U1 small nuclear RNA variants differentially form ribonucleoprotein particles in vitro.

PubMed

Somarelli, Jason A; Mesa, Annia; Rodriguez, Carol E; Sharma, Shalini; Herrera, Rene J

2014-04-25

The U1 small nuclear (sn)RNA participates in splicing of pre-mRNAs by recognizing and binding to 5' splice sites at exon/intron boundaries. U1 snRNAs associate with 5' splice sites in the form of ribonucleoprotein particles (snRNPs) that are comprised of the U1 snRNA and 10 core components, including U1A, U1-70K, U1C and the 'Smith antigen', or Sm, heptamer. The U1 snRNA is highly conserved across a wide range of taxa; however, a number of reports have identified the presence of expressed U1-like snRNAs in multiple species, including humans. While numerous U1-like molecules have been shown to be expressed, it is unclear whether these variant snRNAs have the capacity to form snRNPs and participate in splicing. The purpose of the present study was to further characterize biochemically the ability of previously identified human U1-like variants to form snRNPs and bind to U1 snRNP proteins. A bioinformatics analysis provided support for the existence of multiple expressed variants. In vitro gel shift assays, competition assays, and immunoprecipitations (IPs) revealed that the variants formed high molecular weight assemblies to varying degrees and associated with core U1 snRNP proteins to a lesser extent than the canonical U1 snRNA. Together, these data suggest that the human U1 snRNA variants analyzed here are unable to efficiently bind U1 snRNP proteins. The current work provides additional biochemical insights into the ability of the variants to assemble into snRNPs. Copyright © 2014 Elsevier B.V. All rights reserved.

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Treacher Collins syndrome (TCOF1) gene product is involved in pre-rRNA methylation.

PubMed

Gonzales, Bianca; Henning, Dale; So, Rolando B; Dixon, Jill; Dixon, Michael J; Valdez, Benigno C

2005-07-15

Treacher Collins syndrome (TCS) is characterized by defects in craniofacial development, which results from mutations in the TCOF1 gene. TCOF1 encodes the nucleolar phosphoprotein treacle, which interacts with upstream binding factor (UBF) and affects transcription of the ribosomal DNA gene. The present study shows participation of treacle in the 2'-O-methylation of pre-rRNA. Antisense-mediated down-regulation of treacle expression in Xenopus laevis oocytes reduced 2'-O-methylation of pre-rRNA. Analysis of RNA isolated from wild-type and Tcof1+/- heterozygous mice embryos from strains that exhibit a lethal phenotype showed significant reduction in 2'-O-methylation at nucleotide C463 of 18S rRNA. The level of pseudouridylation of U1642 of 18S rRNA from the same RNA samples was not affected suggesting specificity. There is no significant difference in rRNA methylation between wild-type and heterozygous embryos of DBA x BALB/c mice, which have no obvious craniofacial phenotype. The function of treacle in pre-rRNA methylation is most likely mediated by its direct physical interaction with NOP56, a component of the ribonucleoprotein methylation complex. Although treacle co-localizes with UBF throughout mitosis, it co-localizes with NOP56 and fibrillarin, a putative methyl transferase, only during telophase when rDNA gene transcription and pre-rRNA methylation are known to commence. These observations suggest that treacle might link RNA polymerase I-catalyzed transcription and post-transcriptional modification of pre-rRNA. We hypothesize that haploinsufficiency of treacle in TCS patients results in inhibition of production of properly modified mature rRNA in addition to inhibition of rDNA gene transcription, which consequently affects proliferation and proper differentiation of specific embryonic cells during development.

A New Class of SINEs with snRNA Gene-Derived Heads.

PubMed

Kojima, Kenji K

2015-05-27

Eukaryotic genomes are colonized by various transposons including short interspersed elements (SINEs). The 5' region (head) of the majority of SINEs is derived from one of the three types of RNA genes--7SL RNA, transfer RNA (tRNA), or 5S ribosomal RNA (rRNA)--and the internal promoter inside the head promotes the transcription of the entire SINEs. Here I report a new group of SINEs whose heads originate from either the U1 or U2 small nuclear RNA gene. These SINEs, named SINEU, are distributed among crocodilians and classified into three families. The structures of the SINEU-1 subfamilies indicate the recurrent addition of a U1- or U2-derived sequence onto the 5' end of SINEU-1 elements. SINEU-1 and SINEU-3 are ancient and shared among alligators, crocodiles, and gharials, while SINEU-2 is absent in the alligator genome. SINEU-2 is the only SINE family that was active after the split of crocodiles and gharials. All SINEU families, especially SINEU-3, are preferentially inserted into a family of Mariner DNA transposon, Mariner-N4_AMi. A group of Tx1 non-long terminal repeat retrotransposons designated Tx1-Mar also show target preference for Mariner-N4_AMi, indicating that SINEU was mobilized by Tx1-Mar. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Cloning of a long HIV-1 readthrough transcript and detection of an increased level of early growth response protein-1 (Egr-1) mRNA in chronically infected U937 cells.

PubMed

Dron, M; Hameau, L; Benboudjema, L; Guymarho, J; Cajean-Feroldi, C; Rizza, P; Godard, C; Jasmin, C; Tovey, M G; Lang, M C

1999-01-01

To identify the pathways involved in HIV-1 modification of cellular gene expression, chronically infected U937 cells were screened by mRNA differential display. A chimeric transcript consisting of the 3' end of the LTR of a HIV-1 provirus, followed by 3.7 kb of cellular RNA was identified suggesting that long readthrough transcription might be one of the mechanisms by which gene expression could be modified in individual infected cells. Such a phenomenon may also be the first step towards the potential transduction of cellular sequences. Furthermore, the mRNA encoding for the transcription factor Egr-1 was detected as an over-represented transcript in infected cells. Northern blot analysis confirmed the increase of Egr-1 mRNA content in both HIV-1 infected promonocytic U937 cells and T cell lines such as Jurkat and CEM. Interestingly a similar increase of Egr-1 mRNA has previously been reported to occur in HTLV-1 and HTLV-2 infected T cell lines. Despite the consistent increase in the level of Egr-1 mRNA, the amount of the encoded protein did not appear to be modified in HIV-1 infected cells, suggesting an increased turn over of the protein in chronically infected cells.

snoU6 and 5S RNAs are not reliable miRNA reference genes in neuronal differentiation.

PubMed

Lim, Q E; Zhou, L; Ho, Y K; Wan, G; Too, H P

2011-12-29

Accurate profiling of microRNAs (miRNAs) is an essential step for understanding the functional significance of these small RNAs in both physiological and pathological processes. Quantitative real-time PCR (qPCR) has gained acceptance as a robust and reliable transcriptomic method to profile subtle changes in miRNA levels and requires reference genes for accurate normalization of gene expression. 5S and snoU6 RNAs are commonly used as reference genes in microRNA quantification. It is currently unknown if these small RNAs are stably expressed during neuronal differentiation. Panels of miRNAs have been suggested as alternative reference genes to 5S and snoU6 in various physiological contexts. To test the hypothesis that miRNAs may serve as stable references during neuronal differentiation, the expressions of eight miRNAs, 5S and snoU6 RNAs in five differentiating neuronal cell types were analyzed using qPCR. The stabilities of the expressions were evaluated using two complementary statistical approaches (geNorm and Normfinder). Expressions of 5S and snoU6 RNAs were stable under some but not all conditions of neuronal differentiation and thus are not suitable reference genes. In contrast, a combination of three miRNAs (miR-103, miR-106b and miR-26b) allowed accurate expression normalization across different models of neuronal differentiation. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

U1 small nuclear ribonucleoprotein particle-specific proteins interact with the first and second stem-loops of U1 RNA, with the A protein binding directly to the RNA independently of the 70K and Sm proteins.

PubMed Central

Patton, J R; Habets, W; van Venrooij, W J; Pederson, T

1989-01-01

The U1 small nuclear ribonucleoprotein particle (U1 snRNP), a cofactor in pre-mRNA splicing, contains three proteins, termed 70K, A, and C, that are not present in the other spliceosome-associated snRNPs. We studied the binding of the A and C proteins to U1 RNA, using a U1 snRNP reconstitution system and an antibody-induced nuclease protection technique. Antibodies that reacted with the A and C proteins induced nuclease protection of the first two stem-loops of U1 RNA in reconstituted U1 snRNP. Detailed analysis of the antibody-induced nuclease protection patterns indicated the existence of relatively long-range protein-protein interactions in the U1 snRNP, with the 5' end of U1 RNA and its associated specific proteins interacting with proteins bound to the Sm domain near the 3' end. UV cross-linking experiments in conjunction with an A-protein-specific antibody demonstrated that the A protein bound directly to the U1 RNA rather than assembling in the U1 snRNP exclusively via protein-protein interactions. This conclusion was supported by additional experiments revealing that the A protein could bind to U1 RNA in the absence of bound 70K and Sm core proteins. Images PMID:2529425

[Influence of antisense RNA and sequences of viral transactivators traps on RNA synthesis of HTLV-1 virus].

PubMed

Borisenko, A S; Kotus, E V; Kaloshin, A A

2008-01-01

Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.

Structural and functional analyses of Saccharomyces cerevisiae wild-type and mutant RNA1 genes.

PubMed Central

Traglia, H M; Atkinson, N S; Hopper, A K

1989-01-01

The yeast gene RNA1 has been defined by the thermosensitive rna1-1 lesion. This lesion interferes with the processing and production of all major classes of RNA. Each class of RNA is affected at a distinct and presumably unrelated step. Furthermore, RNA does not appear to exit the nucleus. To investigate how the RNA1 gene product can pleiotropically affect disparate processes, we undertook a structural analysis of wild-type and mutant RNA1 genes. The wild-type gene was found to contain a 407-amino-acid open reading frame that encodes a hydrophilic protein. No clue regarding the function of the RNA1 protein was obtained by searching banks for similarity to other known gene products. Surprisingly, the rna1-1 lesion was found to code for two amino acid differences from wild type. We found that neither single-amino-acid change alone resulted in temperature sensitivity. The carboxy-terminal region of the RNA1 open reading frame contains a highly acidic domain extending from amino acids 334 to 400. We generated genomic deletions that removed C-terminal regions of this protein. Deletion of amino acids 397 to 407 did not appear to affect cell growth. Removal of amino acids 359 to 397, a region containing 24 acidic residues, caused temperature-sensitive growth. This allele, rna1-delta 359-397, defines a second conditional lesion of the RNA1 locus. We found that strains possessing the rna1-delta 359-397 allele did not show thermosensitive defects in pre-rRNA or pre-tRNA processing. Removal of amino acids 330 to 407 resulted in loss of viability. Images PMID:2674676

A New Class of SINEs with snRNA Gene-Derived Heads

PubMed Central

Kojima, Kenji K.

2015-01-01

Eukaryotic genomes are colonized by various transposons including short interspersed elements (SINEs). The 5′ region (head) of the majority of SINEs is derived from one of the three types of RNA genes—7SL RNA, transfer RNA (tRNA), or 5S ribosomal RNA (rRNA)—and the internal promoter inside the head promotes the transcription of the entire SINEs. Here I report a new group of SINEs whose heads originate from either the U1 or U2 small nuclear RNA gene. These SINEs, named SINEU, are distributed among crocodilians and classified into three families. The structures of the SINEU-1 subfamilies indicate the recurrent addition of a U1- or U2-derived sequence onto the 5′ end of SINEU-1 elements. SINEU-1 and SINEU-3 are ancient and shared among alligators, crocodiles, and gharials, while SINEU-2 is absent in the alligator genome. SINEU-2 is the only SINE family that was active after the split of crocodiles and gharials. All SINEU families, especially SINEU-3, are preferentially inserted into a family of Mariner DNA transposon, Mariner-N4_AMi. A group of Tx1 non-long terminal repeat retrotransposons designated Tx1-Mar also show target preference for Mariner-N4_AMi, indicating that SINEU was mobilized by Tx1-Mar. PMID:26019167

Long noncoding RNA EWSAT1-mediated gene repression facilitates Ewing sarcoma oncogenesis

PubMed Central

Marques Howarth, Michelle; Simpson, David; Ngok, Siu P.; Nieves, Bethsaida; Chen, Ron; Siprashvili, Zurab; Vaka, Dedeepya; Breese, Marcus R.; Crompton, Brian D.; Alexe, Gabriela; Hawkins, Doug S.; Jacobson, Damon; Brunner, Alayne L.; West, Robert; Mora, Jaume; Stegmaier, Kimberly; Khavari, Paul; Sweet-Cordero, E. Alejandro

2014-01-01

Chromosomal translocation that results in fusion of the genes encoding RNA-binding protein EWS and transcription factor FLI1 (EWS-FLI1) is pathognomonic for Ewing sarcoma. EWS-FLI1 alters gene expression through mechanisms that are not completely understood. We performed RNA sequencing (RNAseq) analysis on primary pediatric human mesenchymal progenitor cells (pMPCs) expressing EWS-FLI1 in order to identify gene targets of this oncoprotein. We determined that long noncoding RNA-277 (Ewing sarcoma–associated transcript 1 [EWSAT1]) is upregulated by EWS-FLI1 in pMPCs. Inhibition of EWSAT1 expression diminished the ability of Ewing sarcoma cell lines to proliferate and form colonies in soft agar, whereas EWSAT1 inhibition had no effect on other cell types tested. Expression of EWS-FLI1 and EWSAT1 repressed gene expression, and a substantial fraction of targets that were repressed by EWS-FLI1 were also repressed by EWSAT1. Analysis of RNAseq data from primary human Ewing sarcoma further supported a role for EWSAT1 in mediating gene repression. We identified heterogeneous nuclear ribonucleoprotein (HNRNPK) as an RNA-binding protein that interacts with EWSAT1 and found a marked overlap in HNRNPK-repressed genes and those repressed by EWS-FLI1 and EWSAT1, suggesting that HNRNPK participates in EWSAT1-mediated gene repression. Together, our data reveal that EWSAT1 is a downstream target of EWS-FLI1 that facilitates the development of Ewing sarcoma via the repression of target genes. PMID:25401475

Escherichia coli tRNA 2-selenouridine synthase (SelU) converts S2U-RNA to Se2U-RNA via S-geranylated-intermediate.

PubMed

Sierant, Malgorzata; Leszczynska, Grazyna; Sadowska, Klaudia; Komar, Patrycja; Radzikowska-Cieciura, Ewa; Sochacka, Elzbieta; Nawrot, Barbara

2018-06-04

To date the only tRNAs containing nucleosides modified with a selenium (5-carboxymethylaminomethyl-2-selenouridine and 5-methylaminomethyl-2-selenouridine) have been found in bacteria. By using tRNA anticodon-stem-loop fragments containing S2U, Se2U, or geS2U, we found that in vitro tRNA 2-selenouridine synthase (SelU) converts S2U-RNA to Se2U-RNA in a two-step process involving S2U-RNA geranylation (with ppGe) and subsequent selenation of the resulting geS2U-RNA (with SePO 3 3- ). No 'direct' S2U-RNA→Se2U-RNA replacement is observed in the presence of SelU/SePO 3 3- only (without ppGe). These results suggest that the in vivo S2U→Se2U and S2U→geS2U transformations in tRNA, so far claimed to be the elementary reactions occurring independently in the same domain of the SelU enzyme, should be considered a combination of two consecutive events - geranylation (S2U→geS2U) and selenation (geS2U→Se2U). © 2018 Federation of European Biochemical Societies.

Human Immunodeficiency Virus-Type 1 LTR DNA contains an intrinsic gene producing antisense RNA and protein products

PubMed Central

Ludwig, Linda B; Ambrus, Julian L; Krawczyk, Kristie A; Sharma, Sanjay; Brooks, Stephen; Hsiao, Chiu-Bin; Schwartz, Stanley A

2006-01-01

Background While viruses have long been shown to capitalize on their limited genomic size by utilizing both strands of DNA or complementary DNA/RNA intermediates to code for viral proteins, it has been assumed that human retroviruses have all their major proteins translated only from the plus or sense strand of RNA, despite their requirement for a dsDNA proviral intermediate. Several studies, however, have suggested the presence of antisense transcription for both HIV-1 and HTLV-1. More recently an antisense transcript responsible for the HTLV-1 bZIP factor (HBZ) protein has been described. In this study we investigated the possibility of an antisense gene contained within the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR). Results Inspection of published sequences revealed a potential transcription initiator element (INR) situated downstream of, and in reverse orientation to, the usual HIV-1 promoter and transcription start site. This antisense initiator (HIVaINR) suggested the possibility of an antisense gene responsible for RNA and protein production. We show that antisense transcripts are generated, in vitro and in vivo, originating from the TAR DNA of the HIV-1 LTR. To test the possibility that protein(s) could be translated from this novel HIV-1 antisense RNA, recombinant HIV antisense gene-FLAG vectors were designed. Recombinant protein(s) were produced and isolated utilizing carboxy-terminal FLAG epitope (DYKDDDDK) sequences. In addition, affinity-purified antisera to an internal peptide derived from the HIV antisense protein (HAP) sequences identified HAPs from HIV+ human peripheral blood lymphocytes. Conclusion HIV-1 contains an antisense gene in the U3-R regions of the LTR responsible for both an antisense RNA transcript and proteins. This antisense transcript has tremendous potential for intrinsic RNA regulation because of its overlap with the beginning of all HIV-1 sense RNA transcripts by 25 nucleotides. The novel HAPs are

Activation of interferon regulatory factor-3 via toll-like receptor 3 and immunomodulatory functions detected in A549 lung epithelial cells exposed to misplaced U1-snRNA.

PubMed

Sadik, Christian D; Bachmann, Malte; Pfeilschifter, Josef; Mühl, Heiko

2009-08-01

U1-snRNA is an integral part of the U1 ribonucleoprotein pivotal for pre-mRNA splicing. Toll-like receptor (TLR) signaling has recently been associated with immunoregulatory capacities of U1-snRNA. Using lung A549 epithelial/carcinoma cells, we report for the first time on interferon regulatory factor (IRF)-3 activation initiated by endosomally delivered U1-snRNA. This was associated with expression of the IRF3-inducible genes interferon-beta (IFN-beta), CXCL10/IP-10 and indoleamine 2,3-dioxygenase. Mutational analysis of the U1-snRNA-activated IFN-beta promoter confirmed the crucial role of the PRDIII element, previously proven pivotal for promoter activation by IRF3. Notably, expression of these parameters was suppressed by bafilomycin A(1), an inhibitor of endosomal acidification, implicating endosomal TLR activation. Since resiquimod, an agonist of TLR7/8, failed to stimulate A549 cells, data suggest TLR3 to be of prime relevance for cellular activation. To assess the overall regulatory potential of U1-snRNA-activated epithelial cells on cytokine production, co-cultivation with peripheral blood mononuclear cells (PBMC) was performed. Interestingly, A549 cells activated by U1-snRNA reinforced phytohemagglutinin-induced interleukin-10 release by PBMC but suppressed that of tumor necrosis factor-alpha, indicating an anti-inflammatory potential of U1-snRNA. Since U1-snRNA is enriched in apoptotic bodies and epithelial cells are capable of performing efferocytosis, the present data in particular connect to immunobiological aspects of apoptosis at host/environment interfaces.

BRAKER1: Unsupervised RNA-Seq-Based Genome Annotation with GeneMark-ET and AUGUSTUS.

PubMed

Hoff, Katharina J; Lange, Simone; Lomsadze, Alexandre; Borodovsky, Mark; Stanke, Mario

2016-03-01

Gene finding in eukaryotic genomes is notoriously difficult to automate. The task is to design a work flow with a minimal set of tools that would reach state-of-the-art performance across a wide range of species. GeneMark-ET is a gene prediction tool that incorporates RNA-Seq data into unsupervised training and subsequently generates ab initio gene predictions. AUGUSTUS is a gene finder that usually requires supervised training and uses information from RNA-Seq reads in the prediction step. Complementary strengths of GeneMark-ET and AUGUSTUS provided motivation for designing a new combined tool for automatic gene prediction. We present BRAKER1, a pipeline for unsupervised RNA-Seq-based genome annotation that combines the advantages of GeneMark-ET and AUGUSTUS. As input, BRAKER1 requires a genome assembly file and a file in bam-format with spliced alignments of RNA-Seq reads to the genome. First, GeneMark-ET performs iterative training and generates initial gene structures. Second, AUGUSTUS uses predicted genes for training and then integrates RNA-Seq read information into final gene predictions. In our experiments, we observed that BRAKER1 was more accurate than MAKER2 when it is using RNA-Seq as sole source for training and prediction. BRAKER1 does not require pre-trained parameters or a separate expert-prepared training step. BRAKER1 is available for download at http://bioinf.uni-greifswald.de/bioinf/braker/ and http://exon.gatech.edu/GeneMark/ katharina.hoff@uni-greifswald.de or borodovsky@gatech.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Gene expression analysis upon lncRNA DDSR1 knockdown in human fibroblasts

PubMed Central

Jia, Li; Sun, Zhonghe; Wu, Xiaolin; Misteli, Tom; Sharma, Vivek

2015-01-01

Long non-coding RNAs (lncRNAs) play important roles in regulating diverse biological processes including DNA damage and repair. We have recently reported that the DNA damage inducible lncRNA DNA damage-sensitive RNA1 (DDSR1) regulates DNA repair by homologous recombination (HR). Since lncRNAs also modulate gene expression, we identified gene expression changes upon DDSR1 knockdown in human fibroblast cells. Gene expression analysis after RNAi treatment targeted against DDSR1 revealed 119 genes that show differential expression. Here we provide a detailed description of the microarray data (NCBI GEO accession number GSE67048) and the data analysis procedure associated with the publication by Sharma et al., 2015 in EMBO Reports [1]. PMID:26697398

Two Routes to Genetic Suppression of RNA Trimethylguanosine Cap Deficiency via C-Terminal Truncation of U1 snRNP Subunit Snp1 or Overexpression of RNA Polymerase Subunit Rpo26.

PubMed

Qiu, Zhicheng R; Schwer, Beate; Shuman, Stewart

2015-04-24

The trimethylguanosine (TMG) caps of small nuclear (sn) RNAs are synthesized by the enzyme Tgs1 via sequential methyl additions to the N2 atom of the m(7)G cap. Whereas TMG caps are inessential for Saccharomyces cerevisiae vegetative growth at 25° to 37°, tgs1∆ cells that lack TMG caps fail to thrive at 18°. The cold-sensitive defect correlates with ectopic stoichiometric association of nuclear cap-binding complex (CBC) with the residual m(7)G cap of the U1 snRNA and is suppressed fully by Cbc2 mutations that weaken cap binding. Here, we show that normal growth of tgs1∆ cells at 18° is also restored by a C-terminal deletion of 77 amino acids from the Snp1 subunit of yeast U1 snRNP. These results underscore the U1 snRNP as a focal point for TMG cap function in vivo. Casting a broader net, we conducted a dosage suppressor screen for genes that allowed survival of tgs1∆ cells at 18°. We thereby recovered RPO26 (encoding a shared subunit of all three nuclear RNA polymerases) and RPO31 (encoding the largest subunit of RNA polymerase III) as moderate and weak suppressors of tgs1∆ cold sensitivity, respectively. A structure-guided mutagenesis of Rpo26, using rpo26∆ complementation and tgs1∆ suppression as activity readouts, defined Rpo26-(78-155) as a minimized functional domain. Alanine scanning identified Glu89, Glu124, Arg135, and Arg136 as essential for rpo26∆ complementation. The E124A and R135A alleles retained tgs1∆ suppressor activity, thereby establishing a separation-of-function. These results illuminate the structure activity profile of an essential RNA polymerase component. Copyright © 2015 Qiu et al.

The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

PubMed

Fujii, Yoichi Robertus

2013-01-01

MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

The Activation-Induced Assembly of an RNA/Protein Interactome Centered on the Splicing Factor U2AF2 Regulates Gene Expression in Human CD4 T Cells.

PubMed

Whisenant, Thomas C; Peralta, Eigen R; Aarreberg, Lauren D; Gao, Nina J; Head, Steven R; Ordoukhanian, Phillip; Williamson, Jamie R; Salomon, Daniel R

2015-01-01

Activation of CD4 T cells is a reaction to challenges such as microbial pathogens, cancer and toxins that defines adaptive immune responses. The roles of T cell receptor crosslinking, intracellular signaling, and transcription factor activation are well described, but the importance of post-transcriptional regulation by RNA-binding proteins (RBPs) has not been considered in depth. We describe a new model expanding and activating primary human CD4 T cells and applied this to characterizing activation-induced assembly of splicing factors centered on U2AF2. We immunoprecipitated U2AF2 to identify what mRNA transcripts were bound as a function of activation by TCR crosslinking and costimulation. In parallel, mass spectrometry revealed the proteins incorporated into the U2AF2-centered RNA/protein interactome. Molecules that retained interaction with the U2AF2 complex after RNAse treatment were designated as "central" interactome members (CIMs). Mass spectrometry also identified a second class of activation-induced proteins, "peripheral" interactome members (PIMs), that bound to the same transcripts but were not in physical association with U2AF2 or its partners. siRNA knockdown of two CIMs and two PIMs caused changes in activation marker expression, cytokine secretion, and gene expression that were unique to each protein and mapped to pathways associated with key aspects of T cell activation. While knocking down the PIM, SYNCRIP, impacts a limited but immunologically important set of U2AF2-bound transcripts, knockdown of U2AF1 significantly impairs assembly of the majority of protein and mRNA components in the activation-induced interactome. These results demonstrated that CIMs and PIMs, either directly or indirectly through RNA, assembled into activation-induced U2AF2 complexes and play roles in post-transcriptional regulation of genes related to cytokine secretion. These data suggest an additional layer of regulation mediated by the activation-induced assembly of RNA

The Activation-Induced Assembly of an RNA/Protein Interactome Centered on the Splicing Factor U2AF2 Regulates Gene Expression in Human CD4 T Cells

PubMed Central

Aarreberg, Lauren D.; Gao, Nina J.; Head, Steven R.; Ordoukhanian, Phillip; Williamson, Jamie R.; Salomon, Daniel R.

2015-01-01

Activation of CD4 T cells is a reaction to challenges such as microbial pathogens, cancer and toxins that defines adaptive immune responses. The roles of T cell receptor crosslinking, intracellular signaling, and transcription factor activation are well described, but the importance of post-transcriptional regulation by RNA-binding proteins (RBPs) has not been considered in depth. We describe a new model expanding and activating primary human CD4 T cells and applied this to characterizing activation-induced assembly of splicing factors centered on U2AF2. We immunoprecipitated U2AF2 to identify what mRNA transcripts were bound as a function of activation by TCR crosslinking and costimulation. In parallel, mass spectrometry revealed the proteins incorporated into the U2AF2-centered RNA/protein interactome. Molecules that retained interaction with the U2AF2 complex after RNAse treatment were designated as “central” interactome members (CIMs). Mass spectrometry also identified a second class of activation-induced proteins, “peripheral” interactome members (PIMs), that bound to the same transcripts but were not in physical association with U2AF2 or its partners. siRNA knockdown of two CIMs and two PIMs caused changes in activation marker expression, cytokine secretion, and gene expression that were unique to each protein and mapped to pathways associated with key aspects of T cell activation. While knocking down the PIM, SYNCRIP, impacts a limited but immunologically important set of U2AF2-bound transcripts, knockdown of U2AF1 significantly impairs assembly of the majority of protein and mRNA components in the activation-induced interactome. These results demonstrated that CIMs and PIMs, either directly or indirectly through RNA, assembled into activation-induced U2AF2 complexes and play roles in post-transcriptional regulation of genes related to cytokine secretion. These data suggest an additional layer of regulation mediated by the activation-induced assembly

The role of positively charged amino acids and electrostatic interactions in the complex of U1A protein and U1 hairpin II RNA

PubMed Central

Law, Michael J.; Linde, Michael E.; Chambers, Eric J.; Oubridge, Chris; Katsamba, Phinikoula S.; Nilsson, Lennart; Haworth, Ian S.; Laird-Offringa, Ite A.

2006-01-01

Previous kinetic investigations of the N-terminal RNA recognition motif (RRM) domain of spliceosomal protein U1A, interacting with its RNA target U1 hairpin II, provided experimental evidence for a ‘lure and lock’ model of binding in which electrostatic interactions first guide the RNA to the protein, and close range interactions then lock the two molecules together. To further investigate the ‘lure’ step, here we examined the electrostatic roles of two sets of positively charged amino acids in U1A that do not make hydrogen bonds to the RNA: Lys20, Lys22 and Lys23 close to the RNA-binding site, and Arg7, Lys60 and Arg70, located on ‘top’ of the RRM domain, away from the RNA. Surface plasmon resonance-based kinetic studies, supplemented with salt dependence experiments and molecular dynamics simulation, indicate that Lys20 predominantly plays a role in association, while nearby residues Lys22 and Lys23 appear to be at least as important for complex stability. In contrast, kinetic analyses of residues away from the RNA indicate that they have a minimal effect on association and stability. Thus, well-positioned positively charged residues can be important for both initial complex formation and complex maintenance, illustrating the multiple roles of electrostatic interactions in protein–RNA complexes. PMID:16407334

The gene for human U2 snRNP auxiliary factor small 35-kDa subunit (U2AF1) maps to the progressive myoclonus epilepsy (EPM1) critical region on chromosome 21q22.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lalioti, M.D.; Rossier, C.; Antonarakis, S.E.

1996-04-15

We used targeted exon trapping to clone portions of genes from human chromosome 21q22.3. One trapped sequence showed complete homology with the cDNA of human U2AF{sup 35} (M96982; HGM-approved nomenclature U2AF1), which encodes for the small 35-kDa subunit of the U2 snRNP auxiliary factor. Using the U2AF1 cDNA as a probe, we mapped this gene to cosmid Q15D2, a P1, and YAC 350F7 of the Chumakov et al. contig, close to the cystathionine-{beta}-synthase gene (CBS) on 21q22.3. This localization was confirmed by PCR using oligonucleotides from the 3{prime} UTR and by FISH. As U2AF1 associated with a number of differentmore » factors during mRNA splicing, overexpression in trisomy 21 individuals could contribute to some Down syndrome phenotypes by interfering with the splicing process. Furthermore, because this gene maps in the critical region for the progressive myoclonus epilepsy I locus (EPM1), mutation analysis will be carried out in patients to evaluate the potential role of U2AF1 as a candidate for EPM1. 24 refs., 1 fig.« less

Enhancement of chemosensitivity by simultaneously silencing of Mcl-1 and Survivin genes using small interfering RNA in human myelomonocytic leukaemia.

PubMed

Jafarlou, Mahdi; Shanehbandi, Dariush; Dehghan, Parvin; Mansoori, Behzad; Othman, F; Baradaran, Behzad

2017-11-07

Acute myeloid leukaemia (AML) is a genetically heterogeneous, severe and rapidly progressing disease triggered by blocking granulocyte or monocyte differentiation and maturation. Overexpression of myeloid cell leukaemia-1 (Mcl-1) and Survivin is associated with drug resistance, tumour progression and inhibition of apoptotic mechanisms in leukaemia and several cancers. In the present study, we examined the combined effect of etoposide and dual siRNA-mediated silencing of Mcl-1 and Survivin on U-937 AML cells. The AML cells were co-transfected with Mcl-1 and Survivin-specific siRNAs and genes silencing were confirmed by quantitative real-time PCR and Western blotting. Subsequently, MTT assay was used for the evaluation of cytotoxic effects by dual siRNA and etoposide on their own and in combination. For the studying of apoptosis, DNA-histone ELISA and annexin-V/FITC assays were performed. Co-transfection of Mcl-1 and Survivin siRNA significantly blocked their expression at the mRNA and protein levels, leading to the induction of apoptosis and strong inhibition of growth (p < .05). Besides, combined treatment of etoposide with Mcl-1 and Survivin siRNAs co-transfection leads to synergistically enhance etoposide-induced cytotoxic and apoptotic effects (p < .05). The results showed that Mcl-1 and Survivin play a major role in the U937 cells survival and their resistance relative to etoposide. Thus, Mcl-1 and Survivin can be considered as promising molecular targets for the treatment of AML. The combination treatment with etoposide, and siRNA-mediated silencing of corresponding genes may be a novel strategy in chemoresistance AML treatment.

The yeast RNA1 gene product necessary for RNA processing is located in the cytosol and apparently excluded from the nucleus

PubMed Central

1990-01-01

The yeast RNA1 gene is required for RNA processing and nuclear transport of RNA. The rna1-1 mutation of this locus causes defects in pre-tRNA splicing, processing of the primary pre-rRNA transcript, production of mRNA and export of RNA from the nucleus to the cytosol. To understand how this gene product can pleiotropically affect these processes, we sought to determine the intracellular location of the RNA1 protein. As determined by indirect immunofluorescence localization and organelle fractionation, the RNA1 antigen is found exclusively or primarily in the cytoplasm. Only a tiny fraction of the endogenous protein could be localized to and functional in the nucleus. Furthermore, the RNA1 antigen does not localize differently under stress conditions. These findings suggest that the RNA1 protein is not directly involved in RNA processing but may modify nuclear proteins or otherwise transmit a signal from the cytosol to the nucleus or play a role in maintaining the integrity of the nucleus. PMID:2116418

Differential utilization of TATA box-binding protein (TBP) and TBP-related factor 1 (TRF1) at different classes of RNA polymerase III promoters.

PubMed

Verma, Neha; Hung, Ko-Hsuan; Kang, Jin Joo; Barakat, Nermeen H; Stumph, William E

2013-09-20

In the fruit fly Drosophila melanogaster, RNA polymerase III transcription was found to be dependent not upon the canonical TATA box-binding protein (TBP) but instead upon the TBP-related factor 1 (TRF1) (Takada, S., Lis, J. T., Zhou, S., and Tjian, R. (2000) Cell 101, 459-469). Here we confirm that transcription of fly tRNA genes requires TRF1. However, we unexpectedly find that U6 snRNA gene promoters are occupied primarily by TBP in cells and that knockdown of TBP, but not TRF1, inhibits U6 transcription in cells. Moreover, U6 transcription in vitro effectively utilizes TBP, whereas TBP cannot substitute for TRF1 to promote tRNA transcription in vitro. Thus, in fruit flies, different classes of RNA polymerase III promoters differentially utilize TBP and TRF1 for the initiation of transcription.

U1snRNP-mediated suppression of polyadenylation in conjunction with the RNA structure controls poly (A) site selection in foamy viruses

PubMed Central

2013-01-01

Background During reverse transcription, retroviruses duplicate the long terminal repeats (LTRs). These identical LTRs carry both promoter regions and functional polyadenylation sites. To express full-length transcripts, retroviruses have to suppress polyadenylation in the 5′LTR and activate polyadenylation in the 3′LTR. Foamy viruses have a unique LTR structure with respect to the location of the major splice donor (MSD), which is located upstream of the polyadenylation signal. Results Here, we describe the mechanisms of foamy viruses regulating polyadenylation. We show that binding of the U1 small nuclear ribonucleoprotein (U1snRNP) to the MSD suppresses polyadenylation at the 5′LTR. In contrast, polyadenylation at the 3′LTR is achieved by adoption of a different RNA structure at the MSD region, which blocks U1snRNP binding and furthers RNA cleavage and subsequent polyadenylation. Conclusion Recently, it was shown that U1snRNP is able to suppress the usage of intronic cryptic polyadenylation sites in the cellular genome. Foamy viruses take advantage of this surveillance mechanism to suppress premature polyadenylation at the 5’end of their RNA. At the 3’end, Foamy viruses use a secondary structure to presumably block access of U1snRNP and thereby activate polyadenylation at the end of the genome. Our data reveal a contribution of U1snRNP to cellular polyadenylation site selection and to the regulation of gene expression. PMID:23718736

Cloning and characterization of LOS1, a Saccharomyces cerevisiae gene that affects tRNA splicing.

PubMed

Hurt, D J; Wang, S S; Lin, Y H; Hopper, A K

1987-03-01

Saccharomyces cerevisiae strains carrying los1-1 mutations are defective in tRNA processing; at 37 degrees C, such strains accumulate tRNA precursors which have mature 5' and 3' ends but contain intervening sequences. Strains bearing los1-1 and an intron-containing ochre-suppressing tRNA gene, SUP4(0), also fail to suppress the ochre mutations ade2-1(0) and can1-100(0) at 34 degrees C. To understand the role of the LOS1 product in tRNA splicing, we initiated a molecular study of the LOS1 gene. Two plasmids, YEpLOS1 and YCpLOS1, that complement the los1-1 phenotype were isolated from the YEp24 and YCp50 libraries, respectively. YEpLOS1 and YCpLOS1 had overlapping restriction maps, indicating that the DNA in the overlapping segment could complement los1-1 when present in multiple or single copy. Integration of plasmid DNA at the LOS1 locus confirmed that these clones contained authentic LOS1 sequences. Southern analyses showed that LOS1 is a single copy gene. The locations of the LOS1 gene within YEpLOS1 and YCpLOS1 were determined by deletion and gamma-delta mapping. Two genomic disruptions of the LOS1 gene were constructed, i.e., an insertion of a 1.2-kilobase fragment carrying the yeast URA3 gene, los1::URA3, and a 2.4-kilobase deletion from the LOS1 gene, los1-delta V. Disruption or deletion of most of the LOS1 gene was not lethal; cells carrying the disrupted los1 alleles were viable and had phenotypes similar to those of cells carrying the los1-1 allele. Thus, it appears that the los1 gene product expedites tRNA splicing at elevated temperatures but is not essential for this process.

Negative regulation of miRNA-9 on oligodendrocyte lineage gene 1 during hypoxic-ischemic brain damage.

PubMed

Yang, Lijun; Cui, Hong; Cao, Ting

2014-03-01

Oligodendrocyte lineage gene 1 plays a key role in hypoxic-ischemic brain damage and myelin repair. miRNA-9 is involved in the occurrence of many related neurological disorders. Bioinformatics analysis demonstrated that miRNA-9 complementarily, but incompletely, bound oligodendrocyte lineage gene 1, but whether miRNA-9 regulates oligodendrocyte lineage gene 1 remains poorly understood. Whole brain slices of 3-day-old Sprague-Dawley rats were cultured and divided into four groups: control group; oxygen-glucose deprivation group (treatment with 8% O2 + 92% N2 and sugar-free medium for 60 minutes); transfection control group (after oxygen and glucose deprivation for 60 minutes, transfected with control plasmid) and miRNA-9 transfection group (after oxygen and glucose deprivation for 60 minutes, transfected with miRNA-9 plasmid). From the third day of transfection, and with increasing culture days, oligodendrocyte lineage gene 1 expression increased in each group, peaked at 14 days, and then decreased at 21 days. Real-time quantitative PCR results, however, demonstrated that oligodendrocyte lineage gene 1 expression was lower in the miRNA-9 transfection group than that in the transfection control group at 1, 3, 7, 14, 21 and 28 days after transfection. Results suggested that miRNA-9 possibly negatively regulated oligodendrocyte lineage gene 1 in brain tissues during hypoxic-ischemic brain damage.

Stress induction of Bm1 RNA in silkworm larvae: SINEs, an unusual class of stress genes

PubMed Central

Kimura, Richard H.; Choudary, Prabhakara V.; Stone, Koni K.; Schmid, Carl W.

2001-01-01

This study surveys the induction of RNA polymerase III (Pol III)–directed expression of short interspersed element (SINE) transcripts by various stresses in an animal model, silkworm larvae. Sublethal heat shock and exposure to several toxic compounds increase the level of Bm1 RNA, the silkworm SINE transcript, while also transiently increasing expression of a well-characterized stress-induced transcript, Hsp70 messenger RNA (mRNA). In certain cases, the Bm1 RNA response coincides with that of Hsp70 mRNA, but more often Bm1 RNA responds later in recovery. Baculovirus infection and exposure to certain toxic compounds increase Bm1 RNA but not Hsp70 mRNA, showing that SINE induction is not necessarily coupled to transcription of this particular heat shock gene. SINEs behave as an additional class of stress-inducible genes in living animals but are unusual as stress genes because of their high copy number, genomic dispersion, and Pol III–directed transcription. PMID:11599568

The c-Myb target gene neuromedin U functions as a novel cofactor during the early stages of erythropoiesis

PubMed Central

Gambone, Julia E.; Dusaban, Stephanie S.; Loperena, Roxana; Nakata, Yuji

2011-01-01

The requirement of c-Myb during erythropoiesis spurred an interest in identifying c-Myb target genes that are important for erythroid development. Here, we determined that the neuropeptide neuromedin U (NmU) is a c-Myb target gene. Silencing NmU, c-myb, or NmU's cognate receptor NMUR1 expression in human CD34+ cells impaired burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) formation compared with control. Exogenous addition of NmU peptide to NmU or c-myb siRNA-treated CD34+ cells rescued BFU-E and yielded a greater number of CFU-E than observed with control. No rescue of BFU-E and CFU-E growth was observed when NmU peptide was exogenously added to NMUR1 siRNA-treated cells compared with NMUR1 siRNA-treated cells cultured without NmU peptide. In K562 and CD34+ cells, NmU activated protein kinase C-βII, a factor associated with hematopoietic differentiation-proliferation. CD34+ cells cultured under erythroid-inducing conditions, with NmU peptide and erythropoietin added at day 6, revealed an increase in endogenous NmU and c-myb gene expression at day 8 and a 16% expansion of early erythroblasts at day 10 compared to cultures without NmU peptide. Combined, these data strongly support that the c-Myb target gene NmU functions as a novel cofactor for erythropoiesis and expands early erythroblasts. PMID:21378276

Cloning and characterization of LOS1, a Saccharomyces cerevisiae gene that affects tRNA splicing.

PubMed Central

Hurt, D J; Wang, S S; Lin, Y H; Hopper, A K

1987-01-01

Saccharomyces cerevisiae strains carrying los1-1 mutations are defective in tRNA processing; at 37 degrees C, such strains accumulate tRNA precursors which have mature 5' and 3' ends but contain intervening sequences. Strains bearing los1-1 and an intron-containing ochre-suppressing tRNA gene, SUP4(0), also fail to suppress the ochre mutations ade2-1(0) and can1-100(0) at 34 degrees C. To understand the role of the LOS1 product in tRNA splicing, we initiated a molecular study of the LOS1 gene. Two plasmids, YEpLOS1 and YCpLOS1, that complement the los1-1 phenotype were isolated from the YEp24 and YCp50 libraries, respectively. YEpLOS1 and YCpLOS1 had overlapping restriction maps, indicating that the DNA in the overlapping segment could complement los1-1 when present in multiple or single copy. Integration of plasmid DNA at the LOS1 locus confirmed that these clones contained authentic LOS1 sequences. Southern analyses showed that LOS1 is a single copy gene. The locations of the LOS1 gene within YEpLOS1 and YCpLOS1 were determined by deletion and gamma-delta mapping. Two genomic disruptions of the LOS1 gene were constructed, i.e., an insertion of a 1.2-kilobase fragment carrying the yeast URA3 gene, los1::URA3, and a 2.4-kilobase deletion from the LOS1 gene, los1-delta V. Disruption or deletion of most of the LOS1 gene was not lethal; cells carrying the disrupted los1 alleles were viable and had phenotypes similar to those of cells carrying the los1-1 allele. Thus, it appears that the los1 gene product expedites tRNA splicing at elevated temperatures but is not essential for this process. Images PMID:3031485

Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

PubMed

Calvet, J P; Meyer, L M; Pederson, T

1982-07-30

Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

Heterologous and endogenous U6 snRNA promoters enable CRISPR/Cas9 mediated genome editing in Aspergillus niger.

PubMed

Zheng, Xiaomei; Zheng, Ping; Sun, Jibin; Kun, Zhang; Ma, Yanhe

2018-01-01

U6 promoters have been used for single guide RNA (sgRNA) transcription in the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR/Cas9) genome editing system. However, no available U6 promoters have been identified in Aspergillus niger, which is an important industrial platform for organic acid and protein production. Two CRISPR/Cas9 systems established in A. niger have recourse to the RNA polymerase II promoter or in vitro transcription for sgRNA synthesis, but these approaches generally increase cloning efforts and genetic manipulation. The validation of functional RNA polymerase II promoters is therefore an urgent need for A. niger . Here, we developed a novel CRISPR/Cas9 system in A. niger for sgRNA expression, based on one endogenous U6 promoter and two heterologous U6 promoters. The three tested U6 promoters enabled sgRNA transcription and the disruption of the polyketide synthase albA gene in A. niger . Furthermore, this system enabled highly efficient gene insertion at the targeted genome loci in A. niger using donor DNAs with homologous arms as short as 40-bp. This study demonstrated that both heterologous and endogenous U6 promoters were functional for sgRNA expression in A. niger . Based on this result, a novel and simple CRISPR/Cas9 toolbox was established in A. niger, that will benefit future gene functional analysis and genome editing.

The DEAH-box helicase Dhr1 dissociates U3 from the pre-rRNA to promote formation of the central pseudoknot.

PubMed

Sardana, Richa; Liu, Xin; Granneman, Sander; Zhu, Jieyi; Gill, Michael; Papoulas, Ophelia; Marcotte, Edward M; Tollervey, David; Correll, Carl C; Johnson, Arlen W

2015-02-01

In eukaryotes, the highly conserved U3 small nucleolar RNA (snoRNA) base-pairs to multiple sites in the pre-ribosomal RNA (pre-rRNA) to promote early cleavage and folding events. Binding of the U3 box A region to the pre-rRNA is mutually exclusive with folding of the central pseudoknot (CPK), a universally conserved rRNA structure of the small ribosomal subunit essential for protein synthesis. Here, we report that the DEAH-box helicase Dhr1 (Ecm16) is responsible for displacing U3. An active site mutant of Dhr1 blocked release of U3 from the pre-ribosome, thereby trapping a pre-40S particle. This particle had not yet achieved its mature structure because it contained U3, pre-rRNA, and a number of early-acting ribosome synthesis factors but noticeably lacked ribosomal proteins (r-proteins) that surround the CPK. Dhr1 was cross-linked in vivo to the pre-rRNA and to U3 sequences flanking regions that base-pair to the pre-rRNA including those that form the CPK. Point mutations in the box A region of U3 suppressed a cold-sensitive mutation of Dhr1, strongly indicating that U3 is an in vivo substrate of Dhr1. To support the conclusions derived from in vivo analysis we showed that Dhr1 unwinds U3-18S duplexes in vitro by using a mechanism reminiscent of DEAD box proteins.

The DEAH-box Helicase Dhr1 Dissociates U3 from the Pre-rRNA to Promote Formation of the Central Pseudoknot

PubMed Central

Granneman, Sander; Zhu, Jieyi; Gill, Michael; Papoulas, Ophelia; Marcotte, Edward M.; Tollervey, David; Correll, Carl C.; Johnson, Arlen W.

2015-01-01

In eukaryotes, the highly conserved U3 small nucleolar RNA (snoRNA) base-pairs to multiple sites in the pre-ribosomal RNA (pre-rRNA) to promote early cleavage and folding events. Binding of the U3 box A region to the pre-rRNA is mutually exclusive with folding of the central pseudoknot (CPK), a universally conserved rRNA structure of the small ribosomal subunit essential for protein synthesis. Here, we report that the DEAH-box helicase Dhr1 (Ecm16) is responsible for displacing U3. An active site mutant of Dhr1 blocked release of U3 from the pre-ribosome, thereby trapping a pre-40S particle. This particle had not yet achieved its mature structure because it contained U3, pre-rRNA, and a number of early-acting ribosome synthesis factors but noticeably lacked ribosomal proteins (r-proteins) that surround the CPK. Dhr1 was cross-linked in vivo to the pre-rRNA and to U3 sequences flanking regions that base-pair to the pre-rRNA including those that form the CPK. Point mutations in the box A region of U3 suppressed a cold-sensitive mutation of Dhr1, strongly indicating that U3 is an in vivo substrate of Dhr1. To support the conclusions derived from in vivo analysis we showed that Dhr1 unwinds U3-18S duplexes in vitro by using a mechanism reminiscent of DEAD box proteins. PMID:25710520

Increased expression of LD1 genes transcribed by RNA polymerase I in Leishmania donovani as a result of duplication into the rRNA gene locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lodes, M.J.; Merlin, G.; DeVos, T.

1995-12-01

This report investigates the duplication of two LD1 genes into the rRNA locus and the resultant transcription by RNA polymerase I, which has a faster transcription rate than that of RNA polymerase II. This was conducted using a 2.2-Mb chromosome in Leishmania donovani. 55 refs., 6 figs.

A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.

PubMed

Rogalski, T M; Riddle, D L

1988-01-01

The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.

Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

PubMed

Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

2015-02-01

Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

Polymerization of non-complementary RNA: systematic symmetric nucleotide exchanges mainly involving uracil produce mitochondrial RNA transcripts coding for cryptic overlapping genes.

PubMed

Seligmann, Hervé

2013-03-01

Usual DNA→RNA transcription exchanges T→U. Assuming different systematic symmetric nucleotide exchanges during translation, some GenBank RNAs match exactly human mitochondrial sequences (exchange rules listed in decreasing transcript frequencies): C↔U, A↔U, A↔U+C↔G (two nucleotide pairs exchanged), G↔U, A↔G, C↔G, none for A↔C, A↔G+C↔U, and A↔C+G↔U. Most unusual transcripts involve exchanging uracil. Independent measures of rates of rare replicational enzymatic DNA nucleotide misinsertions predict frequencies of RNA transcripts systematically exchanging the corresponding misinserted nucleotides. Exchange transcripts self-hybridize less than other gene regions, self-hybridization increases with length, suggesting endoribonuclease-limited elongation. Blast detects stop codon depleted putative protein coding overlapping genes within exchange-transcribed mitochondrial genes. These align with existing GenBank proteins (mainly metazoan origins, prokaryotic and viral origins underrepresented). These GenBank proteins frequently interact with RNA/DNA, are membrane transporters, or are typical of mitochondrial metabolism. Nucleotide exchange transcript frequencies increase with overlapping gene densities and stop densities, indicating finely tuned counterbalancing regulation of expression of systematic symmetric nucleotide exchange-encrypted proteins. Such expression necessitates combined activities of suppressor tRNAs matching stops, and nucleotide exchange transcription. Two independent properties confirm predicted exchanged overlap coding genes: discrepancy of third codon nucleotide contents from replicational deamination gradients, and codon usage according to circular code predictions. Predictions from both properties converge, especially for frequent nucleotide exchange types. Nucleotide exchanging transcription apparently increases coding densities of protein coding genes without lengthening genomes, revealing unsuspected functional DNA

A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.

PubMed

Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona

2012-01-01

Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.

A Novel Intra-U1 snRNP Cross-Regulation Mechanism: Alternative Splicing Switch Links U1C and U1-70K Expression

PubMed Central

Rösel-Hillgärtner, Tanja Dorothe; Hung, Lee-Hsueh; Khrameeva, Ekaterina; Le Querrec, Patrick; Gelfand, Mikhail S.; Bindereif, Albrecht

2013-01-01

The U1 small nuclear ribonucleoprotein (snRNP)-specific U1C protein participates in 5′ splice site recognition and regulation of pre-mRNA splicing. Based on an RNA-Seq analysis in HeLa cells after U1C knockdown, we found a conserved, intra-U1 snRNP cross-regulation that links U1C and U1-70K expression through alternative splicing and U1 snRNP assembly. To investigate the underlying regulatory mechanism, we combined mutational minigene analysis, in vivo splice-site blocking by antisense morpholinos, and in vitro binding experiments. Alternative splicing of U1-70K pre-mRNA creates the normal (exons 7–8) and a non-productive mRNA isoform, whose balance is determined by U1C protein levels. The non-productive isoform is generated through a U1C-dependent alternative 3′ splice site, which requires an adjacent cluster of regulatory 5′ splice sites and binding of intact U1 snRNPs. As a result of nonsense-mediated decay (NMD) of the non-productive isoform, U1-70K mRNA and protein levels are down-regulated, and U1C incorporation into the U1 snRNP is impaired. U1-70K/U1C-deficient particles are assembled, shifting the alternative splicing balance back towards productive U1-70K splicing, and restoring assembly of intact U1 snRNPs. Taken together, we established a novel feedback regulation that controls U1-70K/U1C homeostasis and ensures correct U1 snRNP assembly and function. PMID:24146627

The DNA damage response activates HPV16 late gene expression at the level of RNA processing.

PubMed

Nilsson, Kersti; Wu, Chengjun; Kajitani, Naoko; Yu, Haoran; Tsimtsirakis, Efthymios; Gong, Lijing; Winquist, Ellenor B; Glahder, Jacob; Ekblad, Lars; Wennerberg, Johan; Schwartz, Stefan

2018-06-01

We show that the alkylating cancer drug melphalan activated the DNA damage response and induced human papillomavirus type 16 (HPV16) late gene expression in an ATM- and Chk1/2-dependent manner. Activation of HPV16 late gene expression included inhibition of the HPV16 early polyadenylation signal that resulted in read-through into the late region of HPV16. This was followed by activation of the exclusively late, HPV16 splice sites SD3632 and SA5639 and production of spliced late L1 mRNAs. Altered HPV16 mRNA processing was paralleled by increased association of phosphorylated BRCA1, BARD1, BCLAF1 and TRAP150 with HPV16 DNA, and increased association of RNA processing factors U2AF65 and hnRNP C with HPV16 mRNAs. These RNA processing factors inhibited HPV16 early polyadenylation and enhanced HPV16 late mRNA splicing, thereby activating HPV16 late gene expression.

Whole-transcriptome RNA-seq, gene set enrichment pathway analysis, and exon coverage analysis of two plastid RNA editing mutants.

PubMed

Hackett, Justin B; Lu, Yan

2017-05-04

In land plants, plastid and mitochondrial RNAs are subject to post-transcriptional C-to-U RNA editing. T-DNA insertions in the ORGANELLE RNA RECOGNITION MOTIF PROTEIN6 gene resulted in reduced photosystem II (PSII) activity and smaller plant and leaf sizes. Exon coverage analysis of the ORRM6 gene showed that orrm6-1 and orrm6-2 are loss-of-function mutants. Compared to other ORRM proteins, ORRM6 affects a relative small number of RNA editing sites. Sanger sequencing of reverse transcription-PCR products of plastid transcripts revealed 2 plastid RNA editing sites that are substantially affected in the orrm6 mutants: psbF-C77 and accD-C794. The psbF gene encodes the β subunit of cytochrome b 559 , an essential component of PSII. The accD gene encodes the β subunit of acetyl-CoA carboxylase, a protein required in plastid fatty acid biosynthesis. Whole-transcriptome RNA-seq demonstrated that editing at psbF-C77 is nearly absent and the editing extent at accD-C794 was significantly reduced. Gene set enrichment pathway analysis showed that expression of multiple gene sets involved in photosynthesis, especially photosynthetic electron transport, is significantly upregulated in both orrm6 mutants. The upregulation could be a mechanism to compensate for the reduced PSII electron transport rate in the orrm6 mutants. These results further demonstrated that Organelle RNA Recognition Motif protein ORRM6 is required in editing of specific RNAs in the Arabidopsis (Arabidopsis thaliana) plastid.

Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

PubMed

Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

2012-01-01

To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (p<0.01) and the expressions of MMP-2 and MMP-9 were inhibited. Recombinant expression plasmid integrin-β1- shRNA can inhibit the expression of integrin-β1 gene and suppress the invasion of PANC-1 cells in vitro significantly.

U2AF1 mutations alter splice site recognition in hematological malignancies.

PubMed

Ilagan, Janine O; Ramakrishnan, Aravind; Hayes, Brian; Murphy, Michele E; Zebari, Ahmad S; Bradley, Philip; Bradley, Robert K

2015-01-01

Whole-exome sequencing studies have identified common mutations affecting genes encoding components of the RNA splicing machinery in hematological malignancies. Here, we sought to determine how mutations affecting the 3' splice site recognition factor U2AF1 alter its normal role in RNA splicing. We find that U2AF1 mutations influence the similarity of splicing programs in leukemias, but do not give rise to widespread splicing failure. U2AF1 mutations cause differential splicing of hundreds of genes, affecting biological pathways such as DNA methylation (DNMT3B), X chromosome inactivation (H2AFY), the DNA damage response (ATR, FANCA), and apoptosis (CASP8). We show that U2AF1 mutations alter the preferred 3' splice site motif in patients, in cell culture, and in vitro. Mutations affecting the first and second zinc fingers give rise to different alterations in splice site preference and largely distinct downstream splicing programs. These allele-specific effects are consistent with a computationally predicted model of U2AF1 in complex with RNA. Our findings suggest that U2AF1 mutations contribute to pathogenesis by causing quantitative changes in splicing that affect diverse cellular pathways, and give insight into the normal function of U2AF1's zinc finger domains. © 2015 Ilagan et al.; Published by Cold Spring Harbor Laboratory Press.

Re-editing the paradigm of Cytidine (C) to Uridine (U) RNA editing.

PubMed

Fossat, Nicolas; Tam, Patrick P L

2014-01-01

Cytidine (C) to Uridine (U) RNA editing is a post-trancriptional modification that until recently was known to only affect Apolipoprotein b (Apob) RNA and minimally require 2 components of the C to U editosome, the deaminase APOBEC1 and the RNA-binding protein A1CF. Our latest work has identified a novel RNA-binding protein, RBM47, as a core component of the editosome, which can substitute A1CF for the editing of ApoB mRNA. In addition, new RNA species that are subjected to C to U editing have been identified. Here, we highlight these recent discoveries and discuss how they change our view of the composition of the C to U editing machinery and expand our knowledge of the functional attributes of C to U RNA editing.

Los1p, involved in yeast pre-tRNA splicing, positively regulates members of the SOL gene family.

PubMed

Shen, W C; Stanford, D R; Hopper, A K

1996-06-01

To understand the role of Los1p in pre-tRNA splicing, we sought los1 multicopy suppressors. We found SOL1 that suppresses both point and null LOS1 mutations. Since, when fused to the Ga14p DNA-binding domain, Los1p activates transcription, we tested whether Los1p regulates SOL1. We found that las1 mutants have depleted levels of SOL1 mRNA and Sol1p. Thus, LOS1 appears to positively regulate SOL1. SOL1 belongs to a multigene family with at least two additional members, SOL2 and SOL3. Sol proteins have extensive similarity to an unusual group of glucose-6-phosphate dehydrogenases. As the similarities are restricted to areas separate from the catalytic domain, these G6PDs may have more than one function. The SOL family appears to be unessential since cells with a triple disruption of all three SOL genes are viable. SOL gene disruptions negatively affect tRNA-mediated nonsense suppression and the severity increases with the number of mutant SOL genes. However, tRNA levels do not vary with either multicopy SOL genes or with SOL disruptions. Therefore, the Sol proteins affect tRNA expression/ function at steps other than transcription or splicing. We propose that LOS1 regulates gene products involved in tRNA expression/function as well as pre-tRNA splicing.

Analysis of aberrant pre-messenger RNA splicing resulting from mutations in ATP8B1 and efficient in vitro rescue by adapted U1 small nuclear RNA.

PubMed

van der Woerd, Wendy L; Mulder, Johanna; Pagani, Franco; Beuers, Ulrich; Houwen, Roderick H J; van de Graaf, Stan F J

2015-04-01

ATP8B1 deficiency is a severe autosomal recessive liver disease resulting from mutations in the ATP8B1 gene characterized by a continuous phenotypical spectrum from intermittent (benign recurrent intrahepatic cholestasis; BRIC) to progressive familial intrahepatic cholestasis (PFIC). Current therapeutic options are insufficient, and elucidating the molecular consequences of mutations could lead to personalized mutation-specific therapies. We investigated the effect on pre-messenger RNA splicing of 14 ATP8B1 mutations at exon-intron boundaries using an in vitro minigene system. Eleven mutations, mostly associated with a PFIC phenotype, resulted in aberrant splicing and a complete absence of correctly spliced product. In contrast, three mutations led to partially correct splicing and were associated with a BRIC phenotype. These findings indicate an inverse correlation between the level of correctly spliced product and disease severity. Expression of modified U1 small nuclear RNAs (snRNA) complementary to the splice donor sites strongly improved or completely rescued splicing for several ATP8B1 mutations located at donor, as well as acceptor, splice sites. In one case, we also evaluated exon-specific U1 snRNAs that, by targeting nonconserved intronic sequences, might reduce possible off-target events. Although very effective in correcting exon skipping, they also induced retention of the short downstream intron. We systematically characterized the molecular consequences of 14 ATP8B1 mutations at exon-intron boundaries associated with ATP8B1 deficiency and found that the majority resulted in total exon skipping. The amount of correctly spliced product inversely correlated with disease severity. Compensatory modified U1 snRNAs, complementary to mutated donor splice sites, were able to improve exon definition very efficiently and could be a novel therapeutic strategy in ATP8B1 deficiency as well as other genetic diseases. © 2014 by the American Association for the Study

Los1p, involved in yeast pre-tRNA splicing, positively regulates members of the SOL gene family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, W.C.; Stanford, D.R.; Hopper, A.K.

1996-06-01

To understand the role of Los1p in pre-tRNA splicing, we sought los1 multicopy suppressors. We found SOL1 that suppresses both point and null LOS1 mutations. Since, when fused to the Gal4p DNA-binding domain, Los1p activates transcription, we tested whether Los1p regulates SOL1. We found that los1 mutants have depleted levels of SOL1 mRNA and Sol1p. Thus, LOS1 appears to positively regulate SOL1. SOL1 belongs to a multigene family with at least two additional members, SOL2 and SOL3. Sol proteins have extensive similarity to an unusual group of glucose-6-phosphate dehydrogenases (G6PDs). As the similarities are restricted to areas separate from themore » catalytic domain, these G6PDs may have more than one function. The SOL gene disruptions negatively affect tRNA-mediated nonsense suppression and the severity increases with the number of mutant SOL genes. However, tRNA levels do not vary with either multicopy SOL genes or with SOL disruptions. Therefore, the Sol proteins affect tRNA expression/function at steps other than transcription or splicing. We propose that LOS1 regulates gene products involved in tRNA expression/function as well as pre-tRNA splicing. 64 refs., 6 figs., 6 tabs.« less

Transcription factor trapping by RNA in gene regulatory elements.

PubMed

Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

2015-11-20

Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

Missing genes, multiple ORFs, and C-to-U type RNA editing in Acrasis kona (Heterolobosea, Excavata) mitochondrial DNA.

PubMed

Fu, Cheng-Jie; Sheikh, Sanea; Miao, Wei; Andersson, Siv G E; Baldauf, Sandra L

2014-08-21

Discoba (Excavata) is an ancient group of eukaryotes with great morphological and ecological diversity. Unlike the other major divisions of Discoba (Jakobida and Euglenozoa), little is known about the mitochondrial DNAs (mtDNAs) of Heterolobosea. We have assembled a complete mtDNA genome from the aggregating heterolobosean amoeba, Acrasis kona, which consists of a single circular highly AT-rich (83.3%) molecule of 51.5 kb. Unexpectedly, A. kona mtDNA is missing roughly 40% of the protein-coding genes and nearly half of the transfer RNAs found in the only other sequenced heterolobosean mtDNAs, those of Naegleria spp. Instead, over a quarter of A. kona mtDNA consists of novel open reading frames. Eleven of the 16 protein-coding genes missing from A. kona mtDNA were identified in its nuclear DNA and polyA RNA, and phylogenetic analyses indicate that at least 10 of these 11 putative nuclear-encoded mitochondrial (NcMt) proteins arose by direct transfer from the mitochondrion. Acrasis kona mtDNA also employs C-to-U type RNA editing, and 12 homologs of DYW-type pentatricopeptide repeat (PPR) proteins implicated in plant organellar RNA editing are found in A. kona nuclear DNA. A mapping of mitochondrial gene content onto a consensus phylogeny reveals a sporadic pattern of relative stasis and rampant gene loss in Discoba. Rampant loss occurred independently in the unique common lineage leading to Heterolobosea + Tsukubamonadida and later in the unique lineage leading to Acrasis. Meanwhile, mtDNA gene content appears to be remarkably stable in the Acrasis sister lineage leading to Naegleria and in their distant relatives Jakobida. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

PubMed

Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

2017-10-01

RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

PubMed Central

Sharma, Kishor; Tollervey, David

1999-01-01

The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

LIM-domain proteins, LIMD1, Ajuba, and WTIP are required for microRNA-mediated gene silencing

PubMed Central

James, Victoria; Zhang, Yining; Foxler, Daniel E.; de Moor, Cornelia H.; Kong, Yi Wen; Webb, Thomas M.; Self, Tim J.; Feng, Yungfeng; Lagos, Dimitrios; Chu, Chia-Ying; Rana, Tariq M.; Morley, Simon J.; Longmore, Gregory D.; Bushell, Martin; Sharp, Tyson V.

2010-01-01

In recent years there have been major advances with respect to the identification of the protein components and mechanisms of microRNA (miRNA) mediated silencing. However, the complete and precise repertoire of components and mechanism(s) of action remain to be fully elucidated. Herein we reveal the identification of a family of three LIM domain-containing proteins, LIMD1, Ajuba and WTIP (Ajuba LIM proteins) as novel mammalian processing body (P-body) components, which highlight a novel mechanism of miRNA-mediated gene silencing. Furthermore, we reveal that LIMD1, Ajuba, and WTIP bind to Ago1/2, RCK, Dcp2, and eIF4E in vivo, that they are required for miRNA-mediated, but not siRNA-mediated gene silencing and that all three proteins bind to the mRNA 5′ m7GTP cap–protein complex. Mechanistically, we propose the Ajuba LIM proteins interact with the m7GTP cap structure via a specific interaction with eIF4E that prevents 4EBP1 and eIF4G interaction. In addition, these LIM-domain proteins facilitate miRNA-mediated gene silencing by acting as an essential molecular link between the translationally inhibited eIF4E-m7GTP-5′cap and Ago1/2 within the miRISC complex attached to the 3′-UTR of mRNA, creating an inhibitory closed-loop complex. PMID:20616046

Massive Gene Transfer and Extensive RNA Editing of a Symbiotic Dinoflagellate Plastid Genome

PubMed Central

Mungpakdee, Sutada; Shinzato, Chuya; Takeuchi, Takeshi; Kawashima, Takeshi; Koyanagi, Ryo; Hisata, Kanako; Tanaka, Makiko; Goto, Hiroki; Fujie, Manabu; Lin, Senjie; Satoh, Nori; Shoguchi, Eiichi

2014-01-01

Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8–3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine types of RNA editing, including a novel G/U type, were discovered in minicircle transcripts but not in genes transferred to the nucleus. In contrast to DNA editing sites in dinoflagellate mitochondria, which tend to be highly conserved across all taxa, editing sites employed in DNA minicircles are highly variable from species to species. Editing is crucial for core photosystem protein function. It restores evolutionarily conserved amino acids and increases peptidyl hydropathy. It also increases protein plasticity necessary to initiate photosystem complex assembly. PMID:24881086

EGO-1, a C. elegans RdRP, Modulates Gene Expression via Production of mRNA-Templated Short Antisense RNAs

PubMed Central

Maniar, Jay M.; Fire, Andrew Z.

2011-01-01

SUMMARY Background The development of the germline in Caenorhabditis elegans is a complex process involving the regulation of thousands of genes in a coordinated manner. Several genes required for small RNA biogenesis and function are among those required for the proper organization of the germline. EGO-1 is a putative RNA-directed RNA polymerase (RdRP) that is required for multiple aspects of C. elegans germline development and efficient RNAi of germline-expressed genes. RdRPs have been proposed to act through a variety of mechanisms including the post-transcriptional targeting of specific mRNAs as well as through a direct interaction with chromatin. Despite extensive investigation, the molecular role of EGO-1 has remained enigmatic. Results Here we use high-throughput small RNA and messenger RNA sequencing to investigate EGO-1 function. We found that EGO-1 is required to produce a distinct pool of small RNAs antisense to a number of germline-expressed mRNAs through several developmental stages. These potential mRNA targets fall into distinct classes, including genes required for kinetochore and nuclear pore assembly, histone-modifying activities and centromeric proteins. We also found several RNAi-related genes to be targets of EGO-1. Finally, we show a strong association between the loss of small RNAs and the rise of mRNA levels in ego-1(−) animals. Conclusions Our data support the conclusion that EGO-1 produces triphosphorylated small RNAs derived from mRNA templates and that these small RNAs modulate gene expression through the targeting of their cognate mRNAs. PMID:21396820

RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

PubMed Central

Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

1999-01-01

In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

PubMed

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

Identification of suitable reference genes for hepatic microRNA quantitation.

PubMed

Lamba, Vishal; Ghodke-Puranik, Yogita; Guan, Weihua; Lamba, Jatinder K

2014-03-07

MicroRNAs (miRNAs) are short (~22 nt) endogenous RNAs that play important roles in regulating expression of a wide variety of genes involved in different cellular processes. Alterations in microRNA expression patterns have been associated with a number of human diseases. Accurate quantitation of microRNA levels is important for their use as biomarkers and in determining their functions. Real time PCR is the gold standard and the most frequently used technique for miRNA quantitation. Real time PCR data analysis includes normalizing the amplification data to suitable endogenous control/s to ensure that microRNA quantitation is not affected by the variability that is potentially introduced at different experimental steps. U6 (RNU6A) and RNU6B are two commonly used endogenous controls in microRNA quantitation. The present study was designed to investigate inter-individual variability and gender differences in hepatic microRNA expression as well as to identify the best endogenous control/s that could be used for normalization of real-time expression data in liver samples. We used Taqman based real time PCR to quantitate hepatic expression levels of 22 microRNAs along with U6 and RNU6B in 50 human livers samples (25 M, 25 F). To identify the best endogenous controls for use in data analysis, we evaluated the amplified candidates for their stability (least variability) in expression using two commonly used software programs: Normfinder and GeNormplus, Both Normfinder and GeNormplus identified U6 to be among the least stable of all the candidates analyzed, and RNU6B was also not among the top genes in stability. mir-152 and mir-23b were identified to be the two most stable candidates by both Normfinder and GeNormplus in our analysis, and were used as endogenous controls for normalization of hepatic miRNA levels. Measurements of microRNA stability indicate that U6 and RNU6B are not suitable for use as endogenous controls for normalizing microRNA relative quantitation

Identification of potential crucial genes and construction of microRNA-mRNA negative regulatory networks in osteosarcoma.

PubMed

Pan, Yue; Lu, Lingyun; Chen, Junquan; Zhong, Yong; Dai, Zhehao

2018-01-01

This study aimed to identify potential crucial genes and construction of microRNA-mRNA negative regulatory networks in osteosarcoma by comprehensive bioinformatics analysis. Data of gene expression profiles (GSE28424) and miRNA expression profiles (GSE28423) were downloaded from GEO database. The differentially expressed genes (DEGs) and miRNAs (DEMIs) were obtained by R Bioconductor packages. Functional and enrichment analyses of selected genes were performed using DAVID database. Protein-protein interaction (PPI) network was constructed by STRING and visualized in Cytoscape. The relationships among the DEGs and module in PPI network were analyzed by plug-in NetworkAnalyzer and MCODE seperately. Through the TargetScan and comparing target genes with DEGs, the miRNA-mRNA regulation network was established. Totally 346 DEGs and 90 DEMIs were found to be differentially expressed. These DEGs were enriched in biological processes and KEGG pathway of inflammatory immune response. 25 genes in the PPI network were selected as hub genes. Top 10 hub genes were TYROBP, HLA-DRA, VWF, PPBP, SERPING1, HLA-DPA1, SERPINA1, KIF20A, FERMT3, HLA-E. PPI network of DEGs followed a pattern of power law network and met the characteristics of small-world network. MCODE analysis identified 4 clusters and the most significant cluster consisted of 11 nodes and 55 edges. SEPP1, CKS2, TCAP, BPI were identified as the seed genes in their own clusters, respectively. The miRNA-mRNA regulation network which was composed of 89 pairs was established. MiR-210 had the highest connectivity with 12 target genes. Among the predicted target of MiR-96, HLA-DPA1 and TYROBP were the hub genes. Our study indicated possible differentially expressed genes and miRNA, and microRNA-mRNA negative regulatory networks in osteosarcoma by bioinformatics analysis, which may provide novel insights for unraveling pathogenesis of osteosarcoma.

Methylation of miRNA genes and oncogenesis.

PubMed

Loginov, V I; Rykov, S V; Fridman, M V; Braga, E A

2015-02-01

Interaction between microRNA (miRNA) and messenger RNA of target genes at the posttranscriptional level provides fine-tuned dynamic regulation of cell signaling pathways. Each miRNA can be involved in regulating hundreds of protein-coding genes, and, conversely, a number of different miRNAs usually target a structural gene. Epigenetic gene inactivation associated with methylation of promoter CpG-islands is common to both protein-coding genes and miRNA genes. Here, data on functions of miRNAs in development of tumor-cell phenotype are reviewed. Genomic organization of promoter CpG-islands of the miRNA genes located in inter- and intragenic areas is discussed. The literature and our own results on frequency of CpG-island methylation in miRNA genes from tumors are summarized, and data regarding a link between such modification and changed activity of miRNA genes and, consequently, protein-coding target genes are presented. Moreover, the impact of miRNA gene methylation on key oncogenetic processes as well as affected signaling pathways is discussed.

Effects of MicroRNA-23a on Differentiation and Gene Expression Profiles in 3T3-L1 Adipocytes

PubMed Central

Huang, Yong; Huang, Jinxiu; Qi, Renli; Wang, Qi; Wu, Yongjiang; Wang, Jing

2016-01-01

MicroRNAs (miRNAs) are small non-coding RNA molecules that regulate growth, development, and programmed death of cells. A newly-published study has shown that miRNA-23a could regulate 3T3-L1 adipocyte differentiation. Here, we identified miRNA-23a as a negative regulator of 3T3-L1 adipocyte differentiation again. Over-expression of miRNA-23a inhibited differentiation and decreased lipogenesis as well as down-regulated mRNA and protein expression of both peroxisome proliferator-activated receptor (PPAR) γ and fatty acid binding protein (FABP) 4, whereas knock down of miRNA-23a showed the opposite effects on differentiation as well as increasing the number of apoptotic cells. Additionally, digital gene expression profiling sequencing (DGE-Seq) was used to assay changes in gene expression profiles following alterations in the level of miR-23a. In total, over-expression or knock down of miRNA-23a significantly changed the expression of 313 and 425 genes, respectively. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses indicated that these genes were mainly involved in the stress response, immune system, metabolism, cell cycle, among other pathways. Additionally, the signal transducer and activator of transcription 1 (Stat1) was shown to be a target of miRNA-23a by computational and dual-luciferase reporter assays that indicated Janus Kinase (Jak)-Stat signal pathway was implicated in regulating adipogenesis mediated by miRNA-23a in adipocytes. PMID:27783036

A conserved intronic U1 snRNP-binding sequence promotes trans-splicing in Drosophila

PubMed Central

Gao, Jun-Li; Fan, Yu-Jie; Wang, Xiu-Ye; Zhang, Yu; Pu, Jia; Li, Liang; Shao, Wei; Zhan, Shuai; Hao, Jianjiang

2015-01-01

Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5′ intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5′ intron finds the 3′ introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5′ intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing. PMID:25838544

Mollusk genes encoding lysine tRNA (UUU) contain introns.

PubMed

Matsuo, M; Abe, Y; Saruta, Y; Okada, N

1995-11-20

New intron-containing genes encoding tRNAs were discovered when genomic DNA isolated from various animal species was amplified by the polymerase chain reaction (PCR) with primers based on sequences of rabbit tRNA(Lys). From sequencing analysis of the products of PCR, we found that introns are present in several genes encoding tRNA(Lys) in mollusks, such as Loligo bleekeri (squid) and Octopus vulgaris (octopus). These introns were specific to genes encoding tRNA(Lys)(CUU) and were not present in genes encoding tRNA(Lys)(CUU). In addition, the sequences of the introns were different from one another. To confirm the results of our initial experiments, we isolated and sequenced genes encoding tRNA(Lys)(CUU) and tRNA(Lys)(UUU). The gene for tRNA(Lys)(UUU) from squid contained an intron, whose sequence was the same as that identified by PCR, and the gene formed a cluster with a corresponding pseudogene. Several DNA regions of 2.1 kb containing this cluster appeared to be tandemly arrayed in the squid genome. By contrast, the gene encoding tRNA(Lys)(CUU) did not contain an intron, as shown also by PCR. The tRNA(Lys)(UUU) that corresponded to the analyzed gene was isolated and characterized. The present study provides the first example of an intron-containing gene encoding a tRNA in mollusks and suggests the universality of introns in such genes in higher eukaryotes.

U14 small nucleolar RNA makes multiple contacts with the pre-ribosomal RNA.

PubMed

Morrissey, J P; Tollervey, D

1997-06-01

The small nucleolar RNA (snoRNA) U14 has two regions of extended primary sequence complementarity to the 18S rRNA. The 3' region (domain B) shows the consensus structure for the methylation guide class of snoRNAs, whereas base-pairing between the 5' region (domain A) and the 18S rRNA sequence is required for the formation of functional ribosomes. Between domains A and B lies another essential region (domain Y). Here we report that yeast U14 can be cross-linked in vivo to the pre-rRNA; cross-linking is detected exclusively with the 35S primary transcript. Many nucleotides in U14 that lie outside of domains A and B are cross-linked to the pre-rRNA; in particular the essential domain Y region is cross-linked at several sites. U14 is, therefore, in far more extensive contact with the pre-rRNA than predicted from simple base-pairing models. Moreover, U14 can be cross-linked to other small RNA species. The functional interactions made by U14 during ribosome synthesis are likely to be very complex.

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

NASA Astrophysics Data System (ADS)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Massive gene transfer and extensive RNA editing of a symbiotic dinoflagellate plastid genome.

PubMed

Mungpakdee, Sutada; Shinzato, Chuya; Takeuchi, Takeshi; Kawashima, Takeshi; Koyanagi, Ryo; Hisata, Kanako; Tanaka, Makiko; Goto, Hiroki; Fujie, Manabu; Lin, Senjie; Satoh, Nori; Shoguchi, Eiichi

2014-05-31

Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8-3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine types of RNA editing, including a novel G/U type, were discovered in minicircle transcripts but not in genes transferred to the nucleus. In contrast to DNA editing sites in dinoflagellate mitochondria, which tend to be highly conserved across all taxa, editing sites employed in DNA minicircles are highly variable from species to species. Editing is crucial for core photosystem protein function. It restores evolutionarily conserved amino acids and increases peptidyl hydropathy. It also increases protein plasticity necessary to initiate photosystem complex assembly. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

[Expression of the Drosophila melanogaster limk1 gene 3'-UTRs mRNA in Yeast Saccharomyces cerevisiae].

PubMed

Rumyantsev, A M; Zakharov, G A; Zhuravlev, A V; Padkina, M V; Savvateeva-Popova, E V; Sambuk, E V

2014-06-01

The stability of mRNA and its translation efficacy in higher eukaryotes are influenced by the interaction of 3'-untranscribed regions (3'-UTRs) with microRNAs and RNA-binding proteins. Since Saccharomyces cerevisiae lack microRNAs, it is possible to evaluate the contribution of only 3'-UTRs' and RNA-binding proteins' interaction in post-transcriptional regulation. For this, the post-transcriptional regulation of Drosophila limk1 gene encoding for the key enzyme of actin remodeling was studied in yeast. Analysis of limkl mRNA 3'-UTRs revealed the potential sites of yeast transcriptional termination. Computer remodeling demonstrated the possibility of secondary structure formation in limkl mRNA 3'-UTRs. For an evaluation of the functional activity of Drosophila 3'-UTRs in yeast, the reporter gene PHO5 encoding for yeast acid phosphatase (AP) fused to different variants of Drosophila limk1 mRNA 3'-UTRs (513, 1075, 1554 bp) was used. Assessments of AP activity and RT-PCR demonstrated that Drosophila limkl gene 3'-UTRs were functionally active and recognized in yeast. Therefore, yeast might be used as an appropriate model system for studies of 3'-UTR's role in post-transcriptional regulation.

Control of aflatoxin production of Aspergillus flavus and Aspergillus parasiticus using RNA silencing technology by targeting aflD (nor-1) gene.

PubMed

Abdel-Hadi, Ahmed M; Caley, Daniel P; Carter, David R F; Magan, Naresh

2011-06-01

Aspergillus flavus and Aspergillus parasiticus are important pathogens of cotton, corn, peanuts and other oil-seed crops, producing toxins both in the field and during storage. We have designed three siRNA sequences (Nor-Ia, Nor-Ib, Nor-Ic) to target the mRNA sequence of the aflD gene to examine the potential for using RNA silencing technology to control aflatoxin production. Thus, the effect of siRNAs targeting of two key genes in the aflatoxin biosynthetic pathway, aflD (structural) and aflR (regulatory gene) and on aflatoxin B(1 )(AFB(1)), and aflatoxin G(1) (AFG(1)) production was examined. The study showed that Nor-Ib gave a significant decrease in aflD mRNA, aflR mRNA abundance, and AFB(1) production (98, 97 and 97% when compared to the controls) in A. flavus NRRL3357, respectively. Reduction in aflD and aflR mRNA abundance and AFB(1 )production increased with concentration of siRNA tested. There was a significant inhibition in aflD and AFB(1) production by A. flavus EGP9 and AFG(1 )production by A. parasiticus NRRL 13005. However, there was no significant decrease in AFG(1) production by A. parasiticus SSWT 2999. Changes in AFB(1) production in relation to mRNA levels of aflD showed a good correlation (R = 0.88; P = 0.00001); changes in aflR mRNA level in relation to mRNA level of aflD also showed good correlation (R = 0.82; P = 0.0001). The correlations between changes in aflR and aflD gene expression suggests a strong relationship between these structural and regulatory genes, and that aflD could be used as a target gene to develop efficient means for aflatoxin control using RNA silencing technology.

Gene amplification-associated overexpression of the RNA editing enzyme ADAR1 enhances human lung tumorigenesis.

PubMed

Anadón, C; Guil, S; Simó-Riudalbas, L; Moutinho, C; Setien, F; Martínez-Cardús, A; Moran, S; Villanueva, A; Calaf, M; Vidal, A; Lazo, P A; Zondervan, I; Savola, S; Kohno, T; Yokota, J; Ribas de Pouplana, L; Esteller, M

2016-08-18

The introduction of new therapies against particular genetic mutations in non-small-cell lung cancer is a promising avenue for improving patient survival, but the target population is small. There is a need to discover new potential actionable genetic lesions, to which end, non-conventional cancer pathways, such as RNA editing, are worth exploring. Herein we show that the adenosine-to-inosine editing enzyme ADAR1 undergoes gene amplification in non-small cancer cell lines and primary tumors in association with higher levels of the corresponding mRNA and protein. From a growth and invasion standpoint, the depletion of ADAR1 expression in amplified cells reduces their tumorigenic potential in cell culture and mouse models, whereas its overexpression has the opposite effects. From a functional perspective, ADAR1 overexpression enhances the editing frequencies of target transcripts such as NEIL1 and miR-381. In the clinical setting, patients with early-stage lung cancer, but harboring ADAR1 gene amplification, have poor outcomes. Overall, our results indicate a role for ADAR1 as a lung cancer oncogene undergoing gene amplification-associated activation that affects downstream RNA editing patterns and patient prognosis.

Design and interpretation of microRNA-reporter gene activity.

PubMed

Carroll, Adam P; Tooney, Paul A; Cairns, Murray J

2013-06-15

MicroRNAs (miRNAs) are small noncoding RNA molecules that act as sequence specificity guides to direct post-transcriptional gene silencing. In doing so, miRNAs regulate many critical developmental processes, including cellular proliferation, differentiation, migration, and apoptosis, as well as more specialized biological functions such as dendritic spine development and synaptogenesis. Interactions between miRNAs and their miRNA recognition elements occur via partial complementarity, rendering tremendous redundancy in targeting such that miRNAs are predicted to regulate 60% of the genome, with each miRNA estimated to regulate more than 200 genes. Because these predictions are prone to false positives and false negatives, there is an ever present need to provide material support to these assertions to firmly establish the biological function of specific miRNAs in both normal and pathophysiological contexts. Using schizophrenia-associated miR-181b as an example, we present detailed guidelines and novel insights for the rapid establishment of a streamlined miRNA-reporter gene assay and explore various design concepts for miRNA-reporter gene applications, including bidirectional miRNA modulation. In exemplifying this approach, we report seven novel miR-181b target sites for five schizophrenia candidate genes (DISC1, BDNF, ENKUR, GRIA1, and GRIK1) and dissect a number of vital concepts regarding future developments for miRNA-reporter gene assays and the interpretation of their results. Copyright © 2013 Elsevier Inc. All rights reserved.

uAUG-mediated translational initiations are responsible for human mu opioid receptor gene expression

PubMed Central

Song, Kyu Young; Kim, Chun Sung; Hwang, Cheol Kyu; Choi, Hack Sun; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H

2010-01-01

Abstract Mu opioid receptor (MOR) is the main site of interaction for major clinical analgesics, particularly morphine. MOR expression is regulated at the transcriptional and post-transcriptional levels. However, the protein expression of the MOR gene is relatively low and the translational control of MOR gene has not been well studied. The 5′-untranslated region (UTR) of the human MOR (OPRM1) mRNA contains four upstream AUG codons (uAUG) preceding the main translation initiation site. We mutated the four uAUGs individually and in combination. Mutations of the third uAUG, containing the same open reading frame, had the strongest inhibitory effect. The inhibitory effect caused by the third in-frame uAUG was confirmed by in vitro translation and receptor-binding assays. Toeprinting results showed that OPRM1 ribosomes initiated efficiently at the first uAUG, and subsequently re-initiated at the in-frame #3 uAUG and the physiological AUG site. This re-initiation resulted in negative expression of OPRM1 under normal conditions. These results indicate that re-initiation in MOR gene expression could play an important role in OPRM1 regulation. PMID:19438807

Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

PubMed Central

Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

2011-01-01

Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

Colocalization and Membrane Association of Murine Hepatitis Virus Gene 1 Products and De Novo-Synthesized Viral RNA in Infected Cells

PubMed Central

Shi, Stephanie T.; Schiller, Jennifer J.; Kanjanahaluethai, Amornrat; Baker, Susan C.; Oh, Jong-Won; Lai, Michael M. C.

1999-01-01

Murine hepatitis virus (MHV) gene 1, the 22-kb polymerase (pol) gene, is first translated into a polyprotein and subsequently processed into multiple proteins by viral autoproteases. Genetic complementation analyses suggest that the majority of the gene 1 products are required for viral RNA synthesis. However, there is no physical evidence supporting the association of any of these products with viral RNA synthesis. We have now performed immunofluorescent-staining studies with four polyclonal antisera to localize various MHV-A59 gene 1 products in virus-infected cells. Immunoprecipitation experiments showed that these antisera detected proteins representing the two papain-like proteases and the 3C-like protease encoded by open reading frame (ORF) 1a, the putative polymerase (p100) and a p35 encoded by ORF 1b, and their precursors. De novo-synthesized viral RNA was labeled with bromouridine triphosphate in lysolecithin-permeabilized MHV-infected cells. Confocal microscopy revealed that all of the viral proteins detected by these antisera colocalized with newly synthesized viral RNA in the cytoplasm, particularly in the perinuclear region of infected cells. Several cysteine and serine protease inhibitors, i.e., E64d, leupeptin, and zinc chloride, inhibited viral RNA synthesis without affecting the localization of viral proteins, suggesting that the processing of the MHV gene 1 polyprotein is tightly associated with viral RNA synthesis. Dual labeling with antibodies specific for cytoplasmic membrane structures showed that MHV gene 1 products and RNA colocalized with the Golgi apparatus in HeLa cells. However, in murine 17CL-1 cells, the viral proteins and viral RNA did not colocalize with the Golgi apparatus but, instead, partially colocalized with the endoplasmic reticulum. Our results provide clear physical evidence that several MHV gene 1 products, including the proteases and the polymerase, are associated with the viral RNA replication-transcription machinery

--RNA Polymerase II Transcription Attenuation at the Yeast DNA Repair Gene, DEF1, Involves Sen1-Dependent and Polyadenylation Site-Dependent Termination.

PubMed

Whalen, Courtney; Tuohy, Christine; Tallo, Thomas; Kaufman, James W; Moore, Claire; Kuehner, Jason N

2018-04-23

Termination of RNA Polymerase II (Pol II) activity serves a vital cellular function by separating ubiquitous transcription units and influencing RNA fate and function. In the yeast Saccharomyces cerevisiae , Pol II termination is carried out by cleavage and polyadenylation factor (CPF-CF) and Nrd1-Nab3-Sen1 (NNS) complexes, which operate primarily at mRNA and non-coding RNA genes, respectively. Premature Pol II termination (attenuation) contributes to gene regulation, but there is limited knowledge of its prevalence and biological significance. In particular, it is unclear how much crosstalk occurs between CPF-CF and NNS complexes and how Pol II attenuation is modulated during stress adaptation. In this study, we have identified an attenuator in the DEF1 DNA repair gene, which includes a portion of the 5'-untranslated region (UTR) and upstream open reading frame (ORF). Using a plasmid-based reporter gene system, we conducted a genetic screen of 14 termination mutants and their ability to confer Pol II read-through defects. The DEF1 attenuator behaved as a hybrid terminator, relying heavily on CPF-CF and Sen1 but without Nrd1 and Nab3 involvement. Our genetic selection identified 22 cis -acting point mutations that clustered into four regions, including a polyadenylation site efficiency element that genetically interacts with its cognate binding-protein Hrp1. Outside of the reporter gene context, a DEF1 attenuator mutant increased mRNA and protein expression, exacerbating the toxicity of a constitutively active Def1 protein. Overall, our data support a biologically significant role for transcription attenuation in regulating DEF1 expression, which can be modulated during the DNA damage response. Copyright © 2018, G3: Genes, Genomes, Genetics.

Mutation of the RDR1 gene caused genome-wide changes in gene expression, regional variation in small RNA clusters and localized alteration in DNA methylation in rice.

PubMed

Wang, Ningning; Zhang, Di; Wang, Zhenhui; Xun, Hongwei; Ma, Jian; Wang, Hui; Huang, Wei; Liu, Ying; Lin, Xiuyun; Li, Ning; Ou, Xiufang; Zhang, Chunyu; Wang, Ming-Bo; Liu, Bao

2014-06-30

Endogenous small (sm) RNAs (primarily si- and miRNAs) are important trans/cis-acting regulators involved in diverse cellular functions. In plants, the RNA-dependent RNA polymerases (RDRs) are essential for smRNA biogenesis. It has been established that RDR2 is involved in the 24 nt siRNA-dependent RNA-directed DNA methylation (RdDM) pathway. Recent studies have suggested that RDR1 is involved in a second RdDM pathway that relies mostly on 21 nt smRNAs and functions to silence a subset of genomic loci that are usually refractory to the normal RdDM pathway in Arabidopsis. Whether and to what extent the homologs of RDR1 may have similar functions in other plants remained unknown. We characterized a loss-of-function mutant (Osrdr1) of the OsRDR1 gene in rice (Oryza sativa L.) derived from a retrotransposon Tos17 insertion. Microarray analysis identified 1,175 differentially expressed genes (5.2% of all expressed genes in the shoot-tip tissue of rice) between Osrdr1 and WT, of which 896 and 279 genes were up- and down-regulated, respectively, in Osrdr1. smRNA sequencing revealed regional alterations in smRNA clusters across the rice genome. Some of the regions with altered smRNA clusters were associated with changes in DNA methylation. In addition, altered expression of several miRNAs was detected in Osrdr1, and at least some of which were associated with altered expression of predicted miRNA target genes. Despite these changes, no phenotypic difference was identified in Osrdr1 relative to WT under normal condition; however, ephemeral phenotypic fluctuations occurred under some abiotic stress conditions. Our results showed that OsRDR1 plays a role in regulating a substantial number of endogenous genes with diverse functions in rice through smRNA-mediated pathways involving DNA methylation, and which participates in abiotic stress response.

Inhibition of HIV-1 gene expression by retroviral vector-mediated small-guide RNAs that direct specific RNA cleavage by tRNase ZL

PubMed Central

Habu, Yuichiro; Miyano-Kurosaki, Naoko; Kitano, Michiko; Endo, Yumihiko; Yukita, Masakazu; Ohira, Shigeru; Takaku, Hiroaki; Nashimoto, Masayuki; Takaku, Hiroshi

2005-01-01

The tRNA 3′-processing endoribonuclease (tRNase Z or 3′ tRNase; EC 3.1.26.11) is an essential enzyme that removes the 3′ trailer from pre-tRNA. The long form (tRNase ZL) can cleave a target RNA in vitro at the site directed by an appropriate small-guide RNA (sgRNA). Here, we investigated whether this sgRNA/tRNase ZL strategy could be applied to gene therapy for AIDS. We tested the ability of four sgRNA-expression plasmids to inhibit HIV-1 gene expression in COS cells, using a transient-expression assay. The three sgRNAs guide inhibition of HIV-1 gene expression in cultured COS cells. Analysis of the HIV-1 mRNA levels suggested that sgRNA directed the tRNase ZL to mediate the degradation of target RNA. The observation that sgRNA was localized primarily in nuclei suggests that tRNase ZL cleaves the HIV-1 mRNA when complexed with sgRNA in this location. We also examined the ability of two retroviral vectors expressing sgRNA to suppress HIV-1 expression in HIV-1-infected Jurkat T cells. sgRNA-SL4 suppressed HIV-1 expression almost completely in infected cells for up to 18 days. These results suggest that the sgRNA/tRNase ZL approach is effective in downregulating HIV-1 gene expression. PMID:15647506

CUS2, a Yeast Homolog of Human Tat-SF1, Rescues Function of Misfolded U2 through an Unusual RNA Recognition Motif

PubMed Central

Yan, Dong; Perriman, Rhonda; Igel, Haller; Howe, Kenneth J.; Neville, Megan; Ares, Manuel

1998-01-01

A screen for suppressors of a U2 snRNA mutation identified CUS2, an atypical member of the RNA recognition motif (RRM) family of RNA binding proteins. CUS2 protein is associated with U2 RNA in splicing extracts and interacts with PRP11, a subunit of the conserved splicing factor SF3a. Absence of CUS2 renders certain U2 RNA folding mutants lethal, arguing that a normal activity of CUS2 is to help refold U2 into a structure favorable for its binding to SF3b and SF3a prior to spliceosome assembly. Both CUS2 function in vivo and the in vitro RNA binding activity of CUS2 are disrupted by mutation of the first RRM, suggesting that rescue of misfolded U2 involves the direct binding of CUS2. Human Tat-SF1, reported to stimulate Tat-specific, transactivating region-dependent human immunodeficiency virus transcription in vitro, is structurally similar to CUS2. Anti-Tat-SF1 antibodies coimmunoprecipitate SF3a66 (SAP62), the human homolog of PRP11, suggesting that Tat-SF1 has a parallel function in splicing in human cells. PMID:9710584

Correct mRNA Processing at a Mutant TT Splice Donor in FANCC Ameliorates the Clinical Phenotype in Patients and Is Enhanced by Delivery of Suppressor U1 snRNAs

PubMed Central

Hartmann, Linda; Neveling, Kornelia; Borkens, Stephanie; Schneider, Hildegard; Freund, Marcel; Grassman, Elke; Theiss, Stephan; Wawer, Angela; Burdach, Stefan; Auerbach, Arleen D.; Schindler, Detlev; Hanenberg, Helmut; Schaal, Heiner

2010-01-01

The U1 small nuclear RNA (U1 snRNA) as a component of the major U2-dependent spliceosome recognizes 5′ splice sites (5′ss) containing GT as the canonical dinucleotide in the intronic positions +1 and +2. The c.165+1G>T germline mutation in the 5′ss of exon 2 of the Fanconi anemia C (FANCC) gene commonly predicted to prevent correct splicing was identified in nine FA patients from three pedigrees. RT-PCR analysis of the endogenous FANCC mRNA splicing pattern of patient-derived fibroblasts revealed aberrant mRNA processing, but surprisingly also correct splicing at the TT dinucleotide, albeit with lower efficiency. This consequently resulted in low levels of correctly spliced transcript and minute levels of normal posttranslationally processed FANCD2 protein, indicating that this naturally occurring TT splicing might contribute to the milder clinical manifestations of the disease in these patients. Functional analysis of this FANCC 5′ss within splicing reporters revealed that both the noncanonical TT dinucleotide and the genomic context of FANCC were required for the residual correct splicing at this mutant 5′ss. Finally, use of lentiviral vectors as a delivery system to introduce expression cassettes for TT-adapted U1 snRNAs into primary FANCC patient fibroblasts allowed the correction of the DNA-damage-induced G2 cell-cycle arrest in these cells, thus representing an alternative transcript-targeting approach for genetic therapy of inherited splice-site mutations. PMID:20869034

Gene expression and splicing alterations analyzed by high throughput RNA sequencing of chronic lymphocytic leukemia specimens.

PubMed

Liao, Wei; Jordaan, Gwen; Nham, Phillipp; Phan, Ryan T; Pelegrini, Matteo; Sharma, Sanjai

2015-10-16

To determine differentially expressed and spliced RNA transcripts in chronic lymphocytic leukemia specimens a high throughput RNA-sequencing (HTS RNA-seq) analysis was performed. Ten CLL specimens and five normal peripheral blood CD19+ B cells were analyzed by HTS RNA-seq. The library preparation was performed with Illumina TrueSeq RNA kit and analyzed by Illumina HiSeq 2000 sequencing system. An average of 48.5 million reads for B cells, and 50.6 million reads for CLL specimens were obtained with 10396 and 10448 assembled transcripts for normal B cells and primary CLL specimens respectively. With the Cuffdiff analysis, 2091 differentially expressed genes (DEG) between B cells and CLL specimens based on FPKM (fragments per kilobase of transcript per million reads and false discovery rate, FDR q < 0.05, fold change >2) were identified. Expression of selected DEGs (n = 32) with up regulated and down regulated expression in CLL from RNA-seq data were also analyzed by qRT-PCR in a test cohort of CLL specimens. Even though there was a variation in fold expression of DEG genes between RNA-seq and qRT-PCR; more than 90 % of analyzed genes were validated by qRT-PCR analysis. Analysis of RNA-seq data for splicing alterations in CLL and B cells was performed by Multivariate Analysis of Transcript Splicing (MATS analysis). Skipped exon was the most frequent splicing alteration in CLL specimens with 128 significant events (P-value <0.05, minimum inclusion level difference >0.1). The RNA-seq analysis of CLL specimens identifies novel DEG and alternatively spliced genes that are potential prognostic markers and therapeutic targets. High level of validation by qRT-PCR for a number of DEG genes supports the accuracy of this analysis. Global comparison of transcriptomes of B cells, IGVH non-mutated CLL (U-CLL) and mutated CLL specimens (M-CLL) with multidimensional scaling analysis was able to segregate CLL and B cell transcriptomes but the M-CLL and U-CLL transcriptomes

Structure, dynamics and RNA binding of the multi-domain splicing factor TIA-1

PubMed Central

Wang, Iren; Hennig, Janosch; Jagtap, Pravin Kumar Ankush; Sonntag, Miriam; Valcárcel, Juan; Sattler, Michael

2014-01-01

Alternative pre-messenger ribonucleic acid (pre-mRNA) splicing is an essential process in eukaryotic gene regulation. The T-cell intracellular antigen-1 (TIA-1) is an apoptosis-promoting factor that modulates alternative splicing of transcripts, including the pre-mRNA encoding the membrane receptor Fas. TIA-1 is a multi-domain ribonucleic acid (RNA) binding protein that recognizes poly-uridine tract RNA sequences to facilitate 5′ splice site recognition by the U1 small nuclear ribonucleoprotein (snRNP). Here, we characterize the RNA interaction and conformational dynamics of TIA-1 by nuclear magnetic resonance (NMR), isothermal titration calorimetry (ITC) and small angle X-ray scattering (SAXS). Our NMR-derived solution structure of TIA-1 RRM2–RRM3 (RRM2,3) reveals that RRM2 adopts a canonical RNA recognition motif (RRM) fold, while RRM3 is preceded by an non-canonical helix α0. NMR and SAXS data show that all three RRMs are largely independent structural modules in the absence of RNA, while RNA binding induces a compact arrangement. RRM2,3 binds to pyrimidine-rich FAS pre-mRNA or poly-uridine (U9) RNA with nanomolar affinities. RRM1 has little intrinsic RNA binding affinity and does not strongly contribute to RNA binding in the context of RRM1,2,3. Our data unravel the role of binding avidity and the contributions of the TIA-1 RRMs for recognition of pyrimidine-rich RNAs. PMID:24682828

The RNA polymerase III-dependent family of genes in hemiascomycetes: comparative RNomics, decoding strategies, transcription and evolutionary implications

PubMed Central

Marck, Christian; Kachouri-Lafond, Rym; Lafontaine, Ingrid; Westhof, Eric; Dujon, Bernard; Grosjean, Henri

2006-01-01

We present the first comprehensive analysis of RNA polymerase III (Pol III) transcribed genes in ten yeast genomes. This set includes all tRNA genes (tDNA) and genes coding for SNR6 (U6), SNR52, SCR1 and RPR1 RNA in the nine hemiascomycetes Saccharomyces cerevisiae, Saccharomyces castellii, Candida glabrata, Kluyveromyces waltii, Kluyveromyces lactis, Eremothecium gossypii, Debaryomyces hansenii, Candida albicans, Yarrowia lipolytica and the archiascomycete Schizosaccharomyces pombe. We systematically analysed sequence specificities of tRNA genes, polymorphism, variability of introns, gene redundancy and gene clustering. Analysis of decoding strategies showed that yeasts close to S.cerevisiae use bacterial decoding rules to read the Leu CUN and Arg CGN codons, in contrast to all other known Eukaryotes. In D.hansenii and C.albicans, we identified a novel tDNA-Leu (AAG), reading the Leu CUU/CUC/CUA codons with an unusual G at position 32. A systematic ‘p-distance tree’ using the 60 variable positions of the tRNA molecule revealed that most tDNAs cluster into amino acid-specific sub-trees, suggesting that, within hemiascomycetes, orthologous tDNAs are more closely related than paralogs. We finally determined the bipartite A- and B-box sequences recognized by TFIIIC. These minimal sequences are nearly conserved throughout hemiascomycetes and were satisfactorily retrieved at appropriate locations in other Pol III genes. PMID:16600899

Gene expression profile after activation of RIG-I in 5'ppp-dsRNA challenged DF1.

PubMed

Chen, Yang; Xu, Qi; Li, Yang; Liu, Ran; Huang, Zhengyang; Wang, Bin; Chen, Guohong

2016-12-01

Retinoic acid inducible gene I (RIG-I) can recognize influenza viruses and evoke the innate immune response. RIG-I is absent in the chicken genome, but is conserved in the genome of ducks. Lack of RIG-I renders chickens more susceptible to avian influenza infection, and the clinical symptoms are more prominent than in other poultry. It is unknown whether introduction of duck RIG-I into chicken cells can establish the immunity as is seen in ducks and the role of RIG-I in established immunity is unknown. In this study, a chicken cell strain with stable expression of duRIG-I was established by lentiviral infection, giving DF1/LV5-RIG-I, and a control strain DF1/LV5 was established in parallel. To verify stable, high level expression of duRIG-I in DF1 cells, the levels of duRIG-I mRNA and protein were determined by real-time RT-PCR and Western blot, respectively. Further, 5'triphosphate double stranded RNA (5'ppp-dsRNA) was used to mimic an RNA virus infection and the infected DF1/LV5-RIG-I and DF1/LV5 cells were subjected to high-throughput RNA-sequencing, which yielded 193.46 M reads and 39.07 G bases. A total of 278 differentially expressed genes (DEGs), i.e., duRIG-I-mediated responsive genes, were identified by RNA-seq. Among the 278 genes, 120 DEGs are annotated in the KEGG database, and the most reliable KEGG pathways are likely to be the signaling pathways of RIG-I like receptors. Functional analysis by Gene ontology (GO) indicates that the functions of these DEGs are primarily related to Type I interferon (IFN) signaling, IFN-β-mediated cellular responses and up-regulation of the RIG-I signaling pathway. Based on the shared genes among different pathways, a network representing crosstalk between RIG-I and other signaling pathways was constructed using Cytoscape software. The network suggests that RIG-mediated pathway may crosstalk with the Jak-STAT signaling pathway, Toll-like receptor signaling pathway, Wnt signaling pathway, ubiquitin-mediated proteolysis

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.

PubMed

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-02-11

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase

PubMed Central

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-01-01

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727

Validation of miRNA genes suitable as reference genes in qPCR analyses of miRNA gene expression in Atlantic salmon (Salmo salar).

PubMed

Johansen, Ilona; Andreassen, Rune

2014-12-23

MicroRNAs (miRNAs) are an abundant class of endogenous small RNA molecules that downregulate gene expression at the post-transcriptional level. They play important roles by regulating genes that control multiple biological processes, and recent years there has been an increased interest in studying miRNA genes and miRNA gene expression. The most common method applied to study gene expression of single genes is quantitative PCR (qPCR). However, before expression of mature miRNAs can be studied robust qPCR methods (miRNA-qPCR) must be developed. This includes identification and validation of suitable reference genes. We are particularly interested in Atlantic salmon (Salmo salar). This is an economically important aquaculture species, but no reference genes dedicated for use in miRNA-qPCR methods has been validated for this species. Our aim was, therefore, to identify suitable reference genes for miRNA-qPCR methods in Salmo salar. We used a systematic approach where we utilized similar studies in other species, some biological criteria, results from deep sequencing of small RNAs and, finally, experimental validation of candidate reference genes by qPCR to identify the most suitable reference genes. Ssa-miR-25-3p was identified as most suitable single reference gene. The best combinations of two reference genes were ssa-miR-25-3p and ssa-miR-455-5p. These two genes were constitutively and stably expressed across many different tissues. Furthermore, infectious salmon anaemia did not seem to affect their expression levels. These genes were amplified with high specificity, good efficiency and the qPCR assays showed a good linearity when applying a simple cybergreen miRNA-PCR method using miRNA gene specific forward primers. We have identified suitable reference genes for miRNA-qPCR in Atlantic salmon. These results will greatly facilitate further studies on miRNA genes in this species. The reference genes identified are conserved genes that are identical in their mature

RNA polymerase gene, microorganism having said gene and the production of RNA polymerase by the use of said microorganism

DOEpatents

Kotani, Hirokazu; Hiraoka, Nobutsugu; Obayashi, Akira

1991-01-01

SP6 bacteriophage RNA polymerase is produced by cultivating a new microorganism (particularly new strains of Escherichia coli) harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene and recovering SP6 bacteriophage RNA polymerase from the culture broth. SP6 bacteriophage RNA polymerase gene is provided as are new microorganisms harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene.

Spliceosomal protein U1A is involved in alternative splicing and salt stress tolerance in Arabidopsis thaliana

PubMed Central

Gu, Jinbao; Xia, Zhiqiang; Luo, Yuehua; Jiang, Xingyu; Qian, Bilian; Xie, He; Zhu, Jian-Kang; Xiong, Liming; Zhu, Jianhua; Wang, Zhen-Yu

2018-01-01

Abstract Soil salinity is a significant threat to sustainable agricultural production worldwide. Plants must adjust their developmental and physiological processes to cope with salt stress. Although the capacity for adaptation ultimately depends on the genome, the exceptional versatility in gene regulation provided by the spliceosome-mediated alternative splicing (AS) is essential in these adaptive processes. However, the functions of the spliceosome in plant stress responses are poorly understood. Here, we report the in-depth characterization of a U1 spliceosomal protein, AtU1A, in controlling AS of pre-mRNAs under salt stress and salt stress tolerance in Arabidopsis thaliana. The atu1a mutant was hypersensitive to salt stress and accumulated more reactive oxygen species (ROS) than the wild-type under salt stress. RNA-seq analysis revealed that AtU1A regulates AS of many genes, presumably through modulating recognition of 5′ splice sites. We showed that AtU1A is associated with the pre-mRNA of the ROS detoxification-related gene ACO1 and is necessary for the regulation of ACO1 AS. ACO1 is important for salt tolerance because ectopic expression of ACO1 in the atu1a mutant can partially rescue its salt hypersensitive phenotype. Our findings highlight the critical role of AtU1A as a regulator of pre-mRNA processing and salt tolerance in plants. PMID:29228330

The Arabidopsis polyamine transporter LHR1/PUT3 modulates heat responsive gene expression by enhancing mRNA stability.

PubMed

Shen, Yun; Ruan, Qingxia; Chai, Haoxi; Yuan, Yongze; Yang, Wannian; Chen, Junping; Xin, Zhanguo; Shi, Huazhong

2016-12-01

Polyamines involve in gene regulation by interacting with and modulating the functions of various anionic macromolecules such as DNA, RNA and proteins. In this study, we identified an important function of the polyamine transporter LHR1 (LOWER EXPRESSION OF HEAT RESPONSIVE GENE1) in heat-inducible gene expression in Arabidopsis thaliana. The lhr1 mutant was isolated through a forward genetic screening for altered expression of the luciferase reporter gene driven by the promoter from the heat-inducible gene AtHSP18.2. The lhr1 mutant showed reduced induction of the luciferase gene in response to heat stress and was more sensitive to high temperature than the wild type. Map-based cloning identified that the LHR1 gene encodes the polyamine transporter PUT3 (POLYAMINE UPTAKE TRANSPORTER 3) localized in the plasma membrane. The LHR1/PUT3 is required for the uptake of extracellular polyamines and plays an important role in stabilizing the mRNAs of several crucial heat stress responsive genes under high temperature. Genome-wide gene expression analysis using RNA-seq identified an array of differentially expressed genes, among which the transcript levels of some of the heat shock protein genes significantly reduced in response to prolonged heat stress in the lhr1 mutant. Our findings revealed an important heat stress response and tolerance mechanism involving polyamine influx which modulates mRNA stability of heat-inducible genes under heat stress conditions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Application of shRNA-containing herpes simplex virus type 1 (HSV-1)-based gene therapy for HSV-2-induced genital herpes.

PubMed

Liu, Zhihong; Xiang, Yang; Wei, Zhun; Yu, Bo; Shao, Yong; Zhang, Jie; Yang, Hong; Li, Manmei; Guan, Ming; Wan, Jun; Zhang, Wei

2013-11-01

HSV-1-based vectors have been widely used to achieve targeted delivery of genes into the nervous system. In the current study, we aim to use shRNA-containing HSV-1-based gene delivery system for the therapy of HSV-2 infection. Guinea pigs were infected intravaginally with HSV-2 and scored daily for 100 days for the severity of vaginal disease. HSV-2 shRNA-containing HSV-1 was applied intravaginally daily between 8 and 14 days after HSV-2 challenge. Delivery of HSV-2 shRNA-containing HSV-1 had no effect on the onset of disease and acute virus shedding in animals, but resulted in a significant reduction in both the cumulative recurrent lesion days and the number of days with recurrent disease. Around half of the animals in the HSV-2 shRNA group did not develop recurrent disease 100 days post HSV-2 infection. In conclusion, HSV-2 shRNA-containing HSV-1 particles are effective in reducing the recurrence of genital herpes caused by HSV-2. Copyright © 2013 Elsevier B.V. All rights reserved.

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

PubMed

Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

2016-05-01

Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

Impaired Spermatogenesis, Muscle, and Erythrocyte Function in U12 Intron Splicing-Defective Zrsr1 Mutant Mice.

PubMed

Horiuchi, Keiko; Perez-Cerezales, Serafín; Papasaikas, Panagiotis; Ramos-Ibeas, Priscila; López-Cardona, Angela Patricia; Laguna-Barraza, Ricardo; Fonseca Balvís, Noelia; Pericuesta, Eva; Fernández-González, Raul; Planells, Benjamín; Viera, Alberto; Suja, Jose Angel; Ross, Pablo Juan; Alén, Francisco; Orio, Laura; Rodriguez de Fonseca, Fernando; Pintado, Belén; Valcárcel, Juan; Gutiérrez-Adán, Alfonso

2018-04-03

The U2AF35-like ZRSR1 has been implicated in the recognition of 3' splice site during spliceosome assembly, but ZRSR1 knockout mice do not show abnormal phenotypes. To analyze ZRSR1 function and its precise role in RNA splicing, we generated ZRSR1 mutant mice containing truncating mutations within its RNA-recognition motif. Homozygous mutant mice exhibited severe defects in erythrocytes, muscle stretch, and spermatogenesis, along with germ cell sloughing and apoptosis, ultimately leading to azoospermia and male sterility. Testis RNA sequencing (RNA-seq) analyses revealed increased intron retention of both U2- and U12-type introns, including U12-type intron events in genes with key functions in spermatogenesis and spermatid development. Affected U2 introns were commonly found flanking U12 introns, suggesting functional cross-talk between the two spliceosomes. The splicing and tissue defects observed in mutant mice attributed to ZRSR1 loss of function suggest a physiological role for this factor in U12 intron splicing. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Functional analysis of U1-70K interacting SR proteins in pre-mRNA splicing in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

A.S.N. Reddy

Proteins of a serine/arginine-rich (SR) family are part of the spliceosome and are implicated in both constitutive and alternative splicing of pre-mRNAs. With the funding from DOE we have been studying alternative of splicing of genes encoding serine/arginine-rich (SR) proteins and the roles of SR proteins that interact with U1-70K in regulating basic and alternative splicing. Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins and its regulation by hormones and stresses: We analyzed the splicing of all 19 Arabidopsis genes in different tissues, during different seedling stages and in response to various hormonal and stress treatments. Remarkably, about 90 differentmore » transcripts are produced from 15 SR genes, thereby increasing the transcriptome complexity of SR genes by about five fold. Using the RNA isolated from polysomes we have shown that most of the splice variants are recruited for translation. Alternative splicing of some SR genes is controlled in a developmental and tissue-specific manner (Palusa et al., 2007). Interestingly, among the various hormones and abiotic stresses tested, temperature stress (cold and heat) and ultraviolet light dramatically altered alternative splicing of pre-mRNAs of several SR genes whereas hormones altered the splicing of only two SR genes (Palusa et al., 2007). Localization and dynamics of a novel serine/arginine-rich protein that interacts with U1-70K: We analyzed the intranuclear movement of SR45 fused to GFP by fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP). We demonstrate that the movement of GFP-SR45 is ATP-dependent. Interestingly, inhibition of transcription or phosphorylation slowed the mobility of GFP-SR45 (Ali et al., 2006). Our studies have revealed that the nuclear localization signals are located in arg/ser-rich domains (RS) 1 and 2, whereas the speckle targeting signals are exclusively present in RS2 (Ali et al., 2006). The

Expression cloning and characterization of a novel gene that encodes the RNA-binding protein FAU-1 from Pyrococcus furiosus.

PubMed Central

Kanai, Akio; Oida, Hanako; Matsuura, Nana; Doi, Hirofumi

2003-01-01

We systematically screened a genomic DNA library to identify proteins of the hyperthermophilic archaeon Pyrococcus furiosus using an expression cloning method. One gene product, which we named FAU-1 (P. furiosus AU-binding), demonstrated the strongest binding activity of all the genomic library-derived proteins tested against an AU-rich RNA sequence. The protein was purified to near homogeneity as a 54 kDa single polypeptide, and the gene locus corresponding to this FAU-1 activity was also sequenced. The FAU-1 gene encoded a 472-amino-acid protein that was characterized by highly charged domains consisting of both acidic and basic amino acids. The N-terminal half of the gene had a degree of similarity (25%) with RNase E from Escherichia coli. Five rounds of RNA-binding-site selection and footprinting analysis showed that the FAU-1 protein binds specifically to the AU-rich sequence in a loop region of a possible RNA ligand. Moreover, we demonstrated that the FAU-1 protein acts as an oligomer, and mainly as a trimer. These results showed that the FAU-1 protein is a novel heat-stable protein with an RNA loop-binding characteristic. PMID:12614195

Isolation of ripening-related genes from ethylene/1-MCP treated papaya through RNA-seq.

PubMed

Shen, Yan Hong; Lu, Bing Guo; Feng, Li; Yang, Fei Ying; Geng, Jiao Jiao; Ming, Ray; Chen, Xiao Jing

2017-08-31

Since papaya is a typical climacteric fruit, exogenous ethylene (ETH) applications can induce premature and quicker ripening, while 1-methylcyclopropene (1-MCP) slows down the ripening processes. Differential gene expression in ETH or 1-MCP-treated papaya fruits accounts for the ripening processes. To isolate the key ripening-related genes and better understand fruit ripening mechanisms, transcriptomes of ETH or 1-MCP-treated, and non-treated (Control Group, CG) papaya fruits were sequenced using Illumina Hiseq2500. A total of 18,648 (1-MCP), 19,093 (CG), and 15,321 (ETH) genes were detected, with the genes detected in the ETH-treatment being the least. This suggests that ETH may inhibit the expression of some genes. Based on the differential gene expression (DGE) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, 53 fruit ripening-related genes were selected: 20 cell wall-related genes, 18 chlorophyll and carotenoid metabolism-related genes, four proteinases and their inhibitors, six plant hormone signal transduction pathway genes, four transcription factors, and one senescence-associated gene. Reverse transcription quantitative PCR (RT-qPCR) analyses confirmed the results of RNA-seq and verified that the expression pattern of six genes is consistent with the fruit senescence process. Based on the expression profiling of genes in carbohydrate metabolic process, chlorophyll metabolism pathway, and carotenoid metabolism pathway, the mechanism of pulp softening and coloration of papaya was deduced and discussed. We illustrate that papaya fruit softening is a complex process with significant cell wall hydrolases, such as pectinases, cellulases, and hemicellulases involved in the process. Exogenous ethylene accelerates the coloration of papaya changing from green to yellow. This is likely due to the inhibition of chlorophyll biosynthesis and the α-branch of carotenoid metabolism. Chy-b may play an important role in the yellow color of papaya

Characterization of Two Cysteine Transfer RNA Genes from Xenopus Laevis

DTIC Science & Technology

1984-07-12

containing amino acids glycine, alanine and serine, are produced by the posterior silk gland of Bombyx mori and therefore high level of tRNAgly, tRNA^Ia...1979) Studies on tRNA adaptation, tRNA turnover, precursor tRNA and tRNA gene distribution in Bombyx mori by using two-dimensional polyacrylamlde gel...Nucleic Acids Research, 1^, 8537-8546. 26. Garber, R.L. and Gage, L.P. (1979) Transcription of a cloned Bombyx mori tRNA^2 gene: Nucleotide sequence of

Effect of NET-1 siRNA conjugated sub-micron bubble complex combined with low-frequency ultrasound exposure in gene transfection

PubMed Central

Wu, Bolin; Liang, Xitian; Jing, Hui; Han, Xue; Sun, Yixin; Guo, Cunli; Liu, Ying; Cheng, Wen

2018-01-01

The present study evaluated the effect of NET-1 siRNA-conjugated sub-micron bubble (SMB) complexes combined with low-frequency ultrasound exposure in gene transfection. The NET-1 gene was highly expressed level in SMMC-7721 human hepatocellular carcinoma cell line. The cells were divided into seven groups and treated with different conditions. The groups with or without low-frequency ultrasound exposure, groups of adherent cells, and suspension cells were separated. The NET-1 siRNA-conjugated SMB complexes were made in the laboratory and tested by Zetasizer Nano ZS90 analyzer. Flow cytometry was used to estimate the transfection efficiency and cellular apoptosis. Western blot and quantitative real-time polymerase chain reaction (qPCR) were used for the estimation of the protein and mRNA expressions, respectively. Transwell analysis determined the migration and invasion capacities of the tumor cells. The results did not show any difference in the transfection efficiency between adherent and suspension cells. However, the NET-1 siRNA-SMB complexes combined with low-frequency ultrasound exposure could enhance the gene transfection effectively. In summary, the NET-1 siRNA-SMB complexes appeared to be promising gene vehicle. PMID:29423111

The phosphotransferase VanU represses expression of four qrr genes antagonizing VanO-mediated quorum-sensing regulation in Vibrio anguillarum

PubMed Central

Weber, Barbara; Lindell, Kristoffer; El Qaidi, Samir; Hjerde, Erik; Willassen, Nils-Peder

2011-01-01

Vibrio anguillarum utilizes quorum sensing to regulate stress responses required for survival in the aquatic environment. Like other Vibrio species, V. anguillarum contains the gene qrr1, which encodes the ancestral quorum regulatory RNA Qrr1, and phosphorelay quorum-sensing systems that modulate the expression of small regulatory RNAs (sRNAs) that destabilize mRNA encoding the transcriptional regulator VanT. In this study, three additional Qrr sRNAs were identified. All four sRNAs were positively regulated by σ54 and the σ54-dependent response regulator VanO, and showed a redundant activity. The Qrr sRNAs, together with the RNA chaperone Hfq, destabilized vanT mRNA and modulated expression of VanT-regulated genes. Unexpectedly, expression of all four qrr genes peaked at high cell density, and exogenously added N-acylhomoserine lactone molecules induced expression of the qrr genes at low cell density. The phosphotransferase VanU, which phosphorylates and activates VanO, repressed expression of the Qrr sRNAs and stabilized vanT mRNA. A model is presented proposing that VanU acts as a branch point, aiding cross-regulation between two independent phosphorelay systems that activate or repress expression of the Qrr sRNAs, giving flexibility and precision in modulating VanT expression and inducing a quorum-sensing response to stresses found in a constantly changing aquatic environment. PMID:21948044

The phosphotransferase VanU represses expression of four qrr genes antagonizing VanO-mediated quorum-sensing regulation in Vibrio anguillarum.

PubMed

Weber, Barbara; Lindell, Kristoffer; El Qaidi, Samir; Hjerde, Erik; Willassen, Nils-Peder; Milton, Debra L

2011-12-01

Vibrio anguillarum utilizes quorum sensing to regulate stress responses required for survival in the aquatic environment. Like other Vibrio species, V. anguillarum contains the gene qrr1, which encodes the ancestral quorum regulatory RNA Qrr1, and phosphorelay quorum-sensing systems that modulate the expression of small regulatory RNAs (sRNAs) that destabilize mRNA encoding the transcriptional regulator VanT. In this study, three additional Qrr sRNAs were identified. All four sRNAs were positively regulated by σ(54) and the σ(54)-dependent response regulator VanO, and showed a redundant activity. The Qrr sRNAs, together with the RNA chaperone Hfq, destabilized vanT mRNA and modulated expression of VanT-regulated genes. Unexpectedly, expression of all four qrr genes peaked at high cell density, and exogenously added N-acylhomoserine lactone molecules induced expression of the qrr genes at low cell density. The phosphotransferase VanU, which phosphorylates and activates VanO, repressed expression of the Qrr sRNAs and stabilized vanT mRNA. A model is presented proposing that VanU acts as a branch point, aiding cross-regulation between two independent phosphorelay systems that activate or repress expression of the Qrr sRNAs, giving flexibility and precision in modulating VanT expression and inducing a quorum-sensing response to stresses found in a constantly changing aquatic environment.

Rapid evolution of RNA editing sites in a small non-essential plastid gene

PubMed Central

Fiebig, Andreas; Stegemann, Sandra; Bock, Ralph

2004-01-01

Chloroplast RNA editing proceeds by C-to-U transitions at highly specific sites. Here, we provide a phylogenetic analysis of RNA editing in a small plastid gene, petL, encoding subunit VI of the cytochrome b6f complex. Analyzing representatives from most major groups of seed plants, we find an unexpectedly high frequency and dynamics of RNA editing. High-frequency editing has previously been observed in plastid ndh genes, which are remarkable in that their mutational inactivation does not produce an obvious mutant phenotype. In order to test the idea that reduced functional constraints allow for more flexible evolution of RNA editing sites, we have created petL knockout plants by tobacco chloroplast transformation. We find that, in the higher plant tobacco, targeted inactivation of petL does not impair plant growth under a variety of conditions markedly contrasting the important role of petL in photosynthesis in the green alga Chlamydomonas reinhardtii. Together with a low number of editing sites in plastid genes that are essential to gene expression and photosynthetic activity, these data suggest that RNA editing sites may evolve more readily in those genes whose transitory loss of function can be tolerated. Accumulated evidence for this ‘relative neutrality hypothesis for the evolution of plastid editing sites’ is discussed. PMID:15240834

In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

PubMed

Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

2014-12-01

Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.

RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases

PubMed Central

Hunter, Lydia J. R.; Brockington, Samuel F.; Murphy, Alex M.; Pate, Adrienne E.; Gruden, Kristina; MacFarlane, Stuart A.; Palukaitis, Peter; Carr, John P.

2016-01-01

Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7. PMID:26979928

RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases.

PubMed

Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P

2016-03-16

Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7.

Downregulation of HIF-1a sensitizes U251 glioma cells to the temozolomide (TMZ) treatment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Jun-Hai; Ma, Zhi-Xiong; Huang, Guo-Hao

Purpose: The aim of this study was to investigate the effect of downregulation of HIF-1α gene on human U251 glioma cells and examine the consequent changes of TMZ induced effects and explore the molecular mechanisms. Methods: U251 cell line stably expressing HIF-1α shRNA was acquired via lentiviral vector transfection. The mRNA and protein expression alterations of genes involved in our study were determined respectively by qRT-PCR and Western blot. Cell proliferation was measured by MTT assay and colony formation assay, cell invasion/migration capacity was determined by transwell invasion assay/wound healing assay, and cell apoptosis was detected by flow cytometry. Results:more » We successfully established a U251 cell line with highly efficient HIF-1α knockdown. HIF-1a downregulation sensitized U251 cells to TMZ treatment and enhanced the proliferation-inhibiting, invasion/migration-suppressing, apoptosis-inducing and differentiation-promoting effects exerted by TMZ. The related molecular mechanisms demonstrated that expression of O{sup 6}-methylguanine DNA methyltransferase gene (MGMT) and genes of Notch1 pathway were significantly upregulated by TMZ treatment. However, this upregulation was abrogated by HIF-1α knockdown. We further confirmed important regulatory roles of HIF-1α in the expression of MGMT and activation of Notch1 pathways. Conclusion: HIF-1α downregulation sensitizes U251 glioma cells to the temozolomide treatment via inhibiting MGMT expression and Notch1 pathway activation. - Highlights: • TMZ caused more significant proliferation inhibition and apoptosis in U251 cells after downregulating HIF-1α. • Under TMZ treatment, HIF-1 downregulated U251 cells exhibited weaker mobility and more differentiated state. • TMZ caused MGMT over-expression and Notch1 pathway activation, which could be abrogated by HIF-1α downregulation.« less

Abundant RNA editing sites of chloroplast protein-coding genes in Ginkgo biloba and an evolutionary pattern analysis.

PubMed

He, Peng; Huang, Sheng; Xiao, Guanghui; Zhang, Yuzhou; Yu, Jianing

2016-12-01

RNA editing is a posttranscriptional modification process that alters the RNA sequence so that it deviates from the genomic DNA sequence. RNA editing mainly occurs in chloroplasts and mitochondrial genomes, and the number of editing sites varies in terrestrial plants. Why and how RNA editing systems evolved remains a mystery. Ginkgo biloba is one of the oldest seed plants and has an important evolutionary position. Determining the patterns and distribution of RNA editing in the ancient plant provides insights into the evolutionary trend of RNA editing, and helping us to further understand their biological significance. In this paper, we investigated 82 protein-coding genes in the chloroplast genome of G. biloba and identified 255 editing sites, which is the highest number of RNA editing events reported in a gymnosperm. All of the editing sites were C-to-U conversions, which mainly occurred in the second codon position, biased towards to the U_A context, and caused an increase in hydrophobic amino acids. RNA editing could change the secondary structures of 82 proteins, and create or eliminate a transmembrane region in five proteins as determined in silico. Finally, the evolutionary tendencies of RNA editing in different gene groups were estimated using the nonsynonymous-synonymous substitution rate selection mode. The G. biloba chloroplast genome possesses the highest number of RNA editing events reported so far in a seed plant. Most of the RNA editing sites can restore amino acid conservation, increase hydrophobicity, and even influence protein structures. Similar purifying selections constitute the dominant evolutionary force at the editing sites of essential genes, such as the psa, some psb and pet groups, and a positive selection occurred in the editing sites of nonessential genes, such as most ndh and a few psb genes.

Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum

PubMed Central

2013-01-01

Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is a powerful technique to understand gene function, particularly when gene knockouts are difficult to obtain. We investigated whether the plant pathogenic fungus Fusarium oxysporum possesses a functional gene silencing machinery and whether hairpin RNA transcripts can be employed to effectively induce gene silencing. Results Here we show that, in the phytopathogenic fungus F. oxysporum, hpRNA transgenes targeting either a β-glucuronidase (Gus) reporter transgene (hpGus) or the endogenous gene Frp1 (hpFrp) did not induce significant silencing of the target genes. Expression analysis suggested that the hpRNA transgenes are prone to transcriptional inactivation, resulting in low levels of hpRNA and siRNA production. However, the hpGus RNA can be efficiently transcribed by promoters acquired either by recombination with a pre-existing, actively transcribed Gus transgene or by fortuitous integration near an endogenous gene promoter allowing siRNA production. These siRNAs effectively induced silencing of a target Gus transgene, which in turn appeared to also induce secondary siRNA production. Furthermore, our results suggested that hpRNA transcripts without poly(A) tails are efficiently processed into siRNAs to induce gene silencing. A convergent promoter transgene, designed to express poly(A)-minus sense and antisense Gus RNAs, without an inverted-repeat DNA structure, induced consistent Gus silencing in F. oxysporum. Conclusions These results indicate that F. oxysporum possesses

E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.

PubMed

Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B

2017-01-01

Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.

Functional Cus1p Is Found with Hsh155p in a Multiprotein Splicing Factor Associated with U2 snRNA

PubMed Central

Pauling, Michelle Haynes; McPheeters, David S.; Ares, Manuel

2000-01-01

To explore the dynamics of snRNP structure and function, we have studied Cus1p, identified as a suppressor of U2 snRNA mutations in budding yeast. Cus1p is homologous to human SAP145, a protein present in the 17S form of the human U2 snRNP. Here, we define the Cus1p amino acids required for function in yeast. The segment of Cus1p required for binding to Hsh49p, a homolog of human SAP49, is contained within an essential region of Cus1p. Antibodies against Cus1p coimmunoprecipitate U2 snRNA, as well as Hsh155p, a protein homologous to human SAP155. Biochemical fractionation of splicing extracts and reconstitution of heat-inactivated splicing extracts from strains carrying a temperature-sensitive allele of CUS1 indicate that Cus1p and Hsh155p reside in a functional, high-salt-stable complex that is salt-dissociable from U2 snRNA. We propose that Cus1p, Hsh49p, and Hsh155p exist in a stable protein complex which can exchange with a core U2 snRNP and which is necessary for U2 snRNP function in prespliceosome assembly. The Cus1p complex shares functional as well as structural similarities with human SF3b. PMID:10688664

Analysis of a new homozygous deletion in the tumor suppressor region at 3p12.3 reveals two novel intronic noncoding RNA genes.

PubMed

Angeloni, Debora; ter Elst, Arja; Wei, Ming Hui; van der Veen, Anneke Y; Braga, Eleonora A; Klimov, Eugene A; Timmer, Tineke; Korobeinikova, Luba; Lerman, Michael I; Buys, Charles H C M

2006-07-01

Homozygous deletions or loss of heterozygosity (LOH) at human chromosome band 3p12 are consistent features of lung and other malignancies, suggesting the presence of a tumor suppressor gene(s) (TSG) at this location. Only one gene has been cloned thus far from the overlapping region deleted in lung and breast cancer cell lines U2020, NCI H2198, and HCC38. It is DUTT1 (Deleted in U Twenty Twenty), also known as ROBO1, FLJ21882, and SAX3, according to HUGO. DUTT1, the human ortholog of the fly gene ROBO, has homology with NCAM proteins. Extensive analyses of DUTT1 in lung cancer have not revealed any mutations, suggesting that another gene(s) at this location could be of importance in lung cancer initiation and progression. Here, we report the discovery of a new, small, homozygous deletion in the small cell lung cancer (SCLC) cell line GLC20, nested in the overlapping, critical region. The deletion was delineated using several polymorphic markers and three overlapping P1 phage clones. Fiber-FISH experiments revealed the deletion was approximately 130 kb. Comparative genomic sequence analysis uncovered short sequence elements highly conserved among mammalian genomes and the chicken genome. The discovery of two EST clusters within the deleted region led to the isolation of two noncoding RNA (ncRNA) genes. These were subsequently found differentially expressed in various tumors when compared to their normal tissues. The ncRNA and other highly conserved sequence elements in the deleted region may represent miRNA targets of importance in cancer initiation or progression. Published 2006 Wiley-Liss, Inc.

RNA Editing Genes Associated with Extreme Old Age in Humans and with Lifespan in C. elegans

PubMed Central

Puca, Annibale; Solovieff, Nadia; Kojima, Toshio; Wang, Meng C.; Melista, Efthymia; Meltzer, Micah; Fischer, Sylvia E. J.; Andersen, Stacy; Hartley, Stephen H.; Sedgewick, Amanda; Arai, Yasumichi; Bergman, Aviv; Barzilai, Nir; Terry, Dellara F.; Riva, Alberto; Anselmi, Chiara Viviani; Malovini, Alberto; Kitamoto, Aya; Sawabe, Motoji; Arai, Tomio; Gondo, Yasuyuki; Steinberg, Martin H.; Hirose, Nobuyoshi; Atzmon, Gil; Ruvkun, Gary; Baldwin, Clinton T.; Perls, Thomas T.

2009-01-01

Background The strong familiality of living to extreme ages suggests that human longevity is genetically regulated. The majority of genes found thus far to be associated with longevity primarily function in lipoprotein metabolism and insulin/IGF-1 signaling. There are likely many more genetic modifiers of human longevity that remain to be discovered. Methodology/Principal Findings Here, we first show that 18 single nucleotide polymorphisms (SNPs) in the RNA editing genes ADARB1 and ADARB2 are associated with extreme old age in a U.S. based study of centenarians, the New England Centenarian Study. We describe replications of these findings in three independently conducted centenarian studies with different genetic backgrounds (Italian, Ashkenazi Jewish and Japanese) that collectively support an association of ADARB1 and ADARB2 with longevity. Some SNPs in ADARB2 replicate consistently in the four populations and suggest a strong effect that is independent of the different genetic backgrounds and environments. To evaluate the functional association of these genes with lifespan, we demonstrate that inactivation of their orthologues adr-1 and adr-2 in C. elegans reduces median survival by 50%. We further demonstrate that inactivation of the argonaute gene, rde-1, a critical regulator of RNA interference, completely restores lifespan to normal levels in the context of adr-1 and adr-2 loss of function. Conclusions/Significance Our results suggest that RNA editors may be an important regulator of aging in humans and that, when evaluated in C. elegans, this pathway may interact with the RNA interference machinery to regulate lifespan. PMID:20011587

Identification of radiation responsive genes and transcriptome profiling via complete RNA sequencing in a stable radioresistant U87 glioblastoma model.

PubMed

Doan, Ninh B; Nguyen, Ha S; Alhajala, Hisham S; Jaber, Basem; Al-Gizawiy, Mona M; Ahn, Eun-Young Erin; Mueller, Wade M; Chitambar, Christopher R; Mirza, Shama P; Schmainda, Kathleen M

2018-05-04

The absence of major progress in the treatment of glioblastoma (GBM) is partly attributable to our poor understanding of both GBM tumor biology and the acquirement of treatment resistance in recurrent GBMs. Recurrent GBMs are characterized by their resistance to radiation. In this study, we used an established stable U87 radioresistant GBM model and total RNA sequencing to shed light on global mRNA expression changes following irradiation. We identified many genes, the expressions of which were altered in our radioresistant GBM model, that have never before been reported to be associated with the development of radioresistant GBM and should be concertedly further investigated to understand their roles in radioresistance. These genes were enriched in various biological processes such as inflammatory response, cell migration, positive regulation of epithelial to mesenchymal transition, angiogenesis, apoptosis, positive regulation of T-cell migration, positive regulation of macrophage chemotaxis, T-cell antigen processing and presentation, and microglial cell activation involved in immune response genes. These findings furnish crucial information for elucidating the molecular mechanisms associated with radioresistance in GBM. Therapeutically, with the global alterations of multiple biological pathways observed in irradiated GBM cells, an effective GBM therapy may require a cocktail carrying multiple agents targeting multiple implicated pathways in order to have a chance at making a substantial impact on improving the overall GBM survival.

Mrd1p binds to pre-rRNA early during transcription independent of U3 snoRNA and is required for compaction of the pre-rRNA into small subunit processomes.

PubMed

Segerstolpe, Asa; Lundkvist, Pär; Osheim, Yvonne N; Beyer, Ann L; Wieslander, Lars

2008-08-01

In Saccharomyces cerevisiae, synthesis of the small ribosomal subunit requires assembly of the 35S pre-rRNA into a 90S preribosomal complex. SnoRNAs, including U3 snoRNA, and many trans-acting proteins are required for the ordered assembly and function of the 90S preribosomal complex. Here, we show that the conserved protein Mrd1p binds to the pre-rRNA early during transcription and is required for compaction of the pre-18S rRNA into SSU processome particles. We have exploited the fact that an Mrd1p-GFP fusion protein is incorporated into the 90S preribosomal complex, where it acts as a partial loss-of-function mutation. When associated with the pre-rRNA, Mrd1p-GFP functionally interacts with the essential Pwp2, Mpp10 and U3 snoRNP subcomplexes that are functionally interconnected in the 90S preribosomal complex. The fusion protein can partially support 90S preribosome-mediated cleavages at the A(0)-A(2) sites. At the same time, on a substantial fraction of transcripts, the composition and/or structure of the 90S preribosomal complex is perturbed by the fusion protein in such a way that cleavage of the 35S pre-rRNA is either blocked or shifted to aberrant sites. These results show that Mrd1p is required for establishing productive structures within the 90S preribosomal complex.

Posttranscriptional regulation of retroviral gene expression: primary RNA transcripts play three roles as pre-mRNA, mRNA, and genomic RNA

PubMed Central

LeBlanc, Jason; Weil, Jason; Beemon, Karen

2013-01-01

After reverse transcription of the retroviral RNA genome and integration of the DNA provirus into the host genome, host machinery is used for viral gene expression along with viral proteins and RNA regulatory elements. Here, we discuss co-transcriptional and posttranscriptional regulation of retroviral gene expression, comparing simple and complex retroviruses. Cellular RNA polymerase II synthesizes full-length viral primary RNA transcripts that are capped and polyadenylated. All retroviruses generate a singly spliced env mRNA from this primary transcript, which encodes the viral glycoproteins. In addition, complex viral RNAs are alternatively spliced to generate accessory proteins, such as Rev, which is involved in posttranscriptional regulation of HIV-1 RNA. Importantly, the splicing of all retroviruses is incomplete; they must maintain and export a fraction of their primary RNA transcripts. This unspliced RNA functions both as the major mRNA for Gag and Pol proteins and as the packaged genomic RNA. Different retroviruses export their unspliced viral RNA from the nucleus to the cytoplasm by either Tap-dependent or Rev/CRM1-dependent routes. Translation of the unspliced mRNA involves frame-shifting or termination codon suppression so that the Gag proteins, which make up the capsid, are expressed more abundantly than the Pol proteins, which are the viral enzymes. After the viral polyproteins assemble into viral particles and bud from the cell membrane, a viral encoded protease cleaves them. Some retroviruses have evolved mechanisms to protect their unspliced RNA from decay by nonsense-mediated RNA decay and to prevent genome editing by the cellular APOBEC deaminases. PMID:23754689

Mechanism of Tumor Metastasis Suppression by the KAI1 Gene

DTIC Science & Technology

2008-02-01

CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT U b . ABSTRACT U c. THIS...activated by the interaction of DARC and Kai1. Task1- b . (completed) Examine the effects of siRNA against the DARC gene on the binding and...suggesting that the N terminus of DARC is essential for binding to KAI1. Task 2- b . Screening a phage display library followed by sequencing the

Traffic at the tmRNA Gene

PubMed Central

Williams, Kelly P.

2003-01-01

A partial screen for genetic elements integrated into completely sequenced bacterial genomes shows more significant bias in specificity for the tmRNA gene (ssrA) than for any type of tRNA gene. Horizontal gene transfer, a major avenue of bacterial evolution, was assessed by focusing on elements using this single attachment locus. Diverse elements use ssrA; among enterobacteria alone, at least four different integrase subfamilies have independently evolved specificity for ssrA, and almost every strain analyzed presents a unique set of integrated elements. Even elements using essentially the same integrase can be very diverse, as is a group with an ssrA-specific integrase of the P4 subfamily. This same integrase appears to promote damage routinely at attachment sites, which may be adaptive. Elements in arrays can recombine; one such event mediated by invertible DNA segments within neighboring elements likely explains the monophasic nature of Salmonella enterica serovar Typhi. One of a limited set of conserved sequences occurs at the attachment site of each enterobacterial element, apparently serving as a transcriptional terminator for ssrA. Elements were usually found integrated into tRNA-like sequence at the 3′ end of ssrA, at subsites corresponding to those used in tRNA genes; an exception was found at the non-tRNA-like 3′ end produced by ssrA gene permutation in cyanobacteria, suggesting that, during the evolution of new site specificity by integrases, tropism toward a conserved 3′ end of an RNA gene may be as strong as toward a tRNA-like sequence. The proximity of ssrA and smpB, which act in concert, was also surveyed. PMID:12533482

Ribonucleoprotein organization of eukaryotic RNA. XXXII. U2 small nuclear RNA precursors and their accurate 3' processing in vitro as ribonucleoprotein particles.

PubMed

Wieben, E D; Nenninger, J M; Pederson, T

1985-05-05

Biosynthetic precursors of U2 small nuclear RNA have been identified in cultured human cells by hybrid-selection of pulse-labeled RNA with cloned U2 DNA. These precursor molecules are one to approximately 16 nucleotides longer than mature U2 RNA and contain 2,2,7-trimethylguanosine "caps". The U2 RNA precursors are associated with proteins that react with a monoclonal antibody for antigens characteristic of small nuclear ribonucleoprotein particles. Like previously described precursors of U1 and U4 small nuclear RNAs, the pre-U2 RNAs are recovered in cytoplasmic fractions, although it is not known if this is their location in vivo. The precursors are processed to mature-size U2 RNA when cytoplasmic extracts are incubated in vitro at 37 degrees C. Mg2+ is required but ATP is not. The ribonucleoprotein structure of the pre-U2 RNA is maintained during the processing reaction in vitro, as are the 2,2,7-trimethylguanosine caps. The ribonucleoprotein organization is of major importance, as exogenous, protein-free U2 RNA precursors are degraded rapidly in the in vitro system. Two lines of evidence indicate that the conversion of U2 precursors to mature-size U2 RNA involves a 3' processing reaction. First, the reaction is unaffected by a large excess of mature U2 small nuclear RNP, whose 5' trimethylguanosine caps would be expected to compete for a 5' processing activity. Second, when pre-U2 RNA precursors are first stoichiometrically decorated with an antibody specific for 2,2,7-trimethylguanosine, the extent of subsequent processing in vitro is unaffected. These results provide the first demonstration of a eukaryotic RNA processing reaction in vitro occurring within a ribonucleoprotein particle.

Identification of U2AF(35)-dependent exons by RNA-Seq reveals a link between 3′ splice-site organization and activity of U2AF-related proteins

PubMed Central

Kralovicova, Jana; Knut, Marcin; Cross, Nicholas C. P.; Vorechovsky, Igor

2015-01-01

The auxiliary factor of U2 small nuclear RNA (U2AF) is a heterodimer consisting of 65- and 35-kD proteins that bind the polypyrimidine tract (PPT) and AG dinucleotides at the 3′ splice site (3′ss). The gene encoding U2AF35 (U2AF1) is alternatively spliced, giving rise to two isoforms U2AF35a and U2AF35b. Here, we knocked down U2AF35 and each isoform and characterized transcriptomes of HEK293 cells with varying U2AF35/U2AF65 and U2AF35a/b ratios. Depletion of both isoforms preferentially modified alternative RNA processing events without widespread failure to recognize 3′ss or constitutive exons. Over a third of differentially used exons were terminal, resulting largely from the use of known alternative polyadenylation (APA) sites. Intronic APA sites activated in depleted cultures were mostly proximal whereas tandem 3′UTR APA was biased toward distal sites. Exons upregulated in depleted cells were preceded by longer AG exclusion zones and PPTs than downregulated or control exons and were largely activated by PUF60 and repressed by CAPERα. The U2AF(35) repression and activation was associated with a significant interchange in the average probabilities to form single-stranded RNA in the optimal PPT and branch site locations and sequences further upstream. Although most differentially used exons were responsive to both U2AF subunits and their inclusion correlated with U2AF levels, a small number of transcripts exhibited distinct responses to U2AF35a and U2AF35b, supporting the existence of isoform-specific interactions. These results provide new insights into function of U2AF and U2AF35 in alternative RNA processing. PMID:25779042

Selenium Deficiency Affects the mRNA Expression of Inflammatory Factors and Selenoprotein Genes in the Kidneys of Broiler Chicks.

PubMed

Zhang, Jiu-Li; Xu, Bo; Huang, Xiao-Dan; Gao, Yu-Hong; Chen, Yu; Shan, An-Shan

2016-05-01

The aim of this study was to investigate the influence of Se deficiency on the transcription of inflammatory factors and selenoprotein genes in the kidneys of broiler chicks. One hundred fifty 1-day-old broiler chicks were randomly assigned to two groups fed with either a low-Se diet (L group, 0.033 mg/kg Se) or an adequate Se diet (C group, 0.2 mg/kg Se). The levels of uric acid (UA) and creatinine (Cr) in the serum and the mRNA levels of 6 inflammatory factors and 25 selenoprotein genes in the kidneys were measured as the clinical signs of Se deficiency occurred at 20 days old. The results indicated that the contents of UA and Cr in the serum increased in L group (p < 0.05), and the mRNA levels of the inflammatory factors (NF-κB, iNOS, COX-2, and TNF-α) increased in L group (p < 0.05). Meanwhile, the mRNA levels of PTGEs and HO-1 were not changed. In addition, 25 selenoprotein transcripts displayed ubiquitous expression in the kidneys of the chicks. The mRNA levels of 14 selenoprotein genes (Dio1, Dio2, GPx3, Sepp1, SelH, SelI, SelK, Sepn1, SelO, SelW, Sep15, SelT, SelU, and SelS) decreased, and 9 selenoprotein genes (GPx1, GPx2, GPx4, SelPb, Txnrd1, Txnrd2, Txnrd3, SPS2, and SelM) increased in L group (p < 0.05), but the Dio3 and Sepx1 mRNA levels did not change. The results indicated that Se deficiency resulted in kidney dysfunction, activation of the NF-κB pathway, and a change in selenoprotein gene expression. The changes of inflammatory factor and selenoprotein gene expression levels were directly related to the abnormal renal functions induced by Se deficiency.

The recruitment of the U5 snRNP to nascent transcripts requires internal loop 1 of U5 snRNA.

PubMed

Kim, Rebecca; Paschedag, Joshua; Novikova, Natalya; Bellini, Michel

2012-12-01

In this study, we take advantage of the high spatial resolution offered by the nucleus and lampbrush chromosomes of the amphibian oocyte to investigate the mechanisms that regulate the intranuclear trafficking of the U5 snRNP and its recruitment to nascent transcripts. We monitor the fate of newly assembled fluorescent U5 snRNP in Xenopus oocytes depleted of U4 and/or U6 snRNAs and demonstrate that the U4/U6.U5 tri-snRNP is not required for the association of U5 snRNP with Cajal bodies, splicing speckles, and nascent transcripts. In addition, using a mutational analysis, we show that a non-functional U5 snRNP can associate with nascent transcripts, and we further characterize internal loop structure 1 of U5 snRNA as a critical element for licensing U5 snRNP to target both nascent transcripts and splicing speckles. Collectively, our data support the model where the recruitment of snRNPs onto pre-mRNAs is independent of spliceosome assembly and suggest that U5 snRNP may promote the association of the U4/U6.U5 tri-snRNP with nascent transcripts.

Plant U13 orthologues and orphan snoRNAs identified by RNomics of RNA from Arabidopsis nucleoli

PubMed Central

Kim, Sang Hyon; Spensley, Mark; Choi, Seung Kook; Calixto, Cristiane P. G.; Pendle, Ali F.; Koroleva, Olga; Shaw, Peter J.; Brown, John W. S.

2010-01-01

Small nucleolar RNAs (snoRNAs) and small Cajal body-specific RNAs (scaRNAs) are non-coding RNAs whose main function in eukaryotes is to guide the modification of nucleotides in ribosomal and spliceosomal small nuclear RNAs, respectively. Full-length sequences of Arabidopsis snoRNAs and scaRNAs have been obtained from cDNA libraries of capped and uncapped small RNAs using RNA from isolated nucleoli from Arabidopsis cell cultures. We have identified 31 novel snoRNA genes (9 box C/D and 22 box H/ACA) and 15 new variants of previously described snoRNAs. Three related capped snoRNAs with a distinct gene organization and structure were identified as orthologues of animal U13snoRNAs. In addition, eight of the novel genes had no complementarity to rRNAs or snRNAs and are therefore putative orphan snoRNAs potentially reflecting wider functions for these RNAs. The nucleolar localization of a number of the snoRNAs and the localization to nuclear bodies of two putative scaRNAs was confirmed by in situ hybridization. The majority of the novel snoRNA genes were found in new gene clusters or as part of previously described clusters. These results expand the repertoire of Arabidopsis snoRNAs to 188 snoRNA genes with 294 gene variants. PMID:20081206

HoxBlinc RNA recruits Set1/MLL complexes to activate Hox gene expression patterns and mesoderm lineage development

PubMed Central

Deng, Changwang; Li, Ying; Zhou, Lei; Cho, Joonseok; Patel, Bhavita; Terada, Nao; Li, Yangqiu; Bungert, Jörg; Qiu, Yi; Huang, Suming

2015-01-01

Summary Trithorax proteins and long-intergenic noncoding RNAs are critical regulators of embryonic stem cell pluripotency; however, how they cooperatively regulate germ layer mesoderm specification remains elusive. We report here that HoxBlinc RNA first specifies Flk1+ mesoderm and then promotes hematopoietic differentiation through regulating hoxb gene pathways. HoxBlinc binds to the hoxb genes, recruits Setd1a/MLL1 complexes, and mediates long-range chromatin interactions to activate transcription of the hoxb genes. Depletion of HoxBlinc by shRNA-mediated KD or CRISPR-Cas9-mediated genetic deletion inhibits expression of hoxb genes and other factors regulating cardiac/hematopoietic differentiation. Reduced hoxb gene expression is accompanied by decreased recruitment of Set1/MLL1 and H3K4me3 modification, as well as by reduced chromatin loop formation. Re-expression of hoxb2-b4 genes in HoxBlinc-depleted embryoid bodies rescues Flk1+ precursors that undergo hematopoietic differentiation. Thus, HoxBlinc plays an important role in controlling hoxb transcription networks that mediate specification of mesoderm-derived Flk1+ precursors and differentiation of Flk1+ cells into hematopoietic lineages. PMID:26725110

Curcumin may serve an anticancer role in human osteosarcoma cell line U-2 OS by targeting ITPR1.

PubMed

Luo, Zhanpeng; Li, Dawei; Luo, Xiaobo; Li, Litao; Gu, Suxi; Yu, Long; Ma, Yuanzheng

2018-04-01

The present study aimed to determine the mechanisms of action of curcumin in osteosarcoma. Human osteosarcoma U-2 OS cells was purchased from the Cell Bank of the Chinese Academy of Sciences. RNA sequencing analysis was performed for 2 curcumin-treated samples and 2 control samples using Illumina deep sequencing technology. The differentially expressed genes were identified using Cufflink software. Enrichment and protein-protein interaction network analyses were performed separately using cluster Profiler package and Cytoscape software to identify key genes. Then, the mRNA levels of key genes were detected by quantitative reverse transcription polymerase chain reaction (RT-qPCR) in U-2 OS cells. Finally, cell apoptosis, proliferation, migration and invasion arrays were performed. In total, 201 DEGs were identified in the curcumin-treated group. EEF1A1 (degree=88), ATF7IP, HIF1A, SMAD7, CLTC, MCM10, ITPR1, ADAM15, WWP2 and ATP5C1, which were enriched in 'biological process', exhibited higher degrees than other genes in the PPI network. RT-qPCR demonstrated that treatment with curcumin was able to significantly increase the levels of CLTC and ITPR1 mRNA in curcumin-treated cells compared with control. In addition, targeting ITPR1 with curcumin significantly promoted apoptosis and suppressed proliferation, migration and invasion. Targeting ITPR1 via curcumin may serve an anticancer role by mediating apoptosis, proliferation, migration and invasion in U-2 OS cells.

Simultaneous regulation of apoptotic gene silencing and angiogenic gene expression for myocardial infarction therapy: Single-carrier delivery of SHP-1 siRNA and VEGF-expressing pDNA.

PubMed

Kim, Dongkyu; Ku, Sook Hee; Kim, Hyosuk; Jeong, Ji Hoon; Lee, Minhyung; Kwon, Ick Chan; Choi, Donghoon; Kim, Sun Hwa

2016-12-10

Gene therapy is aimed at selectively knocking up or knocking down the target genes involved in the development of diseases. In many human diseases, dysregulation of disease-associated genes is occurred concurrently: some genes are abnormally turned up and some are turned down. In the field of non-viral gene therapy, plasmid DNA (pDNA) and small interfering RNA (siRNA) are suggested as representative regulation tools for activating and silencing the expression of genes of interest, representatively. Herein, we simultaneously loaded both siRNA (Src homology region 2 domain-containing tyrosine phosphatase-1 siRNA, siSHP-1) for anti-apoptosis and pDNA (hypoxia-inducible vascular endothelial growth factor expression vector, pHI-VEGF) for angiogenesis in a single polymeric nanocarrier and used to synergistically attenuate ischemia-reperfusion (IR)-induced myocardial infarction, which is mainly caused by dysregulating of cardiac apoptosis and angiogenesis. For dual-modality cardiac gene delivery, siSHP-1 and pHI-VEGF were sequentially incorporated into a stable nanocomplex by using deoxycholic acid-modified polyethylenimine (DA-PEI). The resulting DA-PEI/siSHP-1/pHI-VEGF complexes exhibited the high structural stability against polyanion competition and the improved resistance to digestion by nucleases. The cardiac administration of DA-PEI/siSHP-1/pHI-VEGF reduced cardiomyocyte apoptosis and enhanced cardiac microvessel formation, thereby reducing infarct size in rat ischemia-reperfusion model. The simultaneous anti-apoptotic and angiogenic gene therapies synergized the cardioprotective effects of each strategy; thus our dual-modal single-carrier gene delivery system can be considered as a promising candidate for treating ischemic heart diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

U1 Adaptor Oligonucleotides Targeting BCL2 and GRM1 Suppress Growth of Human Melanoma Xenografts In Vivo

PubMed Central

Goraczniak, Rafal; Wall, Brian A; Behlke, Mark A; Lennox, Kim A; Ho, Eric S; Zaphiros, Nikolas H; Jakubowski, Christopher; Patel, Neil R; Zhao, Steven; Magaway, Carlo; Subbie, Stacey A; Jenny Yu, Lumeng; LaCava, Stephanie; Reuhl, Kenneth R; Chen, Suzie; Gunderson, Samuel I

2013-01-01

U1 Adaptor is a recently discovered oligonucleotide-based gene-silencing technology with a unique mechanism of action that targets nuclear pre-mRNA processing. U1 Adaptors have two distinct functional domains, both of which must be present on the same oligonucleotide to exert their gene-silencing function. Here, we present the first in vivo use of U1 Adaptors by targeting two different human genes implicated in melanomagenesis, B-cell lymphoma 2 (BCL2) and metabotropic glutamate receptor 1 (GRM1), in a human melanoma cell xenograft mouse model system. Using a newly developed dendrimer delivery system, anti-BCL2 U1 Adaptors were very potent and suppressed tumor growth at doses as low as 34 µg/kg with twice weekly intravenous (iv) administration. Anti-GRM1 U1 Adaptors suppressed tumor xenograft growth with similar potency. Mechanism of action was demonstrated by showing target gene suppression in tumors and by observing that negative control U1 Adaptors with just one functional domain show no tumor suppression activity. The anti-BCL2 and anti-GRM1 treatments were equally effective against cell lines harboring either wild-type or a mutant V600E B-RAF allele, the most common mutation in melanoma. Treatment of normal immune-competent mice (C57BL6) indicated no organ toxicity or immune stimulation. These proof-of-concept studies represent an in-depth (over 800 mice in ~108 treatment groups) validation that U1 Adaptors are a highly potent gene-silencing therapeutic and open the way for their further development to treat other human diseases. PMID:23673539

Oligophrenin-1 (OPHN1), a Gene Involved in X-Linked Intellectual Disability, Undergoes RNA Editing and Alternative Splicing during Human Brain Development

PubMed Central

Athanasiadis, Alekos; Galeano, Federica; Locatelli, Franco; Bertini, Enrico; Zanni, Ginevra; Gallo, Angela

2014-01-01

Oligophrenin-1 (OPHN1) encodes for a Rho-GTPase-activating protein, important for dendritic morphogenesis and synaptic function. Mutations in this gene have been identified in patients with X-linked intellectual disability associated with cerebellar hypoplasia. ADAR enzymes are responsible for A-to-I RNA editing, an essential post-transcriptional RNA modification contributing to transcriptome and proteome diversification. Specifically, ADAR2 activity is essential for brain development and function. Herein, we show that the OPHN1 transcript undergoes post-transcriptional modifications such as A-to-I RNA editing and alternative splicing in human brain and other tissues. We found that OPHN1 editing is detectable already at the 18th week of gestation in human brain with a boost of editing at weeks 20 to 33, concomitantly with OPHN1 expression increase and the appearance of a novel OPHN1 splicing isoform. Our results demonstrate that multiple post-transcriptional events occur on OPHN1, a gene playing an important role in brain function and development. PMID:24637888

Oligophrenin-1 (OPHN1), a gene involved in X-linked intellectual disability, undergoes RNA editing and alternative splicing during human brain development.

PubMed

Barresi, Sabina; Tomaselli, Sara; Athanasiadis, Alekos; Galeano, Federica; Locatelli, Franco; Bertini, Enrico; Zanni, Ginevra; Gallo, Angela

2014-01-01

Oligophrenin-1 (OPHN1) encodes for a Rho-GTPase-activating protein, important for dendritic morphogenesis and synaptic function. Mutations in this gene have been identified in patients with X-linked intellectual disability associated with cerebellar hypoplasia. ADAR enzymes are responsible for A-to-I RNA editing, an essential post-transcriptional RNA modification contributing to transcriptome and proteome diversification. Specifically, ADAR2 activity is essential for brain development and function. Herein, we show that the OPHN1 transcript undergoes post-transcriptional modifications such as A-to-I RNA editing and alternative splicing in human brain and other tissues. We found that OPHN1 editing is detectable already at the 18th week of gestation in human brain with a boost of editing at weeks 20 to 33, concomitantly with OPHN1 expression increase and the appearance of a novel OPHN1 splicing isoform. Our results demonstrate that multiple post-transcriptional events occur on OPHN1, a gene playing an important role in brain function and development.

Selection of reference genes for miRNA qRT-PCR under abiotic stress in grapevine.

PubMed

Luo, Meng; Gao, Zhen; Li, Hui; Li, Qin; Zhang, Caixi; Xu, Wenping; Song, Shiren; Ma, Chao; Wang, Shiping

2018-03-13

Grapevine is among the fruit crops with high economic value, and because of the economic losses caused by abiotic stresses, the stress resistance of Vitis vinifera has become an increasingly important research area. Among the mechanisms responding to environmental stresses, the role of miRNA has received much attention recently. qRT-PCR is a powerful method for miRNA quantitation, but the accuracy of the method strongly depends on the appropriate reference genes. To determine the most suitable reference genes for grapevine miRNA qRT-PCR, 15 genes were chosen as candidate reference genes. After eliminating 6 candidate reference genes with unsatisfactory amplification efficiency, the expression stability of the remaining candidate reference genes under salinity, cold and drought was analysed using four algorithms, geNorm, NormFinder, deltaCt and Bestkeeper. The results indicated that U6 snRNA was the most suitable reference gene under salinity and cold stresses; whereas miR168 was the best for drought stress. The best reference gene sets for salinity, cold and drought stresses were miR160e + miR164a, miR160e + miR168 and ACT + UBQ + GAPDH, respectively. The selected reference genes or gene sets were verified using miR319 or miR408 as the target gene.

[Cytokine-mediated regulation of expression of Gfi1 and U2afll4 genes activated by T-cells with different differentiation status in vitro].

PubMed

Yurova, K A; Sokhonevich, N A; Khaziakhmatova, O G; Litvinova, L S

2016-01-01

The dose-dependent effects of cytokines (IL-2, IL-7, and IL-15), which have a common g-chain, on mRNA expression of U2afll4 and GFi1 genes involved in regulation of alternative splicing of the Ptprc gene, have been investigated in vitro using T-lymphocyte cultures with different degrees of differentiation. IL-2, IL-7, and IL-15 caused a similar unidirectional inhibitory effect of various severity on restimulated CD45RO+ T-cells exposed to an antigen-independent activation; they caused a dose-dependent decrease of the U2af1l4 gene expression, and an increase of Gfi1 gene expression. This may suggest formation of active forms of the CD45 receptor, and also limitation of the formation of low-molecular short splice variants of the CD45RO receptor. Under conditions of antigen-independent stimulation of naive CD45RA+-cells rIL-7 and IL-15 exhibited opposite effects on U2af1l4 and Gfi1 gene expression. The increase of IL-7 concentrations in the incubation medium of naive cells was accompanied by a decrease in expression of both genes. IL-15 IL-7 exhibited opposite effects. Cytokines possessing a common g-chain (IL-2, IL-7, and IL-15) prevented antigen-independent differentiation of naive T-cells, by preventing the formation of polyclonal "surrogate" cells. In general, the study of the molecular mechanisms of genetic control determining homeostatic processes of T-cells in response to exposure to antigenic or non-antigenic treatments may be important for construction of a general model of self-maintenance and differentiation of immune cells.

Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology.

PubMed

Sui, Weiguo; Shi, Zhoufang; Xue, Wen; Ou, Minglin; Zhu, Ying; Chen, Jiejing; Lin, Hua; Liu, Fuhua; Dai, Yong

2017-03-01

The aim of the present study was to screen gastric cancer (GC) tissue and adjacent tissue for differences in mRNA and circular (circRNA) expression, to analyze the differences in circRNA and mRNA expression, and to investigate the circRNA expression in gastric carcinoma and its mechanism. circRNA and mRNA differential expression profiles generated using Agilent microarray technology were analyzed in the GC tissues and adjacent tissues. qRT-PCR was used to verify the differential expression of circRNAs and mRNAs according to the interactions between circRNAs and miRNAs as well as the possible existence of miRNA and mRNA interactions. We found that: i) the circRNA expression profile revealed 1,285 significant differences in circRNA expression, with circRNA expression downregulated in 594 samples and upregulated in 691 samples via interactions with miRNAs. The qRT-PCR validation experiments showed that hsa_circRNA_400071, hsa_circRNA_000543 and hsa_circRNA_001959 expression was consistent with the microarray analysis results. ii) 29,112 genes were found in the GC tissues and adjacent tissues, including 5,460 differentially expressed genes. Among them, 2,390 differentially expressed genes were upregulated and 3,070 genes were downregulated. Gene Ontology (GO) analysis of the differentially expressed genes revealed these genes involved in biological process classification, cellular component classification and molecular function classification. Pathway analysis of the differentially expressed genes identified 83 significantly enriched genes, including 28 upregulated genes and 55 downregulated genes. iii) 69 differentially expressed circRNAs were found that might adsorb specific miRNAs to regulate the expression of their target gene mRNAs. The conclusions are: i) differentially expressed circRNAs had corresponding miRNA binding sites. These circRNAs regulated the expression of target genes through interactions with miRNAs and might become new molecular biomarkers for GC

Steroid receptor RNA activator (SRA1): unusual bifaceted gene products with suspected relevance to breast cancer

PubMed Central

Leygue, Etienne

2007-01-01

The steroid receptor RNA activator (SRA) is a unique modulator of steroid receptor transcriptional activity, as it is able to mediate its coregulatory effects as a RNA molecule. Recent findings, however, have painted a more complex picture of the SRA gene (SRA1) products. Indeed, even though SRA was initially thought to be noncoding, several RNA isoforms have now been found to encode an endogenous protein (SRAP), which is well conserved among Chordata. Although the function of SRAP remains largely unknown, it has been proposed that, much like its corresponding RNA, the protein itself might regulate estrogen and androgen receptor signaling pathways. As such, data suggest that both SRA and SRAP might participate in the mechanisms underlying breast, as well as prostate tumorigenesis. This review summarizes the published literature dealing with these two faces of the SRA gene products and underscores the relevance of this bifaceted system to breast cancer development. PMID:17710122

Role of the tomato TAGL1 gene in regulating fruit metabolites elucidated using RNA sequence and metabolomics analyses.

PubMed

Zhao, Xiaodan; Yuan, Xinyu; Chen, Sha; Meng, Lanhuan; Fu, Daqi

2018-01-01

Fruit ripening is a complex biological process affecting fruit quality. In tomato the fruit ripening process is delicately regulated by transcription factors (TFs). Among these, the TOMATO AGAMOUS-LIKE 1 (TAGL1) gene plays an important role in both the development and ripening of fruit. In this study, the TAGL1 gene was successfully silenced by virus-induced gene silencing technology (VIGS), and the global gene expression and metabolites profiles of TAGL1-silenced fruits were analyzed by RNA-sequence analysis (RNA-seq) and liquid chromatography-mass spectrometry (LC-MS/MS). The TAGL1-silenced fruits phenotypically displayed an orange pericarp, which was in accordance with the results expected from the down-regulation of genes associated with carotenoid synthesis. Levels of several amino acids and organic acids were lower in the TAGL1-silenced fruits than in the wild-type fruits, whereas, α-tomatine content was greatly increased (more than 10-fold) in the TAGL1-silenced fruits compared to wild-type fruits. The findings of this study showed that TAGL1 not only regulates the ripening of tomato fruits, but also affects the synthesis and levels of nutrients in the fruit.

Regulatory BC1 RNA in Cognitive Control

ERIC Educational Resources Information Center

Iacoangeli, Anna; Dosunmu, Aderemi; Eom, Taesun; Stefanov, Dimitre G.; Tiedge, Henri

2017-01-01

Dendritic regulatory BC1 RNA is a non-protein-coding (npc) RNA that operates in the translational control of gene expression. The absence of BC1 RNA in BC1 knockout (KO) animals causes translational dysregulation that entails neuronal phenotypic alterations including prolonged epileptiform discharges, audiogenic seizure activity in vivo, and…

Circular RNA of cattle casein genes are highly expressed in bovine mammary gland.

PubMed

Zhang, ChunLei; Wu, Hui; Wang, YanHong; Zhu, ShiQi; Liu, JunQiang; Fang, XingTang; Chen, Hong

2016-06-01

Recent studies have revealed that, in addition to hormones and other protein factors, noncoding RNA molecules play an important regulatory role in milk protein synthesis. Circular RNAs (circRNAs) are universally expressed noncoding RNA species that have been proposed recently to regulate the expression of their parental genes. In the present study, the deep RNA-sequencing technique known as RNA-seq was used to compare expression profiles of circRNAs from 2 pooled RNA samples from cow mammary gland on d 90 and 250 postpartum and to identify the key circRNAs involved in lactation. A total of 4,804 and 4,048 circRNAs were identified in the cow mammary gland on d 90 and 250 postpartum, respectively, of which only 2,231 circRNAs were co-expressed at both lactation stages, suggesting high stage specificity in the circRNAs. The enrichment of some Gene Ontology terms for the circRNA parental genes differed between lactation stages. Among the top 10 enriched Gene Ontology terms, vesicle, endoplasmic reticulum, and mitochondrial lumen were more common on lactation d 90. All 4 casein-coding genes (CSN1S1, CSN1S2, CSN2, and CSN3) produced circRNAs in the cattle mammary gland. In total, 80 circRNAs were identified from these 4 genes; circRNAs from CSN1S1 had very high abundance, and 3 of them accounted for 36% of all the circRNAs expressed in the mammary gland on lactation d 90. Three circRNAs from CSN1S1, 1 circRNA from CSN1S2, and 1 circRNA from CSN2 were all more highly expressed on lactation d 90 than on lactation d 250, as confirmed by quantitative PCR. These circRNAs had several target sites for the microRNA miR-2284 family and were predicted to target CSN1S1 and CSN2 mRNA, suggesting their potential involvement in regulating expression of the casein genes. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

A long noncoding RNA, lincRNA-Tnfaip3, acts as a coregulator of NF-κB to modulate inflammatory gene transcription in mouse macrophages.

PubMed

Ma, Shibin; Ming, Zhenping; Gong, Ai-Yu; Wang, Yang; Chen, Xiqiang; Hu, Guoku; Zhou, Rui; Shibata, Annemarie; Swanson, Patrick C; Chen, Xian-Ming

2017-03-01

Long intergenic noncoding RNAs (lincRNAs) are long noncoding transcripts (>200 nt) from the intergenic regions of annotated protein-coding genes. We report here that the lincRNA gene lincRNA-Tnfaip3 , located at mouse chromosome 10 proximal to the tumor necrosis factor α-induced protein 3 ( Tnfaip3 ) gene, is an early-primary response gene controlled by nuclear factor-κB (NF-κB) signaling in murine macrophages. Functionally, lincRNA- Tnfaip3 appears to mediate both the activation and repression of distinct classes of inflammatory genes in macrophages. Specifically, induction of lincRNA-Tnfaip3 is required for the transactivation of NF-κB-regulated inflammatory genes in response to bacterial LPSs stimulation. LincRNA-Tnfaip3 physically interacts with the high-mobility group box 1 (Hmgb1), assembling a NF-κB/Hmgb1/lincRNA-Tnfaip3 complex in macrophages after LPS stimulation. This resultant NF-κB/Hmgb1/lincRNA-Tnfaip3 complex can modulate Hmgb1-associated histone modifications and, ultimately, transactivation of inflammatory genes in mouse macrophages in response to microbial challenge. Therefore, our data indicate a new regulatory role of NF-κB-induced lincRNA-Tnfaip3 to act as a coactivator of NF-κB for the transcription of inflammatory genes in innate immune cells through modulation of epigenetic chromatin remodeling.-Ma, S., Ming, Z., Gong, A.-Y., Wang, Y., Chen, X., Hu, G., Zhou, R., Shibata, A., Swanson, P. C., Chen, X.-M. A long noncoding RNA, LincRNA-Tnfaip3, acts as a coregulator of NF-κB to modulate inflammatory gene transcription in mouse macrophages. © FASEB.

DNA methylation of miRNA-encoding genes in non-small cell lung cancer patients.

PubMed

Heller, Gerwin; Altenberger, Corinna; Steiner, Irene; Topakian, Thais; Ziegler, Barbara; Tomasich, Erwin; Lang, György; End-Pfützenreuter, Adelheid; Zehetmayer, Sonja; Döme, Balazs; Arns, Britt-Madeleine; Klepetko, Walter; Zielinski, Christoph C; Zöchbauer-Müller, Sabine

2018-03-23

De-regulated DNA methylation leading to transcriptional inactivation of certain genes occurs frequently in non-small cell lung cancers (NSCLC). Besides protein-encoding genes also microRNA (miRNA)-encoding genes may be targets for methylation in NSCLCs, however, the number of known methylated miRNA genes is still small. Thus, we investigated methylation of miRNA genes in primary tumours (TU) and corresponding non-malignant lung tissue samples (NL) of 50 NSCLC patients using methylated DNA immunoprecipitation followed by custom designed tiling microarray analyses (MeDIP-chip) and 252 differentially methylated probes between TU and NL samples were identified. These probes were annotated which resulted in the identification of 34 miRNA-encoding genes with increased methylation in TU specimens. While some of these miRNA-encoding genes were already known to be methylated in NSCLCs (e.g. miR-9-3, miR-124), methylation of the vast majority of them was unknown so far. We selected six miRNA genes (miR-10b, miR-1179, miR-137, miR-572, miR-3150b and miR-129-2) for gene-specific methylation analyses in TU and corresponding NL samples of 104 NSCLC patients and observed a statistically significant increase of methylation of these miRNA genes in TU samples (p<0.0001, respectively). In silico target prediction of the six miRNAs identified several oncogenic/cell proliferation promoting factors (e.g. CCNE1 as miR-1179 target). To investigate if miR-1179 indeed targets CCNE1, we transfected miR-1179 mimics into CCNE1 expressing NSCLC cells and observed down-regulated CCNE1 mRNA expression in these cells compared to control cells. Similar effects on Cyclin E1 expression were seen in Western blot analyses. In addition, we found a statistically significant growth reduction of NSCLC cells transfected with miR-1179 mimics compared to control cells. In conclusion, we identified many methylated miRNA genes in NSCLC patients and found that miR-1179 is a potential tumour cell growth

Processing of Archaebacterial Intron-Containing tRNA Gene Transcripts

DTIC Science & Technology

1988-07-27

number) The overall goal of this project is to develop an understanding of tRNA gene structure and transcript processing in the halophilic Archaebacteria...containing precursor tRNAs in the halophilic Archaebecteria suggest that tRNATr p may be the only interrupted tR?4A gene in these organisms...1 August 1986 RESEARCH OBJECTIVE: To determine the mechanism of tRNA intron processing in the halophilic archaebacteria; characterize the enzyme

A Host Susceptibility Gene, DR1, Facilitates Influenza A Virus Replication by Suppressing Host Innate Immunity and Enhancing Viral RNA Replication

PubMed Central

Hsu, Shih-Feng; Su, Wen-Chi; Jeng, King-Song

2015-01-01

ABSTRACT Influenza A virus (IAV) depends on cellular factors to complete its replication cycle; thus, investigation of the factors utilized by IAV may facilitate antiviral drug development. To this end, a cellular transcriptional repressor, DR1, was identified from a genome-wide RNA interference (RNAi) screen. Knockdown (KD) of DR1 resulted in reductions of viral RNA and protein production, demonstrating that DR1 acts as a positive host factor in IAV replication. Genome-wide transcriptomic analysis showed that there was a strong induction of interferon-stimulated gene (ISG) expression after prolonged DR1 KD. We found that beta interferon (IFN-β) was induced by DR1 KD, thereby activating the JAK-STAT pathway to turn on ISG expression, which led to a strong inhibition of IAV replication. This result suggests that DR1 in normal cells suppresses IFN induction, probably to prevent undesired cytokine production, but that this suppression may create a milieu that favors IAV replication once cells are infected. Furthermore, biochemical assays of viral RNA replication showed that DR1 KD suppressed viral RNA replication. We also showed that DR1 associated with all three subunits of the viral RNA-dependent RNA polymerase (RdRp) complex, indicating that DR1 may interact with individual components of the viral RdRp complex to enhance viral RNA replication. Thus, DR1 may be considered a novel host susceptibility gene for IAV replication via a dual mechanism, not only suppressing the host defense to indirectly favor IAV replication but also directly facilitating viral RNA replication. IMPORTANCE Investigations of virus-host interactions involved in influenza A virus (IAV) replication are important for understanding viral pathogenesis and host defenses, which may manipulate influenza virus infection or prevent the emergence of drug resistance caused by a high error rate during viral RNA replication. For this purpose, a cellular transcriptional repressor, DR1, was identified from

Mechanisms and Regulation of Alternative Pre-mRNA Splicing

PubMed Central

Lee, Yeon

2015-01-01

Precursor messenger RNA (pre-mRNA) splicing is a critical step in the posttranscriptional regulation of gene expression, providing significant expansion of the functional proteome of eukaryotic organisms with limited gene numbers. Split eukaryotic genes contain intervening sequences or introns disrupting protein-coding exons, and intron removal occurs by repeated assembly of a large and highly dynamic ribonucleoprotein complex termed the spliceosome, which is composed of five small nuclear ribonucleoprotein particles, U1, U2, U4/U6, and U5. Biochemical studies over the past 10 years have allowed the isolation as well as compositional, functional, and structural analysis of splicing complexes at distinct stages along the spliceosome cycle. The average human gene contains eight exons and seven introns, producing an average of three or more alternatively spliced mRNA isoforms. Recent high-throughput sequencing studies indicate that 100% of human genes produce at least two alternative mRNA isoforms. Mechanisms of alternative splicing include RNA–protein interactions of splicing factors with regulatory sites termed silencers or enhancers, RNA–RNA base-pairing interactions, or chromatin-based effects that can change or determine splicing patterns. Disease-causing mutations can often occur in splice sites near intron borders or in exonic or intronic RNA regulatory silencer or enhancer elements, as well as in genes that encode splicing factors. Together, these studies provide mechanistic insights into how spliceosome assembly, dynamics, and catalysis occur; how alternative splicing is regulated and evolves; and how splicing can be disrupted by cis- and trans-acting mutations leading to disease states. These findings make the spliceosome an attractive new target for small-molecule, antisense, and genome-editing therapeutic interventions. PMID:25784052

Post-transcriptional inducible gene regulation by natural antisense RNA.

PubMed

Nishizawa, Mikio; Ikeya, Yukinobu; Okumura, Tadayoshi; Kimura, Tominori

2015-01-01

Accumulating data indicate the existence of natural antisense transcripts (asRNAs), frequently transcribed from eukaryotic genes and do not encode proteins in many cases. However, their importance has been overlooked due to their heterogeneity, low expression level, and unknown function. Genes induced in responses to various stimuli are transcriptionally regulated by the activation of a gene promoter and post-transcriptionally regulated by controlling mRNA stability and translatability. A low-copy-number asRNA may post-transcriptionally regulate gene expression with cis-controlling elements on the mRNA. The asRNA itself may act as regulatory RNA in concert with trans-acting factors, including various RNA-binding proteins that bind to cis-controlling elements, microRNAs, and drugs. A novel mechanism that regulates mRNA stability includes the interaction of asRNA with mRNA by hybridization to loops in secondary structures. Furthermore, recent studies have shown that the functional network of mRNAs, asRNAs, and microRNAs finely tunes the levels of mRNA expression. The post-transcriptional mechanisms via these RNA-RNA interactions may play pivotal roles to regulate inducible gene expression and present the possibility of the involvement of asRNAs in various diseases.

The mRNA cap-binding protein Cbc1 is required for high and timely expression of genes by promoting the accumulation of gene-specific activators at promoters.

PubMed

Li, Tianlu; De Clercq, Nikki; Medina, Daniel A; Garre, Elena; Sunnerhagen, Per; Pérez-Ortín, José E; Alepuz, Paula

2016-02-01

The highly conserved Saccharomyces cerevisiae cap-binding protein Cbc1/Sto1 binds mRNA co-transcriptionally and acts as a key coordinator of mRNA fate. Recently, Cbc1 has also been implicated in transcription elongation and pre-initiation complex (PIC) formation. Previously, we described Cbc1 to be required for cell growth under osmotic stress and to mediate osmostress-induced translation reprogramming. Here, we observe delayed global transcription kinetics in cbc1Δ during osmotic stress that correlates with delayed recruitment of TBP and RNA polymerase II to osmo-induced promoters. Interestingly, we detect an interaction between Cbc1 and the MAPK Hog1, which controls most gene expression changes during osmostress, and observe that deletion of CBC1 delays the accumulation of the activator complex Hot1-Hog1 at osmostress promoters. Additionally, CBC1 deletion specifically reduces transcription rates of highly transcribed genes under non-stress conditions, such as ribosomal protein (RP) genes, while having low impact on transcription of weakly expressed genes. For RP genes, we show that recruitment of the specific activator Rap1, and subsequently TBP, to promoters is Cbc1-dependent. Altogether, our results indicate that binding of Cbc1 to the capped mRNAs is necessary for the accumulation of specific activators as well as PIC components at the promoters of genes whose expression requires high and rapid transcription. Copyright © 2016 Elsevier B.V. All rights reserved.

Effects of gestational hypertension and pre-eclampsia in mRNA expression of fibrinolysis genes in primary cultured human umbilical vein endothelial cells.

PubMed

Poblete-Naredo, Irais; Rodríguez-Yáñez, Yury; Corona-Núñez, Rogelio O; González-Monroy, Stuart; Salinas, Juan E; Albores, Arnulfo

2018-05-17

Hypertension disorders (HD) and pre-eclampsia (PRE) are leading causes of maternal deaths worldwide. PRE is associated with vascular endothelial dysfunction and with deregulation of the fibrinolysis pathway genes. Fibrinolysis is the fibrin clot hydrolysis process catalyzed by plasmin, a proteolytic enzyme formed from plasminogen. Plasminogen is cleaved by tissue-type (tPA) and urokinase-type (uPA) activators and inhibited by the plasminogen activator inhibitors type-1 (PAI-1) and type-2 (PAI-2). The whole process maintains blood hemostasis. This study aims to assess PAI-1, PAI-2, tPA and uPA mRNA expression in primary cultured human umbilical vein endothelial cells (HUVEC) isolated and cultured from healthy, HD and PRE women. Results show that PAI-1 and PAI-2 mRNA decreased in HD-HUVEC, whereas PAI-1 and uPA decreased in PRE-HUVEC cultures compared to control ones. Notably, the expression ratio between pro- and anti-fibrinolytic actors remained unchanged among the studied groups. It seems that newborn's hemostasis is maintained balanced probably by a compensatory mechanism that involves changes in the fibrinolysis gene expression profile. The real impact of these changes in mRNA expression is unknown, however, it is suggested that these changes could be associated with an increased predisposition to vascular disease development in the progeny. Copyright © 2018. Published by Elsevier Ltd.

miRNA-mediated 'tug-of-war' model reveals ceRNA propensity of genes in cancers.

PubMed

Swain, Arpit Chandan; Mallick, Bibekanand

2018-06-01

Competing endogenous RNA (ceRNA) are transcripts that cross-regulate each other at the post-transcriptional level by competing for shared microRNA response elements (MREs). These have been implicated in various biological processes impacting cell-fate decisions and diseases including cancer. There are several studies that predict possible ceRNA pairs by adopting various machine-learning and mathematical approaches; however, there is no method that enables us to gauge as well as compare the propensity of the ceRNA of a gene and precisely envisages which among a pair exerts a stronger pull on the shared miRNA pool. In this study, we developed a method that uses the 'tug of war of genes' concept to predict and quantify ceRNA potential of a gene for the shared miRNA pool in cancers based on a score represented by SoCeR (score of competing endogenous RNA). The method was executed on the RNA-Seq transcriptional profiles of genes and miRNA available at TCGA along with CLIP-supported miRNA-target sites to predict ceRNA in 32 cancer types which were validated with already reported cases. The proposed method can be used to determine the sequestering capability of the gene of interest as well as in ranking the probable ceRNA candidates of a gene. Finally, we developed standalone applications (SoCeR tool) to aid researchers in easier implementation of the method in analysing different data sets or diseases. © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

Processing of Archaebacterial Intron-Containing tRNA Gene Transcripts.

DTIC Science & Technology

1987-07-31

1{ 1. Project Goals: A. To determine the mechanism of tRNA intron processing in the halophilic archaebacteria. B. Characterize and compare the...enzyme(s) responsible for the removal of 5’-flanking sequences from halophilic and sulfur-dependent tRNA gene transcripts. C. Examine the structure and...distribution of tRNA introns in the halophilic archaebacteria. 2. Accomplishments: A. Intron processing mechanism We have succeeded in our primary

tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.

PubMed

Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi

2014-01-01

The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

β-glucuronidase use as a single internal control gene may confound analysis in FMR1 mRNA toxicity studies.

PubMed

Kraan, Claudine M; Cornish, Kim M; Bui, Quang M; Li, Xin; Slater, Howard R; Godler, David E

2018-01-01

Relationships between Fragile X Mental Retardation 1 (FMR1) mRNA levels in blood and intragenic FMR1 CGG triplet expansions support the pathogenic role of RNA gain of function toxicity in premutation (PM: 55-199 CGGs) related disorders. Real-time PCR (RT-PCR) studies reporting these findings normalised FMR1 mRNA level to a single internal control gene called β-glucuronidase (GUS). This study evaluated FMR1 mRNA-CGG correlations in 33 PM and 33 age- and IQ-matched control females using three normalisation strategies in peripheral blood mononuclear cells (PBMCs): (i) GUS as a single internal control; (ii) the mean of GUS, Eukaryotic Translation Initiation Factor 4A2 (EIF4A2) and succinate dehydrogenase complex flavoprotein subunit A (SDHA); and (iii) the mean of EIF4A2 and SDHA (with no contribution from GUS). GUS mRNA levels normalised to the mean of EIF4A2 and SDHA mRNA levels and EIF4A2/SDHA ratio were also evaluated. FMR1mRNA level normalised to the mean of EIF4A2 and SDHA mRNA levels, with no contribution from GUS, showed the most significant correlation with CGG size and the greatest difference between PM and control groups (p = 10-11). Only 15% of FMR1 mRNA PM results exceeded the maximum control value when normalised to GUS, compared with over 42% when normalised to the mean of EIF4A2 and SDHA mRNA levels. Neither GUS mRNA level normalised to the mean RNA levels of EIF4A2 and SDHA, nor to the EIF4A2/SDHA ratio were correlated with CGG size. However, greater variability in GUS mRNA levels were observed for both PM and control females across the full range of CGG repeat as compared to the EIF4A2/SDHA ratio. In conclusion, normalisation with multiple control genes, excluding GUS, can improve assessment of the biological significance of FMR1 mRNA-CGG size relationships.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted

SmD1 Modulates the miRNA Pathway Independently of Its Pre-mRNA Splicing Function.

PubMed

Xiong, Xiao-Peng; Vogler, Georg; Kurthkoti, Krishna; Samsonova, Anastasia; Zhou, Rui

2015-08-01

microRNAs (miRNAs) are a class of endogenous regulatory RNAs that play a key role in myriad biological processes. Upon transcription, primary miRNA transcripts are sequentially processed by Drosha and Dicer ribonucleases into ~22-24 nt miRNAs. Subsequently, miRNAs are incorporated into the RNA-induced silencing complexes (RISCs) that contain Argonaute (AGO) family proteins and guide RISC to target RNAs via complementary base pairing, leading to post-transcriptional gene silencing by a combination of translation inhibition and mRNA destabilization. Select pre-mRNA splicing factors have been implicated in small RNA-mediated gene silencing pathways in fission yeast, worms, flies and mammals, but the underlying molecular mechanisms are not well understood. Here, we show that SmD1, a core component of the Drosophila small nuclear ribonucleoprotein particle (snRNP) implicated in splicing, is required for miRNA biogenesis and function. SmD1 interacts with both the microprocessor component Pasha and pri-miRNAs, and is indispensable for optimal miRNA biogenesis. Depletion of SmD1 impairs the assembly and function of the miRISC without significantly affecting the expression of major canonical miRNA pathway components. Moreover, SmD1 physically and functionally associates with components of the miRISC, including AGO1 and GW182. Notably, miRNA defects resulting from SmD1 silencing can be uncoupled from defects in pre-mRNA splicing, and the miRNA and splicing machineries are physically and functionally distinct entities. Finally, photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) analysis identifies numerous SmD1-binding events across the transcriptome and reveals direct SmD1-miRNA interactions. Our study suggests that SmD1 plays a direct role in miRNA-mediated gene silencing independently of its pre-mRNA splicing activity and indicates that the dual roles of splicing factors in post-transcriptional gene regulation may be evolutionarily

Unmasking Upstream Gene Expression Regulators with miRNA-corrected mRNA Data

PubMed Central

Bollmann, Stephanie; Bu, Dengpan; Wang, Jiaqi; Bionaz, Massimo

2015-01-01

Expressed micro-RNA (miRNA) affects messenger RNA (mRNA) abundance, hindering the accuracy of upstream regulator analysis. Our objective was to provide an algorithm to correct such bias. Large mRNA and miRNA analyses were performed on RNA extracted from bovine liver and mammary tissue. Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%). Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%) and four levels of the magnitude of miRNA effect (ME) on mRNA expression (30%, 50%, 75%, and 83% mRNA reduction), we generated 17 different datasets (including the original dataset). For each dataset, we performed upstream regulator analysis using two bioinformatics tools. We detected an increased effect on the upstream regulator analysis with larger miRNA:mRNA pair bins and higher ME. The miRNA correction allowed identification of several upstream regulators not present in the analysis of the original dataset. Thus, the proposed algorithm improved the prediction of upstream regulators. PMID:27279737

Regulation of miRNA Processing and miRNA Mediated Gene Repression in Cancer

PubMed Central

Bajan, Sarah; Hutvagner, Gyorgy

2014-01-01

The majority of human protein-coding genes are predicted to be targets of miRNA-mediated post-transcriptional regulation. The widespread influence of miRNAs is illustrated by their essential roles in all biological processes. Regulated miRNA expression is essential for maintaining cellular differentiation; therefore alterations in miRNA expression patterns are associated with several diseases, including various cancers. High-throughput sequencing technologies revealed low level expressing miRNA isoforms, termed isomiRs. IsomiRs may differ in sequence, length, target preference and expression patterns from their parental miRNA and can arise from differences in miRNA biosynthesis, RNA editing, or SNPs inherent to the miRNA gene. The association between isomiR expression and disease progression is largely unknown. Misregulated miRNA expression is thought to contribute to the formation and/or progression of cancer. However, due to the diversity of targeted transcripts, miRNAs can function as both tumor-suppressor genes and oncogenes as defined by cellular context. Despite this, miRNA profiling studies concluded that the differential expression of particular miRNAs in diseased tissue could aid the diagnosis and treatment of some cancers. PMID:25069508

Impact of spliceosome mutations on RNA splicing in myelodysplasia: dysregulated genes/pathways and clinical associations.

PubMed

Pellagatti, Andrea; Armstrong, Richard N; Steeples, Violetta; Sharma, Eshita; Repapi, Emmanouela; Singh, Shalini; Sanchi, Andrea; Radujkovic, Aleksandar; Horn, Patrick; Dolatshad, Hamid; Roy, Swagata; Broxholme, John; Lockstone, Helen; Taylor, Stephen; Giagounidis, Aristoteles; Vyas, Paresh; Schuh, Anna; Hamblin, Angela; Papaemmanuil, Elli; Killick, Sally; Malcovati, Luca; Hennrich, Marco L; Gavin, Anne-Claude; Ho, Anthony D; Luft, Thomas; Hellström-Lindberg, Eva; Cazzola, Mario; Smith, Christopher W J; Smith, Stephen; Boultwood, Jacqueline

2018-06-21

SF3B1, SRSF2 and U2AF1 are the most frequently mutated splicing factor genes in the myelodysplastic syndromes (MDS). We have performed a comprehensive and systematic analysis to determine the impact of these commonly mutated splicing factors on pre-mRNA splicing in the bone marrow stem/progenitor cells and in the erythroid and myeloid precursors in splicing factor mutant MDS. Using RNA-seq, we determined the aberrantly spliced genes and dysregulated pathways in CD34 + cells of 84 MDS patients. Splicing factor mutations result in different alterations in splicing and largely affect different genes, but these converge in common dysregulated pathways and cellular processes, focused on RNA splicing, protein synthesis and mitochondrial dysfunction, suggesting common mechanisms of action in MDS. Many of these dysregulated pathways and cellular processes can be linked to the known disease pathophysiology associated with splicing factor mutations in MDS, whilst several others have not been previously associated with MDS, such as sirtuin signaling. We identified aberrantly spliced events associated with clinical variables, and isoforms which independently predict survival in MDS and implicate dysregulation of focal adhesion and extracellular exosomes as drivers of poor survival. Aberrantly spliced genes and dysregulated pathways were identified in the MDS-affected lineages in splicing factor mutant MDS. Functional studies demonstrated that knockdown of the mitosis regulators SEPT2 and AKAP8, aberrantly spliced target genes of SF3B1 and SRSF2 mutations respectively, led to impaired erythroid cell growth and differentiation. This study illuminates the impact of the common spliceosome mutations on the MDS phenotype and provides novel insights into disease pathophysiology. Copyright © 2018 American Society of Hematology.

siRNA Versus miRNA as Therapeutics for Gene Silencing

PubMed Central

Lam, Jenny K W; Chow, Michael Y T; Zhang, Yu; Leung, Susan W S

2015-01-01

Discovered a little over two decades ago, small interfering RNAs (siRNAs) and microRNAs (miRNAs) are noncoding RNAs with important roles in gene regulation. They have recently been investigated as novel classes of therapeutic agents for the treatment of a wide range of disorders including cancers and infections. Clinical trials of siRNA- and miRNA-based drugs have already been initiated. siRNAs and miRNAs share many similarities, both are short duplex RNA molecules that exert gene silencing effects at the post-transcriptional level by targeting messenger RNA (mRNA), yet their mechanisms of action and clinical applications are distinct. The major difference between siRNAs and miRNAs is that the former are highly specific with only one mRNA target, whereas the latter have multiple targets. The therapeutic approaches of siRNAs and miRNAs are therefore very different. Hence, this review provides a comparison between therapeutic siRNAs and miRNAs in terms of their mechanisms of action, physicochemical properties, delivery, and clinical applications. Moreover, the challenges in developing both classes of RNA as therapeutics are also discussed. PMID:26372022

Adaptive evolution of newly emerged micro-RNA genes in Drosophila.

PubMed

Lu, Jian; Fu, Yonggui; Kumar, Supriya; Shen, Yang; Zeng, Kai; Xu, Anlong; Carthew, Richard; Wu, Chung-I

2008-05-01

How often micro-RNA (miRNA) genes emerged and how fast they evolved soon after their emergence are some of the central questions in the evolution of miRNAs. Because most known miRNA genes are ancient and highly conserved, these questions can be best answered by identifying newly emerged miRNA genes. Among the 78 miRNA genes in Drosophila reported before 2007, only 5 are confirmed to be newly emerged in the genus (although many more can be found in the newly reported data set; e.g., Ruby et al. 2007; Stark et al. 2007; Lu et al. 2008). These new miRNA genes have undergone numerous changes, even in the normally invariant mature sequences. Four of them (the miR-310/311/312/313 cluster, denoted miR-310s) were duplicated from other conserved miRNA genes. The fifth one (miR-303) appears to be a very young gene, originating de novo from a non-miRNA sequence recently. We sequenced these 5 miRNA genes and their neighboring regions from a worldwide collection of Drosophila melanogaster lines. The levels of divergence and polymorphism in these miRNA genes, vis-à-vis those of the neighboring DNA sequences, suggest that these 5 genes are evolving adaptively. Furthermore, the polymorphism pattern of miR-310s in D. melanogaster is indicative of hitchhiking under positive selection. Thus, a large number of adaptive changes over a long period of time may be essential for the evolution of newly emerged miRNA genes.

An RNA editing/dsRNA binding-independent gene regulatory mechanism of ADARs and its clinical implication in cancer.

PubMed

Qi, Lihua; Song, Yangyang; Chan, Tim Hon Man; Yang, Henry; Lin, Chi Ho; Tay, Daryl Jin Tai; Hong, HuiQi; Tang, Sze Jing; Tan, Kar Tong; Huang, Xi Xiao; Lin, Jaymie Siqi; Ng, Vanessa Hui En; Maury, Julien Jean Pierre; Tenen, Daniel G; Chen, Leilei

2017-10-13

Adenosine-to-inosine (A-to-I) RNA editing, catalyzed by Adenosine DeAminases acting on double-stranded RNA(dsRNA) (ADAR), occurs predominantly in the 3' untranslated regions (3'UTRs) of spliced mRNA. Here we uncover an unanticipated link between ADARs (ADAR1 and ADAR2) and the expression of target genes undergoing extensive 3'UTR editing. Using METTL7A (Methyltransferase Like 7A), a novel tumor suppressor gene with multiple editing sites at its 3'UTR, we demonstrate that its expression could be repressed by ADARs beyond their RNA editing and double-stranded RNA (dsRNA) binding functions. ADARs interact with Dicer to augment the processing of pre-miR-27a to mature miR-27a. Consequently, mature miR-27a targets the METTL7A 3'UTR to repress its expression level. In sum, our study unveils that the extensive 3'UTR editing of METTL7A is merely a footprint of ADAR binding, and there are a subset of target genes that are equivalently regulated by ADAR1 and ADAR2 through their non-canonical RNA editing and dsRNA binding-independent functions, albeit maybe less common. The functional significance of ADARs is much more diverse than previously appreciated and this gene regulatory function of ADARs is most likely to be of high biological importance beyond the best-studied editing function. This non-editing side of ADARs opens another door to target cancer. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

An RNA editing/dsRNA binding-independent gene regulatory mechanism of ADARs and its clinical implication in cancer

PubMed Central

Qi, Lihua; Song, Yangyang; Chan, Tim Hon Man; Yang, Henry; Lin, Chi Ho; Tay, Daryl Jin Tai; Hong, HuiQi; Tang, Sze Jing; Tan, Kar Tong; Huang, Xi Xiao; Lin, Jaymie Siqi; Ng, Vanessa Hui En; Maury, Julien Jean Pierre

2017-01-01

Abstract Adenosine-to-inosine (A-to-I) RNA editing, catalyzed by Adenosine DeAminases acting on double-stranded RNA(dsRNA) (ADAR), occurs predominantly in the 3′ untranslated regions (3′UTRs) of spliced mRNA. Here we uncover an unanticipated link between ADARs (ADAR1 and ADAR2) and the expression of target genes undergoing extensive 3′UTR editing. Using METTL7A (Methyltransferase Like 7A), a novel tumor suppressor gene with multiple editing sites at its 3′UTR, we demonstrate that its expression could be repressed by ADARs beyond their RNA editing and double-stranded RNA (dsRNA) binding functions. ADARs interact with Dicer to augment the processing of pre-miR-27a to mature miR-27a. Consequently, mature miR-27a targets the METTL7A 3′UTR to repress its expression level. In sum, our study unveils that the extensive 3′UTR editing of METTL7A is merely a footprint of ADAR binding, and there are a subset of target genes that are equivalently regulated by ADAR1 and ADAR2 through their non-canonical RNA editing and dsRNA binding-independent functions, albeit maybe less common. The functional significance of ADARs is much more diverse than previously appreciated and this gene regulatory function of ADARs is most likely to be of high biological importance beyond the best-studied editing function. This non-editing side of ADARs opens another door to target cancer. PMID:28985428

HoxBlinc RNA Recruits Set1/MLL Complexes to Activate Hox Gene Expression Patterns and Mesoderm Lineage Development.

PubMed

Deng, Changwang; Li, Ying; Zhou, Lei; Cho, Joonseok; Patel, Bhavita; Terada, Naohiro; Li, Yangqiu; Bungert, Jörg; Qiu, Yi; Huang, Suming

2016-01-05

Trithorax proteins and long-intergenic noncoding RNAs are critical regulators of embryonic stem cell pluripotency; however, how they cooperatively regulate germ layer mesoderm specification remains elusive. We report here that HoxBlinc RNA first specifies Flk1(+) mesoderm and then promotes hematopoietic differentiation through regulation of hoxb pathways. HoxBlinc binds to the hoxb genes, recruits Setd1a/MLL1 complexes, and mediates long-range chromatin interactions to activate transcription of the hoxb genes. Depletion of HoxBlinc by shRNA-mediated knockdown or CRISPR-Cas9-mediated genetic deletion inhibits expression of hoxb genes and other factors regulating cardiac/hematopoietic differentiation. Reduced hoxb expression is accompanied by decreased recruitment of Set1/MLL1 and H3K4me3 modification, as well as by reduced chromatin loop formation. Re-expression of hoxb2-b4 genes in HoxBlinc-depleted embryoid bodies rescues Flk1(+) precursors that undergo hematopoietic differentiation. Thus, HoxBlinc plays an important role in controlling hoxb transcription networks that mediate specification of mesoderm-derived Flk1(+) precursors and differentiation of Flk1(+) cells into hematopoietic lineages. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Hypoxic regulation of the expression of cell proliferation related genes in U87 glioma cells upon inhibition of ire1 signaling enzyme

PubMed

Minchenko, O H; Tsymbal, D O; Minchenko, D O; Riabovol, O O; Ratushna, O O; Karbovskyi, L L

2016-01-01

We have studied the effect of inhibition of IRE1 (inositol requiring enzyme 1), which is a central mediator of endoplasmic reticulum stress and a controller of cell proliferation and tumor growth, on hypoxic regulation of the expression of different proliferation related genes in U87 glioma cells. It was shown that hypoxia leads to up-regulation of the expression of IL13RA2, CD24, ING1, ING2, ENDOG, and POLG genes and to down-regulation – of KRT18, TRAPPC3, TSFM, and MTIF2 genes at the mRNA level in control glioma cells. Changes for ING1 and CD24 genes were more significant. At the same time, inhibition of IRE1 modifies the effect of hypoxia on the expression of all studied genes. In particular, it increases sensitivity to hypoxia of the expression of IL13RA2, TRAPPC3, ENDOG, and PLOG genes and suppresses the effect of hypoxia on the expression of ING1 gene. Additionally, it eliminates hypoxic regulation of KRT18, CD24, ING2, TSFM, and MTIF2 genes expressions and introduces sensitivity to hypoxia of the expression of BET1 gene in glioma cells. The present study demonstrates that hypoxia, which often contributes to tumor growth, affects the expression of almost all studied genes. Additionally, inhibition of IRE1 can both enhance and suppress the hypoxic regulation of these gene expressions in a gene specific manner and thus possibly contributes to slower glioma growth, but several aspects of this regulation must be further clarified.

Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

PubMed

Hughes, J M

1996-06-21

The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

Combinatory RNA-Sequencing Analyses Reveal a Dual Mode of Gene Regulation by ADAR1 in Gastric Cancer.

PubMed

Cho, Charles J; Jung, Jaeeun; Jiang, Lushang; Lee, Eun Ji; Kim, Dae-Soo; Kim, Byung Sik; Kim, Hee Sung; Jung, Hwoon-Yong; Song, Ho-June; Hwang, Sung Wook; Park, Yangsoon; Jung, Min Kyo; Pack, Chan Gi; Myung, Seung-Jae; Chang, Suhwan

2018-04-25

Adenosine deaminase acting on RNA 1 (ADAR1) is known to mediate deamination of adenosine-to-inosine through binding to double-stranded RNA, the phenomenon known as RNA editing. Currently, the function of ADAR1 in gastric cancer is unclear. This study was aimed at investigating RNA editing-dependent and editing-independent functions of ADAR1 in gastric cancer, especially focusing on its influence on editing of 3' untranslated regions (UTRs) and subsequent changes in expression of messenger RNAs (mRNAs) as well as microRNAs (miRNAs). RNA-sequencing and small RNA-sequencing were performed on AGS and MKN-45 cells with a stable ADAR1 knockdown. Changed frequencies of editing and mRNA and miRNA expression were then identified by bioinformatic analyses. Targets of RNA editing were further validated in patients' samples. In the Alu region of both gastric cell lines, editing was most commonly of the A-to-I type in 3'-UTR or intron. mRNA and protein levels of PHACTR4 increased in ADAR1 knockdown cells, because of the loss of seed sequences in 3'-UTR of PHACTR4 mRNA that are required for miRNA-196a-3p binding. Immunohistochemical analyses of tumor and paired normal samples from 16 gastric cancer patients showed that ADAR1 expression was higher in tumors than in normal tissues and inversely correlated with PHACTR4 staining. On the other hand, decreased miRNA-148a-3p expression in ADAR1 knockdown cells led to increased mRNA and protein expression of NFYA, demonstrating ADAR1's editing-independent function. ADAR1 regulates post-transcriptional gene expression in gastric cancer through both RNA editing-dependent and editing-independent mechanisms.

Elongator complex influences telomeric gene silencing and DNA damage response by its role in wobble uridine tRNA modification.

PubMed

Chen, Changchun; Huang, Bo; Eliasson, Mattias; Rydén, Patrik; Byström, Anders S

2011-09-01

Elongator complex is required for formation of the side chains at position 5 of modified nucleosides 5-carbamoylmethyluridine (ncm⁵U₃₄), 5-methoxycarbonylmethyluridine (mcm⁵U₃₄), and 5-methoxycarbonylmethyl-2-thiouridine (mcm⁵s²U₃₄) at wobble position in tRNA. These modified nucleosides are important for efficient decoding during translation. In a recent publication, Elongator complex was implicated to participate in telomeric gene silencing and DNA damage response by interacting with proliferating cell nuclear antigen (PCNA). Here we show that elevated levels of tRNA(Lys)(s²UUU), tRNA(Gln)(s²UUG), and tRNA(Glu)(s²UUC), which in a wild-type background contain the mcm⁵s²U nucleoside at position 34, suppress the defects in telomeric gene silencing and DNA damage response observed in the Elongator mutants. We also found that the reported differences in telomeric gene silencing and DNA damage response of various elp3 alleles correlated with the levels of modified nucleosides at U₃₄. Defects in telomeric gene silencing and DNA damage response are also observed in strains with the tuc2Δ mutation, which abolish the formation of the 2-thio group of the mcm⁵s²U nucleoside in tRNA(Lys)(mcm⁵s²UUU), tRNA(Gln)(mcm⁵s²UUG), and tRNA(Glu)(mcm⁵s²UUC). These observations show that Elongator complex does not directly participate in telomeric gene silencing and DNA damage response, but rather that modified nucleosides at U₃₄ are important for efficient expression of gene products involved in these processes. Consistent with this notion, we found that expression of Sir4, a silent information regulator required for assembly of silent chromatin at telomeres, was decreased in the elp3Δ mutants.

Demonstration of mRNA editing and localization of guide RNA genes in kinetoplast-mitochondria of the plant trypanosomatid Phytomonas serpens.

PubMed

Maslov, D A; Hollar, L; Haghighat, P; Nawathean, P

1998-06-01

Maxicircle molecules of kDNA in several isolates of Phytomonas were detected by hybridization with the 12S rRNA gene probe from Leishmania tarentolae. The estimated size of maxicircles is isolate-specific and varies from 27 to 36 kb. Fully edited and polyadenylated mRNA for kinetoplast-encoded ribosomal protein S12 (RPS12) was found in the steady-state kinetoplast RNA isolated from Phytomonas serpens strain 1G. Two minicircles (1.45 kb) from this strain were also sequenced. Each minicircle contains two 120 bp conserved regions positioned 180 degrees apart, a region enriched with G and T bases and a variable region. One minicircle encodes a gRNA for the first block of editing of RPSl2 mRNA, and the other encodes a gRNA with unknown function. A gRNA gene for the second block of RPSl2 was found on a minicircle sequenced previously. On each minicircle, a gRNA gene is located in the variable region in a similar position and orientation with respect to the conserved regions.

Single-Molecule Mechanical (Un)folding of RNA Hairpins: Effects of Single A-U to A∙C Pair Substitutions and Single Proton Binding and Implications for mRNA Structure-Induced -1 Ribosomal Frameshifting.

PubMed

Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang

2018-06-08

A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.

The HEX1 Gene of Fusarium graminearum Is Required for Fungal Asexual Reproduction and Pathogenesis and for Efficient Viral RNA Accumulation of Fusarium graminearum Virus 1

PubMed Central

Son, Moonil; Lee, Kyung-Mi; Yu, Jisuk; Kang, Minji; Park, Jin Man; Kwon, Sun-Jung

2013-01-01

The accumulation of viral RNA depends on many host cellular factors. The hexagonal peroxisome (Hex1) protein is a fungal protein that is highly expressed when the DK21 strain of Fusarium graminearum virus 1 (FgV1) infects its host, and Hex1 affects the accumulation of FgV1 RNA. The Hex1 protein is the major constituent of the Woronin body (WB), which is a peroxisome-derived electron-dense core organelle that seals the septal pore in response to hyphal wounding. To clarify the role of Hex1 and the WB in the relationship between FgV1 and Fusarium graminearum, we generated targeted gene deletion and overexpression mutants. Although neither HEX1 gene deletion nor overexpression substantially affected vegetative growth, both changes reduced the production of asexual spores and reduced virulence on wheat spikelets in the absence of FgV1 infection. However, the vegetative growth of deletion and overexpression mutants was increased and decreased, respectively, upon FgV1 infection compared to that of an FgV1-infected wild-type isolate. Viral RNA accumulation was significantly decreased in deletion mutants but was significantly increased in overexpression mutants compared to the viral RNA accumulation in the virus-infected wild-type control. Overall, these data indicate that the HEX1 gene plays a direct role in the asexual reproduction and virulence of F. graminearum and facilitates viral RNA accumulation in the FgV1-infected host fungus. PMID:23864619

The centrality of RNA for engineering gene expression

PubMed Central

Chappell, James; Takahashi, Melissa K; Meyer, Sarai; Loughrey, David; Watters, Kyle E; Lucks, Julius

2013-01-01

Synthetic biology holds promise as both a framework for rationally engineering biological systems and a way to revolutionize how we fundamentally understand them. Essential to realizing this promise is the development of strategies and tools to reliably and predictably control and characterize sophisticated patterns of gene expression. Here we review the role that RNA can play towards this goal and make a case for why this versatile, designable, and increasingly characterizable molecule is one of the most powerful substrates for engineering gene expression at our disposal. We discuss current natural and synthetic RNA regulators of gene expression acting at key points of control – transcription, mRNA degradation, and translation. We also consider RNA structural probing and computational RNA structure predication tools as a way to study RNA structure and ultimately function. Finally, we discuss how next-generation sequencing methods are being applied to the study of RNA and to the characterization of RNA's many properties throughout the cell. PMID:24124015

Frequencies and expression levels of programmed death ligand 1 (PD-L1) in circulating tumor RNA (ctRNA) in various cancer types.

PubMed

Ishiba, Toshiyuki; Hoffmann, Andreas-Claudius; Usher, Joshua; Elshimali, Yahya; Sturdevant, Todd; Dang, Mai; Jaimes, Yolanda; Tyagi, Rama; Gonzales, Ronald; Grino, Mary; Pinski, Jacek K; Barzi, Afsaneh; Raez, Luis E; Eberhardt, Wilfried E; Theegarten, Dirk; Lenz, Heinz-Josef; Uetake, Hiroyuki; Danenberg, Peter V; Danenberg, Kathleen

2018-06-07

Precision medicine and prediction of therapeutic response requires monitoring potential biomarkers before and after treatment. Liquid biopsies provide noninvasive prognostic markers such as circulating tumor DNA and RNA. Circulating tumor RNA (ctRNA) in blood is also used to identify mutations in genes of interest, but additionally, provides information about relative expression levels of important genes. In this study, we analyzed PD-L1 expression in ctRNA isolated from various cancer types. Tumors inhibit antitumor response by modulating the immune checkpoint proteins programmed death ligand 1 (PD-L1) and its cognate receptor PD1. The expression of these genes has been implicated in evasion of immune response and resistance to targeted therapies. Blood samples were collected from gastric (GC), colorectal (CRC), lung (NSCLC), breast (BC), prostate cancer (PC) patients, and a healthy control group. ctRNA was purified from fractionated plasma, and following reverse transcription, levels of PD-L1 expression were analyzed using qPCR. PD-L1 expression was detected in the plasma ctRNA of all cancer types at varying frequencies but no PD-L1 mRNA was detected in cancer-free individuals. The frequencies of PD-L1 expression were significantly different among the various cancer types but the median relative PD-L1 expression values were not significantly different. In 12 cases where plasma and tumor tissue were available from the same patients, there was a high degree of concordance between expression of PD-L1 protein in tumor tissues and PD-L1 gene expression in plasma, and both methods were equally predictive of response to nivolumab. PD-L1 mRNA can be detected and quantitated in ctRNA of cancer patients. These results pave the way for further studies aimed at determining whether monitoring the levels of PD-L1 mRNA in blood can identify patients who are most likely to benefit from the conventional treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

New Type of BACE1 siRNA Delivery to Cells

PubMed Central

Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz

2014-01-01

Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230

SL1 RNA gene recovery from Enterobius vermicularis ancient DNA in pre-Columbian human coprolites.

PubMed

Iñiguez, Alena Mayo; Reinhard, Karl; Carvalho Gonçalves, Marcelo Luiz; Ferreira, Luiz Fernando; Araújo, Adauto; Paulo Vicente, Ana Carolina

2006-11-01

Enterobius vermicularis, pinworm, is one of the most common helminths worldwide, infecting nearly a billion people at all socio-economic levels. In prehistoric populations the paleoparasitological findings show a pinworm homogeneous distribution among hunter-gatherers in North America, intensified with the advent of agriculture. This same increase also occurred in the transition from nomad hunter-gatherers to sedentary farmers in South America, although E. vermicularis infection encompasses only the ancient Andean peoples, with no record among the pre-Colombian populations in the South American lowlands. However, the outline of pinworm paleoepidemiology has been supported by microscopic finding of eggs recovered from coprolites. Since molecular techniques are precise and sensitive in detecting pathogen ancient DNA (aDNA), and also could provide insights into the parasite evolutionary history, in this work we have performed a molecular paleoparasitological study of E. vermicularis. aDNA was recovered and pinworm 5S rRNA spacer sequences were determined from pre-Columbian coprolites (4110 BC-AD 900) from four different North and South American archaeological sites. The sequence analysis confirmed E. vermicularis identity and revealed a similarity among ancient and modern sequences. Moreover, polymorphisms were identified at the relative positions 160, 173 and 180, in independent coprolite samples from Tulán, San Pedro de Atacama, Chile (1080-950 BC). We also verified the presence of peculiarities (Splicing leader (SL1) RNA sequence, spliced donor site, the Sm antigen biding site, and RNA secondary structure) which characterise the SL1 RNA gene. The analysis shows that the SL1 RNA gene of contemporary pinworms was present in pre-Columbian E. vermicularis by 6110 years ago. We were successful in detecting E. vermicularis aDNA even in coprolites without direct microscopic evidence of the eggs, improving the diagnosis of helminth infections in the past and further

The major histocompatibility complex genes impact pain response in DA and DA.1U rats.

PubMed

Guo, Yuan; Yao, Fan-Rong; Cao, Dong-Yuan; Li, Li; Wang, Hui-Sheng; Xie, Wen; Zhao, Yan

2015-08-01

Our recent studies have shown that the difference in basal pain sensitivity to mechanical and thermal stimulation between Dark-Agouti (DA) rats and a novel congenic DA.1U rats is major histocompatibility complex (MHC) genes dependent. In the present study, we further used DA and DA.1U rats to investigate the role of MHC genes in formalin-induced pain model by behavioral, electrophysiological and immunohistochemical methods. Behavioral results showed biphasic nociceptive behaviors increased significantly following the intraplantar injection of formalin in the hindpaw of DA and DA.1U rats. The main nociceptive behaviors were lifting and licking, especially in DA rats (P<0.001 and P<0.01). The composite pain scores (CPS) in DA rats were significantly higher than those in DA.1U rats in both phases of the formalin test (P<0.01). Electrophysiological results also showed the biphasic increase in discharge rates of C and Aδ fibers of L5 dorsal root in the two strains, and the net change of the discharge rate of DA rats was significantly higher than that of DA.1U rats (P<0.05). The mechanical thresholds decreased after formalin injection in both strains (P<0.01), and the net change in the mechanical threshold in DA was greater than that in DA.1U rats (P<0.05). The expression of RT1-B, representation of MHC class II molecule, in laminae I-II of L4/5 spinal cord in DA rats was significantly higher than that in DA.1U rats in the respective experimental group (P<0.05). These results suggested that both DA and DA.1U rats exhibited nociceptive responses in formalin-induced pain model and DA rats were more sensitive to noxious chemical stimulus than DA.1U rats, indicating that MHC genes might contribute to the difference in pain sensitivity. Copyright © 2015 Elsevier Inc. All rights reserved.

Photoelectrochemical biosensor for HEN1 RNA methyltransferase detection using peroxidase mimics PtCu NFs and poly(U) polymerase-mediated RNA extension.

PubMed

Wang, Haiyan; Zhu, Libang; Duan, Junling; Wang, Minghui; Yin, Huanshun; Wang, Po; Ai, Shiyun

2018-04-30

2'-O-methyl group on the 3' terminal nucleotide in plant microRNAs, as one kind of RNA methylations, is caused by HEN1 RNA methyltransferase (HENMT1), which is thought to be crucial for ribosome biogenesis and function. Herein, a simple and label-free PEC biosensing method was proposed for assay of HENMT1 activity and inhibitor screening based on peroxidase mimic PtCu nanoframes (PtCu NFs) catalytic signal amplification. In this work, MoS 2 @Graphene quantum dots/Phosphorus-doped rodlike carbon nitride (MoS 2 @GQDs/P-RCN) heterojunction was used as photoactive materials. With the doping of GQDs and the formation of heterojunction, the photoactivity of MoS 2 is greatly improved. After the double-stranded RNA (dsRNA) with 2 nt 3' overhangs was treated with HENMT1 in the presence of S-adenosyl-L-methionine, the 3' terminal nucleotide of the unmethylated dsRNA could be extended under the catalysis of the poly(U) polymerase in the existence of UTP. Poly(A) nucleotide chain modified with carboxyl group was captured on the electrode surface through hybridization reaction and acted as a bridge for the immobilization of reticular DNA-functionalized PtCu NFs (PtCu@DNA). Under the catalysis effect of peroxidase mimics PtCu@DNA towards hydrogen peroxide, O 2- was in situ generated as electron donor and a strong photocurrent was obtained. The proposed PEC bioassay exhibited high selectivity and low detection limit of 3.36ng/mL for HENMT1 activity assay. Furthermore, the inhibition research indicated that chlorpyrifos could inhibit the HENMT1 activity with the IC 50 value of 48.32nM. Copyright © 2017 Elsevier B.V. All rights reserved.

RNA-Seq profiling reveals novel hepatic gene expression pattern in aflatoxin B1 treated rats.

PubMed

Merrick, B Alex; Phadke, Dhiral P; Auerbach, Scott S; Mav, Deepak; Stiegelmeyer, Suzy M; Shah, Ruchir R; Tice, Raymond R

2013-01-01

Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1), a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG) than microarray analysis, including low copy and novel transcripts related to AFB1's carcinogenic activity compared to feed controls (CTRL). Paired-end reads were mapped to the rat genome (Rn4) with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005) compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT's) on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c. We find the

Concerted effects of heterogeneous nuclear ribonucleoprotein C1/C2 to control vitamin D-directed gene transcription and RNA splicing in human bone cells.

PubMed

Zhou, Rui; Park, Juw Won; Chun, Rene F; Lisse, Thomas S; Garcia, Alejandro J; Zavala, Kathryn; Sea, Jessica L; Lu, Zhi-Xiang; Xu, Jianzhong; Adams, John S; Xing, Yi; Hewison, Martin

2017-01-25

Traditionally recognized as an RNA splicing regulator, heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNPC1/C2) can also bind to double-stranded DNA and function in trans as a vitamin D response element (VDRE)-binding protein. As such, hnRNPC1/C2 may couple transcription induced by the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25(OH) 2 D) with subsequent RNA splicing. In MG63 osteoblastic cells, increased expression of the 1,25(OH) 2 D target gene CYP24A1 involved immunoprecipitation of hnRNPC1/C2 with CYP24A1 chromatin and RNA. Knockdown of hnRNPC1/C2 suppressed expression of CYP24A1, but also increased expression of an exon 10-skipped CYP24A1 splice variant; in a minigene model the latter was attenuated by a functional VDRE in the CYP24A1 promoter. In genome-wide analyses, knockdown of hnRNPC1/C2 resulted in 3500 differentially expressed genes and 2232 differentially spliced genes, with significant commonality between groups. 1,25(OH) 2 D induced 324 differentially expressed genes, with 187 also observed following hnRNPC1/C2 knockdown, and a further 168 unique to hnRNPC1/C2 knockdown. However, 1,25(OH) 2 D induced only 10 differentially spliced genes, with no overlap with differentially expressed genes. These data indicate that hnRNPC1/C2 binds to both DNA and RNA and influences both gene expression and RNA splicing, but these actions do not appear to be linked through 1,25(OH) 2 D-mediated induction of transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

Genetic variants in the PIWI-piRNA pathway gene DCP1A predict melanoma disease-specific survival.

PubMed

Zhang, Weikang; Liu, Hongliang; Yin, Jieyun; Wu, Wenting; Zhu, Dakai; Amos, Christopher I; Fang, Shenying; Lee, Jeffrey E; Li, Yi; Han, Jiali; Wei, Qingyi

2016-12-15

The Piwi-piRNA pathway is important for germ cell maintenance, genome integrity, DNA methylation and retrotransposon control and thus may be involved in cancer development. In this study, we comprehensively analyzed prognostic roles of 3,116 common SNPs in PIWI-piRNA pathway genes in melanoma disease-specific survival. A published genome-wide association study (GWAS) by The University of Texas M.D. Anderson Cancer Center was used to identify associated SNPs, which were later validated by another GWAS from the Harvard Nurses' Health Study and Health Professionals Follow-up Study. After multiple testing correction, we found that there were 27 common SNPs in two genes (PIWIL4 and DCP1A) with false discovery rate < 0.2 in the discovery dataset. Three tagSNPs (i.e., rs7933369 and rs508485 in PIWIL4; rs11551405 in DCP1A) were replicated. The rs11551405 A allele, located at the 3' UTR microRNA binding site of DCP1A, was associated with an increased risk of melanoma disease-specific death in both discovery dataset [adjusted Hazards ratio (HR) = 1.66, 95% confidence interval (CI) = 1.21-2.27, p =1.50 × 10 -3 ] and validation dataset (HR = 1.55, 95% CI = 1.03-2.34, p = 0.038), compared with the C allele, and their meta-analysis showed an HR of 1.62 (95% CI, 1.26-2.08, p =1.55 × 10 -4 ). Using RNA-seq data from the 1000 Genomes Project, we found that DCP1A mRNA expression levels increased significantly with the A allele number of rs11551405. Additional large, prospective studies are needed to validate these findings. © 2016 UICC.

RNA Binding Protein-Mediated Post-Transcriptional Gene Regulation in Medulloblastoma

PubMed Central

Bish, Rebecca; Vogel, Christine

2014-01-01

Medulloblastoma, the most common malignant brain tumor in children, is a disease whose mechanisms are now beginning to be uncovered by high-throughput studies of somatic mutations, mRNA expression patterns, and epigenetic profiles of patient tumors. One emerging theme from studies that sequenced the tumor genomes of large cohorts of medulloblastoma patients is frequent mutation of RNA binding proteins. Proteins which bind multiple RNA targets can act as master regulators of gene expression at the post-transcriptional level to co-ordinate cellular processes and alter the phenotype of the cell. Identification of the target genes of RNA binding proteins may highlight essential pathways of medulloblastomagenesis that cannot be detected by study of transcriptomics alone. Furthermore, a subset of RNA binding proteins are attractive drug targets. For example, compounds that are under development as anti-viral targets due to their ability to inhibit RNA helicases could also be tested in novel approaches to medulloblastoma therapy by targeting key RNA binding proteins. In this review, we discuss a number of RNA binding proteins, including Musashi1 (MSI1), DEAD (Asp-Glu-Ala-Asp) box helicase 3 X-linked (DDX3X), DDX31, and cell division cycle and apoptosis regulator 1 (CCAR1), which play potentially critical roles in the growth and/or maintenance of medulloblastoma. PMID:24608801

Gene silencing efficiency and INF-β induction effects of splicing miRNA 155-based artificial miRNA with pre-miRNA stem-loop structures.

PubMed

Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin

2012-02-01

Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.

High-efficiency CRISPR/Cas9 multiplex gene editing using the glycine tRNA-processing system-based strategy in maize.

PubMed

Qi, Weiwei; Zhu, Tong; Tian, Zhongrui; Li, Chaobin; Zhang, Wei; Song, Rentao

2016-08-11

CRISPR/Cas9 genome editing strategy has been applied to a variety of species and the tRNA-processing system has been used to compact multiple gRNAs into one synthetic gene for manipulating multiple genes in rice. We optimized and introduced the multiplex gene editing strategy based on the tRNA-processing system into maize. Maize glycine-tRNA was selected to design multiple tRNA-gRNA units for the simultaneous production of numerous gRNAs under the control of one maize U6 promoter. We designed three gRNAs for simplex editing and three multiple tRNA-gRNA units for multiplex editing. The results indicate that this system not only increased the number of targeted sites but also enhanced mutagenesis efficiency in maize. Additionally, we propose an advanced sequence selection of gRNA spacers for relatively more efficient and accurate chromosomal fragment deletion, which is important for complete abolishment of gene function especially long non-coding RNAs (lncRNAs). Our results also indicated that up to four tRNA-gRNA units in one expression cassette design can still work in maize. The examples reported here demonstrate the utility of the tRNA-processing system-based strategy as an efficient multiplex genome editing tool to enhance maize genetic research and breeding.

Methylation of microRNA genes regulates gene expression in bisexual flower development in andromonoecious poplar

PubMed Central

Song, Yuepeng; Tian, Min; Ci, Dong; Zhang, Deqiang

2015-01-01

Previous studies showed sex-specific DNA methylation and expression of candidate genes in bisexual flowers of andromonoecious poplar, but the regulatory relationship between methylation and microRNAs (miRNAs) remains unclear. To investigate whether the methylation of miRNA genes regulates gene expression in bisexual flower development, the methylome, microRNA, and transcriptome were examined in female and male flowers of andromonoecious poplar. 27 636 methylated coding genes and 113 methylated miRNA genes were identified. In the coding genes, 64.5% of the methylated reads mapped to the gene body region; by contrast, 60.7% of methylated reads in miRNA genes mainly mapped in the 5′ and 3′ flanking regions. CHH methylation showed the highest methylation levels and CHG showed the lowest methylation levels. Correlation analysis showed a significant, negative, strand-specific correlation of methylation and miRNA gene expression (r=0.79, P <0.05). The methylated miRNA genes included eight long miRNAs (lmiRNAs) of 24 nucleotides and 11 miRNAs related to flower development. miRNA172b might play an important role in the regulation of bisexual flower development-related gene expression in andromonoecious poplar, via modification of methylation. Gynomonoecious, female, and male poplars were used to validate the methylation patterns of the miRNA172b gene, implying that hyper-methylation in andromonoecious and gynomonoecious poplar might function as an important regulator in bisexual flower development. Our data provide a useful resource for the study of flower development in poplar and improve our understanding of the effect of epigenetic regulation on genes other than protein-coding genes. PMID:25617468

LincRNA-p21 activates p21 in cis to promote Polycomb target gene expression and to enforce the G1/S checkpoint

PubMed Central

Dimitrova, Nadya; Zamudio, Jesse R.; Jong, Robyn M.; Soukup, Dylan; Resnick, Rebecca; Sarma, Kavitha; Ward, Amanda J.; Raj, Arjun; Lee, Jeannie; Sharp, Phillip A.; Jacks, Tyler

2014-01-01

SUMMARY The p53-regulated long non-coding RNA lincRNA-p21 has been proposed to act in trans via several mechanisms ranging from repressing genes in the p53 transcriptional network to regulating mRNA translation and protein stability. To further examine lincRNA-p21 function we generated a conditional knockout mouse model. We find that lincRNA-p21 predominantly functions in cis to activate expression of its neighboring gene, p21. Mechanistically, we show that lincRNA-p21 acts in concert with hnRNP-K as a co-activator for p53-dependent p21 transcription. Additional phenotypes of lincRNA-p21 deficiency could be attributed to diminished p21 levels, including deregulated expression and altered chromatin state of some Polycomb target genes, defective G1/S checkpoint, increased proliferation rates, and enhanced reprogramming efficiency. These findings indicate that lincRNA-p21 affects global gene expression and influences the p53 tumor suppressor pathway by acting in cis as a locus-restricted co-activator for p53-mediated p21 expression. PMID:24857549

A spontaneous tRNA suppressor of a mutation in the Chlamydomonas reinhardtii nuclear MCD1 gene required for stability of the chloroplast petD mRNA

PubMed Central

Murakami, Shinya; Kuehnle, Katrin; Stern, David B.

2005-01-01

Numerous nuclear gene products are required for the correct expression of organellar genes. One such gene in the green alga Chlamydomonas reinhardtii is MCD1, whose product is required for stability of the chloroplast-encoded petD mRNA. In mcd1 mutants, which are non-photosynthetic, petD mRNA is degraded by a 5′–3′ exonuclease activity, resulting in a failure to synthesize its product, subunit IV of the cytochrome b 6/f complex. Here, we report the sequence of the wild-type MCD1 gene, which encodes a large and novel putative protein. Analysis of three mutant alleles showed that two harbored large deletions, but that one allele, mcd1-2, had a single base change resulting in a nonsense codon near the N-terminus. This same mutant allele can be suppressed by a second-site mutation in the nuclear MCD2 gene, whereas mcd2-1 cannot suppress the deletion in mcd1-1 (Esposito,D. Higgs,D.C. Drager,R.G. Stern, D.B. and Girard-Bascou,J. (2001) Curr. Genet., 39, 40–48). We report the cloning of mcd2-1, and show that the mutation lies in a tRNASer(CGA), which has been modified to translate the nonsense codon in mcd1-2. We discuss how the existence of a large tRNASer gene family may permit this suppression without pleiotropic consequences. PMID:15947135

Evaluation of RNA from human trabecular bone and identification of stable reference genes.

PubMed

Cepollaro, Simona; Della Bella, Elena; de Biase, Dario; Visani, Michela; Fini, Milena

2018-06-01

The isolation of good quality RNA from tissues is an essential prerequisite for gene expression analysis to study pathophysiological processes. This study evaluated the RNA isolated from human trabecular bone and defined a set of stable reference genes. After pulverization, RNA was extracted with a phenol/chloroform method and then purified using silica columns. The A260/280 ratio, A260/230 ratio, RIN, and ribosomal ratio were measured to evaluate RNA quality and integrity. Moreover, the expression of six candidates was analyzed by qPCR and different algorithms were applied to assess reference gene stability. A good purity and quality of RNA was achieved according to A260/280 and A260/230 ratios, and RIN values. TBP, YWHAZ, and PGK1 were the most stable reference genes that should be used for gene expression analysis. In summary, the method proposed is suitable for gene expression evaluation in human bone and a set of reliable reference genes has been identified. © 2017 Wiley Periodicals, Inc.

Genetic variants in microRNA and microRNA biogenesis pathway genes and breast cancer risk among women of African ancestry

PubMed Central

Qian, Frank; Feng, Ye; Zheng, Yonglan; Ogundiran, Temidayo O.; Ojengbede, Oladosu; Zheng, Wei; Blot, William; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Nathanson, Katherine L.; Hennis, Anselm; Nemesure, Barbara; Ambs, Stefan; Kolonel, Laurence N.; Olopade, Olufunmilayo I.; Haiman, Christopher A.; Huo, Dezheng

2016-01-01

Background MicroRNAs (miRNA) regulate breast biology by binding to specific RNA sequences, leading to RNA degradation and inhibition of translation of their target genes. While germline genetic variations may disrupt some of these interactions between miRNAs and their targets, studies assessing the relationship between genetic variations in the miRNA network and breast cancer risk are still limited, particularly among women of African ancestry. Methods We systematically put together a list of 822 and 10,468 genetic variants among primary miRNA sequences and 38 genes in the miRNA biogenesis pathway, respectively; and examined their association with breast cancer risk in the ROOT consortium which includes women of African ancestry. Findings were replicated in an independent consortium. Logistic regression was used to estimate the odds ratio (OR) and 95% confidence intervals (CI). Results For overall breast cancer risk, three single nucleotide polymorphisms (SNPs) in miRNA biogenesis genes DROSHA rs78393591 (OR=0.69, 95% CI: 0.55–0.88, P=0.003), ESR1 rs523736 (OR=0.88, 95% CI: 0.82–0.95, P=3.99×10−4), and ZCCHC11 rs114101502 (OR=1.33, 95% CI: 1.11–1.59, P=0.002) and one SNP in primary miRNA sequence (rs116159732 in miR-6826, OR=0.74, 95% CI: 0.63–0.89, P=0.001) were found to have significant associations in both discovery and validation phases. In a subgroup analysis, two SNPs were associated with risk of estrogen receptor (ER)-negative breast cancer and three SNPs were associated with risk of ER-positive breast cancer. Conclusion Several variants in miRNA and miRNA biogenesis pathway genes were associated with breast cancer risk. Risk associations varied by ER status, suggesting potential new mechanisms in etiology. PMID:27380242

Genetic variants in microRNA and microRNA biogenesis pathway genes and breast cancer risk among women of African ancestry.

PubMed

Qian, Frank; Feng, Ye; Zheng, Yonglan; Ogundiran, Temidayo O; Ojengbede, Oladosu; Zheng, Wei; Blot, William; Ambrosone, Christine B; John, Esther M; Bernstein, Leslie; Hu, Jennifer J; Ziegler, Regina G; Nyante, Sarah; Bandera, Elisa V; Ingles, Sue A; Press, Michael F; Nathanson, Katherine L; Hennis, Anselm; Nemesure, Barbara; Ambs, Stefan; Kolonel, Laurence N; Olopade, Olufunmilayo I; Haiman, Christopher A; Huo, Dezheng

2016-10-01

MicroRNAs (miRNA) regulate breast biology by binding to specific RNA sequences, leading to RNA degradation and inhibition of translation of their target genes. While germline genetic variations may disrupt some of these interactions between miRNAs and their targets, studies assessing the relationship between genetic variations in the miRNA network and breast cancer risk are still limited, particularly among women of African ancestry. We systematically put together a list of 822 and 10,468 genetic variants among primary miRNA sequences and 38 genes in the miRNA biogenesis pathway, respectively; and examined their association with breast cancer risk in the ROOT consortium which includes women of African ancestry. Findings were replicated in an independent consortium. Logistic regression was used to estimate the odds ratio (OR) and 95 % confidence intervals (CI). For overall breast cancer risk, three single-nucleotide polymorphisms (SNPs) in miRNA biogenesis genes DROSHA rs78393591 (OR = 0.69, 95 % CI: 0.55-0.88, P = 0.003), ESR1 rs523736 (OR = 0.88, 95 % CI: 0.82-0.95, P = 3.99 × 10(-4)), and ZCCHC11 rs114101502 (OR = 1.33, 95 % CI: 1.11-1.59, P = 0.002), and one SNP in primary miRNA sequence (rs116159732 in miR-6826, OR = 0.74, 95 % CI: 0.63-0.89, P = 0.001) were found to have significant associations in both discovery and validation phases. In a subgroup analysis, two SNPs were associated with risk of estrogen receptor (ER)-negative breast cancer, and three SNPs were associated with risk of ER-positive breast cancer. Several variants in miRNA and miRNA biogenesis pathway genes were associated with breast cancer risk. Risk associations varied by ER status, suggesting potential new mechanisms in etiology.

Alternative Polyadenylation Allows Differential Negative Feedback of Human miRNA miR-579 on Its Host Gene ZFR

PubMed Central

Hinske, Ludwig Christian; Galante, Pedro A. F.; Limbeck, Elisabeth; Möhnle, Patrick; Parmigiani, Raphael B.; Ohno-Machado, Lucila; Camargo, Anamaria A.; Kreth, Simone

2015-01-01

About half of the known miRNA genes are located within protein-coding host genes, and are thus subject to co-transcription. Accumulating data indicate that this coupling may be an intrinsic mechanism to directly regulate the host gene’s expression, constituting a negative feedback loop. Inevitably, the cell requires a yet largely unknown repertoire of methods to regulate this control mechanism. We propose APA as one possible mechanism by which negative feedback of intronic miRNA on their host genes might be regulated. Using in-silico analyses, we found that host genes that contain seed matching sites for their intronic miRNAs yield longer 32UTRs with more polyadenylation sites. Additionally, the distribution of polyadenylation signals differed significantly between these host genes and host genes of miRNAs that do not contain potential miRNA binding sites. We then transferred these in-silico results to a biological example and investigated the relationship between ZFR and its intronic miRNA miR-579 in a U87 cell line model. We found that ZFR is targeted by its intronic miRNA miR-579 and that alternative polyadenylation allows differential targeting. We additionally used bioinformatics analyses and RNA-Seq to evaluate a potential cross-talk between intronic miRNAs and alternative polyadenylation. CPSF2, a gene previously associated with alternative polyadenylation signal recognition, might be linked to intronic miRNA negative feedback by altering polyadenylation signal utilization. PMID:25799583

ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

PubMed Central

Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

1997-01-01

ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to

Cellular RNA-dependent RNA polymerase involved in posttranscriptional gene silencing has two distinct activity modes.

PubMed

Makeyev, Eugene V; Bamford, Dennis H

2002-12-01

Recent genetic data suggest that proteins homologous to a plant RNA-dependent RNA polymerase (RdRP) play a central role in posttranscriptional gene silencing (PTGS) in many organisms. We show here that purified recombinant protein QDE-1, a genetic component of PTGS ("quelling") in the fungus Neurospora crassa, possesses RNA polymerase activity in vitro. The full-length enzyme and its enzymatically active C-terminal fragment perform two different reactions on single-stranded RNA templates, synthesizing either extensive RNA chains that form template-length duplexes or approximately 9-21-mer complementary RNA oligonucleotides scattered along the entire template. QDE-1 supports both de novo and primer-dependent initiation mechanisms. These results suggest that several distinct activities of cell-encoded RdRPs can be employed for efficient PTGS in vivo.

Methylation of microRNA genes regulates gene expression in bisexual flower development in andromonoecious poplar.

PubMed

Song, Yuepeng; Tian, Min; Ci, Dong; Zhang, Deqiang

2015-04-01

Previous studies showed sex-specific DNA methylation and expression of candidate genes in bisexual flowers of andromonoecious poplar, but the regulatory relationship between methylation and microRNAs (miRNAs) remains unclear. To investigate whether the methylation of miRNA genes regulates gene expression in bisexual flower development, the methylome, microRNA, and transcriptome were examined in female and male flowers of andromonoecious poplar. 27 636 methylated coding genes and 113 methylated miRNA genes were identified. In the coding genes, 64.5% of the methylated reads mapped to the gene body region; by contrast, 60.7% of methylated reads in miRNA genes mainly mapped in the 5' and 3' flanking regions. CHH methylation showed the highest methylation levels and CHG showed the lowest methylation levels. Correlation analysis showed a significant, negative, strand-specific correlation of methylation and miRNA gene expression (r=0.79, P <0.05). The methylated miRNA genes included eight long miRNAs (lmiRNAs) of 24 nucleotides and 11 miRNAs related to flower development. miRNA172b might play an important role in the regulation of bisexual flower development-related gene expression in andromonoecious poplar, via modification of methylation. Gynomonoecious, female, and male poplars were used to validate the methylation patterns of the miRNA172b gene, implying that hyper-methylation in andromonoecious and gynomonoecious poplar might function as an important regulator in bisexual flower development. Our data provide a useful resource for the study of flower development in poplar and improve our understanding of the effect of epigenetic regulation on genes other than protein-coding genes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

A Pre-mRNA-Splicing Factor Is Required for RNA-Directed DNA Methylation in Arabidopsis

PubMed Central

Huang, Chao-Feng; Miki, Daisuke; Tang, Kai; Zhou, Hao-Ran; Zheng, Zhimin; Chen, Wei; Ma, Ze-Yang; Yang, Lan; Zhang, Heng; Liu, Renyi; He, Xin-Jian; Zhu, Jian-Kang

2013-01-01

Cytosine DNA methylation is a stable epigenetic mark that is frequently associated with the silencing of genes and transposable elements (TEs). In Arabidopsis, the establishment of DNA methylation is through the RNA-directed DNA methylation (RdDM) pathway. Here, we report the identification and characterization of RDM16, a new factor in the RdDM pathway. Mutation of RDM16 reduced the DNA methylation levels and partially released the silencing of a reporter gene as well as some endogenous genomic loci in the DNA demethylase ros1-1 mutant background. The rdm16 mutant had morphological defects and was hypersensitive to salt stress and abscisic acid (ABA). Map-based cloning and complementation test led to the identification of RDM16, which encodes a pre-mRNA-splicing factor 3, a component of the U4/U6 snRNP. RNA-seq analysis showed that 308 intron retention events occurred in rdm16, confirming that RDM16 is involved in pre-mRNA splicing in planta. RNA-seq and mRNA expression analysis also revealed that the RDM16 mutation did not affect the pre-mRNA splicing of known RdDM genes, suggesting that RDM16 might be directly involved in RdDM. Small RNA expression analysis on loci showing RDM16-dependent DNA methylation suggested that unlike the previously reported putative splicing factor mutants, rdm16 did not affect small RNA levels; instead, the rdm16 mutation caused a decrease in the levels of Pol V transcripts. ChIP assays revealed that RDM16 was enriched at some Pol V target loci. Our results suggest that RDM16 regulates DNA methylation through influencing Pol V transcript levels. Finally, our genome-wide DNA methylation analysis indicated that RDM16 regulates the overall methylation of TEs and gene-surrounding regions, and preferentially targets Pol IV-dependent DNA methylation loci and the ROS1 target loci. Our work thus contributes to the understanding of RdDM and its interactions with active DNA demethylation. PMID:24068953

Evolutionary relationships between miRNA genes and their activity.

PubMed

Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue

2012-12-22

The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.

Towards a comprehensive picture of C-to-U RNA editing sites in angiosperm mitochondria.

PubMed

Edera, Alejandro A; Gandini, Carolina L; Sanchez-Puerta, M Virginia

2018-05-14

Our understanding of the dynamic and evolution of RNA editing in angiosperms is in part limited by the few editing sites identified to date. This study identified 10,217 editing sites from 17 diverse angiosperms. Our analyses confirmed the universality of certain features of RNA editing, and offer new evidence behind the loss of editing sites in angiosperms. RNA editing is a post-transcriptional process that substitutes cytidines (C) for uridines (U) in organellar transcripts of angiosperms. These substitutions mostly take place in mitochondrial messenger RNAs at specific positions called editing sites. By means of publicly available RNA-seq data, this study identified 10,217 editing sites in mitochondrial protein-coding genes of 17 diverse angiosperms. Even though other types of mismatches were also identified, we did not find evidence of non-canonical editing processes. The results showed an uneven distribution of editing sites among species, genes, and codon positions. The analyses revealed that editing sites were conserved across angiosperms but there were some species-specific sites. Non-synonymous editing sites were particularly highly conserved (~ 80%) across the plant species and were efficiently edited (80% editing extent). In contrast, editing sites at third codon positions were poorly conserved (~ 30%) and only partially edited (~ 40% editing extent). We found that the loss of editing sites along angiosperm evolution is mainly occurring by replacing editing sites with thymidines, instead of a degradation of the editing recognition motif around editing sites. Consecutive and highly conserved editing sites had been replaced by thymidines as result of retroprocessing, by which edited transcripts are reverse transcribed to cDNA and then integrated into the genome by homologous recombination. This phenomenon was more pronounced in eudicots, and in the gene cox1. These results suggest that retroprocessing is a widespread driving force underlying the loss

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.

PubMed

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T

2017-03-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.

A set of highly conserved RNA-binding proteins, alphaCP-1 and alphaCP-2, implicated in mRNA stabilization, are coexpressed from an intronless gene and its intron-containing paralog.

PubMed

Makeyev, A V; Chkheidze, A N; Liebhaber, S A

1999-08-27

Gene families normally expand by segmental genomic duplication and subsequent sequence divergence. Although copies of partially or fully processed mRNA transcripts are occasionally retrotransposed into the genome, they are usually nonfunctional ("processed pseudogenes"). The two major cytoplasmic poly(C)-binding proteins in mammalian cells, alphaCP-1 and alphaCP-2, are implicated in a spectrum of post-transcriptional controls. These proteins are highly similar in structure and are encoded by closely related mRNAs. Based on this close relationship, we were surprised to find that one of these proteins, alphaCP-2, was encoded by a multiexon gene, whereas the second gene, alphaCP-1, was identical to and colinear with its mRNA. The alphaCP-1 and alphaCP-2 genes were shown to be single copy and were mapped to separate chromosomes. The linkage groups encompassing each of the two loci were concordant between mice and humans. These data suggested that the alphaCP-1 gene was generated by retrotransposition of a fully processed alphaCP-2 mRNA and that this event occurred well before the mammalian radiation. The stringent structural conservation of alphaCP-1 and its ubiquitous tissue distribution suggested that the retrotransposed alphaCP-1 gene was rapidly recruited to a function critical to the cell and distinct from that of its alphaCP-2 progenitor.

Systems biology approach to transplant tolerance: proof of concept experiments using RNA interference (RNAi) to knock down hub genes in Jurkat and HeLa cells in vitro.

PubMed

Lwin, Wint Wah; Park, Ken; Wauson, Matthew; Gao, Qin; Finn, Patricia W; Perkins, David; Khanna, Ajai

2012-07-01

Systems biology is gaining importance in studying complex systems such as the functional interconnections of human genes [1]. To investigate the molecular interactions involved in T cell immune responses, we used databases of physical gene-gene interactions to constructed molecular interaction networks (interconnections) with R language algorithms. This helped to identify highly interconnected "hub" genes AT(1)P5C1, IL6ST, PRKCZ, MYC, FOS, JUN, and MAPK1. We hypothesized that suppression of these hub genes in the gene network would result in significant phenotypic effects on T cells and examined this in vitro. The molecular interaction networks were then analyzed and visualized with Cytoscape. Jurkat and HeLa cells were transfected with siRNA for the selected hub genes. Cell proliferation was measured using ATP luminescence and BrdU labeling, which were measured 36, 72, and 96 h after activation. Following T cell stimulation, we found a significant decrease in ATP production (P < 0.05) when the hub genes ATP5C1 and PRKCZ were knocked down using siRNA transfection, whereas no difference in ATP production was observed in siRNA transfected HeLa cells. However, HeLa cells showed a significant (P < 0.05) decrease in cell proliferation when the genes MAPK1, IL6ST, ATP5C1, JUN, and FOS were knocked down. In both Jurkat and HeLa cells, targeted gene knockdown using siRNA showed decreased cell proliferation and ATP production in both Jurkat and HeLa cells. However, Jurkat T cells and HELA cells use different hub genes to regulate activation responses. This experiment provides proof of principle of applying siRNA knockdown of T cell hub genes to evaluate their proliferative capacity and ATP production. This novel concept outlines a systems biology approach to identify hub genes for targeted therapeutics. Published by Elsevier Inc.

Three RNA recognition motifs participate in RNA recognition and structural organization by the pro-apoptotic factor TIA-1

PubMed Central

Bauer, William J.; Heath, Jason; Jenkins, Jermaine L.; Kielkopf, Clara L.

2012-01-01

T-cell intracellular antigen-1 (TIA-1) regulates developmental and stress-responsive pathways through distinct activities at the levels of alternative pre-mRNA splicing and mRNA translation. The TIA-1 polypeptide contains three RNA recognition motifs (RRMs). The central RRM2 and C-terminal RRM3 associate with cellular mRNAs. The N-terminal RRM1 enhances interactions of a C-terminal Q-rich domain of TIA-1 with the U1-C splicing factor, despite linear separation of the domains in the TIA-1 sequence. Given the expanded functional repertoire of the RRM family, it was unknown whether TIA-1 RRM1 contributes to RNA binding as well as documented protein interactions. To address this question, we used isothermal titration calorimetry and small-angle X-ray scattering (SAXS) to dissect the roles of the TIA-1 RRMs in RNA recognition. Notably, the fas RNA exhibited two binding sites with indistinguishable affinities for TIA-1. Analyses of TIA-1 variants established that RRM1 was dispensable for binding AU-rich fas sites, yet all three RRMs were required to bind a polyU RNA with high affinity. SAXS analyses demonstrated a `V' shape for a TIA-1 construct comprising the three RRMs, and revealed that its dimensions became more compact in the RNA-bound state. The sequence-selective involvement of TIA-1 RRM1 in RNA recognition suggests a possible role for RNA sequences in regulating the distinct functions of TIA-1. Further implications for U1-C recruitment by the adjacent TIA-1 binding sites of the fas pre-mRNA and the bent TIA-1 shape, which organizes the N- and C-termini on the same side of the protein, are discussed. PMID:22154808

Progression through the spliceosome cycle requires Prp38p function for U4/U6 snRNA dissociation.

PubMed Central

Xie, J; Beickman, K; Otte, E; Rymond, B C

1998-01-01

The elaborate and energy-intensive spliceosome assembly pathway belies the seemingly simple chemistry of pre-mRNA splicing. Prp38p was previously identified as a protein required in vivo and in vitro for the first pre-mRNA cleavage reaction catalyzed by the spliceosome. Here we show that Prp38p is a unique component of the U4/U6.U5 tri-small nuclear ribonucleoprotein (snRNP) particle and is necessary for an essential step late in spliceosome maturation. Without Prp38p activity spliceosomes form, but arrest in a catalytically impaired state. Functional spliceosomes shed U4 snRNA before 5' splice-site cleavage. In contrast, Prp38p-defective spliceosomes retain U4 snRNA bound to its U6 snRNA base-pairing partner. Prp38p is the first tri-snRNP-specific protein shown to be dispensable for assembly, but required for conformational changes which lead to catalytic activation of the spliceosome. PMID:9582287

HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period

PubMed Central

2012-01-01

Background Recent evidence proposes a novel concept that mammalian natural antisense RNAs play important roles in cellular homeostasis by regulating the expression of several genes. Identification and characterization of retroviral antisense RNA would provide new insights into mechanisms of replication and pathogenesis. HIV-1 encoded-antisense RNAs have been reported, although their structures and functions remain to be studied. We have tried to identify and characterize antisense RNAs of HIV-1 and their function in viral infection. Results Characterization of transcripts of HEK293T cells that were transiently transfected with an expression plasmid with HIV-1NL4–3 DNA in the antisense orientation showed that various antisense transcripts can be expressed. By screening and characterizing antisense RNAs in HIV-1NL4–3-infected cells, we defined the primary structure of a major form of HIV-1 antisense RNAs, which corresponds to a variant of previously reported ASP mRNA. This 2.6 kb RNA was transcribed from the U3 region of the 3′ LTR and terminated at the env region in acutely or chronically infected cell lines and acutely infected human peripheral blood mononuclear cells. Reporter assays clearly demonstrated that the HIV-1 LTR harbours promoter activity in the reverse orientation. Mutation analyses suggested the involvement of NF-κΒ binding sites in the regulation of antisense transcription. The antisense RNA was localized in the nuclei of the infected cells. The expression of this antisense RNA suppressed HIV-1 replication for more than one month. Furthermore, the specific knockdown of this antisense RNA enhanced HIV-1 gene expression and replication. Conclusions The results of the present study identified an accurate structure of the major form of antisense RNAs expressed from the HIV-1NL4–3 provirus and demonstrated its nuclear localization. Functional studies collectively demonstrated a new role of the antisense RNA in viral replication. Thus, we suggest

miRNA-dependent gene silencing involving Ago2-mediated cleavage of a circular antisense RNA

PubMed Central

Hansen, Thomas B; Wiklund, Erik D; Bramsen, Jesper B; Villadsen, Sune B; Statham, Aaron L; Clark, Susan J; Kjems, Jørgen

2011-01-01

MicroRNAs (miRNAs) are ∼22 nt non-coding RNAs that typically bind to the 3′ UTR of target mRNAs in the cytoplasm, resulting in mRNA destabilization and translational repression. Here, we report that miRNAs can also regulate gene expression by targeting non-coding antisense transcripts in human cells. Specifically, we show that miR-671 directs cleavage of a circular antisense transcript of the Cerebellar Degeneration-Related protein 1 (CDR1) locus in an Ago2-slicer-dependent manner. The resulting downregulation of circular antisense has a concomitant decrease in CDR1 mRNA levels, independently of heterochromatin formation. This study provides the first evidence for non-coding antisense transcripts as functional miRNA targets, and a novel regulatory mechanism involving a positive correlation between mRNA and antisense circular RNA levels. PMID:21964070

Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera.

PubMed

Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis

2018-01-01

The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.

MicroRNA-derived network analysis of differentially methylated genes in schizophrenia, implicating GABA receptor B1 [GABBR1] and protein kinase B [AKT1].

PubMed

Gumerov, Vadim; Hegyi, Hedi

2015-10-08

While hundreds of genes have been implicated already in the etiology of schizophrenia, the exact cause is not known or the disease is considered multigenic in origin. Recent discoveries of new types of RNAs and the gradual elimination of the "junk DNA" hypothesis refocused the attention on the noncoding part of the human genome. Here we re-analyzed a recent dataset of differentially methylated genes from schizophrenic patients and cross-tabulated them with cis regulatory and repetitive elements and microRNAs known to be involved in schizophrenia. We found that the number of schizophrenia-related (SZ) microRNA targets follows a scale-free distribution with several microRNA hubs and that schizophrenia-related microRNAs with shared targets form a small-world network. The top ten microRNAs with the highest number of SZ gene targets regulate approximately 80 % of all microRNA-regulated genes whereas the top two microRNAs regulate 40-52 % of all such genes. We also found that genes that are regulated by the same microRNAs tend to have more protein-protein interactions than randomly selected schizophrenia genes. This highlights the role microRNAs possibly play in coordinating the abundance of interacting proteins, an important function that has not been sufficiently explored before. The analysis revealed that GABBR1 is regulated by both of the top two microRNAs and acts as a hub by interacting with many schizophrenia-related genes and sharing several types of transcription-binding sites with its interactors. We also found that differentially methylated repetitive elements are significantly more methylated in schizophrenia, pointing out their potential role in the disease. We find that GABBR1 has a central importance in schizophrenia, even if no direct cause and effect have been shown for it for the time. In addition to being a hub in microRNA-derived regulatory pathways and protein-protein interactions, its centrality is also supported by the high number of cis regulatory

Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

PubMed Central

Kurtz, David T.; Feigelson, Philip

1977-01-01

A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

PubMed

Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

2009-11-01

RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

Identification of two pentatricopeptide repeat genes required for RNA editing and zinc binding by C-terminal cytidine deaminase-like domains.

PubMed

Hayes, Michael L; Giang, Karolyn; Berhane, Beniam; Mulligan, R Michael

2013-12-20

Many transcripts expressed from plant organelle genomes are modified by C-to-U RNA editing. Nuclear encoded pentatricopeptide repeat (PPR) proteins are required as RNA binding specificity determinants in the RNA editing mechanism. Bioinformatic analysis has shown that most of the Arabidopsis PPR proteins necessary for RNA editing events include a C-terminal portion that shares structural characteristics with a superfamily of deaminases. The DYW deaminase domain includes a highly conserved zinc binding motif that shares characteristics with cytidine deaminases. The Arabidopsis PPR genes, ELI1 and DOT4, both have DYW deaminase domains and are required for single RNA editing events in chloroplasts. The ELI1 DYW deaminase domain was expressed as a recombinant protein in Escherichia coli and was shown to bind two zinc atoms per polypeptide. Thus, the DYW deaminase domain binds a zinc metal ion, as expected for a cytidine deaminase, and is potentially the catalytic component of an editing complex. Genetic complementation experiments demonstrate that large portions of the DYW deaminase domain of ELI1 may be eliminated, but the truncated genes retain the ability to restore editing site conversion in a mutant plant. These results suggest that the catalytic activity can be supplied in trans by uncharacterized protein(s) of the editosome.

Characterizing the roles of Cryphonectria parasitica RNA-dependent RNA polymerase-like genes in antiviral defense, viral recombination and transposon transcript accumulation.

PubMed

Zhang, Dong-Xiu; Spiering, Martin J; Nuss, Donald L

2014-01-01

An inducible RNA-silencing pathway, involving a single Dicer protein, DCL2, and a single Argonaute protein, AGL2, was recently shown to serve as an effective antiviral defense response in the chestnut blight fungus Cryphonectria parasitica. Eukaryotic RNA-dependent RNA polymerases (RdRPs) are frequently involved in transcriptional and posttranscriptional gene silencing and antiviral defense. We report here the identification and characterization of four RdRP genes (rdr1-4) in the C. parasitica genome. Sequence relationships with other eukaryotic RdRPs indicated that RDR1 and RDR2 were closely related to QDE-1, an RdRP involved in RNA silencing ("quelling") in Neurospora crassa, whereas RDR3 was more closely related to the meiotic silencing gene SAD-1 in N. crassa. The RdRP domain of RDR4, related to N. crassa RRP-3 of unknown function, was truncated and showed evidence of alternative splicing. Similar to reports for dcl2 and agl2, the expression levels for rdr3 and rdr4 increased after hypovirus CHV-1/EP713 infection, while expression levels of rdr1 and rdr2 were unchanged. The virus-responsive induction patterns for rdr3 and rdr4 were altered in the Δdcl2 and Δagl2 strains, suggesting some level of interaction between rdr3 and rdr4 and the dcl2/agl2 silencing pathway. Single rdr gene knockouts Δrdr1-4, double knockouts Δrdr1/2, Δrdr2/3, Δrdr1/3, and a triple knockout, Δrdr1/2/3, were generated and evaluated for effects on fungal phenotype, the antiviral defense response, viral RNA recombination activity and transposon expression. None of the single or multiple rdr knockout strains displayed any phenotypic differences from the parental strains with or without viral infection or any significant changes in viral RNA accumulation or recombination activity or transposon RNA accumulation, indicating no detectable contribution by the C. parasitica rdr genes to these processes.

Artificial small RNA for sequence specific cleavage of target RNA through RNase III endonuclease Dicer

PubMed Central

Liu, Yali; Liu, Li; Zhan, Yonghao; Zhuang, Chengle; Lin, Junhao; Chen, Mingwei; Li, Jianfa; Cai, Zhiming; Huang, Weiren; Zhang, Yong

2016-01-01

CRISPR-Cas9 system uses a guide RNA which functions in conjunction with Cas9 proteins to target a DNA and cleaves double-strand DNA. This phenomenon raises a question whether an artificial small RNA (asRNA), composed of a Dicer–binding RNA element and an antisense RNA, could also be used to induce Dicer to process and degrade a specific RNA. If so, we could develop a new method which is named DICERi for gene silencing or RNA editing. To prove the feasibility of asRNA, we selected MALAT-1 as target and used Hela and MDA-MB-231 cells as experimental models. The results of qRT-PCR showed that the introduction of asRNA decreased the relative expression level of target gene significantly. Next, we analyzed cell proliferation using CCK-8 and EdU staining assays, and then cell migration using wound scratch and Transwell invasion assays. We found that cell proliferation and cell migration were both suppressed remarkably after asRNA was expressed in Hela and MDA-MB-231 cells. Cell apoptosis was also detected through Hoechst staining and ELISA assays and the data indicated that he numbers of apoptotic cell in experimental groups significantly increased compared with negative controls. In order to prove that the gene silencing effects were caused by Dicer, we co-transfected shRNA silencing Dicer and asRNA. The relative expression levels of Dicer and MALAT-1 were both detected and the results indicated that when the cleavage role of Dicer was silenced, the relative expression level of MALAT-1 was not affected after the introduction of asRNA. All the above results demonstrated that these devices directed by Dicer effectively excised target RNA and repressed the target genes, thus causing phenotypic changes. Our works adds a new dimension to gene regulating technologies and may have broad applications in construction of gene circuits. PMID:27231846

Artificial small RNA for sequence specific cleavage of target RNA through RNase III endonuclease Dicer.

PubMed

Xu, Wen; Liu, Yuchen; Liu, Yali; Liu, Li; Zhan, Yonghao; Zhuang, Chengle; Lin, Junhao; Chen, Mingwei; Li, Jianfa; Cai, Zhiming; Huang, Weiren; Zhang, Yong

2016-08-23

CRISPR-Cas9 system uses a guide RNA which functions in conjunction with Cas9 proteins to target a DNA and cleaves double-strand DNA. This phenomenon raises a question whether an artificial small RNA (asRNA), composed of a Dicer-binding RNA element and an antisense RNA, could also be used to induce Dicer to process and degrade a specific RNA. If so, we could develop a new method which is named DICERi for gene silencing or RNA editing. To prove the feasibility of asRNA, we selected MALAT-1 as target and used Hela and MDA-MB-231 cells as experimental models. The results of qRT-PCR showed that the introduction of asRNA decreased the relative expression level of target gene significantly. Next, we analyzed cell proliferation using CCK-8 and EdU staining assays, and then cell migration using wound scratch and Transwell invasion assays. We found that cell proliferation and cell migration were both suppressed remarkably after asRNA was expressed in Hela and MDA-MB-231 cells. Cell apoptosis was also detected through Hoechst staining and ELISA assays and the data indicated that he numbers of apoptotic cell in experimental groups significantly increased compared with negative controls. In order to prove that the gene silencing effects were caused by Dicer, we co-transfected shRNA silencing Dicer and asRNA. The relative expression levels of Dicer and MALAT-1 were both detected and the results indicated that when the cleavage role of Dicer was silenced, the relative expression level of MALAT-1 was not affected after the introduction of asRNA. All the above results demonstrated that these devices directed by Dicer effectively excised target RNA and repressed the target genes, thus causing phenotypic changes. Our works adds a new dimension to gene regulating technologies and may have broad applications in construction of gene circuits.

Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae.

PubMed

Ito, Yoichiro; Kitagawa, Takao; Yamanishi, Mamoru; Katahira, Satoshi; Izawa, Shingo; Irie, Kenji; Furutani-Seiki, Makoto; Matsuyama, Takashi

2016-11-15

Post-transcriptional upregulation is an effective way to increase the expression of transgenes and thus maximize the yields of target chemicals from metabolically engineered organisms. Refractory elements in the 3' untranslated region (UTR) that increase mRNA half-life might be available. In Saccharomyces cerevisiae, several terminator regions have shown activity in increasing the production of proteins by upstream coding genes; among these terminators the DIT1 terminator has the highest activity. Here, we found in Saccharomyces cerevisiae that two resident trans-acting RNA-binding proteins (Nab6p and Pap1p) enhance the activity of the DIT1 terminator through the cis element GUUCG/U within the 3'-UTR. These two RNA-binding proteins could upregulate a battery of cell-wall-related genes. Mutagenesis of the DIT1 terminator improved its activity by a maximum of 500% of that of the standard PGK1 terminator. Further understanding and improvement of this system will facilitate inexpensive and stable production of complicated organism-derived drugs worldwide.

All Small Nuclear RNAs (snRNAs) of the [U4/U6.U5] Tri-snRNP Localize to Nucleoli; Identification of the Nucleolar Localization Element of U6 snRNA

PubMed Central

Gerbi, Susan A.; Lange, Thilo Sascha

2002-01-01

Previously, we showed that spliceosomal U6 small nuclear RNA (snRNA) transiently passes through the nucleolus. Herein, we report that all individual snRNAs of the [U4/U6.U5] tri-snRNP localize to nucleoli, demonstrated by fluorescence microscopy of nucleolar preparations after injection of fluorescein-labeled snRNA into Xenopus oocyte nuclei. Nucleolar localization of U6 is independent from [U4/U6] snRNP formation since sites of direct interaction of U6 snRNA with U4 snRNA are not nucleolar localization elements. Among all regions in U6, the only one required for nucleolar localization is its 3′ end, which associates with the La protein and subsequently during maturation of U6 is bound by Lsm proteins. This 3′-nucleolar localization element of U6 is both essential and sufficient for nucleolar localization and also required for localization to Cajal bodies. Conversion of the 3′ hydroxyl of U6 snRNA to a 3′ phosphate prevents association with the La protein but does not affect U6 localization to nucleoli or Cajal bodies. PMID:12221120

RNA-Seq Profiling Reveals Novel Hepatic Gene Expression Pattern in Aflatoxin B1 Treated Rats

PubMed Central

Merrick, B. Alex; Phadke, Dhiral P.; Auerbach, Scott S.; Mav, Deepak; Stiegelmeyer, Suzy M.; Shah, Ruchir R.; Tice, Raymond R.

2013-01-01

Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1), a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG) than microarray analysis, including low copy and novel transcripts related to AFB1’s carcinogenic activity compared to feed controls (CTRL). Paired-end reads were mapped to the rat genome (Rn4) with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005) compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT’s) on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c. We find

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

PubMed

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

Novel RNA hybridization method for the in situ detection of ETV1, ETV4, and ETV5 gene fusions in prostate cancer.

PubMed

Kunju, Lakshmi P; Carskadon, Shannon; Siddiqui, Javed; Tomlins, Scott A; Chinnaiyan, Arul M; Palanisamy, Nallasivam

2014-09-01

The genetic basis of 50% to 60% of prostate cancer (PCa) is attributable to rearrangements in E26 transformation-specific (ETS) (ERG, ETV1, ETV4, and ETV5), BRAF, and RAF1 genes and overexpression of SPINK1. The development and validation of reliable detection methods are warranted to classify various molecular subtypes of PCa for diagnostic and prognostic purposes. ETS gene rearrangements are typically detected by fluorescence in situ hybridization and reverse-transcription polymerase chain reaction methods. Recently, monoclonal antibodies against ERG have been developed that detect the truncated ERG protein in immunohistochemical assays where staining levels are strongly correlated with ERG rearrangement status by fluorescence in situ hybridization. However, specific antibodies for ETV1, ETV4, and ETV5 are unavailable, challenging their clinical use. We developed a novel RNA in situ hybridization-based assay for the in situ detection of ETV1, ETV4, and ETV5 in formalin-fixed paraffin-embedded tissues from prostate needle biopsies, prostatectomy, and metastatic PCa specimens using RNA probes. Further, with combined RNA in situ hybridization and immunohistochemistry we identified a rare subset of PCa with dual ETS gene rearrangements in collisions of independent tumor foci. The high specificity and sensitivity of RNA in situ hybridization provides an alternate method enabling bright-field in situ detection of ETS gene aberrations in routine clinically available PCa specimens.

Homo sapiens Systemic RNA Interference-defective-1 Transmembrane Family Member 1 (SIDT1) Protein Mediates Contact-dependent Small RNA Transfer and MicroRNA-21-driven Chemoresistance*

PubMed Central

Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.

2012-01-01

Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

PubMed

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression

NASA Astrophysics Data System (ADS)

Xiong, Li-Ping; Ma, Yu-Qiang; Tang, Lei-Han

2010-09-01

Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology.

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Nuclear Retention Elements of U3 Small Nucleolar RNA

PubMed Central

Speckmann, Wayne; Narayanan, Aarthi; Terns, Rebecca; Terns, Michael P.

1999-01-01

The processing and methylation of precursor rRNA is mediated by the box C/D small nucleolar RNAs (snoRNAs). These snoRNAs differ from most cellular RNAs in that they are not exported to the cytoplasm. Instead, these RNAs are actively retained in the nucleus where they assemble with proteins into mature small nucleolar ribonucleoprotein particles and are targeted to their intranuclear site of action, the nucleolus. In this study, we have identified the cis-acting sequences responsible for the nuclear retention of U3 box C/D snoRNA by analyzing the nucleocytoplasmic distributions of an extensive panel of U3 RNA variants after injection of the RNAs into Xenopus oocyte nuclei. Our data indicate the importance of two conserved sequence motifs in retaining U3 RNA in the nucleus. The first motif is comprised of the conserved box C′ and box D sequences that characterize the box C/D family. The second motif contains conserved box sequences B and C. Either motif is sufficient for nuclear retention, but disruption of both motifs leads to mislocalization of the RNAs to the cytoplasm. Variant RNAs that are not retained also lack 5′ cap hypermethylation and fail to associate with fibrillarin. Furthermore, our results indicate that nuclear retention of U3 RNA does not simply reflect its nucleolar localization. A fragment of U3 containing the box B/C motif is not localized to nucleoli but retained in coiled bodies. Thus, nuclear retention and nucleolar localization are distinct processes with differing sequence requirements. PMID:10567566

Recognition of the 3′ splice site RNA by the U2AF heterodimer involves a dynamic population shift

PubMed Central

Voith von Voithenberg, Lena; Sánchez-Rico, Carolina; Kang, Hyun-Seo; Madl, Tobias; Zanier, Katia; Barth, Anders; Warner, Lisa R.; Sattler, Michael; Lamb, Don C.

2016-01-01

An essential early step in the assembly of human spliceosomes onto pre-mRNA involves the recognition of regulatory RNA cis elements in the 3′ splice site by the U2 auxiliary factor (U2AF). The large (U2AF65) and small (U2AF35) subunits of the U2AF heterodimer contact the polypyrimidine tract (Py-tract) and the AG-dinucleotide, respectively. The tandem RNA recognition motif domains (RRM1,2) of U2AF65 adopt closed/inactive and open/active conformations in the free form and when bound to bona fide Py-tract RNA ligands. To investigate the molecular mechanism and dynamics of 3′ splice site recognition by U2AF65 and the role of U2AF35 in the U2AF heterodimer, we have combined single-pair FRET and NMR experiments. In the absence of RNA, the RRM1,2 domain arrangement is highly dynamic on a submillisecond time scale, switching between closed and open conformations. The addition of Py-tract RNA ligands with increasing binding affinity (strength) gradually shifts the equilibrium toward an open conformation. Notably, the protein–RNA complex is rigid in the presence of a strong Py-tract but exhibits internal motion with weak Py-tracts. Surprisingly, the presence of U2AF35, whose UHM domain interacts with U2AF65 RRM1, increases the population of the open arrangement of U2AF65 RRM1,2 in the absence and presence of a weak Py-tract. These data indicate that the U2AF heterodimer promotes spliceosome assembly by a dynamic population shift toward the open conformation of U2AF65 to facilitate the recognition of weak Py-tracts at the 3′ splice site. The structure and RNA binding of the heterodimer was unaffected by cancer-linked myelodysplastic syndrome mutants. PMID:27799531

Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae).

PubMed

Song, Fan; Li, Hu; Shao, Renfu; Shi, Aimin; Bai, Xiaoshuan; Zheng, Xiaorong; Heiss, Ernst; Cai, Wanzhi

2016-05-16

The typical insect mitochondrial (mt) genome organization, which contains a single chromosome with 37 genes, was found in the infraorder Pentatomomorpha (suborder Heteroptera). The arrangement of mt genes in these true bugs is usually the same as the ancestral mt gene arrangement of insects. Rearrangement of transfer RNA (tRNA) genes, however, has been found in two subfamilies of flat bugs (Mezirinae and Calisiinae, family Aradidae). In this study, we sequenced the complete mt genomes of four species from three other subfamilies (Aradinae, Carventinae and Aneurinae). We found tRNA gene rearrangement in all of these four species. All of the rearranged tRNA genes are located between the mitochondrial control region and cox1, indicating this region as a hotspot for gene rearrangement in flat bugs; the rearrangement is likely caused by events of tandem duplication and random deletion of genes. Furthermore, our phylogenetic and dating analyses indicated that the swap of positions between trnQ and trnI occurred ~162 million years ago (MYA) in the most recent common ancestor of the five subfamilies of flat bugs investigated to date, whereas the swap of positions between trnC and trnW occurred later in the lineage leading to Calisiinae, and the translocation of trnC and trnY occurred later than 134 MYA in the lineage leading to Aradinae.

Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae)

PubMed Central

Song, Fan; Li, Hu; Shao, Renfu; Shi, Aimin; Bai, Xiaoshuan; Zheng, Xiaorong; Heiss, Ernst; Cai, Wanzhi

2016-01-01

The typical insect mitochondrial (mt) genome organization, which contains a single chromosome with 37 genes, was found in the infraorder Pentatomomorpha (suborder Heteroptera). The arrangement of mt genes in these true bugs is usually the same as the ancestral mt gene arrangement of insects. Rearrangement of transfer RNA (tRNA) genes, however, has been found in two subfamilies of flat bugs (Mezirinae and Calisiinae, family Aradidae). In this study, we sequenced the complete mt genomes of four species from three other subfamilies (Aradinae, Carventinae and Aneurinae). We found tRNA gene rearrangement in all of these four species. All of the rearranged tRNA genes are located between the mitochondrial control region and cox1, indicating this region as a hotspot for gene rearrangement in flat bugs; the rearrangement is likely caused by events of tandem duplication and random deletion of genes. Furthermore, our phylogenetic and dating analyses indicated that the swap of positions between trnQ and trnI occurred ~162 million years ago (MYA) in the most recent common ancestor of the five subfamilies of flat bugs investigated to date, whereas the swap of positions between trnC and trnW occurred later in the lineage leading to Calisiinae, and the translocation of trnC and trnY occurred later than 134 MYA in the lineage leading to Aradinae. PMID:27180804

PLMItRNA, a database for mitochondrial tRNA genes and tRNAs in photosynthetic eukaryotes.

PubMed

Damiano, F; Gallerani, R; Liuni, S; Licciulli, F; Ceci, L R

2001-01-01

The PLMItRNA database for mitochondrial tRNA molecules and genes in VIRIDIPLANTAE: (green plants) [Volpetti,V., Gallerani,R., DeBenedetto,C., Liuni,S., Licciulli,F. and Ceci,L.R. (2000) Nucleic Acids Res., 28, 159-162] has been enlarged to include algae. The database now contains 436 genes and 16 tRNA entries relative to 25 higher plants, eight green algae, four red algae (RHODOPHYTAE:) and two STRAMENOPILES: The PLMItRNA database is accessible via the WWW at http://bio-www.ba.cnr.it:8000/PLMItRNA.

Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

PubMed

Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

2017-09-11

To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

Spliced synthetic genes as internal controls in RNA sequencing experiments.

PubMed

Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R

2016-09-01

RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome.

Reversal of multidrug resistance by magnetic Fe3O4 nanoparticle copolymerizating daunorubicin and MDR1 shRNA expression vector in leukemia cells.

PubMed

Chen, Bao-an; Mao, Pei-pei; Cheng, Jian; Gao, Feng; Xia, Guo-hua; Xu, Wen-lin; Shen, Hui-lin; Ding, Jia-hua; Gao, Chong; Sun, Qian; Chen, Wen-ji; Chen, Ning-na; Liu, Li-jie; Li, Xiao-mao; Wang, Xue-mei

2010-08-09

In many instances, multidrug resistance (MDR) is mediated by increasing the expression at the cell surface of the MDR1 gene product, P-glycoprotein (P-gp), a 170-kD energy-dependent efflux pump. The aim of this study was to investigate the potential benefit of combination therapy with magnetic Fe(3)O(4) nanoparticle [MNP (Fe(3)O(4))] and MDR1 shRNA expression vector in K562/A02 cells. For stable reversal of "classical" MDR by short hairpin RNA (shRNA) aiming directly at the target sequence (3491-3509, 1539-1557, and 3103-3121 nucleotide) of MDR1 mRNA. PGC silencer-U6-neo-GFP-shRNA/MDR1 called PGY1-1, PGY1-2, and PGY1-3 were constructed and transfected into K562/A02 cells by lipofectamine 2000. After transfected and incubated with or without MNP (Fe(3)O(4)) for 48 hours, the transcription of MDR1 mRNA and the expression of P-gp were detected by quantitative real-time PCR and Western-blot assay respectively. Meanwhile intracellular concentration of DNR in K562/A02 cells was detected by flow cytometry (FCM). PGC silencer-U6-neo-GFP-shRNA/MDR1 was successfully constructed, which was confirmed by sequencing and PGY1-2 had the greatest MDR1 gene inhibitory ratio. Analysis of the reversal ratio of MDR, the concentration of daunorubicin (DNR) and the transcription of MDR1 gene and expression of P-gp in K562/A02 showed that combination of DNR with either MNP (Fe(3)O(4)) or PGY1-2 exerted a potent cytotoxic effect on K562/A02 cells, while combination of MNP (Fe(3)O(4)) and PGY1-2 could synergistically reverse multidrug resistance. Thus our in vitro data strongly suggested that a combination of MNP (Fe(3)O(4)) and shRNA expression vector might be a more sufficient and less toxic anti-MDR method on leukemia.

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Regulation of the steady state level of Fc gamma RI mRNA by IFN-gamma and dexamethasone in human monocytes, neutrophils, and U-937 cells.

PubMed

Pan, L Y; Mendel, D B; Zurlo, J; Guyre, P M

1990-07-01

The high affinity IgG FcR Fc gamma RI, CD64, plays important roles in the immune response. Fc gamma RI is predominantly expressed on monocytes and macrophages, and barely detectable on neutrophils. rIFN-gamma markedly increases the expression of Fc gamma RI on neutrophils, monocytes, macrophages and myeloid cell lines such as U-937, HL-60, and THP-1. Glucocorticoids inhibit the augmentation of Fc gamma RI expression by rIFN-gamma on neutrophils and myeloid cell lines, but enhance the augmentation of Fc gamma RI expression by rIFN-gamma on monocytes. In this study, we examined the effect of rIFN-gamma and dexamethasone (Dex) on the steady state level of Fc gamma RI mRNA in U-937 cells, neutrophils, and monocytes by hybridizing total RNA with the Fc gamma RI cDNA probe, p135. We found that the amount of Fc gamma RI mRNA increased within 1 h of treatment with rIFN-gamma in all three cell types. This initial induction of Fc gamma RI mRNA by rIFN-gamma was completely blocked by an inhibitor of RNA synthesis, actinomycin D, suggesting that the rIFN-gamma-mediated induction of Fc gamma RI mRNA is dependent on gene transcription. Dex, used in combination with rIFN-gamma, partially blocked the induction of Fc gamma RI mRNA by rIFN-gamma in U-937 cells and neutrophils, but caused a synergistic increase in Fc gamma RI mRNA levels in monocytes. The inhibitory effect of Dex on the steady state level of Fc gamma RI mRNA in U-937 cells was blocked by an inhibitor of protein synthesis, cycloheximide, suggesting that Dex-induced proteins were involved in the regulation of Fc gamma RI expression. This study indicates that the regulation of Fc gamma RI expression on U-937 cells, neutrophils, and monocytes by rIFN-gamma and Dex occurs, at least in part, at the mRNA level. rIFN-gamma increases the steady state level of Fc gamma RI mRNA through a common pathway among U-937 cells, neutrophils, and monocytes, whereas the effect of Dex on rIFN-gamma-induced Fc gamma RI mRNA is cell

Gene expression distribution deconvolution in single-cell RNA sequencing.

PubMed

Wang, Jingshu; Huang, Mo; Torre, Eduardo; Dueck, Hannah; Shaffer, Sydney; Murray, John; Raj, Arjun; Li, Mingyao; Zhang, Nancy R

2018-06-26

Single-cell RNA sequencing (scRNA-seq) enables the quantification of each gene's expression distribution across cells, thus allowing the assessment of the dispersion, nonzero fraction, and other aspects of its distribution beyond the mean. These statistical characterizations of the gene expression distribution are critical for understanding expression variation and for selecting marker genes for population heterogeneity. However, scRNA-seq data are noisy, with each cell typically sequenced at low coverage, thus making it difficult to infer properties of the gene expression distribution from raw counts. Based on a reexamination of nine public datasets, we propose a simple technical noise model for scRNA-seq data with unique molecular identifiers (UMI). We develop deconvolution of single-cell expression distribution (DESCEND), a method that deconvolves the true cross-cell gene expression distribution from observed scRNA-seq counts, leading to improved estimates of properties of the distribution such as dispersion and nonzero fraction. DESCEND can adjust for cell-level covariates such as cell size, cell cycle, and batch effects. DESCEND's noise model and estimation accuracy are further evaluated through comparisons to RNA FISH data, through data splitting and simulations and through its effectiveness in removing known batch effects. We demonstrate how DESCEND can clarify and improve downstream analyses such as finding differentially expressed genes, identifying cell types, and selecting differentiation markers. Copyright © 2018 the Author(s). Published by PNAS.

Concerted evolution of the tandemly repeated genes encoding primate U2 small nuclear RNA (the RNU2 locus) does not prevent rapid diversification of the (CT){sub n} {center_dot} (GA){sub n} microsatellite embedded within the U2 repeat unit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, D.; Weiner, A.M.

1995-12-10

The RNU2 locus encoding human U2 small nuclear RNA (snRNA) is organized as a nearly perfect tandem array containing 5 to 22 copies of a 5.8-kb repeat unit. Just downstream of the U2 snRNA gene in each 5.8-kb repeat unit lies a large (CT){sub n}{center_dot}(GA){sub n} dinucleotide repeat (n {approx} 70). This form of genomic organization, in which one repeat is embedded within another, provides an unusual opportunity to study the balance of forces maintaining the homogeneity of both kinds of repeats. Using a combination of field inversion gel electrophoresis and polymerase chain reaction, we have been able to studymore » the CT microsatellites within individual U2 tandem arrays. We find that the CT microsatellites within an RNU2 allele exhibit significant length polymorphism, despite the remarkable homogeneity of the surrounding U2 repeat units. Length polymorphism is due primarily to loss or gain of CT dinucleotide repeats, but other types of deletions, insertions, and substitutions are also frequent. Polymorphism is greatly reduced in regions where pure (CT){sub n} tracts are interrupted by occasional G residues, suggesting that irregularities stabilize both the length and the sequence of the dinucleotide repeat. We further show that the RNU2 loci of other catarrhine primates (gorilla, chimpanzee, ogangutan, and baboon) contain orthologous CT microsatellites; these also exhibit length polymorphism, but are highly divergent from each other. Thus, although the CT microsatellite is evolving far more rapidly than the rest of the U2 repeat unit, it has persisted through multiple speciation events spanning >35 Myr. The persistence of the CT microsatellite, despite polymorphism and rapid evolution, suggests that it might play a functional role in concerted evolution of the RNU2 loci, perhaps as an initiation site for recombination and/or gene conversion. 70 refs., 5 figs.« less

APOBEC3B cytidine deaminase targets the non-transcribed strand of tRNA genes in yeast.

PubMed

Saini, Natalie; Roberts, Steven A; Sterling, Joan F; Malc, Ewa P; Mieczkowski, Piotr A; Gordenin, Dmitry A

2017-05-01

Variations in mutation rates across the genome have been demonstrated both in model organisms and in cancers. This phenomenon is largely driven by the damage specificity of diverse mutagens and the differences in DNA repair efficiency in given genomic contexts. Here, we demonstrate that the single-strand DNA-specific cytidine deaminase APOBEC3B (A3B) damages tRNA genes at a 1000-fold higher efficiency than other non-tRNA genomic regions in budding yeast. We found that A3B-induced lesions in tRNA genes were predominantly located on the non-transcribed strand, while no transcriptional strand bias was observed in protein coding genes. Furthermore, tRNA gene mutations were exacerbated in cells where RNaseH expression was completely abolished (Δrnh1Δrnh35). These data suggest a transcription-dependent mechanism for A3B-induced tRNA gene hypermutation. Interestingly, in strains proficient in DNA repair, only 1% of the abasic sites formed upon excision of A3B-deaminated cytosines were not repaired leading to mutations in tRNA genes, while 18% of these lesions failed to be repaired in the remainder of the genome. A3B-induced mutagenesis in tRNA genes was found to be efficiently suppressed by the redundant activities of both base excision repair (BER) and the error-free DNA damage bypass pathway. On the other hand, deficiencies in BER did not have a profound effect on A3B-induced mutations in CAN1, the reporter for protein coding genes. We hypothesize that differences in the mechanisms underlying ssDNA formation at tRNA genes and other genomic loci are the key determinants of the choice of the repair pathways and consequently the efficiency of DNA damage repair in these regions. Overall, our results indicate that tRNA genes are highly susceptible to ssDNA-specific DNA damaging agents. However, increased DNA repair efficacy in tRNA genes can prevent their hypermutation and maintain both genome and proteome homeostasis. Published by Elsevier B.V.

Inhibition of N-Myc down regulated gene 1 in in vitro cultured human glioblastoma cells

PubMed Central

Said, Harun M; Polat, Buelent; Stein, Susanne; Guckenberger, Mathias; Hagemann, Carsten; Staab, Adrian; Katzer, Astrid; Anacker, Jelena; Flentje, Michael; Vordermark, Dirk

2012-01-01

AIM: To study short dsRNA oligonucleotides (siRNA) as a potent tool for artificially modulating gene expression of N-Myc down regulated gene 1 (NDRG1) gene induced under different physiological conditions (Normoxia and hypoxia) modulating NDRG1 transcription, mRNA stability and translation. METHODS: A cell line established from a patient with glioblastoma multiforme. Plasmid DNA for transfections was prepared with the Endofree Plasmid Maxi kit. From plates containing 5 × 107 cells, nuclear extracts were prepared according to previous protocols. The pSUPER-NDRG1 vectors were designed, two sequences were selected from the human NDRG1 cDNA (5’-GCATTATTGGCATGGGAAC-3’ and 5’-ATGCAGAGTAACGTGGAAG-3’. reverse transcription polymerase chain reaction was performed using primers designed using published information on β-actin and hypoxia-inducible factor (HIF)-1α mRNA sequences in GenBank. NDRG1 mRNA and protein level expression results under different conditions of hypoxia or reoxygenation were compared to aerobic control conditions using the Mann-Whitney U test. Reoxygenation values were also compared to the NDRG1 levels after 24 h of hypoxia (P < 0.05 was considered significant). RESULTS: siRNA- and iodoacetate (IAA)-mediated downregulation of NDRG1 mRNA and protein expression in vitro in human glioblastoma cell lines showed a nearly complete inhibition of NDRG1 expression when compared to the results obtained due to the inhibitory role of glycolysis inhibitor IAA. Hypoxia responsive elements bound by nuclear HIF-1 in human glioblastoma cells in vitro under different oxygenation conditions and the clearly enhanced binding of nuclear extracts from glioblastoma cell samples exposed to extreme hypoxic conditions confirmed the HIF-1 Western blotting results. CONCLUSION: NDRG1 represents an additional diagnostic marker for brain tumor detection, due to the role of hypoxia in regulating this gene, and it can represent a potential target for tumor treatment in human