948044
Weber, Barbara; Lindell, Kristoffer; El Qaidi, Samir; Hjerde, Erik; Willassen, Nils-Peder; Milton, Debra L
2011-12-01
Vibrio anguillarum utilizes quorum sensing to regulate stress responses required for survival in the aquatic environment. Like other Vibrio species, V. anguillarum contains the gene qrr1, which encodes the ancestral quorum regulatory RNA Qrr1, and phosphorelay quorum-sensing systems that modulate the expression of small regulatory RNAs (sRNAs) that destabilize mRNA encoding the transcriptional regulator VanT. In this study, three additional Qrr sRNAs were identified. All four sRNAs were positively regulated by σ(54) and the σ(54)-dependent response regulator VanO, and showed a redundant activity. The Qrr sRNAs, together with the RNA chaperone Hfq, destabilized vanT mRNA and modulated expression of VanT-regulated genes. Unexpectedly, expression of all four qrr genes peaked at high cell density, and exogenously added N-acylhomoserine lactone molecules induced expression of the qrr genes at low cell density. The phosphotransferase VanU, which phosphorylates and activates VanO, repressed expression of the Qrr sRNAs and stabilized vanT mRNA. A model is presented proposing that VanU acts as a branch point, aiding cross-regulation between two independent phosphorelay systems that activate or repress expression of the Qrr sRNAs, giving flexibility and precision in modulating VanT expression and inducing a quorum-sensing response to stresses found in a constantly changing aquatic environment.
Rapid evolution of RNA editing sites in a small non-essential plastid gene
Fiebig, Andreas; Stegemann, Sandra; Bock, Ralph
2004-01-01
Chloroplast RNA editing proceeds by C-to-U transitions at highly specific sites. Here, we provide a phylogenetic analysis of RNA editing in a small plastid gene, petL, encoding subunit VI of the cytochrome b6f complex. Analyzing representatives from most major groups of seed plants, we find an unexpectedly high frequency and dynamics of RNA editing. High-frequency editing has previously been observed in plastid ndh genes, which are remarkable in that their mutational inactivation does not produce an obvious mutant phenotype. In order to test the idea that reduced functional constraints allow for more flexible evolution of RNA editing sites, we have created petL knockout plants by tobacco chloroplast transformation. We find that, in the higher plant tobacco, targeted inactivation of petL does not impair plant growth under a variety of conditions markedly contrasting the important role of petL in photosynthesis in the green alga Chlamydomonas reinhardtii. Together with a low number of editing sites in plastid genes that are essential to gene expression and photosynthetic activity, these data suggest that RNA editing sites may evolve more readily in those genes whose transitory loss of function can be tolerated. Accumulated evidence for this ‘relative neutrality hypothesis for the evolution of plastid editing sites’ is discussed. PMID:15240834
In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.
Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj
2014-12-01
Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.
Hunter, Lydia J. R.; Brockington, Samuel F.; Murphy, Alex M.; Pate, Adrienne E.; Gruden, Kristina; MacFarlane, Stuart A.; Palukaitis, Peter; Carr, John P.
2016-01-01
Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7. PMID:26979928
Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P
2016-03-16
Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7.
Downregulation of HIF-1a sensitizes U251 glioma cells to the temozolomide (TMZ) treatment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Jun-Hai; Ma, Zhi-Xiong; Huang, Guo-Hao
Purpose: The aim of this study was to investigate the effect of downregulation of HIF-1α gene on human U251 glioma cells and examine the consequent changes of TMZ induced effects and explore the molecular mechanisms. Methods: U251 cell line stably expressing HIF-1α shRNA was acquired via lentiviral vector transfection. The mRNA and protein expression alterations of genes involved in our study were determined respectively by qRT-PCR and Western blot. Cell proliferation was measured by MTT assay and colony formation assay, cell invasion/migration capacity was determined by transwell invasion assay/wound healing assay, and cell apoptosis was detected by flow cytometry. Results:more » We successfully established a U251 cell line with highly efficient HIF-1α knockdown. HIF-1a downregulation sensitized U251 cells to TMZ treatment and enhanced the proliferation-inhibiting, invasion/migration-suppressing, apoptosis-inducing and differentiation-promoting effects exerted by TMZ. The related molecular mechanisms demonstrated that expression of O{sup 6}-methylguanine DNA methyltransferase gene (MGMT) and genes of Notch1 pathway were significantly upregulated by TMZ treatment. However, this upregulation was abrogated by HIF-1α knockdown. We further confirmed important regulatory roles of HIF-1α in the expression of MGMT and activation of Notch1 pathways. Conclusion: HIF-1α downregulation sensitizes U251 glioma cells to the temozolomide treatment via inhibiting MGMT expression and Notch1 pathway activation. - Highlights: • TMZ caused more significant proliferation inhibition and apoptosis in U251 cells after downregulating HIF-1α. • Under TMZ treatment, HIF-1 downregulated U251 cells exhibited weaker mobility and more differentiated state. • TMZ caused MGMT over-expression and Notch1 pathway activation, which could be abrogated by HIF-1α downregulation.« less
He, Peng; Huang, Sheng; Xiao, Guanghui; Zhang, Yuzhou; Yu, Jianing
2016-12-01
RNA editing is a posttranscriptional modification process that alters the RNA sequence so that it deviates from the genomic DNA sequence. RNA editing mainly occurs in chloroplasts and mitochondrial genomes, and the number of editing sites varies in terrestrial plants. Why and how RNA editing systems evolved remains a mystery. Ginkgo biloba is one of the oldest seed plants and has an important evolutionary position. Determining the patterns and distribution of RNA editing in the ancient plant provides insights into the evolutionary trend of RNA editing, and helping us to further understand their biological significance. In this paper, we investigated 82 protein-coding genes in the chloroplast genome of G. biloba and identified 255 editing sites, which is the highest number of RNA editing events reported in a gymnosperm. All of the editing sites were C-to-U conversions, which mainly occurred in the second codon position, biased towards to the U_A context, and caused an increase in hydrophobic amino acids. RNA editing could change the secondary structures of 82 proteins, and create or eliminate a transmembrane region in five proteins as determined in silico. Finally, the evolutionary tendencies of RNA editing in different gene groups were estimated using the nonsynonymous-synonymous substitution rate selection mode. The G. biloba chloroplast genome possesses the highest number of RNA editing events reported so far in a seed plant. Most of the RNA editing sites can restore amino acid conservation, increase hydrophobicity, and even influence protein structures. Similar purifying selections constitute the dominant evolutionary force at the editing sites of essential genes, such as the psa, some psb and pet groups, and a positive selection occurred in the editing sites of nonessential genes, such as most ndh and a few psb genes.
Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum
2013-01-01
Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is a powerful technique to understand gene function, particularly when gene knockouts are difficult to obtain. We investigated whether the plant pathogenic fungus Fusarium oxysporum possesses a functional gene silencing machinery and whether hairpin RNA transcripts can be employed to effectively induce gene silencing. Results Here we show that, in the phytopathogenic fungus F. oxysporum, hpRNA transgenes targeting either a β-glucuronidase (Gus) reporter transgene (hpGus) or the endogenous gene Frp1 (hpFrp) did not induce significant silencing of the target genes. Expression analysis suggested that the hpRNA transgenes are prone to transcriptional inactivation, resulting in low levels of hpRNA and siRNA production. However, the hpGus RNA can be efficiently transcribed by promoters acquired either by recombination with a pre-existing, actively transcribed Gus transgene or by fortuitous integration near an endogenous gene promoter allowing siRNA production. These siRNAs effectively induced silencing of a target Gus transgene, which in turn appeared to also induce secondary siRNA production. Furthermore, our results suggested that hpRNA transcripts without poly(A) tails are efficiently processed into siRNAs to induce gene silencing. A convergent promoter transgene, designed to express poly(A)-minus sense and antisense Gus RNAs, without an inverted-repeat DNA structure, induced consistent Gus silencing in F. oxysporum. Conclusions These results indicate that F. oxysporum possesses
E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.
Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B
2017-01-01
Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.
Functional Cus1p Is Found with Hsh155p in a Multiprotein Splicing Factor Associated with U2 snRNA
Pauling, Michelle Haynes; McPheeters, David S.; Ares, Manuel
2000-01-01
To explore the dynamics of snRNP structure and function, we have studied Cus1p, identified as a suppressor of U2 snRNA mutations in budding yeast. Cus1p is homologous to human SAP145, a protein present in the 17S form of the human U2 snRNP. Here, we define the Cus1p amino acids required for function in yeast. The segment of Cus1p required for binding to Hsh49p, a homolog of human SAP49, is contained within an essential region of Cus1p. Antibodies against Cus1p coimmunoprecipitate U2 snRNA, as well as Hsh155p, a protein homologous to human SAP155. Biochemical fractionation of splicing extracts and reconstitution of heat-inactivated splicing extracts from strains carrying a temperature-sensitive allele of CUS1 indicate that Cus1p and Hsh155p reside in a functional, high-salt-stable complex that is salt-dissociable from U2 snRNA. We propose that Cus1p, Hsh49p, and Hsh155p exist in a stable protein complex which can exchange with a core U2 snRNP and which is necessary for U2 snRNP function in prespliceosome assembly. The Cus1p complex shares functional as well as structural similarities with human SF3b. PMID:10688664
Angeloni, Debora; ter Elst, Arja; Wei, Ming Hui; van der Veen, Anneke Y; Braga, Eleonora A; Klimov, Eugene A; Timmer, Tineke; Korobeinikova, Luba; Lerman, Michael I; Buys, Charles H C M
2006-07-01
Homozygous deletions or loss of heterozygosity (LOH) at human chromosome band 3p12 are consistent features of lung and other malignancies, suggesting the presence of a tumor suppressor gene(s) (TSG) at this location. Only one gene has been cloned thus far from the overlapping region deleted in lung and breast cancer cell lines U2020, NCI H2198, and HCC38. It is DUTT1 (Deleted in U Twenty Twenty), also known as ROBO1, FLJ21882, and SAX3, according to HUGO. DUTT1, the human ortholog of the fly gene ROBO, has homology with NCAM proteins. Extensive analyses of DUTT1 in lung cancer have not revealed any mutations, suggesting that another gene(s) at this location could be of importance in lung cancer initiation and progression. Here, we report the discovery of a new, small, homozygous deletion in the small cell lung cancer (SCLC) cell line GLC20, nested in the overlapping, critical region. The deletion was delineated using several polymorphic markers and three overlapping P1 phage clones. Fiber-FISH experiments revealed the deletion was approximately 130 kb. Comparative genomic sequence analysis uncovered short sequence elements highly conserved among mammalian genomes and the chicken genome. The discovery of two EST clusters within the deleted region led to the isolation of two noncoding RNA (ncRNA) genes. These were subsequently found differentially expressed in various tumors when compared to their normal tissues. The ncRNA and other highly conserved sequence elements in the deleted region may represent miRNA targets of importance in cancer initiation or progression. Published 2006 Wiley-Liss, Inc.
RNA Editing Genes Associated with Extreme Old Age in Humans and with Lifespan in C. elegans
Puca, Annibale; Solovieff, Nadia; Kojima, Toshio; Wang, Meng C.; Melista, Efthymia; Meltzer, Micah; Fischer, Sylvia E. J.; Andersen, Stacy; Hartley, Stephen H.; Sedgewick, Amanda; Arai, Yasumichi; Bergman, Aviv; Barzilai, Nir; Terry, Dellara F.; Riva, Alberto; Anselmi, Chiara Viviani; Malovini, Alberto; Kitamoto, Aya; Sawabe, Motoji; Arai, Tomio; Gondo, Yasuyuki; Steinberg, Martin H.; Hirose, Nobuyoshi; Atzmon, Gil; Ruvkun, Gary; Baldwin, Clinton T.; Perls, Thomas T.
2009-01-01
Background The strong familiality of living to extreme ages suggests that human longevity is genetically regulated. The majority of genes found thus far to be associated with longevity primarily function in lipoprotein metabolism and insulin/IGF-1 signaling. There are likely many more genetic modifiers of human longevity that remain to be discovered. Methodology/Principal Findings Here, we first show that 18 single nucleotide polymorphisms (SNPs) in the RNA editing genes ADARB1 and ADARB2 are associated with extreme old age in a U.S. based study of centenarians, the New England Centenarian Study. We describe replications of these findings in three independently conducted centenarian studies with different genetic backgrounds (Italian, Ashkenazi Jewish and Japanese) that collectively support an association of ADARB1 and ADARB2 with longevity. Some SNPs in ADARB2 replicate consistently in the four populations and suggest a strong effect that is independent of the different genetic backgrounds and environments. To evaluate the functional association of these genes with lifespan, we demonstrate that inactivation of their orthologues adr-1 and adr-2 in C. elegans reduces median survival by 50%. We further demonstrate that inactivation of the argonaute gene, rde-1, a critical regulator of RNA interference, completely restores lifespan to normal levels in the context of adr-1 and adr-2 loss of function. Conclusions/Significance Our results suggest that RNA editors may be an important regulator of aging in humans and that, when evaluated in C. elegans, this pathway may interact with the RNA interference machinery to regulate lifespan. PMID:20011587
Doan, Ninh B; Nguyen, Ha S; Alhajala, Hisham S; Jaber, Basem; Al-Gizawiy, Mona M; Ahn, Eun-Young Erin; Mueller, Wade M; Chitambar, Christopher R; Mirza, Shama P; Schmainda, Kathleen M
2018-05-04
The absence of major progress in the treatment of glioblastoma (GBM) is partly attributable to our poor understanding of both GBM tumor biology and the acquirement of treatment resistance in recurrent GBMs. Recurrent GBMs are characterized by their resistance to radiation. In this study, we used an established stable U87 radioresistant GBM model and total RNA sequencing to shed light on global mRNA expression changes following irradiation. We identified many genes, the expressions of which were altered in our radioresistant GBM model, that have never before been reported to be associated with the development of radioresistant GBM and should be concertedly further investigated to understand their roles in radioresistance. These genes were enriched in various biological processes such as inflammatory response, cell migration, positive regulation of epithelial to mesenchymal transition, angiogenesis, apoptosis, positive regulation of T-cell migration, positive regulation of macrophage chemotaxis, T-cell antigen processing and presentation, and microglial cell activation involved in immune response genes. These findings furnish crucial information for elucidating the molecular mechanisms associated with radioresistance in GBM. Therapeutically, with the global alterations of multiple biological pathways observed in irradiated GBM cells, an effective GBM therapy may require a cocktail carrying multiple agents targeting multiple implicated pathways in order to have a chance at making a substantial impact on improving the overall GBM survival.
Segerstolpe, Asa; Lundkvist, Pär; Osheim, Yvonne N; Beyer, Ann L; Wieslander, Lars
2008-08-01
In Saccharomyces cerevisiae, synthesis of the small ribosomal subunit requires assembly of the 35S pre-rRNA into a 90S preribosomal complex. SnoRNAs, including U3 snoRNA, and many trans-acting proteins are required for the ordered assembly and function of the 90S preribosomal complex. Here, we show that the conserved protein Mrd1p binds to the pre-rRNA early during transcription and is required for compaction of the pre-18S rRNA into SSU processome particles. We have exploited the fact that an Mrd1p-GFP fusion protein is incorporated into the 90S preribosomal complex, where it acts as a partial loss-of-function mutation. When associated with the pre-rRNA, Mrd1p-GFP functionally interacts with the essential Pwp2, Mpp10 and U3 snoRNP subcomplexes that are functionally interconnected in the 90S preribosomal complex. The fusion protein can partially support 90S preribosome-mediated cleavages at the A(0)-A(2) sites. At the same time, on a substantial fraction of transcripts, the composition and/or structure of the 90S preribosomal complex is perturbed by the fusion protein in such a way that cleavage of the 35S pre-rRNA is either blocked or shifted to aberrant sites. These results show that Mrd1p is required for establishing productive structures within the 90S preribosomal complex.
LeBlanc, Jason; Weil, Jason; Beemon, Karen
2013-01-01
After reverse transcription of the retroviral RNA genome and integration of the DNA provirus into the host genome, host machinery is used for viral gene expression along with viral proteins and RNA regulatory elements. Here, we discuss co-transcriptional and posttranscriptional regulation of retroviral gene expression, comparing simple and complex retroviruses. Cellular RNA polymerase II synthesizes full-length viral primary RNA transcripts that are capped and polyadenylated. All retroviruses generate a singly spliced env mRNA from this primary transcript, which encodes the viral glycoproteins. In addition, complex viral RNAs are alternatively spliced to generate accessory proteins, such as Rev, which is involved in posttranscriptional regulation of HIV-1 RNA. Importantly, the splicing of all retroviruses is incomplete; they must maintain and export a fraction of their primary RNA transcripts. This unspliced RNA functions both as the major mRNA for Gag and Pol proteins and as the packaged genomic RNA. Different retroviruses export their unspliced viral RNA from the nucleus to the cytoplasm by either Tap-dependent or Rev/CRM1-dependent routes. Translation of the unspliced mRNA involves frame-shifting or termination codon suppression so that the Gag proteins, which make up the capsid, are expressed more abundantly than the Pol proteins, which are the viral enzymes. After the viral polyproteins assemble into viral particles and bud from the cell membrane, a viral encoded protease cleaves them. Some retroviruses have evolved mechanisms to protect their unspliced RNA from decay by nonsense-mediated RNA decay and to prevent genome editing by the cellular APOBEC deaminases. PMID:23754689
Mechanism of Tumor Metastasis Suppression by the KAI1 Gene
2008-02-01
CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT U b . ABSTRACT U c. THIS...activated by the interaction of DARC and Kai1. Task1- b . (completed) Examine the effects of siRNA against the DARC gene on the binding and...suggesting that the N terminus of DARC is essential for binding to KAI1. Task 2- b . Screening a phage display library followed by sequencing the
Williams, Kelly P.
2003-01-01
A partial screen for genetic elements integrated into completely sequenced bacterial genomes shows more significant bias in specificity for the tmRNA gene (ssrA) than for any type of tRNA gene. Horizontal gene transfer, a major avenue of bacterial evolution, was assessed by focusing on elements using this single attachment locus. Diverse elements use ssrA; among enterobacteria alone, at least four different integrase subfamilies have independently evolved specificity for ssrA, and almost every strain analyzed presents a unique set of integrated elements. Even elements using essentially the same integrase can be very diverse, as is a group with an ssrA-specific integrase of the P4 subfamily. This same integrase appears to promote damage routinely at attachment sites, which may be adaptive. Elements in arrays can recombine; one such event mediated by invertible DNA segments within neighboring elements likely explains the monophasic nature of Salmonella enterica serovar Typhi. One of a limited set of conserved sequences occurs at the attachment site of each enterobacterial element, apparently serving as a transcriptional terminator for ssrA. Elements were usually found integrated into tRNA-like sequence at the 3′ end of ssrA, at subsites corresponding to those used in tRNA genes; an exception was found at the non-tRNA-like 3′ end produced by ssrA gene permutation in cyanobacteria, suggesting that, during the evolution of new site specificity by integrases, tropism toward a conserved 3′ end of an RNA gene may be as strong as toward a tRNA-like sequence. The proximity of ssrA and smpB, which act in concert, was also surveyed. PMID:12533482
Wieben, E D; Nenninger, J M; Pederson, T
1985-05-05
Biosynthetic precursors of U2 small nuclear RNA have been identified in cultured human cells by hybrid-selection of pulse-labeled RNA with cloned U2 DNA. These precursor molecules are one to approximately 16 nucleotides longer than mature U2 RNA and contain 2,2,7-trimethylguanosine "caps". The U2 RNA precursors are associated with proteins that react with a monoclonal antibody for antigens characteristic of small nuclear ribonucleoprotein particles. Like previously described precursors of U1 and U4 small nuclear RNAs, the pre-U2 RNAs are recovered in cytoplasmic fractions, although it is not known if this is their location in vivo. The precursors are processed to mature-size U2 RNA when cytoplasmic extracts are incubated in vitro at 37 degrees C. Mg2+ is required but ATP is not. The ribonucleoprotein structure of the pre-U2 RNA is maintained during the processing reaction in vitro, as are the 2,2,7-trimethylguanosine caps. The ribonucleoprotein organization is of major importance, as exogenous, protein-free U2 RNA precursors are degraded rapidly in the in vitro system. Two lines of evidence indicate that the conversion of U2 precursors to mature-size U2 RNA involves a 3' processing reaction. First, the reaction is unaffected by a large excess of mature U2 small nuclear RNP, whose 5' trimethylguanosine caps would be expected to compete for a 5' processing activity. Second, when pre-U2 RNA precursors are first stoichiometrically decorated with an antibody specific for 2,2,7-trimethylguanosine, the extent of subsequent processing in vitro is unaffected. These results provide the first demonstration of a eukaryotic RNA processing reaction in vitro occurring within a ribonucleoprotein particle.
Kralovicova, Jana; Knut, Marcin; Cross, Nicholas C. P.; Vorechovsky, Igor
2015-01-01
The auxiliary factor of U2 small nuclear RNA (U2AF) is a heterodimer consisting of 65- and 35-kD proteins that bind the polypyrimidine tract (PPT) and AG dinucleotides at the 3′ splice site (3′ss). The gene encoding U2AF35 (U2AF1) is alternatively spliced, giving rise to two isoforms U2AF35a and U2AF35b. Here, we knocked down U2AF35 and each isoform and characterized transcriptomes of HEK293 cells with varying U2AF35/U2AF65 and U2AF35a/b ratios. Depletion of both isoforms preferentially modified alternative RNA processing events without widespread failure to recognize 3′ss or constitutive exons. Over a third of differentially used exons were terminal, resulting largely from the use of known alternative polyadenylation (APA) sites. Intronic APA sites activated in depleted cultures were mostly proximal whereas tandem 3′UTR APA was biased toward distal sites. Exons upregulated in depleted cells were preceded by longer AG exclusion zones and PPTs than downregulated or control exons and were largely activated by PUF60 and repressed by CAPERα. The U2AF(35) repression and activation was associated with a significant interchange in the average probabilities to form single-stranded RNA in the optimal PPT and branch site locations and sequences further upstream. Although most differentially used exons were responsive to both U2AF subunits and their inclusion correlated with U2AF levels, a small number of transcripts exhibited distinct responses to U2AF35a and U2AF35b, supporting the existence of isoform-specific interactions. These results provide new insights into function of U2AF and U2AF35 in alternative RNA processing. PMID:25779042
Zhang, Jiu-Li; Xu, Bo; Huang, Xiao-Dan; Gao, Yu-Hong; Chen, Yu; Shan, An-Shan
2016-05-01
The aim of this study was to investigate the influence of Se deficiency on the transcription of inflammatory factors and selenoprotein genes in the kidneys of broiler chicks. One hundred fifty 1-day-old broiler chicks were randomly assigned to two groups fed with either a low-Se diet (L group, 0.033 mg/kg Se) or an adequate Se diet (C group, 0.2 mg/kg Se). The levels of uric acid (UA) and creatinine (Cr) in the serum and the mRNA levels of 6 inflammatory factors and 25 selenoprotein genes in the kidneys were measured as the clinical signs of Se deficiency occurred at 20 days old. The results indicated that the contents of UA and Cr in the serum increased in L group (p < 0.05), and the mRNA levels of the inflammatory factors (NF-κB, iNOS, COX-2, and TNF-α) increased in L group (p < 0.05). Meanwhile, the mRNA levels of PTGEs and HO-1 were not changed. In addition, 25 selenoprotein transcripts displayed ubiquitous expression in the kidneys of the chicks. The mRNA levels of 14 selenoprotein genes (Dio1, Dio2, GPx3, Sepp1, SelH, SelI, SelK, Sepn1, SelO, SelW, Sep15, SelT, SelU, and SelS) decreased, and 9 selenoprotein genes (GPx1, GPx2, GPx4, SelPb, Txnrd1, Txnrd2, Txnrd3, SPS2, and SelM) increased in L group (p < 0.05), but the Dio3 and Sepx1 mRNA levels did not change. The results indicated that Se deficiency resulted in kidney dysfunction, activation of the NF-κB pathway, and a change in selenoprotein gene expression. The changes of inflammatory factor and selenoprotein gene expression levels were directly related to the abnormal renal functions induced by Se deficiency.
The recruitment of the U5 snRNP to nascent transcripts requires internal loop 1 of U5 snRNA.
Kim, Rebecca; Paschedag, Joshua; Novikova, Natalya; Bellini, Michel
2012-12-01
In this study, we take advantage of the high spatial resolution offered by the nucleus and lampbrush chromosomes of the amphibian oocyte to investigate the mechanisms that regulate the intranuclear trafficking of the U5 snRNP and its recruitment to nascent transcripts. We monitor the fate of newly assembled fluorescent U5 snRNP in Xenopus oocytes depleted of U4 and/or U6 snRNAs and demonstrate that the U4/U6.U5 tri-snRNP is not required for the association of U5 snRNP with Cajal bodies, splicing speckles, and nascent transcripts. In addition, using a mutational analysis, we show that a non-functional U5 snRNP can associate with nascent transcripts, and we further characterize internal loop structure 1 of U5 snRNA as a critical element for licensing U5 snRNP to target both nascent transcripts and splicing speckles. Collectively, our data support the model where the recruitment of snRNPs onto pre-mRNAs is independent of spliceosome assembly and suggest that U5 snRNP may promote the association of the U4/U6.U5 tri-snRNP with nascent transcripts.
Plant U13 orthologues and orphan snoRNAs identified by RNomics of RNA from Arabidopsis nucleoli
Kim, Sang Hyon; Spensley, Mark; Choi, Seung Kook; Calixto, Cristiane P. G.; Pendle, Ali F.; Koroleva, Olga; Shaw, Peter J.; Brown, John W. S.
2010-01-01
Small nucleolar RNAs (snoRNAs) and small Cajal body-specific RNAs (scaRNAs) are non-coding RNAs whose main function in eukaryotes is to guide the modification of nucleotides in ribosomal and spliceosomal small nuclear RNAs, respectively. Full-length sequences of Arabidopsis snoRNAs and scaRNAs have been obtained from cDNA libraries of capped and uncapped small RNAs using RNA from isolated nucleoli from Arabidopsis cell cultures. We have identified 31 novel snoRNA genes (9 box C/D and 22 box H/ACA) and 15 new variants of previously described snoRNAs. Three related capped snoRNAs with a distinct gene organization and structure were identified as orthologues of animal U13snoRNAs. In addition, eight of the novel genes had no complementarity to rRNAs or snRNAs and are therefore putative orphan snoRNAs potentially reflecting wider functions for these RNAs. The nucleolar localization of a number of the snoRNAs and the localization to nuclear bodies of two putative scaRNAs was confirmed by in situ hybridization. The majority of the novel snoRNA genes were found in new gene clusters or as part of previously described clusters. These results expand the repertoire of Arabidopsis snoRNAs to 188 snoRNA genes with 294 gene variants. PMID:20081206
Deng, Changwang; Li, Ying; Zhou, Lei; Cho, Joonseok; Patel, Bhavita; Terada, Nao; Li, Yangqiu; Bungert, Jörg; Qiu, Yi; Huang, Suming
2015-01-01
Summary Trithorax proteins and long-intergenic noncoding RNAs are critical regulators of embryonic stem cell pluripotency; however, how they cooperatively regulate germ layer mesoderm specification remains elusive. We report here that HoxBlinc RNA first specifies Flk1+ mesoderm and then promotes hematopoietic differentiation through regulating hoxb gene pathways. HoxBlinc binds to the hoxb genes, recruits Setd1a/MLL1 complexes, and mediates long-range chromatin interactions to activate transcription of the hoxb genes. Depletion of HoxBlinc by shRNA-mediated KD or CRISPR-Cas9-mediated genetic deletion inhibits expression of hoxb genes and other factors regulating cardiac/hematopoietic differentiation. Reduced hoxb gene expression is accompanied by decreased recruitment of Set1/MLL1 and H3K4me3 modification, as well as by reduced chromatin loop formation. Re-expression of hoxb2-b4 genes in HoxBlinc-depleted embryoid bodies rescues Flk1+ precursors that undergo hematopoietic differentiation. Thus, HoxBlinc plays an important role in controlling hoxb transcription networks that mediate specification of mesoderm-derived Flk1+ precursors and differentiation of Flk1+ cells into hematopoietic lineages. PMID:26725110
Curcumin may serve an anticancer role in human osteosarcoma cell line U-2 OS by targeting ITPR1.
Luo, Zhanpeng; Li, Dawei; Luo, Xiaobo; Li, Litao; Gu, Suxi; Yu, Long; Ma, Yuanzheng
2018-04-01
The present study aimed to determine the mechanisms of action of curcumin in osteosarcoma. Human osteosarcoma U-2 OS cells was purchased from the Cell Bank of the Chinese Academy of Sciences. RNA sequencing analysis was performed for 2 curcumin-treated samples and 2 control samples using Illumina deep sequencing technology. The differentially expressed genes were identified using Cufflink software. Enrichment and protein-protein interaction network analyses were performed separately using cluster Profiler package and Cytoscape software to identify key genes. Then, the mRNA levels of key genes were detected by quantitative reverse transcription polymerase chain reaction (RT-qPCR) in U-2 OS cells. Finally, cell apoptosis, proliferation, migration and invasion arrays were performed. In total, 201 DEGs were identified in the curcumin-treated group. EEF1A1 (degree=88), ATF7IP, HIF1A, SMAD7, CLTC, MCM10, ITPR1, ADAM15, WWP2 and ATP5C1, which were enriched in 'biological process', exhibited higher degrees than other genes in the PPI network. RT-qPCR demonstrated that treatment with curcumin was able to significantly increase the levels of CLTC and ITPR1 mRNA in curcumin-treated cells compared with control. In addition, targeting ITPR1 with curcumin significantly promoted apoptosis and suppressed proliferation, migration and invasion. Targeting ITPR1 via curcumin may serve an anticancer role by mediating apoptosis, proliferation, migration and invasion in U-2 OS cells.
Kim, Dongkyu; Ku, Sook Hee; Kim, Hyosuk; Jeong, Ji Hoon; Lee, Minhyung; Kwon, Ick Chan; Choi, Donghoon; Kim, Sun Hwa
2016-12-10
Gene therapy is aimed at selectively knocking up or knocking down the target genes involved in the development of diseases. In many human diseases, dysregulation of disease-associated genes is occurred concurrently: some genes are abnormally turned up and some are turned down. In the field of non-viral gene therapy, plasmid DNA (pDNA) and small interfering RNA (siRNA) are suggested as representative regulation tools for activating and silencing the expression of genes of interest, representatively. Herein, we simultaneously loaded both siRNA (Src homology region 2 domain-containing tyrosine phosphatase-1 siRNA, siSHP-1) for anti-apoptosis and pDNA (hypoxia-inducible vascular endothelial growth factor expression vector, pHI-VEGF) for angiogenesis in a single polymeric nanocarrier and used to synergistically attenuate ischemia-reperfusion (IR)-induced myocardial infarction, which is mainly caused by dysregulating of cardiac apoptosis and angiogenesis. For dual-modality cardiac gene delivery, siSHP-1 and pHI-VEGF were sequentially incorporated into a stable nanocomplex by using deoxycholic acid-modified polyethylenimine (DA-PEI). The resulting DA-PEI/siSHP-1/pHI-VEGF complexes exhibited the high structural stability against polyanion competition and the improved resistance to digestion by nucleases. The cardiac administration of DA-PEI/siSHP-1/pHI-VEGF reduced cardiomyocyte apoptosis and enhanced cardiac microvessel formation, thereby reducing infarct size in rat ischemia-reperfusion model. The simultaneous anti-apoptotic and angiogenic gene therapies synergized the cardioprotective effects of each strategy; thus our dual-modal single-carrier gene delivery system can be considered as a promising candidate for treating ischemic heart diseases. Copyright © 2016 Elsevier B.V. All rights reserved.
Goraczniak, Rafal; Wall, Brian A; Behlke, Mark A; Lennox, Kim A; Ho, Eric S; Zaphiros, Nikolas H; Jakubowski, Christopher; Patel, Neil R; Zhao, Steven; Magaway, Carlo; Subbie, Stacey A; Jenny Yu, Lumeng; LaCava, Stephanie; Reuhl, Kenneth R; Chen, Suzie; Gunderson, Samuel I
2013-01-01
U1 Adaptor is a recently discovered oligonucleotide-based gene-silencing technology with a unique mechanism of action that targets nuclear pre-mRNA processing. U1 Adaptors have two distinct functional domains, both of which must be present on the same oligonucleotide to exert their gene-silencing function. Here, we present the first in vivo use of U1 Adaptors by targeting two different human genes implicated in melanomagenesis, B-cell lymphoma 2 (BCL2) and metabotropic glutamate receptor 1 (GRM1), in a human melanoma cell xenograft mouse model system. Using a newly developed dendrimer delivery system, anti-BCL2 U1 Adaptors were very potent and suppressed tumor growth at doses as low as 34 µg/kg with twice weekly intravenous (iv) administration. Anti-GRM1 U1 Adaptors suppressed tumor xenograft growth with similar potency. Mechanism of action was demonstrated by showing target gene suppression in tumors and by observing that negative control U1 Adaptors with just one functional domain show no tumor suppression activity. The anti-BCL2 and anti-GRM1 treatments were equally effective against cell lines harboring either wild-type or a mutant V600E B-RAF allele, the most common mutation in melanoma. Treatment of normal immune-competent mice (C57BL6) indicated no organ toxicity or immune stimulation. These proof-of-concept studies represent an in-depth (over 800 mice in ~108 treatment groups) validation that U1 Adaptors are a highly potent gene-silencing therapeutic and open the way for their further development to treat other human diseases. PMID:23673539
Athanasiadis, Alekos; Galeano, Federica; Locatelli, Franco; Bertini, Enrico; Zanni, Ginevra; Gallo, Angela
2014-01-01
Oligophrenin-1 (OPHN1) encodes for a Rho-GTPase-activating protein, important for dendritic morphogenesis and synaptic function. Mutations in this gene have been identified in patients with X-linked intellectual disability associated with cerebellar hypoplasia. ADAR enzymes are responsible for A-to-I RNA editing, an essential post-transcriptional RNA modification contributing to transcriptome and proteome diversification. Specifically, ADAR2 activity is essential for brain development and function. Herein, we show that the OPHN1 transcript undergoes post-transcriptional modifications such as A-to-I RNA editing and alternative splicing in human brain and other tissues. We found that OPHN1 editing is detectable already at the 18th week of gestation in human brain with a boost of editing at weeks 20 to 33, concomitantly with OPHN1 expression increase and the appearance of a novel OPHN1 splicing isoform. Our results demonstrate that multiple post-transcriptional events occur on OPHN1, a gene playing an important role in brain function and development. PMID:24637888
Barresi, Sabina; Tomaselli, Sara; Athanasiadis, Alekos; Galeano, Federica; Locatelli, Franco; Bertini, Enrico; Zanni, Ginevra; Gallo, Angela
2014-01-01
Oligophrenin-1 (OPHN1) encodes for a Rho-GTPase-activating protein, important for dendritic morphogenesis and synaptic function. Mutations in this gene have been identified in patients with X-linked intellectual disability associated with cerebellar hypoplasia. ADAR enzymes are responsible for A-to-I RNA editing, an essential post-transcriptional RNA modification contributing to transcriptome and proteome diversification. Specifically, ADAR2 activity is essential for brain development and function. Herein, we show that the OPHN1 transcript undergoes post-transcriptional modifications such as A-to-I RNA editing and alternative splicing in human brain and other tissues. We found that OPHN1 editing is detectable already at the 18th week of gestation in human brain with a boost of editing at weeks 20 to 33, concomitantly with OPHN1 expression increase and the appearance of a novel OPHN1 splicing isoform. Our results demonstrate that multiple post-transcriptional events occur on OPHN1, a gene playing an important role in brain function and development.
Selection of reference genes for miRNA qRT-PCR under abiotic stress in grapevine.
Luo, Meng; Gao, Zhen; Li, Hui; Li, Qin; Zhang, Caixi; Xu, Wenping; Song, Shiren; Ma, Chao; Wang, Shiping
2018-03-13
Grapevine is among the fruit crops with high economic value, and because of the economic losses caused by abiotic stresses, the stress resistance of Vitis vinifera has become an increasingly important research area. Among the mechanisms responding to environmental stresses, the role of miRNA has received much attention recently. qRT-PCR is a powerful method for miRNA quantitation, but the accuracy of the method strongly depends on the appropriate reference genes. To determine the most suitable reference genes for grapevine miRNA qRT-PCR, 15 genes were chosen as candidate reference genes. After eliminating 6 candidate reference genes with unsatisfactory amplification efficiency, the expression stability of the remaining candidate reference genes under salinity, cold and drought was analysed using four algorithms, geNorm, NormFinder, deltaCt and Bestkeeper. The results indicated that U6 snRNA was the most suitable reference gene under salinity and cold stresses; whereas miR168 was the best for drought stress. The best reference gene sets for salinity, cold and drought stresses were miR160e + miR164a, miR160e + miR168 and ACT + UBQ + GAPDH, respectively. The selected reference genes or gene sets were verified using miR319 or miR408 as the target gene.
Yurova, K A; Sokhonevich, N A; Khaziakhmatova, O G; Litvinova, L S
2016-01-01
The dose-dependent effects of cytokines (IL-2, IL-7, and IL-15), which have a common g-chain, on mRNA expression of U2afll4 and GFi1 genes involved in regulation of alternative splicing of the Ptprc gene, have been investigated in vitro using T-lymphocyte cultures with different degrees of differentiation. IL-2, IL-7, and IL-15 caused a similar unidirectional inhibitory effect of various severity on restimulated CD45RO+ T-cells exposed to an antigen-independent activation; they caused a dose-dependent decrease of the U2af1l4 gene expression, and an increase of Gfi1 gene expression. This may suggest formation of active forms of the CD45 receptor, and also limitation of the formation of low-molecular short splice variants of the CD45RO receptor. Under conditions of antigen-independent stimulation of naive CD45RA+-cells rIL-7 and IL-15 exhibited opposite effects on U2af1l4 and Gfi1 gene expression. The increase of IL-7 concentrations in the incubation medium of naive cells was accompanied by a decrease in expression of both genes. IL-15 IL-7 exhibited opposite effects. Cytokines possessing a common g-chain (IL-2, IL-7, and IL-15) prevented antigen-independent differentiation of naive T-cells, by preventing the formation of polyclonal "surrogate" cells. In general, the study of the molecular mechanisms of genetic control determining homeostatic processes of T-cells in response to exposure to antigenic or non-antigenic treatments may be important for construction of a general model of self-maintenance and differentiation of immune cells.
Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology.
Sui, Weiguo; Shi, Zhoufang; Xue, Wen; Ou, Minglin; Zhu, Ying; Chen, Jiejing; Lin, Hua; Liu, Fuhua; Dai, Yong
2017-03-01
The aim of the present study was to screen gastric cancer (GC) tissue and adjacent tissue for differences in mRNA and circular (circRNA) expression, to analyze the differences in circRNA and mRNA expression, and to investigate the circRNA expression in gastric carcinoma and its mechanism. circRNA and mRNA differential expression profiles generated using Agilent microarray technology were analyzed in the GC tissues and adjacent tissues. qRT-PCR was used to verify the differential expression of circRNAs and mRNAs according to the interactions between circRNAs and miRNAs as well as the possible existence of miRNA and mRNA interactions. We found that: i) the circRNA expression profile revealed 1,285 significant differences in circRNA expression, with circRNA expression downregulated in 594 samples and upregulated in 691 samples via interactions with miRNAs. The qRT-PCR validation experiments showed that hsa_circRNA_400071, hsa_circRNA_000543 and hsa_circRNA_001959 expression was consistent with the microarray analysis results. ii) 29,112 genes were found in the GC tissues and adjacent tissues, including 5,460 differentially expressed genes. Among them, 2,390 differentially expressed genes were upregulated and 3,070 genes were downregulated. Gene Ontology (GO) analysis of the differentially expressed genes revealed these genes involved in biological process classification, cellular component classification and molecular function classification. Pathway analysis of the differentially expressed genes identified 83 significantly enriched genes, including 28 upregulated genes and 55 downregulated genes. iii) 69 differentially expressed circRNAs were found that might adsorb specific miRNAs to regulate the expression of their target gene mRNAs. The conclusions are: i) differentially expressed circRNAs had corresponding miRNA binding sites. These circRNAs regulated the expression of target genes through interactions with miRNAs and might become new molecular biomarkers for GC
Leygue, Etienne
2007-01-01
The steroid receptor RNA activator (SRA) is a unique modulator of steroid receptor transcriptional activity, as it is able to mediate its coregulatory effects as a RNA molecule. Recent findings, however, have painted a more complex picture of the SRA gene (SRA1) products. Indeed, even though SRA was initially thought to be noncoding, several RNA isoforms have now been found to encode an endogenous protein (SRAP), which is well conserved among Chordata. Although the function of SRAP remains largely unknown, it has been proposed that, much like its corresponding RNA, the protein itself might regulate estrogen and androgen receptor signaling pathways. As such, data suggest that both SRA and SRAP might participate in the mechanisms underlying breast, as well as prostate tumorigenesis. This review summarizes the published literature dealing with these two faces of the SRA gene products and underscores the relevance of this bifaceted system to breast cancer development. PMID:17710122
Zhao, Xiaodan; Yuan, Xinyu; Chen, Sha; Meng, Lanhuan; Fu, Daqi
2018-01-01
Fruit ripening is a complex biological process affecting fruit quality. In tomato the fruit ripening process is delicately regulated by transcription factors (TFs). Among these, the TOMATO AGAMOUS-LIKE 1 (TAGL1) gene plays an important role in both the development and ripening of fruit. In this study, the TAGL1 gene was successfully silenced by virus-induced gene silencing technology (VIGS), and the global gene expression and metabolites profiles of TAGL1-silenced fruits were analyzed by RNA-sequence analysis (RNA-seq) and liquid chromatography-mass spectrometry (LC-MS/MS). The TAGL1-silenced fruits phenotypically displayed an orange pericarp, which was in accordance with the results expected from the down-regulation of genes associated with carotenoid synthesis. Levels of several amino acids and organic acids were lower in the TAGL1-silenced fruits than in the wild-type fruits, whereas, α-tomatine content was greatly increased (more than 10-fold) in the TAGL1-silenced fruits compared to wild-type fruits. The findings of this study showed that TAGL1 not only regulates the ripening of tomato fruits, but also affects the synthesis and levels of nutrients in the fruit.
Regulatory BC1 RNA in Cognitive Control
ERIC Educational Resources Information Center
Iacoangeli, Anna; Dosunmu, Aderemi; Eom, Taesun; Stefanov, Dimitre G.; Tiedge, Henri
2017-01-01
Dendritic regulatory BC1 RNA is a non-protein-coding (npc) RNA that operates in the translational control of gene expression. The absence of BC1 RNA in BC1 knockout (KO) animals causes translational dysregulation that entails neuronal phenotypic alterations including prolonged epileptiform discharges, audiogenic seizure activity in vivo, and…
Circular RNA of cattle casein genes are highly expressed in bovine mammary gland.
Zhang, ChunLei; Wu, Hui; Wang, YanHong; Zhu, ShiQi; Liu, JunQiang; Fang, XingTang; Chen, Hong
2016-06-01
Recent studies have revealed that, in addition to hormones and other protein factors, noncoding RNA molecules play an important regulatory role in milk protein synthesis. Circular RNAs (circRNAs) are universally expressed noncoding RNA species that have been proposed recently to regulate the expression of their parental genes. In the present study, the deep RNA-sequencing technique known as RNA-seq was used to compare expression profiles of circRNAs from 2 pooled RNA samples from cow mammary gland on d 90 and 250 postpartum and to identify the key circRNAs involved in lactation. A total of 4,804 and 4,048 circRNAs were identified in the cow mammary gland on d 90 and 250 postpartum, respectively, of which only 2,231 circRNAs were co-expressed at both lactation stages, suggesting high stage specificity in the circRNAs. The enrichment of some Gene Ontology terms for the circRNA parental genes differed between lactation stages. Among the top 10 enriched Gene Ontology terms, vesicle, endoplasmic reticulum, and mitochondrial lumen were more common on lactation d 90. All 4 casein-coding genes (CSN1S1, CSN1S2, CSN2, and CSN3) produced circRNAs in the cattle mammary gland. In total, 80 circRNAs were identified from these 4 genes; circRNAs from CSN1S1 had very high abundance, and 3 of them accounted for 36% of all the circRNAs expressed in the mammary gland on lactation d 90. Three circRNAs from CSN1S1, 1 circRNA from CSN1S2, and 1 circRNA from CSN2 were all more highly expressed on lactation d 90 than on lactation d 250, as confirmed by quantitative PCR. These circRNAs had several target sites for the microRNA miR-2284 family and were predicted to target CSN1S1 and CSN2 mRNA, suggesting their potential involvement in regulating expression of the casein genes. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Ma, Shibin; Ming, Zhenping; Gong, Ai-Yu; Wang, Yang; Chen, Xiqiang; Hu, Guoku; Zhou, Rui; Shibata, Annemarie; Swanson, Patrick C; Chen, Xian-Ming
2017-03-01
Long intergenic noncoding RNAs (lincRNAs) are long noncoding transcripts (>200 nt) from the intergenic regions of annotated protein-coding genes. We report here that the lincRNA gene lincRNA-Tnfaip3 , located at mouse chromosome 10 proximal to the tumor necrosis factor α-induced protein 3 ( Tnfaip3 ) gene, is an early-primary response gene controlled by nuclear factor-κB (NF-κB) signaling in murine macrophages. Functionally, lincRNA- Tnfaip3 appears to mediate both the activation and repression of distinct classes of inflammatory genes in macrophages. Specifically, induction of lincRNA-Tnfaip3 is required for the transactivation of NF-κB-regulated inflammatory genes in response to bacterial LPSs stimulation. LincRNA-Tnfaip3 physically interacts with the high-mobility group box 1 (Hmgb1), assembling a NF-κB/Hmgb1/lincRNA-Tnfaip3 complex in macrophages after LPS stimulation. This resultant NF-κB/Hmgb1/lincRNA-Tnfaip3 complex can modulate Hmgb1-associated histone modifications and, ultimately, transactivation of inflammatory genes in mouse macrophages in response to microbial challenge. Therefore, our data indicate a new regulatory role of NF-κB-induced lincRNA-Tnfaip3 to act as a coactivator of NF-κB for the transcription of inflammatory genes in innate immune cells through modulation of epigenetic chromatin remodeling.-Ma, S., Ming, Z., Gong, A.-Y., Wang, Y., Chen, X., Hu, G., Zhou, R., Shibata, A., Swanson, P. C., Chen, X.-M. A long noncoding RNA, LincRNA-Tnfaip3, acts as a coregulator of NF-κB to modulate inflammatory gene transcription in mouse macrophages. © FASEB.
DNA methylation of miRNA-encoding genes in non-small cell lung cancer patients.
Heller, Gerwin; Altenberger, Corinna; Steiner, Irene; Topakian, Thais; Ziegler, Barbara; Tomasich, Erwin; Lang, György; End-Pfützenreuter, Adelheid; Zehetmayer, Sonja; Döme, Balazs; Arns, Britt-Madeleine; Klepetko, Walter; Zielinski, Christoph C; Zöchbauer-Müller, Sabine
2018-03-23
De-regulated DNA methylation leading to transcriptional inactivation of certain genes occurs frequently in non-small cell lung cancers (NSCLC). Besides protein-encoding genes also microRNA (miRNA)-encoding genes may be targets for methylation in NSCLCs, however, the number of known methylated miRNA genes is still small. Thus, we investigated methylation of miRNA genes in primary tumours (TU) and corresponding non-malignant lung tissue samples (NL) of 50 NSCLC patients using methylated DNA immunoprecipitation followed by custom designed tiling microarray analyses (MeDIP-chip) and 252 differentially methylated probes between TU and NL samples were identified. These probes were annotated which resulted in the identification of 34 miRNA-encoding genes with increased methylation in TU specimens. While some of these miRNA-encoding genes were already known to be methylated in NSCLCs (e.g. miR-9-3, miR-124), methylation of the vast majority of them was unknown so far. We selected six miRNA genes (miR-10b, miR-1179, miR-137, miR-572, miR-3150b and miR-129-2) for gene-specific methylation analyses in TU and corresponding NL samples of 104 NSCLC patients and observed a statistically significant increase of methylation of these miRNA genes in TU samples (p<0.0001, respectively). In silico target prediction of the six miRNAs identified several oncogenic/cell proliferation promoting factors (e.g. CCNE1 as miR-1179 target). To investigate if miR-1179 indeed targets CCNE1, we transfected miR-1179 mimics into CCNE1 expressing NSCLC cells and observed down-regulated CCNE1 mRNA expression in these cells compared to control cells. Similar effects on Cyclin E1 expression were seen in Western blot analyses. In addition, we found a statistically significant growth reduction of NSCLC cells transfected with miR-1179 mimics compared to control cells. In conclusion, we identified many methylated miRNA genes in NSCLC patients and found that miR-1179 is a potential tumour cell growth
Processing of Archaebacterial Intron-Containing tRNA Gene Transcripts
1988-07-27
number) The overall goal of this project is to develop an understanding of tRNA gene structure and transcript processing in the halophilic Archaebacteria...containing precursor tRNAs in the halophilic Archaebecteria suggest that tRNATr p may be the only interrupted tR?4A gene in these organisms...1 August 1986 RESEARCH OBJECTIVE: To determine the mechanism of tRNA intron processing in the halophilic archaebacteria; characterize the enzyme
Hsu, Shih-Feng; Su, Wen-Chi; Jeng, King-Song
2015-01-01
ABSTRACT Influenza A virus (IAV) depends on cellular factors to complete its replication cycle; thus, investigation of the factors utilized by IAV may facilitate antiviral drug development. To this end, a cellular transcriptional repressor, DR1, was identified from a genome-wide RNA interference (RNAi) screen. Knockdown (KD) of DR1 resulted in reductions of viral RNA and protein production, demonstrating that DR1 acts as a positive host factor in IAV replication. Genome-wide transcriptomic analysis showed that there was a strong induction of interferon-stimulated gene (ISG) expression after prolonged DR1 KD. We found that beta interferon (IFN-β) was induced by DR1 KD, thereby activating the JAK-STAT pathway to turn on ISG expression, which led to a strong inhibition of IAV replication. This result suggests that DR1 in normal cells suppresses IFN induction, probably to prevent undesired cytokine production, but that this suppression may create a milieu that favors IAV replication once cells are infected. Furthermore, biochemical assays of viral RNA replication showed that DR1 KD suppressed viral RNA replication. We also showed that DR1 associated with all three subunits of the viral RNA-dependent RNA polymerase (RdRp) complex, indicating that DR1 may interact with individual components of the viral RdRp complex to enhance viral RNA replication. Thus, DR1 may be considered a novel host susceptibility gene for IAV replication via a dual mechanism, not only suppressing the host defense to indirectly favor IAV replication but also directly facilitating viral RNA replication. IMPORTANCE Investigations of virus-host interactions involved in influenza A virus (IAV) replication are important for understanding viral pathogenesis and host defenses, which may manipulate influenza virus infection or prevent the emergence of drug resistance caused by a high error rate during viral RNA replication. For this purpose, a cellular transcriptional repressor, DR1, was identified from
Mechanisms and Regulation of Alternative Pre-mRNA Splicing
Lee, Yeon
2015-01-01
Precursor messenger RNA (pre-mRNA) splicing is a critical step in the posttranscriptional regulation of gene expression, providing significant expansion of the functional proteome of eukaryotic organisms with limited gene numbers. Split eukaryotic genes contain intervening sequences or introns disrupting protein-coding exons, and intron removal occurs by repeated assembly of a large and highly dynamic ribonucleoprotein complex termed the spliceosome, which is composed of five small nuclear ribonucleoprotein particles, U1, U2, U4/U6, and U5. Biochemical studies over the past 10 years have allowed the isolation as well as compositional, functional, and structural analysis of splicing complexes at distinct stages along the spliceosome cycle. The average human gene contains eight exons and seven introns, producing an average of three or more alternatively spliced mRNA isoforms. Recent high-throughput sequencing studies indicate that 100% of human genes produce at least two alternative mRNA isoforms. Mechanisms of alternative splicing include RNA–protein interactions of splicing factors with regulatory sites termed silencers or enhancers, RNA–RNA base-pairing interactions, or chromatin-based effects that can change or determine splicing patterns. Disease-causing mutations can often occur in splice sites near intron borders or in exonic or intronic RNA regulatory silencer or enhancer elements, as well as in genes that encode splicing factors. Together, these studies provide mechanistic insights into how spliceosome assembly, dynamics, and catalysis occur; how alternative splicing is regulated and evolves; and how splicing can be disrupted by cis- and trans-acting mutations leading to disease states. These findings make the spliceosome an attractive new target for small-molecule, antisense, and genome-editing therapeutic interventions. PMID:25784052
Post-transcriptional inducible gene regulation by natural antisense RNA.
Nishizawa, Mikio; Ikeya, Yukinobu; Okumura, Tadayoshi; Kimura, Tominori
2015-01-01
Accumulating data indicate the existence of natural antisense transcripts (asRNAs), frequently transcribed from eukaryotic genes and do not encode proteins in many cases. However, their importance has been overlooked due to their heterogeneity, low expression level, and unknown function. Genes induced in responses to various stimuli are transcriptionally regulated by the activation of a gene promoter and post-transcriptionally regulated by controlling mRNA stability and translatability. A low-copy-number asRNA may post-transcriptionally regulate gene expression with cis-controlling elements on the mRNA. The asRNA itself may act as regulatory RNA in concert with trans-acting factors, including various RNA-binding proteins that bind to cis-controlling elements, microRNAs, and drugs. A novel mechanism that regulates mRNA stability includes the interaction of asRNA with mRNA by hybridization to loops in secondary structures. Furthermore, recent studies have shown that the functional network of mRNAs, asRNAs, and microRNAs finely tunes the levels of mRNA expression. The post-transcriptional mechanisms via these RNA-RNA interactions may play pivotal roles to regulate inducible gene expression and present the possibility of the involvement of asRNAs in various diseases.
Li, Tianlu; De Clercq, Nikki; Medina, Daniel A; Garre, Elena; Sunnerhagen, Per; Pérez-Ortín, José E; Alepuz, Paula
2016-02-01
The highly conserved Saccharomyces cerevisiae cap-binding protein Cbc1/Sto1 binds mRNA co-transcriptionally and acts as a key coordinator of mRNA fate. Recently, Cbc1 has also been implicated in transcription elongation and pre-initiation complex (PIC) formation. Previously, we described Cbc1 to be required for cell growth under osmotic stress and to mediate osmostress-induced translation reprogramming. Here, we observe delayed global transcription kinetics in cbc1Δ during osmotic stress that correlates with delayed recruitment of TBP and RNA polymerase II to osmo-induced promoters. Interestingly, we detect an interaction between Cbc1 and the MAPK Hog1, which controls most gene expression changes during osmostress, and observe that deletion of CBC1 delays the accumulation of the activator complex Hot1-Hog1 at osmostress promoters. Additionally, CBC1 deletion specifically reduces transcription rates of highly transcribed genes under non-stress conditions, such as ribosomal protein (RP) genes, while having low impact on transcription of weakly expressed genes. For RP genes, we show that recruitment of the specific activator Rap1, and subsequently TBP, to promoters is Cbc1-dependent. Altogether, our results indicate that binding of Cbc1 to the capped mRNAs is necessary for the accumulation of specific activators as well as PIC components at the promoters of genes whose expression requires high and rapid transcription. Copyright © 2016 Elsevier B.V. All rights reserved.
Poblete-Naredo, Irais; Rodríguez-Yáñez, Yury; Corona-Núñez, Rogelio O; González-Monroy, Stuart; Salinas, Juan E; Albores, Arnulfo
2018-05-17
Hypertension disorders (HD) and pre-eclampsia (PRE) are leading causes of maternal deaths worldwide. PRE is associated with vascular endothelial dysfunction and with deregulation of the fibrinolysis pathway genes. Fibrinolysis is the fibrin clot hydrolysis process catalyzed by plasmin, a proteolytic enzyme formed from plasminogen. Plasminogen is cleaved by tissue-type (tPA) and urokinase-type (uPA) activators and inhibited by the plasminogen activator inhibitors type-1 (PAI-1) and type-2 (PAI-2). The whole process maintains blood hemostasis. This study aims to assess PAI-1, PAI-2, tPA and uPA mRNA expression in primary cultured human umbilical vein endothelial cells (HUVEC) isolated and cultured from healthy, HD and PRE women. Results show that PAI-1 and PAI-2 mRNA decreased in HD-HUVEC, whereas PAI-1 and uPA decreased in PRE-HUVEC cultures compared to control ones. Notably, the expression ratio between pro- and anti-fibrinolytic actors remained unchanged among the studied groups. It seems that newborn's hemostasis is maintained balanced probably by a compensatory mechanism that involves changes in the fibrinolysis gene expression profile. The real impact of these changes in mRNA expression is unknown, however, it is suggested that these changes could be associated with an increased predisposition to vascular disease development in the progeny. Copyright © 2018. Published by Elsevier Ltd.
miRNA-mediated 'tug-of-war' model reveals ceRNA propensity of genes in cancers.
Swain, Arpit Chandan; Mallick, Bibekanand
2018-06-01
Competing endogenous RNA (ceRNA) are transcripts that cross-regulate each other at the post-transcriptional level by competing for shared microRNA response elements (MREs). These have been implicated in various biological processes impacting cell-fate decisions and diseases including cancer. There are several studies that predict possible ceRNA pairs by adopting various machine-learning and mathematical approaches; however, there is no method that enables us to gauge as well as compare the propensity of the ceRNA of a gene and precisely envisages which among a pair exerts a stronger pull on the shared miRNA pool. In this study, we developed a method that uses the 'tug of war of genes' concept to predict and quantify ceRNA potential of a gene for the shared miRNA pool in cancers based on a score represented by SoCeR (score of competing endogenous RNA). The method was executed on the RNA-Seq transcriptional profiles of genes and miRNA available at TCGA along with CLIP-supported miRNA-target sites to predict ceRNA in 32 cancer types which were validated with already reported cases. The proposed method can be used to determine the sequestering capability of the gene of interest as well as in ranking the probable ceRNA candidates of a gene. Finally, we developed standalone applications (SoCeR tool) to aid researchers in easier implementation of the method in analysing different data sets or diseases. © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.
Processing of Archaebacterial Intron-Containing tRNA Gene Transcripts.
1987-07-31
1{ 1. Project Goals: A. To determine the mechanism of tRNA intron processing in the halophilic archaebacteria. B. Characterize and compare the...enzyme(s) responsible for the removal of 5’-flanking sequences from halophilic and sulfur-dependent tRNA gene transcripts. C. Examine the structure and...distribution of tRNA introns in the halophilic archaebacteria. 2. Accomplishments: A. Intron processing mechanism We have succeeded in our primary
tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.
Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi
2014-01-01
The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.
Kraan, Claudine M; Cornish, Kim M; Bui, Quang M; Li, Xin; Slater, Howard R; Godler, David E
2018-01-01
Relationships between Fragile X Mental Retardation 1 (FMR1) mRNA levels in blood and intragenic FMR1 CGG triplet expansions support the pathogenic role of RNA gain of function toxicity in premutation (PM: 55-199 CGGs) related disorders. Real-time PCR (RT-PCR) studies reporting these findings normalised FMR1 mRNA level to a single internal control gene called β-glucuronidase (GUS). This study evaluated FMR1 mRNA-CGG correlations in 33 PM and 33 age- and IQ-matched control females using three normalisation strategies in peripheral blood mononuclear cells (PBMCs): (i) GUS as a single internal control; (ii) the mean of GUS, Eukaryotic Translation Initiation Factor 4A2 (EIF4A2) and succinate dehydrogenase complex flavoprotein subunit A (SDHA); and (iii) the mean of EIF4A2 and SDHA (with no contribution from GUS). GUS mRNA levels normalised to the mean of EIF4A2 and SDHA mRNA levels and EIF4A2/SDHA ratio were also evaluated. FMR1mRNA level normalised to the mean of EIF4A2 and SDHA mRNA levels, with no contribution from GUS, showed the most significant correlation with CGG size and the greatest difference between PM and control groups (p = 10-11). Only 15% of FMR1 mRNA PM results exceeded the maximum control value when normalised to GUS, compared with over 42% when normalised to the mean of EIF4A2 and SDHA mRNA levels. Neither GUS mRNA level normalised to the mean RNA levels of EIF4A2 and SDHA, nor to the EIF4A2/SDHA ratio were correlated with CGG size. However, greater variability in GUS mRNA levels were observed for both PM and control females across the full range of CGG repeat as compared to the EIF4A2/SDHA ratio. In conclusion, normalisation with multiple control genes, excluding GUS, can improve assessment of the biological significance of FMR1 mRNA-CGG size relationships.
Santangeloyz, K.S.; Bertoneyz, A.L.
2011-01-01
summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this
Santangelo, K S; Bertone, A L
2011-12-01
To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted
SmD1 Modulates the miRNA Pathway Independently of Its Pre-mRNA Splicing Function.
Xiong, Xiao-Peng; Vogler, Georg; Kurthkoti, Krishna; Samsonova, Anastasia; Zhou, Rui
2015-08-01
microRNAs (miRNAs) are a class of endogenous regulatory RNAs that play a key role in myriad biological processes. Upon transcription, primary miRNA transcripts are sequentially processed by Drosha and Dicer ribonucleases into ~22-24 nt miRNAs. Subsequently, miRNAs are incorporated into the RNA-induced silencing complexes (RISCs) that contain Argonaute (AGO) family proteins and guide RISC to target RNAs via complementary base pairing, leading to post-transcriptional gene silencing by a combination of translation inhibition and mRNA destabilization. Select pre-mRNA splicing factors have been implicated in small RNA-mediated gene silencing pathways in fission yeast, worms, flies and mammals, but the underlying molecular mechanisms are not well understood. Here, we show that SmD1, a core component of the Drosophila small nuclear ribonucleoprotein particle (snRNP) implicated in splicing, is required for miRNA biogenesis and function. SmD1 interacts with both the microprocessor component Pasha and pri-miRNAs, and is indispensable for optimal miRNA biogenesis. Depletion of SmD1 impairs the assembly and function of the miRISC without significantly affecting the expression of major canonical miRNA pathway components. Moreover, SmD1 physically and functionally associates with components of the miRISC, including AGO1 and GW182. Notably, miRNA defects resulting from SmD1 silencing can be uncoupled from defects in pre-mRNA splicing, and the miRNA and splicing machineries are physically and functionally distinct entities. Finally, photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) analysis identifies numerous SmD1-binding events across the transcriptome and reveals direct SmD1-miRNA interactions. Our study suggests that SmD1 plays a direct role in miRNA-mediated gene silencing independently of its pre-mRNA splicing activity and indicates that the dual roles of splicing factors in post-transcriptional gene regulation may be evolutionarily
Unmasking Upstream Gene Expression Regulators with miRNA-corrected mRNA Data
Bollmann, Stephanie; Bu, Dengpan; Wang, Jiaqi; Bionaz, Massimo
2015-01-01
Expressed micro-RNA (miRNA) affects messenger RNA (mRNA) abundance, hindering the accuracy of upstream regulator analysis. Our objective was to provide an algorithm to correct such bias. Large mRNA and miRNA analyses were performed on RNA extracted from bovine liver and mammary tissue. Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%). Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%) and four levels of the magnitude of miRNA effect (ME) on mRNA expression (30%, 50%, 75%, and 83% mRNA reduction), we generated 17 different datasets (including the original dataset). For each dataset, we performed upstream regulator analysis using two bioinformatics tools. We detected an increased effect on the upstream regulator analysis with larger miRNA:mRNA pair bins and higher ME. The miRNA correction allowed identification of several upstream regulators not present in the analysis of the original dataset. Thus, the proposed algorithm improved the prediction of upstream regulators. PMID:27279737
Regulation of miRNA Processing and miRNA Mediated Gene Repression in Cancer
Bajan, Sarah; Hutvagner, Gyorgy
2014-01-01
The majority of human protein-coding genes are predicted to be targets of miRNA-mediated post-transcriptional regulation. The widespread influence of miRNAs is illustrated by their essential roles in all biological processes. Regulated miRNA expression is essential for maintaining cellular differentiation; therefore alterations in miRNA expression patterns are associated with several diseases, including various cancers. High-throughput sequencing technologies revealed low level expressing miRNA isoforms, termed isomiRs. IsomiRs may differ in sequence, length, target preference and expression patterns from their parental miRNA and can arise from differences in miRNA biosynthesis, RNA editing, or SNPs inherent to the miRNA gene. The association between isomiR expression and disease progression is largely unknown. Misregulated miRNA expression is thought to contribute to the formation and/or progression of cancer. However, due to the diversity of targeted transcripts, miRNAs can function as both tumor-suppressor genes and oncogenes as defined by cellular context. Despite this, miRNA profiling studies concluded that the differential expression of particular miRNAs in diseased tissue could aid the diagnosis and treatment of some cancers. PMID:25069508
Pellagatti, Andrea; Armstrong, Richard N; Steeples, Violetta; Sharma, Eshita; Repapi, Emmanouela; Singh, Shalini; Sanchi, Andrea; Radujkovic, Aleksandar; Horn, Patrick; Dolatshad, Hamid; Roy, Swagata; Broxholme, John; Lockstone, Helen; Taylor, Stephen; Giagounidis, Aristoteles; Vyas, Paresh; Schuh, Anna; Hamblin, Angela; Papaemmanuil, Elli; Killick, Sally; Malcovati, Luca; Hennrich, Marco L; Gavin, Anne-Claude; Ho, Anthony D; Luft, Thomas; Hellström-Lindberg, Eva; Cazzola, Mario; Smith, Christopher W J; Smith, Stephen; Boultwood, Jacqueline
2018-06-21
SF3B1, SRSF2 and U2AF1 are the most frequently mutated splicing factor genes in the myelodysplastic syndromes (MDS). We have performed a comprehensive and systematic analysis to determine the impact of these commonly mutated splicing factors on pre-mRNA splicing in the bone marrow stem/progenitor cells and in the erythroid and myeloid precursors in splicing factor mutant MDS. Using RNA-seq, we determined the aberrantly spliced genes and dysregulated pathways in CD34 + cells of 84 MDS patients. Splicing factor mutations result in different alterations in splicing and largely affect different genes, but these converge in common dysregulated pathways and cellular processes, focused on RNA splicing, protein synthesis and mitochondrial dysfunction, suggesting common mechanisms of action in MDS. Many of these dysregulated pathways and cellular processes can be linked to the known disease pathophysiology associated with splicing factor mutations in MDS, whilst several others have not been previously associated with MDS, such as sirtuin signaling. We identified aberrantly spliced events associated with clinical variables, and isoforms which independently predict survival in MDS and implicate dysregulation of focal adhesion and extracellular exosomes as drivers of poor survival. Aberrantly spliced genes and dysregulated pathways were identified in the MDS-affected lineages in splicing factor mutant MDS. Functional studies demonstrated that knockdown of the mitosis regulators SEPT2 and AKAP8, aberrantly spliced target genes of SF3B1 and SRSF2 mutations respectively, led to impaired erythroid cell growth and differentiation. This study illuminates the impact of the common spliceosome mutations on the MDS phenotype and provides novel insights into disease pathophysiology. Copyright © 2018 American Society of Hematology.
siRNA Versus miRNA as Therapeutics for Gene Silencing
Lam, Jenny K W; Chow, Michael Y T; Zhang, Yu; Leung, Susan W S
2015-01-01
Discovered a little over two decades ago, small interfering RNAs (siRNAs) and microRNAs (miRNAs) are noncoding RNAs with important roles in gene regulation. They have recently been investigated as novel classes of therapeutic agents for the treatment of a wide range of disorders including cancers and infections. Clinical trials of siRNA- and miRNA-based drugs have already been initiated. siRNAs and miRNAs share many similarities, both are short duplex RNA molecules that exert gene silencing effects at the post-transcriptional level by targeting messenger RNA (mRNA), yet their mechanisms of action and clinical applications are distinct. The major difference between siRNAs and miRNAs is that the former are highly specific with only one mRNA target, whereas the latter have multiple targets. The therapeutic approaches of siRNAs and miRNAs are therefore very different. Hence, this review provides a comparison between therapeutic siRNAs and miRNAs in terms of their mechanisms of action, physicochemical properties, delivery, and clinical applications. Moreover, the challenges in developing both classes of RNA as therapeutics are also discussed. PMID:26372022
Adaptive evolution of newly emerged micro-RNA genes in Drosophila.
Lu, Jian; Fu, Yonggui; Kumar, Supriya; Shen, Yang; Zeng, Kai; Xu, Anlong; Carthew, Richard; Wu, Chung-I
2008-05-01
How often micro-RNA (miRNA) genes emerged and how fast they evolved soon after their emergence are some of the central questions in the evolution of miRNAs. Because most known miRNA genes are ancient and highly conserved, these questions can be best answered by identifying newly emerged miRNA genes. Among the 78 miRNA genes in Drosophila reported before 2007, only 5 are confirmed to be newly emerged in the genus (although many more can be found in the newly reported data set; e.g., Ruby et al. 2007; Stark et al. 2007; Lu et al. 2008). These new miRNA genes have undergone numerous changes, even in the normally invariant mature sequences. Four of them (the miR-310/311/312/313 cluster, denoted miR-310s) were duplicated from other conserved miRNA genes. The fifth one (miR-303) appears to be a very young gene, originating de novo from a non-miRNA sequence recently. We sequenced these 5 miRNA genes and their neighboring regions from a worldwide collection of Drosophila melanogaster lines. The levels of divergence and polymorphism in these miRNA genes, vis-à-vis those of the neighboring DNA sequences, suggest that these 5 genes are evolving adaptively. Furthermore, the polymorphism pattern of miR-310s in D. melanogaster is indicative of hitchhiking under positive selection. Thus, a large number of adaptive changes over a long period of time may be essential for the evolution of newly emerged miRNA genes.
Qi, Lihua; Song, Yangyang; Chan, Tim Hon Man; Yang, Henry; Lin, Chi Ho; Tay, Daryl Jin Tai; Hong, HuiQi; Tang, Sze Jing; Tan, Kar Tong; Huang, Xi Xiao; Lin, Jaymie Siqi; Ng, Vanessa Hui En; Maury, Julien Jean Pierre; Tenen, Daniel G; Chen, Leilei
2017-10-13
Adenosine-to-inosine (A-to-I) RNA editing, catalyzed by Adenosine DeAminases acting on double-stranded RNA(dsRNA) (ADAR), occurs predominantly in the 3' untranslated regions (3'UTRs) of spliced mRNA. Here we uncover an unanticipated link between ADARs (ADAR1 and ADAR2) and the expression of target genes undergoing extensive 3'UTR editing. Using METTL7A (Methyltransferase Like 7A), a novel tumor suppressor gene with multiple editing sites at its 3'UTR, we demonstrate that its expression could be repressed by ADARs beyond their RNA editing and double-stranded RNA (dsRNA) binding functions. ADARs interact with Dicer to augment the processing of pre-miR-27a to mature miR-27a. Consequently, mature miR-27a targets the METTL7A 3'UTR to repress its expression level. In sum, our study unveils that the extensive 3'UTR editing of METTL7A is merely a footprint of ADAR binding, and there are a subset of target genes that are equivalently regulated by ADAR1 and ADAR2 through their non-canonical RNA editing and dsRNA binding-independent functions, albeit maybe less common. The functional significance of ADARs is much more diverse than previously appreciated and this gene regulatory function of ADARs is most likely to be of high biological importance beyond the best-studied editing function. This non-editing side of ADARs opens another door to target cancer. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Qi, Lihua; Song, Yangyang; Chan, Tim Hon Man; Yang, Henry; Lin, Chi Ho; Tay, Daryl Jin Tai; Hong, HuiQi; Tang, Sze Jing; Tan, Kar Tong; Huang, Xi Xiao; Lin, Jaymie Siqi; Ng, Vanessa Hui En; Maury, Julien Jean Pierre
2017-01-01
Abstract Adenosine-to-inosine (A-to-I) RNA editing, catalyzed by Adenosine DeAminases acting on double-stranded RNA(dsRNA) (ADAR), occurs predominantly in the 3′ untranslated regions (3′UTRs) of spliced mRNA. Here we uncover an unanticipated link between ADARs (ADAR1 and ADAR2) and the expression of target genes undergoing extensive 3′UTR editing. Using METTL7A (Methyltransferase Like 7A), a novel tumor suppressor gene with multiple editing sites at its 3′UTR, we demonstrate that its expression could be repressed by ADARs beyond their RNA editing and double-stranded RNA (dsRNA) binding functions. ADARs interact with Dicer to augment the processing of pre-miR-27a to mature miR-27a. Consequently, mature miR-27a targets the METTL7A 3′UTR to repress its expression level. In sum, our study unveils that the extensive 3′UTR editing of METTL7A is merely a footprint of ADAR binding, and there are a subset of target genes that are equivalently regulated by ADAR1 and ADAR2 through their non-canonical RNA editing and dsRNA binding-independent functions, albeit maybe less common. The functional significance of ADARs is much more diverse than previously appreciated and this gene regulatory function of ADARs is most likely to be of high biological importance beyond the best-studied editing function. This non-editing side of ADARs opens another door to target cancer. PMID:28985428
Deng, Changwang; Li, Ying; Zhou, Lei; Cho, Joonseok; Patel, Bhavita; Terada, Naohiro; Li, Yangqiu; Bungert, Jörg; Qiu, Yi; Huang, Suming
2016-01-05
Trithorax proteins and long-intergenic noncoding RNAs are critical regulators of embryonic stem cell pluripotency; however, how they cooperatively regulate germ layer mesoderm specification remains elusive. We report here that HoxBlinc RNA first specifies Flk1(+) mesoderm and then promotes hematopoietic differentiation through regulation of hoxb pathways. HoxBlinc binds to the hoxb genes, recruits Setd1a/MLL1 complexes, and mediates long-range chromatin interactions to activate transcription of the hoxb genes. Depletion of HoxBlinc by shRNA-mediated knockdown or CRISPR-Cas9-mediated genetic deletion inhibits expression of hoxb genes and other factors regulating cardiac/hematopoietic differentiation. Reduced hoxb expression is accompanied by decreased recruitment of Set1/MLL1 and H3K4me3 modification, as well as by reduced chromatin loop formation. Re-expression of hoxb2-b4 genes in HoxBlinc-depleted embryoid bodies rescues Flk1(+) precursors that undergo hematopoietic differentiation. Thus, HoxBlinc plays an important role in controlling hoxb transcription networks that mediate specification of mesoderm-derived Flk1(+) precursors and differentiation of Flk1(+) cells into hematopoietic lineages. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Minchenko, O H; Tsymbal, D O; Minchenko, D O; Riabovol, O O; Ratushna, O O; Karbovskyi, L L
2016-01-01
We have studied the effect of inhibition of IRE1 (inositol requiring enzyme 1), which is a central mediator of endoplasmic reticulum stress and a controller of cell proliferation and tumor growth, on hypoxic regulation of the expression of different proliferation related genes in U87 glioma cells. It was shown that hypoxia leads to up-regulation of the expression of IL13RA2, CD24, ING1, ING2, ENDOG, and POLG genes and to down-regulation – of KRT18, TRAPPC3, TSFM, and MTIF2 genes at the mRNA level in control glioma cells. Changes for ING1 and CD24 genes were more significant. At the same time, inhibition of IRE1 modifies the effect of hypoxia on the expression of all studied genes. In particular, it increases sensitivity to hypoxia of the expression of IL13RA2, TRAPPC3, ENDOG, and PLOG genes and suppresses the effect of hypoxia on the expression of ING1 gene. Additionally, it eliminates hypoxic regulation of KRT18, CD24, ING2, TSFM, and MTIF2 genes expressions and introduces sensitivity to hypoxia of the expression of BET1 gene in glioma cells. The present study demonstrates that hypoxia, which often contributes to tumor growth, affects the expression of almost all studied genes. Additionally, inhibition of IRE1 can both enhance and suppress the hypoxic regulation of these gene expressions in a gene specific manner and thus possibly contributes to slower glioma growth, but several aspects of this regulation must be further clarified.
Hughes, J M
1996-06-21
The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.
Cho, Charles J; Jung, Jaeeun; Jiang, Lushang; Lee, Eun Ji; Kim, Dae-Soo; Kim, Byung Sik; Kim, Hee Sung; Jung, Hwoon-Yong; Song, Ho-June; Hwang, Sung Wook; Park, Yangsoon; Jung, Min Kyo; Pack, Chan Gi; Myung, Seung-Jae; Chang, Suhwan
2018-04-25
Adenosine deaminase acting on RNA 1 (ADAR1) is known to mediate deamination of adenosine-to-inosine through binding to double-stranded RNA, the phenomenon known as RNA editing. Currently, the function of ADAR1 in gastric cancer is unclear. This study was aimed at investigating RNA editing-dependent and editing-independent functions of ADAR1 in gastric cancer, especially focusing on its influence on editing of 3' untranslated regions (UTRs) and subsequent changes in expression of messenger RNAs (mRNAs) as well as microRNAs (miRNAs). RNA-sequencing and small RNA-sequencing were performed on AGS and MKN-45 cells with a stable ADAR1 knockdown. Changed frequencies of editing and mRNA and miRNA expression were then identified by bioinformatic analyses. Targets of RNA editing were further validated in patients' samples. In the Alu region of both gastric cell lines, editing was most commonly of the A-to-I type in 3'-UTR or intron. mRNA and protein levels of PHACTR4 increased in ADAR1 knockdown cells, because of the loss of seed sequences in 3'-UTR of PHACTR4 mRNA that are required for miRNA-196a-3p binding. Immunohistochemical analyses of tumor and paired normal samples from 16 gastric cancer patients showed that ADAR1 expression was higher in tumors than in normal tissues and inversely correlated with PHACTR4 staining. On the other hand, decreased miRNA-148a-3p expression in ADAR1 knockdown cells led to increased mRNA and protein expression of NFYA, demonstrating ADAR1's editing-independent function. ADAR1 regulates post-transcriptional gene expression in gastric cancer through both RNA editing-dependent and editing-independent mechanisms.
Chen, Changchun; Huang, Bo; Eliasson, Mattias; Rydén, Patrik; Byström, Anders S
2011-09-01
Elongator complex is required for formation of the side chains at position 5 of modified nucleosides 5-carbamoylmethyluridine (ncm⁵U₃₄), 5-methoxycarbonylmethyluridine (mcm⁵U₃₄), and 5-methoxycarbonylmethyl-2-thiouridine (mcm⁵s²U₃₄) at wobble position in tRNA. These modified nucleosides are important for efficient decoding during translation. In a recent publication, Elongator complex was implicated to participate in telomeric gene silencing and DNA damage response by interacting with proliferating cell nuclear antigen (PCNA). Here we show that elevated levels of tRNA(Lys)(s²UUU), tRNA(Gln)(s²UUG), and tRNA(Glu)(s²UUC), which in a wild-type background contain the mcm⁵s²U nucleoside at position 34, suppress the defects in telomeric gene silencing and DNA damage response observed in the Elongator mutants. We also found that the reported differences in telomeric gene silencing and DNA damage response of various elp3 alleles correlated with the levels of modified nucleosides at U₃₄. Defects in telomeric gene silencing and DNA damage response are also observed in strains with the tuc2Δ mutation, which abolish the formation of the 2-thio group of the mcm⁵s²U nucleoside in tRNA(Lys)(mcm⁵s²UUU), tRNA(Gln)(mcm⁵s²UUG), and tRNA(Glu)(mcm⁵s²UUC). These observations show that Elongator complex does not directly participate in telomeric gene silencing and DNA damage response, but rather that modified nucleosides at U₃₄ are important for efficient expression of gene products involved in these processes. Consistent with this notion, we found that expression of Sir4, a silent information regulator required for assembly of silent chromatin at telomeres, was decreased in the elp3Δ mutants.
Maslov, D A; Hollar, L; Haghighat, P; Nawathean, P
1998-06-01
Maxicircle molecules of kDNA in several isolates of Phytomonas were detected by hybridization with the 12S rRNA gene probe from Leishmania tarentolae. The estimated size of maxicircles is isolate-specific and varies from 27 to 36 kb. Fully edited and polyadenylated mRNA for kinetoplast-encoded ribosomal protein S12 (RPS12) was found in the steady-state kinetoplast RNA isolated from Phytomonas serpens strain 1G. Two minicircles (1.45 kb) from this strain were also sequenced. Each minicircle contains two 120 bp conserved regions positioned 180 degrees apart, a region enriched with G and T bases and a variable region. One minicircle encodes a gRNA for the first block of editing of RPSl2 mRNA, and the other encodes a gRNA with unknown function. A gRNA gene for the second block of RPSl2 was found on a minicircle sequenced previously. On each minicircle, a gRNA gene is located in the variable region in a similar position and orientation with respect to the conserved regions.
Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang
2018-06-08
A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.
Son, Moonil; Lee, Kyung-Mi; Yu, Jisuk; Kang, Minji; Park, Jin Man; Kwon, Sun-Jung
2013-01-01
The accumulation of viral RNA depends on many host cellular factors. The hexagonal peroxisome (Hex1) protein is a fungal protein that is highly expressed when the DK21 strain of Fusarium graminearum virus 1 (FgV1) infects its host, and Hex1 affects the accumulation of FgV1 RNA. The Hex1 protein is the major constituent of the Woronin body (WB), which is a peroxisome-derived electron-dense core organelle that seals the septal pore in response to hyphal wounding. To clarify the role of Hex1 and the WB in the relationship between FgV1 and Fusarium graminearum, we generated targeted gene deletion and overexpression mutants. Although neither HEX1 gene deletion nor overexpression substantially affected vegetative growth, both changes reduced the production of asexual spores and reduced virulence on wheat spikelets in the absence of FgV1 infection. However, the vegetative growth of deletion and overexpression mutants was increased and decreased, respectively, upon FgV1 infection compared to that of an FgV1-infected wild-type isolate. Viral RNA accumulation was significantly decreased in deletion mutants but was significantly increased in overexpression mutants compared to the viral RNA accumulation in the virus-infected wild-type control. Overall, these data indicate that the HEX1 gene plays a direct role in the asexual reproduction and virulence of F. graminearum and facilitates viral RNA accumulation in the FgV1-infected host fungus. PMID:23864619
The centrality of RNA for engineering gene expression
Chappell, James; Takahashi, Melissa K; Meyer, Sarai; Loughrey, David; Watters, Kyle E; Lucks, Julius
2013-01-01
Synthetic biology holds promise as both a framework for rationally engineering biological systems and a way to revolutionize how we fundamentally understand them. Essential to realizing this promise is the development of strategies and tools to reliably and predictably control and characterize sophisticated patterns of gene expression. Here we review the role that RNA can play towards this goal and make a case for why this versatile, designable, and increasingly characterizable molecule is one of the most powerful substrates for engineering gene expression at our disposal. We discuss current natural and synthetic RNA regulators of gene expression acting at key points of control – transcription, mRNA degradation, and translation. We also consider RNA structural probing and computational RNA structure predication tools as a way to study RNA structure and ultimately function. Finally, we discuss how next-generation sequencing methods are being applied to the study of RNA and to the characterization of RNA's many properties throughout the cell. PMID:24124015
Ishiba, Toshiyuki; Hoffmann, Andreas-Claudius; Usher, Joshua; Elshimali, Yahya; Sturdevant, Todd; Dang, Mai; Jaimes, Yolanda; Tyagi, Rama; Gonzales, Ronald; Grino, Mary; Pinski, Jacek K; Barzi, Afsaneh; Raez, Luis E; Eberhardt, Wilfried E; Theegarten, Dirk; Lenz, Heinz-Josef; Uetake, Hiroyuki; Danenberg, Peter V; Danenberg, Kathleen
2018-06-07
Precision medicine and prediction of therapeutic response requires monitoring potential biomarkers before and after treatment. Liquid biopsies provide noninvasive prognostic markers such as circulating tumor DNA and RNA. Circulating tumor RNA (ctRNA) in blood is also used to identify mutations in genes of interest, but additionally, provides information about relative expression levels of important genes. In this study, we analyzed PD-L1 expression in ctRNA isolated from various cancer types. Tumors inhibit antitumor response by modulating the immune checkpoint proteins programmed death ligand 1 (PD-L1) and its cognate receptor PD1. The expression of these genes has been implicated in evasion of immune response and resistance to targeted therapies. Blood samples were collected from gastric (GC), colorectal (CRC), lung (NSCLC), breast (BC), prostate cancer (PC) patients, and a healthy control group. ctRNA was purified from fractionated plasma, and following reverse transcription, levels of PD-L1 expression were analyzed using qPCR. PD-L1 expression was detected in the plasma ctRNA of all cancer types at varying frequencies but no PD-L1 mRNA was detected in cancer-free individuals. The frequencies of PD-L1 expression were significantly different among the various cancer types but the median relative PD-L1 expression values were not significantly different. In 12 cases where plasma and tumor tissue were available from the same patients, there was a high degree of concordance between expression of PD-L1 protein in tumor tissues and PD-L1 gene expression in plasma, and both methods were equally predictive of response to nivolumab. PD-L1 mRNA can be detected and quantitated in ctRNA of cancer patients. These results pave the way for further studies aimed at determining whether monitoring the levels of PD-L1 mRNA in blood can identify patients who are most likely to benefit from the conventional treatment. Copyright © 2018 Elsevier Inc. All rights reserved.
New Type of BACE1 siRNA Delivery to Cells
Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz
2014-01-01
Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230
SL1 RNA gene recovery from Enterobius vermicularis ancient DNA in pre-Columbian human coprolites.
Iñiguez, Alena Mayo; Reinhard, Karl; Carvalho Gonçalves, Marcelo Luiz; Ferreira, Luiz Fernando; Araújo, Adauto; Paulo Vicente, Ana Carolina
2006-11-01
Enterobius vermicularis, pinworm, is one of the most common helminths worldwide, infecting nearly a billion people at all socio-economic levels. In prehistoric populations the paleoparasitological findings show a pinworm homogeneous distribution among hunter-gatherers in North America, intensified with the advent of agriculture. This same increase also occurred in the transition from nomad hunter-gatherers to sedentary farmers in South America, although E. vermicularis infection encompasses only the ancient Andean peoples, with no record among the pre-Colombian populations in the South American lowlands. However, the outline of pinworm paleoepidemiology has been supported by microscopic finding of eggs recovered from coprolites. Since molecular techniques are precise and sensitive in detecting pathogen ancient DNA (aDNA), and also could provide insights into the parasite evolutionary history, in this work we have performed a molecular paleoparasitological study of E. vermicularis. aDNA was recovered and pinworm 5S rRNA spacer sequences were determined from pre-Columbian coprolites (4110 BC-AD 900) from four different North and South American archaeological sites. The sequence analysis confirmed E. vermicularis identity and revealed a similarity among ancient and modern sequences. Moreover, polymorphisms were identified at the relative positions 160, 173 and 180, in independent coprolite samples from Tulán, San Pedro de Atacama, Chile (1080-950 BC). We also verified the presence of peculiarities (Splicing leader (SL1) RNA sequence, spliced donor site, the Sm antigen biding site, and RNA secondary structure) which characterise the SL1 RNA gene. The analysis shows that the SL1 RNA gene of contemporary pinworms was present in pre-Columbian E. vermicularis by 6110 years ago. We were successful in detecting E. vermicularis aDNA even in coprolites without direct microscopic evidence of the eggs, improving the diagnosis of helminth infections in the past and further
The major histocompatibility complex genes impact pain response in DA and DA.1U rats.
Guo, Yuan; Yao, Fan-Rong; Cao, Dong-Yuan; Li, Li; Wang, Hui-Sheng; Xie, Wen; Zhao, Yan
2015-08-01
Our recent studies have shown that the difference in basal pain sensitivity to mechanical and thermal stimulation between Dark-Agouti (DA) rats and a novel congenic DA.1U rats is major histocompatibility complex (MHC) genes dependent. In the present study, we further used DA and DA.1U rats to investigate the role of MHC genes in formalin-induced pain model by behavioral, electrophysiological and immunohistochemical methods. Behavioral results showed biphasic nociceptive behaviors increased significantly following the intraplantar injection of formalin in the hindpaw of DA and DA.1U rats. The main nociceptive behaviors were lifting and licking, especially in DA rats (P<0.001 and P<0.01). The composite pain scores (CPS) in DA rats were significantly higher than those in DA.1U rats in both phases of the formalin test (P<0.01). Electrophysiological results also showed the biphasic increase in discharge rates of C and Aδ fibers of L5 dorsal root in the two strains, and the net change of the discharge rate of DA rats was significantly higher than that of DA.1U rats (P<0.05). The mechanical thresholds decreased after formalin injection in both strains (P<0.01), and the net change in the mechanical threshold in DA was greater than that in DA.1U rats (P<0.05). The expression of RT1-B, representation of MHC class II molecule, in laminae I-II of L4/5 spinal cord in DA rats was significantly higher than that in DA.1U rats in the respective experimental group (P<0.05). These results suggested that both DA and DA.1U rats exhibited nociceptive responses in formalin-induced pain model and DA rats were more sensitive to noxious chemical stimulus than DA.1U rats, indicating that MHC genes might contribute to the difference in pain sensitivity. Copyright © 2015 Elsevier Inc. All rights reserved.
Wang, Haiyan; Zhu, Libang; Duan, Junling; Wang, Minghui; Yin, Huanshun; Wang, Po; Ai, Shiyun
2018-04-30
2'-O-methyl group on the 3' terminal nucleotide in plant microRNAs, as one kind of RNA methylations, is caused by HEN1 RNA methyltransferase (HENMT1), which is thought to be crucial for ribosome biogenesis and function. Herein, a simple and label-free PEC biosensing method was proposed for assay of HENMT1 activity and inhibitor screening based on peroxidase mimic PtCu nanoframes (PtCu NFs) catalytic signal amplification. In this work, MoS 2 @Graphene quantum dots/Phosphorus-doped rodlike carbon nitride (MoS 2 @GQDs/P-RCN) heterojunction was used as photoactive materials. With the doping of GQDs and the formation of heterojunction, the photoactivity of MoS 2 is greatly improved. After the double-stranded RNA (dsRNA) with 2 nt 3' overhangs was treated with HENMT1 in the presence of S-adenosyl-L-methionine, the 3' terminal nucleotide of the unmethylated dsRNA could be extended under the catalysis of the poly(U) polymerase in the existence of UTP. Poly(A) nucleotide chain modified with carboxyl group was captured on the electrode surface through hybridization reaction and acted as a bridge for the immobilization of reticular DNA-functionalized PtCu NFs (PtCu@DNA). Under the catalysis effect of peroxidase mimics PtCu@DNA towards hydrogen peroxide, O 2- was in situ generated as electron donor and a strong photocurrent was obtained. The proposed PEC bioassay exhibited high selectivity and low detection limit of 3.36ng/mL for HENMT1 activity assay. Furthermore, the inhibition research indicated that chlorpyrifos could inhibit the HENMT1 activity with the IC 50 value of 48.32nM. Copyright © 2017 Elsevier B.V. All rights reserved.
RNA-Seq profiling reveals novel hepatic gene expression pattern in aflatoxin B1 treated rats.
Merrick, B Alex; Phadke, Dhiral P; Auerbach, Scott S; Mav, Deepak; Stiegelmeyer, Suzy M; Shah, Ruchir R; Tice, Raymond R
2013-01-01
Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1), a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG) than microarray analysis, including low copy and novel transcripts related to AFB1's carcinogenic activity compared to feed controls (CTRL). Paired-end reads were mapped to the rat genome (Rn4) with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005) compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT's) on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c. We find the
Zhou, Rui; Park, Juw Won; Chun, Rene F; Lisse, Thomas S; Garcia, Alejandro J; Zavala, Kathryn; Sea, Jessica L; Lu, Zhi-Xiang; Xu, Jianzhong; Adams, John S; Xing, Yi; Hewison, Martin
2017-01-25
Traditionally recognized as an RNA splicing regulator, heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNPC1/C2) can also bind to double-stranded DNA and function in trans as a vitamin D response element (VDRE)-binding protein. As such, hnRNPC1/C2 may couple transcription induced by the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25(OH) 2 D) with subsequent RNA splicing. In MG63 osteoblastic cells, increased expression of the 1,25(OH) 2 D target gene CYP24A1 involved immunoprecipitation of hnRNPC1/C2 with CYP24A1 chromatin and RNA. Knockdown of hnRNPC1/C2 suppressed expression of CYP24A1, but also increased expression of an exon 10-skipped CYP24A1 splice variant; in a minigene model the latter was attenuated by a functional VDRE in the CYP24A1 promoter. In genome-wide analyses, knockdown of hnRNPC1/C2 resulted in 3500 differentially expressed genes and 2232 differentially spliced genes, with significant commonality between groups. 1,25(OH) 2 D induced 324 differentially expressed genes, with 187 also observed following hnRNPC1/C2 knockdown, and a further 168 unique to hnRNPC1/C2 knockdown. However, 1,25(OH) 2 D induced only 10 differentially spliced genes, with no overlap with differentially expressed genes. These data indicate that hnRNPC1/C2 binds to both DNA and RNA and influences both gene expression and RNA splicing, but these actions do not appear to be linked through 1,25(OH) 2 D-mediated induction of transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.
Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A
2018-05-01
Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.
Genetic variants in the PIWI-piRNA pathway gene DCP1A predict melanoma disease-specific survival.
Zhang, Weikang; Liu, Hongliang; Yin, Jieyun; Wu, Wenting; Zhu, Dakai; Amos, Christopher I; Fang, Shenying; Lee, Jeffrey E; Li, Yi; Han, Jiali; Wei, Qingyi
2016-12-15
The Piwi-piRNA pathway is important for germ cell maintenance, genome integrity, DNA methylation and retrotransposon control and thus may be involved in cancer development. In this study, we comprehensively analyzed prognostic roles of 3,116 common SNPs in PIWI-piRNA pathway genes in melanoma disease-specific survival. A published genome-wide association study (GWAS) by The University of Texas M.D. Anderson Cancer Center was used to identify associated SNPs, which were later validated by another GWAS from the Harvard Nurses' Health Study and Health Professionals Follow-up Study. After multiple testing correction, we found that there were 27 common SNPs in two genes (PIWIL4 and DCP1A) with false discovery rate < 0.2 in the discovery dataset. Three tagSNPs (i.e., rs7933369 and rs508485 in PIWIL4; rs11551405 in DCP1A) were replicated. The rs11551405 A allele, located at the 3' UTR microRNA binding site of DCP1A, was associated with an increased risk of melanoma disease-specific death in both discovery dataset [adjusted Hazards ratio (HR) = 1.66, 95% confidence interval (CI) = 1.21-2.27, p =1.50 × 10 -3 ] and validation dataset (HR = 1.55, 95% CI = 1.03-2.34, p = 0.038), compared with the C allele, and their meta-analysis showed an HR of 1.62 (95% CI, 1.26-2.08, p =1.55 × 10 -4 ). Using RNA-seq data from the 1000 Genomes Project, we found that DCP1A mRNA expression levels increased significantly with the A allele number of rs11551405. Additional large, prospective studies are needed to validate these findings. © 2016 UICC.
RNA Binding Protein-Mediated Post-Transcriptional Gene Regulation in Medulloblastoma
Bish, Rebecca; Vogel, Christine
2014-01-01
Medulloblastoma, the most common malignant brain tumor in children, is a disease whose mechanisms are now beginning to be uncovered by high-throughput studies of somatic mutations, mRNA expression patterns, and epigenetic profiles of patient tumors. One emerging theme from studies that sequenced the tumor genomes of large cohorts of medulloblastoma patients is frequent mutation of RNA binding proteins. Proteins which bind multiple RNA targets can act as master regulators of gene expression at the post-transcriptional level to co-ordinate cellular processes and alter the phenotype of the cell. Identification of the target genes of RNA binding proteins may highlight essential pathways of medulloblastomagenesis that cannot be detected by study of transcriptomics alone. Furthermore, a subset of RNA binding proteins are attractive drug targets. For example, compounds that are under development as anti-viral targets due to their ability to inhibit RNA helicases could also be tested in novel approaches to medulloblastoma therapy by targeting key RNA binding proteins. In this review, we discuss a number of RNA binding proteins, including Musashi1 (MSI1), DEAD (Asp-Glu-Ala-Asp) box helicase 3 X-linked (DDX3X), DDX31, and cell division cycle and apoptosis regulator 1 (CCAR1), which play potentially critical roles in the growth and/or maintenance of medulloblastoma. PMID:24608801
Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin
2012-02-01
Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.
Qi, Weiwei; Zhu, Tong; Tian, Zhongrui; Li, Chaobin; Zhang, Wei; Song, Rentao
2016-08-11
CRISPR/Cas9 genome editing strategy has been applied to a variety of species and the tRNA-processing system has been used to compact multiple gRNAs into one synthetic gene for manipulating multiple genes in rice. We optimized and introduced the multiplex gene editing strategy based on the tRNA-processing system into maize. Maize glycine-tRNA was selected to design multiple tRNA-gRNA units for the simultaneous production of numerous gRNAs under the control of one maize U6 promoter. We designed three gRNAs for simplex editing and three multiple tRNA-gRNA units for multiplex editing. The results indicate that this system not only increased the number of targeted sites but also enhanced mutagenesis efficiency in maize. Additionally, we propose an advanced sequence selection of gRNA spacers for relatively more efficient and accurate chromosomal fragment deletion, which is important for complete abolishment of gene function especially long non-coding RNAs (lncRNAs). Our results also indicated that up to four tRNA-gRNA units in one expression cassette design can still work in maize. The examples reported here demonstrate the utility of the tRNA-processing system-based strategy as an efficient multiplex genome editing tool to enhance maize genetic research and breeding.
Song, Yuepeng; Tian, Min; Ci, Dong; Zhang, Deqiang
2015-01-01
Previous studies showed sex-specific DNA methylation and expression of candidate genes in bisexual flowers of andromonoecious poplar, but the regulatory relationship between methylation and microRNAs (miRNAs) remains unclear. To investigate whether the methylation of miRNA genes regulates gene expression in bisexual flower development, the methylome, microRNA, and transcriptome were examined in female and male flowers of andromonoecious poplar. 27 636 methylated coding genes and 113 methylated miRNA genes were identified. In the coding genes, 64.5% of the methylated reads mapped to the gene body region; by contrast, 60.7% of methylated reads in miRNA genes mainly mapped in the 5′ and 3′ flanking regions. CHH methylation showed the highest methylation levels and CHG showed the lowest methylation levels. Correlation analysis showed a significant, negative, strand-specific correlation of methylation and miRNA gene expression (r=0.79, P <0.05). The methylated miRNA genes included eight long miRNAs (lmiRNAs) of 24 nucleotides and 11 miRNAs related to flower development. miRNA172b might play an important role in the regulation of bisexual flower development-related gene expression in andromonoecious poplar, via modification of methylation. Gynomonoecious, female, and male poplars were used to validate the methylation patterns of the miRNA172b gene, implying that hyper-methylation in andromonoecious and gynomonoecious poplar might function as an important regulator in bisexual flower development. Our data provide a useful resource for the study of flower development in poplar and improve our understanding of the effect of epigenetic regulation on genes other than protein-coding genes. PMID:25617468
Dimitrova, Nadya; Zamudio, Jesse R.; Jong, Robyn M.; Soukup, Dylan; Resnick, Rebecca; Sarma, Kavitha; Ward, Amanda J.; Raj, Arjun; Lee, Jeannie; Sharp, Phillip A.; Jacks, Tyler
2014-01-01
SUMMARY The p53-regulated long non-coding RNA lincRNA-p21 has been proposed to act in trans via several mechanisms ranging from repressing genes in the p53 transcriptional network to regulating mRNA translation and protein stability. To further examine lincRNA-p21 function we generated a conditional knockout mouse model. We find that lincRNA-p21 predominantly functions in cis to activate expression of its neighboring gene, p21. Mechanistically, we show that lincRNA-p21 acts in concert with hnRNP-K as a co-activator for p53-dependent p21 transcription. Additional phenotypes of lincRNA-p21 deficiency could be attributed to diminished p21 levels, including deregulated expression and altered chromatin state of some Polycomb target genes, defective G1/S checkpoint, increased proliferation rates, and enhanced reprogramming efficiency. These findings indicate that lincRNA-p21 affects global gene expression and influences the p53 tumor suppressor pathway by acting in cis as a locus-restricted co-activator for p53-mediated p21 expression. PMID:24857549
Murakami, Shinya; Kuehnle, Katrin; Stern, David B.
2005-01-01
Numerous nuclear gene products are required for the correct expression of organellar genes. One such gene in the green alga Chlamydomonas reinhardtii is MCD1, whose product is required for stability of the chloroplast-encoded petD mRNA. In mcd1 mutants, which are non-photosynthetic, petD mRNA is degraded by a 5′–3′ exonuclease activity, resulting in a failure to synthesize its product, subunit IV of the cytochrome b 6/f complex. Here, we report the sequence of the wild-type MCD1 gene, which encodes a large and novel putative protein. Analysis of three mutant alleles showed that two harbored large deletions, but that one allele, mcd1-2, had a single base change resulting in a nonsense codon near the N-terminus. This same mutant allele can be suppressed by a second-site mutation in the nuclear MCD2 gene, whereas mcd2-1 cannot suppress the deletion in mcd1-1 (Esposito,D. Higgs,D.C. Drager,R.G. Stern, D.B. and Girard-Bascou,J. (2001) Curr. Genet., 39, 40–48). We report the cloning of mcd2-1, and show that the mutation lies in a tRNASer(CGA), which has been modified to translate the nonsense codon in mcd1-2. We discuss how the existence of a large tRNASer gene family may permit this suppression without pleiotropic consequences. PMID:15947135
Evaluation of RNA from human trabecular bone and identification of stable reference genes.
Cepollaro, Simona; Della Bella, Elena; de Biase, Dario; Visani, Michela; Fini, Milena
2018-06-01
The isolation of good quality RNA from tissues is an essential prerequisite for gene expression analysis to study pathophysiological processes. This study evaluated the RNA isolated from human trabecular bone and defined a set of stable reference genes. After pulverization, RNA was extracted with a phenol/chloroform method and then purified using silica columns. The A260/280 ratio, A260/230 ratio, RIN, and ribosomal ratio were measured to evaluate RNA quality and integrity. Moreover, the expression of six candidates was analyzed by qPCR and different algorithms were applied to assess reference gene stability. A good purity and quality of RNA was achieved according to A260/280 and A260/230 ratios, and RIN values. TBP, YWHAZ, and PGK1 were the most stable reference genes that should be used for gene expression analysis. In summary, the method proposed is suitable for gene expression evaluation in human bone and a set of reliable reference genes has been identified. © 2017 Wiley Periodicals, Inc.
Qian, Frank; Feng, Ye; Zheng, Yonglan; Ogundiran, Temidayo O.; Ojengbede, Oladosu; Zheng, Wei; Blot, William; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Nathanson, Katherine L.; Hennis, Anselm; Nemesure, Barbara; Ambs, Stefan; Kolonel, Laurence N.; Olopade, Olufunmilayo I.; Haiman, Christopher A.; Huo, Dezheng
2016-01-01
Background MicroRNAs (miRNA) regulate breast biology by binding to specific RNA sequences, leading to RNA degradation and inhibition of translation of their target genes. While germline genetic variations may disrupt some of these interactions between miRNAs and their targets, studies assessing the relationship between genetic variations in the miRNA network and breast cancer risk are still limited, particularly among women of African ancestry. Methods We systematically put together a list of 822 and 10,468 genetic variants among primary miRNA sequences and 38 genes in the miRNA biogenesis pathway, respectively; and examined their association with breast cancer risk in the ROOT consortium which includes women of African ancestry. Findings were replicated in an independent consortium. Logistic regression was used to estimate the odds ratio (OR) and 95% confidence intervals (CI). Results For overall breast cancer risk, three single nucleotide polymorphisms (SNPs) in miRNA biogenesis genes DROSHA rs78393591 (OR=0.69, 95% CI: 0.55–0.88, P=0.003), ESR1 rs523736 (OR=0.88, 95% CI: 0.82–0.95, P=3.99×10−4), and ZCCHC11 rs114101502 (OR=1.33, 95% CI: 1.11–1.59, P=0.002) and one SNP in primary miRNA sequence (rs116159732 in miR-6826, OR=0.74, 95% CI: 0.63–0.89, P=0.001) were found to have significant associations in both discovery and validation phases. In a subgroup analysis, two SNPs were associated with risk of estrogen receptor (ER)-negative breast cancer and three SNPs were associated with risk of ER-positive breast cancer. Conclusion Several variants in miRNA and miRNA biogenesis pathway genes were associated with breast cancer risk. Risk associations varied by ER status, suggesting potential new mechanisms in etiology. PMID:27380242
Qian, Frank; Feng, Ye; Zheng, Yonglan; Ogundiran, Temidayo O; Ojengbede, Oladosu; Zheng, Wei; Blot, William; Ambrosone, Christine B; John, Esther M; Bernstein, Leslie; Hu, Jennifer J; Ziegler, Regina G; Nyante, Sarah; Bandera, Elisa V; Ingles, Sue A; Press, Michael F; Nathanson, Katherine L; Hennis, Anselm; Nemesure, Barbara; Ambs, Stefan; Kolonel, Laurence N; Olopade, Olufunmilayo I; Haiman, Christopher A; Huo, Dezheng
2016-10-01
MicroRNAs (miRNA) regulate breast biology by binding to specific RNA sequences, leading to RNA degradation and inhibition of translation of their target genes. While germline genetic variations may disrupt some of these interactions between miRNAs and their targets, studies assessing the relationship between genetic variations in the miRNA network and breast cancer risk are still limited, particularly among women of African ancestry. We systematically put together a list of 822 and 10,468 genetic variants among primary miRNA sequences and 38 genes in the miRNA biogenesis pathway, respectively; and examined their association with breast cancer risk in the ROOT consortium which includes women of African ancestry. Findings were replicated in an independent consortium. Logistic regression was used to estimate the odds ratio (OR) and 95 % confidence intervals (CI). For overall breast cancer risk, three single-nucleotide polymorphisms (SNPs) in miRNA biogenesis genes DROSHA rs78393591 (OR = 0.69, 95 % CI: 0.55-0.88, P = 0.003), ESR1 rs523736 (OR = 0.88, 95 % CI: 0.82-0.95, P = 3.99 × 10(-4)), and ZCCHC11 rs114101502 (OR = 1.33, 95 % CI: 1.11-1.59, P = 0.002), and one SNP in primary miRNA sequence (rs116159732 in miR-6826, OR = 0.74, 95 % CI: 0.63-0.89, P = 0.001) were found to have significant associations in both discovery and validation phases. In a subgroup analysis, two SNPs were associated with risk of estrogen receptor (ER)-negative breast cancer, and three SNPs were associated with risk of ER-positive breast cancer. Several variants in miRNA and miRNA biogenesis pathway genes were associated with breast cancer risk. Risk associations varied by ER status, suggesting potential new mechanisms in etiology.
Hinske, Ludwig Christian; Galante, Pedro A. F.; Limbeck, Elisabeth; Möhnle, Patrick; Parmigiani, Raphael B.; Ohno-Machado, Lucila; Camargo, Anamaria A.; Kreth, Simone
2015-01-01
About half of the known miRNA genes are located within protein-coding host genes, and are thus subject to co-transcription. Accumulating data indicate that this coupling may be an intrinsic mechanism to directly regulate the host gene’s expression, constituting a negative feedback loop. Inevitably, the cell requires a yet largely unknown repertoire of methods to regulate this control mechanism. We propose APA as one possible mechanism by which negative feedback of intronic miRNA on their host genes might be regulated. Using in-silico analyses, we found that host genes that contain seed matching sites for their intronic miRNAs yield longer 32UTRs with more polyadenylation sites. Additionally, the distribution of polyadenylation signals differed significantly between these host genes and host genes of miRNAs that do not contain potential miRNA binding sites. We then transferred these in-silico results to a biological example and investigated the relationship between ZFR and its intronic miRNA miR-579 in a U87 cell line model. We found that ZFR is targeted by its intronic miRNA miR-579 and that alternative polyadenylation allows differential targeting. We additionally used bioinformatics analyses and RNA-Seq to evaluate a potential cross-talk between intronic miRNAs and alternative polyadenylation. CPSF2, a gene previously associated with alternative polyadenylation signal recognition, might be linked to intronic miRNA negative feedback by altering polyadenylation signal utilization. PMID:25799583
Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun
1997-01-01
ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to
Makeyev, Eugene V; Bamford, Dennis H
2002-12-01
Recent genetic data suggest that proteins homologous to a plant RNA-dependent RNA polymerase (RdRP) play a central role in posttranscriptional gene silencing (PTGS) in many organisms. We show here that purified recombinant protein QDE-1, a genetic component of PTGS ("quelling") in the fungus Neurospora crassa, possesses RNA polymerase activity in vitro. The full-length enzyme and its enzymatically active C-terminal fragment perform two different reactions on single-stranded RNA templates, synthesizing either extensive RNA chains that form template-length duplexes or approximately 9-21-mer complementary RNA oligonucleotides scattered along the entire template. QDE-1 supports both de novo and primer-dependent initiation mechanisms. These results suggest that several distinct activities of cell-encoded RdRPs can be employed for efficient PTGS in vivo.
Song, Yuepeng; Tian, Min; Ci, Dong; Zhang, Deqiang
2015-04-01
Previous studies showed sex-specific DNA methylation and expression of candidate genes in bisexual flowers of andromonoecious poplar, but the regulatory relationship between methylation and microRNAs (miRNAs) remains unclear. To investigate whether the methylation of miRNA genes regulates gene expression in bisexual flower development, the methylome, microRNA, and transcriptome were examined in female and male flowers of andromonoecious poplar. 27 636 methylated coding genes and 113 methylated miRNA genes were identified. In the coding genes, 64.5% of the methylated reads mapped to the gene body region; by contrast, 60.7% of methylated reads in miRNA genes mainly mapped in the 5' and 3' flanking regions. CHH methylation showed the highest methylation levels and CHG showed the lowest methylation levels. Correlation analysis showed a significant, negative, strand-specific correlation of methylation and miRNA gene expression (r=0.79, P <0.05). The methylated miRNA genes included eight long miRNAs (lmiRNAs) of 24 nucleotides and 11 miRNAs related to flower development. miRNA172b might play an important role in the regulation of bisexual flower development-related gene expression in andromonoecious poplar, via modification of methylation. Gynomonoecious, female, and male poplars were used to validate the methylation patterns of the miRNA172b gene, implying that hyper-methylation in andromonoecious and gynomonoecious poplar might function as an important regulator in bisexual flower development. Our data provide a useful resource for the study of flower development in poplar and improve our understanding of the effect of epigenetic regulation on genes other than protein-coding genes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
A Pre-mRNA-Splicing Factor Is Required for RNA-Directed DNA Methylation in Arabidopsis
Huang, Chao-Feng; Miki, Daisuke; Tang, Kai; Zhou, Hao-Ran; Zheng, Zhimin; Chen, Wei; Ma, Ze-Yang; Yang, Lan; Zhang, Heng; Liu, Renyi; He, Xin-Jian; Zhu, Jian-Kang
2013-01-01
Cytosine DNA methylation is a stable epigenetic mark that is frequently associated with the silencing of genes and transposable elements (TEs). In Arabidopsis, the establishment of DNA methylation is through the RNA-directed DNA methylation (RdDM) pathway. Here, we report the identification and characterization of RDM16, a new factor in the RdDM pathway. Mutation of RDM16 reduced the DNA methylation levels and partially released the silencing of a reporter gene as well as some endogenous genomic loci in the DNA demethylase ros1-1 mutant background. The rdm16 mutant had morphological defects and was hypersensitive to salt stress and abscisic acid (ABA). Map-based cloning and complementation test led to the identification of RDM16, which encodes a pre-mRNA-splicing factor 3, a component of the U4/U6 snRNP. RNA-seq analysis showed that 308 intron retention events occurred in rdm16, confirming that RDM16 is involved in pre-mRNA splicing in planta. RNA-seq and mRNA expression analysis also revealed that the RDM16 mutation did not affect the pre-mRNA splicing of known RdDM genes, suggesting that RDM16 might be directly involved in RdDM. Small RNA expression analysis on loci showing RDM16-dependent DNA methylation suggested that unlike the previously reported putative splicing factor mutants, rdm16 did not affect small RNA levels; instead, the rdm16 mutation caused a decrease in the levels of Pol V transcripts. ChIP assays revealed that RDM16 was enriched at some Pol V target loci. Our results suggest that RDM16 regulates DNA methylation through influencing Pol V transcript levels. Finally, our genome-wide DNA methylation analysis indicated that RDM16 regulates the overall methylation of TEs and gene-surrounding regions, and preferentially targets Pol IV-dependent DNA methylation loci and the ROS1 target loci. Our work thus contributes to the understanding of RdDM and its interactions with active DNA demethylation. PMID:24068953
Evolutionary relationships between miRNA genes and their activity.
Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue
2012-12-22
The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.
Towards a comprehensive picture of C-to-U RNA editing sites in angiosperm mitochondria.
Edera, Alejandro A; Gandini, Carolina L; Sanchez-Puerta, M Virginia
2018-05-14
Our understanding of the dynamic and evolution of RNA editing in angiosperms is in part limited by the few editing sites identified to date. This study identified 10,217 editing sites from 17 diverse angiosperms. Our analyses confirmed the universality of certain features of RNA editing, and offer new evidence behind the loss of editing sites in angiosperms. RNA editing is a post-transcriptional process that substitutes cytidines (C) for uridines (U) in organellar transcripts of angiosperms. These substitutions mostly take place in mitochondrial messenger RNAs at specific positions called editing sites. By means of publicly available RNA-seq data, this study identified 10,217 editing sites in mitochondrial protein-coding genes of 17 diverse angiosperms. Even though other types of mismatches were also identified, we did not find evidence of non-canonical editing processes. The results showed an uneven distribution of editing sites among species, genes, and codon positions. The analyses revealed that editing sites were conserved across angiosperms but there were some species-specific sites. Non-synonymous editing sites were particularly highly conserved (~ 80%) across the plant species and were efficiently edited (80% editing extent). In contrast, editing sites at third codon positions were poorly conserved (~ 30%) and only partially edited (~ 40% editing extent). We found that the loss of editing sites along angiosperm evolution is mainly occurring by replacing editing sites with thymidines, instead of a degradation of the editing recognition motif around editing sites. Consecutive and highly conserved editing sites had been replaced by thymidines as result of retroprocessing, by which edited transcripts are reverse transcribed to cDNA and then integrated into the genome by homologous recombination. This phenomenon was more pronounced in eudicots, and in the gene cox1. These results suggest that retroprocessing is a widespread driving force underlying the loss
A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression
Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.
2017-01-01
A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250
A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.
Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T
2017-03-01
A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.
Makeyev, A V; Chkheidze, A N; Liebhaber, S A
1999-08-27
Gene families normally expand by segmental genomic duplication and subsequent sequence divergence. Although copies of partially or fully processed mRNA transcripts are occasionally retrotransposed into the genome, they are usually nonfunctional ("processed pseudogenes"). The two major cytoplasmic poly(C)-binding proteins in mammalian cells, alphaCP-1 and alphaCP-2, are implicated in a spectrum of post-transcriptional controls. These proteins are highly similar in structure and are encoded by closely related mRNAs. Based on this close relationship, we were surprised to find that one of these proteins, alphaCP-2, was encoded by a multiexon gene, whereas the second gene, alphaCP-1, was identical to and colinear with its mRNA. The alphaCP-1 and alphaCP-2 genes were shown to be single copy and were mapped to separate chromosomes. The linkage groups encompassing each of the two loci were concordant between mice and humans. These data suggested that the alphaCP-1 gene was generated by retrotransposition of a fully processed alphaCP-2 mRNA and that this event occurred well before the mammalian radiation. The stringent structural conservation of alphaCP-1 and its ubiquitous tissue distribution suggested that the retrotransposed alphaCP-1 gene was rapidly recruited to a function critical to the cell and distinct from that of its alphaCP-2 progenitor.
Lwin, Wint Wah; Park, Ken; Wauson, Matthew; Gao, Qin; Finn, Patricia W; Perkins, David; Khanna, Ajai
2012-07-01
Systems biology is gaining importance in studying complex systems such as the functional interconnections of human genes [1]. To investigate the molecular interactions involved in T cell immune responses, we used databases of physical gene-gene interactions to constructed molecular interaction networks (interconnections) with R language algorithms. This helped to identify highly interconnected "hub" genes AT(1)P5C1, IL6ST, PRKCZ, MYC, FOS, JUN, and MAPK1. We hypothesized that suppression of these hub genes in the gene network would result in significant phenotypic effects on T cells and examined this in vitro. The molecular interaction networks were then analyzed and visualized with Cytoscape. Jurkat and HeLa cells were transfected with siRNA for the selected hub genes. Cell proliferation was measured using ATP luminescence and BrdU labeling, which were measured 36, 72, and 96 h after activation. Following T cell stimulation, we found a significant decrease in ATP production (P < 0.05) when the hub genes ATP5C1 and PRKCZ were knocked down using siRNA transfection, whereas no difference in ATP production was observed in siRNA transfected HeLa cells. However, HeLa cells showed a significant (P < 0.05) decrease in cell proliferation when the genes MAPK1, IL6ST, ATP5C1, JUN, and FOS were knocked down. In both Jurkat and HeLa cells, targeted gene knockdown using siRNA showed decreased cell proliferation and ATP production in both Jurkat and HeLa cells. However, Jurkat T cells and HELA cells use different hub genes to regulate activation responses. This experiment provides proof of principle of applying siRNA knockdown of T cell hub genes to evaluate their proliferative capacity and ATP production. This novel concept outlines a systems biology approach to identify hub genes for targeted therapeutics. Published by Elsevier Inc.
Bauer, William J.; Heath, Jason; Jenkins, Jermaine L.; Kielkopf, Clara L.
2012-01-01
T-cell intracellular antigen-1 (TIA-1) regulates developmental and stress-responsive pathways through distinct activities at the levels of alternative pre-mRNA splicing and mRNA translation. The TIA-1 polypeptide contains three RNA recognition motifs (RRMs). The central RRM2 and C-terminal RRM3 associate with cellular mRNAs. The N-terminal RRM1 enhances interactions of a C-terminal Q-rich domain of TIA-1 with the U1-C splicing factor, despite linear separation of the domains in the TIA-1 sequence. Given the expanded functional repertoire of the RRM family, it was unknown whether TIA-1 RRM1 contributes to RNA binding as well as documented protein interactions. To address this question, we used isothermal titration calorimetry and small-angle X-ray scattering (SAXS) to dissect the roles of the TIA-1 RRMs in RNA recognition. Notably, the fas RNA exhibited two binding sites with indistinguishable affinities for TIA-1. Analyses of TIA-1 variants established that RRM1 was dispensable for binding AU-rich fas sites, yet all three RRMs were required to bind a polyU RNA with high affinity. SAXS analyses demonstrated a `V' shape for a TIA-1 construct comprising the three RRMs, and revealed that its dimensions became more compact in the RNA-bound state. The sequence-selective involvement of TIA-1 RRM1 in RNA recognition suggests a possible role for RNA sequences in regulating the distinct functions of TIA-1. Further implications for U1-C recruitment by the adjacent TIA-1 binding sites of the fas pre-mRNA and the bent TIA-1 shape, which organizes the N- and C-termini on the same side of the protein, are discussed. PMID:22154808
Progression through the spliceosome cycle requires Prp38p function for U4/U6 snRNA dissociation.
Xie, J; Beickman, K; Otte, E; Rymond, B C
1998-01-01
The elaborate and energy-intensive spliceosome assembly pathway belies the seemingly simple chemistry of pre-mRNA splicing. Prp38p was previously identified as a protein required in vivo and in vitro for the first pre-mRNA cleavage reaction catalyzed by the spliceosome. Here we show that Prp38p is a unique component of the U4/U6.U5 tri-small nuclear ribonucleoprotein (snRNP) particle and is necessary for an essential step late in spliceosome maturation. Without Prp38p activity spliceosomes form, but arrest in a catalytically impaired state. Functional spliceosomes shed U4 snRNA before 5' splice-site cleavage. In contrast, Prp38p-defective spliceosomes retain U4 snRNA bound to its U6 snRNA base-pairing partner. Prp38p is the first tri-snRNP-specific protein shown to be dispensable for assembly, but required for conformational changes which lead to catalytic activation of the spliceosome. PMID:9582287
HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period
2012-01-01
Background Recent evidence proposes a novel concept that mammalian natural antisense RNAs play important roles in cellular homeostasis by regulating the expression of several genes. Identification and characterization of retroviral antisense RNA would provide new insights into mechanisms of replication and pathogenesis. HIV-1 encoded-antisense RNAs have been reported, although their structures and functions remain to be studied. We have tried to identify and characterize antisense RNAs of HIV-1 and their function in viral infection. Results Characterization of transcripts of HEK293T cells that were transiently transfected with an expression plasmid with HIV-1NL4–3 DNA in the antisense orientation showed that various antisense transcripts can be expressed. By screening and characterizing antisense RNAs in HIV-1NL4–3-infected cells, we defined the primary structure of a major form of HIV-1 antisense RNAs, which corresponds to a variant of previously reported ASP mRNA. This 2.6 kb RNA was transcribed from the U3 region of the 3′ LTR and terminated at the env region in acutely or chronically infected cell lines and acutely infected human peripheral blood mononuclear cells. Reporter assays clearly demonstrated that the HIV-1 LTR harbours promoter activity in the reverse orientation. Mutation analyses suggested the involvement of NF-κΒ binding sites in the regulation of antisense transcription. The antisense RNA was localized in the nuclei of the infected cells. The expression of this antisense RNA suppressed HIV-1 replication for more than one month. Furthermore, the specific knockdown of this antisense RNA enhanced HIV-1 gene expression and replication. Conclusions The results of the present study identified an accurate structure of the major form of antisense RNAs expressed from the HIV-1NL4–3 provirus and demonstrated its nuclear localization. Functional studies collectively demonstrated a new role of the antisense RNA in viral replication. Thus, we suggest
miRNA-dependent gene silencing involving Ago2-mediated cleavage of a circular antisense RNA
Hansen, Thomas B; Wiklund, Erik D; Bramsen, Jesper B; Villadsen, Sune B; Statham, Aaron L; Clark, Susan J; Kjems, Jørgen
2011-01-01
MicroRNAs (miRNAs) are ∼22 nt non-coding RNAs that typically bind to the 3′ UTR of target mRNAs in the cytoplasm, resulting in mRNA destabilization and translational repression. Here, we report that miRNAs can also regulate gene expression by targeting non-coding antisense transcripts in human cells. Specifically, we show that miR-671 directs cleavage of a circular antisense transcript of the Cerebellar Degeneration-Related protein 1 (CDR1) locus in an Ago2-slicer-dependent manner. The resulting downregulation of circular antisense has a concomitant decrease in CDR1 mRNA levels, independently of heterochromatin formation. This study provides the first evidence for non-coding antisense transcripts as functional miRNA targets, and a novel regulatory mechanism involving a positive correlation between mRNA and antisense circular RNA levels. PMID:21964070
Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis
2018-01-01
The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.
Gumerov, Vadim; Hegyi, Hedi
2015-10-08
While hundreds of genes have been implicated already in the etiology of schizophrenia, the exact cause is not known or the disease is considered multigenic in origin. Recent discoveries of new types of RNAs and the gradual elimination of the "junk DNA" hypothesis refocused the attention on the noncoding part of the human genome. Here we re-analyzed a recent dataset of differentially methylated genes from schizophrenic patients and cross-tabulated them with cis regulatory and repetitive elements and microRNAs known to be involved in schizophrenia. We found that the number of schizophrenia-related (SZ) microRNA targets follows a scale-free distribution with several microRNA hubs and that schizophrenia-related microRNAs with shared targets form a small-world network. The top ten microRNAs with the highest number of SZ gene targets regulate approximately 80 % of all microRNA-regulated genes whereas the top two microRNAs regulate 40-52 % of all such genes. We also found that genes that are regulated by the same microRNAs tend to have more protein-protein interactions than randomly selected schizophrenia genes. This highlights the role microRNAs possibly play in coordinating the abundance of interacting proteins, an important function that has not been sufficiently explored before. The analysis revealed that GABBR1 is regulated by both of the top two microRNAs and acts as a hub by interacting with many schizophrenia-related genes and sharing several types of transcription-binding sites with its interactors. We also found that differentially methylated repetitive elements are significantly more methylated in schizophrenia, pointing out their potential role in the disease. We find that GABBR1 has a central importance in schizophrenia, even if no direct cause and effect have been shown for it for the time. In addition to being a hub in microRNA-derived regulatory pathways and protein-protein interactions, its centrality is also supported by the high number of cis regulatory
Kurtz, David T.; Feigelson, Philip
1977-01-01
A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184
Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R
2009-11-01
RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.
Hayes, Michael L; Giang, Karolyn; Berhane, Beniam; Mulligan, R Michael
2013-12-20
Many transcripts expressed from plant organelle genomes are modified by C-to-U RNA editing. Nuclear encoded pentatricopeptide repeat (PPR) proteins are required as RNA binding specificity determinants in the RNA editing mechanism. Bioinformatic analysis has shown that most of the Arabidopsis PPR proteins necessary for RNA editing events include a C-terminal portion that shares structural characteristics with a superfamily of deaminases. The DYW deaminase domain includes a highly conserved zinc binding motif that shares characteristics with cytidine deaminases. The Arabidopsis PPR genes, ELI1 and DOT4, both have DYW deaminase domains and are required for single RNA editing events in chloroplasts. The ELI1 DYW deaminase domain was expressed as a recombinant protein in Escherichia coli and was shown to bind two zinc atoms per polypeptide. Thus, the DYW deaminase domain binds a zinc metal ion, as expected for a cytidine deaminase, and is potentially the catalytic component of an editing complex. Genetic complementation experiments demonstrate that large portions of the DYW deaminase domain of ELI1 may be eliminated, but the truncated genes retain the ability to restore editing site conversion in a mutant plant. These results suggest that the catalytic activity can be supplied in trans by uncharacterized protein(s) of the editosome.
Zhang, Dong-Xiu; Spiering, Martin J; Nuss, Donald L
2014-01-01
An inducible RNA-silencing pathway, involving a single Dicer protein, DCL2, and a single Argonaute protein, AGL2, was recently shown to serve as an effective antiviral defense response in the chestnut blight fungus Cryphonectria parasitica. Eukaryotic RNA-dependent RNA polymerases (RdRPs) are frequently involved in transcriptional and posttranscriptional gene silencing and antiviral defense. We report here the identification and characterization of four RdRP genes (rdr1-4) in the C. parasitica genome. Sequence relationships with other eukaryotic RdRPs indicated that RDR1 and RDR2 were closely related to QDE-1, an RdRP involved in RNA silencing ("quelling") in Neurospora crassa, whereas RDR3 was more closely related to the meiotic silencing gene SAD-1 in N. crassa. The RdRP domain of RDR4, related to N. crassa RRP-3 of unknown function, was truncated and showed evidence of alternative splicing. Similar to reports for dcl2 and agl2, the expression levels for rdr3 and rdr4 increased after hypovirus CHV-1/EP713 infection, while expression levels of rdr1 and rdr2 were unchanged. The virus-responsive induction patterns for rdr3 and rdr4 were altered in the Δdcl2 and Δagl2 strains, suggesting some level of interaction between rdr3 and rdr4 and the dcl2/agl2 silencing pathway. Single rdr gene knockouts Δrdr1-4, double knockouts Δrdr1/2, Δrdr2/3, Δrdr1/3, and a triple knockout, Δrdr1/2/3, were generated and evaluated for effects on fungal phenotype, the antiviral defense response, viral RNA recombination activity and transposon expression. None of the single or multiple rdr knockout strains displayed any phenotypic differences from the parental strains with or without viral infection or any significant changes in viral RNA accumulation or recombination activity or transposon RNA accumulation, indicating no detectable contribution by the C. parasitica rdr genes to these processes.
Liu, Yali; Liu, Li; Zhan, Yonghao; Zhuang, Chengle; Lin, Junhao; Chen, Mingwei; Li, Jianfa; Cai, Zhiming; Huang, Weiren; Zhang, Yong
2016-01-01
CRISPR-Cas9 system uses a guide RNA which functions in conjunction with Cas9 proteins to target a DNA and cleaves double-strand DNA. This phenomenon raises a question whether an artificial small RNA (asRNA), composed of a Dicer–binding RNA element and an antisense RNA, could also be used to induce Dicer to process and degrade a specific RNA. If so, we could develop a new method which is named DICERi for gene silencing or RNA editing. To prove the feasibility of asRNA, we selected MALAT-1 as target and used Hela and MDA-MB-231 cells as experimental models. The results of qRT-PCR showed that the introduction of asRNA decreased the relative expression level of target gene significantly. Next, we analyzed cell proliferation using CCK-8 and EdU staining assays, and then cell migration using wound scratch and Transwell invasion assays. We found that cell proliferation and cell migration were both suppressed remarkably after asRNA was expressed in Hela and MDA-MB-231 cells. Cell apoptosis was also detected through Hoechst staining and ELISA assays and the data indicated that he numbers of apoptotic cell in experimental groups significantly increased compared with negative controls. In order to prove that the gene silencing effects were caused by Dicer, we co-transfected shRNA silencing Dicer and asRNA. The relative expression levels of Dicer and MALAT-1 were both detected and the results indicated that when the cleavage role of Dicer was silenced, the relative expression level of MALAT-1 was not affected after the introduction of asRNA. All the above results demonstrated that these devices directed by Dicer effectively excised target RNA and repressed the target genes, thus causing phenotypic changes. Our works adds a new dimension to gene regulating technologies and may have broad applications in construction of gene circuits. PMID:27231846
Xu, Wen; Liu, Yuchen; Liu, Yali; Liu, Li; Zhan, Yonghao; Zhuang, Chengle; Lin, Junhao; Chen, Mingwei; Li, Jianfa; Cai, Zhiming; Huang, Weiren; Zhang, Yong
2016-08-23
CRISPR-Cas9 system uses a guide RNA which functions in conjunction with Cas9 proteins to target a DNA and cleaves double-strand DNA. This phenomenon raises a question whether an artificial small RNA (asRNA), composed of a Dicer-binding RNA element and an antisense RNA, could also be used to induce Dicer to process and degrade a specific RNA. If so, we could develop a new method which is named DICERi for gene silencing or RNA editing. To prove the feasibility of asRNA, we selected MALAT-1 as target and used Hela and MDA-MB-231 cells as experimental models. The results of qRT-PCR showed that the introduction of asRNA decreased the relative expression level of target gene significantly. Next, we analyzed cell proliferation using CCK-8 and EdU staining assays, and then cell migration using wound scratch and Transwell invasion assays. We found that cell proliferation and cell migration were both suppressed remarkably after asRNA was expressed in Hela and MDA-MB-231 cells. Cell apoptosis was also detected through Hoechst staining and ELISA assays and the data indicated that he numbers of apoptotic cell in experimental groups significantly increased compared with negative controls. In order to prove that the gene silencing effects were caused by Dicer, we co-transfected shRNA silencing Dicer and asRNA. The relative expression levels of Dicer and MALAT-1 were both detected and the results indicated that when the cleavage role of Dicer was silenced, the relative expression level of MALAT-1 was not affected after the introduction of asRNA. All the above results demonstrated that these devices directed by Dicer effectively excised target RNA and repressed the target genes, thus causing phenotypic changes. Our works adds a new dimension to gene regulating technologies and may have broad applications in construction of gene circuits.
Ito, Yoichiro; Kitagawa, Takao; Yamanishi, Mamoru; Katahira, Satoshi; Izawa, Shingo; Irie, Kenji; Furutani-Seiki, Makoto; Matsuyama, Takashi
2016-11-15
Post-transcriptional upregulation is an effective way to increase the expression of transgenes and thus maximize the yields of target chemicals from metabolically engineered organisms. Refractory elements in the 3' untranslated region (UTR) that increase mRNA half-life might be available. In Saccharomyces cerevisiae, several terminator regions have shown activity in increasing the production of proteins by upstream coding genes; among these terminators the DIT1 terminator has the highest activity. Here, we found in Saccharomyces cerevisiae that two resident trans-acting RNA-binding proteins (Nab6p and Pap1p) enhance the activity of the DIT1 terminator through the cis element GUUCG/U within the 3'-UTR. These two RNA-binding proteins could upregulate a battery of cell-wall-related genes. Mutagenesis of the DIT1 terminator improved its activity by a maximum of 500% of that of the standard PGK1 terminator. Further understanding and improvement of this system will facilitate inexpensive and stable production of complicated organism-derived drugs worldwide.
Gerbi, Susan A.; Lange, Thilo Sascha
2002-01-01
Previously, we showed that spliceosomal U6 small nuclear RNA (snRNA) transiently passes through the nucleolus. Herein, we report that all individual snRNAs of the [U4/U6.U5] tri-snRNP localize to nucleoli, demonstrated by fluorescence microscopy of nucleolar preparations after injection of fluorescein-labeled snRNA into Xenopus oocyte nuclei. Nucleolar localization of U6 is independent from [U4/U6] snRNP formation since sites of direct interaction of U6 snRNA with U4 snRNA are not nucleolar localization elements. Among all regions in U6, the only one required for nucleolar localization is its 3′ end, which associates with the La protein and subsequently during maturation of U6 is bound by Lsm proteins. This 3′-nucleolar localization element of U6 is both essential and sufficient for nucleolar localization and also required for localization to Cajal bodies. Conversion of the 3′ hydroxyl of U6 snRNA to a 3′ phosphate prevents association with the La protein but does not affect U6 localization to nucleoli or Cajal bodies. PMID:12221120
RNA-Seq Profiling Reveals Novel Hepatic Gene Expression Pattern in Aflatoxin B1 Treated Rats
Merrick, B. Alex; Phadke, Dhiral P.; Auerbach, Scott S.; Mav, Deepak; Stiegelmeyer, Suzy M.; Shah, Ruchir R.; Tice, Raymond R.
2013-01-01
Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1), a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG) than microarray analysis, including low copy and novel transcripts related to AFB1’s carcinogenic activity compared to feed controls (CTRL). Paired-end reads were mapped to the rat genome (Rn4) with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005) compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT’s) on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c. We find
Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.
Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila
2012-07-13
Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.
Kunju, Lakshmi P; Carskadon, Shannon; Siddiqui, Javed; Tomlins, Scott A; Chinnaiyan, Arul M; Palanisamy, Nallasivam
2014-09-01
The genetic basis of 50% to 60% of prostate cancer (PCa) is attributable to rearrangements in E26 transformation-specific (ETS) (ERG, ETV1, ETV4, and ETV5), BRAF, and RAF1 genes and overexpression of SPINK1. The development and validation of reliable detection methods are warranted to classify various molecular subtypes of PCa for diagnostic and prognostic purposes. ETS gene rearrangements are typically detected by fluorescence in situ hybridization and reverse-transcription polymerase chain reaction methods. Recently, monoclonal antibodies against ERG have been developed that detect the truncated ERG protein in immunohistochemical assays where staining levels are strongly correlated with ERG rearrangement status by fluorescence in situ hybridization. However, specific antibodies for ETV1, ETV4, and ETV5 are unavailable, challenging their clinical use. We developed a novel RNA in situ hybridization-based assay for the in situ detection of ETV1, ETV4, and ETV5 in formalin-fixed paraffin-embedded tissues from prostate needle biopsies, prostatectomy, and metastatic PCa specimens using RNA probes. Further, with combined RNA in situ hybridization and immunohistochemistry we identified a rare subset of PCa with dual ETS gene rearrangements in collisions of independent tumor foci. The high specificity and sensitivity of RNA in situ hybridization provides an alternate method enabling bright-field in situ detection of ETS gene aberrations in routine clinically available PCa specimens.
Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.
2012-01-01
Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression
NASA Astrophysics Data System (ADS)
Xiong, Li-Ping; Ma, Yu-Qiang; Tang, Lei-Han
2010-09-01
Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology.
Novel variants of the 5S rRNA genes in Eruca sativa.
Singh, K; Bhatia, S; Lakshmikumaran, M
1994-02-01
The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)
Nuclear Retention Elements of U3 Small Nucleolar RNA
Speckmann, Wayne; Narayanan, Aarthi; Terns, Rebecca; Terns, Michael P.
1999-01-01
The processing and methylation of precursor rRNA is mediated by the box C/D small nucleolar RNAs (snoRNAs). These snoRNAs differ from most cellular RNAs in that they are not exported to the cytoplasm. Instead, these RNAs are actively retained in the nucleus where they assemble with proteins into mature small nucleolar ribonucleoprotein particles and are targeted to their intranuclear site of action, the nucleolus. In this study, we have identified the cis-acting sequences responsible for the nuclear retention of U3 box C/D snoRNA by analyzing the nucleocytoplasmic distributions of an extensive panel of U3 RNA variants after injection of the RNAs into Xenopus oocyte nuclei. Our data indicate the importance of two conserved sequence motifs in retaining U3 RNA in the nucleus. The first motif is comprised of the conserved box C′ and box D sequences that characterize the box C/D family. The second motif contains conserved box sequences B and C. Either motif is sufficient for nuclear retention, but disruption of both motifs leads to mislocalization of the RNAs to the cytoplasm. Variant RNAs that are not retained also lack 5′ cap hypermethylation and fail to associate with fibrillarin. Furthermore, our results indicate that nuclear retention of U3 RNA does not simply reflect its nucleolar localization. A fragment of U3 containing the box B/C motif is not localized to nucleoli but retained in coiled bodies. Thus, nuclear retention and nucleolar localization are distinct processes with differing sequence requirements. PMID:10567566
Recognition of the 3′ splice site RNA by the U2AF heterodimer involves a dynamic population shift
Voith von Voithenberg, Lena; Sánchez-Rico, Carolina; Kang, Hyun-Seo; Madl, Tobias; Zanier, Katia; Barth, Anders; Warner, Lisa R.; Sattler, Michael; Lamb, Don C.
2016-01-01
An essential early step in the assembly of human spliceosomes onto pre-mRNA involves the recognition of regulatory RNA cis elements in the 3′ splice site by the U2 auxiliary factor (U2AF). The large (U2AF65) and small (U2AF35) subunits of the U2AF heterodimer contact the polypyrimidine tract (Py-tract) and the AG-dinucleotide, respectively. The tandem RNA recognition motif domains (RRM1,2) of U2AF65 adopt closed/inactive and open/active conformations in the free form and when bound to bona fide Py-tract RNA ligands. To investigate the molecular mechanism and dynamics of 3′ splice site recognition by U2AF65 and the role of U2AF35 in the U2AF heterodimer, we have combined single-pair FRET and NMR experiments. In the absence of RNA, the RRM1,2 domain arrangement is highly dynamic on a submillisecond time scale, switching between closed and open conformations. The addition of Py-tract RNA ligands with increasing binding affinity (strength) gradually shifts the equilibrium toward an open conformation. Notably, the protein–RNA complex is rigid in the presence of a strong Py-tract but exhibits internal motion with weak Py-tracts. Surprisingly, the presence of U2AF35, whose UHM domain interacts with U2AF65 RRM1, increases the population of the open arrangement of U2AF65 RRM1,2 in the absence and presence of a weak Py-tract. These data indicate that the U2AF heterodimer promotes spliceosome assembly by a dynamic population shift toward the open conformation of U2AF65 to facilitate the recognition of weak Py-tracts at the 3′ splice site. The structure and RNA binding of the heterodimer was unaffected by cancer-linked myelodysplastic syndrome mutants. PMID:27799531
Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae).
Song, Fan; Li, Hu; Shao, Renfu; Shi, Aimin; Bai, Xiaoshuan; Zheng, Xiaorong; Heiss, Ernst; Cai, Wanzhi
2016-05-16
The typical insect mitochondrial (mt) genome organization, which contains a single chromosome with 37 genes, was found in the infraorder Pentatomomorpha (suborder Heteroptera). The arrangement of mt genes in these true bugs is usually the same as the ancestral mt gene arrangement of insects. Rearrangement of transfer RNA (tRNA) genes, however, has been found in two subfamilies of flat bugs (Mezirinae and Calisiinae, family Aradidae). In this study, we sequenced the complete mt genomes of four species from three other subfamilies (Aradinae, Carventinae and Aneurinae). We found tRNA gene rearrangement in all of these four species. All of the rearranged tRNA genes are located between the mitochondrial control region and cox1, indicating this region as a hotspot for gene rearrangement in flat bugs; the rearrangement is likely caused by events of tandem duplication and random deletion of genes. Furthermore, our phylogenetic and dating analyses indicated that the swap of positions between trnQ and trnI occurred ~162 million years ago (MYA) in the most recent common ancestor of the five subfamilies of flat bugs investigated to date, whereas the swap of positions between trnC and trnW occurred later in the lineage leading to Calisiinae, and the translocation of trnC and trnY occurred later than 134 MYA in the lineage leading to Aradinae.
Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae)
Song, Fan; Li, Hu; Shao, Renfu; Shi, Aimin; Bai, Xiaoshuan; Zheng, Xiaorong; Heiss, Ernst; Cai, Wanzhi
2016-01-01
The typical insect mitochondrial (mt) genome organization, which contains a single chromosome with 37 genes, was found in the infraorder Pentatomomorpha (suborder Heteroptera). The arrangement of mt genes in these true bugs is usually the same as the ancestral mt gene arrangement of insects. Rearrangement of transfer RNA (tRNA) genes, however, has been found in two subfamilies of flat bugs (Mezirinae and Calisiinae, family Aradidae). In this study, we sequenced the complete mt genomes of four species from three other subfamilies (Aradinae, Carventinae and Aneurinae). We found tRNA gene rearrangement in all of these four species. All of the rearranged tRNA genes are located between the mitochondrial control region and cox1, indicating this region as a hotspot for gene rearrangement in flat bugs; the rearrangement is likely caused by events of tandem duplication and random deletion of genes. Furthermore, our phylogenetic and dating analyses indicated that the swap of positions between trnQ and trnI occurred ~162 million years ago (MYA) in the most recent common ancestor of the five subfamilies of flat bugs investigated to date, whereas the swap of positions between trnC and trnW occurred later in the lineage leading to Calisiinae, and the translocation of trnC and trnY occurred later than 134 MYA in the lineage leading to Aradinae. PMID:27180804
PLMItRNA, a database for mitochondrial tRNA genes and tRNAs in photosynthetic eukaryotes.
Damiano, F; Gallerani, R; Liuni, S; Licciulli, F; Ceci, L R
2001-01-01
The PLMItRNA database for mitochondrial tRNA molecules and genes in VIRIDIPLANTAE: (green plants) [Volpetti,V., Gallerani,R., DeBenedetto,C., Liuni,S., Licciulli,F. and Ceci,L.R. (2000) Nucleic Acids Res., 28, 159-162] has been enlarged to include algae. The database now contains 436 genes and 16 tRNA entries relative to 25 higher plants, eight green algae, four red algae (RHODOPHYTAE:) and two STRAMENOPILES: The PLMItRNA database is accessible via the WWW at http://bio-www.ba.cnr.it:8000/PLMItRNA.
Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.
Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C
2017-09-11
To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.
Spliced synthetic genes as internal controls in RNA sequencing experiments.
Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R
2016-09-01
RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome.
Chen, Bao-an; Mao, Pei-pei; Cheng, Jian; Gao, Feng; Xia, Guo-hua; Xu, Wen-lin; Shen, Hui-lin; Ding, Jia-hua; Gao, Chong; Sun, Qian; Chen, Wen-ji; Chen, Ning-na; Liu, Li-jie; Li, Xiao-mao; Wang, Xue-mei
2010-08-09
In many instances, multidrug resistance (MDR) is mediated by increasing the expression at the cell surface of the MDR1 gene product, P-glycoprotein (P-gp), a 170-kD energy-dependent efflux pump. The aim of this study was to investigate the potential benefit of combination therapy with magnetic Fe(3)O(4) nanoparticle [MNP (Fe(3)O(4))] and MDR1 shRNA expression vector in K562/A02 cells. For stable reversal of "classical" MDR by short hairpin RNA (shRNA) aiming directly at the target sequence (3491-3509, 1539-1557, and 3103-3121 nucleotide) of MDR1 mRNA. PGC silencer-U6-neo-GFP-shRNA/MDR1 called PGY1-1, PGY1-2, and PGY1-3 were constructed and transfected into K562/A02 cells by lipofectamine 2000. After transfected and incubated with or without MNP (Fe(3)O(4)) for 48 hours, the transcription of MDR1 mRNA and the expression of P-gp were detected by quantitative real-time PCR and Western-blot assay respectively. Meanwhile intracellular concentration of DNR in K562/A02 cells was detected by flow cytometry (FCM). PGC silencer-U6-neo-GFP-shRNA/MDR1 was successfully constructed, which was confirmed by sequencing and PGY1-2 had the greatest MDR1 gene inhibitory ratio. Analysis of the reversal ratio of MDR, the concentration of daunorubicin (DNR) and the transcription of MDR1 gene and expression of P-gp in K562/A02 showed that combination of DNR with either MNP (Fe(3)O(4)) or PGY1-2 exerted a potent cytotoxic effect on K562/A02 cells, while combination of MNP (Fe(3)O(4)) and PGY1-2 could synergistically reverse multidrug resistance. Thus our in vitro data strongly suggested that a combination of MNP (Fe(3)O(4)) and shRNA expression vector might be a more sufficient and less toxic anti-MDR method on leukemia.
Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene
USDA-ARS?s Scientific Manuscript database
This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...
Pan, L Y; Mendel, D B; Zurlo, J; Guyre, P M
1990-07-01
The high affinity IgG FcR Fc gamma RI, CD64, plays important roles in the immune response. Fc gamma RI is predominantly expressed on monocytes and macrophages, and barely detectable on neutrophils. rIFN-gamma markedly increases the expression of Fc gamma RI on neutrophils, monocytes, macrophages and myeloid cell lines such as U-937, HL-60, and THP-1. Glucocorticoids inhibit the augmentation of Fc gamma RI expression by rIFN-gamma on neutrophils and myeloid cell lines, but enhance the augmentation of Fc gamma RI expression by rIFN-gamma on monocytes. In this study, we examined the effect of rIFN-gamma and dexamethasone (Dex) on the steady state level of Fc gamma RI mRNA in U-937 cells, neutrophils, and monocytes by hybridizing total RNA with the Fc gamma RI cDNA probe, p135. We found that the amount of Fc gamma RI mRNA increased within 1 h of treatment with rIFN-gamma in all three cell types. This initial induction of Fc gamma RI mRNA by rIFN-gamma was completely blocked by an inhibitor of RNA synthesis, actinomycin D, suggesting that the rIFN-gamma-mediated induction of Fc gamma RI mRNA is dependent on gene transcription. Dex, used in combination with rIFN-gamma, partially blocked the induction of Fc gamma RI mRNA by rIFN-gamma in U-937 cells and neutrophils, but caused a synergistic increase in Fc gamma RI mRNA levels in monocytes. The inhibitory effect of Dex on the steady state level of Fc gamma RI mRNA in U-937 cells was blocked by an inhibitor of protein synthesis, cycloheximide, suggesting that Dex-induced proteins were involved in the regulation of Fc gamma RI expression. This study indicates that the regulation of Fc gamma RI expression on U-937 cells, neutrophils, and monocytes by rIFN-gamma and Dex occurs, at least in part, at the mRNA level. rIFN-gamma increases the steady state level of Fc gamma RI mRNA through a common pathway among U-937 cells, neutrophils, and monocytes, whereas the effect of Dex on rIFN-gamma-induced Fc gamma RI mRNA is cell
Gene expression distribution deconvolution in single-cell RNA sequencing.
Wang, Jingshu; Huang, Mo; Torre, Eduardo; Dueck, Hannah; Shaffer, Sydney; Murray, John; Raj, Arjun; Li, Mingyao; Zhang, Nancy R
2018-06-26
Single-cell RNA sequencing (scRNA-seq) enables the quantification of each gene's expression distribution across cells, thus allowing the assessment of the dispersion, nonzero fraction, and other aspects of its distribution beyond the mean. These statistical characterizations of the gene expression distribution are critical for understanding expression variation and for selecting marker genes for population heterogeneity. However, scRNA-seq data are noisy, with each cell typically sequenced at low coverage, thus making it difficult to infer properties of the gene expression distribution from raw counts. Based on a reexamination of nine public datasets, we propose a simple technical noise model for scRNA-seq data with unique molecular identifiers (UMI). We develop deconvolution of single-cell expression distribution (DESCEND), a method that deconvolves the true cross-cell gene expression distribution from observed scRNA-seq counts, leading to improved estimates of properties of the distribution such as dispersion and nonzero fraction. DESCEND can adjust for cell-level covariates such as cell size, cell cycle, and batch effects. DESCEND's noise model and estimation accuracy are further evaluated through comparisons to RNA FISH data, through data splitting and simulations and through its effectiveness in removing known batch effects. We demonstrate how DESCEND can clarify and improve downstream analyses such as finding differentially expressed genes, identifying cell types, and selecting differentiation markers. Copyright © 2018 the Author(s). Published by PNAS.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liao, D.; Weiner, A.M.
1995-12-10
The RNU2 locus encoding human U2 small nuclear RNA (snRNA) is organized as a nearly perfect tandem array containing 5 to 22 copies of a 5.8-kb repeat unit. Just downstream of the U2 snRNA gene in each 5.8-kb repeat unit lies a large (CT){sub n}{center_dot}(GA){sub n} dinucleotide repeat (n {approx} 70). This form of genomic organization, in which one repeat is embedded within another, provides an unusual opportunity to study the balance of forces maintaining the homogeneity of both kinds of repeats. Using a combination of field inversion gel electrophoresis and polymerase chain reaction, we have been able to studymore » the CT microsatellites within individual U2 tandem arrays. We find that the CT microsatellites within an RNU2 allele exhibit significant length polymorphism, despite the remarkable homogeneity of the surrounding U2 repeat units. Length polymorphism is due primarily to loss or gain of CT dinucleotide repeats, but other types of deletions, insertions, and substitutions are also frequent. Polymorphism is greatly reduced in regions where pure (CT){sub n} tracts are interrupted by occasional G residues, suggesting that irregularities stabilize both the length and the sequence of the dinucleotide repeat. We further show that the RNU2 loci of other catarrhine primates (gorilla, chimpanzee, ogangutan, and baboon) contain orthologous CT microsatellites; these also exhibit length polymorphism, but are highly divergent from each other. Thus, although the CT microsatellite is evolving far more rapidly than the rest of the U2 repeat unit, it has persisted through multiple speciation events spanning >35 Myr. The persistence of the CT microsatellite, despite polymorphism and rapid evolution, suggests that it might play a functional role in concerted evolution of the RNU2 loci, perhaps as an initiation site for recombination and/or gene conversion. 70 refs., 5 figs.« less
APOBEC3B cytidine deaminase targets the non-transcribed strand of tRNA genes in yeast.
Saini, Natalie; Roberts, Steven A; Sterling, Joan F; Malc, Ewa P; Mieczkowski, Piotr A; Gordenin, Dmitry A
2017-05-01
Variations in mutation rates across the genome have been demonstrated both in model organisms and in cancers. This phenomenon is largely driven by the damage specificity of diverse mutagens and the differences in DNA repair efficiency in given genomic contexts. Here, we demonstrate that the single-strand DNA-specific cytidine deaminase APOBEC3B (A3B) damages tRNA genes at a 1000-fold higher efficiency than other non-tRNA genomic regions in budding yeast. We found that A3B-induced lesions in tRNA genes were predominantly located on the non-transcribed strand, while no transcriptional strand bias was observed in protein coding genes. Furthermore, tRNA gene mutations were exacerbated in cells where RNaseH expression was completely abolished (Δrnh1Δrnh35). These data suggest a transcription-dependent mechanism for A3B-induced tRNA gene hypermutation. Interestingly, in strains proficient in DNA repair, only 1% of the abasic sites formed upon excision of A3B-deaminated cytosines were not repaired leading to mutations in tRNA genes, while 18% of these lesions failed to be repaired in the remainder of the genome. A3B-induced mutagenesis in tRNA genes was found to be efficiently suppressed by the redundant activities of both base excision repair (BER) and the error-free DNA damage bypass pathway. On the other hand, deficiencies in BER did not have a profound effect on A3B-induced mutations in CAN1, the reporter for protein coding genes. We hypothesize that differences in the mechanisms underlying ssDNA formation at tRNA genes and other genomic loci are the key determinants of the choice of the repair pathways and consequently the efficiency of DNA damage repair in these regions. Overall, our results indicate that tRNA genes are highly susceptible to ssDNA-specific DNA damaging agents. However, increased DNA repair efficacy in tRNA genes can prevent their hypermutation and maintain both genome and proteome homeostasis. Published by Elsevier B.V.
Inhibition of N-Myc down regulated gene 1 in in vitro cultured human glioblastoma cells
Said, Harun M; Polat, Buelent; Stein, Susanne; Guckenberger, Mathias; Hagemann, Carsten; Staab, Adrian; Katzer, Astrid; Anacker, Jelena; Flentje, Michael; Vordermark, Dirk
2012-01-01
AIM: To study short dsRNA oligonucleotides (siRNA) as a potent tool for artificially modulating gene expression of N-Myc down regulated gene 1 (NDRG1) gene induced under different physiological conditions (Normoxia and hypoxia) modulating NDRG1 transcription, mRNA stability and translation. METHODS: A cell line established from a patient with glioblastoma multiforme. Plasmid DNA for transfections was prepared with the Endofree Plasmid Maxi kit. From plates containing 5 × 107 cells, nuclear extracts were prepared according to previous protocols. The pSUPER-NDRG1 vectors were designed, two sequences were selected from the human NDRG1 cDNA (5’-GCATTATTGGCATGGGAAC-3’ and 5’-ATGCAGAGTAACGTGGAAG-3’. reverse transcription polymerase chain reaction was performed using primers designed using published information on β-actin and hypoxia-inducible factor (HIF)-1α mRNA sequences in GenBank. NDRG1 mRNA and protein level expression results under different conditions of hypoxia or reoxygenation were compared to aerobic control conditions using the Mann-Whitney U test. Reoxygenation values were also compared to the NDRG1 levels after 24 h of hypoxia (P < 0.05 was considered significant). RESULTS: siRNA- and iodoacetate (IAA)-mediated downregulation of NDRG1 mRNA and protein expression in vitro in human glioblastoma cell lines showed a nearly complete inhibition of NDRG1 expression when compared to the results obtained due to the inhibitory role of glycolysis inhibitor IAA. Hypoxia responsive elements bound by nuclear HIF-1 in human glioblastoma cells in vitro under different oxygenation conditions and the clearly enhanced binding of nuclear extracts from glioblastoma cell samples exposed to extreme hypoxic conditions confirmed the HIF-1 Western blotting results. CONCLUSION: NDRG1 represents an additional diagnostic marker for brain tumor detection, due to the role of hypoxia in regulating this gene, and it can represent a potential target for tumor treatment in human
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
tRNA gene copy number variation in humans
Iben, James R.; Maraia, Richard J.
2014-01-01
The human tRNAome consists of more than 500 interspersed tRNA genes comprising 51 anticodon families of largely unequal copy number. We examined tRNA gene copy number variation (tgCNV) in six individuals; two kindreds of two parents and a child, using high coverage whole genome sequence data. Such differences may be important because translation of some mRNAs is sensitive to the relative amounts of tRNAs and because tRNA competition determines translational efficiency vs. fidelity and production of native vs. misfolded proteins. We identified several tRNA gene clusters with CNV, which in some cases were part of larger iterations. In addition there was an isolated tRNALysCUU gene that was absent as a homozygous deletion in one of the parents. When assessed by semiquantitative PCR in 98 DNA samples representing a wide variety of ethnicities, this allele was found deleted in hetero- or homozygosity in all groups at ~50% frequency. This is the first report of copy number variation of human tRNA genes. We conclude that tgCNV exists at significant levels among individual humans and discuss the results in terms of genetic diversity and prior genome wide association studies (GWAS) that suggest the importance of the ratio of tRNALys isoacceptors in Type-2 diabetes. PMID:24342656
Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan
2012-09-01
The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.
Building a stable RNA U-turn with a protonated cytidine.
Gottstein-Schmidtke, Sina R; Duchardt-Ferner, Elke; Groher, Florian; Weigand, Julia E; Gottstein, Daniel; Suess, Beatrix; Wöhnert, Jens
2014-08-01
The U-turn is a classical three-dimensional RNA folding motif first identified in the anticodon and T-loops of tRNAs. It also occurs frequently as a building block in other functional RNA structures in many different sequence and structural contexts. U-turns induce sharp changes in the direction of the RNA backbone and often conform to the 3-nt consensus sequence 5'-UNR-3' (N = any nucleotide, R = purine). The canonical U-turn motif is stabilized by a hydrogen bond between the N3 imino group of the U residue and the 3' phosphate group of the R residue as well as a hydrogen bond between the 2'-hydroxyl group of the uridine and the N7 nitrogen of the R residue. Here, we demonstrate that a protonated cytidine can functionally and structurally replace the uridine at the first position of the canonical U-turn motif in the apical loop of the neomycin riboswitch. Using NMR spectroscopy, we directly show that the N3 imino group of the protonated cytidine forms a hydrogen bond with the backbone phosphate 3' from the third nucleotide of the U-turn analogously to the imino group of the uridine in the canonical motif. In addition, we compare the stability of the hydrogen bonds in the mutant U-turn motif to the wild type and describe the NMR signature of the C+-phosphate interaction. Our results have implications for the prediction of RNA structural motifs and suggest simple approaches for the experimental identification of hydrogen bonds between protonated C-imino groups and the phosphate backbone. © 2014 Gottstein-Schmidtke et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Lee, Soo Hyeon; Chung, Bong Hyun; Park, Tae Gwan; Nam, Yoon Sung; Mok, Hyejung
2012-07-17
Because of RNA's ability to encode structure and functional information, researchers have fabricated diverse geometric structures from this polymer at the micro- and nanoscale. With their tunable structures, rigidity, and biocompatibility, novel two-dimensional and three-dimensional RNA structures can serve as a fundamental platform for biomedical applications, including engineered tissues, biosensors, and drug delivery vehicles. The discovery of the potential of small-interfering RNA (siRNA) has underscored the applications of RNA-based micro- and nanostructures in medicine. Small-interfering RNA (siRNA), synthetic double-stranded RNA consisting of approximately 21 base pairs, suppresses problematic target genes in a sequence-specific manner via inherent RNA interference (RNAi) processing. As a result, siRNA offers a potential strategy for treatment of many human diseases. However, due to inefficient delivery to cells and off-target effects, the clinical application of therapeutic siRNA has been very challenging. To address these issues, researchers have studied a variety of nanocarrier systems for siRNA delivery. In this Account, we describe several strategies for efficient siRNA delivery and selective gene silencing. We took advantage of facile chemical conjugation and complementary hybridization to design novel siRNA-based micro- and nanostructures. Using chemical crosslinkers and hydrophobic/hydrophilic polymers at the end of siRNA, we produced various RNA-based structures, including siRNA block copolymers, micelles, linear siRNA homopolymers, and microhydrogels. Because of their increased charge density and flexibility compared with conventional siRNA, these micro- and nanostructures can form polyelectrolyte complexes with poorly charged and biocompatible cationic carriers that are both more condensed and more homogenous than the complexes formed in other carrier systems. In addition, the fabricated siRNA-based structures are linked by cleavable disulfide
Wang, Y; Wang, J; Gao, Y
2001-07-01
To observe and compare the expression pattern of Msx-1, Msx-2 mRNA during the different stages of hard tissue formation in the first mandibular molar of mouse and investigate the relationship between the two genes. First mandibular molar germs from 1, 3, 7 and 14-days old mouse were separated and reverse transcription-polymerase chain reaction was performed on the total RNA of them using Msx-1, Msx-2 specific primers separately. Expression of both genes were detected during the different stages of hard tissue formation in the mouse first mandibular molars, but there was some interesting differences in the quantitiy between the two genes. Msx-1 transcripts appeared at the 1 day postnatally, and increase through 3 day, 7 day, then maximally expressed at 14 days postnatally; while Msx-2 mRNA was seen and expressed maximally at the 3 days postnatally, then there was a gradual reduction at 7 days, and 14 days postnatally. The homeobox gene Msx-1, Msx-2 may play a role in the events of the hard tissue formation. The complementary expression pattern of them during the specific stage of hard tissue formation indicates that there may be some functional redundancy between them during the biomineralization.
Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps
Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz
2015-01-01
In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450
Upregulating endogenous genes by an RNA-programmable artificial transactivator
Fimiani, Cristina; Goina, Elisa; Mallamaci, Antonello
2015-01-01
To promote expression of endogenous genes ad libitum, we developed a novel, programmable transcription factor prototype. Kept together via an MS2 coat protein/RNA interface, it includes a fixed, polypeptidic transactivating domain and a variable RNA domain that recognizes the desired gene. Thanks to this device, we specifically upregulated five genes, in cell lines and primary cultures of murine pallial precursors. Gene upregulation was small, however sufficient to robustly inhibit neuronal differentiation. The transactivator interacted with target gene chromatin via its RNA cofactor. Its activity was restricted to cells in which the target gene is normally transcribed. Our device might be useful for specific applications. However for this purpose, it will require an improvement of its transactivation power as well as a better characterization of its target specificity and mechanism of action. PMID:26152305
Strategies for Improving siRNA-Induced Gene Silencing Efficiency
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-01-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency. PMID:29399550
Strategies for Improving siRNA-Induced Gene Silencing Efficiency.
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-12-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.
Dandoy-Dron, F; Guillo, F; Benboudjema, L; Deslys, J P; Lasmézas, C; Dormont, D; Tovey, M G; Dron, M
1998-03-27
To define genes associated with or responsible for the neurodegenerative changes observed in transmissible spongiform encephalopathies, we analyzed gene expression in scrapie-infected mouse brain using "mRNA differential display." The RNA transcripts of eight genes were increased 3-8-fold in the brains of scrapie-infected animals. Five of these genes have not previously been reported to exhibit increased expression in this disease: cathepsin S, the C1q B-chain of complement, apolipoprotein D, and two previously unidentified genes denominated scrapie-responsive gene (ScRG)-1 and ScRG-2, which are preferentially expressed in brain tissue. Increased expression of the three remaining genes, beta2 microglobulin, F4/80, and metallothionein II, has previously been reported to occur in experimental scrapie. Kinetic analysis revealed a concomitant increase in the levels of ScRG-1, cathepsin S, the C1q B-chain of complement, and beta2 microglobulin mRNA as well as glial fibrillary acidic protein and F4/80 transcripts, markers of astrocytosis and microglial activation, respectively. In contrast, the level of ScRG-2, apolipoprotein D, and metallothionein II mRNA was only increased at the terminal stage of the disease. ScRG-1 mRNA was found to be preferentially expressed in glial cells and to code for a short protein of 47 amino acids with a strong hydrophobic N-terminal region.
Establishment of conditional vectors for hairpin siRNA knockdowns
Matsukura, Shiro; Jones, Peter A.; Takai, Daiya
2003-01-01
Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529
Preedagasamzin, Sarinthip; Nualkaew, Tiwaporn; Pongrujikorn, Tanjitti; Jinawath, Natini; Kole, Ryszard; Fucharoen, Suthat; Jearawiriyapaisarn, Natee; Svasti, Saovaros
2018-04-30
Repair of a splicing defect of β-globin pre-mRNA harboring hemoglobin E (HbE) mutation was successfully accomplished in erythroid cells from patients with β-thalassemia/HbE disorder by a synthetic splice-switching oligonucleotide (SSO). However, its application is limited by short-term effectiveness and requirement of lifelong periodic administration of SSO, especially for chronic diseases like thalassemias. Here, we engineered lentiviral vectors that stably express U7 small nuclear RNA (U7 snRNA) carrying the splice-switching sequence of the SSO that restores correct splicing of β E -globin pre-mRNA and achieves a long-term therapeutic effect. Using a two-step tiling approach, we systematically screened U7 snRNAs carrying splice-switching SSO sequences targeted to the cryptic 5' splice site created by HbE mutation. We tested this approach and identified the most responsive element for mediating splicing correction in engineered U7 snRNAs in HeLa-β E cell model cell line. Remarkably, the U7 snRNA lentiviral vector (U7 βE4+1) targeted to this region effectively restored the correctly-spliced β E -globin mRNA for at least 5 months. Moreover, the effects of the U7 βE4+1 snRNA lentiviral vector were also evident as upregulation of the correctly-spliced β E -globin mRNA in erythroid progenitor cells from β-thalassemia/HbE patients treated with the vector, which led to improvements of pathologies in erythroid progenitor cells from thalassemia patients. These results suggest that the splicing correction of β E -globin pre-mRNA by the engineered U7 snRNA lentiviral vector provides a promising, long-term treatment for β-thalassemia/HbE. Copyright © 2018 Elsevier Inc. All rights reserved.
Expression of the barley stripe mosaic virus RNA beta "triple gene block".
Zhou, H; Jackson, A O
1996-02-15
Genomic RNA beta of barley strip mosaic virus (BSMV) contains four defined open reading frames (ORFs). These include the coat protein (beta a) and a "triple gene block" consisting of the beta b, beta c, and beta d ORFs that overlap one another. Two subgenomic beta RNAs (sgRNA beta 1 and sgRNA beta 2) with sizes of 2.5 and 0.96 kb were identified in BSMV-infected protoplasts, and their transcription initiation sites were mapped to nucleotides 789 and 2327, respectively, of RNA beta by primer extension experiments. In a cell-free wheat germ translation system, genomic RNA beta served as a mRNA only for the 22-kDa coat protein, and sgRNA beta 1 directed synthesis of only the 58-kDA beta b protein. However, with sgRNA beta 2, three proteins with sizes of 14, 17, and 23 kDa were synthesized. Both the 14- and the 23-kDa proteins were recognized by the beta d antibodies in vitro and in vivo. These results demonstrated that the 14-kDa protein was encoded by the beta d ORF and suggested that the 23-kDa protein, designated beta d', is a readthrough product of the amber stop codon of the beta d ORF. Mutagenesis of sgRNA beta 2 revealed that the 17-kDa protein was a product of the beta c ORF. Expression of sgRNA beta 1 and sgRNA beta 2 was also investigated with the chloramphenicol acetyl transferase (CAT) reporter gene in protoplasts coinfected with RNAs alpha and gamma plus chimeric RNA beta derivatives containing the CAT gene in-frame with the beta b, beta c, beta d, or beta d' ORFs. Elimination of the sgRNA beta 1 promoter abolished CAT expression from the beta b-CAT chimeric RNA, and removal of the sgRNA beta 2 promoter prevented CAT expression from the beta c-CAT, beta d-CAT, and beta d'-CAT chimeric RNAs. Taken together, these results demonstrate that the BSMV coat protein is the sole translation product of the genomic RNA beta, whereas sgRNA beta 1 serves as a messenger for translation of the beta b protein, and sgRNA beta 2 functions as a messenger for translation of
mRNA expression levels of hypoxia-induced and stem cell-associated genes in human glioblastoma.
Bache, Matthias; Rot, Swetlana; Keßler, Jacqueline; Güttler, Antje; Wichmann, Henri; Greither, Thomas; Wach, Sven; Taubert, Helge; Söling, Ariane; Bilkenroth, Udo; Kappler, Matthias; Vordermark, Dirk
2015-06-01
The roles of hypoxia-induced and stem cell-associated genes in the development of malignancy and tumour progression are well known. However, there are a limited number of studies analysing the impact of mRNA expression levels of hypoxia-induced and stem cell-associated genes in the tissues of brain tumours and glioblastoma patients. In this study, tumour tissues from patients with glioblastoma multiforme and tumour adjacent tissues were analysed. We investigated mRNA expression levels of hypoxia-inducible factor-1α (HIF-1α), hypoxia-inducible factor-2α (HIF-2α), carbonic anhydrase 9 (CA9), vascular endothelial growth factor (VEGF), glucose transporter-1 (GLUT-1) and osteopontin (OPN), and stem cell-associated genes survivin, epidermal growth factor receptor (EGFR), human telomerase reverse transcriptase (hTERT), Nanog and octamer binding transcription factor 4 (OCT4) using quantitative real-time polymerase chain reaction (qRT-PCR). Our data revealed higher mRNA expression levels of hypoxia-induced and stem cell-associated genes in tumour tissue than levels in the tumour adjacent tissues in patients with glioblastoma multiforme. A strong positive correlation between the mRNA expression levels of HIF-2α, CA9, VEGF, GLUT-1 and OPN suggests a specific hypoxia-associated profile of mRNA expression in glioblastoma multiforme. Additionally, the results indicate the role of stem-cell-related genes in tumour hypoxia. Kaplan-Maier analysis revealed that high mRNA expression levels of hypoxia-induced markers showed a trend towards shorter overall survival in glioblastoma patients (P=0.061). Our data suggest that mRNA expression levels of hypoxia-induced genes are important tumour markers in patients with glioblastoma multiforme.
Early BrdU-responsive genes constitute a novel class of senescence-associated genes in human cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Minagawa, Sachi; Nakabayashi, Kazuhiko; Fujii, Michihiko
2005-04-01
We identified genes that immediately respond to 5-bromodeoxyuridine (BrdU) in SUSM-1, an immortal fibroblastic line, with DNA microarray and Northern blot analysis. At least 29 genes were found to alter gene expression greater than twice more or less than controls within 36 h after addition of BrdU. They took several different expression patterns upon addition of BrdU, and the majority showed a significant alteration within 12 h. When compared among SUSM-1, HeLa, and TIG-7 normal human fibroblasts, 19 genes behaved similarly upon addition of BrdU. In addition, 14 genes, 9 of which are novel as regards senescence, behaved similarly inmore » senescent TIG-7 cells. The genes do not seem to have a role in proliferation or cell cycle progression. These results suggest that the early BrdU-responsive genes represent early signs of cellular senescence and can be its new biomarkers.« less
Midthun, K; Valdesuso, J; Hoshino, Y; Flores, J; Kapikian, A Z; Chanock, R M
1987-01-01
Antigenic characterization of human and animal rotaviruses by the plaque reduction neutralization assay has shown the existence of naturally occurring intertypes. Antiserum to M37, a rotavirus strain isolated from an asymptomatic neonate, neutralizes both Wa and ST3 strains, which are classified as serotype 1 and serotype 4 human rotaviruses, respectively. Likewise, antiserum to SB-1A, a porcine rotavirus, neutralizes rotavirus strains belonging to serotype 4 or 5. Plaque reduction neutralization assay of reassortant rotaviruses produced in vitro from these intertypes indicates that these viruses share one antigenically related outer capsid protein, VP3, with one serotype and another antigenically related outer capsid protein, VP7, with the other serotype. Thus, M37 is related to ST3 on the basis of its fourth-gene product, VP3, and to Wa on the basis of its ninth-gene product, VP7, whereas SB-1A is related to Gottfried (serotype 4 porcine rotavirus) via VP7 and to OSU (serotype 5 porcine rotavirus) via VP3. RNA-RNA hybridization studies revealed a high degree of homology between the VP3 or VP7 gene segments responsible for shared serotype specificity. Thus, the fourth gene segments of M37 and ST3 were highly homologous, while M37 and Wa had homology between their ninth gene segments. SB-1A and Gottfried were homologous not only with respect to the ninth gene but had complete homology in all other genes except the fourth gene. The fourth gene of SB-1A was highly homologous with the fourth gene of OSU. These observations suggested that SB-1A was a naturally occurring reassortant between Gottfried-like and OSU-like porcine rotavirus strains. Our observations also suggested that intertypes may result from genetic reassortment in nature. Images PMID:3029162
The Role of U2AF1 Mutations in the Pathogenesis of Myelodysplastic Syndromes
2015-10-01
mutation, U2AF1(S34F), on hematopoiesis and pre-mRNA splicing in vivo, we created doxycycline-inducible U2AF1(WT) and U2AF1(S34F) transgenic mice...U2AF1(S34F) versus U2AF1(WT). Together, these results suggest that mutant U2AF1 expression contributes to the altered hematopoiesis and pre-mRNA...Spliceosome, Mouse Model, Hematopoiesis , RNA-seq, U2AF1 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME
Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.
Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J
2010-11-01
MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992
Microprocessor mediates transcriptional termination in long noncoding microRNA genes
Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J.; Jopling, Catherine L.
2015-01-01
MicroRNA (miRNA) play a major role in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with co-transcriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. While most miRNA are located within introns of protein coding genes, a substantial minority of miRNA originate from long non coding (lnc) RNA where transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lnc-pri-miRNA do not use the canonical cleavage and polyadenylation (CPA) pathway, but instead use Microprocessor cleavage to terminate transcription. This Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a novel RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells. PMID:25730776
Kato, Yasuhiko; Perez, Christelle Alexa G; Mohamad Ishak, Nur Syafiqah; Nong, Quang D; Sudo, Yuumi; Matsuura, Tomoaki; Wada, Tadashi; Watanabe, Hajime
2018-06-04
Long noncoding RNAs (lncRNAs) are pervasively transcribed in the eukaryotic genome [1] and are important for the control of master regulatory genes that are involved in cell differentiation and development [2, 3]. Here, we show that a 5' UTR-overlapping lncRNA regulates the male-specific expression of the DM-domain gene doublesex1 (dsx1) in the crustacean Daphnia magna, which produces males in response to environmental stimuli. This lncRNA, named doublesex1 alpha promoter-associated long RNA (DAPALR), is transcribed upstream the transcription start site (TSS) in a sense orientation and subjected to 5' end capping and 3' end processing at a stem-loop structure before the dsx1 coding exon. Similar to dsx1, its expression is only activated in males by the juvenile hormone (JH) and basic-leucine zipper (bZIP) transcription factor Vrille (Vri) and is maintained during embryogenesis. Knockdown of DAPALR in males silenced dsx1 and led to feminization, including egg production, whereas ectopic expression of DAPALR in dsx1-silenced females resulted in the de-repression of dsx1. We further demonstrate that the DAPALR transcript overlaps the dsx1 5'-UTR, and this overlapping region is required for dsx1 activation. Our results suggest that DAPALR can transactivate and possibly maintain dsx1 expression. This might be important for converting transient environmental signals into stable male development, controlled by the continuous expression of dsx1. Copyright © 2018 Elsevier Ltd. All rights reserved.
Rayon-Estrada, Violeta; Harjanto, Dewi; Hamilton, Claire E; Berchiche, Yamina A; Gantman, Emily Conn; Sakmar, Thomas P; Bulloch, Karen; Gagnidze, Khatuna; Harroch, Sheila; McEwen, Bruce S; Papavasiliou, F Nina
2017-12-12
Epitranscriptomics refers to posttranscriptional alterations on an mRNA sequence that are dynamic and reproducible, and affect gene expression in a similar way to epigenetic modifications. However, the functional relevance of those modifications for the transcript, the cell, and the organism remain poorly understood. Here, we focus on RNA editing and show that Apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-1 (APOBEC1), together with its cofactor RBM47, mediates robust editing in different tissues. The majority of editing events alter the sequence of the 3'UTR of targeted transcripts, and we focus on one cell type (monocytes) and on a small set of highly edited transcripts within it to show that editing alters gene expression by modulating translation (but not RNA stability or localization). We further show that specific cellular processes (phagocytosis and transendothelial migration) are enriched for transcripts that are targets of editing and that editing alters their function. Finally, we survey bone marrow progenitors and demonstrate that common monocyte progenitor cells express high levels of APOBEC1 and are susceptible to loss of the editing enzyme. Overall, APOBEC1-mediated transcriptome diversification is required for the fine-tuning of protein expression in monocytes, suggesting an epitranscriptomic mechanism for the proper maintenance of homeostasis in innate immune cells. Copyright © 2017 the Author(s). Published by PNAS.
Villela, Darine; Ramalho, Rodrigo F; Silva, Aderbal R T; Brentani, Helena; Suemoto, Claudia K; Pasqualucci, Carlos Augusto; Grinberg, Lea T; Krepischi, Ana C V; Rosenberg, Carla
2016-01-01
This study investigated for the first time the genomewide DNA methylation changes of noncoding RNA genes in the temporal cortex samples from individuals with Alzheimer's disease (AD). The methylome of 10 AD individuals and 10 age-matched controls were obtained using Illumina 450 K methylation array. A total of 2,095 among the 15,258 interrogated noncoding RNA CpG sites presented differential methylation, 161 of which were associated with miRNA genes. In particular, 10 miRNA CpG sites that were found to be hypermethylated in AD compared to control brains represent transcripts that have been previously associated with the disease. This miRNA set is predicted to target 33 coding genes from the neuregulin receptor complex (ErbB) signaling pathway, which is required for the neurons myelination process. For 6 of these miRNA genes (MIR9-1, MIR9-3, MIR181C, MIR124-1, MIR146B, and MIR451), the hypermethylation pattern is in agreement with previous results from literature that shows downregulation of miR-9, miR-181c, miR-124, miR-146b, and miR-451 in the AD brain. Our data implicate dysregulation of miRNA methylation as contributor to the pathogenesis of AD.
Kou, Shu-Jun; Wu, Xiao-Meng; Liu, Zheng; Liu, Yuan-Long; Xu, Qiang; Guo, Wen-Wu
2012-12-01
miRNAs have recently been reported to modulate somatic embryogenesis (SE), a key pathway of plant regeneration in vitro. For expression level detection and subsequent function dissection of miRNAs in certain biological processes, qRT-PCR is one of the most effective and sensitive techniques, for which suitable reference gene selection is a prerequisite. In this study, three miRNAs and eight non-coding RNAs (ncRNA) were selected as reference candidates, and their expression stability was inspected in developing citrus SE tissues cultured at 20, 25, and 30 °C. Stability of the eight non-miRNA ncRNAs was further validated in five adult tissues without temperature treatment. The best single reference gene for SE tissues was snoR14 or snoRD25, while for the adult tissues the best one was U4; although they were not as stable as the optimal multiple references snoR14 + U6 for SE tissues and snoR14 + U5 for adult tissues. For expression normalization of less abundant miRNAs in SE tissues, miR3954 was assessed as a viable reference. Single reference gene snoR14 outperformed multiple references for the overall SE and adult tissues. As one of the pioneer systematic studies on reference gene identification for plant miRNA normalization, this study benefits future exploration on miRNA function in citrus and provides valuable information for similar studies in other higher plants. Three miRNAs and eight non-coding RNAs were tested as reference candidates on developing citrus SE tissues. Best single references snoR14 or snoRD25 and optimal multiple references snoR14 + U6, snoR14 + U5 were identified.
Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia
2018-06-01
When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.
Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David
2018-03-19
To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.
RNA Interference Therapies for an HIV-1 Functional Cure.
Scarborough, Robert J; Gatignol, Anne
2017-12-27
HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.
Ito, Yoichiro; Kitagawa, Takao; Yamanishi, Mamoru; Katahira, Satoshi; Izawa, Shingo; Irie, Kenji; Furutani-Seiki, Makoto; Matsuyama, Takashi
2016-01-01
Post-transcriptional upregulation is an effective way to increase the expression of transgenes and thus maximize the yields of target chemicals from metabolically engineered organisms. Refractory elements in the 3′ untranslated region (UTR) that increase mRNA half-life might be available. In Saccharomyces cerevisiae, several terminator regions have shown activity in increasing the production of proteins by upstream coding genes; among these terminators the DIT1 terminator has the highest activity. Here, we found in Saccharomyces cerevisiae that two resident trans-acting RNA-binding proteins (Nab6p and Pap1p) enhance the activity of the DIT1 terminator through the cis element GUUCG/U within the 3′-UTR. These two RNA-binding proteins could upregulate a battery of cell-wall–related genes. Mutagenesis of the DIT1 terminator improved its activity by a maximum of 500% of that of the standard PGK1 terminator. Further understanding and improvement of this system will facilitate inexpensive and stable production of complicated organism-derived drugs worldwide. PMID:27845367
Polycomb repressive complex 1 modifies transcription of active genes
Pherson, Michelle; Misulovin, Ziva; Gause, Maria; Mihindukulasuriya, Kathie; Swain, Amanda; Dorsett, Dale
2017-01-01
This study examines the role of Polycomb repressive complex 1 (PRC1) at active genes. The PRC1 and PRC2 complexes are crucial for epigenetic silencing during development of an organism. They are recruited to Polycomb response elements (PREs) and establish silenced domains over several kilobases. Recent studies show that PRC1 is also directly recruited to active genes by the cohesin complex. Cohesin participates broadly in control of gene transcription, but it is unknown whether cohesin-recruited PRC1 also plays a role in transcriptional control of active genes. We address this question using genome-wide RNA sequencing (RNA-seq) and chromatin immunoprecipitation sequencing (ChIP-seq). The results show that PRC1 influences transcription of active genes, and a significant fraction of its effects are likely direct. The roles of different PRC1 subunits can also vary depending on the gene. Depletion of PRC1 subunits by RNA interference alters phosphorylation of RNA polymerase II (Pol II) and occupancy by the Spt5 pausing-elongation factor at most active genes. These effects on Pol II phosphorylation and Spt5 are likely linked to changes in elongation and RNA processing detected by nascent RNA-seq, although the mechanisms remain unresolved. The experiments also reveal that PRC1 facilitates association of Spt5 with enhancers and PREs. Reduced Spt5 levels at these regulatory sequences upon PRC1 depletion coincide with changes in Pol II occupancy and phosphorylation. Our findings indicate that, in addition to its repressive roles in epigenetic gene silencing, PRC1 broadly influences transcription of active genes and may suppress transcription of nonpromoter regulatory sequences. PMID:28782042
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.
Drouin, Guy; Tsang, Corey
2012-06-01
Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
Maruyama, Atsushi; Mimura, Junsei; Itoh, Ken
2014-01-01
Recent studies have disclosed the function of enhancer RNAs (eRNAs), which are long non-coding RNAs transcribed from gene enhancer regions, in transcriptional regulation. However, it remains unclear whether eRNAs are involved in the regulation of human heme oxygenase-1 gene (HO-1) induction. Here, we report that multiple nuclear-enriched eRNAs are transcribed from the regions adjacent to two human HO-1 enhancers (i.e. the distal E2 and proximal E1 enhancers), and some of these eRNAs are induced by the oxidative stress-causing reagent diethyl maleate (DEM). We demonstrated that the expression of one forward direction (5′ to 3′) eRNA transcribed from the human HO-1 E2 enhancer region (named human HO-1enhancer RNA E2-3; hereafter called eRNA E2-3) was induced by DEM in an NRF2-dependent manner in HeLa cells. Conversely, knockdown of BACH1, a repressor of HO-1 transcription, further increased DEM-inducible eRNA E2-3 transcription as well as HO-1 expression. In addition, we showed that knockdown of eRNA E2-3 selectively down-regulated DEM-induced HO-1 expression. Furthermore, eRNA E2-3 knockdown attenuated DEM-induced Pol II binding to the promoter and E2 enhancer regions of HO-1 without affecting NRF2 recruitment to the E2 enhancer. These findings indicate that eRNAE2-3 is functional and is required for HO-1 induction. PMID:25404134
Incorporation of excess wild-type and mutant tRNA(3Lys) into human immunodeficiency virus type 1.
Huang, Y; Mak, J; Cao, Q; Li, Z; Wainberg, M A; Kleiman, L
1994-01-01
Human immunodeficiency virus (HIV) particles produced in COS-7 cells transfected with HIV type 1 (HIV-1) proviral DNA contain 8 molecules of tRNA(3Lys) per 2 molecules of genomic RNA and 12 molecules of tRNA1,2Lys per 2 molecules of genomic RNA. When COS-7 cells are transfected with a plasmid containing both HIV-1 proviral DNA and a human tRNA3Lys gene, there is a large increase in the amount of cytoplasmic tRNA3Lys per microgram of total cellular RNA, and the tRNA3Lys content in the virus increases from 8 to 17 molecules per 2 molecules of genomic RNA. However, the total number of tRNALys molecules per 2 molecules of genomic RNA remains constant at 20; i.e., the viral tRNA1,2Lys content decreases from 12 to 3 molecules per 2 molecules of genomic RNA. All detectable tRNA3Lys is aminoacylated in the cytoplasm of infected cells and deacylated in the virus. When COS-7 cells are transfected with a plasmid containing both HIV-1 proviral DNA and a mutant amber suppressor tRNA3Lys gene (in which the anticodon is changed from TTT to CTA), there is also a large increase in the relative concentration of cytoplasmic tRNA3Lys, and the tRNA3Lys content in the virus increases from 8 to 15 molecules per 2 molecules of genomic RNA, with a decrease in viral tRNA1,2Lys from 12 to 5 molecules per 2 molecules of genomic RNA. Thus, the total number of molecules of tRNALys in the virion remains at 20. The alteration of the anticodon has little effect on the viral packaging of this mutant tRNA in spite of the fact that it no longer contains the modified base mcm 5s2U at position 34, and its ability to be aminoacylated is significantly impaired compared with that of wild-type tRNA3Lys. Viral particles which have incorporated either excess wild-type tRNA3Lys or mutant suppressor tRNA3Lys show no differences in viral infectivity compared with wild-type HIV-1. Images PMID:7966556
Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Qiu, Shuqing; Rollins, Meaghen; Datla, Raju; Gupta, Vidya S; Kadoo, Narendra Y
2013-04-01
MicroRNAs (miRNAs) are small (20-24 nucleotide long) endogenous regulatory RNAs that play important roles in plant growth and development. They regulate gene expression at the post-transcriptional level by translational repression or target degradation and gene silencing. In this study, we identified 116 conserved miRNAs belonging to 23 families from the flax (Linum usitatissimum L.) genome using a computational approach. The precursor miRNAs varied in length; while most of the mature miRNAs were 21 nucleotide long, intergenic and showed conserved signatures of RNA polymerase II transcripts in their upstream regions. Promoter region analysis of the flax miRNA genes indicated prevalence of MYB transcription factor binding sites. Four miRNA gene clusters containing members of three phylogenetic groups were identified. Further, 142 target genes were predicted for these miRNAs and most of these represent transcriptional regulators. The miRNA encoding genes were expressed in diverse tissues as determined by digital expression analysis as well as real-time PCR. The expression of fourteen miRNAs and nine target genes was independently validated using the quantitative reverse transcription PCR (qRT-PCR). This study suggests that a large number of conserved plant miRNAs are also found in flax and these may play important roles in growth and development of flax.
LncRNA-TP53TG1 Participated in the Stress Response Under Glucose Deprivation in Glioma.
Chen, Xin; Gao, Yang; Li, Deheng; Cao, Yiqun; Hao, Bin
2017-12-01
Gliomas are the most common brain tumors of the center nervous system. And long non-coding RNAs (lncRNAs) are non-protein coding transcripts, which have been considered as one type of gene expression regulator for cancer development. In this study, we investigated the role of lncRNA-TP53TG1 in response to glucose deprivation in human gliomas. The expression levels of TP53TG1 in glioma tissues and cells were analyzed by qRT-PCR. In addition, the influence of TP53TG1 on glucose metabolism related genes at the mRNA level during both high and low glucose treatment was detected by qRT-PCR. MTT, clonogenicity assays, and flow cytometry were performed to detect the cell proliferation and cell apoptosis. Furthermore, the migration of glioma cells was examined by Transwell assays. The expression of TP53TG1 was significantly higher in human glioma tissues or cell lines compared with normal brain tissue or NHA. Moreover, TP53TG1 and some tumor glucose metabolism related genes, such as GRP78, LDHA, and IDH1 were up-regulated significantly in U87 and LN18 cells under glucose deprivation. In addition, knockdown of TP53TG1 decreased cell proliferation and migration and down-regulated GRP78 and IDH1 expression levels and up-regulated PKM2 levels in U87 cells under glucose deprivation. However, over-expression of TP53TG1 showed the opposite tendency. Moreover, the effects of TP53TG1 were more remarkable in low glucose than that in high glucose. Our data showed that TP53TG1 under glucose deprivation may promote cell proliferation and migration by influencing the expression of glucose metabolism related genes in glioma. J. Cell. Biochem. 118: 4897-4904, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
Altered Expression of Porcine Piwi Genes and piRNA during Development
Kowalczykiewicz, Dorota; Pawlak, Piotr; Lechniak, Dorota; Wrzesinski, Jan
2012-01-01
Three Sus scrofa Piwi genes (Piwil1, Piwil2 and Piwil4) encoding proteins of 861, 985 and 853 aminoacids, respectively, were cloned and sequenced. Alignment of the Piwi proteins showed the high identity between Sus scrofa and Homo sapiens. Relative transcript abundance of porcine Piwil1, Piwil2 and Piwil4 genes in testes, ovaries and oocytes derived from sexually immature and mature animals was examined using Real-Time PCR. Expression of the three Piwi mRNAs was proved to be tissue specific and restricted exclusively to the gonads. In testes of adult pigs the highest relative transcript abundance was observed for the Sus scrofa Piwil1 gene. On the other hand, in testes of neonatal pigs the Piwil1 transcript level was over 2–fold reduced while the level of Piwil2 transcript was higher. As regards the expression of the Piwil4 transcript, its level was 34-fold elevated in testes of neonatal piglet when compared to adult male. In ovaries of prepubertal and pubertal female pigs transcript abundance of the three Piwi genes was significantly reduced in comparison with testes. However, similarly to testes, in ovaries of neonatal pigs the Piwil2 gene was characterized by the highest relative transcript abundance among the three Piwi genes analysed. In prepubertal and pubertal oocytes Piwil1 transcript was the most abundant whereas the expression of Piwil4 was undetectable. We also demonstrated that expression of piRNA occurs preferentially in the gonads of adult male and female pigs. Moreover, a piRNA subset isolated from ovaries was 2–3 nucleotides longer than the piRNA from testes. PMID:22952772
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wagner, B.J.; Long, L.; Pettenati, M.J.
Messenger RNAs encoding many oncoproteins and cytokines are relatively unstable. Their instability, which ensures appropriate levels and timing of expression, is controlled in part by proteins that bind to A + U-rich instability elements (AREs) present in the 3{prime}-untranslated regions of the mRNAs. cDNAs encoding the AUF1 family of ARE-binding proteins were cloned from human and murine cDNA libraries. In the present study monochromosomal somatic cell hybrids were used to localize two AUF1 loci to human chromosomes 4 and X. In situ hybridization analyses using P1 clones as probes identified the 4q21.1-q21.2 and Xq12 regions as the locations of themore » AUF1 genes. 10 refs., 2 figs.« less
Han, Junwei; Shang, Desi; Zhang, Yunpeng; Zhang, Wei; Yao, Qianlan; Han, Lei; Xu, Yanjun; Yan, Wei; Bao, Zhaoshi; You, Gan; Jiang, Tao; Kang, Chunsheng; Li, Xia
2014-01-01
The prognosis of glioma patients is usually poor, especially in patients with glioblastoma (World Health Organization (WHO) grade IV). The regulatory functions of microRNA (miRNA) on genes have important implications in glioma cell survival. However, there are not many studies that have investigated glioma survival by integrating miRNAs and genes while also considering pathway structure. In this study, we performed sample-matched miRNA and mRNA expression profilings to systematically analyze glioma patient survival. During this analytical process, we developed pathway-based random walk to identify a glioma core miRNA-gene module, simultaneously considering pathway structure information and multi-level involvement of miRNAs and genes. The core miRNA-gene module we identified was comprised of four apparent sub-modules; all four sub-modules displayed a significant correlation with patient survival in the testing set (P-values≤0.001). Notably, one sub-module that consisted of 6 miRNAs and 26 genes also correlated with survival time in the high-grade subgroup (WHO grade III and IV), P-value = 0.0062. Furthermore, the 26-gene expression signature from this sub-module had robust predictive power in four independent, publicly available glioma datasets. Our findings suggested that the expression signatures, which were identified by integration of miRNA and gene level, were closely associated with overall survival among the glioma patients with various grades. PMID:24809850
Gao, Shan; Hein, San; Dagnæs-Hansen, Frederik; Weyer, Kathrin; Yang, Chuanxu; Nielsen, Rikke; Christensen, Erik I; Fenton, Robert A; Kjems, Jørgen
2014-01-01
RNAi-based strategies provide a great therapeutic potential for treatment of various human diseases including kidney disorders, but face the challenge of in vivo delivery and specific targeting. The chitosan delivery system has previously been shown to target siRNA specifically to the kidneys in mice when administered intravenously. Here we confirm by 2D and 3D bioimaging that chitosan formulated siRNA is retained in the kidney for more than 48 hours where it accumulates in proximal tubule epithelial cells (PTECs), a process that was strongly dependent on the molecular weight of chitosan. Chitosan/siRNA nanoparticles, administered to chimeric mice with conditional knockout of the megalin gene, distributed almost exclusively in cells that expressed megalin, implying that the chitosan/siRNA particle uptake was mediated by a megalin-dependent endocytotic pathway. Knockdown of the water channel aquaporin 1 (AQP1) by up to 50% in PTECs was achieved utilizing the systemic i.v. delivery of chitosan/AQP1 siRNA in mice. In conclusion, specific targeting PTECs with the chitosan nanoparticle system may prove to be a useful strategy for knockdown of specific genes in PTECs, and provides a potential therapeutic strategy for treating various kidney diseases.
Gao, Shan; Hein, San; Dagnæs-Hansen, Frederik; Weyer, Kathrin; Yang, Chuanxu; Nielsen, Rikke; Christensen, Erik I; Fenton, Robert A; Kjems, Jørgen
2014-01-01
RNAi-based strategies provide a great therapeutic potential for treatment of various human diseases including kidney disorders, but face the challenge of in vivo delivery and specific targeting. The chitosan delivery system has previously been shown to target siRNA specifically to the kidneys in mice when administered intravenously. Here we confirm by 2D and 3D bioimaging that chitosan formulated siRNA is retained in the kidney for more than 48 hours where it accumulates in proximal tubule epithelial cells (PTECs), a process that was strongly dependent on the molecular weight of chitosan. Chitosan/siRNA nanoparticles, administered to chimeric mice with conditional knockout of the megalin gene, distributed almost exclusively in cells that expressed megalin, implying that the chitosan/siRNA particle uptake was mediated by a megalin-dependent endocytotic pathway. Knockdown of the water channel aquaporin 1 (AQP1) by up to 50% in PTECs was achieved utilizing the systemic i.v. delivery of chitosan/AQP1 siRNA in mice. In conclusion, specific targeting PTECs with the chitosan nanoparticle system may prove to be a useful strategy for knockdown of specific genes in PTECs, and provides a potential therapeutic strategy for treating various kidney diseases. PMID:25157280
RNA-Seq for Bacterial Gene Expression.
Poulsen, Line Dahl; Vinther, Jeppe
2018-06-01
RNA sequencing (RNA-seq) has become the preferred method for global quantification of bacterial gene expression. With the continued improvements in sequencing technology and data analysis tools, the most labor-intensive and expensive part of an RNA-seq experiment is the preparation of sequencing libraries, which is also essential for the quality of the data obtained. Here, we present a straightforward and inexpensive basic protocol for preparation of strand-specific RNA-seq libraries from bacterial RNA as well as a computational pipeline for the data analysis of sequencing reads. The protocol is based on the Illumina platform and allows easy multiplexing of samples and the removal of sequencing reads that are PCR duplicates. © 2018 by John Wiley & Sons, Inc. © 2018 John Wiley & Sons, Inc.
Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian
2013-01-01
In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.
miRNA-Processing Gene Methylation and Cancer Risk.
Joyce, Brian T; Zheng, Yinan; Zhang, Zhou; Liu, Lei; Kocherginsky, Masha; Murphy, Robert; Achenbach, Chad J; Musa, Jonah; Wehbe, Firas; Just, Allan; Shen, Jincheng; Vokonas, Pantel; Schwartz, Joel; Baccarelli, Andrea A; Hou, Lifang
2018-05-01
Background: Dysregulation of miRNA and methylation levels are epigenetic hallmarks of cancer, potentially linked via miRNA-processing genes. Studies have found genetic alterations to miRNA-processing genes in cancer cells and human population studies. Our objective was to prospectively examine changes in DNA methylation of miRNA-processing genes and their associations with cancer risk. Methods: We examined cohort data from the Department of Veterans' Affairs Normative Aging Study. Participants were assessed every 3 to 5 years starting in 1999 through 2013 including questionnaires, medical record review, and blood collection. Blood from 686 consenting participants was analyzed using the Illumina 450K BeadChip array to measure methylation at CpG sites throughout the genome. We selected 19 genes based on a literature review, with 519 corresponding CpG sites. We then used Cox proportional hazards models to examine associations with cancer incidence, and generalized estimating equations to examine associations with cancer prevalence. Associations at false discovery rate < 0.05 were considered statistically significant. Results: Methylation of three CpGs ( DROSHA : cg23230564, TNRC6B : cg06751583, and TNRC6B : cg21034183) was prospectively associated with time to cancer development (positively for cg06751583, inversely for cg23230564 and cg21034183), whereas methylation of one CpG site ( DROSHA : cg16131300) was positively associated with cancer prevalence. Conclusions: DNA methylation of DROSHA , a key miRNA-processing gene, and TNRC6B may play a role in early carcinogenesis. Impact: Changes in miRNA processing may exert multiple effects on cancer development, including protecting against it via altered global miRNAs, and may be a useful early detection biomarker of cancer. Cancer Epidemiol Biomarkers Prev; 27(5); 550-7. ©2018 AACR . ©2018 American Association for Cancer Research.
Non-functional genes repaired at the RNA level.
Burger, Gertraud
2016-01-01
Genomes and genes continuously evolve. Gene sequences undergo substitutions, deletions or nucleotide insertions; mobile genetic elements invade genomes and interleave in genes; chromosomes break, even within genes, and pieces reseal in reshuffled order. To maintain functional gene products and assure an organism's survival, two principal strategies are used - either repair of the gene itself or of its product. I will introduce common types of gene aberrations and how gene function is restored secondarily, and then focus on systematically fragmented genes found in a poorly studied protist group, the diplonemids. Expression of their broken genes involves restitching of pieces at the RNA-level, and substantial RNA editing, to compensate for point mutations. I will conclude with thoughts on how such a grotesquely unorthodox system may have evolved, and why this group of organisms persists and thrives since tens of millions of years. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Fei, Dennis Liang; Motowski, Hayley; Chatrikhi, Rakesh; Gao, Shaojian; Kielkopf, Clara L.; Varmus, Harold
2016-01-01
We have asked how the common S34F mutation in the splicing factor U2AF1 regulates alternative splicing in lung cancer, and why wild-type U2AF1 is retained in cancers with this mutation. A human lung epithelial cell line was genetically modified so that U2AF1S34F is expressed from one of the two endogenous U2AF1 loci. By altering levels of mutant or wild-type U2AF1 in this cell line and by analyzing published data on human lung adenocarcinomas, we show that S34F-associated changes in alternative splicing are proportional to the ratio of S34F:wild-type gene products and not to absolute levels of either the mutant or wild-type factor. Preferential recognition of specific 3′ splice sites in S34F-expressing cells is largely explained by differential in vitro RNA-binding affinities of mutant versus wild-type U2AF1 for those same 3′ splice sites. Finally, we show that lung adenocarcinoma cell lines bearing U2AF1 mutations do not require the mutant protein for growth in vitro or in vivo. In contrast, wild-type U2AF1 is required for survival, regardless of whether cells carry the U2AF1S34F allele. Our results provide mechanistic explanations of the magnitude of splicing changes observed in U2AF1-mutant cells and why tumors harboring U2AF1 mutations always retain an expressed copy of the wild-type allele. PMID:27776121
Puppin, Cinzia; Durante, Cosimo; Sponziello, Marialuisa; Verrienti, Antonella; Pecce, Valeria; Lavarone, Elisa; Baldan, Federica; Campese, Antonio Francesco; Boichard, Amelie; Lacroix, Ludovic; Russo, Diego; Filetti, Sebastiano; Damante, Giuseppe
2014-11-01
Abnormal expression of non-coding micro RNA (miRNA) has been described in medullary thyroid carcinoma (MTC). Expression of genes encoding factors involved in miRNA biogenesis results often deregulated in human cancer and correlates with aggressive clinical behavior. In this study, expression of four genes involved in miRNA biogenesis (DICER, DROSHA, DCGR8, and XPO5) was investigated in 54 specimens of MTC. Among them, 33 and 13 harbored RET and RAS mutations, respectively. DICER, DGCR8, and XPO5 mRNA levels were significantly overexpressed in MTC harboring RET mutations, in particular, in the presence of RET634 mutation. When MTCs with RET and RAS mutations were compared, only DGCR8 displayed a significant difference, while MTCs with RAS mutations did not show significant differences with respect to non-mutated tumors. We then attempted to correlate expression of miRNA biogenesis genes with tumor aggressiveness. According to the TNM status, MTCs were divided in two groups and compared (N0 M0 vs. N1 and/or M1): for all four genes no significant difference was detected. Cell line experiments, in which expression of a RET mutation is silenced by siRNA, suggest the existence of a causal relationship between RET mutation and overexpression of DICER, DGCR8, and XPO5 genes. These findings demonstrate that RET- but not RAS-driven tumorigenic alterations include abnormalities in the expression of some important genes involved in miRNA biogenesis that could represent new potential markers for targeted therapies in the treatment of RET-mutated MTCs aimed to restore the normal miRNA expression profile.
Etich, Julia; Bergmeier, Vera; Pitzler, Lena; Brachvogel, Bent
2017-03-01
Wound healing is a coordinated process to restore tissue homeostasis and reestablish the protective barrier of the skin. miRNAs may modulate the expression of target genes to contribute to repair processes, but due to the complexity of the tissue it is challenging to quantify gene expression during the distinct phases of wound repair. Here, we aimed to identify a common reference gene to quantify changes in miRNA and mRNA expression during skin wound healing. Quantitative real-time PCR and bioinformatic analysis tools were used to identify suitable reference genes during skin repair and their reliability was tested by studying the expression of mRNAs and miRNAs. Morphological assessment of wounds showed that the injury model recapitulates the distinct phases of skin repair. Non-degraded RNA could be isolated from skin and wounds and used to study the expression of non-coding small nuclear RNAs during wound healing. Among those, RNU6B was most constantly expressed during skin repair. Using this reference gene we could confirm the transient upregulation of IL-1β and PTPRC/CD45 during the early phase as well as the increased expression of collagen type I at later stages of repair and validate the differential expression of miR-204, miR-205, and miR-31 in skin wounds. In contrast to Gapdh the normalization to multiple reference genes gave a similar outcome. RNU6B is an accurate alternative normalizer to quantify mRNA and miRNA expression during the distinct phases of skin wound healing when analysis of multiple reference genes is not feasible.
NASA Technical Reports Server (NTRS)
Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.
1992-01-01
We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.
Internal control regions for transcription of eukaryotic tRNA genes.
Sharp, S; DeFranco, D; Dingermann, T; Farrell, P; Söll, D
1981-01-01
We have identified the region within a eukaryotic tRNA gene required for initiation of transcription. These results were obtained by systematically constructing deletions extending from the 5' or the 3' flanking regions into a cloned Drosophila tRNAArg gene by using nuclease BAL 31. The ability of the newly generated deletion clones to direct the in vitro synthesis of tRNA precursors was measured in transcription systems from Xenopus laevis oocytes, Drosophila Kc cells, and HeLa cells. Two control regions within the coding sequence were identified. The first was essential for transcription and was contained between nucleotides 8 and 25 of the mature tRNA sequence. Genes devoid of the second control region, which was contained between nucleotides 50 and 58 of the mature tRNA sequence, could be transcribed but with reduced efficiency. Thus, the promoter regions within a tRNA gene encode the tRNA sequences of the D stem and D loop, the invariant uridine at position 8, and the semi-invariant G-T-psi-C sequence. Images PMID:6947245
The RNA-induced silencing complex: a versatile gene-silencing machine.
Pratt, Ashley J; MacRae, Ian J
2009-07-03
RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.
Lin, Jia-Hwei; Levin, Henry L.
1998-01-01
An inverted repeat (IR) within the U5 region of the Rous sarcoma virus (RSV) mRNA forms a structure composed of a 7-bp stem and a 5-nucleotide (nt) loop. This U5-IR structure has been shown to be required for the initiation of reverse transcription. The mRNA of Tf1, long terminal repeat-containing retrotransposon from fission yeast (Schizosaccharomyces pombe) contains nucleotides with the potential to form a U5-IR stem-loop that is strikingly similar to that of RSV. The putative U5-IR stem-loop of Tf1 consists of a 7-bp stem and a 25-nt loop. Results from mutagenesis studies indicate that the U5-IR stem-loop in the mRNA of Tf1 does form and that it is required for Tf1 transposition. Although the loop is required for transposition, we were surprised that the specific sequence of the nucleotides within the loop was unimportant for function. Additional investigation indicates that the loss of transposition activity due to a reduction in the loop size to 6 nt could be rescued by increasing the GC content of the stem. This result indicates that the large loop in the Tf1 mRNA relative to that of the RSV allows the formation of the relatively weak U5-IR stem. The levels of Tf1 proteins expressed and the amounts of Tf1 RNA packaged into the virus-like particles were not affected by mutations in the U5-IR structure. However, all of the mutations in the U5-IR structure that caused defects in transposition produced low amounts of reverse transcripts. A unique feature in the initiation of Tf1 reverse transcription is that, instead of a tRNA, the first 11 nt of the Tf1 mRNA serve as the minus-strand primer. Analysis of the 5′ end of Tf1 mRNA revealed that the mutations in the U5-IR stem-loop that resulted in defects in reverse transcription caused a reduction in the cleavage activity required to generate the Tf1 primer. Our results indicate that the U5-IR stems of Tf1 and RSV are conserved in size, position, and function. PMID:9774699
Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F
2017-01-06
Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis
Sex-specific silencing of X-linked genes by Xist RNA
Gayen, Srimonta; Maclary, Emily; Hinten, Michael; Kalantry, Sundeep
2016-01-01
X-inactive specific transcript (Xist) long noncoding RNA (lncRNA) is thought to catalyze silencing of X-linked genes in cis during X-chromosome inactivation, which equalizes X-linked gene dosage between male and female mammals. To test the impact of Xist RNA on X-linked gene silencing, we ectopically induced endogenous Xist by ablating the antisense repressor Tsix in mice. We find that ectopic Xist RNA induction and subsequent X-linked gene silencing is sex specific in embryos and in differentiating embryonic stem cells (ESCs) and epiblast stem cells (EpiSCs). A higher frequency of XΔTsixY male cells displayed ectopic Xist RNA coating compared with XΔTsixX female cells. This increase reflected the inability of XΔTsixY cells to efficiently silence X-linked genes compared with XΔTsixX cells, despite equivalent Xist RNA induction and coating. Silencing of genes on both Xs resulted in significantly reduced proliferation and increased cell death in XΔTsixX female cells relative to XΔTsixY male cells. Thus, whereas Xist RNA can inactivate the X chromosome in females it may not do so in males. We further found comparable silencing in differentiating XΔTsixY and 39,XΔTsix (XΔTsixO) ESCs, excluding the Y chromosome and instead implicating the X-chromosome dose as the source of the sex-specific differences. Because XΔTsixX female embryonic epiblast cells and EpiSCs harbor an inactivated X chromosome prior to ectopic inactivation of the active XΔTsix X chromosome, we propose that the increased expression of one or more X-inactivation escapees activates Xist and, separately, helps trigger X-linked gene silencing. PMID:26739568
Iwamoto, Masao; Tagiri, Akemi
2016-02-01
Fertilizers are often potential environmental pollutants, therefore increasing productivity and the efficiency of nutrient uptake to boost crop yields without the risk of environmental pollution is a desirable goal. Here, we show that the transcription factor encoding gene RDD1 plays a role in improving the uptake and accumulation of various nutrient ions in rice. RDD1 was found to be targeted by the microRNA miR166. An RDD1 transgene driven by a strong constitutive promoter exhibited a diurnally oscillating expression similar to that of the endogenous RDD1, and nucleotide substitution within the miR166 recognition site to prevent miR166-RDD1 mRNA pairing resulted in constitutive RDD1 expression. The RDD1 protein was localized to vascular tissue because miR166 repressed RDD1 expression in the mesophyll. The overexpression of RDD1 induced the expression of genes associated with the transport of several nutrients such as NH4(+), Na(+), SO4(2-), Cl(-), PO4(3-) and sucrose, and the uptake and accumulation of various nutrient ions under low-nutrient conditions. Moreover, the overexpression of RDD1 increased nitrogen responsiveness and grain productivity. Our results suggest that RDD1 can contribute to the increased grain productivity of rice via inducing the efficient uptake and accumulation of various nutrient ions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Minchenko, O H; Kharkova, A P; Minchenko, D O; Karbovskyi, L L
2015-01-01
We have studied hypoxic regulation of the expression of different insulin-like growth factor binding protein genes in U87 glioma cells in relation to inhibition of IRE1 (inositol requiring enzyme-1), a central mediator of endoplasmic reticulum stress, which controls cell proliferation and tumor growth. We have demonstrated that hypoxia leads to up-regulation of the expression of IGFBP6, IGFBP7, IGFBP10/CYR61, WISP1, and WISP2 genes and down-regulation--of IGFBP9/NOV gene at the mRNA level in control glioma cells, being more signifcant changes for IGFBP10/CYR61 and WISP2 genes. At the same time, inhibition of IRE1 modifies the effect of hypoxia on the expression of all studied genes: eliminates sensitivity to hypoxia the expression of IGFBP7 and IGFBP9/NOV genes, suppresses effect of hypoxia on IGFBP6, IGFBP10/CYR61, and WISP2 genes, and slightly enhances hypoxic regulation of WISP1 gene expression in glioma cells. We have also demonstrated that the expression of all studied genes in glioma cells is regulated by IRE1 signaling enzyme upon normoxic condition, because inhibition of IRE1 significantly up-regulates IGFBP7, IGFBP10/CYR61, WISP1, and WISP2 genes and down-regulates IGFBP6 and IGFBP9/NOV genes as compared to control glioma cells. The present study demonstrates that hypoxia, which contributes to tumor growth, affects all studied IGFBP and WISP gene expressions and that inhibition of IRE1 preferentially abolishes or suppresses the hypoxic regulation of these gene expressions and thus possibly contributes to slower glioma growth. Moreover, inhibition of IRE1, which correlates with suppression of cell proliferation and glioma growth, is down-regulated expression of pro-proliferative IGFBP genes, attesting to the fact that endoplasmic reticulum stress is a necessary component of malignant tumor growth.
Computational Prediction of miRNA Genes from Small RNA Sequencing Data
Kang, Wenjing; Friedländer, Marc R.
2015-01-01
Next-generation sequencing now for the first time allows researchers to gage the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. microRNAs (miRNAs) are 22 nucleotide small RNAs (sRNAs) that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq), which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here, we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field. PMID:25674563
Escape of X-linked miRNA genes from meiotic sex chromosome inactivation
Sosa, Enrique; Flores, Luis; Yan, Wei; McCarrey, John R.
2015-01-01
Past studies have indicated that transcription of all X-linked genes is repressed by meiotic sex chromosome inactivation (MSCI) during the meiotic phase of spermatogenesis in mammals. However, more recent studies have shown an increase in steady-state levels of certain X-linked miRNAs in pachytene spermatocytes, suggesting that either synthesis of these miRNAs increases or that degradation of these miRNAs decreases dramatically in these cells. To distinguish between these possibilities, we performed RNA-FISH to detect nascent transcripts from multiple miRNA genes in various spermatogenic cell types. Our results show definitively that Type I X-linked miRNA genes are subject to MSCI, as are all or most X-linked mRNA genes, whereas Type II and III X-linked miRNA genes escape MSCI by continuing ongoing, active transcription in primary spermatocytes. We corroborated these results by co-localization of RNA-FISH signals with both a corresponding DNA-FISH signal and an immunofluorescence signal for RNA polymerase II. We also found that X-linked miRNA genes that escape MSCI locate non-randomly to the periphery of the XY body, whereas genes that are subject to MSCI remain located within the XY body in pachytene spermatocytes, suggesting that the mechanism of escape of X-linked miRNA genes from MSCI involves their relocation to a position outside of the repressive chromatin domain associated with the XY body. The fact that Type II and III X-linked miRNA genes escape MSCI suggests an immediacy of function of the encoded miRNAs specifically required during the meiotic stages of spermatogenesis. PMID:26395485
Building a stable RNA U-turn with a protonated cytidine
Gottstein-Schmidtke, Sina R.; Duchardt-Ferner, Elke; Groher, Florian; Weigand, Julia E.; Gottstein, Daniel; Suess, Beatrix; Wöhnert, Jens
2014-01-01
The U-turn is a classical three-dimensional RNA folding motif first identified in the anticodon and T-loops of tRNAs. It also occurs frequently as a building block in other functional RNA structures in many different sequence and structural contexts. U-turns induce sharp changes in the direction of the RNA backbone and often conform to the 3-nt consensus sequence 5′-UNR-3′ (N = any nucleotide, R = purine). The canonical U-turn motif is stabilized by a hydrogen bond between the N3 imino group of the U residue and the 3′ phosphate group of the R residue as well as a hydrogen bond between the 2′-hydroxyl group of the uridine and the N7 nitrogen of the R residue. Here, we demonstrate that a protonated cytidine can functionally and structurally replace the uridine at the first position of the canonical U-turn motif in the apical loop of the neomycin riboswitch. Using NMR spectroscopy, we directly show that the N3 imino group of the protonated cytidine forms a hydrogen bond with the backbone phosphate 3′ from the third nucleotide of the U-turn analogously to the imino group of the uridine in the canonical motif. In addition, we compare the stability of the hydrogen bonds in the mutant U-turn motif to the wild type and describe the NMR signature of the C+-phosphate interaction. Our results have implications for the prediction of RNA structural motifs and suggest simple approaches for the experimental identification of hydrogen bonds between protonated C-imino groups and the phosphate backbone. PMID:24951555
Ming, Zhenping; Gong, Ai-Yu; Wang, Yang; Zhang, Xin-Tian; Li, Min; Dolata, Courtney E; Chen, Xian-Ming
2018-03-01
To counteract host immunity, Cryptosporidium parvum has evolved multiple strategies to suppress host antimicrobial defense. One such strategy is to reduce the production of the antimicrobial peptide beta-defensin 1 (DEFB1) by host epithelial cells but the underlying mechanisms remain unclear. Recent studies demonstrate that a panel of parasite RNA transcripts of low protein-coding potential are delivered into infected host cells and may modulate host gene transcription. Using in vitro models of intestinal cryptosporidiosis, in this study, we analyzed the expression profile of host beta-defensin genes in host cells following infection. We found that C. parvum infection caused a significant downregulation of the DEFB1 gene. Interestingly, downregulation of DEFB1 gene was associated with host delivery of Cdg7_FLc_1000 RNA transcript, a C. parvum RNA that has previously demonstrated to be delivered into the nuclei of infected host cells. Knockdown of Cdg7_FLc_1000 in host cells could attenuate the trans-suppression of host DEFB1 gene and decreased the parasite burden. Therefore, our data suggest that trans-suppression of DEFB1 gene in intestinal epithelial cells following C. parvum infection involves host delivery of parasite Cdg7_FLc_1000 RNA, a process that may be relevant to the epithelial defense evasion by C. parvum at the early stage of infection.
Song, Jianbo; Mo, Xiaowei; Yang, Haiqi; Yue, Luming; Song, Jun; Mo, Beixin
2017-01-01
The ubiquitination pathway regulates growth, development, and stress responses in plants, and the U-box protein family of ubiquitin ligases has important roles in this pathway. Here, 64 putative U-box proteins were identified in the Medicago truncatula genome. In addition to the conserved U-box motif, other functional domains, such as the ARM, kinase, KAP, and WD40 domains, were also detected. Phylogenetic analysis of the M. truncatula U-box proteins grouped them into six subfamilies, and chromosomal mapping and synteny analyses indicated that tandem and segmental duplications may have contributed to the expansion and evolution of the U-box gene family in this species. Using RNA-seq data from M. truncatula seedlings subjected to three different abiotic stresses, we identified 33 stress-inducible plant U-box genes (MtPUBs). Specifically, 25 salinity-, 15 drought-, and 16 cold-regulated MtPUBs were detected. Among them, MtPUB10, MtPUB17, MtPUB18, MtPUB35, MtPUB42, and MtPUB44 responded to all three stress conditions. Expression profiling by qRT-PCR was consistent with the RNA-seq data, and stress-related elements were identified in the promoter regions. The present findings strongly indicate that U-box proteins play critical roles in abiotic stress response in M. truncatula.
Yang, Haiqi; Yue, Luming; Song, Jun
2017-01-01
The ubiquitination pathway regulates growth, development, and stress responses in plants, and the U-box protein family of ubiquitin ligases has important roles in this pathway. Here, 64 putative U-box proteins were identified in the Medicago truncatula genome. In addition to the conserved U-box motif, other functional domains, such as the ARM, kinase, KAP, and WD40 domains, were also detected. Phylogenetic analysis of the M. truncatula U-box proteins grouped them into six subfamilies, and chromosomal mapping and synteny analyses indicated that tandem and segmental duplications may have contributed to the expansion and evolution of the U-box gene family in this species. Using RNA-seq data from M. truncatula seedlings subjected to three different abiotic stresses, we identified 33 stress-inducible plant U-box genes (MtPUBs). Specifically, 25 salinity-, 15 drought-, and 16 cold-regulated MtPUBs were detected. Among them, MtPUB10, MtPUB17, MtPUB18, MtPUB35, MtPUB42, and MtPUB44 responded to all three stress conditions. Expression profiling by qRT-PCR was consistent with the RNA-seq data, and stress-related elements were identified in the promoter regions. The present findings strongly indicate that U-box proteins play critical roles in abiotic stress response in M. truncatula. PMID:28771553
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Kogure, Akiko; Uno, Masaharu; Ikeda, Takako; Nishida, Eisuke
2017-07-07
Intermittent fasting (IF) is a dietary restriction regimen that extends the lifespans of Caenorhabditis elegans and mammals by inducing changes in gene expression. However, how IF induces these changes and promotes longevity remains unclear. One proposed mechanism involves gene regulation by microRNAs (miRNAs), small non-coding RNAs (∼22 nucleotides) that repress gene expression and whose expression can be altered by fasting. To test this proposition, we examined the role of the miRNA machinery in fasting-induced transcriptional changes and longevity in C. elegans We revealed that fasting up-regulated the expression of the miRNA-induced silencing complex (miRISC) components, including Argonaute and GW182, and the miRNA-processing enzyme DRSH-1 (the ortholog of the Drosophila Drosha enzyme). Our lifespan measurements demonstrated that IF-induced longevity was suppressed by knock-out or knockdown of miRISC components and was completely inhibited by drsh-1 ablation. Remarkably, drsh-1 ablation inhibited the fasting-induced changes in the expression of the target genes of DAF-16, the insulin/IGF-1 signaling effector in C. elegans Fasting-induced transcriptome alterations were substantially and modestly suppressed in the drsh-1 null mutant and the null mutant of ain-1 , a gene encoding GW182, respectively. Moreover, miRNA array analyses revealed that the expression levels of numerous miRNAs changed after 2 days of fasting. These results indicate that components of the miRNA machinery, especially the miRNA-processing enzyme DRSH-1, play an important role in mediating IF-induced longevity via the regulation of fasting-induced changes in gene expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Tugume, Arthur K.; Amayo, Robert; Weinheimer, Isabel; Mukasa, Settumba B.; Rubaihayo, Patrick R.; Valkonen, Jari P. T.
2013-01-01
Background The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae) encodes a Class 1 RNase III (RNase3), a putative hydrophobic protein (p7) and a 22-kDa protein (p22) from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas) virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. Methodology/Principal Findings Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae) in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA) strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae) and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b) encoding an RNase3 homolog (<56% identity to SPCSV RNase3) able to suppresses sense-mediated RNA silencing was detected in I. sinensis. Conclusions/Significance SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in sweetpotato. A
Versatile RNA tetra-U helix linking motif as a toolkit for nucleic acid nanotechnology.
Bui, My N; Brittany Johnson, M; Viard, Mathias; Satterwhite, Emily; Martins, Angelica N; Li, Zhihai; Marriott, Ian; Afonin, Kirill A; Khisamutdinov, Emil F
2017-04-01
RNA nanotechnology employs synthetically modified ribonucleic acid (RNA) to engineer highly stable nanostructures in one, two, and three dimensions for medical applications. Despite the tremendous advantages in RNA nanotechnology, unmodified RNA itself is fragile and prone to enzymatic degradation. In contrast to use traditionally modified RNA strands e.g. 2'-fluorine, 2'-amine, 2'-methyl, we studied the effect of RNA/DNA hybrid approach utilizing a computer-assisted RNA tetra-uracil (tetra-U) motif as a toolkit to address questions related to assembly efficiency, versatility, stability, and the production costs of hybrid RNA/DNA nanoparticles. The tetra-U RNA motif was implemented to construct four functional triangles using RNA, DNA and RNA/DNA mixtures, resulting in fine-tunable enzymatic and thermodynamic stabilities, immunostimulatory activity and RNAi capability. Moreover, the tetra-U toolkit has great potential in the fabrication of rectangular, pentagonal, and hexagonal NPs, representing the power of simplicity of RNA/DNA approach for RNA nanotechnology and nanomedicine community. Copyright © 2017 Elsevier Inc. All rights reserved.
IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.
Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana
2016-11-07
The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.
IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells
Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana
2016-01-01
The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein. PMID:27827994
Timescales and bottlenecks in miRNA-dependent gene regulation.
Hausser, Jean; Syed, Afzal Pasha; Selevsek, Nathalie; van Nimwegen, Erik; Jaskiewicz, Lukasz; Aebersold, Ruedi; Zavolan, Mihaela
2013-12-03
MiRNAs are post-transcriptional regulators that contribute to the establishment and maintenance of gene expression patterns. Although their biogenesis and decay appear to be under complex control, the implications of miRNA expression dynamics for the processes that they regulate are not well understood. We derived a mathematical model of miRNA-mediated gene regulation, inferred its parameters from experimental data sets, and found that the model describes well time-dependent changes in mRNA, protein and ribosome density levels measured upon miRNA transfection and induction. The inferred parameters indicate that the timescale of miRNA-dependent regulation is slower than initially thought. Delays in miRNA loading into Argonaute proteins and the slow decay of proteins relative to mRNAs can explain the typically small changes in protein levels observed upon miRNA transfection. For miRNAs to regulate protein expression on the timescale of a day, as miRNAs involved in cell-cycle regulation do, accelerated miRNA turnover is necessary.
Ranaei-Siadat, Ehsan; Fabret, Céline; Seijo, Bili; Dardel, Frédéric; Grosjean, Henri; Nonin-Lecomte, Sylvie
2013-01-01
In bacteria, trans-translation rescues stalled ribosomes by the combined action of tmRNA (transfer-mRNA) and its associated protein SmpB. The tmRNA 5′ and 3′ ends fold into a tRNA-like domain (TLD), which shares structural and functional similarities with tRNAs. As in tRNAs, the UUC sequence of the T-arm of the TLD is post-transcriptionally modified to m5UψC. In tRNAs of gram-negative bacteria, formation of m5U is catalyzed by the SAM-dependent methyltransferase TrmA, while formation of m5U at two different positions in rRNA is catalyzed by distinct site-specific methyltransferases RlmC and RlmD. Here, we show that m5U formation in tmRNAs is exclusively due to TrmA and should be considered as a dual-specific enzyme. The evidence comes from the lack of m5U in purified tmRNA or TLD variants recovered from an Escherichia coli mutant strain deleted of the trmA gene. Detection of m5U in RNA was performed by NMR analysis. PMID:23603891
Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A
2016-06-28
Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.
Global Profiling of hnRNP A2/B1-RNA Binding on Chromatin Highlights LncRNA Interactions.
Nguyen, Eric D; Balas, Maggie M; Griffin, April M; Roberts, Justin T; Johnson, Aaron M
2018-06-23
Long noncoding RNAs (lncRNAs) often carry out their functions through associations with adaptor proteins. We recently identified heterogeneous ribonucleoprotein (hnRNP) A2/B1 as an adaptor of the human HOTAIR lncRNA. hnRNP A2 and B1 are splice isoforms of the same gene. The spliced version of HOTAIR preferentially associates with the B1 isoform, which we hypothesize contributes to RNA-RNA matching between HOTAIR and transcripts of target genes in breast cancer. Here we used enhanced cross-linking immunoprecipitation (eCLIP) to map the direct interactions between A2/B1 and RNA in breast cancer cells. Despite differing by only twelve amino acids, the A2 and B1 splice isoforms associate preferentially with distinct populations of RNA in vivo. Through cellular fractionation experiments we characterize the pattern of RNA association in chromatin, nucleoplasm, and cytoplasm. We find that a majority of interactions occur on chromatin, even those that do not contribute to co-transcriptional splicing. A2/B1 binding site locations on multiple RNAs hint at a contribution to the regulation and function of lncRNAs. Surprisingly, the strongest A2/B1 binding site occurs in a retained intron of HOTAIR, which interrupts an RNA-RNA interaction hotspot. In vitro eCLIP experiments highlight additional exonic B1 binding sites in HOTAIR which also surround the RNA-RNA interaction hotspot. Interestingly, a version of HOTAIR with the intron retained is still capable of making RNA-RNA interactions in vitro through the hotspot region. Our data further characterize the multiple functions of a repurposed splicing factor with isoform-biased interactions, and highlight that the majority of these functions occur on chromatin-associated RNA.
Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne
2010-01-01
Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190
Masè, Michela; Grasso, Margherita; Avogaro, Laura; D'Amato, Elvira; Tessarolo, Francesco; Graffigna, Angelo; Denti, Michela Alessandra; Ravelli, Flavia
2017-01-24
MicroRNAs (miRNAs) are emerging as key regulators of complex biological processes in several cardiovascular diseases, including atrial fibrillation (AF). Reverse transcription-quantitative polymerase chain reaction is a powerful technique to quantitatively assess miRNA expression profile, but reliable results depend on proper data normalization by suitable reference genes. Despite the increasing number of studies assessing miRNAs in cardiac disease, no consensus on the best reference genes has been reached. This work aims to assess reference genes stability in human cardiac tissue with a focus on AF investigation. We evaluated the stability of five reference genes (U6, SNORD48, SNORD44, miR-16, and 5S) in atrial tissue samples from eighteen cardiac-surgery patients in sinus rhythm and AF. Stability was quantified by combining BestKeeper, delta-C q , GeNorm, and NormFinder statistical tools. All methods assessed SNORD48 as the best and U6 as the worst reference gene. Applications of different normalization strategies significantly impacted miRNA expression profiles in the study population. Our results point out the necessity of a consensus on data normalization in AF studies to avoid the emergence of divergent biological conclusions.
Masè, Michela; Grasso, Margherita; Avogaro, Laura; D’Amato, Elvira; Tessarolo, Francesco; Graffigna, Angelo; Denti, Michela Alessandra; Ravelli, Flavia
2017-01-01
MicroRNAs (miRNAs) are emerging as key regulators of complex biological processes in several cardiovascular diseases, including atrial fibrillation (AF). Reverse transcription-quantitative polymerase chain reaction is a powerful technique to quantitatively assess miRNA expression profile, but reliable results depend on proper data normalization by suitable reference genes. Despite the increasing number of studies assessing miRNAs in cardiac disease, no consensus on the best reference genes has been reached. This work aims to assess reference genes stability in human cardiac tissue with a focus on AF investigation. We evaluated the stability of five reference genes (U6, SNORD48, SNORD44, miR-16, and 5S) in atrial tissue samples from eighteen cardiac-surgery patients in sinus rhythm and AF. Stability was quantified by combining BestKeeper, delta-Cq, GeNorm, and NormFinder statistical tools. All methods assessed SNORD48 as the best and U6 as the worst reference gene. Applications of different normalization strategies significantly impacted miRNA expression profiles in the study population. Our results point out the necessity of a consensus on data normalization in AF studies to avoid the emergence of divergent biological conclusions. PMID:28117343
IAOseq: inferring abundance of overlapping genes using RNA-seq data.
Sun, Hong; Yang, Shuang; Tun, Liangliang; Li, Yixue
2015-01-01
Overlapping transcription constitutes a common mechanism for regulating gene expression. A major limitation of the overlapping transcription assays is the lack of high throughput expression data. We developed a new tool (IAOseq) that is based on reads distributions along the transcribed regions to identify the expression levels of overlapping genes from standard RNA-seq data. Compared with five commonly used quantification methods, IAOseq showed better performance in the estimation accuracy of overlapping transcription levels. For the same strand overlapping transcription, currently existing high-throughput methods are rarely available to distinguish which strand was present in the original mRNA template. The IAOseq results showed that the commonly used methods gave an average of 1.6 fold overestimation of the expression levels of same strand overlapping genes. This work provides a useful tool for mining overlapping transcription levels from standard RNA-seq libraries. IAOseq could be used to help us understand the complex regulatory mechanism mediated by overlapping transcripts. IAOseq is freely available at http://lifecenter.sgst.cn/main/en/IAO_seq.jsp.
Selective gene silencing by viral delivery of short hairpin RNA
2010-01-01
RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246
An intronic microRNA silences genes that are functionally antagonistic to its host gene.
Barik, Sailen
2008-09-01
MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Li, Siming; Mi, Lin; Yu, Lei; Yu, Qi; Liu, Tongyu; Wang, Guo-Xiao; Zhao, Xu-Yun; Wu, Jun
2017-01-01
Brown and beige adipocytes convert chemical energy into heat through uncoupled respiration to defend against cold stress. Beyond thermogenesis, brown and beige fats engage other metabolic tissues via secreted factors to influence systemic energy metabolism. How the protein and long noncoding RNA (lncRNA) regulatory networks act in concert to regulate key aspects of thermogenic adipocyte biology remains largely unknown. Here we developed a genome-wide functional screen to interrogate the transcription factors and cofactors in thermogenic gene activation and identified zinc finger and BTB domain-containing 7b (Zbtb7b) as a potent driver of brown fat development and thermogenesis and cold-induced beige fat formation. Zbtb7b is required for activation of the thermogenic gene program in brown and beige adipocytes. Genetic ablation of Zbtb7b impaired cold-induced transcriptional remodeling in brown fat, rendering mice sensitive to cold temperature, and diminished browning of inguinal white fat. Proteomic analysis revealed a mechanistic link between Zbtb7b and the lncRNA regulatory pathway through which Zbtb7b recruits the brown fat lncRNA 1 (Blnc1)/heterogeneous nuclear ribonucleoprotein U (hnRNPU) ribonucleoprotein complex to activate thermogenic gene expression in adipocytes. These findings illustrate the emerging concept of a protein–lncRNA regulatory network in the control of adipose tissue biology and energy metabolism. PMID:28784777
Wang, S Y; Huo, J L; Miao, Y W; Cheng, W M; Zeng, Y Z
2013-04-02
U2 small nuclear RNA auxiliary factor 2 (U2AF2) is an important gene for pre-messenger RNA splicing in higher eukaryotes. In this study, the Banna mini-pig inbred line (BMI) U2AF2 coding sequence (CDS) was cloned, sequenced, and characterized. The U2AF2 complete CDS was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) technique based on the conserved sequence information of cattle and known highly homologous swine expressed sequence tags. This novel gene was deposited into the National Center for Biotechnology Information database (Accession No. JQ839267). Sequence analysis revealed that the BMI U2AF2 coding sequence consisted of 1416 bp and encoded 471 amino acids with a molecular weight of 53.12 kDa. The protein sequence has high sequence homology with U2AF65 of 6 species - Homo sapiens (100%), Equus caballus (100%), Canis lupus (100%), Macaca mulatta (99.8%), Bos taurus (74.4%), and Mus musculus (74.4%). The phylogenetic tree analysis revealed that BMI U2AF65 has a closer genetic relationship with B. taurus U2AF65 than with U2AF65 of E. caballus, C. lupus, M. mulatta, H. sapiens, and M. musculus. RT-PCR analysis showed that BMI U2AF2 was most highly expressed in the brain; moderately expressed in the spleen, lung, muscle, and skin; and weakly expressed in the liver, kidney, and ovary. Its expression was nearly silent in the spinal cord, nerve fiber, heart, stomach, pancreas, and intestine. Three microRNA target sites were predicted in the CDS of BMI U2AF2 messenger RNA. Our results establish a foundation for further insight into this swine gene.
RNA-binding properties and RNA chaperone activity of human peroxiredoxin 1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Ji-Hee; Lee, Jeong-Mi; Lee, Hae Na
2012-09-07
Highlights: Black-Right-Pointing-Pointer hPrx1 has RNA-binding properties. Black-Right-Pointing-Pointer hPrx1 exhibits helix-destabilizing activity. Black-Right-Pointing-Pointer Cold stress increases hPrx1 level in the nuclear fraction. Black-Right-Pointing-Pointer hPrx1 enhances the viability of cells exposed to cold stress. -- Abstract: Human peroxiredoxin 1 (hPrx1), a member of the peroxiredoxin family, detoxifies peroxide substrates and has been implicated in numerous biological processes, including cell growth, proliferation, differentiation, apoptosis, and redox signaling. To date, Prx1 has not been implicated in RNA metabolism. Here, we investigated the ability of hPrx1 to bind RNA and act as an RNA chaperone. In vitro, hPrx1 bound to RNA and DNA, and unwoundmore » nucleic acid duplexes. hPrx1 also acted as a transcription anti-terminator in an assay using an Escherichia coli strain containing a stem-loop structure upstream of the chloramphenicol resistance gene. The overall cellular level of hPrx1 expression was not increased at low temperatures, but the nuclear level of hPrx1 was increased. In addition, hPrx1 overexpression enhanced the survival of cells exposed to cold stress, whereas hPrx1 knockdown significantly reduced cell survival under the same conditions. These findings suggest that hPrx1 may perform biological functions as a RNA-binding protein, which are distinctive from known functions of hPrx1 as a reactive oxygen species scavenger.« less
Sugita, M; Shinozaki, K; Sugiura, M
1985-06-01
The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.
TARGET researchers molecularly characterized favorable histology Wilms tumor (FHWT), a pediatric renal cancer. Comprehensive genome and transcript analyses revealed single-nucleotide substitution/deletion mutations in microRNA processing genes (15% of FHWT patients) and Sine Oculis Homeobox Homolog 1/2 (SIX1/2) genes (7% of FHWT patients). SIX1/2 genes play a critical role in renal development and were not previously associated with FHWT, thus presenting a novel role for SIX1/2 pathway aberrations in this disease.
Mundus, D; Wollenzien, P
1998-11-01
Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was derivitized with azidophenacylbromide (APAB) resulting in the photoreactive azido moiety at a maximum of 25 A from the 4' position on psoralen (SSP25APA). 16S rRNA containing SSP, SSP25APA or control 16S rRNA were reconstituted and 30S particles were isolated. The reconstituted subunits containing SSP or SSP25APA had normal protein composition, were active in tRNA binding and had the usual pattern of chemical reactivity except for increased kethoxal reactivity at G791 and modest changes in four other regions. Irradiation of the derivatized 30S subunits in activation buffer produced several intramolecular RNA crosslinks that were visualized and separated by gel electrophoresis and characterized by primer extension. Four major crosslink sites made by the SSP reagent were identified at positions U561/U562, U920/U921, C866 and U723; a fifth major crosslink at G693 was identified when the SSP25APA reagent was used. A number of additional crosslinks of lower frequency were seen, particularly with the APA reagent. These data indicate a central location close to the decoding region and central pseudoknot for nucleotides U788/U789 in the activated 30S subunit.
Liang, Chaoqiong; Hao, Jianjun; Meng, Yan; Luo, Laixin; Li, Jianqiang
2018-01-01
Cucumber green mottle mosaic virus (CGMMV) is an economically important pathogen and causes significant reduction of both yield and quality of cucumber (Cucumis sativus). Currently, there were no satisfied strategies for controlling the disease. A better understanding of microRNA (miRNA) expression related to the regulation of plant-virus interactions and virus resistance would be of great assistance when developing control strategies for CGMMV. However, accurate expression analysis is highly dependent on robust and reliable reference gene used as an internal control for normalization of miRNA expression. Most commonly used reference genes involved in CGMMV-infected cucumber are not universally expressed depending on tissue types and stages of plant development. It is therefore crucial to identify suitable reference genes in investigating the role of miRNA expression. In this study, seven reference genes, including Actin, Tubulin, EF-1α, 18S rRNA, Ubiquitin, GAPDH and Cyclophilin, were evaluated for the most accurate results in analyses using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Gene expression was assayed on cucumber leaves, stems and roots that were collected at different days post inoculation with CGMMV. The expression data were analyzed using algorithms including delta-Ct, geNorm, NormFinder, and BestKeeper as well as the comparative tool RefFinder. The reference genes were subsequently validated using miR159. The results showed that EF-1α and GAPDH were the most reliable reference genes for normalizing miRNA expression in leaf, root and stem samples, while Ubiquitin and EF-1α were the most suitable combination overall. PMID:29543906
Trapnell, Cole; Roberts, Adam; Goff, Loyal; Pertea, Geo; Kim, Daehwan; Kelley, David R; Pimentel, Harold; Salzberg, Steven L; Rinn, John L; Pachter, Lior
2012-01-01
Recent advances in high-throughput cDNA sequencing (RNA-seq) can reveal new genes and splice variants and quantify expression genome-wide in a single assay. The volume and complexity of data from RNA-seq experiments necessitate scalable, fast and mathematically principled analysis software. TopHat and Cufflinks are free, open-source software tools for gene discovery and comprehensive expression analysis of high-throughput mRNA sequencing (RNA-seq) data. Together, they allow biologists to identify new genes and new splice variants of known ones, as well as compare gene and transcript expression under two or more conditions. This protocol describes in detail how to use TopHat and Cufflinks to perform such analyses. It also covers several accessory tools and utilities that aid in managing data, including CummeRbund, a tool for visualizing RNA-seq analysis results. Although the procedure assumes basic informatics skills, these tools assume little to no background with RNA-seq analysis and are meant for novices and experts alike. The protocol begins with raw sequencing reads and produces a transcriptome assembly, lists of differentially expressed and regulated genes and transcripts, and publication-quality visualizations of analysis results. The protocol's execution time depends on the volume of transcriptome sequencing data and available computing resources but takes less than 1 d of computer time for typical experiments and ~1 h of hands-on time. PMID:22383036
Seim, Inge; Carter, Shea L; Herington, Adrian C; Chopin, Lisa K
2008-01-01
Background The peptide hormone ghrelin has many important physiological and pathophysiological roles, including the stimulation of growth hormone (GH) release, appetite regulation, gut motility and proliferation of cancer cells. We previously identified a gene on the opposite strand of the ghrelin gene, ghrelinOS (GHRLOS), which spans the promoter and untranslated regions of the ghrelin gene (GHRL). Here we further characterise GHRLOS. Results We have described GHRLOS mRNA isoforms that extend over 1.4 kb of the promoter region and 106 nucleotides of exon 4 of the ghrelin gene, GHRL. These GHRLOS transcripts initiate 4.8 kb downstream of the terminal exon 4 of GHRL and are present in the 3' untranslated exon of the adjacent gene TATDN2 (TatD DNase domain containing 2). Interestingly, we have also identified a putative non-coding TATDN2-GHRLOS chimaeric transcript, indicating that GHRLOS RNA biogenesis is extremely complex. Moreover, we have discovered that the 3' region of GHRLOS is also antisense, in a tail-to-tail fashion to a novel terminal exon of the neighbouring SEC13 gene, which is important in protein transport. Sequence analyses revealed that GHRLOS is riddled with stop codons, and that there is little nucleotide and amino-acid sequence conservation of the GHRLOS gene between vertebrates. The gene spans 44 kb on 3p25.3, is extensively spliced and harbours multiple variable exons. We have also investigated the expression of GHRLOS and found evidence of differential tissue expression. It is highly expressed in tissues which are emerging as major sites of non-coding RNA expression (the thymus, brain, and testis), as well as in the ovary and uterus. In contrast, very low levels were found in the stomach where sense, GHRL derived RNAs are highly expressed. Conclusion GHRLOS RNA transcripts display several distinctive features of non-coding (ncRNA) genes, including 5' capping, polyadenylation, extensive splicing and short open reading frames. The gene is also
Seim, Inge; Carter, Shea L; Herington, Adrian C; Chopin, Lisa K
2008-10-28
The peptide hormone ghrelin has many important physiological and pathophysiological roles, including the stimulation of growth hormone (GH) release, appetite regulation, gut motility and proliferation of cancer cells. We previously identified a gene on the opposite strand of the ghrelin gene, ghrelinOS (GHRLOS), which spans the promoter and untranslated regions of the ghrelin gene (GHRL). Here we further characterise GHRLOS. We have described GHRLOS mRNA isoforms that extend over 1.4 kb of the promoter region and 106 nucleotides of exon 4 of the ghrelin gene, GHRL. These GHRLOS transcripts initiate 4.8 kb downstream of the terminal exon 4 of GHRL and are present in the 3' untranslated exon of the adjacent gene TATDN2 (TatD DNase domain containing 2). Interestingly, we have also identified a putative non-coding TATDN2-GHRLOS chimaeric transcript, indicating that GHRLOS RNA biogenesis is extremely complex. Moreover, we have discovered that the 3' region of GHRLOS is also antisense, in a tail-to-tail fashion to a novel terminal exon of the neighbouring SEC13 gene, which is important in protein transport. Sequence analyses revealed that GHRLOS is riddled with stop codons, and that there is little nucleotide and amino-acid sequence conservation of the GHRLOS gene between vertebrates. The gene spans 44 kb on 3p25.3, is extensively spliced and harbours multiple variable exons. We have also investigated the expression of GHRLOS and found evidence of differential tissue expression. It is highly expressed in tissues which are emerging as major sites of non-coding RNA expression (the thymus, brain, and testis), as well as in the ovary and uterus. In contrast, very low levels were found in the stomach where sense, GHRL derived RNAs are highly expressed. GHRLOS RNA transcripts display several distinctive features of non-coding (ncRNA) genes, including 5' capping, polyadenylation, extensive splicing and short open reading frames. The gene is also non-conserved, with differential
Deleavey, Glen F.; Watts, Jonathan K.; Alain, Tommy; Robert, Francis; Kalota, Anna; Aishwarya, Veenu; Pelletier, Jerry; Gewirtz, Alan M.; Sonenberg, Nahum; Damha, Masad J.
2010-01-01
We report that combining a DNA analog (2′F-ANA) with rigid RNA analogs [2′F-RNA and/or locked nucleic acid (LNA)] in siRNA duplexes can produce gene silencing agents with enhanced potency. The favored conformations of these two analogs are different, and combining them in a 1–1 pattern led to reduced affinity, whereas alternating short continuous regions of individual modifications increased affinity relative to an RNA:RNA duplex. Thus, the binding affinity at key regions of the siRNA duplex could be tuned by changing the pattern of incorporation of DNA-like and RNA-like nucleotides. These heavily or fully modified duplexes are active against a range of mRNA targets. Effective patterns of modification were chosen based on screens using two sequences targeting firefly luciferase. We then applied the most effective duplex designs to the knockdown of the eIF4E binding proteins 4E-BP1 and 4E-BP2. We identified modified duplexes with potency comparable to native siRNA. Modified duplexes showed dramatically enhanced stability to serum nucleases, and were characterized by circular dichroism and thermal denaturation studies. Chemical modification significantly reduced the immunostimulatory properties of these siRNAs in human peripheral blood mononuclear cells. PMID:20413581
Wang, Qiong; Hui, Haipeng; Guo, Zhendong; Zhang, Weina; Hu, Yaou; He, Tao; Tai, Yanhong; Peng, Peng; Wang, Li
2013-11-01
Rho GTPase activating protein 26 (ARHGAP26) is a negative regulator of the Rho family that converts the small G proteins RhoA and Cdc42 to their inactive GDP-bound forms. It is essential for the CLIC/GEEC endocytic pathway, cell spreading, and muscle development. The present study shows that ARHGAP26 mRNA undergoes extensive A-to-I RNA editing in the 3' UTR that is specifically catalyzed by ADAR1. Furthermore, the mRNA and protein levels of ARHGAP26 were decreased in cells in which ADAR1 was knocked down. Conversely, ADAR1 overexpression increased the abundance of ARHGAP26 mRNA and protein. In addition, we found that both miR-30b-3p and miR-573 target the ARHGAP26 gene and that RNA editing of ARHGAP26 mediated by ADAR1 abolished the repression of its expression by miR-30b-3p or miR-573. When ADAR1 was overexpressed, the reduced abundance of ARHGAP26 protein mediated by miR-30b-3p or miR-573 was rescued. Importantly, we also found that knocking down ADAR1 elevated RhoA activity, which was consistent with the reduced level of ARHGAP26. Conversely, when ADAR1 was overexpressed, the amount of RhoA-GTP decreased. The similar expression patterns of ARHGAP26 and ADAR1 in human tissue samples further confirmed our findings. Taken together, our results suggest that ADAR1 regulates the expression of ARHGAP26 through A-to-I RNA editing by disrupting the binding of miR-30b-3p and miR-573 within the 3' UTR of ARHGAP26. This study provides a novel insight into the mechanism by which ADAR1 and its RNA editing function regulate microRNA-mediated modulation of target genes.
shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.
Basit, Abdul; Tang, Wenwen; Wu, Dianqing
2016-01-01
To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment.
Origin of sphinx, a young chimeric RNA gene in Drosophila melanogaster
Wang, Wen; Brunet, Frédéric G.; Nevo, Eviatar; Long, Manyuan
2002-01-01
Non-protein-coding RNA genes play an important role in various biological processes. How new RNA genes originated and whether this process is controlled by similar evolutionary mechanisms for the origin of protein-coding genes remains unclear. A young chimeric RNA gene that we term sphinx (spx) provides the first insight into the early stage of evolution of RNA genes. spx originated as an insertion of a retroposed sequence of the ATP synthase chain F gene at the cytological region 60DB since the divergence of Drosophila melanogaster from its sibling species 2–3 million years ago. This retrosequence, which is located at 102F on the fourth chromosome, recruited a nearby exon and intron, thereby evolving a chimeric gene structure. This molecular process suggests that the mechanism of exon shuffling, which can generate protein-coding genes, also plays a role in the origin of RNA genes. The subsequent evolutionary process of spx has been associated with a high nucleotide substitution rate, possibly driven by a continuous positive Darwinian selection for a novel function, as is shown in its sex- and development-specific alternative splicing. To test whether spx has adapted to different environments, we investigated its population genetic structure in the unique “Evolution Canyon” in Israel, revealing a similar haplotype structure in spx, and thus similar evolutionary forces operating on spx between environments. PMID:11904380
Didychuk, Allison L; Montemayor, Eric J; Carrocci, Tucker J; DeLaitsch, Andrew T; Lucarelli, Stefani E; Westler, William M; Brow, David A; Hoskins, Aaron A; Butcher, Samuel E
2017-09-08
U6 small nuclear ribonucleoprotein (snRNP) biogenesis is essential for spliceosome assembly, but not well understood. Here, we report structures of the U6 RNA processing enzyme Usb1 from yeast and a substrate analog bound complex from humans. Unlike the human ortholog, we show that yeast Usb1 has cyclic phosphodiesterase activity that leaves a terminal 3' phosphate which prevents overprocessing. Usb1 processing of U6 RNA dramatically alters its affinity for cognate RNA-binding proteins. We reconstitute the post-transcriptional assembly of yeast U6 snRNP in vitro, which occurs through a complex series of handoffs involving 10 proteins (Lhp1, Prp24, Usb1 and Lsm2-8) and anti-cooperative interactions between Prp24 and Lhp1. We propose a model for U6 snRNP assembly that explains how evolutionarily divergent and seemingly antagonistic proteins cooperate to protect and chaperone the nascent snRNA during its journey to the spliceosome.The mechanism of U6 small nuclear ribonucleoprotein (snRNP) biogenesis is not well understood. Here the authors characterize the enzymatic activities and structures of yeast and human U6 RNA processing enzyme Usb1, reconstitute post-transcriptional assembly of yeast U6 snRNP in vitro, and propose a model for U6 snRNP assembly.
DAG1, no gene for RNA regulation?
Brancaccio, Andrea
2012-04-10
DAG1 encodes for a precursor protein that liberates the two subunits featured by the dystroglycan (DG) adhesion complex that are involved in an increasing number of cellular functions in a wide variety of cells and tissues. Aside from the proteolytic events producing the α and β subunits, especially the former undergoes extensive "post-production" modifications taking place within the ER/Golgi where its core protein is both N- and O-decorated with sugars. These post-translational events, that are mainly orchestrated by a plethora of certified, or putative, glycosyltransferases, prelude to the excocytosis-mediated trafficking and targeting of the DG complex to the plasma membrane. Extensive genetic and biochemical evidences have been accumulated so far on α-DG glycosylation, while little is know on possible regulatory events underlying the chromatine activation, transcription or post-transcription (splicing and escape from the nucleus) of DAG1 or of its mRNA. A scenario is envisaged in which cells would use a sort of preferential, and scarcely regulated, route for DAG1 activation, that would imply fast mRNA transcription, maturation and export to the cytosol, and would prelude to the multiple time-consuming enzymatic post-translational activities needed for its glycosylation. Such a provocative view might be helpful to trigger future work aiming at disclosing the complete molecular mechanisms underlying DAG1 activation and at improving our knowledge of any pre-translational step that is involved in dystroglycan regulation. Copyright © 2012 Elsevier B.V. All rights reserved.
Yao, Zhicheng; Luo, Jingyan; Hu, Kunpeng; Lin, Jizong; Huang, He; Wang, Qiangliang; Zhang, Peng; Xiong, Zhiyong; He, Chonghua; Huang, Zejian; Liu, Bo; Yang, Yang
2017-04-01
There is increasing evidence that circular RNA (circRNA) are involved in cancer development, but the regulation and function of human circRNA remain largely unknown. In this study, we demonstrated that ZKSCAN1, a zinc finger family gene, is expressed in both linear and circular (circZKSCAN1) forms of RNA in human hepatocellular carcinoma (HCC) tissues and cell lines. Here, we analyzed a cohort of 102 patients and found that expression of both ZKSCAN1mRNA and circZKSCAN1 was significantly lower (P < 0.05) in the HCC samples compared with that in matched adjacent nontumorous tissues by reverse transcription PCR (RT-PCR). The low expression level of ZKSCAN1 was only associated with tumor size (P = 0.032), while the cirZKSCAN1 levels varied in patients with different tumor numbers (P < 0.01), cirrhosis (P = 0.031), vascular invasion (P = 0.002), or microscopic vascular invasion (P = 0.002), as well as with the tumor grade (P < 0.001). Silencing both ZKSCAN1mRNA and circZKSCAN1 promoted cell proliferation, migration, and invasion. In contrast, overexpression of both forms of RNA repressed HCC progression in vivo and in vitro. Silencing or overexpression of both forms of RNA did not interfere with each other. RNA-seq revealed a very different molecular basis for the observed effects; ZKSCAN1mRNA mainly regulated cellular metabolism, while circZKSCAN1 mediated several cancer-related signaling pathways, suggesting a nonredundant role for ZKSCAN1mRNA and circRNA. In conclusion, our results revealed two post-translational products (ZKSCAN1mRNA and circZKSCAN1) that cooperated closely with one another to inhibit growth, migration, and invasion of HCC. cirZKSCAN1 might be a useful marker for the diagnosis of HCC. © 2017 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.
Gan, Yu; Li, Yinan; Long, Zhi; Lee, Ahn R; Xie, Ning; Lovnicki, Jessica M; Tang, Yuxin; Chen, Xiang; Huang, Jiaoti; Dong, Xuesen
2018-05-01
Treatment-induced neuroendocrine prostate cancer (t-NEPC) is an aggressive subtype of prostate cancer (PCa) that becomes more prevalent when hormonal therapy, chemotherapy, or radiation therapy is applied to patients with metastatic prostate adenocarcinoma (AdPC). How AdPC cells survive these anti-cancer therapies and progress into t-NEPC remains unclear. By comparing the whole transcriptomes between AdPC and t-NEPC, we identified Bif-1, an apoptosis-associated gene, which undergoes alternative RNA splicing in t-NEPC. We found that while Bif-1a is the predominant variant of the Bif-1 gene in AdPC, two neural-specific variants, Bif-1b and Bif-1c, are highly expressed in t-NEPC patients, patient derived xenografts, and cell models. The neural-specific RNA splicing factor, SRRM4, promotes Bif-1b and Bif-1c splicing, and the expression of SRRM4 in tumors is strongly associated with Bif-1b/-1c levels. Furthermore, we showed that Bif-1a is pro-apoptotic, while Bif-1b and Bif-1c are anti-apoptotic in PCa cells under camptothecin and UV light irritation treatments. Taken together, our data indicate that SRRM4 regulates alternative RNA splicing of the Bif-1 gene that enables PCa cells resistant to apoptotic stimuli under anti-cancer therapies, and may contribute to AdPC progression into t-NEPC. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Morimoto, Shimpei; Yahara, Koji
2018-03-01
Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential
Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries
Toro-Ascuy, Daniela; Rojas-Araya, Bárbara; Valiente-Echeverría, Fernando; Soto-Rifo, Ricardo
2016-01-01
The human immunodeficiency virus type-1 (HIV-1) unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs) containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1), Staufen double-stranded RNA binding protein 1/2 (STAU1/2), or components of miRNA-induced silencing complex (miRISC) and processing bodies (PBs). More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A), allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries. PMID:27886048
Rainaldi, Guglielmo; Volpicella, Mariateresa; Licciulli, Flavio; Liuni, Sabino; Gallerani, Raffaele; Ceci, Luigi R
2003-01-01
The updated version of PLMItRNA reports information and multialignments on 609 genes and 34 tRNA molecules active in the mitochondria of Viridiplantae (27 Embryophyta and 10 Chlorophyta), and photosynthetic algae (one Cryptophyta, four Rhodophyta and two Stramenopiles). Colour-code based tables reporting the different genetic origin of identified genes allow hyper-textual link to single entries. Promoter sequences identified for tRNA genes in the mitochondrial genomes of Angiospermae are also reported. The PLMItRNA database is accessible at http://bighost.area.ba.cnr.it/PLMItRNA/.
Wu, Hui; Shi, Yinfeng; Huang, Chusen; Zhang, Yang; Wu, Jiahui; Shen, Hebai; Jia, Nengqin
2014-04-01
RNA interference-mediated gene silencing relating to disease has recently emerged as a powerful method in gene therapy. Despite the promises, effective transport of siRNA with minimal side effects remains a challenge. Halloysites are cheap and naturally available aluminosilicate clay nanotubes with high mechanical strength and biocompatibility. In this study, a novel multifunctional nanocarrier based on functionalized halloysite nanotubes (f-HNTs) has been developed via electrostatic layer-by-layer assembling approach for loading and intracellular delivery of therapeutic antisurvivin siRNA and simultaneously tracking their intracellular transport, in which PEI-modified HNTs are used as gene vector, antisurvivin siRNA as gene therapeutic agent, and mercaptoacetic acid-capped CdSe quantum dots as fluorescent labeling probes. The successful assembly of the f-HNTs-siRNA complexes was systematically characterized by transmission electron microscopy (TEM), UV-visible spectrophotometry, Zeta potential measurement, fluorescence spectrophotometry, and electrochemical impedance spectroscopy. Confocal microscopy, biological TEM, and flow cytometry studies revealed that the complexes enabled the efficient intracellular delivery of siRNA for cell-specific gene silencing. MTT assays exhibited that the complexes can enhance antitumor activity. Furthermore, Western blot analysis showed that f-HNTs-mediated siRNA delivery effectively knocked down gene expression of survivin and thereby decreased the levels of target proteins of PANC-1 cells. Therefore, this study suggested that the synthesized f-HNTs were a new effective drug delivery system for potential application in cancer gene therapy.
Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa
Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying
2014-01-01
Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031
C-to-U editing and site-directed RNA editing for the correction of genetic mutations.
Vu, Luyen Thi; Tsukahara, Toshifumi
2017-07-24
Cytidine to uridine (C-to-U) editing is one type of substitutional RNA editing. It occurs in both mammals and plants. The molecular mechanism of C-to-U editing involves the hydrolytic deamination of a cytosine to a uracil base. C-to-U editing is mediated by RNA-specific cytidine deaminases and several complementation factors, which have not been completely identified. Here, we review recent findings related to the regulation and enzymatic basis of C-to-U RNA editing. More importantly, when C-to-U editing occurs in coding regions, it has the power to reprogram genetic information on the RNA level, therefore it has great potential for applications in transcript repair (diseases related to thymidine to cytidine (T>C) or adenosine to guanosine (A>G) point mutations). If it is possible to manipulate or mimic C-to-U editing, T>C or A>G genetic mutation-related diseases could be treated. Enzymatic and non-enzymatic site-directed RNA editing are two different approaches for mimicking C-to-U editing. For enzymatic site-directed RNA editing, C-to-U editing has not yet been successfully performed, and in theory, adenosine to inosine (A-to-I) editing involves the same strategy as C-to-U editing. Therefore, in this review, for applications in transcript repair, we will provide a detailed overview of enzymatic site-directed RNA editing, with a focus on A-to-I editing and non-enzymatic site-directed C-to-U editing.
Chen, Wei; Zhao, Wenshan; Yang, Aiting; Xu, Anjian; Wang, Huan; Cong, Min; Liu, Tianhui; Wang, Ping; You, Hong
2017-12-15
Liver fibrosis, characterized with the excessive accumulation of extracellular matrix (ECM) proteins, represents the final common pathway of chronic liver inflammation. Ever-increasing evidence indicates microRNAs (miRNAs) dysregulation has important implications in the different stages of liver fibrosis. However, our knowledge of miRNA-gene regulation details pertaining to such disease remains unclear. The publicly available Gene Expression Omnibus (GEO) datasets of patients suffered from cirrhosis were extracted for integrated analysis. Differentially expressed miRNAs (DEMs) and genes (DEGs) were identified using GEO2R web tool. Putative target gene prediction of DEMs was carried out using the intersection of five major algorithms: DIANA-microT, TargetScan, miRanda, PICTAR5 and miRWalk. Functional miRNA-gene regulatory network (FMGRN) was constructed based on the computational target predictions at the sequence level and the inverse expression relationships between DEMs and DEGs. DAVID web server was selected to perform KEGG pathway enrichment analysis. Functional miRNA-gene regulatory module was generated based on the biological interpretation. Internal connections among genes in liver fibrosis-related module were determined using String database. MiRNA-gene regulatory modules related to liver fibrosis were experimentally verified in recombinant human TGFβ1 stimulated and specific miRNA inhibitor treated LX-2 cells. We totally identified 85 and 923 dysregulated miRNAs and genes in liver cirrhosis biopsy samples compared to their normal controls. All evident miRNA-gene pairs were identified and assembled into FMGRN which consisted of 990 regulations between 51 miRNAs and 275 genes, forming two big sub-networks that were defined as down-network and up-network, respectively. KEGG pathway enrichment analysis revealed that up-network was prominently involved in several KEGG pathways, in which "Focal adhesion", "PI3K-Akt signaling pathway" and "ECM
NASA Technical Reports Server (NTRS)
Lu, C.; Fedoroff, N.
2000-01-01
Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.
Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.
Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin
2013-09-22
High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.
Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review
Huang, Weizhe; He, Ziying
2013-01-01
RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498
Tissue- and Time-Specific Expression of Otherwise Identical tRNA Genes
Adir, Idan; Dahan, Orna; Broday, Limor; Pilpel, Yitzhak; Rechavi, Oded
2016-01-01
Codon usage bias affects protein translation because tRNAs that recognize synonymous codons differ in their abundance. Although the current dogma states that tRNA expression is exclusively regulated by intrinsic control elements (A- and B-box sequences), we revealed, using a reporter that monitors the levels of individual tRNA genes in Caenorhabditis elegans, that eight tryptophan tRNA genes, 100% identical in sequence, are expressed in different tissues and change their expression dynamically. Furthermore, the expression levels of the sup-7 tRNA gene at day 6 were found to predict the animal’s lifespan. We discovered that the expression of tRNAs that reside within introns of protein-coding genes is affected by the host gene’s promoter. Pairing between specific Pol II genes and the tRNAs that are contained in their introns is most likely adaptive, since a genome-wide analysis revealed that the presence of specific intronic tRNAs within specific orthologous genes is conserved across Caenorhabditis species. PMID:27560950
An Unsolved Mystery: The Target-Recognizing RNA Species of MicroRNA Genes
Chen, Chang-Zheng
2013-01-01
MicroRNAs (miRNAs) are an abundant class of endogenous ~ 21-nucleotide (nt) RNAs. These small RNAs are produced from long primary miRNA transcripts — pri-miRNAs — through sequential endonucleolytic maturation steps that yield precursor miRNA (pre-miRNA) intermediates and then the mature miRNAs. The mature miRNAs are loaded into the RNA-induced silencing complexes (RISC), and guide RISC to target mRNAs for cleavage and/or translational repression. This paradigm, which represents one of major discoveries of modern molecular biology, is built on the assumption that mature miRNAs are the only species produced from miRNA genes that recognize targets. This assumption has guided the miRNA field for more than a decade and has led to our current understanding of the mechanisms of target recognition and repression by miRNAs. Although progress has been made, fundamental questions remain unanswered with regard to the principles of target recognition and mechanisms of repression. Here I raise questions about the assumption that mature miRNAs are the only target-recognizing species produced from miRNA genes and discuss the consequences of working under an incomplete or incorrect assumption. Moreover, I present evolution-based and experimental evidence that support the roles of pri-/pre-miRNAs in target recognition and repression. Finally, I propose a conceptual framework that integrates the functions of pri-/pre-miRNAs and mature miRNAs in target recognition and repression. The integrated framework opens experimental enquiry and permits interpretation of fundamental problems that have so far been precluded. PMID:23685275
Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J
1981-01-01
We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619
Blevins, Tana; Aliev, Fazil; Adkins, Amy; Hack, Laura; Bigdeli, Tim; D. van der Vaart, Andrew; Web, Bradley Todd; Bacanu, Silviu-Alin; Kalsi, Gursharan; Kendler, Kenneth S.; Miles, Michael F.; Dick, Danielle; Riley, Brien P.; Dumur, Catherine; Vladimirov, Vladimir I.
2015-01-01
Alcohol consumption is known to lead to gene expression changes in the brain. After performing weighted gene co-expression network analyses (WGCNA) on genome-wide mRNA and microRNA (miRNA) expression in Nucleus Accumbens (NAc) of subjects with alcohol dependence (AD; N = 18) and of matched controls (N = 18), six mRNA and three miRNA modules significantly correlated with AD were identified (Bonferoni-adj. p≤ 0.05). Cell-type-specific transcriptome analyses revealed two of the mRNA modules to be enriched for neuronal specific marker genes and downregulated in AD, whereas the remaining four mRNA modules were enriched for astrocyte and microglial specific marker genes and upregulated in AD. Gene set enrichment analysis demonstrated that neuronal specific modules were enriched for genes involved in oxidative phosphorylation, mitochondrial dysfunction and MAPK signaling. Glial-specific modules were predominantly enriched for genes involved in processes related to immune functions, i.e. cytokine signaling (all adj. p≤ 0.05). In mRNA and miRNA modules, 461 and 25 candidate hub genes were identified, respectively. In contrast to the expected biological functions of miRNAs, correlation analyses between mRNA and miRNA hub genes revealed a higher number of positive than negative correlations (χ2 test p≤ 0.0001). Integration of hub gene expression with genome-wide genotypic data resulted in 591 mRNA cis-eQTLs and 62 miRNA cis-eQTLs. mRNA cis-eQTLs were significantly enriched for AD diagnosis and AD symptom counts (adj. p = 0.014 and p = 0.024, respectively) in AD GWAS signals in a large, independent genetic sample from the Collaborative Study on Genetics of Alcohol (COGA). In conclusion, our study identified putative gene network hubs coordinating mRNA and miRNA co-expression changes in the NAc of AD subjects, and our genetic (cis-eQTL) analysis provides novel insights into the etiological mechanisms of AD. PMID:26381263
A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.
Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R
2008-11-01
Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.
Gene repression via multiplex gRNA strategy in Y. lipolytica.
Zhang, Jin-Lai; Peng, Yang-Zi; Liu, Duo; Liu, Hong; Cao, Ying-Xiu; Li, Bing-Zhi; Li, Chun; Yuan, Ying-Jin
2018-04-20
The oleaginous yeast Yarrowia lipolytica is a promising microbial cell factory due to their biochemical characteristics and native capacity to accumulate lipid-based chemicals. To create heterogenous biosynthesis pathway and manipulate metabolic flux in Y. lipolytica, numerous studies have been done for developing synthetic biology tools for gene regulation. CRISPR interference (CRISPRi), as an emerging technology, has been applied for specifically repressing genes of interest. In this study, we established CRISPRi systems in Y. lipolytica based on four different repressors, that was DNase-deactivated Cpf1 (dCpf1) from Francisella novicida, deactivated Cas9 (dCas9) from Streptococcus pyogenes, and two fusion proteins (dCpf1-KRAB and dCas9-KRAB). Ten gRNAs that bound to different regions of gfp gene were designed and the results indicated that there was no clear correlation between the repression efficiency and targeting sites no matter which repressor protein was used. In order to rapidly yield strong gene repression, a multiplex gRNAs strategy based on one-step Golden-brick assembly technology was developed. High repression efficiency 85% (dCpf1) and 92% (dCas9) were achieved in a short time by making three different gRNAs towards gfp gene simultaneously, which avoided the need of screening effective gRNA loci in advance. Moreover, two genes interference including gfp and vioE and three genes repression including vioA, vioB and vioE in protodeoxy-violaceinic acid pathway were also realized. Taken together, successful CRISPRi-mediated regulation of gene expression via four different repressors dCpf1, dCas9, dCpf1-KRAB and dCas9-KRAB in Y. lipolytica is achieved. And we demonstrate a multiplexed gRNA targeting strategy can efficiently achieve transcriptional simultaneous repression of several targeted genes and different sites of one gene using the one-step Golden-brick assembly. This timesaving method promised to be a potent transformative tool valuable for
Paraboschi, Elvezia Maria; Cardamone, Giulia; Rimoldi, Valeria; Gemmati, Donato; Spreafico, Marta; Duga, Stefano; Soldà, Giulia; Asselta, Rosanna
2015-09-30
Abnormalities in RNA metabolism and alternative splicing (AS) are emerging as important players in complex disease phenotypes. In particular, accumulating evidence suggests the existence of pathogenic links between multiple sclerosis (MS) and altered AS, including functional studies showing that an imbalance in alternatively-spliced isoforms may contribute to disease etiology. Here, we tested whether the altered expression of AS-related genes represents a MS-specific signature. A comprehensive comparative analysis of gene expression profiles of publicly-available microarray datasets (190 MS cases, 182 controls), followed by gene-ontology enrichment analysis, highlighted a significant enrichment for differentially-expressed genes involved in RNA metabolism/AS. In detail, a total of 17 genes were found to be differentially expressed in MS in multiple datasets, with CELF1 being dysregulated in five out of seven studies. We confirmed CELF1 downregulation in MS (p=0.0015) by real-time RT-PCRs on RNA extracted from blood cells of 30 cases and 30 controls. As a proof of concept, we experimentally verified the unbalance in alternatively-spliced isoforms in MS of the NFAT5 gene, a putative CELF1 target. In conclusion, for the first time we provide evidence of a consistent dysregulation of splicing-related genes in MS and we discuss its possible implications in modulating specific AS events in MS susceptibility genes.
An siRNA-based method for efficient silencing of gene expression in mature brown adipocytes.
Isidor, Marie S; Winther, Sally; Basse, Astrid L; Petersen, M Christine H; Cannon, Barbara; Nedergaard, Jan; Hansen, Jacob B
2016-01-01
Brown adipose tissue is a promising therapeutic target for opposing obesity, glucose intolerance and insulin resistance. The ability to modulate gene expression in mature brown adipocytes is important to understand brown adipocyte function and delineate novel regulatory mechanisms of non-shivering thermogenesis. The aim of this study was to optimize a lipofection-based small interfering RNA (siRNA) transfection protocol for efficient silencing of gene expression in mature brown adipocytes. We determined that a critical parameter was to deliver the siRNA to mature adipocytes by reverse transfection, i.e. transfection of non-adherent cells. Using this protocol, we effectively knocked down both high- and low-abundance transcripts in a model of mature brown adipocytes (WT-1) as well as in primary mature mouse brown adipocytes. A functional consequence of the knockdown was confirmed by an attenuated increase in uncoupled respiration (thermogenesis) in response to β-adrenergic stimulation of mature WT-1 brown adipocytes transfected with uncoupling protein 1 siRNA. Efficient gene silencing was also obtained in various mouse and human white adipocyte models (3T3-L1, primary mouse white adipocytes, hMADS) with the ability to undergo "browning." In summary, we report an easy and versatile reverse siRNA transfection protocol to achieve specific silencing of gene expression in various models of mature brown and browning-competent white adipocytes, including primary cells.
Li, Qintong; Cooper, Jeffrey J.; Altwerger, Gary H.; Feldkamp, Michael D.; Shea, Madeline A.; Price, David H.
2007-01-01
P-TEFb regulates eukaryotic gene expression at the level of transcription elongation, and is itself controlled by the reversible association of 7SK RNA and an RNA-binding protein HEXIM1 or HEXIM2. In an effort to determine the minimal region of 7SK needed to interact with HEXIM1 in vitro, we found that an oligo comprised of nucleotides 10–48 sufficed. A bid to further narrow down the minimal region of 7SK led to a surprising finding that HEXIM1 binds to double-stranded RNA in a sequence-independent manner. Both dsRNA and 7SK (10–48), but not dsDNA, competed efficiently with full-length 7SK for HEXIM1 binding in vitro. Upon binding dsRNA, a large conformational change was observed in HEXIM1 that allowed the recruitment and inhibition of P-TEFb. Both subcellular fractionation and immunofluorescence demonstrated that, while most HEXIM1 is found in the nucleus, a significant fraction is found in the cytoplasm. Immunoprecipitation experiments demonstrated that both nuclear and cytoplasmic HEXIM1 is associated with RNA. Interestingly, the one microRNA examined (mir-16) was found in HEXIM1 immunoprecipitates, while the small nuclear RNAs, U6 and U2, were not. Our study illuminates novel properties of HEXIM1 both in vitro and in vivo, and suggests that HEXIM1 may be involved in other nuclear and cytoplasmic processes besides controlling P-TEFb. PMID:17395637
Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.
Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258
Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.; ...
2015-11-03
Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentallydynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ~50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclearlocalized. Splicemore » site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. Finally, we conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.
Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentallydynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ~50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclearlocalized. Splicemore » site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. Finally, we conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease.« less
Splicing factor SFRS1 recognizes a functionally diverse landscape of RNA transcripts.
Sanford, Jeremy R; Wang, Xin; Mort, Matthew; Vanduyn, Natalia; Cooper, David N; Mooney, Sean D; Edenberg, Howard J; Liu, Yunlong
2009-03-01
Metazoan genes are encrypted with at least two superimposed codes: the genetic code to specify the primary structure of proteins and the splicing code to expand their proteomic output via alternative splicing. Here, we define the specificity of a central regulator of pre-mRNA splicing, the conserved, essential splicing factor SFRS1. Cross-linking immunoprecipitation and high-throughput sequencing (CLIP-seq) identified 23,632 binding sites for SFRS1 in the transcriptome of cultured human embryonic kidney cells. SFRS1 was found to engage many different classes of functionally distinct transcripts including mRNA, miRNA, snoRNAs, ncRNAs, and conserved intergenic transcripts of unknown function. The majority of these diverse transcripts share a purine-rich consensus motif corresponding to the canonical SFRS1 binding site. The consensus site was not only enriched in exons cross-linked to SFRS1 in vivo, but was also enriched in close proximity to splice sites. mRNAs encoding RNA processing factors were significantly overrepresented, suggesting that SFRS1 may broadly influence the post-transcriptional control of gene expression in vivo. Finally, a search for the SFRS1 consensus motif within the Human Gene Mutation Database identified 181 mutations in 82 different genes that disrupt predicted SFRS1 binding sites. This comprehensive analysis substantially expands the known roles of human SR proteins in the regulation of a diverse array of RNA transcripts.
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.
Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina
2015-11-13
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.
Slattery, Martha L; Herrick, Jennifer S; Stevens, John R; Wolff, Roger K; Mullany, Lila E
2017-01-01
Determination of functional pathways regulated by microRNAs (miRNAs), while an essential step in developing therapeutics, is challenging. Some miRNAs have been studied extensively; others have limited information. In this study, we focus on 254 miRNAs previously identified as being associated with colorectal cancer and their database-identified validated target genes. We use RNA-Seq data to evaluate messenger RNA (mRNA) expression for 157 subjects who also had miRNA expression data. In the replication phase of the study, we replicated associations between 254 miRNAs associated with colorectal cancer and mRNA expression of database-identified target genes in normal colonic mucosa. In the discovery phase of the study, we evaluated expression of 18 miR-NAs (those with 20 or fewer database-identified target genes along with miR-21-5p, miR-215-5p, and miR-124-3p which have more than 500 database-identified target genes) with expression of 17 434 mRNAs to identify new targets in colon tissue. Seed region matches between miRNA and newly identified targeted mRNA were used to help determine direct miRNA-mRNA associations. From the replication of the 121 miRNAs that had at least 1 database-identified target gene using mRNA expression methods, 97.9% were expressed in normal colonic mucosa. Of the 8622 target miRNA-mRNA associations identified in the database, 2658 (30.2%) were associated with gene expression in normal colonic mucosa after adjusting for multiple comparisons. Of the 133 miRNAs with database-identified target genes by non-mRNA expression methods, 97.2% were expressed in normal colonic mucosa. After adjustment for multiple comparisons, 2416 miRNA-mRNA associations remained significant (19.8%). Results from the discovery phase based on detailed examination of 18 miRNAs identified more than 80 000 miRNA-mRNA associations that had not previously linked to the miRNA. Of these miRNA-mRNA associations, 15.6% and 14.8% had seed matches for CRCh38 and CRCh37
miRTex: A Text Mining System for miRNA-Gene Relation Extraction
Li, Gang; Ross, Karen E.; Arighi, Cecilia N.; Peng, Yifan; Wu, Cathy H.; Vijay-Shanker, K.
2015-01-01
MicroRNAs (miRNAs) regulate a wide range of cellular and developmental processes through gene expression suppression or mRNA degradation. Experimentally validated miRNA gene targets are often reported in the literature. In this paper, we describe miRTex, a text mining system that extracts miRNA-target relations, as well as miRNA-gene and gene-miRNA regulation relations. The system achieves good precision and recall when evaluated on a literature corpus of 150 abstracts with F-scores close to 0.90 on the three different types of relations. We conducted full-scale text mining using miRTex to process all the Medline abstracts and all the full-length articles in the PubMed Central Open Access Subset. The results for all the Medline abstracts are stored in a database for interactive query and file download via the website at http://proteininformationresource.org/mirtex. Using miRTex, we identified genes potentially regulated by miRNAs in Triple Negative Breast Cancer, as well as miRNA-gene relations that, in conjunction with kinase-substrate relations, regulate the response to abiotic stress in Arabidopsis thaliana. These two use cases demonstrate the usefulness of miRTex text mining in the analysis of miRNA-regulated biological processes. PMID:26407127
Jares, P.; Campo, E.; Pinyol, M.; Bosch, F.; Miquel, R.; Fernandez, P. L.; Sanchez-Beato, M.; Soler, F.; Perez-Losada, A.; Nayach, I.; Mallofré, C.; Piris, M. A.; Montserrat, E.; Cardesa, A.
1996-01-01
Mantle cell lymphomas (MCLs) are molecularly characterized by bcl-1 rearrangement and constant cyclin D1 (PRAD-1/CCND1) gene overexpression. Cyclin D1 is a G1 cyclin that participates in the control of the cell cycle progression by interacting with the retinoblastoma gene product (pRb). Inactivation of the Rb tumor suppressor gene has been implicated in the development of different types of human tumors including some high grade non-Hodgkin's lymphomas. To determine the role of the retinoblastoma gene in the pathogenesis of MCLs and its possible interaction with cyclin D1, pRb expression was examined in 23 MCLs including 17 typical and 6 blastic variants by immunohistochemistry and Western blot. Rb gene structure was studied in 13 cases by Southern blot. Cytogenetic analysis was performed in 5 cases. The results were compared with the cyclin D1 mRNA levels examined by Northern analysis, and the proliferative activity of the tumors was measured by Ki-67 growth fraction and flow cytometry. pRb was expressed in all MCLs. The expression varied from case to case (mean, 14.1% of positive cells; range, 1.3 to 42%) with a significant correlation with the proliferative activity of the tumors (mitotic index r = 0.85; Ki-67 r = 0.7; S phase = 0.73). Blastic variants showed higher numbers of pRb-positive cells (mean, 29%) than the typical cases (10%; P < 0.005) by immunohistochemistry and, concordantly, higher levels of expression by Western blot. In addition, the blastic cases also had an increased expression of the phosphorylated protein. No alterations in Rb gene structure were observed by Southern blot analysis. Cyclin D1 mRNA levels were independent of pRb expression and the proliferative activity of the tumors. These findings suggest that pRb in MCLs is normally regulated in relation to the proliferative activity of the tumors. Cyclin D1 overexpression may play a role in the maintenance of cell proliferation by overcoming the suppressive growth control of pRb. Images
Winters, Jennifer L; Davila, Jaime I; McDonald, Amber M; Nair, Asha A; Fadra, Numrah; Wehrs, Rebecca N; Thomas, Brittany C; Balcom, Jessica R; Jin, Long; Wu, Xianglin; Voss, Jesse S; Klee, Eric W; Oliver, Gavin R; Graham, Rondell P; Neff, Jadee L; Rumilla, Kandelaria M; Aypar, Umut; Kipp, Benjamin R; Jenkins, Robert B; Jen, Jin; Halling, Kevin C
2018-06-13
We assessed the performance characteristics of an RNA sequencing (RNA-Seq) assay designed to detect gene fusions in 571 genes to help manage patients with cancer. Polyadenylated RNA was converted to cDNA, which was then used to prepare next-generation sequencing libraries that were sequenced on an Illumina HiSeq 2500 instrument and analyzed with an in-house developed bioinformatic pipeline. The assay identified 38 of 41 gene fusions detected by another method, such as fluorescence in situ hybridization or RT-PCR, for a sensitivity of 93%. No false-positive gene fusions were identified in 15 normal tissue specimens and 10 tumor specimens that were negative for fusions by RNA sequencing or Mate Pair NGS (100% specificity). The assay also identified 22 fusions in 17 tumor specimens that had not been detected by other methods. Eighteen of the 22 fusions had not previously been described. Good intra-assay and interassay reproducibility was observed with complete concordance for the presence or absence of gene fusions in replicates. The analytical sensitivity of the assay was tested by diluting RNA isolated from gene fusion-positive cases with fusion-negative RNA. Gene fusions were generally detectable down to 12.5% dilutions for most fusions and as little as 3% for some fusions. This assay can help identify fusions in patients with cancer; these patients may in turn benefit from both US Food and Drug Administration-approved and investigational targeted therapies. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
DNMT1-interacting RNAs block gene specific DNA methylation
Di Ruscio, Annalisa; Ebralidze, Alexander K.; Benoukraf, Touati; Amabile, Giovanni; Goff, Loyal A.; Terragni, Joylon; Figueroa, Maria Eugenia; De Figureido Pontes, Lorena Lobo; Alberich-Jorda, Meritxell; Zhang, Pu; Wu, Mengchu; D’Alò, Francesco; Melnick, Ari; Leone, Giuseppe; Ebralidze, Konstantin K.; Pradhan, Sriharsa; Rinn, John L.; Tenen, Daniel G.
2013-01-01
Summary DNA methylation was described almost a century ago. However, the rules governing its establishment and maintenance remain elusive. Here, we present data demonstrating that active transcription regulates levels of genomic methylation. We identified a novel RNA arising from the CEBPA gene locus critical in regulating the local DNA methylation profile. This RNA binds to DNMT1 and prevents CEBPA gene locus methylation. Deep sequencing of transcripts associated with DNMT1 combined with genome-scale methylation and expression profiling extended the generality of this finding to numerous gene loci. Collectively, these results delineate the nature of DNMT1-RNA interactions and suggest strategies for gene selective demethylation of therapeutic targets in disease. PMID:24107992
RNA Binding Proteins Posttranscriptionally Regulate Genes Involved In Oncogenesis
2010-06-01
whose steady state mRNA levels may not significantly change, but which are tr anslationally active inside cancer cells. Potentially the...techniques have the potential to better delineate gene s whose steady state mRNA levels may not significantly change, but which are translationally active ...significantly change, but which are tr anslationally active inside cancer cells. Potentially the identification of such genes m ay offer novel therapeutic
Zhang, Zhiting; Guo, Qianqian; Zhang, Shufang; Xiang, Chenxi; Guo, Xinwei; Zhang, Feng; Gao, Lanlan; Ni, Haiwei; Xi, Tao; Zheng, Lufeng
2018-05-07
RNA binding proteins (RBPs) are pivotal post-transcriptional regulators. RNPC1, an RBP, acts as a tumor suppressor through binding and regulating the expression of target genes in cancer cells. This study disclosed that RNPC1 expression was positively correlated with breast cancer patients' relapse free and overall survival, and RNPC1suppressed breast cancer cells metastasis. Mechanistically, RNPC1 promoting a competing endogenous network (ceRNA) crosstalk between STARD13, CDH5, HOXD10, and HOXD1 (STARD13-correlated ceRNA network) that we previously confirmed in breast cancer cells through stabilizing the transcripts and thus facilitating the expression of these four genes in breast cancer cells. Furthermore, RNPC1 overexpression restrained the promotion of STARD13, CDH5, HOXD10, and HOXD1 knockdown on cell metastasis. Notably, RNPC1 expression was positively correlated with CDH5, HOXD1 and HOXD10 expression in breast cancer tissues, and attenuated adriamycin resistance. Taken together, these results identified that RNPC1 could inhibit breast cancer cells metastasis via promoting STARD13-correlated ceRNA network.
The SAGA/TREX-2 subunit Sus1 binds widely to transcribed genes and affects mRNA turnover globally.
García-Molinero, Varinia; García-Martínez, José; Reja, Rohit; Furió-Tarí, Pedro; Antúnez, Oreto; Vinayachandran, Vinesh; Conesa, Ana; Pugh, B Franklin; Pérez-Ortín, José E; Rodríguez-Navarro, Susana
2018-03-29
Eukaryotic transcription is regulated through two complexes, the general transcription factor IID (TFIID) and the coactivator Spt-Ada-Gcn5 acetyltransferase (SAGA). Recent findings confirm that both TFIID and SAGA contribute to the synthesis of nearly all transcripts and are recruited genome-wide in yeast. However, how this broad recruitment confers selectivity under specific conditions remains an open question. Here we find that the SAGA/TREX-2 subunit Sus1 associates with upstream regulatory regions of many yeast genes and that heat shock drastically changes Sus1 binding. While Sus1 binding to TFIID-dominated genes is not affected by temperature, its recruitment to SAGA-dominated genes and RP genes is significantly disturbed under heat shock, with Sus1 relocated to environmental stress-responsive genes in these conditions. Moreover, in contrast to recent results showing that SAGA deubiquitinating enzyme Ubp8 is dispensable for RNA synthesis, genomic run-on experiments demonstrate that Sus1 contributes to synthesis and stability of a wide range of transcripts. Our study provides support for a model in which SAGA/TREX-2 factor Sus1 acts as a global transcriptional regulator in yeast but has differential activity at yeast genes as a function of their transcription rate or during stress conditions.
Saccharomyces cerevisiae possesses a stress-inducible glycyl-tRNA synthetase gene.
Chen, Shun-Jia; Wu, Yi-Hua; Huang, Hsiao-Yun; Wang, Chien-Chia
2012-01-01
Aminoacyl-tRNA synthetases are a large family of housekeeping enzymes that are pivotal in protein translation and other vital cellular processes. Saccharomyces cerevisiae possesses two distinct nuclear glycyl-tRNA synthetase (GlyRS) genes, GRS1 and GRS2. GRS1 encodes both cytoplasmic and mitochondrial activities, while GRS2 is essentially silent and dispensable under normal conditions. We herein present evidence that expression of GRS2 was drastically induced upon heat shock, ethanol or hydrogen peroxide addition, and high pH, while expression of GRS1 was somewhat repressed under those conditions. In addition, GlyRS2 (the enzyme encoded by GRS2) had a higher protein stability and a lower K(M) value for yeast tRNA(Gly) under heat shock conditions than under normal conditions. Moreover, GRS2 rescued the growth defect of a GRS1 knockout strain when highly expressed by a strong promoter at 37 °C, but not at the optimal temperature of 30 °C. These results suggest that GRS2 is actually an inducible gene that may function to rescue the activity of GRS1 under stress conditions.
Nanocarriers Assisted siRNA Gene Therapy for the Management of Cardiovascular Disorders.
Maheshwari, Rahul; Tekade, Muktika; Sharma, Piyoosh A; Tekade, Rakesh Kumar
2015-01-01
Cardiovascular diseases (CVDs), primarily myocardial infarction (MI), atherosclerosis, hypertension and congestive heart failure symbolize the foremost cause of death in almost all parts of the world. Besides the traditional therapeutic approaches for the management of CVDs, newer innovative strategies are also emerging on the horizon. Recently, gene silencing via small interfering RNA (siRNA) is one of the hot topics amongst various strategies involved in the management of CVDs. The siRNA mechanism involves natural catalytic processes to silence pathological genes that are overexpressed in a particular disease. Also the versatility of gene expression by siRNA deciphers a prospective tactic to down-regulate diseases associated gene, protein or receptor existing on a specific disease target. This article reviews the application of siRNA against CVDs with special emphasis on gene targets in combination with delivery systems such as cationic hydrogels, polyplexes, peptides, liposomes and dendrimers.
Genomic organization of the rat alpha 2u-globulin gene cluster.
McFadyen, D A; Addison, W; Locke, J
1999-05-01
The alpha 2u-globulin are a group of similar proteins, belonging to the lipocalin superfamily of proteins, that are synthesized in a subset of secretory tissues in rats. The many alpha 2u-globulin isoforms are encoded by a multigene family that exhibits extensive homology. Despite a high degree of sequence identity, individual family members show diverse expression patterns involving complex hormonal, tissue-specific, and developmental regulation. Analysis suggests that there are approximately 20 alpha 2u-globulin genes in the rat genome. We have used fluorescence in situ hybridization (FISH) to show that the alpha 2u-globulin genes are clustered at a single site on rat Chromosome (Chr) 5 (5q22-24). Southern blots of rat genomic DNA separated by pulsed field gel electrophoresis indicated that the alpha 2u-globulin genes are contained on two NruI fragments with a total size of 880 kbp. Analysis of three P1 clones containing alpha 2u-globulin genes indicated that the alpha 2u-globulin genes are tandemly arranged in a head-to-tail fashion. The organization of the alpha 2u-globulin genes in the rat as a tandem array of single genes differs from the homologous major urinary protein genes in the mouse, which are organized as tandem arrays of divergently oriented gene pairs. The structure of these gene clusters may have consequences for the proposed function, as a pheromone transporter, for the protein products encoded by these genes.
Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes.
Milbury, Coren A; Lee, Jung C; Cannone, Jamie J; Gaffney, Patrick M; Gutell, Robin R
2010-09-02
Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA) genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.
Enhanced levels of scrapie responsive gene mRNA in BSE-infected mouse brain.
Dandoy-Dron, F; Benboudjema, L; Guillo, F; Jaegly, A; Jasmin, C; Dormont, D; Tovey, M G; Dron, M
2000-03-10
The expression of the mRNA of nine scrapie responsive genes was analyzed in the brains of FVB/N mice infected with bovine spongiform encephalopathy (BSE). The RNA transcripts of eight genes were overexpressed to a comparable extent in both BSE-infected and scrapie-infected mice, indicating a common series of pathogenic events in the two transmissible spongiform encephalopathies (TSEs). In contrast, the serine proteinase inhibitor spi 2, an analogue of the human alpha-1 antichymotrypsin gene, was overexpressed to a greater extent in the brains of scrapie-infected animals than in animals infected with BSE, reflecting either an agent specific or a mouse strain specific response. The levels of spi 2 mRNA were increased during the course of scrapie prior to the onset of clinical signs of the disease and the increase reached 11 to 45 fold relative to uninfected controls in terminally ill mice. Spi 2, in common with four of the other scrapie responsive genes studied, is known to be associated with pro-inflammatory processes. These observations underline the importance of cell reactivity in TSE. In addition, scrg2 mRNA the level of which is enhanced in TSE-infected mouse brain, was identified as a previously unrecognized long transcript of the murine aldolase C gene. However, the level of the principal aldolase C mRNA is unaffected in TSE. The increased representation of the longer transcript in the late stage of the disease may reflect changes in mRNA processing and/or stability in reactive astrocytes or in damaged Purkinje cells.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F.W.; Davanloo, P.; Rosenberg, A.H.
1984-03-30
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties.
Canella, Donatella; Bernasconi, David; Gilardi, Federica; LeMartelot, Gwendal; Migliavacca, Eugenia; Praz, Viviane; Cousin, Pascal; Delorenzi, Mauro; Hernandez, Nouria; Hernandez, Nouria; Delorenzi, Mauro; Deplancke, Bart; Desvergne, Béatrice; Guex, Nicolas; Herr, Winship; Naef, Felix; Rougemont, Jacques; Schibler, Ueli; Deplancke, Bart; Guex, Nicolas; Herr, Winship; Guex, Nicolas; Andersin, Teemu; Cousin, Pascal; Gilardi, Federica; Gos, Pascal; Le Martelot, Gwendal; Lammers, Fabienne; Canella, Donatella; Gilardi, Federica; Raghav, Sunil; Fabbretti, Roberto; Fortier, Arnaud; Long, Li; Vlegel, Volker; Xenarios, Ioannis; Migliavacca, Eugenia; Praz, Viviane; Guex, Nicolas; Naef, Felix; Rougemont, Jacques; David, Fabrice; Jarosz, Yohan; Kuznetsov, Dmitry; Liechti, Robin; Martin, Olivier; Ross, Frederick; Sinclair, Lucas; Cajan, Julia; Krier, Irina; Leleu, Marion; Migliavacca, Eugenia; Molina, Nacho; Naldi, Aurélien; Rey, Guillaume; Symul, Laura; Guex, Nicolas; Naef, Felix; Rougemont, Jacques; Bernasconi, David; Delorenzi, Mauro; Andersin, Teemu; Canella, Donatella; Gilardi, Federica; Le Martelot, Gwendal; Lammers, Fabienne; Raghav, Sunil
2012-01-01
The genomic loci occupied by RNA polymerase (RNAP) III have been characterized in human culture cells by genome-wide chromatin immunoprecipitations, followed by deep sequencing (ChIP-seq). These studies have shown that only ∼40% of the annotated 622 human tRNA genes and pseudogenes are occupied by RNAP-III, and that these genes are often in open chromatin regions rich in active RNAP-II transcription units. We have used ChIP-seq to characterize RNAP-III-occupied loci in a differentiated tissue, the mouse liver. Our studies define the mouse liver RNAP-III-occupied loci including a conserved mammalian interspersed repeat (MIR) as a potential regulator of an RNAP-III subunit-encoding gene. They reveal that synteny relationships can be established between a number of human and mouse RNAP-III genes, and that the expression levels of these genes are significantly linked. They establish that variations within the A and B promoter boxes, as well as the strength of the terminator sequence, can strongly affect RNAP-III occupancy of tRNA genes. They reveal correlations with various genomic features that explain the observed variation of 81% of tRNA scores. In mouse liver, loci represented in the NCBI37/mm9 genome assembly that are clearly occupied by RNAP-III comprise 50 Rn5s (5S RNA) genes, 14 known non-tRNA RNAP-III genes, nine Rn4.5s (4.5S RNA) genes, and 29 SINEs. Moreover, out of the 433 annotated tRNA genes, half are occupied by RNAP-III. Transfer RNA gene expression levels reflect both an underlying genomic organization conserved in dividing human culture cells and resting mouse liver cells, and the particular promoter and terminator strengths of individual genes. PMID:22287103
[Construction of Rev-erbβ gene knockout HEK293 cell line with CRISPR/Cas9 system].
Chen, Fang; Zhang, Weifeng; Zhao, Junli; Yang, Peiyan; Ma, Rui; Xia, Haibin
2016-11-01
Objective To prepare Rev-erbβ knockout HEK293 cells using clustered regularly interspaced short palindromic repeats/Cas 9 nuclease (CRISPR/Cas9) gene editing technology. Methods The knock-in or knockout of Rev-erbβ gene could be realized by single-guide RNA (sgRNA)-mediated Cas9 cutting of target DNA, and followed by DNA homologous recombination or non-homologous end joining-mediated DNA repair. Firstly, four sgRNAs were designed for Rev-erbβ gene. The sgRNA1 and sgRNA2 with the higher activity were respectively used to construct pCMV-hCas9-U6-Rev-erbβ sgRNA1 and pCMV-hCas9-U6-Rev-erbβ sgRNA2. Then, pCMV-hCas9-U6-Rev-erbβ sgRNA1, pCMV-hCas9-U6-Rev-erbβ sgRNA2 and pAd5-E1/hRev-erbβ donor plasmid vectors were co-transfected into HEK293 cells. Through drug screening, cloning and sequencing, the Rev-erbβ gene-knockout HEK293 (Rev-erbβ -/- ) cell lines were obtained with one chain integrated with exogenous gene fragment and the other chain for deletion mutants. Finally, the HEK293 (Rev-erbβ -/- ) cell lines (C3-6) was detected with real-time quantitative PCR and Western blotting. Results Expression of Rev-erbβ mRNA and protein was undetectable in HEK293 Rev-erbβ -/- cell line. Conclusion Using CRISPR/Cas9 technology, the HEK293 Rev-erbβ -/- cell line has been successfully constructed, which would provide an effective tool for the study on the function of Rev-erbβ.
Suzuki, Shigeki; Hoshino, Hiroaki; Yoshida, Kazuma; Nakanishi, Jun; Tsuchiya-Hirata, Shizu; Kobuke, Seiji; Haruyama, Naoto; Nishimura, Fusanori; Shiba, Hideki
2018-01-15
Chromatin-enriched noncoding RNAs (ncRNAs) have emerged as key molecules in epigenetic processes by interacting with chromatin-associated proteins. Recently, protein-coding mRNA genes have been reported to be chromatin-tethered, similar with ncRNA. However, very little is known about whether chromatin-enriched mRNA is involved in the chromatin modification process. Here, we comprehensively examined chromatin-enriched RNA in squamous cell carcinoma (SQCC) cells by RNA subcellular localization analysis, which was a combination of RNA fractionation and RNA-seq. We identified 11 mRNAs as highly chromatin-enriched RNAs. Among these, we focused on the dentin matrix protein-1 (DMP-1) gene because its expression in SQCC cells has not been reported. Furthermore, we clarified that DMP-1 mRNA was retained in chromatin in its unspliced form in SQCC in vitro and in vivo. As the inhibition of the unspliced DMP-1 mRNA (unspDMP-1) expression resulted in decreased cellular proliferation in SQCC cells, we performed ChIP-qPCR to identify cell cycle-related genes whose expression was epigenetically modified by unspDMP-1, and found that the CDKN1B promoter became active in SQCC cells by inhibiting unspDMP-1 expression. This result was further validated by the increased CDKN1B gene expression in the cells treated with siRNA for unspDMP-1 and by restoration of the decreased cellular proliferation rate by simultaneously inhibiting CDKN1B expression in SQCC cells. Further, to examine whether unspDMP-1 was able to associate with the CDKN1B promoter region, SQCC cells stably expressing PP7-mCherry fusion protein were transiently transfected with the unspDMP-1 fused to 24 repeats of the PP7 RNA stem loop (unspDMP-1-24xPP7) and we found that unspDMP-1-24xPP7 was efficiently precipitated with the antibody against mCherry and was significantly enriched in the CDKN1B promoter region. Thus, unspDMP-1 is a novel chromatin-enriched RNA that epigenetically regulates cellular proliferation of SQCC
About miRNAs, miRNA seeds, target genes and target pathways.
Kehl, Tim; Backes, Christina; Kern, Fabian; Fehlmann, Tobias; Ludwig, Nicole; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas
2017-12-05
miRNAs are typically repressing gene expression by binding to the 3' UTR, leading to degradation of the mRNA. This process is dominated by the eight-base seed region of the miRNA. Further, miRNAs are known not only to target genes but also to target significant parts of pathways. A logical line of thoughts is: miRNAs with similar (seed) sequence target similar sets of genes and thus similar sets of pathways. By calculating similarity scores for all 3.25 million pairs of 2,550 human miRNAs, we found that this pattern frequently holds, while we also observed exceptions. Respective results were obtained for both, predicted target genes as well as experimentally validated targets. We note that miRNAs target gene set similarity follows a bimodal distribution, pointing at a set of 282 miRNAs that seems to target genes with very high specificity. Further, we discuss miRNAs with different (seed) sequences that nonetheless regulate similar gene sets or pathways. Most intriguingly, we found miRNA pairs that regulate different gene sets but similar pathways such as miR-6886-5p and miR-3529-5p. These are jointly targeting different parts of the MAPK signaling cascade. The main goal of this study is to provide a general overview on the results, to highlight a selection of relevant results on miRNAs, miRNA seeds, target genes and target pathways and to raise awareness for artifacts in respective comparisons. The full set of information that allows to infer detailed results on each miRNA has been included in miRPathDB, the miRNA target pathway database (https://mpd.bioinf.uni-sb.de).
Minchenko, D O; Riabovol, O O; Ratushna, O O; Minchenko, O H
2017-01-01
The aim of the present study was to examine the effect of inhibition of endoplasmic reticulum stress signaling, mediated by IRE1 (inositol requiring enzyme 1), which is a central mediator of the unfolded protein response on the expression of genes encoded estrogen related proteins (NRIP1/RIP140, TRIM16/EBBP, ESRRA/NR3B1, FAM162A/E2IG5, PGRMC2/PMBP, and SLC39A6/LIV-1) and their hypoxic regulation in U87 glioma cells for evaluation of their possible significance in the control of glioma cells proliferation. The expression of NRIP1, EBBP, ESRRA, E2IG5, PGRMC2, and SLC39A6 genes in U87 glioma cells, transfected by empty vector pcDNA3.1 (control) and cells without IRE1 signaling enzyme function (transfected by dnIRE1) upon hypoxia, was studied by a quantitative polymerase chain reaction. Inhibition of both enzymatic activities (kinase and endoribonuclease) of IRE1 signaling enzyme function up-regulates the expression of EBBP, E2IG5, PGRMC2, and SLC39A6 genes is in U87 glioma cells in comparison with the control glioma cells, with more significant changes for E2IG5 and PGRMC2 genes. At the same time, the expression of NRIP1 and ESRRA genes is strongly down-regulated in glioma cells upon inhibition of IRE1. We also showed that hypoxia increases the expression of E2IG5, PGRMC2, and EBBP genes and decreases NRIP1 and ESRRA genes expression in control glioma cells. Furthermore, the inhibition of IRE1 in U87 glioma cells decreases the eff ect of hypoxia on the expression of E2IG5 and PGRMC2 genes, eliminates hypoxic regulation of NRIP1 gene, and enhances the sensitivity of ESRRA gene to hypoxic condition. Furthermore, the expression of SLC39A6 gene is resistant to hypoxia in both the glioma cells with and without IRE1 signaling enzyme function. Results of this investigation demonstrate that inhibition of IRE1 signaling enzyme function affects the expression of NRIP1, EBBP, ESRRA, E2IG5, PGRMC2, and SLC39A6 genes in U87 glioma cells in gene specific manner and these changes
Tan, Jean-Marie; Payne, Elizabeth J.; Lin, Lynlee L.; Sinnya, Sudipta; Raphael, Anthony P.; Lambie, Duncan; Frazer, Ian H.; Dinger, Marcel E.; Soyer, H. Peter
2017-01-01
Identification of appropriate reference genes (RGs) is critical to accurate data interpretation in quantitative real-time PCR (qPCR) experiments. In this study, we have utilised next generation RNA sequencing (RNA-seq) to analyse the transcriptome of a panel of non-melanoma skin cancer lesions, identifying genes that are consistently expressed across all samples. Genes encoding ribosomal proteins were amongst the most stable in this dataset. Validation of this RNA-seq data was examined using qPCR to confirm the suitability of a set of highly stable genes for use as qPCR RGs. These genes will provide a valuable resource for the normalisation of qPCR data for the analysis of non-melanoma skin cancer. PMID:28852586
The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1
Boccara, Martine; Hamilton, William D. O.; Baulcombe, David C.
1986-01-01
The RNA1 of tobacco rattle virus (TRV) has been cloned as cDNA and the nucleotide sequence determined of 2 kb from the 3'-terminal region. The sequence contains three long open reading frames. One of these starts 5' of the cDNA and probably corresponds to the carboxy-terminal sequence of a 170-K protein encoded on RNA1. The deduced protein sequence from this reading frame shows homology with the putative replicases of tobacco mosaic virus (TMV) and tricornaviruses. The location of the second open reading frame, which encodes a 29-K polypeptide, was shown by Northern blot analysis to coincide with a 1.6-kb subgenomic RNA. The validity of this reading frame was confirmed by showing that the cDNA extending over this region could be transcribed and translated in vitro to produce a polypeptide of the predicted size which co-migrates in electrophoresis with a translation product of authentic viral RNA. The sequence of this 29-K polypeptide showed homology with two regions in the 30-K protein of TMV. This homology includes positions in the TMV 30-K protein where mutations have been identified which affect the transport of virus between cells. The third open reading frame encodes a potential 16-K protein and was shown by Northern blot hybridisation to be contained within the region of a 0.7-kb subgenomic RNA which is found in cellular RNA of infected cells but not virus particles. The many similarities between TRV and TMV in viral morphology, gene organisation and sequence suggest that these two viral groups may share a common viral ancestor. ImagesFig. 2.Fig. 3. PMID:16453668
Natural Variation of Epstein-Barr Virus Genes, Proteins, and Primary MicroRNA.
Correia, Samantha; Palser, Anne; Elgueta Karstegl, Claudio; Middeldorp, Jaap M; Ramayanti, Octavia; Cohen, Jeffrey I; Hildesheim, Allan; Fellner, Maria Dolores; Wiels, Joelle; White, Robert E; Kellam, Paul; Farrell, Paul J
2017-08-01
Viral gene sequences from an enlarged set of about 200 Epstein-Barr virus (EBV) strains, including many primary isolates, have been used to investigate variation in key viral genetic regions, particularly LMP1, Zp, gp350, EBNA1, and the BART microRNA (miRNA) cluster 2. Determination of type 1 and type 2 EBV in saliva samples from people from a wide range of geographic and ethnic backgrounds demonstrates a small percentage of healthy white Caucasian British people carrying predominantly type 2 EBV. Linkage of Zp and gp350 variants to type 2 EBV is likely to be due to their genes being adjacent to the EBNA3 locus, which is one of the major determinants of the type 1/type 2 distinction. A novel classification of EBNA1 DNA binding domains, named QCIGP, results from phylogeny analysis of their protein sequences but is not linked to the type 1/type 2 classification. The BART cluster 2 miRNA region is classified into three major variants through single-nucleotide polymorphisms (SNPs) in the primary miRNA outside the mature miRNA sequences. These SNPs can result in altered levels of expression of some miRNAs from the BART variant frequently present in Chinese and Indonesian nasopharyngeal carcinoma (NPC) samples. The EBV genetic variants identified here provide a basis for future, more directed analysis of association of specific EBV variations with EBV biology and EBV-associated diseases. IMPORTANCE Incidence of diseases associated with EBV varies greatly in different parts of the world. Thus, relationships between EBV genome sequence variation and health, disease, geography, and ethnicity of the host may be important for understanding the role of EBV in diseases and for development of an effective EBV vaccine. This paper provides the most comprehensive analysis so far of variation in specific EBV genes relevant to these diseases and proposed EBV vaccines. By focusing on variation in LMP1, Zp, gp350, EBNA1, and the BART miRNA cluster 2, new relationships with the known
2012-01-01
Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13
Nanotherapeutics Using an HIV-1 Poly A and Transactivator of the HIV-1 LTR-(TAR-) Specific siRNA
Mahajan, Supriya D.; Aalinkeel, Ravikumar; Reynolds, Jessica L.; Nair, Bindukumar; Sykes, Donald E.; Law, Wing-Cheung; Ding, Hong; Bergey, Earl J.; Prasad, Paras N.; Schwartz, Stanley A.
2011-01-01
HIV-1 replication can be efficiently inhibited by intracellular expression of an siRNA targeting the viral RNA. We used a well-validated siRNA (si510) which targets the poly A/TAR (transactivator of the HIV-1 LTR) site and suppresses viral replication. Nanotechnology holds much potential for impact in the field of HIV-1 therapeutics, and nanoparticles such as quantum rods (QRs) can be easily functionalized to incorporate siRNA forming stable nanoplexes that can be used for gene silencing. We evaluated the efficacy of the QR-si510 HIV-1 siRNA nanoplex in suppressing viral replication in the HIV-1-infected monocytic cell line THP-1 by measuring p24 antigen levels and gene expression levels of HIV-1 LTR. Our results suggest that the QR-si510 HIV-1 siRNA nanoplex is not only effective in delivering siRNA, but also in suppressing HIV-1 viral replication for a longer time period. HIV-1 nanotherapeutics can thus enhance systemic bioavailability and offer multifunctionality. PMID:21660279
Donadon, Irving; Pinotti, Mirko; Rajkowska, Katarzyna; Pianigiani, Giulia; Barbon, Elena; Morini, Elisabetta; Motaln, Helena; Rogelj, Boris; Mingozzi, Federico; Slaugenhaupt, Susan A; Pagani, Franco
2018-04-25
Familial dysautonomia (FD) is a rare genetic disease with no treatment, caused by an intronic point mutation (c.2204 + 6T>C) that negatively affects the definition of exon 20 in the Elongator complex protein 1 gene (ELP1 also known as IKBKAP). This substitution modifies the 5' splice site and, in combination with regulatory splicing factors, induces different levels of exon 20 skipping, in various tissues. Here, we evaluated the therapeutic potential of a novel class of U1 snRNA molecules, Exon-Specific U1s (ExSpeU1s), in correcting ELP1 exon 20 recognition. Lentivirus-mediated expression of ELP1-ExSpeU1 in FD fibroblasts improved ELP1 splicing and protein levels. We next focused on a transgenic mouse model that recapitulates the same tissue-specific mis-splicing seen in FD patients. Intraperitoneal delivery of ELP1-ExSpeU1s-adeno-associated virus particles successfully increased the production of full-length human ELP1 transcript and protein. This splice-switching class of molecules is the first to specifically correct the ELP1 exon 20 splicing defect. Our data provide proof of principle of ExSpeU1s-adeno-associated virus particles as a novel therapeutic strategy for FD.
Naghitorabi, Mojgan; Mir Mohammad Sadeghi, Hamid; Mohammadi Asl, Javad; Rabbani, Mohammad; Jafarian-Dehkordi, Abbas
2017-01-01
Promoter methylation is one of the main epigenetic mechanisms that leads to the inactivation of tumor suppressor genes during carcinogenesis. Due to the reversible nature of DNA methylation, many studies have been performed to correct theses epigenetic defects by inhibiting DNA methyltransferases (DNMTs). In this case novel therapeutics especially siRNA oligonucleotides have been used to specifically knock down the DNMTs at mRNA level. Also many studies have focused on transcriptional gene silencing in mammalian cells via siRNA mediated promoter methylation. The present study was designed to assess the role of siRNA mediated promoter methylation in DNMT3B knockdown and alteration of promoter methylation of Cadherin-1 (CDH1), Glutathione S-Transferase Pi 1(GSTP1), and DNMT3B genes in MDA-MB-453 cell line. MDA-MB-453 cells were transfected with siDNMT targeting DNMT3B promoter and harvested at 24 and 48 h post transfection to monitor gene silencing and promoter methylation respectively. DNMT3B expression was monitored by quantitative RT-PCR method. Promoter methylation was quantitatively evaluated using differential high resolution melting analysis. A non-significant 20% reduction in DNMT3B mRNA level was shown only after first transfection with siDNMT, which was not reproducible. Promoter methylation levels of DNMT3B, CDH1, and GSTP1 were detected at about 15%, 70% and 10% respectively, in the MDA-MB-453 cell line, with no significant change after transfection. Our results indicated that siDNMT sequence were not able to affect promoter methylation and silencing of DNMT3B in MDA-MB-453 cells. However, quantitation of methylation confirmed a hypermethylated phenotype at CDH1 and GSTP1 promoters as well as a differential methylation pattern at DNMT3B promoter in breast cancer.
Vacek, A T; Bourque, D P
1980-09-01
Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.
Balancing gene expression without library construction via a reusable sRNA pool.
Ghodasara, Amar; Voigt, Christopher A
2017-07-27
Balancing protein expression is critical when optimizing genetic systems. Typically, this requires library construction to vary the genetic parts controlling each gene, which can be expensive and time-consuming. Here, we develop sRNAs corresponding to 15nt 'target' sequences that can be inserted upstream of a gene. The targeted gene can be repressed from 1.6- to 87-fold by controlling sRNA expression using promoters of different strength. A pool is built where six sRNAs are placed under the control of 16 promoters that span a ∼103-fold range of strengths, yielding ∼107 combinations. This pool can simultaneously optimize up to six genes in a system. This requires building only a single system-specific construct by placing a target sequence upstream of each gene and transforming it with the pre-built sRNA pool. The resulting library is screened and the top clone is sequenced to determine the promoter controlling each sRNA, from which the fold-repression of the genes can be inferred. The system is then rebuilt by rationally selecting parts that implement the optimal expression of each gene. We demonstrate the versatility of this approach by using the same pool to optimize a metabolic pathway (β-carotene) and genetic circuit (XNOR logic gate). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Target mimics: an embedded layer of microRNA-involved gene regulatory networks in plants.
Meng, Yijun; Shao, Chaogang; Wang, Huizhong; Jin, Yongfeng
2012-05-21
MicroRNAs (miRNAs) play an essential role in gene regulation in plants. At the same time, the expression of miRNA genes is also tightly controlled. Recently, a novel mechanism called "target mimicry" was discovered, providing another layer for modulating miRNA activities. However, except for the artificial target mimics manipulated for functional studies on certain miRNA genes, only one example, IPS1 (Induced by Phosphate Starvation 1)-miR399 was experimentally confirmed in planta. To date, few analyses for comprehensive identification of natural target mimics have been performed in plants. Thus, limited evidences are available to provide detailed information for interrogating the questionable issue whether target mimicry was widespread in planta, and implicated in certain biological processes. In this study, genome-wide computational prediction of endogenous miRNA mimics was performed in Arabidopsis and rice, and dozens of target mimics were identified. In contrast to a recent report, the densities of target mimic sites were found to be much higher within the untranslated regions (UTRs) when compared to those within the coding sequences (CDSs) in both plants. Some novel sequence characteristics were observed for the miRNAs that were potentially regulated by the target mimics. GO (Gene Ontology) term enrichment analysis revealed some functional insights into the predicted mimics. After degradome sequencing data-based identification of miRNA targets, the regulatory networks constituted by target mimics, miRNAs and their downstream targets were constructed, and some intriguing subnetworks were further exploited. These results together suggest that target mimicry may be widely implicated in regulating miRNA activities in planta, and we hope this study could expand the current understanding of miRNA-involved regulatory networks.
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
Bhinder, Bhavneet; Antczak, Christophe; Ramirez, Christina N.; Shum, David; Liu-Sullivan, Nancy; Radu, Constantin; Frattini, Mark G.
2013-01-01
Abstract RNA interference technology is becoming an integral tool for target discovery and validation.; With perhaps the exception of only few studies published using arrayed short hairpin RNA (shRNA) libraries, most of the reports have been either against pooled siRNA or shRNA, or arrayed siRNA libraries. For this purpose, we have developed a workflow and performed an arrayed genome-scale shRNA lethality screen against the TRC1 library in HeLa cells. The resulting targets would be a valuable resource of candidates toward a better understanding of cellular homeostasis. Using a high-stringency hit nomination method encompassing criteria of at least three active hairpins per gene and filtered for potential off-target effects (OTEs), referred to as the Bhinder–Djaballah analysis method, we identified 1,252 lethal and 6 rescuer gene candidates, knockdown of which resulted in severe cell death or enhanced growth, respectively. Cross referencing individual hairpins with the TRC1 validated clone database, 239 of the 1,252 candidates were deemed independently validated with at least three validated clones. Through our systematic OTE analysis, we have identified 31 microRNAs (miRNAs) in lethal and 2 in rescuer genes; all having a seed heptamer mimic in the corresponding shRNA hairpins and likely cause of the OTE observed in our screen, perhaps unraveling a previously unknown plausible essentiality of these miRNAs in cellular viability. Taken together, we report on a methodology for performing large-scale arrayed shRNA screens, a comprehensive analysis method to nominate high-confidence hits, and a performance assessment of the TRC1 library highlighting the intracellular inefficiencies of shRNA processing in general. PMID:23198867
Evaluation of tools for highly variable gene discovery from single-cell RNA-seq data.
Yip, Shun H; Sham, Pak Chung; Wang, Junwen
2018-02-21
Traditional RNA sequencing (RNA-seq) allows the detection of gene expression variations between two or more cell populations through differentially expressed gene (DEG) analysis. However, genes that contribute to cell-to-cell differences are not discoverable with RNA-seq because RNA-seq samples are obtained from a mixture of cells. Single-cell RNA-seq (scRNA-seq) allows the detection of gene expression in each cell. With scRNA-seq, highly variable gene (HVG) discovery allows the detection of genes that contribute strongly to cell-to-cell variation within a homogeneous cell population, such as a population of embryonic stem cells. This analysis is implemented in many software packages. In this study, we compare seven HVG methods from six software packages, including BASiCS, Brennecke, scLVM, scran, scVEGs and Seurat. Our results demonstrate that reproducibility in HVG analysis requires a larger sample size than DEG analysis. Discrepancies between methods and potential issues in these tools are discussed and recommendations are made.
Rearrangement of competing U2 RNA helices within the spliceosome promotes multiple steps in splicing
Perriman, Rhonda J.; Ares, Manuel
2007-01-01
Nuclear pre-messenger RNA (pre-mRNA) splicing requires multiple spliceosomal small nuclear RNA (snRNA) and pre-mRNA rearrangements. Here we reveal a new snRNA conformational switch in which successive roles for two competing U2 helices, stem IIa and stem IIc, promote distinct splicing steps. When stem IIa is stabilized by loss of stem IIc, rapid ATP-independent and Cus2p-insensitive prespliceosome formation occurs. In contrast, hyperstabilized stem IIc improves the first splicing step on aberrant branchpoint pre-mRNAs and rescues temperature-sensitive U6–U57C, a U6 mutation that also suppresses first-step splicing defects of branchpoint mutations. A second, later role for stem IIa is revealed by its suppression of a cold-sensitive allele of the second-step splicing factor PRP16. Our data expose a spliceosomal progression cycle of U2 stem IIa formation, disruption by stem IIc, and then reformation of stem IIa before the second catalytic step. We propose that the competing stem IIa and stem IIc helices are key spliceosomal RNA elements that optimize juxtaposition of the proper reactive sites during splicing. PMID:17403781
Post-transcriptional bursting in genes regulated by small RNA molecules
NASA Astrophysics Data System (ADS)
Rodrigo, Guillermo
2018-03-01
Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.
Identification and consequences of miRNA-target interactions--beyond repression of gene expression.
Hausser, Jean; Zavolan, Mihaela
2014-09-01
Comparative genomics analyses and high-throughput experimental studies indicate that a microRNA (miRNA) binds to hundreds of sites across the transcriptome. Although the knockout of components of the miRNA biogenesis pathway has profound phenotypic consequences, most predicted miRNA targets undergo small changes at the mRNA and protein levels when the expression of the miRNA is perturbed. Alternatively, miRNAs can establish thresholds in and increase the coherence of the expression of their target genes, as well as reduce the cell-to-cell variability in target gene expression. Here, we review the recent progress in identifying miRNA targets and the emerging paradigms of how miRNAs shape the dynamics of target gene expression.
A snoRNA modulates mRNA 3′ end processing and regulates the expression of a subset of mRNAs
Huang, Chunliu; Shi, Junjie; Guo, Yibin; Huang, Weijun; Huang, Shanshan; Ming, Siqi; Wu, Xingui; Zhang, Rui; Ding, Junjun; Zhao, Wei; Jia, Jie; Huang, Xi; Xiang, Andy Peng
2017-01-01
Abstract mRNA 3′ end processing is an essential step in gene expression. It is well established that canonical eukaryotic pre-mRNA 3′ processing is carried out within a macromolecular machinery consisting of dozens of trans-acting proteins. However, it is unknown whether RNAs play any role in this process. Unexpectedly, we found that a subset of small nucleolar RNAs (snoRNAs) are associated with the mammalian mRNA 3′ processing complex. These snoRNAs primarily interact with Fip1, a component of cleavage and polyadenylation specificity factor (CPSF). We have functionally characterized one of these snoRNAs and our results demonstrated that the U/A-rich SNORD50A inhibits mRNA 3′ processing by blocking the Fip1-poly(A) site (PAS) interaction. Consistently, SNORD50A depletion altered the Fip1–RNA interaction landscape and changed the alternative polyadenylation (APA) profiles and/or transcript levels of a subset of genes. Taken together, our data revealed a novel function for snoRNAs and provided the first evidence that non-coding RNAs may play an important role in regulating mRNA 3′ processing. PMID:28911119
Li, Tong-Huai; Zhang, Jing-Jing; Liu, Shao-Xiao; Chen, Yan
2018-05-01
The aim of this study was to evaluate the correlation of long non-coding RNAs (lncRNAs) taurine-upregulated gene 1 (TUG1) with clinicopathological characteristics as well as overall survival (OS) in epithelial ovarian cancer (EOC) patients, and investigate its function in EOC cells proliferation and apoptosis in vitro.LncRNA TUG1 expressions were detected in tumor tissues and paired adjacent tissues obtained from 96 EOC patients. Blank mimic, lncRNA TUG1 mimic, blank inhibitor, and lncRNA TUG1 inhibitor plasmids were transfected into SKOV3 cells. CKK-8, annexin V-FITC-propidium iodide, qPCR and western blot assays were performed to detect cells proliferation, cells apoptosis, RNA expression, and protein expression, respectively.LncRNA TUG1 expression was higher in tumor tissue compared to paired adjacent tissue (P < .001), and it was positively correlated with pathological grade (P = .022), tumor size (P = .011) and FIGO stage (P < .001). Kaplan-Meier curve showed that lncRNA TUG1 high expression was associated with worse OS (P = .003). Multivariate Cox analysis indicated that lncRNA TUG1 high expression (vs. low expression) (P = .035) was independently predictive factor for shorter OS. In vitro, cells proliferation was promoted after treatment with lncRNA TUG1 mimic and was suppressed after treatment with lncRNA TUG1 inhibitor. In addition, cells apoptosis rate was decreased in lncRNA TUG1 mimic group compared to NC1 mimic, and increased in lncRNA TUG1 inhibitor group compared to NC2 inhibitor.In conclusion, lncRNA TUG1 is positively correlated with advanced disease and poor prognosis, and it promotes cells proliferation and inhibits cells apoptosis in EOC cells.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.
1997-12-02
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.
1999-02-09
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.
1997-12-02
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.
1990-01-01
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.
1999-02-09
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.
Zhong, Di; Zhao, Siren; He, Guangxu; Li, Jinku; Lang, Yanbin; Ye, Wei; Li, Yongli; Jiang, Chuanlu; Li, Xianfeng
2015-06-01
Leucine-rich α2 glycoprotein 1 (LRG1) has been shown to be aberrantly expressed in multiple human malignancies. However, the biological functions of LRG1 in human glioblastoma remain unknown. Here, we report for the first time the role of LRG1 in glioblastoma development based on the preliminary in vitro and in vivo data. We first confirmed the expression of LRG1 in human glioblastoma cell lines. Next, to investigate the role of LRG1 in the tumorigenesis and development of glioblastoma, a short hairpin RNA (shRNA) construct targeting LRG1 mRNA was transfected into U251 glioblastoma cells to generate a cell line with stably silenced LRG1 expression. The results showed that silencing of LRG1 significantly inhibited cell proliferation, induced cell cycle arrest at G0/G1 phase, and enhanced apoptosis in U251 cells in vitro. Consistently, LRG1 silencing resulted in the downregulation of key cell cycle factors including cyclin D1, B, and E and apoptotic gene Bcl-2 while elevated the levels of pro-apoptotic Bax and cleaved caspase-3, as determined by Western blot analysis. We further demonstrate that the silencing of LRG1 expression effectively reduced the tumorigenicity of U251 cells, delayed tumor formation, and promoted apoptosis in a xenograft tumor model in vivo. In conclusion, silencing the expression of LRG1 suppresses the growth of glioblastoma U251 cells in vitro and in vivo, suggesting that LRG1 may play a critical role in glioblastoma development, and it may have potential clinical implications in glioblastoma therapy.
Systematic discovery of Xist RNA binding proteins
Chu, Ci; Zhang, Qiangfeng Cliff; da Rocha, Simão Teixeira; Flynn, Ryan A.; Bharadwaj, Maheetha; Calabrese, J. Mauro; Magnuson, Terry; Heard, Edith; Chang, Howard Y.
2015-01-01
Summary Noncoding RNAs (ncRNAs) function with associated proteins to effect complex structural and regulatory outcomes. To reveal the composition and dynamics of specific noncoding RNA- protein complexes (RNPs) in vivo, we developed comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS). ChIRP-MS analysis of four ncRNAs captures key protein interactors, including a U1-specific link to the 3′ RNA processing machinery. Xist, an essential lncRNA for X-chromosome inactivation (XCI), interacts with 81 proteins from chromatin modification, nuclear matrix, and RNA remodeling pathways. The Xist RNA-protein particle assembles in two steps coupled with the transition from pluripotency to differentiation. Specific interactors include HnrnpK that participates in Xist-mediated gene silencing and histone modifications, but not Xist localization and Drosophila Split ends homolog Spen that interacts via the A-repeat domain of Xist and is required for gene silencing. Thus, Xist lncRNA engages with proteins in a modular and developmentally controlled manner to coordinate chromatin spreading and silencing. PMID:25843628
Lan, DaoLiang; Xiong, XianRong; Wei, YanLi; Xu, Tong; Zhong, JinCheng; Zhi, XiangDong; Wang, Yong; Li, Jian
2014-09-01
RNA-Seq, a high-throughput (HT) sequencing technique, has been used effectively in large-scale transcriptomic studies, and is particularly useful for improving gene structure information and mining of new genes. In this study, RNA-Seq HT technology was employed to analyze the transcriptome of yak ovary. After Illumina-Solexa deep sequencing, 26826516 clean reads with a total of 4828772880 bp were obtained from the ovary library. Alignment analysis showed that 16992 yak genes mapped to the yak genome and 3734 of these genes were involved in alternative splicing. Gene structure refinement analysis showed that 7340 genes that were annotated in the yak genome could be extended at the 5' or 3' ends based on the alignments been the transcripts and the genome sequence. Novel transcript prediction analysis identified 6321 new transcripts with lengths ranging from 180 to 14884 bp, and 2267 of them were predicted to code proteins. BLAST analysis of the new transcripts showed that 1200?4933 mapped to the non-redundant (nr), nucleotide (nt) and/or SwissProt sequence databases. Comparative statistical analysis of the new mapped transcripts showed that the majority of them were similar to genes in Bos taurus (41.4%), Bos grunniens mutus (33.0%), Ovis aries (6.3%), Homo sapiens (2.8%), Mus musculus (1.6%) and other species. Functional analysis showed that these expressed genes were involved in various Gene Ontology (GO) categories and Kyoto Encyclopedia of Genes and Genomes pathways. GO analysis of the new transcripts found that the largest proportion of them was associated with reproduction. The results of this study will provide a basis for describing the normal transcriptome map of yak ovary and for future studies on yak breeding performance. Moreover, the results confirmed that RNA-Seq HT technology is highly advantageous in improving gene structure information and mining of new genes, as well as in providing valuable data to expand the yak genome information.
Fourtounis, Jimmy; Wang, I-Ming; Mathieu, Marie-Claude; Claveau, David; Loo, Tenneille; Jackson, Aimee L; Peters, Mette A; Therien, Alex G; Boie, Yves; Crackower, Michael A
2012-10-12
Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease.
Al Sheikh, Yazeed A.; Marie, Mohammed Ali M.; John, James; Krishnappa, Lakshmana Gowda; Dabwab, Khaled Homoud M.
2014-01-01
Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were bla TEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae. PMID:25005152
Leopardi, R; Ward, P L; Ogle, W O; Roizman, B
1997-01-01
The expression of herpes simplex virus 1 gamma (late) genes requires functional alpha proteins (gamma1 genes) and the onset of viral DNA synthesis (gamma2 genes). We report that late in infection after the onset of viral DNA synthesis, cell nuclei exhibit defined structures which contain two viral regulatory proteins (infected cell proteins 4 and 22) required for gamma gene expression, RNA polymerase II, a host nucleolar protein (EAP or L22) known to be associated with ribosomes and to bind small RNAs, including the Epstein-Barr virus small nuclear RNAs, and newly synthesized progeny DNA. The formation of these complexes required the onset of viral DNA synthesis. The association of infected cell protein 22, a highly posttranslationally processed protein, with these structures did not occur in cells infected with a viral mutant deleted in the genes U(L)13 and U(S)3, each of which specifies a protein kinase known to phosphorylate the protein. PMID:8995634
Li, Xueni; Liu, Shiheng; Jiang, Jiansen; Zhang, Lingdi; Espinosa, Sara; Hill, Ryan C; Hansen, Kirk C; Zhou, Z Hong; Zhao, Rui
2018-04-11
The originally published version of this Article contained several errors in Figure 2, panel a: the basepair register in SL3-4 of yeast U1 snRNA was depicted incorrectly; the basepair for A287-U295 in yeast U1 snRNA was erroneously present; basepairs for U84-G119, G309-U532, A288-U295 and U289-A294 in yeast U1 snRNA were missing; the bulging nucleotide in SL3 of human U1 snRNA was depicted as G instead of C; and the dashed boxes defining the 5' ss binding site and Sm site in both human and yeast snRNAs were not drawn accurately. These have now been corrected in both the PDF and HTML versions of the Article.
Almeida, Miguel Vasconcelos; Dietz, Sabrina; Redl, Stefan; Karaulanov, Emil; Hildebrandt, Andrea; Renz, Christian; Ulrich, Helle D; König, Julian; Butter, Falk; Ketting, René F
2018-05-16
Argonaute proteins and their associated small RNAs (sRNAs) are evolutionarily conserved regulators of gene expression. Gametocyte-specific factor 1 (Gtsf1) proteins, characterized by two tandem CHHC zinc fingers and an unstructured C-terminal tail, are conserved in animals and have been shown to interact with Piwi clade Argonautes, thereby assisting their activity. We identified the Caenorhabditis elegans Gtsf1 homolog, named it gtsf-1 and characterized it in the context of the sRNA pathways of C. elegans We report that GTSF-1 is not required for Piwi-mediated gene silencing. Instead, gtsf-1 mutants show a striking depletion of 26G-RNAs, a class of endogenous sRNAs, fully phenocopying rrf-3 mutants. We show, both in vivo and in vitro , that GTSF-1 interacts with RRF-3 via its CHHC zinc fingers. Furthermore, we demonstrate that GTSF-1 is required for the assembly of a larger RRF-3 and DCR-1-containing complex (ERIC), thereby allowing for 26G-RNA generation. We propose that GTSF-1 homologs may act to drive the assembly of larger complexes that act in sRNA production and/or in imposing sRNA-mediated silencing activities. © 2018 The Authors.
Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)
Ronander, Elena; Bengtsson, Dominique C.; Joergensen, Louise; Jensen, Anja T. R.; Arnot, David E.
2012-01-01
Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1. Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types. PMID:23070076
Local gene silencing in plants via synthetic dsRNA and carrier peptide.
Numata, Keiji; Ohtani, Misato; Yoshizumi, Takeshi; Demura, Taku; Kodama, Yutaka
2014-10-01
Quick and facile transient RNA interference (RNAi) is one of the most valuable plant biotechnologies for analysing plant gene functions. To establish a novel double-strand RNA (dsRNA) delivery system for plants, we developed an ionic complex of synthetic dsRNA with a carrier peptide in which a cell-penetrating peptide is fused with a polycation sequence as a gene carrier. The dsRNA-peptide complex is 100-300 nm in diameter and positively charged. Infiltration of the complex into intact leaf cells of Arabidopsis thaliana successfully induced rapid and efficient down-regulation of exogenous and endogenous genes such as yellow fluorescent protein and chalcone synthase. The present method realizes quick and local gene silencing in specific tissues and/or organs in plants. © 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J
2015-01-01
In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
Evaluating whole transcriptome amplification for gene profiling experiments using RNA-Seq.
Faherty, Sheena L; Campbell, C Ryan; Larsen, Peter A; Yoder, Anne D
2015-07-30
RNA-Seq has enabled high-throughput gene expression profiling to provide insight into the functional link between genotype and phenotype. Low quantities of starting RNA can be a severe hindrance for studies that aim to utilize RNA-Seq. To mitigate this bottleneck, whole transcriptome amplification (WTA) technologies have been developed to generate sufficient sequencing targets from minute amounts of RNA. Successful WTA requires accurate replication of transcript abundance without the loss or distortion of specific mRNAs. Here, we test the efficacy of NuGEN's Ovation RNA-Seq V2 system, which uses linear isothermal amplification with a unique chimeric primer for amplification, using white adipose tissue from standard laboratory rats (Rattus norvegicus). Our goal was to investigate potential biological artifacts introduced through WTA approaches by establishing comparisons between matched raw and amplified RNA libraries derived from biological replicates. We found that 93% of expressed genes were identical between all unamplified versus matched amplified comparisons, also finding that gene density is similar across all comparisons. Our sequencing experiment and downstream bioinformatic analyses using the Tuxedo analysis pipeline resulted in the assembly of 25,543 high-quality transcripts. Libraries constructed from raw RNA and WTA samples averaged 15,298 and 15,253 expressed genes, respectively. Although significant differentially expressed genes (P < 0.05) were identified in all matched samples, each of these represents less than 0.15% of all shared genes for each comparison. Transcriptome amplification is efficient at maintaining relative transcript frequencies with no significant bias when using this NuGEN linear isothermal amplification kit under ideal laboratory conditions as presented in this study. This methodology has broad applications, from clinical and diagnostic, to field-based studies when sample acquisition, or sample preservation, methods prove
Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ
Mank, Nils N.; Berghoff, Bork A.; Hermanns, Yannick N.; Klug, Gabriele
2012-01-01
The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA. PMID:22988125
Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.
Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele
2012-10-02
The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.
Oh, Hye Rim; An, Chang Hyeok; Yoo, Nam Jin; Lee, Sug Hyung
2015-02-01
Initiation of transcription for ribosomal RNA (rRNA) by RNA polymerase I requires TATA-binding protein (TBP) and TBP-associated factors (TAF1A, TAF1B and TAF1C). p53 tumour suppressor inhibits rRNA transcription by blocking TAF1C-UBF interaction, but alterations of TAF1C itself in tumorigenesis remain unknown. The aim of this study was to explore whether TAF1C gene was mutated in gastric (GC) and colorectal cancers (CRC).In a public database, we found that TAF1C gene had a mononucleotide repeat (C8) in the coding sequences that might be a mutation target in the cancers with microsatellite instability (MSI). We analysed 79 GC and 124 CRC by single-strand conformation polymorphism and DNA sequencing analyses. In this study, we found TAF1C frameshift mutations (8.8% of GC and 10.1% of CRC with MSI-H), which were not found in stable MSI/low MSI (MSS/MSI-L) (0/90). In addition, we analysed intratumoural heterogeneity (ITH) of TAF1C frameshift mutations in 16 CRC and found that three CRC (18.8%) harboured regional ITH of the TAF1C frameshift mutations. Our results indicate that TAF1C gene harboured not only somatic frameshift mutations but also the mutational ITH, which together might play a role in tumourigenesis of GC and CRC. Our data also suggest that multi-regional mutation analysis is needed for a better evaluation of the mutation status in CRC.
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification
Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina
2015-01-01
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the
RNA interference can be used to disrupt gene function in tardigrades.
Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob
2013-05-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.
Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.
Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P
2010-08-01
Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.
Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.
Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L
2010-01-01
Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.
funRNA: a fungi-centered genomics platform for genes encoding key components of RNAi.
Choi, Jaeyoung; Kim, Ki-Tae; Jeon, Jongbum; Wu, Jiayao; Song, Hyeunjeong; Asiegbu, Fred O; Lee, Yong-Hwan
2014-01-01
RNA interference (RNAi) is involved in genome defense as well as diverse cellular, developmental, and physiological processes. Key components of RNAi are Argonaute, Dicer, and RNA-dependent RNA polymerase (RdRP), which have been functionally characterized mainly in model organisms. The key components are believed to exist throughout eukaryotes; however, there is no systematic platform for archiving and dissecting these important gene families. In addition, few fungi have been studied to date, limiting our understanding of RNAi in fungi. Here we present funRNA http://funrna.riceblast.snu.ac.kr/, a fungal kingdom-wide comparative genomics platform for putative genes encoding Argonaute, Dicer, and RdRP. To identify and archive genes encoding the abovementioned key components, protein domain profiles were determined from reference sequences obtained from UniProtKB/SwissProt. The domain profiles were searched using fungal, metazoan, and plant genomes, as well as bacterial and archaeal genomes. 1,163, 442, and 678 genes encoding Argonaute, Dicer, and RdRP, respectively, were predicted. Based on the identification results, active site variation of Argonaute, diversification of Dicer, and sequence analysis of RdRP were discussed in a fungus-oriented manner. funRNA provides results from diverse bioinformatics programs and job submission forms for BLAST, BLASTMatrix, and ClustalW. Furthermore, sequence collections created in funRNA are synced with several gene family analysis portals and databases, offering further analysis opportunities. funRNA provides identification results from a broad taxonomic range and diverse analysis functions, and could be used in diverse comparative and evolutionary studies. It could serve as a versatile genomics workbench for key components of RNAi.
Human tRNA genes function as chromatin insulators
Raab, Jesse R; Chiu, Jonathan; Zhu, Jingchun; Katzman, Sol; Kurukuti, Sreenivasulu; Wade, Paul A; Haussler, David; Kamakaka, Rohinton T
2012-01-01
Insulators help separate active chromatin domains from silenced ones. In yeast, gene promoters act as insulators to block the spread of Sir and HP1 mediated silencing while in metazoans most insulators are multipartite autonomous entities. tDNAs are repetitive sequences dispersed throughout the human genome and we now show that some of these tDNAs can function as insulators in human cells. Using computational methods, we identified putative human tDNA insulators. Using silencer blocking, transgene protection and repressor blocking assays we show that some of these tDNA-containing fragments can function as barrier insulators in human cells. We find that these elements also have the ability to block enhancers from activating RNA pol II transcribed promoters. Characterization of a putative tDNA insulator in human cells reveals that the site possesses chromatin signatures similar to those observed at other better-characterized eukaryotic insulators. Enhanced 4C analysis demonstrates that the tDNA insulator makes long-range chromatin contacts with other tDNAs and ETC sites but not with intervening or flanking RNA pol II transcribed genes. PMID:22085927
Zhang, Yu; Mo, Wei-Jia; Wang, Xiao; Zhang, Tong-Tong; Qin, Yuan; Wang, Han-Lin; Chen, Gang; Wei, Dan-Ming; Dang, Yi-Wu
2018-05-02
The long non‑coding RNA (lncRNA) PVT1 plays vital roles in the tumorigenesis and development of various types of cancer. However, the potential expression profiling, functions and pathways of PVT1 in HCC remain unknown. PVT1 was knocked down in SMMC‑7721 cells, and a miRNA microarray analysis was performed to detect the differentially expressed miRNAs. Twelve target prediction algorithms were used to predict the underlying targets of these differentially expressed miRNAs. Bioinformatics analysis was performed to explore the underlying functions, pathways and networks of the targeted genes. Furthermore, the relationship between PVT1 and the clinical parameters in HCC was confirmed based on the original data in the TCGA database. Among the differentially expressed miRNAs, the top two upregulated and downregulated miRNAs were selected for further analysis based on the false discovery rate (FDR), fold‑change (FC) and P‑values. Based on the TCGA database, PVT1 was obviously highly expressed in HCC, and a statistically higher PVT1 expression was found for sex (male), ethnicity (Asian) and pathological grade (G3+G4) compared to the control groups (P<0.05). Furthermore, Gene Ontology (GO) analysis revealed that the target genes were involved in complex cellular pathways, such as the macromolecule biosynthetic process, compound metabolic process, and transcription. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis revealed that the MAPK and Wnt signaling pathways may be correlated with the regulation of the four candidate miRNAs. The results therefore provide significant information on the differentially expressed miRNAs associated with PVT1 in HCC, and we hypothesized that PVT1 may play vital roles in HCC by regulating different miRNAs or target gene expression (particularly MAPK8) via the MAPK or Wnt signaling pathways. Thus, further investigation of the molecular mechanism of PVT1 in HCC is needed.
[Study on the inhibition effect of siRNA on herpes simplex virus type 2 ICP4 gene].
Liu, Ji-feng; Guan, Cui-ping; Tang, Xu; Xu, Ai-e
2010-06-01
To explore the inhibition effect of RNA interference on the ICP4 expression and DNA replication of herpes simplex virus type 2 (HSV2). Four pairs of siRNA targeted to HSV2 ICP4 gene and negative control siRNA were synthetized by chemical method, named as siRNA-1, siRNA-2, siRNA-3, siRNA-4 and siRNA-N respecticely. HSV2 HG52 was used to attack Vero cell after transfection overnight. Vero cell and supernatant were collected at 1d, 2d, 3d, 4d and 5d after virus attacking. Flurogenic quantitative reverse transcription polymerase chain reaction (FQ-RT-PCR)was used to detect the expression of HSV2 ICP4 mRNA, flurogenic quantitative polymerase chain reaction(FG-PCR) was used to detect the expression of HSV2 DNA and Western-Blot was used to detect the expression of HSV2 ICP4 protein. All the four pairs of siRNA could significantly inhibit the expression of HSV2 ICP4 mRNA and protein, especially siRNA-2. The above siRNAs could significantly decrease HSV2 DNA copy number,too. siRNAs targeted to HSV2 ICP4 gene could significantly inhibit expression of HSV2 ICP4 mRNA and protein, and decrease HSV2 DNA copy number, suggesting that siRNA can inhibit HSV2 DNA replication through silencing ICP4 gene.
Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie
2016-05-11
Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.
Förch, Patrik; Merendino, Livia; Martínez, Concepción; Valcárcel, Juan
2003-01-01
The splicing factor U2AF(65), U2 small nuclear ribonucleoprotein particle (snRNP) auxillary factor of 65 kDa, binds to pyrimidine-rich sequences at 3' splice sites to recruit U2 snRNP to pre-mRNAs. We report that U2AF(65) can also promote the recruitment of U1 snRNP to weak 5' splice sites that are followed by uridine-rich sequences. The arginine- and serine-rich domain of U2AF(65) is critical for U1 recruitment, and we discuss the role of its RNA-RNA annealing activity in this novel function of U2AF(65). PMID:12558503
Peng, Hui; Lan, Chaowang; Zheng, Yi; Hutvagner, Gyorgy; Tao, Dacheng; Li, Jinyan
2017-03-24
MicroRNAs always function cooperatively in their regulation of gene expression. Dysfunctions of these co-functional microRNAs can play significant roles in disease development. We are interested in those multi-disease associated co-functional microRNAs that regulate their common dysfunctional target genes cooperatively in the development of multiple diseases. The research is potentially useful for human disease studies at the transcriptional level and for the study of multi-purpose microRNA therapeutics. We designed a computational method to detect multi-disease associated co-functional microRNA pairs and conducted cross disease analysis on a reconstructed disease-gene-microRNA (DGR) tripartite network. The construction of the DGR tripartite network is by the integration of newly predicted disease-microRNA associations with those relationships of diseases, microRNAs and genes maintained by existing databases. The prediction method uses a set of reliable negative samples of disease-microRNA association and a pre-computed kernel matrix instead of kernel functions. From this reconstructed DGR tripartite network, multi-disease associated co-functional microRNA pairs are detected together with their common dysfunctional target genes and ranked by a novel scoring method. We also conducted proof-of-concept case studies on cancer-related co-functional microRNA pairs as well as on non-cancer disease-related microRNA pairs. With the prioritization of the co-functional microRNAs that relate to a series of diseases, we found that the co-function phenomenon is not unusual. We also confirmed that the regulation of the microRNAs for the development of cancers is more complex and have more unique properties than those of non-cancer diseases.
RNA-guided genome editing for target gene mutations in wheat.
Upadhyay, Santosh Kumar; Kumar, Jitesh; Alok, Anshu; Tuli, Rakesh
2013-12-09
The clustered, regularly interspaced, short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas) system has been used as an efficient tool for genome editing. We report the application of CRISPR-Cas-mediated genome editing to wheat (Triticum aestivum), the most important food crop plant with a very large and complex genome. The mutations were targeted in the inositol oxygenase (inox) and phytoene desaturase (pds) genes using cell suspension culture of wheat and in the pds gene in leaves of Nicotiana benthamiana. The expression of chimeric guide RNAs (cgRNA) targeting single and multiple sites resulted in indel mutations in all the tested samples. The expression of Cas9 or sgRNA alone did not cause any mutation. The expression of duplex cgRNA with Cas9 targeting two sites in the same gene resulted in deletion of DNA fragment between the targeted sequences. Multiplexing the cgRNA could target two genes at one time. Target specificity analysis of cgRNA showed that mismatches at the 3' end of the target site abolished the cleavage activity completely. The mismatches at the 5' end reduced cleavage, suggesting that the off target effects can be abolished in vivo by selecting target sites with unique sequences at 3' end. This approach provides a powerful method for genome engineering in plants.
Polymorphisms in miRNA genes and their involvement in autoimmune diseases susceptibility.
Latini, Andrea; Ciccacci, Cinzia; Novelli, Giuseppe; Borgiani, Paola
2017-08-01
MicroRNAs (miRNAs) are small non-coding RNA molecules that negatively regulate the expression of multiple protein-encoding genes at the post-transcriptional level. MicroRNAs are involved in different pathways, such as cellular proliferation and differentiation, signal transduction and inflammation, and play crucial roles in the development of several diseases, such as cancer, diabetes, and cardiovascular diseases. They have recently been recognized to play a role also in the pathogenesis of autoimmune diseases. Although the majority of studies are focused on miRNA expression profiles investigation, a growing number of studies have been investigating the role of polymorphisms in miRNA genes in the autoimmune diseases development. Indeed, polymorphisms affecting the miRNA genes can modify the set of targets they regulate or the maturation efficiency. This review is aimed to give an overview about the available studies that have investigated the association of miRNA gene polymorphisms with the susceptibility to various autoimmune diseases and to their clinical phenotypes.
Dempoya, Junichi; Imaizumi, Tadaatsu; Hayakari, Ryo; Xing, Fei; Yoshida, Hidemi; Okumura, Ken; Satoh, Kei
2012-01-01
Upon viral infection, pattern recognition receptors sense viral nucleic acids, leading to the production of type I interferons (IFNs), which initiate antiviral activities. Type I IFNs bind to their cognate receptor, IFNAR, resulting in the activation of signal-transducing activators of transcription 1 (STAT1). Thus, it has long been thought that double-stranded RNA (dsRNA)-induced STAT1 phosphorylation is mediated by the transactivation of type I IFN signaling. Foreign RNA, such as viral RNA, in cells is sensed by the cytoplasmic sensors retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA-5). In this study, we explored the molecular mechanism responsible for STAT1 phosphorylation in response to the sensing of dsRNA by cytosolic RNA sensors. Polyinosinic-poly(C) [poly(I:C)], a synthetic dsRNA that is sensed by both RIG-I and MDA-5, induces STAT1 phosphorylation. We found that the poly(I:C)-induced initial phosphorylation of STAT1 is dependent on the RIG-I pathway and that MDA-5 is not involved in STAT1 phosphorylation. Furthermore, pretreatment of the cells with neutralizing antibody targeting the IFN receptor suppressed the initial STAT1 phosphorylation in response to poly(I:C), suggesting that this initial phosphorylation event is predominantly type I IFN dependent. In contrast, neither the known RIG-I pathway nor type I IFN is involved in the late phosphorylation of STAT1. In addition, poly(I:C) stimulated STAT1 phosphorylation in type I IFN receptor-deficient U5A cells with delayed kinetics. Collectively, our study provides evidence of a comprehensive regulatory mechanism in which dsRNA induces STAT1 phosphorylation, indicating the importance of STAT1 in maintaining very tight regulation of the innate immune system. PMID:22973045
The Evolution and Expression Pattern of Human Overlapping lncRNA and Protein-coding Gene Pairs.
Ning, Qianqian; Li, Yixue; Wang, Zhen; Zhou, Songwen; Sun, Hong; Yu, Guangjun
2017-03-27
Long non-coding RNA overlapping with protein-coding gene (lncRNA-coding pair) is a special type of overlapping genes. Protein-coding overlapping genes have been well studied and increasing attention has been paid to lncRNAs. By studying lncRNA-coding pairs in human genome, we showed that lncRNA-coding pairs were more likely to be generated by overprinting and retaining genes in lncRNA-coding pairs were given higher priority than non-overlapping genes. Besides, the preference of overlapping configurations preserved during evolution was based on the origin of lncRNA-coding pairs. Further investigations showed that lncRNAs promoting the splicing of their embedded protein-coding partners was a unilateral interaction, but the existence of overlapping partners improving the gene expression was bidirectional and the effect was decreased with the increased evolutionary age of genes. Additionally, the expression of lncRNA-coding pairs showed an overall positive correlation and the expression correlation was associated with their overlapping configurations, local genomic environment and evolutionary age of genes. Comparison of the expression correlation of lncRNA-coding pairs between normal and cancer samples found that the lineage-specific pairs including old protein-coding genes may play an important role in tumorigenesis. This work presents a systematically comprehensive understanding of the evolution and the expression pattern of human lncRNA-coding pairs.
NASA Astrophysics Data System (ADS)
Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy
2015-01-01
Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Hu, Z; Lin, Q; Chen, H; Li, Z; Yin, F; Feng, X
2014-12-01
Insect cytochrome P450 monooxygenases (P450s) play an important role in catalysis of many reactions leading to insecticides resistance. Our previous studies on transcriptome analysis of chlorantraniliprole-resistant development in the diamondback moth, Plutella xylostella revealed that up-regulation of cytochrome P450s are one of the main factors leading to the development of chlorantraniliprole resistance. Here, we report for the first time a novel cytochrome P450 gene CYP321E1, which belongs to the cytochrome P450 gene family CYP321. Real-time quantitative PCR (RT-qPCR) analyses indicated that CYP321E1 was expressed at all developmental stages of P. xylostella but was highest in the fourth-instar larvae; furthermore, the relatively high expression was observed in the midgut of the fourth-instar larvae, followed by fat bodies and epidermis. The expression of CYP321E1 in P. xylostella was differentially affected by three representative insecticides, including alphamethrin, abamectin and chlorantraniliprole. Among them, the exposure to chlorantraniliprole resulted in the largest transcript level of this cytochrome P450 gene. The findings suggested potential involvement of CYP321E1 in chlorantraniliprole resistance of P. xylostella. To assess the functional link of CYP321E1 to chlorantraniliprole resistance, RNA interference (RNAi)-mediated gene silencing by double stranded RNA (dsRNA) injecting was used. Results revealed that injection delivery of dsRNA can greatly reduce gene expression after 24 h. As a consequence of RNAi, a significant increment in mortality of larvae injected CYP321E1 dsRNA was observed after 24 h of exposure to chlorantraniliprole. These results strongly support our notion that this novel cytochrome P450 gene plays an important role in chlorantraniliprole detoxification in the diamondback moth and is partly responsible for its resistance.
He, Xin; Chen, Xinxin; Zhang, Xue; Duan, Xiaobing; Pan, Ting; Hu, Qifei; Zhang, Yijun; Zhong, Fudi; Liu, Jun; Zhang, Hong; Luo, Juan; Wu, Kang; Peng, Gao; Luo, Haihua; Zhang, Lehong; Li, Xiaoxi; Zhang, Hui
2015-01-01
PIWI-interacting RNA (piRNA) silences the transposons in germlines or induces epigenetic modifications in the invertebrates. However, its function in the mammalian somatic cells remains unknown. Here we demonstrate that a piRNA derived from Growth Arrest Specific 5, a tumor-suppressive long non-coding RNA, potently upregulates the transcription of tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL), a proapoptotic protein, by inducing H3K4 methylation/H3K27 demethylation. Interestingly, the PIWIL1/4 proteins, which bind with this piRNA, directly interact with WDR5, resulting in a site-specific recruitment of the hCOMPASS-like complexes containing at least MLL3 and UTX (KDM6A). We have indicated a novel pathway for piRNAs to specially activate gene expression. Given that MLL3 or UTX are frequently mutated in various tumors, the piRNA/MLL3/UTX complex mediates the induction of TRAIL, and consequently leads to the inhibition of tumor growth. PMID:25779046
Massingham, Lauren J; Johnson, Kirby L; Scholl, Thomas M; Slonim, Donna K; Wick, Heather C; Bianchi, Diana W
2014-09-01
Turner syndrome is a sex chromosome aneuploidy with characteristic malformations. Amniotic fluid, a complex biological material, could contribute to the understanding of Turner syndrome pathogenesis. In this pilot study, global gene expression analysis of cell-free RNA in amniotic fluid supernatant was utilized to identify specific genes/organ systems that may play a role in Turner syndrome pathophysiology. Cell-free RNA from amniotic fluid of five mid-trimester Turner syndrome fetuses and five euploid female fetuses matched for gestational age was extracted, amplified, and hybridized onto Affymetrix(®) U133 Plus 2.0 arrays. Significantly differentially regulated genes were identified using paired t tests. Biological interpretation was performed using Ingenuity Pathway Analysis and BioGPS gene expression atlas. There were 470 statistically significantly differentially expressed genes identified. They were widely distributed across the genome. XIST was significantly down-regulated (p < 0.0001); SHOX was not differentially expressed. One of the most highly represented organ systems was the hematologic/immune system, distinguishing the Turner syndrome transcriptome from other aneuploidies we previously studied. Manual curation of the differentially expressed gene list identified genes of possible pathologic significance, including NFATC3, IGFBP5, and LDLR. Transcriptomic differences in the amniotic fluid of Turner syndrome fetuses are due to genome-wide dysregulation. The hematologic/immune system differences may play a role in early-onset autoimmune dysfunction. Other genes identified with possible pathologic significance are associated with cardiac and skeletal systems, which are known to be affected in females with Turner syndrome. The discovery-driven approach described here may be useful in elucidating novel mechanisms of disease in Turner syndrome.
Mod5 protein binds to tRNA gene complexes and affects local transcriptional silencing
Pratt-Hyatt, Matthew; Pai, Dave A.; Haeusler, Rebecca A.; Wozniak, Glenn G.; Good, Paul D.; Miller, Erin L.; McLeod, Ian X.; Yates, John R.; Hopper, Anita K.; Engelke, David R.
2013-01-01
The tRNA gene-mediated (tgm) silencing of RNA polymerase II promoters is dependent on subnuclear clustering of the tRNA genes, but genetic analysis shows that the silencing requires additional mechanisms. We have identified proteins that bind tRNA gene transcription complexes and are required for tgm silencing but not required for gene clustering. One of the proteins, Mod5, is a tRNA modifying enzyme that adds an N6-isopentenyl adenosine modification at position 37 on a small number of tRNAs in the cytoplasm, although a subpopulation of Mod5 is also found in the nucleus. Recent publications have also shown that Mod5 has tumor suppressor characteristics in humans as well as confers drug resistance through prion-like misfolding in yeast. Here, we show that a subpopulation of Mod5 associates with tRNA gene complexes in the nucleolus. This association occurs and is required for tgm silencing regardless of whether the pre-tRNA transcripts are substrates for Mod5 modification. In addition, Mod5 is bound to nuclear pre-tRNA transcripts, although they are not substrates for the A37 modification. Lastly, we show that truncation of the tRNA transcript to remove the normal tRNA structure also alleviates silencing, suggesting that synthesis of intact pre-tRNAs is required for the silencing mechanism. These results are discussed in light of recent results showing that silencing near tRNA genes also requires chromatin modification. PMID:23898186
Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago
2016-12-01
Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
Zhang, Jun; Wang, Yan; Fu, Lin; Feng, Yu-Jie; Ji, Yan-Li; Wang, Hua; Xu, De-Xiang
2018-07-01
Cadmium (Cd) is a persistent environmental and occupational contaminant that accumulates in humans and shows adverse effects on health. Accumulating evidence reveals that environmental Cd exposure is associated with hepatic lipid accumulation and metabolic alterations in adult male mice. However, whether Cd exposure induces hepatic lipid accumulation and metabolic alterations in female mice remains poorly understood. In the present study, we aimed to investigate the effects of Cd exposure on insulin resistance, hepatic lipid accumulation and associated metabolic pathways. Female CD1 mice were administrated with CdCl 2 (10 and 100 mg l -1 ) by drinking water. We found that Cd exposure did not induce obesity, insulin resistance and hepatic lipid accumulation. By contrary, mice in the Cd-100 mg l -1 group presented a significant reduction of the glucose area under the curve during the glucose tolerance test. However, there was a significant elevation in the mRNA level of Fasn and Scd-1, which were critical genes during hepatic fatty acid synthesis. Moreover, hepatic Fabp1 and Fabp4, two genes for hepatic fatty acid uptake were upregulated in Cd-treated mice. Of interest, Lpl, a key gene for hepatic lipoprotein lysis, was also upregulated in Cd-treated mice. Collectively, our results suggest that Cd exposure upregulated mRNA level of genes related to hepatic lipid metabolism although there was no insulin resistance and hepatic lipid accumulation shown in the present study. Copyright © 2018 John Wiley & Sons, Ltd.
Schertzer, Michael; Jouravleva, Karina; Perderiset, Mylene; Dingli, Florent; Loew, Damarys; Le Guen, Tangui; Bardoni, Barbara; de Villartay, Jean-Pierre; Revy, Patrick; Londoño-Vallejo, Arturo
2015-01-01
Hoyeraal-Hreidarsson syndrome (HHS) is a severe form of Dyskeratosis congenita characterized by developmental defects, bone marrow failure and immunodeficiency and has been associated with telomere dysfunction. Recently, mutations in Regulator of Telomere ELongation helicase 1 (RTEL1), a helicase first identified in Mus musculus as being responsible for the maintenance of long telomeres, have been identified in several HHS patients. Here we show that RTEL1 is required for the export and the correct cytoplasmic trafficking of the small nuclear (sn) RNA pre-U2, a component of the major spliceosome complex. RTEL1-HHS cells show abnormal subcellular partitioning of pre-U2, defects in the recycling of ribonucleotide proteins (RNP) in the cytoplasm and splicing defects. While most of these phenotypes can be suppressed by re-expressing the wild-type protein in RTEL1-HHS cells, expression of RTEL1 mutated variants in immortalized cells provokes cytoplasmic mislocalizations of pre-U2 and other RNP components, as well as splicing defects, thus phenocopying RTEL1-HHS cellular defects. Strikingly, expression of a cytoplasmic form of RTEL1 is sufficient to correct RNP mislocalizations both in RTEL1–HHS cells and in cells expressing nuclear mutated forms of RTEL1. This work unravels completely unanticipated roles for RTEL1 in RNP trafficking and strongly suggests that defects in RNP biogenesis pathways contribute to the pathology of HHS. PMID:25628358
Schertzer, Michael; Jouravleva, Karina; Perderiset, Mylene; Dingli, Florent; Loew, Damarys; Le Guen, Tangui; Bardoni, Barbara; de Villartay, Jean-Pierre; Revy, Patrick; Londoño-Vallejo, Arturo
2015-02-18
Hoyeraal-Hreidarsson syndrome (HHS) is a severe form of Dyskeratosis congenita characterized by developmental defects, bone marrow failure and immunodeficiency and has been associated with telomere dysfunction. Recently, mutations in Regulator of Telomere ELongation helicase 1 (RTEL1), a helicase first identified in Mus musculus as being responsible for the maintenance of long telomeres, have been identified in several HHS patients. Here we show that RTEL1 is required for the export and the correct cytoplasmic trafficking of the small nuclear (sn) RNA pre-U2, a component of the major spliceosome complex. RTEL1-HHS cells show abnormal subcellular partitioning of pre-U2, defects in the recycling of ribonucleotide proteins (RNP) in the cytoplasm and splicing defects. While most of these phenotypes can be suppressed by re-expressing the wild-type protein in RTEL1-HHS cells, expression of RTEL1 mutated variants in immortalized cells provokes cytoplasmic mislocalizations of pre-U2 and other RNP components, as well as splicing defects, thus phenocopying RTEL1-HHS cellular defects. Strikingly, expression of a cytoplasmic form of RTEL1 is sufficient to correct RNP mislocalizations both in RTEL1-HHS cells and in cells expressing nuclear mutated forms of RTEL1. This work unravels completely unanticipated roles for RTEL1 in RNP trafficking and strongly suggests that defects in RNP biogenesis pathways contribute to the pathology of HHS. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?
Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T
2018-03-15
The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA
Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard
2013-01-01
Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863
RNA-Seq workflow: gene-level exploratory analysis and differential expression
Love, Michael I.; Anders, Simon; Kim, Vladislav; Huber, Wolfgang
2015-01-01
Here we walk through an end-to-end gene-level RNA-Seq differential expression workflow using Bioconductor packages. We will start from the FASTQ files, show how these were aligned to the reference genome, and prepare a count matrix which tallies the number of RNA-seq reads/fragments within each gene for each sample. We will perform exploratory data analysis (EDA) for quality assessment and to explore the relationship between samples, perform differential gene expression analysis, and visually explore the results. PMID:26674615
Wang, F J; Jin, L; Guo, Y Q; Liu, R; He, M N; Li, M Z; Li, X W
2014-11-27
Muscle growth and development is associated with remarkable changes in protein-coding and microRNA (miRNA) gene expression. To determine the expression patterns of genes and miRNAs related to muscle growth and development, we measured the expression levels of 25 protein-coding and 16 miRNA genes in skeletal and cardiac muscles throughout 5 developmental stages by quantitative reverse transcription-polymerase chain reaction. The Short Time-Series Expression Miner (STEM) software clustering results showed that growth-related genes were downregulated at all developmental stages in both the psoas major and longissimus dorsi muscles, indicating their involvement in early developmental stages. Furthermore, genes related to muscle atrophy, such as forkhead box 1 and muscle ring finger, showed unregulated expression with increasing age, suggesting a decrease in protein synthesis during the later stages of skeletal muscle development. We found that development of the cardiac muscle was a complex process in which growth-related genes were highly expressed during embryonic development, but they did not show uniform postnatal expression patterns. Moreover, the expression level of miR-499, which enhances the expression of the β-myosin heavy chain, was significantly different in the psoas major and longissimus dorsi muscles, suggesting the involvement of miR-499 in the determination of skeletal muscle fiber types. We also performed correlation analyses of messenger RNA and miRNA expression. We found negative relationships between miR-486 and forkhead box 1, and miR-133a and serum response factor at all developmental stages, suggesting that forkhead box 1 and serum response factor are potential targets of miR-486 and miR-133a, respectively.
Xing, Zhiguo; Ni, Yaping; Zhao, Junjie; Ma, Xudong
2017-05-01
Glioblastoma multiforme is a type of central nervous system tumor with extremely poor prognosis. Previously, hydrogen peroxide (H 2 O 2 ), which promotes the oxidative stress response, has been reported to induce the apoptosis of glioma cells. Recently, secreted frizzled-related protein 1 (SFRP1) has been shown to be associated with various types of malignant tumors and with H 2 O 2 -induced oxidative stress in cardiomyocytes by negatively regulating the Wnt signaling pathway. This study aimed to explore SFRP1 expression and its roles in H 2 O 2 -induced apoptosis in human glioma cells. We found that the SFRP1 level was decreased in several human glioma cell lines, including U87, U251, and SW1783 cells. In U251 cells, SFRP1 could function as a cancer suppressor gene, and the growth of U251 cells could be inhibited not only by H 2 O 2 but also by the overexpression of SFRP1. Furthermore, we demonstrated that H 2 O 2 -induced SFRP1 gene demethylation partially contributed to H 2 O 2 -induced U251 cell apoptosis, which was verified by studies using an SFRP inhibitor (WAY-316606). Our research identified that H 2 O 2 -induced SFRP1 gene demethylation contributes to H 2 O 2 -induced apoptosis in human U251 glioma cells.
Prasad, Kasavajhala V. S. K.; Abdel-Hameed, Amira A. E.; Xing, Denghui; Reddy, Anireddy S. N.
2016-01-01
Abiotic and biotic stresses cause significant yield losses in all crops. Acquisition of stress tolerance in plants requires rapid reprogramming of gene expression. SR1/CAMTA3, a member of signal responsive transcription factors (TFs), functions both as a positive and a negative regulator of biotic stress responses and as a positive regulator of cold stress-induced gene expression. Using high throughput RNA-seq, we identified ~3000 SR1-regulated genes. Promoters of about 60% of the differentially expressed genes have a known DNA binding site for SR1, suggesting that they are likely direct targets. Gene ontology analysis of SR1-regulated genes confirmed previously known functions of SR1 and uncovered a potential role for this TF in salt stress. Our results showed that SR1 mutant is more tolerant to salt stress than the wild type and complemented line. Improved tolerance of sr1 seedlings to salt is accompanied with the induction of salt-responsive genes. Furthermore, ChIP-PCR results showed that SR1 binds to promoters of several salt-responsive genes. These results suggest that SR1 acts as a negative regulator of salt tolerance by directly repressing the expression of salt-responsive genes. Overall, this study identified SR1-regulated genes globally and uncovered a previously uncharacterized role for SR1 in salt stress response. PMID:27251464
The architecture of the spliceosomal U4/U6.U5 tri-snRNP
Nguyen, Thi Hoang Duong; Galej, Wojciech P.; Bai, Xiao-chen; Savva, Christos G.; Newman, Andrew J.; Scheres, Sjors H. W.; Nagai, Kiyoshi
2015-01-01
U4/U6.U5 tri-snRNP is a 1.5 MDa pre-assembled spliceosomal complex comprising U5 snRNA, extensively base-paired U4/U6 snRNAs and >30 proteins, including the key components Prp8, Brr2 and Snu114. The tri-snRNP combines with a pre-mRNA substrate bound to U1 and U2 snRNPs and transforms into a catalytically active spliceosome following extensive compositional and conformational changes triggered by unwinding of the U4/U6 snRNAs. CryoEM single-particle reconstruction of yeast tri-snRNP at 5.9Å resolution reveals the essentially complete organization of its RNA and protein components. The single-stranded region of U4 snRNA between its 3′-stem-loop and the U4/U6 snRNA stem I is loaded into the Brr2 helicase active site ready for unwinding. Snu114 and the N-terminal domain of Prp8 position U5 snRNA to insert its Loop I, which aligns the exons for splicing, into the Prp8 active site cavity. The structure provides crucial insights into the activation process and the active site of the spliceosome. PMID:26106855
A human haploid gene trap collection to study lncRNAs with unusual RNA biology.
Kornienko, Aleksandra E; Vlatkovic, Irena; Neesen, Jürgen; Barlow, Denise P; Pauler, Florian M
2016-01-01
Many thousand long non-coding (lnc) RNAs are mapped in the human genome. Time consuming studies using reverse genetic approaches by post-transcriptional knock-down or genetic modification of the locus demonstrated diverse biological functions for a few of these transcripts. The Human Gene Trap Mutant Collection in haploid KBM7 cells is a ready-to-use tool for studying protein-coding gene function. As lncRNAs show remarkable differences in RNA biology compared to protein-coding genes, it is unclear if this gene trap collection is useful for functional analysis of lncRNAs. Here we use the uncharacterized LOC100288798 lncRNA as a model to answer this question. Using public RNA-seq data we show that LOC100288798 is ubiquitously expressed, but inefficiently spliced. The minor spliced LOC100288798 isoforms are exported to the cytoplasm, whereas the major unspliced isoform is nuclear localized. This shows that LOC100288798 RNA biology differs markedly from typical mRNAs. De novo assembly from RNA-seq data suggests that LOC100288798 extends 289kb beyond its annotated 3' end and overlaps the downstream SLC38A4 gene. Three cell lines with independent gene trap insertions in LOC100288798 were available from the KBM7 gene trap collection. RT-qPCR and RNA-seq confirmed successful lncRNA truncation and its extended length. Expression analysis from RNA-seq data shows significant deregulation of 41 protein-coding genes upon LOC100288798 truncation. Our data shows that gene trap collections in human haploid cell lines are useful tools to study lncRNAs, and identifies the previously uncharacterized LOC100288798 as a potential gene regulator.
Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan
2015-04-01
Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. © 2015 IUMS.
RNA interference can be used to disrupt gene function in tardigrades
Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob
2012-01-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800
King, Isabelle N.; Yartseva, Valeria; Salas, Donaldo; Kumar, Abhishek; Heidersbach, Amy; Ando, D. Michael; Stallings, Nancy R.; Elliott, Jeffrey L.; Srivastava, Deepak; Ivey, Kathryn N.
2014-01-01
MicroRNA (miRNA) maturation is regulated by interaction of particular miRNA precursors with specific RNA-binding proteins. Following their biogenesis, mature miRNAs are incorporated into the RNA-induced silencing complex (RISC) where they interact with mRNAs to negatively regulate protein production. However, little is known about how mature miRNAs are regulated at the level of their activity. To address this, we screened for proteins differentially bound to the mature form of the miR-1 or miR-133 miRNA families. These muscle-enriched, co-transcribed miRNA pairs cooperate to suppress smooth muscle gene expression in the heart. However, they also have opposing roles, with the miR-1 family, composed of miR-1 and miR-206, promoting myogenic differentiation, whereas miR-133 maintains the progenitor state. Here, we describe a physical interaction between TDP-43, an RNA-binding protein that forms aggregates in the neuromuscular disease, amyotrophic lateral sclerosis, and the miR-1, but not miR-133, family. Deficiency of the TDP-43 Drosophila ortholog enhanced dmiR-1 activity in vivo. In mammalian cells, TDP-43 limited the activity of both miR-1 and miR-206, but not the miR-133 family, by disrupting their RISC association. Consistent with TDP-43 dampening miR-1/206 activity, protein levels of the miR-1/206 targets, IGF-1 and HDAC4, were elevated in TDP-43 transgenic mouse muscle. This occurred without corresponding Igf-1 or Hdac4 mRNA increases and despite higher miR-1 and miR-206 expression. Our findings reveal that TDP-43 negatively regulates the activity of the miR-1 family of miRNAs by limiting their bioavailability for RISC loading and suggest a processing-independent mechanism for differential regulation of miRNA activity. PMID:24719334
Epigenetic regulation of TTF-I-mediated promoter–terminator interactions of rRNA genes
Németh, Attila; Guibert, Sylvain; Tiwari, Vijay Kumar; Ohlsson, Rolf; Längst, Gernot
2008-01-01
Ribosomal RNA synthesis is the eukaryotic cell's main transcriptional activity, but little is known about the chromatin domain organization and epigenetics of actively transcribed rRNA genes. Here, we show epigenetic and spatial organization of mouse rRNA genes at the molecular level. TTF-I-binding sites subdivide the rRNA transcription unit into functional chromatin domains and sharply delimit transcription factor occupancy. H2A.Z-containing nucleosomes occupy the spacer promoter next to a newly characterized TTF-I-binding site. The spacer and the promoter proximal TTF-I-binding sites demarcate the enhancer. DNA from both the enhancer and the coding region is hypomethylated in actively transcribed repeats. 3C analysis revealed an interaction between promoter and terminator regions, which brings the beginning and end of active rRNA genes into close contact. Reporter assays show that TTF-I mediates this interaction, thereby linking topology and epigenetic regulation of the rRNA genes. PMID:18354495
Independent suppression of ribosomal +1 frameshifts by different tRNA anticodon loop modifications.
Klassen, Roland; Bruch, Alexander; Schaffrath, Raffael
2017-09-02
Recently, a role for the anticodon wobble uridine modification 5-methoxycarbonylmethyl-2-thiouridine (mcm 5 s 2 U) has been revealed in the suppression of translational +1 frameshifts in Saccharomyces cerevisiae. Loss of either the mcm 5 U or s 2 U parts of the modification elevated +1 frameshift rates and results obtained with reporters involving a tRNA Lys UUU dependent frameshift site suggested these effects are caused by reduced ribosomal A-site binding of the hypomodified tRNA. Combined loss of mcm 5 U and s 2 U leads to increased ribosome pausing at tRNA Lys UUU dependent codons and synergistic growth defects but effects on +1 frameshift rates remained undefined to this end. We show in here that simultaneous removal of mcm 5 U and s 2 U results in synergistically increased +1 frameshift rates that are suppressible by extra copies of tRNA Lys UUU . Thus, two distinct chemical modifications of the same wobble base independently contribute to reading frame maintenance, loss of which may cause or contribute to observed growth defects. Since the thiolation pathway is sensitive to moderately elevated temperatures in yeast, we observe a heat-induced increase of +1 frameshift rates in wild type cells that depends on the sulfur transfer protein Urm1. Furthermore, we find that temperature-induced frameshifting is kept in check by the dehydration of N6-threonylcarbamoyladenosine (t 6 A) to its cyclic derivative (ct 6 A) at the anticodon adjacent position 37. Since loss of ct 6 A in elp3 or urm1 mutant cells is detrimental for temperature stress resistance we assume that conversion of t 6 A to ct 6 A serves to limit deleterious effects on translational fidelity caused by hypomodified states of wobble uridine bases.
Côté, Guillaume; Perry, Guy; Blier, Pierre; Bernatchez, Louis
2007-01-01
Background Quantitative reaction norm theory proposes that genotype-by-environment interaction (GxE) results from inter-individual differences of expression in adaptive suites of genes in distinct environments. However, environmental norms for actual gene suites are poorly documented. In this study, we investigated the effects of GxE interactions on levels of gene transcription and growth by documenting the impact of rearing environment (freshwater vs. saltwater), sex and genotypic (low vs. high estimated breeding value EBV) effects on the transcription level of insulin-like growth factor (IGF-1) and growth hormone receptor (GHR) in brook charr (Salvelinus fontinalis). Results Males grew faster than females (μ♀ = 1.20 ± 0.07 g·d-1, μ♂ = 1.46 ± 0.06 g·d-1) and high-EBV fish faster than low-EBV fish (μLOW = 0.97 ± 0.05 g·d-1, μHIGH = 1.58 ± 0.07 g·d-1; p < 0.05). However, growth was markedly lower in saltwater-reared fish than freshwater sibs (μFW = 1.52 ± 0.07 g·d-1, μSW = 1.15 ± 0.06 g·d-1), yet GHR mRNA transcription level was significantly higher in saltwater than in freshwater (μSW = 0.85 ± 0.05, μFW = 0.61 ± 0.05). The ratio of actual growth to units in assayed mRNA ('individual transcript efficiency', iTE; g·d-1·u-1) also differed among EBV groups (μLOW = 2.0 ± 0.24 g·d-1·u-1; μHIGH = 3.7 ± 0.24 g·d-1·u-1) and environments (μSW = 2.0 ± 0.25 g·d-1·u-1; μFW = 3.7 ± 0.25 g·d-1·u-1) for GHR. Males had a lower iTE for GHR than females (μ♂ = 2.4 ± 0.29 g·d-1·u-1; μ♀ = 3.1 ± 0.23 g·d-1·u-1). There was no difference in IGF-1 transcription level between environments (p > 0.7) or EBV groups (p > 0.15) but the level of IGF-1 was four times higher in males than females (μ♂ = 2.4 ± 0.11, μ♀ = 0.58 ± 0.09; p < 0.0001). We detected significant sexual differences in iTE (μ♂ = 1.3 ± 0.59 g·d-1·u-1; μ♀ = 3.9 ± 0.47 g·d-1·u-1), salinities (μSW = 2.3 ± 0.52 g·d-1·u-1; μFW = 3.7 ± 0.53 g·d-1·u-1
Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang
2018-01-01
Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .
Do, Duy N.; Dudemaine, Pier-Luc; Fomenky, Bridget E.
2018-01-01
A better understanding of the factors that regulate growth and immune response of the gastrointestinal tract (GIT) of calves will promote informed management practices in calf rearing. This study aimed to explore genomics (messenger RNA (mRNA)) and epigenomics (long non-coding RNA (lncRNA)) mechanisms regulating the development of the rumen and ileum in calves. Thirty-two calves (≈5-days-old) were reared for 96 days following standard procedures. Sixteen calves were humanely euthanized on experiment day 33 (D33) (pre-weaning) and another 16 on D96 (post-weaning) for collection of ileum and rumen tissues. RNA from tissues was subjected to next generation sequencing and 3310 and 4217 mRNAs were differentially expressed (DE) between D33 and D96 in ileum and rumen tissues, respectively. Gene ontology and pathways enrichment of DE genes confirmed their roles in developmental processes, immunity and lipid metabolism. A total of 1568 (63 known and 1505 novel) and 4243 (88 known and 4155 novel) lncRNAs were detected in ileum and rumen tissues, respectively. Cis target gene analysis identified BMPR1A, an important gene for a GIT disease (juvenile polyposis syndrome) in humans, as a candidate cis target gene for lncRNAs in both tissues. LncRNA cis target gene enrichment suggested that lncRNAs might regulate growth and development in both tissues as well as posttranscriptional gene silencing by RNA or microRNA processing in rumen, or disease resistance mechanisms in ileum. This study provides a catalog of bovine lncRNAs and set a baseline for exploring their functions in calf GIT development. PMID:29510583
Ibeagha-Awemu, Eveline M; Do, Duy N; Dudemaine, Pier-Luc; Fomenky, Bridget E; Bissonnette, Nathalie
2018-03-05
A better understanding of the factors that regulate growth and immune response of the gastrointestinal tract (GIT) of calves will promote informed management practices in calf rearing. This study aimed to explore genomics (messenger RNA (mRNA)) and epigenomics (long non-coding RNA (lncRNA)) mechanisms regulating the development of the rumen and ileum in calves. Thirty-two calves (≈5-days-old) were reared for 96 days following standard procedures. Sixteen calves were humanely euthanized on experiment day 33 (D33) (pre-weaning) and another 16 on D96 (post-weaning) for collection of ileum and rumen tissues. RNA from tissues was subjected to next generation sequencing and 3310 and 4217 mRNAs were differentially expressed (DE) between D33 and D96 in ileum and rumen tissues, respectively. Gene ontology and pathways enrichment of DE genes confirmed their roles in developmental processes, immunity and lipid metabolism. A total of 1568 (63 known and 1505 novel) and 4243 (88 known and 4155 novel) lncRNAs were detected in ileum and rumen tissues, respectively. Cis target gene analysis identified BMPR1A , an important gene for a GIT disease (juvenile polyposis syndrome) in humans, as a candidate cis target gene for lncRNAs in both tissues. LncRNA cis target gene enrichment suggested that lncRNAs might regulate growth and development in both tissues as well as posttranscriptional gene silencing by RNA or microRNA processing in rumen, or disease resistance mechanisms in ileum. This study provides a catalog of bovine lncRNAs and set a baseline for exploring their functions in calf GIT development.
The 7SK snRNP associates with the little elongation complex to promote snRNA gene expression.
Egloff, Sylvain; Vitali, Patrice; Tellier, Michael; Raffel, Raoul; Murphy, Shona; Kiss, Tamás
2017-04-03
The 7SK small nuclear RNP (snRNP), composed of the 7SK small nuclear RNA (snRNA), MePCE, and Larp7, regulates the mRNA elongation capacity of RNA polymerase II (RNAPII) through controlling the nuclear activity of positive transcription elongation factor b (P-TEFb). Here, we demonstrate that the human 7SK snRNP also functions as a canonical transcription factor that, in collaboration with the little elongation complex (LEC) comprising ELL, Ice1, Ice2, and ZC3H8, promotes transcription of RNAPII-specific spliceosomal snRNA and small nucleolar RNA (snoRNA) genes. The 7SK snRNA specifically associates with a fraction of RNAPII hyperphosphorylated at Ser5 and Ser7, which is a hallmark of RNAPII engaged in snRNA synthesis. Chromatin immunoprecipitation (ChIP) and chromatin isolation by RNA purification (ChIRP) experiments revealed enrichments for all components of the 7SK snRNP on RNAPII-specific sn/snoRNA genes. Depletion of 7SK snRNA or Larp7 disrupts LEC integrity, inhibits RNAPII recruitment to RNAPII-specific sn/snoRNA genes, and reduces nascent snRNA and snoRNA synthesis. Thus, through controlling both mRNA elongation and sn/snoRNA synthesis, the 7SK snRNP is a key regulator of nuclear RNA production by RNAPII. © 2017 The Authors.
Gene and miRNA expression profiles in autism spectrum disorders.
Ghahramani Seno, Mohammad M; Hu, Pingzhao; Gwadry, Fuad G; Pinto, Dalila; Marshall, Christian R; Casallo, Guillermo; Scherer, Stephen W
2011-03-22
Accumulating data indicate that there is significant genetic heterogeneity underlying the etiology in individuals diagnosed with autism spectrum disorder (ASD). Some rare and highly-penetrant gene variants and copy number variation (CNV) regions including NLGN3, NLGN4, NRXN1, SHANK2, SHANK3, PTCHD1, 1q21.1, maternally-inherited duplication of 15q11-q13, 16p11.2, amongst others, have been identified to be involved in ASD. Genome-wide association studies have identified other apparently low risk loci and in some other cases, ASD arises as a co-morbid phenotype with other medical genetic conditions (e.g. fragile X). The progress studying the genetics of ASD has largely been accomplished using genomic analyses of germline-derived DNA. Here, we used gene and miRNA expression profiling using cell-line derived total RNA to evaluate possible transcripts and networks of molecules involved in ASD. Our analysis identified several novel dysregulated genes and miRNAs in ASD compared with controls, including HEY1, SOX9, miR-486 and miR-181b. All of these are involved in nervous system development and function and some others, for example, are involved in NOTCH signaling networks (e.g. HEY1). Further, we found significant enrichment in molecules associated with neurological disorders such as Rett syndrome and those associated with nervous system development and function including long-term potentiation. Our data will provide a valuable resource for discovery purposes and for comparison to other gene expression-based, genome-wide DNA studies and other functional data. Copyright © 2010 Elsevier B.V. All rights reserved.
Bongianino, Rossana; Denegri, Marco; Mazzanti, Andrea; Lodola, Francesco; Vollero, Alessandra; Boncompagni, Simona; Fasciano, Silvia; Rizzo, Giulia; Mangione, Damiano; Barbaro, Serena; Di Fonso, Alessia; Napolitano, Carlo; Auricchio, Alberto; Protasi, Feliciano; Priori, Silvia G
2017-08-18
Mutations in the cardiac Ryanodine Receptor gene ( RYR2 ) cause dominant catecholaminergic polymorphic ventricular tachycardia (CPVT), a leading cause of sudden death in apparently healthy individuals exposed to emotions or physical exercise. We investigated the efficacy of allele-specific silencing by RNA interference to prevent CPVT phenotypic manifestations in our dominant CPVT mice model carriers of the heterozygous mutation R4496C in RYR2 . We developed an in vitro mRNA and protein-based assays to screen multiple siRNAs for their ability to selectively silence mutant RYR2 -R4496C mRNA over the corresponding wild-type allele. For the most performant of these siRNAs (siRYR2-U10), we evaluated the efficacy of an adeno-associated serotype 9 viral vector (AAV9) expressing miRYR2-U10 in correcting RyR2 (Ryanodine Receptor type 2 protein) function after in vivo delivery by intraperitoneal injection in neonatal and adult RyR2 R4496C/+ (mice heterozygous for the R4496C mutation in the RyR2) heterozygous CPVT mice. Transcriptional analysis showed that after treatment with miRYR2-U10, the ratio between wild-type and mutant RYR2 mRNA was doubled (from 1:1 to 2:1) confirming the ability of miRYR2-U10 to selectively inhibit RYR2 -R4496C mRNA, whereas protein quantification showed that total RyR2 was reduced by 15% in the heart of treated mice. Furthermore, AAV9-miRYR2-U10 effectively (1) reduced isoproterenol-induced delayed afterdepolarizations and triggered activity in infected cells, (2) reduced adrenergically mediated ventricular tachycardia in treated mice, (3) reverted ultrastructural abnormalities of junctional sarcoplasmic reticulum and transverse tubules, and (4) attenuated mitochondrial abnormalities. The study demonstrates that allele-specific silencing with miRYR2-U10 prevents life-threatening arrhythmias in CPVT mice, suggesting that the reduction of mutant RyR2 may be a novel therapeutic approach for CPVT. © 2017 American Heart Association, Inc.
Regulatory BC1 RNA in cognitive control.
Iacoangeli, Anna; Dosunmu, Aderemi; Eom, Taesun; Stefanov, Dimitre G; Tiedge, Henri
2017-07-01
Dendritic regulatory BC1 RNA is a non-protein-coding (npc) RNA that operates in the translational control of gene expression. The absence of BC1 RNA in BC1 knockout (KO) animals causes translational dysregulation that entails neuronal phenotypic alterations including prolonged epileptiform discharges, audiogenic seizure activity in vivo, and excessive cortical oscillations in the γ frequency band. Here we asked whether BC1 RNA control is also required for higher brain functions such as learning, memory, or cognition. To address this question, we used odor/object attentional set shifting tasks in which prefrontal cortical performance was assessed in a series of discrimination and conflict learning sessions. Results obtained in these behavioral trials indicate that BC1 KO animals were significantly impaired in their cognitive flexibility. When faced with conflicting information sources, BC1 KO animals committed regressive errors as they were compromised in their ability to disengage from recently acquired memories even though recall of such memories was in conflict with new situational context. The observed cognitive deficits are reminiscent of those previously described in subtypes of human autism spectrum disorders. © 2017 Iacoangeli et al.; Published by Cold Spring Harbor Laboratory Press.
A Single Multiplex crRNA Array for FnCpf1-Mediated Human Genome Editing.
Sun, Huihui; Li, Fanfan; Liu, Jie; Yang, Fayu; Zeng, Zhenhai; Lv, Xiujuan; Tu, Mengjun; Liu, Yeqing; Ge, Xianglian; Liu, Changbao; Zhao, Junzhao; Zhang, Zongduan; Qu, Jia; Song, Zongming; Gu, Feng
2018-06-15
Cpf1 has been harnessed as a tool for genome manipulation in various species because of its simplicity and high efficiency. Our recent study demonstrated that FnCpf1 could be utilized for human genome editing with notable advantages for target sequence selection due to the flexibility of the protospacer adjacent motif (PAM) sequence. Multiplex genome editing provides a powerful tool for targeting members of multigene families, dissecting gene networks, modeling multigenic disorders in vivo, and applying gene therapy. However, there are no reports at present that show FnCpf1-mediated multiplex genome editing via a single customized CRISPR RNA (crRNA) array. In the present study, we utilize a single customized crRNA array to simultaneously target multiple genes in human cells. In addition, we also demonstrate that a single customized crRNA array to target multiple sites in one gene could be achieved. Collectively, FnCpf1, a powerful genome-editing tool for multiple genomic targets, can be harnessed for effective manipulation of the human genome. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Browne, Sarah K; Roesser, James R; Zhu, Sheng Zu; Ginder, Gordon D
2006-12-15
IFNs regulate most MHC class I genes by stimulating transcription initiation. As shown previously, IFN-gamma controls HLA-A expression primarily at the posttranscriptional level. We have defined two 8-base sequences in a 39-nucleotide region in the 3'-transcribed region of the HLA-A gene that are required for the posttranscriptional response to IFN-gamma. Stimulation of HLA-A expression by IFN-gamma requires nuclear export of HLA-A mRNA by chromosome maintenance region 1 (CRM-1). Treatment of cells with leptomycin B, a specific inhibitor of CRM-1, completely inhibited IFN-gamma induction of HLA-A. Expression of a truncated, dominant-negative form of the nucleoporin NUP214/CAN, DeltaCAN, that specifically interacts with CRM-1, also prevented IFN-gamma stimulation of HLA-A, providing confirmation of the role of CRM-1. Increased expression of HLA-A induced by IFN-gamma also requires protein methylation, as shown by the fact that treatment of SK-N-MC cells or HeLa cells with the PRMT1 inhibitor 5'-methyl-5'-thioadenosine abolished the cellular response to IFN-gamma. In contrast with HLA-A, IFN-gamma-induced expression of the HLA class Ib gene, HLA-E, was not affected by either 5'-methyl-5'-thioadenosine or leptomycin B. These results provide proof of principle that it is possible to differentially modulate the IFN-gamma-induced expression of the HLA-E and HLA-A genes, whose products often mediate opposing effects on cellular immunity to tumor cells, pathogens, and autoantigens.
Shen, W C; Selvakumar, D; Stanford, D R; Hopper, A K
1993-09-15
Mutations of the Saccharomyces cerevisiae LOS1 gene cause the accumulation of end matured intron-containing pre-tRNAs at elevated temperatures. In an effort to decipher the role of the LOS1 protein in pre-tRNA splicing, we have analyzed the LOS1 gene and its protein product. The LOS1 gene is located on the left arm of chromosome XI and the order of genes in this area of the chromosome is .... URA1 ... SAC1 TRP3 UBA1 STE6 LOS1 .... FAS1..... The LOS1 open reading frame encodes a putative protein of 1100 amino acids that shows no significant homology to other genes. The LOS1 open reading frame was tagged with the influenza virus hemagglutinin epitope recognized by the 12CA5 antibody. The 12CA5 antibody recognizes an epitope-tagged protein of the size predicted by the LOS1 open reading frame. Using this antibody for indirect immunofluorescence and cell fractionation studies we show that the LOS1 protein is located in nuclei. Los1p cannot be extracted from nuclei by treatment with nucleases, salts, or Triton X-100. This insolubility suggests that Los1p is a component of the nucleoskeleton. We propose that LOS1 mutations may affect pre-tRNA processing via alteration of the nuclear matrix.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A
2008-12-23
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.
2008-01-01
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934
Pentheroudakis, George; Kotoula, Vassiliki; Eleftheraki, Anastasia G; Tsolaki, Eleftheria; Wirtz, Ralph M; Kalogeras, Konstantine T; Batistatou, Anna; Bobos, Mattheos; Dimopoulos, Meletios A; Timotheadou, Eleni; Gogas, Helen; Christodoulou, Christos; Papadopoulou, Kyriaki; Efstratiou, Ioannis; Scopa, Chrisoula D; Papaspyrou, Irene; Vlachodimitropoulos, Dimitrios; Linardou, Helena; Samantas, Epaminontas; Pectasides, Dimitrios; Pavlidis, Nicholas; Fountzilas, George
2013-01-01
Discrepant data have been published on the incidence and prognostic significance of ESR1 gene amplification in early breast cancer. Formalin-fixed paraffin-embedded tumor blocks were collected from women with early breast cancer participating in two HeCOG adjuvant trials. Messenger RNA was studied by quantitative PCR, ER protein expression was centrally assessed using immunohistochemistry (IHC) and ESR1 gene copy number by dual fluorescent in situ hybridization probes. In a total of 1010 women with resected node-positive early breast adenocarcinoma, the tumoral ESR1/CEP6 gene ratio was suggestive of deletion in 159 (15.7%), gene gain in 551 (54.6%) and amplification in 42 cases (4.2%), with only 30 tumors (3%) harboring five or more ESR1 copies. Gene copy number ratio showed a significant, though weak correlation to mRNA and protein expression (Spearman's Rho <0.23, p = 0.01). ESR1 clusters were observed in 9.5% (57 gain, 38 amplification) of cases. In contrast to mRNA and protein expression, which were favorable prognosticators, gene copy number changes did not obtain prognostic significance. When ESR1/CEP6 gene ratio was combined with function (as defined by ER protein and mRNA expression) in a molecular classifier, the Gene Functional profile, it was functional status that impacted on prognosis. In univariate analysis, patients with functional tumors (positive ER protein expression and gene ratio normal or gain/amplification) fared better than those with non-functional tumors with ESR1 gain (HR for relapse or death 0.49-0.64, p = 0.003). Significant interactions were observed between gene gain/amplification and paclitaxel therapy (trend for DFS benefit from paclitaxel only in patients with ESR1 gain/amplification, p = 0.066) and Gene Functional profile with HER2 amplification (Gene Functional profile prognostic only in HER2-normal cases, p = 0.029). ESR1 gene deletion and amplification do not constitute per se prognostic markers, instead they can
You, Chun-Xiang; Zhao, Qiang; Wang, Xiao-Fei; Xie, Xing-Bin; Feng, Xiao-Ming; Zhao, Ling-Ling; Shu, Huai-Rui; Hao, Yu-Jin
2014-02-01
Although numerous miRNAs have been already isolated from fruit trees, knowledge about miRNA biogenesis is largely unknown in fruit trees. Double-strand RNA-binding (DRB) protein plays an important role in miRNA processing and maturation; however, its role in the regulation of economically important traits is not clear yet in fruit trees. EST blast and RACE amplification were performed to isolate apple MdDRB1 gene. Following expression analysis, RNA binding and protein interaction assays, MdDRB1 was transformed into apple callus and in vitro tissue cultures to characterize the functions of MdDRB1 in miRNA biogenesis, adventitious rooting, leaf development and tree growth habit. MdDRB1 contained two highly conserved DRB domains. Its transcripts existed in all tissues tested and are induced by hormones. It bound to double-strand RNAs and interacted with AtDCL1 (Dicer-Like 1) and MdDCL1. Chip assay indicated its role in miRNA biogenesis. Transgenic analysis showed that MdDRB1 controls adventitious rooting, leaf curvature and tree architecture by modulating the accumulation of miRNAs and the transcript levels of miRNA target genes. Our results demonstrated that MdDRB1 functions in the miRNA biogenesis in a conserved way and that it is a master regulator in the formation of economically important traits in fruit trees. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard
2012-04-01
Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
CORNAS: coverage-dependent RNA-Seq analysis of gene expression data without biological replicates.
Low, Joel Z B; Khang, Tsung Fei; Tammi, Martti T
2017-12-28
In current statistical methods for calling differentially expressed genes in RNA-Seq experiments, the assumption is that an adjusted observed gene count represents an unknown true gene count. This adjustment usually consists of a normalization step to account for heterogeneous sample library sizes, and then the resulting normalized gene counts are used as input for parametric or non-parametric differential gene expression tests. A distribution of true gene counts, each with a different probability, can result in the same observed gene count. Importantly, sequencing coverage information is currently not explicitly incorporated into any of the statistical models used for RNA-Seq analysis. We developed a fast Bayesian method which uses the sequencing coverage information determined from the concentration of an RNA sample to estimate the posterior distribution of a true gene count. Our method has better or comparable performance compared to NOISeq and GFOLD, according to the results from simulations and experiments with real unreplicated data. We incorporated a previously unused sequencing coverage parameter into a procedure for differential gene expression analysis with RNA-Seq data. Our results suggest that our method can be used to overcome analytical bottlenecks in experiments with limited number of replicates and low sequencing coverage. The method is implemented in CORNAS (Coverage-dependent RNA-Seq), and is available at https://github.com/joel-lzb/CORNAS .
Xu, Li; Zhao, Lixia; Gao, Yandi; Xu, Jing; Han, Renzhi
2017-03-17
Clustered regularly interspaced short palindromic repeat/Cas9 (CRISPR/Cas9) system has emerged in recent years as a highly efficient RNA-guided gene manipulation platform. Simultaneous editing or transcriptional activation/suppression of different genes becomes feasible with the co-delivery of multiple guide RNAs (gRNAs). Here, we report that multiple gRNAs linked with self-cleaving ribozymes and/or tRNA could be simultaneously expressed from a single U6 promoter to exert genome editing of dystrophin and myosin binding protein C3 in human and mouse cells. Moreover, this strategy allows the expression of multiple gRNAs for synergistic transcription activation of follistatin when used with catalytically inactive dCas9-VP64 or dCas9-p300core fusions. Finally, the gRNAs linked by the self-cleaving ribozymes and tRNA could be expressed from RNA polymerase type II (pol II) promoters such as generic CMV and muscle/heart-specific MHCK7. This is particularly useful for in vivo applications when the packaging capacity of recombinant adeno-associated virus is limited while tissue-specific delivery of gRNAs and Cas9 is desired. Taken together, this study provides a novel strategy to enable tissue-specific expression of more than one gRNAs for multiplex gene editing from a single pol II promoter. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Pan, Dongli; Pesola, Jean M; Li, Gang; McCarron, Seamus; Coen, Donald M
2017-01-15
Herpes simplex virus 1 (HSV-1) latency entails the repression of productive ("lytic") gene expression. An attractive hypothesis to explain some of this repression involves inhibition of the expression of ICP0, a lytic gene activator, by a viral microRNA, miR-H2, which is completely complementary to ICP0 mRNA. To test this hypothesis, we engineered mutations that disrupt miR-H2 without affecting ICP0 in HSV-1. The mutant virus exhibited drastically reduced expression of miR-H2 but showed wild-type levels of infectious virus production and no increase in ICP0 expression in lytically infected cells, which is consistent with the weak expression of miR-H2 relative to the level of ICP0 mRNA in that setting. Following corneal inoculation of mice, the mutant was not significantly different from wild-type virus in terms of infectious virus production in the trigeminal ganglia during acute infection, mouse mortality, or the rate of reactivation from explanted latently infected ganglia. Critically, the mutant was indistinguishable from wild-type virus for the expression of ICP0 and other lytic genes in acutely and latently infected mouse trigeminal ganglia. The latter result may be related to miR-H2 being less effective in inhibiting ICP0 expression in transfection assays than a host microRNA, miR-138, which has previously been shown to inhibit lytic gene expression in infected ganglia by targeting ICP0 mRNA. Additionally, transfected miR-138 reduced lytic gene expression in infected cells more effectively than miR-H2. While this study provides little support for the hypothesis that miR-H2 promotes latency by inhibiting ICP0 expression, the possibility remains that miR-H2 might target other genes during latency. Herpes simplex virus 1 (HSV-1), which causes a variety of diseases, can establish lifelong latent infections from which virus can reactivate to cause recurrent disease. Latency is the most biologically interesting and clinically vexing feature of the virus. Ever since
2012-01-01
Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798
RBM20 Regulates Circular RNA Production From the Titin Gene.
Khan, Mohsin A F; Reckman, Yolan J; Aufiero, Simona; van den Hoogenhof, Maarten M G; van der Made, Ingeborg; Beqqali, Abdelaziz; Koolbergen, Dave R; Rasmussen, Torsten B; van der Velden, Jolanda; Creemers, Esther E; Pinto, Yigal M
2016-10-14
RNA-binding motif protein 20 (RBM20) is essential for normal splicing of many cardiac genes, and loss of RBM20 causes dilated cardiomyopathy. Given its role in splicing, we hypothesized an important role for RBM20 in forming circular RNAs (circRNAs), a novel class of noncoding RNA molecules. To establish the role of RBM20 in the formation of circRNAs in the heart. Here, we performed circRNA profiling on ribosomal depleted RNA from human hearts and identified the expression of thousands of circRNAs, with some of them regulated in disease. Interestingly, we identified 80 circRNAs to be expressed from the titin gene, a gene that is known to undergo highly complex alternative splicing. We show that some of these circRNAs are dynamically regulated in dilated cardiomyopathy but not in hypertrophic cardiomyopathy. We generated RBM20-null mice and show that they completely lack these titin circRNAs. In addition, in a cardiac sample from an RBM20 mutation carrier, titin circRNA production was severely altered. Interestingly, the loss of RBM20 caused only a specific subset of titin circRNAs to be lost. These circRNAs originated from the RBM20-regulated I-band region of the titin transcript. We show that RBM20 is crucial for the formation of a subset of circRNAs that originate from the I-band of the titin gene. We propose that RBM20, by excluding specific exons from the pre-mRNA, provides the substrate to form this class of RBM20-dependent circRNAs. © 2016 American Heart Association, Inc.
King, Isabelle N; Yartseva, Valeria; Salas, Donaldo; Kumar, Abhishek; Heidersbach, Amy; Ando, D Michael; Stallings, Nancy R; Elliott, Jeffrey L; Srivastava, Deepak; Ivey, Kathryn N
2014-05-16
MicroRNA (miRNA) maturation is regulated by interaction of particular miRNA precursors with specific RNA-binding proteins. Following their biogenesis, mature miRNAs are incorporated into the RNA-induced silencing complex (RISC) where they interact with mRNAs to negatively regulate protein production. However, little is known about how mature miRNAs are regulated at the level of their activity. To address this, we screened for proteins differentially bound to the mature form of the miR-1 or miR-133 miRNA families. These muscle-enriched, co-transcribed miRNA pairs cooperate to suppress smooth muscle gene expression in the heart. However, they also have opposing roles, with the miR-1 family, composed of miR-1 and miR-206, promoting myogenic differentiation, whereas miR-133 maintains the progenitor state. Here, we describe a physical interaction between TDP-43, an RNA-binding protein that forms aggregates in the neuromuscular disease, amyotrophic lateral sclerosis, and the miR-1, but not miR-133, family. Deficiency of the TDP-43 Drosophila ortholog enhanced dmiR-1 activity in vivo. In mammalian cells, TDP-43 limited the activity of both miR-1 and miR-206, but not the miR-133 family, by disrupting their RISC association. Consistent with TDP-43 dampening miR-1/206 activity, protein levels of the miR-1/206 targets, IGF-1 and HDAC4, were elevated in TDP-43 transgenic mouse muscle. This occurred without corresponding Igf-1 or Hdac4 mRNA increases and despite higher miR-1 and miR-206 expression. Our findings reveal that TDP-43 negatively regulates the activity of the miR-1 family of miRNAs by limiting their bioavailability for RISC loading and suggest a processing-independent mechanism for differential regulation of miRNA activity. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Differential transcriptional control of the two tRNA(fMet) genes of Escherichia coli K-12.
Nagase, T; Ishii, S; Imamoto, F
1988-07-15
The metZ gene of Escherichia coli, which encodes the tRNA(f1Met), was cloned. Using the nucleotide sequence, in vitro transcription, and S1 nuclease mapping analyses, we identified the promoter region, transcriptional start point, the two tandem tRNA(f1Met) structural genes separated by an intergenic space of 33 bp, and the two Rho-independent transcriptional termination sites, in that order. We compared the promoter region of the metZ gene with that of the metY gene, which encodes the tRNA(f2Met) and is located in the promoter-proximal portion of the nusA operon. A G + C-rich sequence (5'-GCGCATCCAC-3'), similar to the corresponding sequence of the rrn promoters that are under stringent control, was found between the Pribnow box and the transcriptional start point of the metZ promoter, but not in the metY promoter region. We therefore examined the effect of guanosine 3'-diphosphate, 5'-diphosphate (ppGpp), the chemical mediator of stringent control, and found that ppGpp inhibited the transcription of the metZ gene, but not that of the metY gene. These data suggested that the promoters for metZ and metY have different physiological functions and are regulated by different mechanisms.
Comparative functional characterization of the CSR-1 22G-RNA pathway in Caenorhabditis nematodes
Tu, Shikui; Wu, Monica Z.; Wang, Jie; Cutter, Asher D.; Weng, Zhiping; Claycomb, Julie M.
2015-01-01
As a champion of small RNA research for two decades, Caenorhabditis elegans has revealed the essential Argonaute CSR-1 to play key nuclear roles in modulating chromatin, chromosome segregation and germline gene expression via 22G-small RNAs. Despite CSR-1 being preserved among diverse nematodes, the conservation and divergence in function of the targets of small RNA pathways remains poorly resolved. Here we apply comparative functional genomic analysis between C. elegans and Caenorhabditis briggsae to characterize the CSR-1 pathway, its targets and their evolution. C. briggsae CSR-1-associated small RNAs that we identified by immunoprecipitation-small RNA sequencing overlap with 22G-RNAs depleted in cbr-csr-1 RNAi-treated worms. By comparing 22G-RNAs and target genes between species, we defined a set of CSR-1 target genes with conserved germline expression, enrichment in operons and more slowly evolving coding sequences than other genes, along with a small group of evolutionarily labile targets. We demonstrate that the association of CSR-1 with chromatin is preserved, and show that depletion of cbr-csr-1 leads to chromosome segregation defects and embryonic lethality. This first comparative characterization of a small RNA pathway in Caenorhabditis establishes a conserved nuclear role for CSR-1 and highlights its key role in germline gene regulation across multiple animal species. PMID:25510497
Gene Ranking of RNA-Seq Data via Discriminant Non-Negative Matrix Factorization.
Jia, Zhilong; Zhang, Xiang; Guan, Naiyang; Bo, Xiaochen; Barnes, Michael R; Luo, Zhigang
2015-01-01
RNA-sequencing is rapidly becoming the method of choice for studying the full complexity of transcriptomes, however with increasing dimensionality, accurate gene ranking is becoming increasingly challenging. This paper proposes an accurate and sensitive gene ranking method that implements discriminant non-negative matrix factorization (DNMF) for RNA-seq data. To the best of our knowledge, this is the first work to explore the utility of DNMF for gene ranking. When incorporating Fisher's discriminant criteria and setting the reduced dimension as two, DNMF learns two factors to approximate the original gene expression data, abstracting the up-regulated or down-regulated metagene by using the sample label information. The first factor denotes all the genes' weights of two metagenes as the additive combination of all genes, while the second learned factor represents the expression values of two metagenes. In the gene ranking stage, all the genes are ranked as a descending sequence according to the differential values of the metagene weights. Leveraging the nature of NMF and Fisher's criterion, DNMF can robustly boost the gene ranking performance. The Area Under the Curve analysis of differential expression analysis on two benchmarking tests of four RNA-seq data sets with similar phenotypes showed that our proposed DNMF-based gene ranking method outperforms other widely used methods. Moreover, the Gene Set Enrichment Analysis also showed DNMF outweighs others. DNMF is also computationally efficient, substantially outperforming all other benchmarked methods. Consequently, we suggest DNMF is an effective method for the analysis of differential gene expression and gene ranking for RNA-seq data.
A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.
Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P
2003-04-08
We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.
Di, Yanming; Schafer, Daniel W.; Wilhelm, Larry J.; Fox, Samuel E.; Sullivan, Christopher M.; Curzon, Aron D.; Carrington, James C.; Mockler, Todd C.; Chang, Jeff H.
2011-01-01
GENE-counter is a complete Perl-based computational pipeline for analyzing RNA-Sequencing (RNA-Seq) data for differential gene expression. In addition to its use in studying transcriptomes of eukaryotic model organisms, GENE-counter is applicable for prokaryotes and non-model organisms without an available genome reference sequence. For alignments, GENE-counter is configured for CASHX, Bowtie, and BWA, but an end user can use any Sequence Alignment/Map (SAM)-compliant program of preference. To analyze data for differential gene expression, GENE-counter can be run with any one of three statistics packages that are based on variations of the negative binomial distribution. The default method is a new and simple statistical test we developed based on an over-parameterized version of the negative binomial distribution. GENE-counter also includes three different methods for assessing differentially expressed features for enriched gene ontology (GO) terms. Results are transparent and data are systematically stored in a MySQL relational database to facilitate additional analyses as well as quality assessment. We used next generation sequencing to generate a small-scale RNA-Seq dataset derived from the heavily studied defense response of Arabidopsis thaliana and used GENE-counter to process the data. Collectively, the support from analysis of microarrays as well as the observed and substantial overlap in results from each of the three statistics packages demonstrates that GENE-counter is well suited for handling the unique characteristics of small sample sizes and high variability in gene counts. PMID:21998647
Nicolas, Francisco Esteban; Moxon, Simon; de Haro, Juan P.; Calo, Silvia; Grigoriev, Igor V.; Torres-Martínez, Santiago; Moulton, Vincent; Ruiz-Vázquez, Rosa M.; Dalmay, Tamas
2010-01-01
Endogenous short RNAs (esRNAs) play diverse roles in eukaryotes and usually are produced from double-stranded RNA (dsRNA) by Dicer. esRNAs are grouped into different classes based on biogenesis and function but not all classes are present in all three eukaryotic kingdoms. The esRNA register of fungi is poorly described compared to other eukaryotes and it is not clear what esRNA classes are present in this kingdom and whether they regulate the expression of protein coding genes. However, evidence that some dicer mutant fungi display altered phenotypes suggests that esRNAs play an important role in fungi. Here, we show that the basal fungus Mucor circinelloides produces new classes of esRNAs that map to exons and regulate the expression of many protein coding genes. The largest class of these exonic-siRNAs (ex-siRNAs) are generated by RNA-dependent RNA Polymerase 1 (RdRP1) and dicer-like 2 (DCL2) and target the mRNAs of protein coding genes from which they were produced. Our results expand the range of esRNAs in eukaryotes and reveal a new role for esRNAs in fungi. PMID:20427422
Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo
2018-04-14
To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .
Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo
2018-01-01
AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291
Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin
2018-06-08
Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.