Sample records for ugandan tertiary hospital

  1. Breast Cancer Risk Factors among Ugandan Women at a Tertiary Hospital: A Case-Control Study

    PubMed Central

    Galukande, Moses; Wabinga, Henry; Mirembe, Florence; Karamagi, Charles; Asea, Alexzander

    2016-01-01

    Background Although East Africa, like other countries in sub-Saharan Africa, has a lower incidence of breast cancer than high-income countries, the disease rate is rising steeply in Africa; it has nearly tripled in the past few decades in Uganda. There is a paucity of studies that have examined the relation between reproductive factors and breast cancer risk factors in Ugandan women. Objective To determine breast cancer risk factors among indigenous Ugandan women. Methods This is a hospital-based unmatched case-control study. Interviews were conducted between 2011 and 2012 using structured questionnaires. Patients with histologyproven breast cancer were recruited over a 2-year period. Logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs). Results A total of 350 women were recruited; 113 were cases and 237 were controls. The mean age was 47.5 years (SD 14) for the cases and 45.5 years (SD 14.1) for the controls. The odds of breast cancer risk seemed lower for those who breastfed (adjusted OR = 0.04; 95% CI: 0.01, 0.18). There was no significance for early age at first full-term birth (adjusted OR = 1.96; 95% CI: 0.97, 3.96; p = 0.061), and urban residence carried no increased odds of breast cancer either (p = 0.201). Conclusion Breastfeeding seems to be associated with reduced odds of breast cancer. PMID:27104645

  2. Breast Cancer Risk Factors among Ugandan Women at a Tertiary Hospital: A Case-Control Study.

    PubMed

    Galukande, Moses; Wabinga, Henry; Mirembe, Florence; Karamagi, Charles; Asea, Alexzander

    2016-01-01

    Although East Africa, like other countries in sub-Saharan Africa, has a lower incidence of breast cancer than high-income countries, the disease rate is rising steeply in Africa; it has nearly tripled in the past few decades in Uganda. There is a paucity of studies that have examined the relation between reproductive factors and breast cancer risk factors in Ugandan women. To determine breast cancer risk factors among indigenous Ugandan women. This is a hospital-based unmatched case-control study. Interviews were conducted between 2011 and 2012 using structured questionnaires. Patients with histology-proven breast cancer were recruited over a 2-year period. Logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs). A total of 350 women were recruited; 113 were cases and 237 were controls. The mean age was 47.5 years (SD 14) for the cases and 45.5 years (SD 14.1) for the controls. The odds of breast cancer risk seemed lower for those who breastfed (adjusted OR = 0.04; 95% CI: 0.01, 0.18). There was no significance for early age at first full-term birth (adjusted OR = 1.96; 95% CI: 0.97, 3.96; p = 0.061), and urban residence carried no increased odds of breast cancer either (p = 0.201). Breastfeeding seems to be associated with reduced odds of breast cancer. © 2016 The Author(s) Published by S. Karger AG, Basel.

  3. The clinical presentation and early outcomes of necrotizing fasciitis in a Ugandan Tertiary Hospital--a prospective study.

    PubMed

    Magala, John; Makobore, Patson; Makumbi, Timothy; Kaggwa, Sam; Kalanzi, Edris; Galukande, Moses

    2014-07-28

    Necrotizing fasciitis is an infectious process characterized by rapidly progressing necrosis of superficial fascia and subcutaneous tissue with subsequent necrosis of overlying skin.Necrotizing fasciitis is a rare but fatal infection. The worldwide incidence is at 0.4 per 100,000. Mortality is up to 80% with no intervention, and 30-50% with intervention. Delay in intervention is associated with poor outcome. The risk factors for necrotizing fasciitis are diabetes mellitus, HIV, malignancy, illicit drug use, malnutrition among others.The aim of this study was to describe the clinical presentation and early outcomes of necrotizing fasciitis amongst Ugandan patients. A prospective descriptive case series study conducted at Mulago National Referral and Teaching hospital from 5th January to 30th April 2011. Patients with necrotizing fasciitis were consecutively recruited after clinical evaluation, laboratory and microbiological tests were performed. Aggressive debridement was done and broad-spectrum antibiotics administered. Patients were followed up on surgical wards. Ethical approval was obtained. Thirty five patients were recruited over a 4 months period. More males were affected with, M: F 3:1. The 20-40 years age group was most affected. Attainment of healthy granulation tissue took 19 days on average. Mortality rate was 14% (5/35). Limbs were the most affected body parts 20/35 (57%), the scrotum and perineum (23%). Among infants the scalp was the most affected. Co-morbidities included HIV 8/35 (17%), and DM (5%) among others. The commonest organisms were gram negative. Split skin grafting was necessary in 74% (26/35) of patients. There were a high number of patients with necrotizing fasciitis; it was associated with low mortality but high morbidity (long hospital stay). There was a high preponderance to males and limbs were the more affected body parts.

  4. The clinical presentation and early outcomes of necrotizing fasciitis in a Ugandan Tertiary Hospital- a prospective study

    PubMed Central

    2014-01-01

    Background Necrotizing fasciitis is an infectious process characterized by rapidly progressing necrosis of superficial fascia and subcutaneous tissue with subsequent necrosis of overlying skin. Necrotizing fasciitis is a rare but fatal infection. The worldwide incidence is at 0.4 per 100,000. Mortality is up to 80% with no intervention, and 30-50% with intervention. Delay in intervention is associated with poor outcome. The risk factors for necrotizing fasciitis are diabetes mellitus, HIV, malignancy, illicit drug use, malnutrition among others. The aim of this study was to describe the clinical presentation and early outcomes of necrotizing fasciitis amongst Ugandan patients. Methods A prospective descriptive case series study conducted at Mulago National Referral and Teaching hospital from 5th January to 30th April 2011. Patients with necrotizing fasciitis were consecutively recruited after clinical evaluation, laboratory and microbiological tests were performed. Aggressive debridement was done and broad-spectrum antibiotics administered. Patients were followed up on surgical wards. Ethical approval was obtained. Results Thirty five patients were recruited over a 4 months period. More males were affected with, M: F 3:1. The 20-40 years age group was most affected. Attainment of healthy granulation tissue took 19 days on average. Mortality rate was 14% (5/35). Limbs were the most affected body parts 20/35 (57%), the scrotum and perineum (23%). Among infants the scalp was the most affected. Co-morbidities included HIV 8/35 (17%), and DM (5%) among others. The commonest organisms were gram negative. Split skin grafting was necessary in 74% (26/35) of patients. Conclusion There were a high number of patients with necrotizing fasciitis; it was associated with low mortality but high morbidity (long hospital stay). There was a high preponderance to males and limbs were the more affected body parts. PMID:25069415

  5. Neonatal exchange transfusions in tertiary and non-tertiary hospital settings, New South Wales, 2001-2012.

    PubMed

    Chessman, Julia C; Bowen, Jennifer R; Ford, Jane B

    2017-05-01

    To describe neonatal exchange transfusions in New South Wales (NSW) before and after release in January 2007 of a NSW Health guideline regarding exchange transfusions in tertiary and non-tertiary hospitals. The study population included neonates receiving exchange transfusion in NSW hospitals, 2001-2012. Linked birth and hospital data for mothers and babies were used to describe birth characteristics and maternal and neonatal conditions. Exchange transfusions were identified in hospital data and compared for 2001-2006 and 2007-2012. Maternal and neonatal characteristics were compared with χ 2 and Wilcoxon signed-rank tests. Between 2001 and 2012, there were 286 exchange transfusions performed for 281 neonates in NSW hospitals. The number of exchange transfusions decreased from 187 in 184 neonates for 2001-2006 to 99 in 97 neonates 2007-2012 (P < 0.001). The percentage of exchange transfusions performed at tertiary hospitals increased from 85% in 2001-2006 to 91% in 2007-2012, although this was not statistically significant (P = 0.16). Most neonates requiring exchange transfusion were born in tertiary hospitals: 62% for 2001-2006 and 69% for 2007-2012. Among those born in a non-tertiary hospital, the percentage transferred or admitted to a tertiary hospital for exchange transfusion was 63% in 2001-2006 and 77% in 2007-2012. Between 2001 and 2012, there was a decrease in neonatal exchange transfusions in NSW. After the 2007 guideline there was a non-significant increase in the proportion of exchange transfusions performed at tertiary hospitals. Although rare, exchange transfusions are still expected to occur occasionally in non-tertiary hospitals, requiring continuing support for this procedure in these settings. © 2017 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  6. Barriers to health service access among female migrant Ugandan sex workers in Guangzhou, China.

    PubMed

    Davis, Alissa; Meyerson, Beth E; Aghaulor, Blessing; Brown, Katherine; Watson, Adisyn; Muessig, Kathryn E; Yang, Ligang; Tucker, Joseph D

    2016-10-14

    Increased trade between China and Uganda has fueled trafficking of female Ugandans into China. These women may face challenges accessing health services. This study focused on examining barriers to health care access among female Ugandan sex workers in China. In 2014, we undertook in-depth interviews with 19 female Ugandan sex workers in Guangzhou, China. Interviews focused on barriers to health service access and were analyzed using an a priori coding framework followed by open-coding to capture emergent themes. Out of 19 women, 12 women reported a history of being trafficked into China. None of the women had a valid Chinese visa. Fear of being arrested for lack of documentation discouraged women in this sample from accessing hospital services. Low pay, housing exploitation, and remittances contributed to participants' lack of financial resources, which further inhibited their ability to access health services. Participants expressed feeling social isolation from the local community and reported mistrust of local individuals and organizations, including hospitals. Ugandan sex workers in China faced substantial structural barriers that limited health service access. Policy changes and the development of new programs are urgently needed to ensure these women have improved access to health services.

  7. Disaster resilience in tertiary hospitals: a cross-sectional survey in Shandong Province, China.

    PubMed

    Zhong, Shuang; Hou, Xiang-Yu; Clark, Michele; Zang, Yu-Li; Wang, Lu; Xu, Ling-Zhong; FitzGerald, Gerard

    2014-03-25

    Hospital disaster resilience can be defined as a hospital's ability to resist, absorb, and respond to the shock of disasters while maintaining critical functions, and then to recover to its original state or adapt to a new one. This study aims to explore the status of resilience among tertiary hospitals in Shandong Province, China. A stratified random sample (n = 50) was derived from tertiary A, tertiary B, and tertiary C hospitals in Shandong Province, and was surveyed by questionnaire. Data on hospital characteristics and 8 key domains of hospital resilience were collected and analysed. Variables were binary, and analysed using descriptive statistics such as frequencies. A response rate of 82% (n = 41) was attained. Factor analysis identified four key factors from eight domains which appear to reflect the overall level of disaster resilience. These were hospital safety, disaster management mechanisms, disaster resources and disaster medical care capability. The survey demonstrated that in regard to hospital safety, 93% had syndromic surveillance systems for infectious diseases and 68% had evaluated their safety standards. In regard to disaster management mechanisms, all had general plans, while only 20% had specific plans for individual hazards. 49% had a public communication protocol and 43.9% attended the local coordination meetings. In regard to disaster resources, 75.6% and 87.5% stockpiled emergency drugs and materials respectively, while less than a third (30%) had a signed Memorandum of Understanding with other hospitals to share these resources. Finally in regard to medical care, 66% could dispatch an on-site medical rescue team, but only 5% had a 'portable hospital' function and 36.6% and 12% of the hospitals could surge their beds and staff capacity respectively. The average beds surge capacity within 1 day was 13%. This study validated the broad utility of a framework for understanding and measuring the level of hospital resilience. The survey

  8. Analysis of colonoscopic perforations at a local clinic and a tertiary hospital.

    PubMed

    Sagawa, Toshihiko; Kakizaki, Satoru; Iizuka, Haruhisa; Onozato, Yasuhiro; Sohara, Naondo; Okamura, Shinichi; Mori, Masatomo

    2012-09-21

    To define the clinical characteristics, and to assess the management of colonoscopic complications at a local clinic. A retrospective review of the medical records was performed for the patients with iatrogenic colon perforations after endoscopy at a local clinic between April 2006 and December 2010. Data obtained from a tertiary hospital in the same region were also analyzed. The underlying conditions, clinical presentations, perforation locations, treatment types (operative or conservative) and outcome data for patients at the local clinic and the tertiary hospital were compared. A total of 10  826 colonoscopies, and 2625 therapeutic procedures were performed at a local clinic and 32  148 colonoscopies, and 7787 therapeutic procedures were performed at the tertiary hospital. The clinic had no perforations during diagnostic colonoscopy and 8 (0.3%) perforations were determined to be related to therapeutic procedures. The perforation rates in each therapeutic procedure were 0.06% (1/1609) in polypectomy, 0.2% (2/885) in endoscopic mucosal resection (EMR), and 3.8% (5/131) in endoscopic submucosal dissection (ESD). Perforation rates for ESD were significantly higher than those for polypectomy or EMR (P < 0.01). All of these patients were treated conservatively. On the other hand, three (0.01%) perforation cases were observed among the 24  361 diagnostic procedures performed, and these cases were treated with surgery in a tertiary hospital. Six perforations occurred with therapeutic endoscopy (perforation rate, 0.08%; 1 per 1298 procedures). Perforation rates for specific procedure types were 0.02% (1 per 5500) for polypectomy, 0.17% (1 per 561) for EMR, 2.3% (1 per 43) for ESD in the tertiary hospital. There were no differences in the perforation rates for each therapeutic procedure between the clinic and the tertiary hospital. The incidence of iatrogenic perforation requiring surgical treatment was quite low in both the clinic and the tertiary hospital

  9. Disaster resilience in tertiary hospitals: a cross-sectional survey in Shandong Province, China

    PubMed Central

    2014-01-01

    Background Hospital disaster resilience can be defined as a hospital’s ability to resist, absorb, and respond to the shock of disasters while maintaining critical functions, and then to recover to its original state or adapt to a new one. This study aims to explore the status of resilience among tertiary hospitals in Shandong Province, China. Methods A stratified random sample (n = 50) was derived from tertiary A, tertiary B, and tertiary C hospitals in Shandong Province, and was surveyed by questionnaire. Data on hospital characteristics and 8 key domains of hospital resilience were collected and analysed. Variables were binary, and analysed using descriptive statistics such as frequencies. Results A response rate of 82% (n = 41) was attained. Factor analysis identified four key factors from eight domains which appear to reflect the overall level of disaster resilience. These were hospital safety, disaster management mechanisms, disaster resources and disaster medical care capability. The survey demonstrated that in regard to hospital safety, 93% had syndromic surveillance systems for infectious diseases and 68% had evaluated their safety standards. In regard to disaster management mechanisms, all had general plans, while only 20% had specific plans for individual hazards. 49% had a public communication protocol and 43.9% attended the local coordination meetings. In regard to disaster resources, 75.6% and 87.5% stockpiled emergency drugs and materials respectively, while less than a third (30%) had a signed Memorandum of Understanding with other hospitals to share these resources. Finally in regard to medical care, 66% could dispatch an on-site medical rescue team, but only 5% had a ‘portable hospital’ function and 36.6% and 12% of the hospitals could surge their beds and staff capacity respectively. The average beds surge capacity within 1 day was 13%. Conclusions This study validated the broad utility of a framework for understanding and measuring the

  10. Impact of long-stay beds on the performance of a tertiary hospital in emergencies

    PubMed Central

    Pazin, Antonio; de Almeida, Edna; Cirilo, Leni Peres; Lourençato, Frederica Montanari; Baptista, Lisandra Maria; Pintyá, José Paulo; Capeli, Ronaldo Dias; da Silva, Sonia Maria Pirani Felix; Wolf, Claudia Maria; Dinardi, Marcelo Marcos; Scarpelini, Sandro; Damasceno, Maria Cecília

    2015-01-01

    ABSTRACT OBJECTIVE To assess the impact of implementing long-stay beds for patients of low complexity and high dependency in small hospitals on the performance of an emergency referral tertiary hospital. METHODS For this longitudinal study, we identified hospitals in three municipalities of a regional department of health covered by tertiary care that supplied 10 long-stay beds each. Patients were transferred to hospitals in those municipalities based on a specific protocol. The outcome of transferred patients was obtained by daily monitoring. Confounding factors were adjusted by Cox logistic and semiparametric regression. RESULTS Between September 1, 2013 and September 30, 2014, 97 patients were transferred, 72.1% male, with a mean age of 60.5 years (SD = 1.9), for which 108 transfers were performed. Of these patients, 41.7% died, 33.3% were discharged, 15.7% returned to tertiary care, and only 9.3% tertiary remained hospitalized until the end of the analysis period. We estimated the Charlson comorbidity index – 0 (n = 28 [25.9%]), 1 (n = 31 [56.5%]) and ≥ 2 (n = 19 [17.5%]) – the only variable that increased the chance of death or return to the tertiary hospital (Odds Ratio = 2.4; 95%CI 1.3;4.4). The length of stay in long-stay beds was 4,253 patient days, which would represent 607 patients at the tertiary hospital, considering the average hospital stay of seven days. The tertiary hospital increased the number of patients treated in 50.0% for Intensive Care, 66.0% for Neurology and 9.3% in total. Patients stayed in long-stay beds mainly in the first 30 (50.0%) and 60 (75.0%) days. CONCLUSIONS Implementing long-stay beds increased the number of patients treated in tertiary care, both in general and in system bottleneck areas such as Neurology and Intensive Care. The Charlson index of comorbidity is associated with the chance of patient death or return to tertiary care, even when adjusted for possible confounding factors. PMID:26603353

  11. Descriptive analysis of neurological in-hospital consultations in a tertiary hospital.

    PubMed

    Aller-Alvarez, J S; Quintana, M; Santamarina, E; Álvarez-Sabín, J

    2017-04-01

    In-hospital consultations (IHC) are essential in clinical practice in tertiary hospitals. The aim of this study is to analyse the impact of neurological IHCs. One-year retrospective descriptive study of neurological IHCs conducted from May 2013 to April 2014 at our tertiary hospital. A total of 472 patients were included (mean age, 62.1 years; male patients, 56.8%) and 24.4% had previously been evaluated by a neurologist. Patients were hospitalised a median of 18 days and 19.7% had been referred by another hospital. The departments requesting the most in-hospital consultations were intensive care (20.1%), internal medicine (14.4%), and cardiology (9.1%). Reasons for requesting an IHC were stroke (26.9%), epilepsy (20.6%), and confusional states (7.6%). An on-call neurologist evaluated 41.9% of the patients. The purpose of the IHC was to provide a diagnosis in 56.3% and treatment in 28.2% of the cases; 69.5% of the patients required additional tests. Treatment was adjusted in 18.9% of patients and additional drugs were administered to 27.3%. While 62.1% of cases required no additional IHCs, 11% required further assessment, and 4.9% were transferred to the neurology department. Of the patient total, 16.9% died during hospitalisation (in 37.5%, the purpose of the consultation was to certify brain death); 45.6% were referred to the neurology department at discharge and 6.1% visited the emergency department due to neurological impairment within 6 months of discharge. IHCs facilitate diagnosis and management of patients with neurological diseases, which may help reduce the number of visits to the emergency department. On-call neurologists are essential in tertiary hospitals, and they are frequently asked to diagnose brain death. Copyright © 2015 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  12. Measuring case-mix complexity of tertiary care hospitals using DRGs.

    PubMed

    Park, Hayoung; Shin, Youngsoo

    2004-02-01

    The objectives of the study were to develop a model that measures and evaluates case-mix complexity of tertiary care hospitals, and to examine the characteristics of such a model. Physician panels defined three classes of case complexity and assigned disease categories represented by Adjacent Diagnosis Related Groups (ADRGs) to one of three case complexity classes. Three types of scores, indicating proportions of inpatients in each case complexity class standardized by the proportions at the national level, were defined to measure the case-mix complexity of a hospital. Discharge information for about 10% of inpatient episodes at 85 hospitals with bed size larger than 400 and their input structure and research and education activity were used to evaluate the case-mix complexity model. Results show its power to predict hospitals with the expected functions of tertiary care hospitals, i.e. resource intensive care, expensive input structure, and high levels of research and education activities.

  13. Medical tourism in India: perceptions of physicians in tertiary care hospitals.

    PubMed

    Qadeer, Imrana; Reddy, Sunita

    2013-12-17

    Senior physicians of modern medicine in India play a key role in shaping policies and public opinion and institutional management. This paper explores their perceptions of medical tourism (MT) within India which is a complex process involving international demands and policy shifts from service to commercialisation of health care for trade, gross domestic profit, and foreign exchange. Through interviews of 91 physicians in tertiary care hospitals in three cities of India, this paper explores four areas of concern: their understanding of MT, their views of the hospitals they work in, perceptions of the value and place of MT in their hospital and their views on the implications of MT for medical care in the country. An overwhelming majority (90%) of physicians in the private tertiary sector and 74.3 percent in the public tertiary sector see huge scope for MT in the private tertiary sector in India. The private tertiary sector physicians were concerned about their patients alone and felt that health of the poor was the responsibility of the state. The public tertiary sector physicians' however, were sensitive to the problems of the common man and felt responsible. Even though the glamour of hi-tech associated with MT dazzled them, only 35.8 percent wanted MT in their hospitals and a total of 56 percent of them said MT cannot be a public sector priority. 10 percent in the private sector expressed reservations towards MT while the rest demanded state subsidies for MT. The disconnect between their concern for the common man and professionals views on MT was due to the lack of appreciation of the continuum between commercialisation, the denial of resources to public hospitals and shift of subsidies to the private sector. The paper highlights the differences and similarities in the perceptions and context of the two sets of physicians, presents evidence, that questions the support for MT and finally analyzes some key implications of MT on Indian health services, ethical

  14. Medical tourism in india: perceptions of physicians in tertiary care hospitals

    PubMed Central

    2013-01-01

    Senior physicians of modern medicine in India play a key role in shaping policies and public opinion and institutional management. This paper explores their perceptions of medical tourism (MT) within India which is a complex process involving international demands and policy shifts from service to commercialisation of health care for trade, gross domestic profit, and foreign exchange. Through interviews of 91 physicians in tertiary care hospitals in three cities of India, this paper explores four areas of concern: their understanding of MT, their views of the hospitals they work in, perceptions of the value and place of MT in their hospital and their views on the implications of MT for medical care in the country. An overwhelming majority (90%) of physicians in the private tertiary sector and 74.3 percent in the public tertiary sector see huge scope for MT in the private tertiary sector in India. The private tertiary sector physicians were concerned about their patients alone and felt that health of the poor was the responsibility of the state. The public tertiary sector physicians’ however, were sensitive to the problems of the common man and felt responsible. Even though the glamour of hi-tech associated with MT dazzled them, only 35.8 percent wanted MT in their hospitals and a total of 56 percent of them said MT cannot be a public sector priority. 10 percent in the private sector expressed reservations towards MT while the rest demanded state subsidies for MT. The disconnect between their concern for the common man and professionals views on MT was due to the lack of appreciation of the continuum between commercialisation, the denial of resources to public hospitals and shift of subsidies to the private sector. The paper highlights the differences and similarities in the perceptions and context of the two sets of physicians, presents evidence, that questions the support for MT and finally analyzes some key implications of MT on Indian health services, ethical

  15. Mortality in newborns referred to tertiary hospital: An introspection

    PubMed Central

    Aggarwal, Kailash Chandra; Gupta, Ratan; Sharma, Shobha; Sehgal, Rachna; Roy, Manas Pratim

    2015-01-01

    Background: India is one of the largest contributors in the pool of neonatal death in the world. However, there are inadequate data on newborns referred to tertiary care centers. The present study aimed to find out predictors of mortality among newborns delivered elsewhere and admitted in a tertiary hospital in New Delhi between February and September 2014. Materials and Methods: Hospital data for were retrieved and analyzed for determining predictors for mortality of the newborns. Time of admission, referral and presenting clinical features were considered. Results: Out of 1496 newborns included in the study, there were 300 deaths. About 43% deaths took place in first 24 hours of life. Asphyxia and low birth weight were the main causes of death in early neonatal period, whereas sepsis had maximum contribution in deaths during late neonatal period. Severe hypothermia, severe respiratory distress, admission within first 24 hours of life, absence of health personnel during transport and referral from any hospital had significant correlation with mortality. Conclusions: There is need for ensure thermoregulation, respiratory sufficiency and presence of health personnel during transport. PMID:26288788

  16. Management for the children with otitis media with effusion in the tertiary hospital.

    PubMed

    Choung, Yun-Hoon; Shin, You Ree; Choi, Seong Jun; Park, Keehyun; Park, Hun Yi; Lee, Jong Bin; Han, Dong Hee; Kahng, Hison

    2008-12-01

    Recently, new evidence-based recommendations have been introduced for diagnosing and managing otitis media with effusion (OME) in children. However, there are some difficulties to follow the general guidelines in the tertiary hospitals. The purpose is to evaluate the efficiency of antibiotics or antihistamines for treatment of children with OME in the tertiary hospital with a randomized prospective clinical study. Eighty-four children with OME who had been diagnosed in the tertiary hospital were randomized to receive 5 different medications for 2 weeks. We prescribed antibiotics (amoxicillin-clavulanate syrup) in Group I (n=16), antibiotics/steroids (prednisolone) in Group II (n=18), antibiotics/antihistamines (ebastine) in Group III (n=15), antibiotics/steroids/antihistamines in Group IV (n=17), and mucolytics (ivy leaf extract) in Group V (n=17) for control. We followed-up children every 2 weeks and evaluated the state of OME at 3 months. Thirty six (42.9%) of 84 children were resolved within average 6.9 weeks after the treatments. Thirty-six (42.9%) were treated with ventilation tube insertion and 12 patients (14.3%) were observed. There was no difference in the resolution rates of OME among the five different protocols (P>0.05). There was no difference in the resolution rates among groups who used steroids, antihistamines, steroids and antihistamines, or other medications to manage 42 children with allergies (P>0.05). In the tertiary hospital, the cure rate of children with OME was not as high as well-known, and antibiotics or anti-allergic medications were not more effective than control. We may, therefore, need any other guidelines which are different from the previous evidence-based recommendations, including early operation in the tertiary hospitals.

  17. National Rules for Drug–Drug Interactions: Are They Appropriate for Tertiary Hospitals?

    PubMed Central

    2016-01-01

    The application of appropriate rules for drug–drug interactions (DDIs) could substantially reduce the number of adverse drug events. However, current implementations of such rules in tertiary hospitals are problematic as physicians are receiving too many alerts, causing high override rates and alert fatigue. We investigated the potential impact of Korean national DDI rules in a drug utilization review program in terms of their severity coverage and the clinical efficiency of how physicians respond to them. Using lists of high-priority DDIs developed with the support of the U.S. government, we evaluated 706 contraindicated DDI pairs released in May 2015. We evaluated clinical log data from one tertiary hospital and prescription data from two other tertiary hospitals. The measured parameters were national DDI rule coverage for high-priority DDIs, alert override rate, and number of prescription pairs. The coverage rates of national DDI rules were 80% and 3.0% at the class and drug levels, respectively. The analysis of the system log data showed an overall override rate of 79.6%. Only 0.3% of all of the alerts (n = 66) were high-priority DDI rules. These showed a lower override rate of 51.5%, which was much lower than for the overall DDI rules. We also found 342 and 80 unmatched high-priority DDI pairs which were absent in national rules in inpatient orders from the other two hospitals. The national DDI rules are not complete in terms of their coverage of severe DDIs. They also lack clinical efficiency in tertiary settings, suggesting improved systematic approaches are needed. PMID:27822925

  18. Satisfaction, motivation, and intent to stay among Ugandan physicians: a survey from 18 national hospitals.

    PubMed

    Luboga, Sam; Hagopian, Amy; Ndiku, John; Bancroft, Emily; McQuide, Pamela

    2011-01-01

    Uganda faces a colossal shortages of human resources for health. Previous literature has largely focused on those who leave. This paper reports on a study of physicians working in 18 public and private facilities in Uganda as part of a larger study of more than 641 hospital-based health workers in Uganda. We report what could entice physicians to stay longer, satisfaction with current positions, and future career intentions. This study took place in 18 Ugandan hospitals. We describe the 49 physicians who participated in 11 focus groups and the 63 physicians who completed questionnaires, out of a larger sample of 641 health workers overall. Only 37% of physicians said they were satisfied with their jobs, and 46% reported they were at risk of leaving the health sector or the country. After compensation, the largest contributors to dissatisfaction among physicians were quality of management, availability of equipment and supplies (including drugs), quality of facility infrastructure, staffing and workload, political influence, community location, and professional development. Physicians in our study were highly dissatisfied, with almost half the sample reporting a risk to leave the sector or the country. The established link in literature between physician dissatisfaction and departure from the health system suggests national and regional policy makers should consider interventions that address the contributors to dissatisfaction identified in our study. Copyright © 2010 John Wiley & Sons, Ltd.

  19. Epidemiology and molecular typing of VRE bloodstream isolates in an Irish tertiary care hospital.

    PubMed

    Ryan, L; O'Mahony, E; Wrenn, C; FitzGerald, S; Fox, U; Boyle, B; Schaffer, K; Werner, G; Klare, I

    2015-10-01

    Ireland has the highest rate of vancomycin-resistant Enterococcus faecium (VREfm) isolated from blood of nosocomial patients in Europe, which rose from 33% (110/330) in 2007 to 45% (178/392) in 2012. No other European country had a VREfm rate from blood cultures of >25%. Our aim was to elucidate the reasons for this significantly higher rate in Ireland. The epidemiology and molecular typing of VRE from bloodstream infections (BSIs) was examined in a tertiary care referral hospital and isolates were compared with those from other tertiary care referral centres in the region. The most common source of VRE BSIs was intra-abdominal sepsis, followed by line-related infection and febrile neutropenia. Most of the isolates were positive for vanA; 52% (43/83) possessed the esp gene and 12% (10/83) possessed the hyl gene. Genotyping by SmaI macrorestriction analysis (PFGE) of isolates revealed clonal relatedness between bloodstream isolates and environmental isolates. VRE BSI isolates from two other tertiary care hospitals in the Dublin region showed relatedness by PFGE analysis. MLST revealed four STs (ST17, ST18, ST78 and ST203), all belonging to the clonal complex of hospital-associated strains. Irish VRE BSI isolates have virulence factor profiles as previously reported from Europe. Typing analysis shows the spread of individual clones within the hospital and between regional tertiary care hospitals. Apart from transmission of VRE within the hospital and transfer of colonized patients between Irish hospitals, no other explanation for the persistently high VREfm BSI rate in Ireland has been found. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Examining the characteristics of workplace violence in one non-tertiary hospital.

    PubMed

    Chapman, Rose; Styles, Irene; Perry, Laura; Combs, Shane

    2010-02-01

    This study sought to determine the prevalence and characteristics of workplace violence directed at a volunteer sample of nurses at one non-tertiary hospital. Respondents' reasons for not reporting these incidents were also investigated. Incidents of workplace violence are increasing worldwide. However, no studies have investigated this phenomenon from the perspective of nurses in Western Australian non-tertiary hospitals. Survey. A survey was distributed to all 332 nurses working in several areas of one non-tertiary hospital in Western Australia to determine their experiences of workplace violence over a 12 month period. Of the 113 nurses who agreed to participate in this study, 75% reported experiencing workplace violence in the previous twelve months. When asked about their most recent incident, 50% of the nurses said they had reported it verbally, mostly to more senior staff. Only 16% of the nurses completed an official incident report. Reasons for not reporting included the view that WPV is just part of the job and the perception that management would not be responsive. This study showed that for this sample of nurses violent events are occurring at a rate that is similar to those reported in other studies. This finding should be of great concern to the organisation and the community in general. Organisations are obliged to improve the safety of the workplace environment for both staff and patients. The findings of our study may be of help to healthcare institutions in developing education programmes for nurses, patients and their friends and relatives to reduce the impact and frequency of workplace violence.

  1. The Quality and Utility of Surgical and Anesthetic Data at a Ugandan Regional Referral Hospital.

    PubMed

    Tumusiime, G; Was, A; Preston, M A; Riesel, J N; Ttendo, S S; Firth, P G

    2017-02-01

    There are little primary data available on the delivery or quality of surgical treatment in rural sub-Saharan African hospitals. To initiate a quality improvement system, we characterized the existing data capture at a Ugandan Regional Referral Hospital. We examined the surgical ward admission (January 2008-December/2011) and operating theater logbooks (January 2010-July 2011) at Mbarara Regional Referral Hospital. There were 6346 admissions recorded over three years. The mean patient age was 31.4 ± 22.3 years; 29.8 % (n = 1888) of admissions were children. Leading causes of admission were general surgical problems (n = 3050, 48.1 %), trauma (n = 2041, 32.2 %), oncology (n = 718, 11.3 %) and congenital condition (n = 193, 3.0 %). Laparotomy (n = 468, 35.3 %), incision and drainage (n = 188, 14.2 %) and hernia repair (n = 90, 6.8 %) were the most common surgical procedures. Of 1325 operative patients, 994 (75 %) had an ASA I-II score. Of patients undergoing 810 procedures booked as non-elective, 583 (72 %) had an ASA "E" rating. Records of 41.3 % (n-403/975) of patients age 5 years or older undergoing non-obstetric operations were missing from the ward logbook. Missing patients were younger (25 [13,40] versus 30 [18,46] years, p = 0.002) and had higher ASA scores (ASA III-V 29.0 % versus 18.9 %, p < 0.001) than patients recorded in the logbbook; there was no diffence in gender (male 62.8 % versus 67.0 %, p = 0.20). The hospital records system measures surgical care, but improved data capture is needed to determine outcomes with sufficient accuracy to guide and record expansion of surgical capacity.

  2. Low prevalence of Pneumocystis jirovecii lung colonization in Ugandan HIV-infected patients hospitalized with non-Pneumocystis pneumonia.

    PubMed

    Taylor, Steve M; Meshnick, Steven R; Worodria, William; Andama, Alfred; Davis, J Lucian; Cattamanchi, Adithya; den Boon, Saskia; Yoo, Samuel D; Goodman, Carol D; Huang, Laurence

    2012-02-01

    Pneumocystis jirovecii is an important opportunistic infection in human immunodeficiency virus (HIV)-infected patients. In the developed world, P. jirovecii epidemiology is marked by frequent colonization in immunosuppressed patients, but data on the prevalence of colonization are very limited in sub-Saharan Africa, where the majority of persons living with HIV reside. Our objective was to describe the epidemiology of P. jirovecii colonization among HIV-positive patients in a cross-sectional, hospital-based study of patients admitted with suspected pneumonia in Kampala, Uganda. P. jirovecii was detectable in bronchoalveolar lavage fluid from 7 (6%) of 124 consecutive patients with non-Pneumocystis pneumonia. Colonization was not associated with patient demographic or clinical information. This prevalence is substantially lower than in published studies in the developed world and suggests that there is a limited reservoir of organisms for clinical infections in this Ugandan population. These findings may partially explain the low incidence of Pneumocystis pneumonia in Uganda and other sub-Saharan African countries. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Implementation of subcutaneous insulin protocol for non-critically ill hospitalized patients in andalusian tertiary care hospitals.

    PubMed

    Martínez-Brocca, María Asunción; Morales, Cristóbal; Rodríguez-Ortega, Pilar; González-Aguilera, Beatriz; Montes, Cristina; Colomo, Natalia; Piédrola, Gonzalo; Méndez-Muros, Mariola; Serrano, Isabel; Ruiz de Adana, Maria Soledad; Moreno, Alberto; Fernández, Ignacio; Aguilar, Manuel; Acosta, Domingo; Palomares, Rafael

    2015-02-01

    In 2009, the Andalusian Society of Endocrinology and Nutrition designed a protocol for subcutaneous insulin treatment in hospitalized non-critically ill patients (HIP). To analyze implementation of HIP at tertiary care hospitals from the Andalusian Public Health System. A descriptive, multicenter study conducted in 8 tertiary care hospitals on a random sample of non-critically ill patients with diabetes/hyperglycemia (n=306) hospitalized for ≥48 hours in 5 non-surgical (SM) and 2 surgical (SQ) departments. Type 1 and other specific types of diabetes, pregnancy and nutritional support were exclusion criteria. 288 patients were included for analysis (62.5% males; 70.3±10.3 years; 71.5% SM, 28.5% SQ). A scheduled subcutaneous insulin regimen based on basal-bolus-correction protocol was started in 55.9% (95%CI: 50.5-61.2%) of patients, 63.1% SM vs. 37.8% SQ (P<.05). Alternatives to insulin regimen based on basal-bolus-correction included sliding scale insulin (43.7%), diet (31.3%), oral antidiabetic drugs (17.2%), premixed insulin (1.6%), and others (6.2%). For patients previously on oral antidiabetic drugs, in-hospital insulin dose was 0.32±0.1 IU/kg/day. In patients previously on insulin, in-hospital insulin dose was increased by 17% [-13-53], and in those on insulin plus oral antidiabetic drugs, in-hospital insulin dose was increased by 26.4% [-6-100]. Supplemental insulin doses used for<40 IU/day and 40-80 IU/day were 72.2% and 56.7% respectively. HbA1c was measured in 23.6% of patients (95CI%: 18.8-28.8); 27.7% SM vs. 13.3% SQ (P<.05). Strategies are needed to improve implementation of the inpatient subcutaneous insulin protocol, particularly in surgical departments. Sliding scale insulin is still the most common alternative to insulin regimen based on basal-bolus-correction scheduled insulin. Metabolic control assessment during hospitalization should be encouraged. Copyright © 2014 SEEN. Published by Elsevier España, S.L.U. All rights reserved.

  4. Environment surveillance of filamentous fungi in two tertiary care hospitals in China.

    PubMed

    Hao, Zhen-feng; Ao, Jun-hong; Hao, Fei; Yang, Rong-ya; Zhu, He; Zhang, Jie

    2011-07-05

    Invasive fungal infections have constituted an increasingly important cause of morbidity and mortality in immunocompromised patients. In this study, a surveillance project was conducted in three different intensive care units of two large tertiary hospitals in China. A one-year surveillance project was conducted in two tertiary hospitals which located in northern China and southwest China respectively. Air, surfaces and tap water were sampled twice a month in a central intensive care unit, a bone marrow transplant unit, a neurosurgery intensive care unit and a live transplant department. Environmental conditions such as humidity, temperature and events taking place, for example the present of the visitors, healthcare staff and cleaning crew were also recorded at the time of sampling. The air fungal load was 91.94 cfu/m(3) and 71.02 cfu/m(3) in the southwest China hospital and the northern China hospital respectively. The five most prevalent fungi collected from air and surfaces were Penicillium spp., Cladospcrium spp., Alternaria spp., Aspergillus spp. and Saccharomyces spp. in the southwest China hospital, meanwhile Penicillium spp., Fusarium spp., Aspergillus spp., Alternaria spp. and Cladospcrium spp. in the northern China hospital. The least contaminated department was intensive care units, and the heaviest contaminated department was neurosurgery intensive care unit. Seventy-three percent of all surfaces examined in the northern China hospital and eighty-six percent in the southwest China hospital yielded fungi. Fifty-four percent of water samples from the northern China hospital and forty-nine percent from the southwest China hospital yielded fungi. These findings suggested that the fungus exist in the environment of the hospital including air, surface and water. Air and surface fungal load fluctuated over the year. Air fungal load was lower in winter and higher in summer and autumn, but seldom exceeded acceptable level. The higher values were created during

  5. Unlicensed and off-label use of drugs in pediatric surgical units at tertiary care hospitals of Pakistan.

    PubMed

    Aamir, Muhammad; Khan, Jamshaid Ali; Shakeel, Faisal; Asim, Syed Muhammad

    2017-08-01

    Background Unlicensed and off-label prescribing practice is global dilemma around the world. This pioneering study was designed to determine unlicensed and off-label use of drug in surgical wards of tertiary care hospitals of Pakistan. Objective To assess unlicensed and off-label use of drugs in pediatric surgical unit at three tertiary care hospitals in Peshawar, Pakistan. Setting Two government and one private tertiary care hospitals in Pakistan. Method Drug profiles of 895 patients from three different clinical settings were evaluated for unlicensed and off-label use of drugs using Micromedex DRUGDEX. Main outcome measure Characteristics of the unlicensed and off-label drug prescriptions. Result Total of 3168 prescribed drugs were analyzed in this study. Indication (38.7%) and dose (34.8%) were the most frequent off-label categories. In comparison with the corresponding reference categories, infants and children, male patients and having less than five prescribed drugs were significant predictors of unlicensed prescriptions. In comparison with the corresponding reference categories, significant predictors of off-label drug prescribing were children younger than two year, children between 2-12 years, patient staying at hospital less than 5 days and patients having less than five prescribed drugs. Conclusion The prevalence of unlicensed and off-label drug prescriptions are high at pediatric surgical ward of tertiary care hospitals. More awareness of the efficacy and safety of drugs are required in pediatrics. In addition, new formulations with advanced dosing for children are also required to minimize the risk of adverse outcomes.

  6. Determinants of the direct cost of heart failure hospitalization in a public tertiary hospital.

    PubMed

    Parissis, John; Athanasakis, Kostas; Farmakis, Dimitrios; Boubouchairopoulou, Nadia; Mareti, Christina; Bistola, Vasiliki; Ikonomidis, Ignatios; Kyriopoulos, John; Filippatos, Gerasimos; Lekakis, John

    2015-02-01

    Heart failure (HF) is the first reason for hospital admission in the elderly and represents a major financial burden, the greatest part of which results from hospitalization costs. We sought to analyze current HF hospitalization-related expenditure and identify predictors of cost in a public tertiary hospital in Europe. We performed a retrospective chart review of 197 consecutive patients, aged 56±16years, 80% male, with left ventricular ejection fraction (LVEF) of 30±10%, hospitalized for HF in a major university hospital in Athens, Greece. The survey involved the number of hospitalization days, laboratory investigations and medical therapies. Patients who were hospitalized in CCU/ICU or underwent interventional procedures or device implantations were excluded from analysis. Costs were estimated based on the Greek healthcare system perspective in 2013. Patients were hospitalized for a median of 7 days with a total direct cost of €3198±3260/patient. The largest part of the expenses (79%) was attributed to hospitalization (ward), while laboratory investigations and medical treatment accounted for 17% and 4%, respectively. In multivariate analysis, pre-admission New York Heart Association NYHA class (p=0.001), serum creatinine (p=0.003) and NT-proBNP (p=0.004) were significant independent predictors of hospitalization cost. Direct cost of HF hospitalization is high particularly in patients with more severe symptoms, profound neurohormonal activation and renal dysfunction. Strategies to lower hospitalization rates are warranted in the current setting of financial constraints faced by many European countries. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  7. Difference between Japanese Secondary and Tertiary Medical Facilities Regarding Changes in the Hospitalization of Children for Pneumonia after the Introduction of the Pneumococcal Conjugate Vaccine.

    PubMed

    Haro, Kaoru; Ogawa, Masato; Hoshina, Takayuki; Kojiro, Masumi; Kusuhara, Koichi

    2017-05-24

    This study aimed to compare hospitalization of children for pneumonia between secondary and tertiary medical facilities, which hospitalize many children without and with underlying diseases, respectively, after the introduction of the pneumococcal conjugate vaccine (PCV). Our retrospective study included children admitted to the Department of Pediatrics at Kitakyushu General Hospital, a secondary medical facility, and the Hospital of the University of Occupational and Environment Health, Japan, a tertiary medical facility, from 2009 to 2013 for pneumonia. We compared the change in the rate of hospitalization for pneumonia after the introduction of the 7-valent PCV between the secondary and tertiary medical facilities. Hospitalization of patients with pneumonia declined by 28.8% in our secondary medical facility. In particular, hospitalization for pneumonia other than confirmed mycoplasmal or viral pneumonia was significantly reduced by 49.2%. In contrast, hospitalization of patients with pneumonia did not decline in our tertiary medical facility. After the introduction of PCV, hospitalization of children for pneumonia was not reduced at the tertiary medical facility. Various other pathogens besides pneumococcus may be associated with the development of pneumonia in children with underlying diseases.

  8. Practices and challenges of infectious waste management: A qualitative descriptive study from tertiary care hospitals in Pakistan

    PubMed Central

    Kumar, Ramesh; Shaikh, Babar Tasneem; Somrongthong, Ratana; Chapman, Robert S

    2015-01-01

    Background and Objective: Infectious waste management practices among health care workers in the tertiary care hospitals have been questionable. The study intended to identify issues that impede a proper infectious waste management. Methods: Besides direct observation, in-depths interviews were conducted with the hospital administrators and senior management involved in healthcare waste management during March 2014. We looked at the processes related to segregation, collection, storage and disposal of hospital waste, and identified variety of issues in all the steps. Results: Serious gaps and deficiencies were observed related to segregation, collection, storage and disposal of the hospital wastes, hence proving to be hazardous to the patients as well as the visitors. Poor safety, insufficient budget, lack of trainings, weak monitoring and supervision, and poor coordination has eventually resulted in improper waste management in the tertiary hospitals of Rawalpindi. Conclusion: Study has concluded that the poor resources and lack of healthcare worker’s training in infectious waste results in poor waste management at hospitals. PMID:26430405

  9. Nutritional supplement practices of professional Ugandan athletes: a cross-sectional study.

    PubMed

    Muwonge, Haruna; Zavuga, Robert; Kabenge, Peninnah Aligawesa; Makubuya, Timothy

    2017-01-01

    The use of nutritional supplements (NS) places athletes at great risk for inadvertent doping. Due to the paucity of data on supplement use, this study aimed to determine the proportion of Ugandan athletes using nutritional supplements and to investigate the athletes' motivation to use these supplements. A cross-sectional study was conducted in which an interviewer-administered questionnaire was used to collect data from 359 professional athletes participating in individual (boxing, cycling, athletics) and team (basketball, rugby, football, netball, and volleyball) sports. The data were categorized, and a Chi-square test was used for statistical analysis. Of the 359 athletes, 48 (13.4%) used nutritional supplements. Carbohydrate supplements, energy drinks, vitamin and mineral supplements, fish oils, and protein supplements were the most common supplements used by athletes. NS use was significantly more common among athletes who played rugby and basketball ( X 2 = 61.101, p < 0.0001), athletes who had played the sport for 5-10 years ( X 2 = 7.460, p = 0.024), and athletes who had attained a tertiary education ( X 2 = 33.377, p < 0.0001). The athletes' occupation had no bearing on whether they used supplements. Nutritionists/dieticians, retail stores and pharmacies were the most common sources of NS products, whereas health practitioners, online media and teammates were the most common sources of information regarding NS. Most athletes used NS to improve their physical performance and health. Compared to NS use by athletes elsewhere, NS use among Ugandan athletes was low. However, determinants of athlete NS use in the current study (category of sport and duration of time spent playing the sport) are similar to those reported elsewhere.

  10. On the Limits of Sexual Health Literacy: Insights from Ugandan Schoolgirls

    ERIC Educational Resources Information Center

    Jones, Shelley; Norton, Bonny

    2007-01-01

    This article makes the case that current conceptions of sexual health literacy have limited relevance to the Ugandan context because they assume that knowledge of unsafe sexual practices will lead to changes in behavior and lifestyle. Drawing on a longitudinal case study with 15 Ugandan schoolgirls in rural Uganda from August 2004 to September…

  11. Hospital discharge summary scorecard: a quality improvement tool used in a tertiary hospital general medicine service.

    PubMed

    Singh, G; Harvey, R; Dyne, A; Said, A; Scott, I

    2015-12-01

    We assessed the impact of completion and feedback of discharge summary scorecards on the quality of discharge summaries written by interns in a general medicine service of a tertiary hospital. The scorecards significantly improved summary quality in the first three rotations of the intern year and could be readily adopted by other units as a quality improvement intervention for optimizing clinical handover to primary care providers. © 2015 Royal Australasian College of Physicians.

  12. Factors contributing to nursing team work in an acute care tertiary hospital.

    PubMed

    Polis, Suzanne; Higgs, Megan; Manning, Vicki; Netto, Gayle; Fernandez, Ritin

    Effective nursing teamwork is an essential component of quality health care and patient safety. Understanding which factors foster team work ensures teamwork qualities are cultivated and sustained. This study aims to investigate which factors are associated with team work in an Australian acute care tertiary hospital across all inpatient and outpatient settings. All nurses and midwives rostered to inpatient and outpatient wards in an acute care 600 bed hospital in Sydney Australia were invited to participate in a cross sectional survey between September to October 2013. Data were collected, collated, checked and analysed using Statistical Package for the Social Sciences (SPSS) Version 21. Factors reporting a significant correlation with where p < 0.05 were analysed in a multiple regression model. A total of 501 surveys were returned. Nursing teamwork scores ranged between 3.32 and 4.08. Teamwork subscale Shared Mental Model consistently rated the highest. Mean scores for overall communication between nurses and team leadership were 3.6 (S.D. 0.57) and 3.8 (SD 0.6) respectively. Leadership and communication between nurses were significant predictors of team work p < 0.001. Our findings describe factors predictive of teamwork in an acute care tertiary based hospital setting across inpatient and outpatient specialty units. Our findings are of particular relevance in identifying areas of nurse education and workforce planning to improve nursing team work.

  13. Pylephlebitis: incidence and prognosis in a tertiary hospital.

    PubMed

    Belhassen-García, Moncef; Gomez-Munuera, Mercedes; Pardo-Lledias, Javier; Velasco-Tirado, Virginia; Perez-Persona, Ernesto; Galindo-Perez, Inmaculada; Alvela-Suárez, Lucia; Romero-Alegría, Angela; Muñoz-Bellvis, Luis; Cordero-Sánchez, Miguel

    2014-01-01

    Septic thrombophlebitis of the portal vein or its branches, most often secondary to intra-abdominal infection is known as pylephlebitis. The frequency and the prognosis of this complication are unknown. The aim of this study was to determine the global and relative incidence of the most frequent intra-abdominal infections and the real prognosis of this disease. An observational retrospective study was conducted in a tertiary care hospital (University Hospital of Salamanca, Spain) from January 1999 to December 2008. A total of 7796 patients with intra-abdominal infection were evaluated, of whom 13 (0.6%) had been diagnosed with pylephlebitis. Diverticulitis was the most frequent underlying process, followed by biliary infection. Early mortality was 23%. Survivors had no recurrences, but one of them developed portal cavernomatosis. Pylephlebitis is a rare complication of intra-abdominal infection, with a high early mortality, but with a good prognosis for survivors. Copyright © 2013 Elsevier España, S.L. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  14. Characteristics of Infective Endocarditis in a Tertiary Hospital in East China.

    PubMed

    Xu, Huimin; Cai, Siyu; Dai, Haibin

    2016-01-01

    The epidemiology, clinical presentation, and treatment of infective endocarditis (IE) has significantly changed over the past few years in developed countries. However, relevant data from developing countries are different and remain scarce. The objective of this study was to evaluate the clinical presentations, treatment and outcomes of IE patients in a tertiary hospital in East China over an 8-year period. This was a retrospective observational study of consecutive cases of definite or possible IE as per the modified Duke criteria between January 2008 and December 2015. A total of 135 definite and 39 probable IE cases were identified. The mean age was 47.8 ± 15.7 years, with a male preponderance (1.9: 1). Degenerative valve disease accounted for 30.5% cases of IE, followed by congenital heart disease (29.9%) and rheumatic heart disease (14.9%). Native cardiac valves were present in 93.7% of the IE patients. Echocardiography and blood culture were performed in all patients, of whom 55.2% were found to have large vegetations (≥10 mm) and the positive rate of blood culture was 60.3%. Streptococcus remained the chief causative agent that was identified in 61.9% of culture-positive patients. Glycopeptide antibacterials and cephalosporins were the most frequently used antimicrobial drugs for IE therapy. Seventy-six (43.7%) of the IE patients were surgically treated. The mortality rate during hospital stay was 10.9%. Our data reflected clinical and microbiological profile, and treatment of IE in a tertiary hospital located in the East China.

  15. Characteristics of Infective Endocarditis in a Tertiary Hospital in East China

    PubMed Central

    Xu, Huimin; Cai, Siyu

    2016-01-01

    The epidemiology, clinical presentation, and treatment of infective endocarditis (IE) has significantly changed over the past few years in developed countries. However, relevant data from developing countries are different and remain scarce. The objective of this study was to evaluate the clinical presentations, treatment and outcomes of IE patients in a tertiary hospital in East China over an 8-year period. This was a retrospective observational study of consecutive cases of definite or possible IE as per the modified Duke criteria between January 2008 and December 2015. A total of 135 definite and 39 probable IE cases were identified. The mean age was 47.8 ± 15.7 years, with a male preponderance (1.9: 1). Degenerative valve disease accounted for 30.5% cases of IE, followed by congenital heart disease (29.9%) and rheumatic heart disease (14.9%). Native cardiac valves were present in 93.7% of the IE patients. Echocardiography and blood culture were performed in all patients, of whom 55.2% were found to have large vegetations (≥10 mm) and the positive rate of blood culture was 60.3%. Streptococcus remained the chief causative agent that was identified in 61.9% of culture-positive patients. Glycopeptide antibacterials and cephalosporins were the most frequently used antimicrobial drugs for IE therapy. Seventy-six (43.7%) of the IE patients were surgically treated. The mortality rate during hospital stay was 10.9%. Our data reflected clinical and microbiological profile, and treatment of IE in a tertiary hospital located in the East China. PMID:27861628

  16. Disease patterns and clinical outcomes of patients admitted in intensive care units of tertiary referral hospitals of Tanzania.

    PubMed

    Sawe, Hendry R; Mfinanga, Juma A; Lidenge, Salum J; Mpondo, Boniventura C T; Msangi, Silas; Lugazia, Edwin; Mwafongo, Victor; Runyon, Michael S; Reynolds, Teri A

    2014-09-23

    In sub-Saharan Africa the availability of intensive care unit (ICU) services is limited by a variety of factors, including lack of financial resources, lack of available technology and well-trained staff. Tanzania has four main referral hospitals, located in zones so as to serve as tertiary level referral centers. All the referral hospitals have some ICU services, operating at varying levels of equipment and qualified staff. We analyzed and describe the disease patterns and clinical outcomes of patients admitted in ICUs of the tertiary referral hospitals of Tanzania. This was a retrospective analysis of ICU patient records, for three years (2009 to 2011) from all tertiary referral hospitals of Tanzania, namely Muhimbili National Hospital (MNH), Kilimanjaro Christian Medical Centre (KCMC), Mbeya Referral Hospital (MRH) and Bugando Medical Centre (BMC). MNH is the largest of the four referral hospitals with 1300 beds, and MRH is the smallest with 480 beds. The ratio of hospital beds to ICU beds is 217:1 at MNH, 54:1 at BMC, 39:1 at KCMC, and 80:1 at MRH. KCMC had no infusion pumps. None of the ICUs had a point-of-care (POC) arterial blood gas (ABG) analyzer. None of the ICUs had an Intensive Care specialist or a nutritionist. A masters-trained critical care nurse was available only at MNH. From 2009-2011, the total number of patients admitted to the four ICUs was 5627, male to female ratio 1.4:1, median age of 34 years. Overall, Trauma (22.2%) was the main disease category followed by infectious disease (19.7%). Intracranial injury (12.5%) was the leading diagnosis in all age groups, while pneumonia (11.7%) was the leading diagnosis in pediatric patients (<18 years). Patients with tetanus (2.4%) had the longest median length ICU stay: 8 (5,13) days. The overall in-ICU mortality rate was 41.4%. The ICUs in tertiary referral hospitals of Tanzania are severely limited in infrastructure, personnel, and resources, making it difficult or impossible to provide optimum care

  17. Evaluation of nutritional care of hospitalized children in a tertiary pediatric hospital.

    PubMed

    De Longueville, Caroline; Robert, Martine; Debande, Marjorie; Podlubnai, Sylviane; Defourny, Sophie; Namane, Sid-Ali; Pace, Aude; Brans, Camille; Cayrol, Elodie; Goyens, Philippe; De Laet, Corinne

    2018-06-01

    Hospitalized children are at risk of malnutrition. The aim of the present study was to evaluate a clinical practice in a tertiary hospital. The nutritional team developed a specific software for screening of malnutrition and risk of malnutrition (Evalnut) that provides also recommendations for the nutritional management of the patient. The data recorded into this program and the tool itself were analyzed and optimizations are highlighted. A retrospective study analyzed the data collected in 2015 during 4931 consecutive hospitalizations (3984 children) at the University Children's Hospital Queen Fabiola. Pivot tables analysis (Excel) of the database of the screening tool was compared with the clinical practice of the dietitians. First data processing excluded records with abnormal or missing values. Impact of nutritional care analysis needs at least 2 evaluations and a positive patient's height trend. In case of height equality, only length of hospital stays less than 2 weeks were kept. This study highlighted inaccurate database records related to imperfections of the computer program, missing or erroneous measures and incomplete encoding. First analysis on 3219 valid hospitalizations showed statistical correlations. Prevalence of malnutrition on admission was 33%, split into 14,5% acute malnutrition, 15% chronic malnutrition and 3,5% mixed malnutrition. Overall, 30,3% of the children were categorized at risk of developing malnutrition during their stay. Positive impact of nutritional management on the resulting nutritional status was demonstrated on the second data selection (352 hospitalizations): WFH median (interquartile range) increased from 96,1% (87,1-106,4) on admission to 96,9% (89,1-106,1) (p < 0,01) on discharge. An optimization of the existing software was finally proposed. In our hospital, the dietitians are the most aware on the importance of nutritional assessment and management during hospitalization. Encouraging results are obtained. Inclusion of

  18. Descriptive Analysis on the Impacts of Universal Zero-Markup Drug Policy on a Chinese Urban Tertiary Hospital

    PubMed Central

    Yang, Dong

    2016-01-01

    Background Universal Zero-Markup Drug Policy (UZMDP) mandates no price mark-ups on any drug dispensed by a healthcare institution, and covers the medicines not included in the China’s National Essential Medicine System. Five tertiary hospitals in Beijing, China implemented UZMDP in 2012. Its impacts on these hospitals are unknown. We described the effects of UZMDP on a participating hospital, Jishuitan Hospital, Beijing, China (JST). Methods This retrospective longitudinal study examined the hospital-level data of JST and city-level data of tertiary hospitals of Beijing, China (BJT) 2009–2015. Rank-sum tests and join-point regression analyses were used to assess absolute changes and differences in trends, respectively. Results In absolute terms, after the UZDMP implementation, there were increased annual patient-visits and decreased ratios of medicine-to-healthcare-charges (RMOH) in JST outpatient and inpatient services; however, in outpatient service, physician work-days decreased and physician-workload and inflation-adjusted per-visit healthcare charges increased, while the inpatient physician work-days increased and inpatient mortality-rate reduced. Interestingly, the decreasing trend in inpatient mortality-rate was neutralized after UZDMP implementation. Compared with BJT and under influence of UZDMP, JST outpatient and inpatient services both had increasing trends in annual patient-visits (annual percentage changes[APC] = 8.1% and 6.5%, respectively) and decreasing trends in RMOH (APC = -4.3% and -5.4%, respectively), while JST outpatient services had increasing trend in inflation-adjusted per-visit healthcare charges (APC = 3.4%) and JST inpatient service had decreasing trend in inflation-adjusted per-visit medicine-charges (APC = -5.2%). Conclusion Implementation of UZMDP seems to increase annual patient-visits, reduce RMOH and have different impacts on outpatient and inpatient services in a Chinese urban tertiary hospital. PMID:27627811

  19. Descriptive Analysis on the Impacts of Universal Zero-Markup Drug Policy on a Chinese Urban Tertiary Hospital.

    PubMed

    Tian, Wei; Yuan, Jiangfan; Yang, Dong; Zhang, Lanjing

    2016-01-01

    Universal Zero-Markup Drug Policy (UZMDP) mandates no price mark-ups on any drug dispensed by a healthcare institution, and covers the medicines not included in the China's National Essential Medicine System. Five tertiary hospitals in Beijing, China implemented UZMDP in 2012. Its impacts on these hospitals are unknown. We described the effects of UZMDP on a participating hospital, Jishuitan Hospital, Beijing, China (JST). This retrospective longitudinal study examined the hospital-level data of JST and city-level data of tertiary hospitals of Beijing, China (BJT) 2009-2015. Rank-sum tests and join-point regression analyses were used to assess absolute changes and differences in trends, respectively. In absolute terms, after the UZDMP implementation, there were increased annual patient-visits and decreased ratios of medicine-to-healthcare-charges (RMOH) in JST outpatient and inpatient services; however, in outpatient service, physician work-days decreased and physician-workload and inflation-adjusted per-visit healthcare charges increased, while the inpatient physician work-days increased and inpatient mortality-rate reduced. Interestingly, the decreasing trend in inpatient mortality-rate was neutralized after UZDMP implementation. Compared with BJT and under influence of UZDMP, JST outpatient and inpatient services both had increasing trends in annual patient-visits (annual percentage changes[APC] = 8.1% and 6.5%, respectively) and decreasing trends in RMOH (APC = -4.3% and -5.4%, respectively), while JST outpatient services had increasing trend in inflation-adjusted per-visit healthcare charges (APC = 3.4%) and JST inpatient service had decreasing trend in inflation-adjusted per-visit medicine-charges (APC = -5.2%). Implementation of UZMDP seems to increase annual patient-visits, reduce RMOH and have different impacts on outpatient and inpatient services in a Chinese urban tertiary hospital.

  20. [Experience of the surgical management of the esophageal achalasia in a tertiary care hospital].

    PubMed

    Barajas-Fregoso, Elpidio Manuel; Romero-Hernández, Teodoro; Sánchez-Fernández, Patricio Rogelio; Fuentes-Orozco, Clotilde; González-Ojeda, Alejandro; Macías-Amezcua, Michel Dassaejv

    2015-01-01

    Achalasia is a primary esophageal motor disorder. The most common symptoms are: dysphagia, chest pain, reflux and weight loss. The esophageal manometry is the standard for diagnosis. The aim of this paper is to determine the effectiveness of the surgical management in patients with achalasia in a tertiary care hospital. A case series consisting of achalasia patients, treated surgically between January and December of 2011. Clinical charts were reviewed to obtain data and registries of the type of surgical procedure, morbidity and mortality. Fourteen patients were identified, with an average age of 49.1 years. The most common symptoms were: dysphagia, vomiting, weight loss and pyrosis. Eight open approaches were performed and six by laparoscopy, with an average length of cardiomyotomy of 9.4 cm. Eleven patients received an antireflux procedure. The effectiveness of procedures performed was 85.7 %. Surgical management offered at this tertiary care hospital does not differ from that reported in other case series, giving effectiveness and safety for patients with achalasia.

  1. Patients' assessment of quality of care in public tertiary hospitals with and without accreditation: comparative cross-sectional study.

    PubMed

    Aboshaiqah, Ahmad E; Alonazi, Wadi B; Patalagsa, Joel Gonzales

    2016-11-01

    To compare patients' assessment of quality of care provided by public tertiary hospitals grouped according to accreditation status. Healthcare institutions worldwide are increasingly adopting accreditation as continuing initiative aimed at improving structures, processes and outcomes associated with quality of care. Patients being recipients of health care need to participate in assessing the quality of care they experienced while confined for therapeutic management. Comparative, cross-sectional. Data were collected from patients confined in public tertiary hospitals (n = 517 in four with accreditation and n = 542 in four without accreditation) in Riyadh, Saudi Arabia between February 2011-June 2011. Patients rated key performance indicators grouped under the dimensions of structure, process and outcome. Mann-Whitney U-test, Spearman Correlation Coefficient and coefficient of determination were used in analysing data. Patients in accredited public tertiary hospitals perceived structure, outcome and overall quality of care statistically higher than patients in non-accredited hospitals. No statistical differences were found in process (access and communication) indicators. Accreditation status is marginally associated with structure; outcome; and overall quality of care. The proportion of variance in the ranks of accreditation status explained the proportion of variance in the ranks of structure; outcome; and overall quality of care. The results apparently showed better structure, outcome and overall quality of care in accredited hospitals. Accreditation's association in the overall quality of care apparently remained unclear. Further studies are needed to appreciate the contribution of accreditation. © 2016 John Wiley & Sons Ltd.

  2. Causes of prolonged hospitalization among general internal medicine patients of a tertiary care center.

    PubMed

    Ruangkriengsin, Darat; Phisalprapa, Pochamana

    2014-03-01

    Unnecessary days of prolonged hospitalization may lead to the increase in hospital-related complications and costs, especially in tertiary care center Currently, there have not been many studies about the causes of prolonged hospitalization. Some identified causes could, however, be prevented and improved. To identify the prevalence, causes, predictive factors, prognosis, and economic burden of prolonged hospitalization in patients who had been in general internal medicine wards of the tertiary care center for 7 days or more. Retrospective chart review study was conducted among all patients who were admitted for 7 days or more in general internal medicine wards of Siriraj Hospital, the largest tertiary care center in Thailand. The period of this study was from 1 August 2012 to 30 September 2012. Demographic data, principle diagnosis, comorbid diseases, complications, discharge status, total costs of admission and percentage of reimbursement were collected. The causes of prolonged hospitalization at day 7, 14, 30, and 90 were assessed. Five hundred and sixty-two charts were reviewed. The average length of stay was 25.9 days. The two most common causes of prolonged admission at day 7 were treatment of main diagnosed disease with stable condition (27.6%) and waiting for completion of intravenous antibiotics administration with stable condition (19.5%). The causes of prolonged hospitalization at day 14 were unstable condition from complications (22.6%) and those waiting for completion of intravenous antibiotics administration with stable condition (15.8%). The causes of prolonged admission at day 30 were unstable conditions from complications (25.6%), difficulty weaning or ventilator dependence (17.6%), and caregiver problems (15.2%). The causes of prolonged hospitalization at day 90 were unstable condition from complications (30.0%), caregiver problems (30.0%), and palliative care (25.0%). Poor outcomes were shown in the patients admitted more than 90 days. Percentage

  3. Healthcare associated infections in Paediatric Intensive Care Unit of a tertiary care hospital in India: Hospital stay & extra costs.

    PubMed

    Sodhi, Jitender; Satpathy, Sidhartha; Sharma, D K; Lodha, Rakesh; Kapil, Arti; Wadhwa, Nitya; Gupta, Shakti Kumar

    2016-04-01

    Healthcare associated infections (HAIs) increase the length of stay in the hospital and consequently costs as reported from studies done in developed countries. The current study was undertaken to evaluate the impact of HAIs on length of stay and costs of health care in children admitted to Paediatric Intensive Care Unit (PICU) of a tertiary care hospital in north India. This prospective study was done in the seven bedded PICU of a large multi-specialty tertiary care hospital in New Delhi, India. A total of 20 children with HAI (cases) and 35 children without HAI (controls), admitted to the PICU during the study period (January 2012 to June 2012), were matched for gender, age, and average severity of illness score. Each patient's length of stay was obtained prospectively. Costs of healthcare were estimated according to traditional and time driven activity based costing methods approach. The median extra length of PICU stay for children with HAI (cases), compared with children with no HAI (controls), was seven days (IQR 3-16). The mean total costs of patients with and without HAI were ' 2,04,787 (US$ 3,413) and ' 56,587 (US$ 943), respectively and the mean difference in the total cost between cases and controls was ' 1,48,200 (95% CI 55,716 to 2,40,685, p<0.01). This study highlights the effect of HAI on costs for PICU patients, especially costs due to prolongation of hospital stay, and suggests the need to develop effective strategies for prevention of HAI to reduce costs of health care.

  4. Gestational Trophoblastic Disease - Clinicopathological Study at Tertiary Care Hospital

    PubMed Central

    Aher, Vidhya; Gadhiya, Suchi; Jagtap, Swati Sunil

    2017-01-01

    Introduction Gestational Trophoblastic Disease (GTD) is a term used for a group of pregnancy-related tumours. These consist of various tumours and tumour like lesions characterized by proliferation of trophoblastic tissue. Amongst GTD, hydatidiform moles are the most common form. These lesions sometimes may develop into invasive moles, or, in rare cases, into choriocarcinoma. Aim To study the clinicopathologic characteristics and prevalence of different forms of gestational trophoblastic disease in a tertiary care hospital. Materials and Methods The present study was descriptive, observational, analytical type done in Department of Pathology at tertiary care hospital from May 2012 to April 2016. All cases clinically suspected of GTD were included and confirmation was done by histopathological study on H&E stained slides. The cases of GTD were classified according to WHO classification. Detailed histomorphological features and beta human Chorionic Gonadotropin (hCG) levels were correlated. Results During study period, 18345 deliveries were reported; out of which 77 cases were diagnosed as GTD. Almost 97.40% cases were of hydatidiform moles, 1.30% cases of choriocarcinoma and 1.30% cases of Placental Site Trophoblastic Tumour (PSTT). Among the cases of hydatidiform mole 57.34% were complete mole and 41.33% cases were of partial mole. The common clinical presentation was per vaginal bleeding and amenorrhea. The blood group A was most commonly observed in patient (49.35%). In majority of cases beta hCG levels were between 50,000 to 100000 mIU/ml. The correlation between beta hCG level and GTD were done. Conclusion Pregnant females clinically presenting with abnormal vaginal bleeding must be evaluated for GTD. Histopathological examination is helpful for confirmatory diagnosis. Follow up of such patients is essential for early detection of malignant trophoblastic tumours. PMID:28969138

  5. [Status of subjective well-being for medical staff in a tertiary hospital].

    PubMed

    Deng, Yunlong; Liu, Yan; Xu, Shaorong; Zhao, Min; Li, Junping; Xiong, Yan

    2016-06-28

    To investigate the status of subjective well-being (SWB) for medical staffs who contact with patients directly in a tertiary hospital.
 Staffs from a tertiary hospital in Hunan province were investigated the SWB Scale (SWBS-cc20) from 2012 to 2014.
 The scores of SWB for medical staffs are high (81.67±12.33). Among the 10 sub-dimensions of SWB, medical staffs performed the best in family atmosphere, personal growth, and interpersonal adaptation, while performed the worst in physical health, mental health and material contentment. Title, job nature, education and occupation significantly affected the status of SWB. Staffs who directly connected with patients have less scores of SWB than those who do not (t=-4.80, P<0.001). Moreover, they perform better in contentment (OR=0.079, 95% CI 1.278 to 2.214, P<0.001), but worse in mental health (OR=1.315, 95% CI 1.023 to 1.690, P<0.05) and physical health (OR=1.313, 95% CI 1.029 to 1.677, P<0.05).
 Medical staffs have high scores of SWB. Staffs who directly connected with patients have less scores of SWB than those who do not. Moreover, they perform better in contentment, but worse in mental health and physical health.

  6. Reverse transport of children from a tertiary pediatric hospital.

    PubMed

    McPherson, Mona L; Jefferson, Larry S; Smith, E O'Brian; Sitler, Garry C; Graf, Jeanine M

    2007-01-01

    The purpose of this study was to determine the epidemiology and resources used and to study the potential savings of pediatric reverse transport patients. A case control study was performed with patients undergoing a reverse or outbound transport from a large, pediatric hospital. Twenty-five children undergoing reverse transport were compared with matched controls. Lengths of stay and costs were compared between the reverse transport and matched control patients. Fifty-two percent of the reverse transport patients returned home, whereas 32% went home for end-of-life care and 16% went to other facilities. The average reverse transport was more than 400 miles and cost $6,064. The reverse transport of these patients did not save pediatric intensive care unit (PICU) days but did result in a shorter hospital stay compared with the matched controls (10 vs. 19 days, P = .03). Decreased utilization of bed days came from less use of intermediate care unit resources. Pediatric patients undergo reverse transports for a variety of reasons, often for end-of-life care. The ability to reverse transport pediatric patients may not save PICU bed days but may offer pediatric tertiary care hospitals a means to provide more intermediate care bed availability.

  7. The economic effect of a tertiary hospital-based heart failure program.

    PubMed

    Gregory, Douglas; DeNofrio, David; Konstam, Marvin A

    2005-08-16

    This study was designed to determine the economic effect of a tertiary heart failure (HF) program at an academic medical center. Most hospitals use cross-sectional financial models to analyze the economic contribution of clinical programs for a budget period. We estimated the incremental value of a tertiary hospital HF program on the basis of the longitudinal utilization of a sample of HF patients. The primary data source was a sample of 82 HF patients referred for cardiac transplant evaluation at an academic medical center during calendar years 2000 to 2001. Cumulative recurrent rates of utilization, cost, and reimbursement for hospital services were computed as functions of time using reliability models. The economic contribution of patients transplanted was contrasted with those not transplanted. Mean hospitalizations and outpatient encounters per patient at the end of the first year of follow-up for those transplanted were 2.1 (95% confidence interval [CI] 1.6 to 2.7) and 11.9 (95% CI 9.2 to 15.4), compared with 1.1 (95% CI 0.8 to 1.6) and 6.0 (95% CI 4.8 to 7.6), respectively, for those not transplanted. Mean revenue and direct cost per patient were 194,470 dollars (95% CI 136,683 dollars to 276,689 dollars) and 146,623 dollars (95% CI 96,377 dollars to 233,065 dollars), respectively, for transplanted patients and 43,587 dollars (95% CI 28,149 dollars to 67,503 dollars) and 33,424 dollars (95% CI 21,584 dollars to 51,760 dollars), respectively, for non-transplanted patients. The point estimates of first-year contribution margins per patient for transplanted and non-transplanted patients were 47,847 dollars and 10,163 dollars, respectively. Newly evaluated patients for cardiac transplantation at an academic medical center generated substantial incident demands for inpatient and outpatient services over a two-year follow-up period. The estimated contribution margin associated with these services was positive. Hospitals without cardiac transplantation that serve

  8. Clinicians and their cameras: policy, ethics and practice in an Australian tertiary hospital.

    PubMed

    Burns, Kara; Belton, Suzanne

    2013-09-01

    Medical photography illustrates what people would prefer to keep private, is practiced when people are vulnerable, and has the power to freeze a moment in time. Given it is a sensitive area of health, lawful and ethical practice is paramount. This paper recognises and seeks to clarify the possibility of widespread clinician-taken medical photography in a tertiary hospital in northern Australia, examining the legal and ethical implications of this practice. A framework of Northern Territory law, state Department of Health policy and human rights theory were used to argue the thesis. Clinicians from 13 purposively chosen wards were asked to participate in an anonymous survey and confidential in-depth interviews. Questions were generated from the literature and local knowledge on the topics of 'occurrence', 'image use', 'quality of consent', 'cameras and technology', 'confidentiality', 'data storage and security', 'hospital policy and law' and 'cultural issues'. One hundred and seventy surveys and eights interviews were analysed using descriptive statistics and theme and content analysis, then triangulated for similarity, difference and unique responses. Forty-eight percent of clinicians surveyed take medical photographs, with the majority using hospital-owned cameras. However, one-fifth of clinicians reported photographing with personal mobile phones. Non-compliance with written consent requirements articulated in policy was endemic, with most clinicians surveyed obtaining only verbal consent. Labeling, storage, copyright and cultural issues were generally misunderstood, with a significant number of clinicians risking the security of patient information by storing images on personal devices. If this tertiary hospital does not develop a clinical photography action plan to address staff lack of knowledge, and noncompliance with policy and mobile phone use, patients' data is at risk of being distributed into the public domain where unauthorised publication may cause

  9. Resistance patterns of multidrug resistant Acinetobacter baumannii in an ICU of a tertiary care hospital, Malaysia

    PubMed Central

    Janahiraman, Sivakami; Aziz, Muhammad Nazri; Hoo, Fan Kee; P’ng, Hon Shen; Boo, Yang Liang; Ramachandran, Vasudevan; Shamsuddin, Ahmad Fuad

    2015-01-01

    Backgrounds & Objective: Antimicrobial resistance is a major health problem worldwide in hospitals. The main contributing factors are exposures to broad-spectrum antimicrobials and cross-infections. Understanding the extent and type of antimicrobial use in tertiary care hospitals will aid in developing national antimicrobial stewardship priorities. Methods: In this study, we have analyzed the antimicrobial agents’ usage for acquisition of multidrug resistant using retrospective, cross-sectional, single-centre study in a multidisciplinary ICU at tertiary care hospital. Results: Acinetobacter baumannii (ACB) was isolated in various specimens from 662 patients. From these, 136 patients who were diagnosed with Ventilator-associated pneumonia (VAP) caused by ACB were included into the study. In our study, MDR strain accounts for 51% of all VAP cases caused by ACB. The development of ACB VAP were 10.5 + 6.4 days for MDR strains compared to susceptible organism (7.8 + 4.5 days) and had significantly longer ICU stay. Conclusion: The study concludes that prudent use of antimicrobial agents is important to reduce acquisition of MDR ACB. PMID:26870101

  10. Profile of infective endocarditis at a tertiary-care hospital in Japan over a 14-year period: characteristics, outcome and predictors for in-hospital mortality.

    PubMed

    Hase, Ryota; Otsuka, Yoshihito; Yoshida, Kazuki; Hosokawa, Naoto

    2015-04-01

    The aims of this study were to describe the epidemiological features and clinical characteristics of infective endocarditis (IE) at a tertiary-care hospital in Japan and to identify the factors associated with in-hospital mortality. A retrospective observational study was conducted at a 925-bed tertiary-care teaching hospital in Japan. All adult patients diagnosed with definite IE between August 2000 and July 2014 according to the modified Duke criteria were included. A total of 180 patients (60.6% men; mean age, 69.1 years) with definite IE were included. The most common pathogen was Staphylococcus aureus (27.2%). Nine patients (5.0%) had culture-negative IE. Transthoracic and transoesophageal echocardiography were performed in 180 (100%) and 132 patients (73.3%), respectively, and vegetations were detected in 128 patients (71.1%). Surgical therapy was performed in 31 patients (17.2%). Overall, the in-hospital mortality rate was 26.1%. The independent predictors of in-hospital mortality were methicillin-resistant S. aureus (MRSA), vascular phenomena, health care-associated IE and heart failure. MRSA, vascular phenomena, health care-associated IE and heart failure were independent predictors of in-hospital mortality. The unique characteristics in our cohort were the very high mean age, low rate of culture-negative IE, high rate of definite IE without detected vegetations and predominance of S. aureus. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Knowledge, attitude and practice of standard precautions of infection control by hospital workers in two tertiary hospitals in Nigeria

    PubMed Central

    Pondei, Kemebradikumo; Adetunji, Babatunde; Chima, George; Isichei, Christian; Gidado, Sanusi

    2015-01-01

    Background: Standard precautions are recommended to prevent transmission of infection in hospitals. However, their implementation is dependent on the knowledge and attitudes of healthcare workers (HCW). This study describes the knowledge, attitude and practice (KAP) of standard precautions of infection control among HCW of two tertiary hospitals in Nigeria is described. Methods: A cross-sectional study was undertaken in 2011/2012 among HCW in two tertiary hospitals in Nigeria. Data was collected via a structured self-administered questionnaire assessing core elements of KAP of standard precautions. Percentage KAP scores were calculated and professional differences in median percentage KAP scores were ascertained. Results: A total of 290 HCW participated in the study (76% response rate), including 111 (38.3%) doctors, 147 (50.7%) nurses and 32 (11%) laboratory scientists. Overall median knowledge and attitude scores toward standard precautions were above 90%, but median practice score was 50.8%. The majority of the HCW had poor knowledge of injection safety and complained of inadequate resources to practise standard precautions. House officers, laboratory scientists and junior cadres of nurses had lower knowledge and compliance with standard precautions than more experienced doctors and nurses. Conclusion: Our results suggest generally poor compliance with standard precautions of infection control among HCW in Nigeria. Policies that foster training of HCW in standard precautions and guarantee regular provision of infection control and prevention resources in health facilities are required in Nigeria. PMID:28989394

  12. [Governance of tertiary referral hospitals in the Democratic Republic of the Congo: a critical interpretive synthesis of the literature].

    PubMed

    Karemere, H; Kahindo, J B; Ribesse, N; Macq, J

    2013-01-01

    Because hospitals are complex enterprises requiring adaptive systems, it is appropriate to apply the theory and terminology of governance or even better adaptive governance to the interpretation of their management. This study focused on understanding hospital governance in Logo, Bunia, and Katana, three hospitals in two regions of the eastern DRC, which has been characterized by intermittent armed conflict since 1996. In such a context of war and continuous insecurity, how can governance be interpreted for hospitals required to adapt to a constantly changing environment to be able to continue to provide health care? A critical interpretive synthesis of the literature, identified by searching for keywords related to governance. The concepts of governance, adaptive governance, performance, leadership, and complex adaptive system concepts are defined. The interpretation of the concepts helps us to better understand (1) the hospital as a complex adaptive system, (2) the governance of tertiary referral hospitals, (3) analysis of hospital performance, and (4) leadership for good governance of these hospitals. The interpretation of these concepts raises several questions about their application to the eastern DRC. Conclusion. This critical interpretive synthesis opens the door to a new way of exploring tertiary hospitals and their governance in the eastern DRC.

  13. Six-month outcome in patients with myocardial infarction initially admitted to tertiary and nontertiary hospitals. RESCATE Investigators. Recursos Empleados en el Síndrome Coronario Agudo y Tiempos de Espera.

    PubMed

    Marrugat, J; Sanz, G; Masiá, R; Valle, V; Molina, L; Cardona, M; Sala, J; Serés, L; Szescielinski, L; Albert, X; Lupón, J; Alonso, J

    1997-11-01

    The aim of the present study was to ascertain whether the degree of accessibility to coronary angiography and revascularization results in differing usages or outcomes, or both, in the setting of a high coverage national health system. The selective use of coronary angiography and revascularization procedures in the management of acute myocardial infarction (MI) remains controversial. A cohort of 1,460 consecutive patients with a first MI admitted to four referral teaching hospitals (one with tertiary facilities) were followed up for 6 months after admission. Only patients initially admitted to each of the study hospitals were retained for analysis in the original hospital's cohort. End points were 6-month mortality and readmission for reinfarction, unstable angina, heart failure or severe ventricular arrhythmia. Patients admitted to the tertiary hospital were more likely to undergo coronary angiography (adjusted relative risk 4.22, 95% confidence interval [CI] 3.37 to 5.45) than those admitted to the nontertiary sites (use rate: 22.1% for nontertiary care, 55.5% for tertiary care). Revascularization procedures were performed in 21.2% of patients in the tertiary hospital and in 8.3% in the nontertiary hospitals (p < 0.0001). Median delay for emergency coronary angiography was shorter in the tertiary hospital (within 1 vs. 2 days, p < 0.0001). Six-month mortality or readmission rates were similar (23.7% and 24.7% for tertiary and nontertiary care, respectively). After adjustment for comorbidity and disease severity, the relative risk of death or readmission for the tertiary hospital was 1.03 (95% CI 0.69 to 1.53) times that of the nontertiary hospitals. Selective use of coronary angiography and revascularization procedures may be as effective as less restricted use in the management of acute MI.

  14. Evaluation of health literacy status among patients in a tertiary care hospital in coastal karnataka, India.

    PubMed

    U P, Rathnakar; Belman, Madhuri; Kamath, Ashwin; B, Unnikrishnan; Shenoy K, Ashok; A L, Udupa

    2013-11-01

    People with limited health literacy are more likely to make medication errors, and they have less health knowledge, worse health status, more hospitalizations, and higher healthcare costs than people with adequate literacy. The objective of this study is to assess the health literacy status among patients who are able to read and understand English attending a tertiary care hospital by using Rapid Estimate of Adult Literacy in Medicine [REALM] technique and to compare the health literacy levels to educational status and other baseline characteristics. A widely used word recognition method [REALM] was used to assess the HL status of 200 patients attending a tertiary care hospital in Southern India. The number of correctly pronounced words was used to assign a grade-equivalent reading level. Scores 0 to 44 indicate reading skills at or below the 6th grade level, scores from 45 to 60 represent skills at the 7th or 8th grade level, and scores above 60 indicate skills at the high-school level or higher. HL status was found below adequate level in more than 50% of the patients. Younger age group showed better HL scores compared to those aged more than 25 years. General education level or the medium of education does not truly reflect HL levels as brought out in the study. Even those with postgraduate qualification had poor HL skills. The study was carried out to find out the HL levels among patients attending a tertiary care hospital. It was assumed that the general education levels may not reflect true HL status. In view of the results of this study it can be concluded that patient's HL skills should not be taken for granted and adequate attention should be paid in educating and briefing patients whenever patients are required to interpret and understand health care related documents.

  15. Abusive Head Trauma at a Tertiary Care Children's Hospital in Mexico City. A Preliminary Study

    ERIC Educational Resources Information Center

    Diaz-Olavarrieta, Claudia; Garcia-Pina, Corina A.; Loredo-Abdala, Arturo; Paz, Francisco; Garcia, Sandra G.; Schilmann, Astrid

    2011-01-01

    Objectives: Determine the prevalence, clinical signs and symptoms, and demographic and family characteristics of children attending a tertiary care hospital in Mexico City, Mexico, to illustrate the characteristics of abusive head trauma among this population. Methods: This is a cross-sectional descriptive study of infants and children under 5,…

  16. [Prevalence of depressive and anxiety disorders in cardiovascular outpatients from 14 tertiary general hospitals of 5 Chinese cities].

    PubMed

    Li, Guo; Jiang, Ronghuan; Guo, Chengjun; Liu, Meiyan; Zhang, Lijun

    2014-12-01

    To explore the prevalence of depression and (or) anxiety disorders among cardiovascular outpatients of tertiary general hospitals of five Chinese cities. A hospital-based cross-sectional survey was conducted in the cardiovascular out-patient departments of 14 tertiary general hospitals in five Chinese cities. The patients aged 18 years and over were recruited consecutively, who were conscious and with informed consent, and can finish the questionnaire independently. All the subjects were screened with Hospital Anxiety Depression Scale (HADS). The subjects with HADS score of 8 and over were interviewed and diagnosed by psychiatrists using mini international neuropsychiatric interview (MINI). The physicians made the diagnosis and management without knowing the results of MINI and HADS score. Subjects who refused MINI were defined as the case of loss of follow-up. A total 2 123 subjects were included in the survey. The adjusted prevalence rate of depressive and anxiety disorder was 4.05% (86/2 123), the depressive and/or anxiety disorder was 14.27 % (303/2 123), depressive and anxiety disorder and mixed depressive or anxiety disorder was 14.37% (305/2 123) according to MINI. The adjusted prevalence of lifetime depressive and anxiety disorder was 5.37% (114/2 123), depressive and/or anxiety disorder was 16.91% (359/2 123), depressive and anxiety disorder and mixed depressive-anxiety disorder was 17.00% (361/2 123). There is a high prevalence of depressive and anxiety disorder among cardiovascular outpatients from tertiary general hospitals in China. Therefore, doctors must pay attention to this disorder and try to reduce the impact of this disorder in cardiovascular patients.

  17. Frequency and predictors of seasonal influenza vaccination and reasons for refusal among patients at a large tertiary referral hospital.

    PubMed

    Masnick, Max; Leekha, Surbhi

    2015-07-01

    We assessed frequency and predictors of seasonal influenza vaccination acceptance among inpatients at a large tertiary referral hospital, as well as reasons for vaccination refusal. Over 5 seasons, >60% of patients unvaccinated on admission refused influenza vaccination while hospitalized; "believes not at risk" was the reason most commonly given.

  18. Determinants and influencing mechanism of outpatient satisfaction: a survey on tertiary hospitals in the People’s Republic of China

    PubMed Central

    Yu, Wenya; Li, Meina; Xue, Chen; Wang, Jingrui; Liu, Jiazhen; Chen, Haiping; Zhang, Lulu

    2016-01-01

    Objective Most patients in the People’s Republic of China prefer tertiary hospitals when seeking medical services. The aim of this study was to assess outpatient satisfaction with tertiary hospitals in the People’s Republic of China, test overall and subscale satisfaction, and explore whether sociodemographic characteristics lead to different degrees of satisfaction and whether subscale outpatient satisfaction contributes to overall satisfaction. Methods A closed questionnaire was given out to investigate outpatients’ sociodemographic characteristics, overall satisfaction, and various subtypes of satisfaction, and a 5-point Likert scale was employed to measure the degree of outpatient satisfaction. Descriptive analysis, Kruskal–Wallis test, Spearman’s rank correlation coefficient, and logistic regression analysis were employed for statistical analysis. Results Response rate was 92.48% (971/1,050). Outpatients’ sociodemographic characteristics (including sex, age, occupation, monthly income, residence, and marital status) were related to various subtypes of satisfaction to varying degrees. Outpatients who were male, older, married, with low or middle incomes, living in Shanghai or other areas of the People’s Republic of China, medical staff, or students were more satisfied with various subtypes of satisfaction than those without these characteristics. In further analyses, satisfaction with their medical needs being met by doctors had the strongest relation to overall satisfaction, followed by satisfaction with doctors’ service attitudes, medical costs, waiting time, prescription, and diagnosis and treatment time. Satisfaction with environment had the weakest contribution to overall satisfaction. Conclusion This study gave some suggestions for tertiary hospitals in advanced areas of the People’s Republic of China. Outpatient sociodemographic characteristics should be paid more attention by medical staff to improve the degree of satisfaction

  19. Analysis of orbital malignancies presenting in a tertiary care hospital in Pakistan

    PubMed Central

    Khan, Asad Aslam; Sarwar, Suhail; Sadiq, Mohammad Ali A; Ahmad, Imran; Tariq, Nayab; Sibghat-ul-Noor

    2017-01-01

    Objective: To determine the frequencies of various orbital malignancies amongst orbital lesions in patients presenting in a tertiary care hospital in Pakistan. Methods: A retrospective analysis of 666 orbital cases with an established histopathological diagnosis of malignant tumors treated in Mayo Hospital Lahore from 1996 to 2015 (20 years). Results: About 66% of the malignant tumors were primary, 25% secondary, 8% haematopoietic and 1% metastatic. Almost 50% of the cases were children. Retinoblastoma is the commonest tumor (43% overall and 87% among children). Squamous cell carcinoma is the second commonest (15.6% overall and 31% among adults). These are then followed by Adenoid cystic carcinoma of Lacrimal Gland (9%), Lymphoma/Leukaemia (8%) and Rhabdomyosarcoma (6.3%). Conclusion: Frequencies of various orbital malignancies show geographical variation in both paediatric and adult population. PMID:28367175

  20. Posttraumatic Resilience in Former Ugandan Child Soldiers

    ERIC Educational Resources Information Center

    Klasen, Fionna; Oettingen, Gabriele; Daniels, Judith; Post, Manuela; Hoyer, Catrin; Adam, Hubertus

    2010-01-01

    The present research examines posttraumatic resilience in extremely exposed children and adolescents based on interviews with 330 former Ugandan child soldiers (age = 11-17, female = 48.5%). Despite severe trauma exposure, 27.6% showed posttraumatic resilience as indicated by the absence of posttraumatic stress disorder, depression, and clinically…

  1. Validity of subjective global assessment as a screening method for hospital malnutrition. Prevalence of malnutrition in a tertiary hospital.

    PubMed

    Moriana, Miriam; Civera, Miguel; Artero, Ana; Real, Jose T; Caro, Juan; Ascaso, Juan F; Martinez-Valls, Jose F

    2014-04-01

    Hospital malnutrition is a highly prevalent problem that affects patient morbidity and mortality resulting in longer hospital stays and increased healthcare costs. Although there is no single nutritional screening method, subjective global assessment (SGA) may be a useful, inexpensive, and easily reproducible tool. A cross-sectional, observational, randomized study was conducted in 197 patients in a tertiary hospital. SGA, anthropometric data, and biochemical parameters were used to assess the nutritional status of study patients. Fifty percent of subjects were malnourished according to SGA. A higher prevalence of malnutrition was found in medical (53%) as compared to surgical departments (47%). Half the subjects (50%) had malnutrition by SGA, but only 37.8% received nutritional treatment during their hospital stay. Mean hospital stay was longer for patients malnourished (13.5 days) or at risk of malnutrition (12.1 days) as compared to well nourished subjects (6.97 days). SGA significantly correlated (P<.012) with anthropometric and biochemical malnutrition parameters. Prevalence of hospital malnutrition is very high in both medical and surgical departments and is inadequately treated. SGA is a useful tool for screening hospital malnutrition because of its high degree of correlation with anthropometric and biochemical parameters. Copyright © 2013 SEEN. Published by Elsevier Espana. All rights reserved.

  2. Outcomes of in-hospital, out of intensive care and operation theatre cardiac arrests in a tertiary referral hospital.

    PubMed

    Chakravarthy, Murali; Mitra, Sona; Nonis, Latha

    2012-01-01

    Cardiac arrest in the hospital wards may not receive as much attention as it does in the operation theatre and intensive care unit (ICU). The experience and the qualifications of personnel in the ward may not be comparable to those in the other vital areas of the hospital. The outcome of cardiac arrest from the ward areas is a reasonable surrogate of training of the ward nurses and technicians in cardiopulmonary resuscitation. We conducted an audit to assess the issues surrounding the resuscitation of cardiac arrest in areas other than operation theatre and ICU in a tertiary referral hospital. AIMS OF THE AUDIT: To assess the outcomes of cardiac arrest in a tertiary referral hospital. Areas such as wards, dialysis room and emergency room were considered for the audit. This is a retrospective observational audit of the case records of all the adult patients who were resuscitated from 'code blue'. Data for 2 years from 2007 was analysed by a research fellow unconnected with the resuscitations. Twenty-two thousand three hundred and forty-four patients were admitted as in-patients to the hospital during the 2 years, starting May 2007 through May 2009. One hundred code blue calls were received during this time. Twenty-two of the total calls received were false. Among the 78 confirmed cardiac arrests 69 occurred in the wards, 2 in emergency room, 1 in cardiac catheterisation laboratory and 3 in dialysis room. Twenty-eight patients were declared dead after unsuccessful cardiopulmonary resuscitation. Among the 50 who were resuscitated with a return of spontaneous rhythm 26 died. Twenty-four patients were discharged (survival rate of 30%). The survival decreased significantly as the age progressed beyond 60. The resuscitation rates were better in day shifts in contrast to the night. Higher survival was noted in patients who received resuscitation in less than a minute. A overall survival to discharge rate of 30% was noted in this audit. Higher survival rates might be

  3. Outcomes of in-hospital, out of intensive care and operation theatre cardiac arrests in a tertiary referral hospital

    PubMed Central

    Chakravarthy, Murali; Mitra, Sona; Nonis, Latha

    2012-01-01

    Objective Cardiac arrest in the hospital wards may not receive as much attention as it does in the operation theatre and intensive care unit (ICU). The experience and the qualifications of personnel in the ward may not be comparable to those in the other vital areas of the hospital. The outcome of cardiac arrest from the ward areas is a reasonable surrogate of training of the ward nurses and technicians in cardiopulmonary resuscitation. We conducted an audit to assess the issues surrounding the resuscitation of cardiac arrest in areas other than operation theatre and ICU in a tertiary referral hospital. Aims of the audit To assess the outcomes of cardiac arrest in a tertiary referral hospital. Areas such as wards, dialysis room and emergency room were considered for the audit. Methods This is a retrospective observational audit of the case records of all the adult patients who were resuscitated from ‘code blue’. Data for 2 years from 2007 was analysed by a research fellow unconnected with the resuscitations. Results Twenty-two thousand three hundred and forty-four patients were admitted as in-patients to the hospital during the 2 years, starting May 2007 through May 2009. One hundred code blue calls were received during this time. Twenty-two of the total calls received were false. Among the 78 confirmed cardiac arrests 69 occurred in the wards, 2 in emergency room, 1 in cardiac catheterisation laboratory and 3 in dialysis room. Twenty-eight patients were declared dead after unsuccessful cardiopulmonary resuscitation. Among the 50 who were resuscitated with a return of spontaneous rhythm 26 died. Twenty-four patients were discharged (survival rate of 30%). The survival decreased significantly as the age progressed beyond 60. The resuscitation rates were better in day shifts in contrast to the night. Higher survival was noted in patients who received resuscitation in less than a minute. Conclusion A overall survival to discharge rate of 30% was noted in this

  4. Distance Learning Library Services in Ugandan Universities

    ERIC Educational Resources Information Center

    Mayende, Jackline Estomihi Kiwelu; Obura, Constant Okello

    2013-01-01

    The study carried out at Makerere University and Uganda Martyrs University in 2010 aimed at providing strategies for enhanced distance learning library services in terms of convenience and adequacy. The study adopted a cross sectional descriptive survey design. The study revealed services provided in branch libraries in Ugandan universities were…

  5. Prevalence and causes of blindness at a tertiary hospital in Douala, Cameroon

    PubMed Central

    Eballé, André Omgbwa; Mvogo, Côme Ebana; Koki, Godefroy; Mounè, Nyouma; Teutu, Cyrille; Ellong, Augustin; Bella, Assumpta Lucienne

    2011-01-01

    Purpose The aim of this study was to determine the prevalence and causes of bilateral and unilateral blindness in the town of Douala and its environs based on data from the ophthalmic unit of a tertiary hospital in Douala. Methods We conducted a retrospective epidemiological survey of consultations at the eye unit of the Douala General Hospital over the last 20 years (from January 1, 1990 to December 31, 2009). Results Out of the 1927 cases of blindness, 1000 were unilateral, corresponding to a hospital prevalence of 1.84% and 927 cases were bilateral, corresponding to a hospital prevalence of 1.71%. No statistically significant difference was noted between the two (P = 0.14). The leading causes of bilateral blindness were cataract (50.1%), glaucoma (19.7%), and diabetic retinopathy (7.8%) while the leading causes of unilateral blindness were cataract (40.4%), glaucoma (14.1%), and retinal detachment (9.1%). Cataract (51.2%), cortical blindness (16.3%), and congenital glaucoma (10%) were the leading causes of bilateral blindness in children aged less than 10 years. Conclusion Blindness remains a public health problem in the Douala region with a hospital prevalence which is relatively higher than the national estimate given by the National Blindness Control Program. PMID:21966211

  6. [Association between occupational stress and presenteeism among medical staff at grade A tertiary hospitals in Shanghai, China].

    PubMed

    Dai, Junming; Hua, Yujie; Zhang, Hao; Huang, Li; Fu, Hua

    2015-10-01

    To investigate the current status of occupational stress and presenteeism among medical staff at grade A tertiary hospitals in Shanghai, China, and to analyze the association between occupational stress and presenteeism. A total of 2356 healthcare workers from eight grade A tertiary hospitals in Shanghai were investigated by stratified random sampling. All the subjects were asked to complete self-administered questionnaires with informed consent. The occupational stress was assessed by the occupational stress core questionnaire. The presenteeism was evaluated by the Stanford Presenteeism Scale. In all subjects, the average score of presenteeism was 15.23 ± 3.89, and 72.5% felt occupational stress in self-evaluation. There were significant differences in the score of presenteeism between subjects with different ages, education levels, occupations, lengths of service, job titles, and shifts (all P<0.05). There were significant differences in the score of presenteeism and the rate of high presenteeism between subjects with different indices of occupational stress, including job demand, control, social support, and demand-control ratio (P<0.01). High job demand and high demand-control ratio were risk factors for high presenteeism (OR=2.56, 95% CI=2.01~3.27; OR=1.53, 95% CI=1.23~1.90). High social support was a protective factor for high presenteeism (OR=0.23, 95% CI=0.18~0.29). The intensity of occupational stress in medical staff from grade A tertiary hospitals is positively correlated with the level of presenteeism. It is important to promote social support to reduce the loss of work efficiency due to presenteeism.

  7. Factors associated with patients' choice of physician in the Korean population: Database analyses of a tertiary hospital.

    PubMed

    Kim, Kidong; Ahn, Soyeon; Lee, Banghyun; Lee, Kibeom; Yoo, Sooyoung; Lee, Kyogu; Suh, Dong Hoon; No, Jae Hong; Kim, Yong Beom

    2018-01-01

    This study aimed to determine the factors influencing patients' choice of physician at the first visit through database analysis of a tertiary hospital in South Korea. We collected data on the first treatments performed by physicians who had treated patients for at least 3 consecutive years over 10 years (from 2003 to 2012) from the database of Seoul National University's affiliated tertiary hospital. Ultimately, we obtained data on 524,012 first treatments of 319,004 patients performed by 115 physicians. Variables including physicians' age and medical school and patients' age were evaluated as influencing factors for the number of first treatments performed by each physician in each year using a Poisson regression through generalized estimating equations with a log link. The number of first treatments decreased over the study period. Notably, the relative risk for first treatments was lower among older physicians than among younger physicians (relative risk 0.96; 95% confidence interval 0.95 to 0.98). Physicians graduating from Seoul National University (SNU) also had a higher risk for performing first treatments than did those not from SNU (relative risk 1.58; 95% confidence interval 1.18 to 2.10). Finally, relative risk was also higher among older patients than among younger patients (relative risk 1.03; 95% confidence interval 1.01 to 1.04). This study systematically demonstrated that physicians' age, whether the physician graduated from the highest-quality university, and patients' age all related to patients' choice of physician at the first visit in a tertiary university hospital. These findings might be due to Korean cultural factors.

  8. Lessons learned from the development of health applications in a tertiary hospital.

    PubMed

    Park, Joong-Yeol; Lee, Guna; Shin, Soo-Yong; Kim, Jeong Hun; Han, Hye-Won; Kwon, Tae-Wan; Kim, Woo Sung; Lee, Jae Ho

    2014-03-01

    Adoption of smart devices for hospital use has been increasing with the development of health applications (apps) for patient point-of-care and hospital management. To promote the use of health apps, we describe the lessons learned from developing 12 health apps in the largest tertiary hospital in Korea. We reviewed and analyzed 12 routinely used apps in three categories-Smart Clinic, Smart Patient, and Smart Hospital-based on target users and functions. The log data for each app were collected from the date of release up until December 2012. Medical personnel accessed a mobile electronic medical record app classified as Smart Clinic an average of 452 times per day. Smart Hospital apps are actively used to communicate with each other. Patients logged on to a mobile personal health record app categorized as Smart Patient an average of 222 times per day. As the mobile trend, the choice of supporting operating system (OS) is more difficult. By developing these apps, a monitoring system is needed for evaluation. We described the lessons learned regarding OS support, device choice, and developmental strategy. The OS can be chosen according to market share or hospital strategic plan. Smartphones were favored compared with tablets. Alliance with an information technology company can be the best way to develop apps. Health apps designed for smart devices can be used to improve healthcare. However, to develop health apps, hospitals must define their future goals and carefully consider all the aspects.

  9. Evaluation of Health Literacy Status Among Patients in a Tertiary Care Hospital in Coastal Karnataka, India

    PubMed Central

    U.P, Rathnakar; Belman, Madhuri; Kamath, Ashwin; B, Unnikrishnan; Shenoy K, Ashok; A.L, Udupa

    2013-01-01

    Introduction: People with limited health literacy are more likely to make medication errors, and they have less health knowledge, worse health status, more hospitalizations, and higher healthcare costs than people with adequate literacy. The objective of this study is to assess the health literacy status among patients who are able to read and understand English attending a tertiary care hospital by using Rapid Estimate of Adult Literacy in Medicine [REALM] technique and to compare the health literacy levels to educational status and other baseline characteristics. Material and Methods: A widely used word recognition method [REALM] was used to assess the HL status of 200 patients attending a tertiary care hospital in Southern India. The number of correctly pronounced words was used to assign a grade-equivalent reading level. Scores 0 to 44 indicate reading skills at or below the 6th grade level, scores from 45 to 60 represent skills at the 7th or 8th grade level, and scores above 60 indicate skills at the high-school level or higher. Results: HL status was found below adequate level in more than 50% of the patients. Younger age group showed better HL scores compared to those aged more than 25 years. General education level or the medium of education does not truly reflect HL levels as brought out in the study. Even those with postgraduate qualification had poor HL skills. Conclusion: The study was carried out to find out the HL levels among patients attending a tertiary care hospital. It was assumed that the general education levels may not reflect true HL status. In view of the results of this study it can be concluded that patient’s HL skills should not be taken for granted and adequate attention should be paid in educating and briefing patients whenever patients are required to interpret and understand health care related documents. PMID:24392398

  10. Socioeconomic factors affecting patients’ utilization of primary care services at a Tertiary Teaching Hospital in Riyadh, Saudi Arabia

    PubMed Central

    Alsubaie, Abdulaziz M.; Almohaimede, Khaled A.; Aljadoa, Abdulrahman F.; Jarallah, Osamah J.; Althnayan, Yasser I.; Alturki, Yousef A.

    2016-01-01

    Background: Primary care services utilization is dependent on socioeconomic factors. It is proven that variation in socioeconomic factors result in discrepancies in the use of such services. Admittedly, research is limited on the socioeconomic factors affecting the utilization of primary care services in Saudi Arabia. Objectives: The aim of this research was to study the effect of the main socioeconomic factors affecting patients' utilization of primary care services at a tertiary teaching hospital, Riyadh, Saudi Arabia. Materials and Methods: A cross-sectional study was conducted from January to February 2014 in a primary care clinic of a tertiary teaching hospital in Riyadh city; subjects selected using a random consecutive sampling technique. A self-administered questionnaire in Arabic was given to the participants to collect the data which comprised sociodemographic data, utilization measures, and health needs. The data were analyzed using SPSS version 21. Results: A total of 358 subjects participated in the study. The main factors that best determine the utilization of primary health care clinic in a tertiary teaching hospital were the possession of a health insurance (P = 0.046, odds ratio [OR] = 8.333), and bad self-health-perception (P < 0.014, OR: 2.088). Chronic illness was also associated with higher utilization (OR = 2.003). Conclusion: Our results reveal that chronic health problems, self-health-perception, and health insurance are the most significant socioeconomic factors affecting the utilization of primary care services. PMID:26929723

  11. Prevalence of antibodies against Treponema pallidum among HIV-positive patients in a tertiary care hospital in Mexico.

    PubMed

    Mata-Marín, José Antonio; Sandoval-Sánchez, Juan Joel; Huerta-García, Gloria; Arroyo-Anduiza, Carla Ileana; Alcalá-Martínez, Enrique; Mata-Marín, Luis Alberto; Sandoval-Ramirez, Jorge Luis; Gaytán-Martínez, Jesús

    2015-02-01

    Our objective was to determine the seroprevalence of syphilis among HIV-infected patients in a tertiary care hospital in Mexico City. A cross-sectional study was developed, and 318 HIV-positive patients were evaluated from January to February 2013 at Hospital de Infectología, National Medical Center 'La Raza' (a tertiary care hospital specialising in infectious diseases in Mexico City). Laboratory data were screened for the detection of antibodies against Treponema pallidum. Patients completed a questionnaire relating to socio-demographic data and factors associated with syphilis. Of the 318 patients, 83% were men. The mean age ± SD was 36 ± 11 years; 52% were men who have sex with men and 47% had undertaken higher education. The overall seroprevalence of syphilis among these patients was 25% (95% confidence interval 21%, 30%). Men who have sex with men had a significantly higher seroprevalence (30% vs. 15%, p = 0.009). We conclude that, in Mexico, there is a high seroprevalence of syphilis antibodies in HIV-infected patients and that men who have sex with men are the group most affected. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  12. Muddy puddles - the microbiology of puddles located outside tertiary university teaching hospitals.

    PubMed

    Furukawa, M; McCaughan, J; Stirling, J; Millar, B C; Bell, J; Goldsmith, C E; Reid, A; Misawa, N; Moore, J E

    2018-04-01

    In the British Isles, the frequency of rain results in the formation of puddles on footpaths and roads in/around hospitals. No data are available demonstrating the microbiological composition of such puddles and therefore a study was undertaken to examine the microbiology of puddles in the grounds of two tertiary university-teaching hospitals (18 sites) and compared with control puddles from non-hospital rural environments (eight sites), estimating (i) total viable count; (ii) identification of organisms in puddles; (iii) enumeration of Escherichia coli: (iv) detection of Extended Spectrum β-Lactamase producing organisms and (v) direct antimicrobial susceptibility testing. A mean count of 2·3 × 10 3  CFU per ml and 1·0 × 10 9  CFU per ml was obtained for hospital and non-hospital puddles respectively. Isolates (n = 77; 54 hospital and 23 non-hospital) were isolated comprising of 23 species among 17 genera (hospital sites), where the majority (10/16; 62·5%) of genera identified were Gram-negative approximately, a fifth (20·6%) were shared by hospital and non-hospital rural samples. Escherichia coli was detected in half of the hospital puddles and under-half (37·5%) of the rural puddles extended spectrum β-lactamase organisms were not detected in any samples examined. Rainwater puddles from the hospital and non-hospital environments contain a diverse range of bacteria, which are capable of causing infections. This study demonstrated the presence of a wide diversity of bacterial taxa associated with rainwater puddles around hospitals, many of which are capable of causing human disease. Of clinical significance is the presence of Pseudomonas aeruginosa isolated from a hospital puddle, particularly for patients with cystic fibrosis. The presence of potentially disease-causing bacteria in puddles in and around hospitals identifies a new potential environmental reservoir of bacteria. Furthermore work is now needed to define their potential of entering or

  13. Quality of Inpatient Pediatric Case Management for Four Leading Causes of Child Mortality at Six Government-Run Ugandan Hospitals

    PubMed Central

    Sears, David; Mpimbaza, Arthur; Kigozi, Ruth; Sserwanga, Asadu; Chang, Michelle A.; Kapella, Bryan K.; Yoon, Steven; Kamya, Moses R.; Dorsey, Grant; Ruel, Theodore

    2015-01-01

    Background A better understanding of case management practices is required to improve inpatient pediatric care in resource-limited settings. Here we utilize data from a unique health facility-based surveillance system at six Ugandan hospitals to evaluate the quality of pediatric case management and the factors associated with appropriate care. Methods All children up to the age of 14 years admitted to six district or regional hospitals over 15 months were included in the study. Four case management categories were defined for analysis: suspected malaria, selected illnesses requiring antibiotics, suspected anemia, and diarrhea. The quality of case management for each category was determined by comparing recorded treatments with evidence-based best practices as defined in national guidelines. Associations between variables of interest and the receipt of appropriate case management were estimated using multivariable logistic regression. Results A total of 30,351 admissions were screened for inclusion in the analysis. Ninety-two percent of children met criteria for suspected malaria and 81% received appropriate case management. Thirty-two percent of children had selected illnesses requiring antibiotics and 89% received appropriate antibiotics. Thirty percent of children met criteria for suspected anemia and 38% received appropriate case management. Twelve percent of children had diarrhea and 18% received appropriate case management. Multivariable logistic regression revealed large differences in the quality of care between health facilities. There was also a strong association between a positive malaria diagnostic test result and the odds of receiving appropriate case management for comorbid non-malarial illnesses - children with a positive malaria test were more likely to receive appropriate care for anemia and less likely for illnesses requiring antibiotics and diarrhea. Conclusions Appropriate management of suspected anemia and diarrhea occurred infrequently

  14. Socioeconomic status and utilization of amblyopia services at a tertiary pediatric hospital in Canada.

    PubMed

    Sharma, Abhishek; Wong, Agnes M F; Colpa, Linda; Chow, Amy H Y; Jin, Ya-Ping

    2016-12-01

    To evaluate whether socioeconomic status is associated with equal utilization of amblyopia services at The Hospital for Sick Children (SickKids), a pediatric tertiary hospital in Canada. This is a retrospective, cross-sectional study. The medical records of children aged under 7 years diagnosed with amblyopia at SickKids from 2007 to 2009 were reviewed. Socioeconomic status was derived from patients' residential postal codes through linking with income data in the 2006 Canadian census report. Patients were divided into 5 income quintiles to compare with amblyopia service utilization. The main outcome measure was the observed distribution of amblyopia patients by socioeconomic status versus the expected distribution of 20% for each quintile. The analyses included 336 patients. Children with amblyopia at SickKids were more likely to come from the richest neighbourhood (32.5%), whereas children from each of the 3 lowest quintiles (14.6%-15.5%) were less likely to present at SickKids. These results differed significantly from the expected 20% for each quintile (p < 0.0001). All types of amblyopia were significantly under-represented for children from the lower socioeconomic groups. When analyses were stratified by travel distance to the hospital, a significant inequality between the lower and higher income quintiles remained for nonmetropolitan Toronto patients, but not for metropolitan Toronto patients. Despite a publicly funded health-care system in Canada, children from lower socioeconomic neighbourhoods in distant areas utilize the amblyopia services in a tertiary pediatric centre less often than those from higher socioeconomic status. Copyright © 2016 Canadian Ophthalmological Society. All rights reserved.

  15. Seroprevalence of coeliac disease in at-risk subjects at the main tertiary hospital, southwest of Saudi Arabia.

    PubMed

    Al-Hakami, Ahmed M

    2016-03-01

    Coeliac disease (CD) is a gluten-induced autoimmune inflammation of small bowel villi, leading to atrophy and malabsorption. The current study aims to assess the prevalence of CD in high-risk subjects in the Aseer region, southwest of Saudi Arabia and to investigate the associated presentations. This is a retrospective case-finding study of the laboratory records for a 3-year period (2009-2012) at the main tertiary hospital (Aseer Central Hospital). Serum anti-tissue transglutaminase (atTG) and endomysial antibody (EmA) levels were determined along with small intestinal histopathological examination. The proportion of cases that tested positive for at least one coeliac antibody marker was 18.4% (58/315). Forty cases underwent endoscopic examination during the analysis, among which 22 were confirmed to have CD. The individual antibody positivity for atTG and EmA was 17.5% and 15.6%, respectively. The most common clinical condition (47%) associated with these markers was type 1 diabetes mellitus (T1DM). Interestingly, gastrointestinal presentations constituted only 11.5%. The rate of CD among hospital requests, including non-gastrointestinal symptomatic patients, at the Aseer main tertiary hospital seems to be high. Determining the prevalence of CD and also investigating the high-risk group commonly affected by CD warrant more screening studies. Copyright © 2016 Arab Journal of Gastroenterology. Published by Elsevier B.V. All rights reserved.

  16. Hospital-associated methicillin-resistant Staphylococcus aureus: A cross-sectional analysis of risk factors in South African tertiary public hospitals

    PubMed Central

    Kuonza, Lazarus; Musekiwa, Alfred; Iyaloo, Samantha; Perovic, Olga

    2017-01-01

    Introduction Hospital-associated methicillin-resistant S. aureus (HA-MRSA) remains a significant cause of morbidity and mortality worldwide. We conducted a study to determine risk factors for HA-MRSA in order to inform control strategies in South Africa. Methods We used surveillance data collected from five tertiary hospitals in Gauteng and Western Cape provinces during 2014 for analysis. A case of HA-MRSA was defined as isolation of MRSA from a blood culture 48 hours after admission and/or if the patient was hospitalised in the six months prior to the current culture. Multivariable logistic regression modelling was used to determine risk factors for HA-MRSA. Results Of the 9971 patients with positive blood cultures, 7.7% (772) had S. aureus bacteraemia (SAB). The overall prevalence of MRSA among those with SAB was 30.9% (231/747; 95% confidence interval [CI] 27.6%– 34.3%). HA-MRSA infections accounted for 28.3% of patients with SAB (207/731; 95% CI 25.1%– 31.7%). Burns (adjusted odds ratio [aOR] 12.7; 95% CI 4.7–34.4), age ≤1 month (aOR 8.7; 95% CI 3.0–24.6), residency at a long-term care facility (aOR 5.2; 95% CI, 1.5–17.4), antibiotic use within two months of the current SAB episode (aOR 5.1; 95% CI 2.8–9.1), hospital stay of 13 days or more (aOR 2.8; 95% CI 1.3–5.6) and mechanical ventilation (aOR 2.2; 95% CI 1.07–4.6), were independent risk factors for HA-MRSA infection. Conclusion The prevalence of MRSA remains high in South African tertiary public hospitals. Several identified risk factors of HA-MRSA infections should be considered when instituting infection and prevention strategies in public-sector hospitals, including intensifying the implementation of antimicrobial stewardship programmes. There is an urgent need to strengthen infection prevention and control in burn wards, neonatal wards, and intensive care units which house mechanically ventilated patients. PMID:29145465

  17. 'They wrote "gay" on her file': transgender Ugandans in HIV prevention and treatment.

    PubMed

    Minor Peters, Melissa

    2016-01-01

    This paper examines the ways in which HIV-related programmes for heterosexual Ugandans and also for men who have sex with men work to deny healthcare services to transgender people in Uganda. Contrary to current conventional wisdom, the study found that the widespread use of the term 'men who have sex with men' produces greater barriers to healthcare for queer Ugandans than identity categories such as 'lesbian' or 'transgender'. Interventions for men who have sex with men assume a male-identified sexual subject with agency over sexual practices, such as frequency of condom use. Based on two years of ethnographic research in Kampala, I suggest that the focus on individual sexual practices harms transgender people in two ways. First, current HIV prevention and treatment programmes fail to account for risk factors that accrue to both male and female transgender Ugandans due to the social enforcement of gender norms. Second, the term men who have sex with men directs attention towards stigmatised sexual practices, producing the neglect and abuse of non-heteronormative individuals. In the context of Ugandan healthcare, terms such as 'transgender' and kuchu instead focus attention on the dignity and humanity of the rights-bearing person. These findings emphasise how health practitioners must pay attention to emic categories in order to address the ways in which vulnerability is distributed along social vectors of difference.

  18. Challenges and Perspectives for Tertiary Level Hospitals in Bolivia: The case of Santa Cruz de La Sierra Department.

    PubMed

    Medici, André

    2015-01-01

    Current legislation transferred public tertiary hospitals in Bolivia from the Municipalities to the Regional Level. However, the Regional Governments are experiencing technical and financial constraints to reform infrastructure, modernize equipment and introduce reforms to allow better governance, management and sustainability of these hospitals. This articles summarizes the recent experience of the Government of Santa Cruz de la Sierra in Bolivia where five tertiary hospitals and blood bank (most of them in precarious working conditions) has been transferred in 2012 from the Municipal Government of Santa Cruz (the capital) to the Regional Government of Santa Cruz. To face the challenges, the Regional Government of Santa Cruz implement several improvements, such as contract new clinical and administrative personal, increases hospital budgetary autonomy, outsource hospitals' auxiliary services, take measures to eliminate waiting lists and make several new investments to modernize and equip the hospitals. The World Bank was contracted to evaluated the future financial sustainability of these investments and to advice the Government to propose changes to increase the hospitals' management performance. The article describes the remaining challenges in these hospitals and the proposals from the World Bank Study. In the area of quality of care, the main challenge is to improve client satisfaction and continuous outcomes monitoring and evaluation according quality standards. In the area of financing, the challenge is how to assure the sustainability of these hospitals with the current level of health financing and the insufficient financial transfers from the National Government. In the area of Governance, reforms to streamline and simplify internal processes need to be introduced in order to establish mechanisms to increase transparency and accountability, allowing the hospital to have a good administration and adequate participation of the main actors in the guidance of

  19. A tertiary hospital audit of the use of medical imaging in the 24 h preceding death.

    PubMed

    Liu, D; Weil, J; Boughey, M; Sutherland, T

    2016-02-01

    This study aims to investigate the number, modality and indication for imaging studies performed on acute hospital inpatients in the 24 h prior to death. Data were obtained from retrospective analysis of deceased patients from a university affiliated tertiary hospital over a 2-year period and it was found that around one in five inpatients received medical imaging in the last 24 h of their life (364 of 1855, 19.6%). © 2016 Royal Australasian College of Physicians.

  20. Off-label and unlicensed drug use in hospitalized newborns in a Saudi tertiary care hospital: a cohort study.

    PubMed

    Mazhar, Faizan; Akram, Shahzad; Haider, Nafis; Hadi, Muhammad Abdul; Sultana, Jabeen

    2018-06-01

    Objective To determine the extent of off-label and unlicensed prescribing in hospitalized newborns and to identify patient-related risk factors associated with off-label prescribing. Methods A prospective cohort study was conducted between January and March 2016 at a neonatology department of a tertiary-care hospital in the Eastern province. All consecutive admissions to all neonatal care levels meeting the inclusion and exclusion criteria were eligible for enrollment. All prescriptions were classified as off-label or unlicensed according to drug product monograph. Clinical and prescription data were extracted using a pilot-tested structured data collection sheet. Results During the study period 583 prescriptions were made for 138 newborns, of which 29.7% (173/583) and 12.9% (75/583) were classified as off-label and unlicensed drugs respectively for use in neonates. Thirty-four percent (47/138) of patients received at least one off-label/unlicensed medicine. Mechanical ventilation, admission to the neonatal intensive care unit and length of hospital stay were identified as independent risk factors associated with prescribing of at least one off-label medication. Conclusion Use of off-label and unlicensed drugs in hospitalized newborns seems to be a common practice in this Saudi hospital. Future research should evaluate safety and efficacy of off-label and/or unlicensed use of drugs in neonates.

  1. Improving mental health service users' with medical co-morbidity transition between tertiary medical hospital and primary care services: a qualitative study.

    PubMed

    Cranwell, Kate; Polacsek, Meg; McCann, Terence V

    2016-07-26

    Mental health service users have high rates of medical co-morbidity but frequently experience problems accessing and transitioning between tertiary medical and primary care services. The aim of this study was to identify ways to improve service users' with medical co-morbidity care and experience during their transition between tertiary medical hospitals and primary care services. Experience-based co-design (EBCD) qualitative study incorporating a focus group discussion. The study took place in a large tertiary medical service, incorporating three medical hospitals, and primary care services, in Melbourne, Australia. A purposive sample of service users and their caregivers and tertiary medical and primary care clinicians participated in the focus group discussion, in August 2014. A semi-structured interview guide was used to inform data collection. A thematic analysis of the data was undertaken. Thirteen participants took part in the focus group interview, comprising 5 service users, 2 caregivers and 6 clinicians. Five themes were abstracted from the data, illustrating participants' perspectives about factors that facilitated (clinicians' expertise, engagement and accessibility enhancing transition) and presented as barriers (improving access pathways; enhancing communication and continuity of care; improving clinicians' attitudes; and increasing caregiver participation) to service users' progress through tertiary medical and primary care services. A sixth theme, enhancing service users' transition, incorporated three strategies to enhance their transition through tertiary medical and primary care services. EBCD is a useful approach to collaboratively develop strategies to improve service users' with medical co-morbidity and their caregivers' transition between tertiary medical and primary care services. A whole-of-service approach, incorporating policy development and implementation, change of practice philosophy, professional development education and support for

  2. Immunization Status of NICU Graduates at a Tertiary Care Children's Hospital.

    PubMed

    Macintosh, Janelle L B; Huggins, Leslie J; Eden, Lacey M; Merrill, Katreena Collette; Luthy, Karlen E Beth

    2017-04-01

    Approximately 500,000 infants are born prematurely each year in the United States. Immunization of infants in a neonatal intensive care unit (NICU) set a precedence for future immunizations. The objectives of this study were to determine the current rates of immunization and identify variables associated with immunizations of NICU graduates who were aged 60 days or older at time of discharge. This descriptive pilot study utilized retrospective paper medical record review in one tertiary children's hospital. The relationships between immunization status and study variables were examined using t tests and logistic regression. Of 43 infants discharged at least 60 days of age or older from the NICU, 74.4% were fully immunized in accordance with American Academy of Pediatrics (AAP) recommendations. Significant predictors were age at discharge for immunization and steroid use for nonimmunization. Immunization needs to be a priority in order to give NICU infants every advantage regarding their future health status. Nurses need to implement hospital policies ensuring immunizations of NICU graduates. Future studies should focus on samples from diverse hospitals and levels of NICUs. Qualitative studies exploring and describing parent and provider knowledge of current AAP guidelines will strengthen our understanding of potential barriers to immunization.

  3. Herpes–Zoster Infection in a Tertiary Hospital in Brazil

    PubMed Central

    Antoniolli, Luciana; Azambuja, Aline; Rodrigues, Camila; Borges, Rafael; Goldani, Luciano

    2017-01-01

    Abstract Background herpes zoster (HZ) is a common infection with potential complications requiring hospital care, especially for patients with multiple comorbities. However, there is little information on HZ from hospital registries. Methods we searched for hospital-based records of B02 code (ICD-10) between March 2000 and January 2017 at Hospital de Clínicas de Porto Alegre, a tertiary, university hospital in south Brazil. To avoid misclassifications, we considered clinical evaluation for the diagnosis of cutaneous HZ and postherpetic neuralgia (PHN), ophthalmological evaluation for ophthalmic HZ and the combination of clinical, radiologic and cerebrospinal fluid analysis for HZ meningo-encephalitis (ME). We analyzed conditions associated with immune dysregulation, complications, length of hospital stay, and mortality. Chi-square test and Kaplan-Meier estimator were used for statistical analyses. P < 0.05 was considered statistically significant. Results there were 847 records for this period, of which 801 were confirmed according to our criteria and included in the analysis. Most patients were women (n = 448; 60%), with an average of 48.8 years, standard deviation of 22.2. There were more diagnoses in the inpatients group (74.4%), and fewer in the emergency room (22.4%) and outpatient (3.3%). The median length of hospital stay was 7 days (2-10, P25-P75) when HZ was the main reason for admission. Most patients presented cutaneous HZ (n = 743, 92.8%). There were fewer cases of PHN (6.1%), ophthalmic HZ (7.6%) and ME (4.1%). Seventy percent had some kind of immune dysregulation; more frequently AIDS (31%), use of immunosuppressive agents (18.7%) and malignant disease (16.2%). We followed the subjects for a median of 28.2 (2.8-77.5) months. During this period, there were 105 (13.1%) deaths. Five were related to HZ ME. The 30-day overall mortality rate was 1.5%. There was no statistical difference in cumulative survival (graph 1, P = 0.05) or incidence of

  4. Molecular epidemiology and spatiotemporal analysis of hospital-acquired Acinetobacter baumannii infection in a tertiary care hospital in southern Thailand.

    PubMed

    Chusri, S; Chongsuvivatwong, V; Rivera, J I; Silpapojakul, K; Singkhamanan, K; McNeil, E; Doi, Y

    2017-01-01

    Acinetobacter baumannii is a major hospital-acquired pathogen in Thailand that has a negative effect on patient survival. The nature of its transmission is poorly understood. To investigate the genotypic and spatiotemporal pattern of A. baumannii infection at a hospital in Thailand. The medical records of patients infected with A. baumannii at an 800-bed tertiary care hospital in southern Thailand between January 2010 and December 2011 were reviewed retrospectively. A. baumannii was identified at the genomospecies level. Carbapenemase genes were identified among carbapenem-resistant isolates associated with A. baumannii infection. A spatiotemporal analysis was performed by admission ward, time of infection and pulsed-field gel electrophoresis (PFGE) groups of A. baumannii. Nine PFGE groups were identified among the 197 A. baumannii infections. All A. baumannii isolates were assigned to International Clonal Lineage II. bla OXA-23 was the most prevalent carbapenemase gene. Outbreaks were observed mainly in respiratory and intensive care units. The association between PFGE group and hospital unit was significant. Spatiotemporal analysis identified 20 clusters of single PFGE group infections. Approximately half of the clusters involved multiple hospital units simultaneously. A. baumannii transmitted both within and between hospital wards. Better understanding and control of the transmission of A. baumannii are needed. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  5. Estimation of Need for Palliative Care among Noncancer Patients Attending a Tertiary Care Hospital.

    PubMed

    Prasad, Parvathy; Sarkar, Sonali; Dubashi, Biswajit; Adinarayanan, S

    2017-01-01

    Palliative care services, until recently, were mainly restricted to cancer patients with incurable diseases. Hence, evaluative studies of palliative care are sparse in areas other than oncology. To estimate what proportion of patients attending the Departments of Neurology, Cardiology, and Nephrology of Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER), Puducherry, required palliative care and to identify the palliative care needs of those patients. This was an exploratory descriptive study conducted in the three departments of JIPMER. There was no predetermined sample size for the study. The participants were all adult inpatients and outpatients who were in need of palliative care in the departments of Cardiology, Nephrology, and Neurology on the day of study. Percentage distribution was used to analyze the categorical variables such as education, gender, age, patients in need of palliative care, and their needs. The study showed that one in ten non-cancer patients in tertiary care hospitals may require palliative care services. Apart from issues in physical domain, a substantial proportion of participants also had issues in the psychological, emotional, and financial domains. This study highlights the need for incorporation and initiation of palliative care services in other non-cancer specialties in tertiary care hospitals to ensure holistic management of such cases. Counseling service has also to be rendered as part of palliative care since a good share of the patients had psychological and emotional issues.

  6. Sexually Transmitted Infections: Experience in a Multidisciplinary Clinic in a Tertiary Hospital (2010-2013).

    PubMed

    Moreno-Ribera, N; Fuertes-de Vega, I; Blanco-Arévalo, J L; Bosch-Mestres, J; González-Cordón, A; Estrach-Panella, T; García-de Olalla, P; Alsina-Gibert, M

    2016-04-01

    The number of consultations for sexually transmitted infections (STIs) is increasing in Spain. The aim of this study was to describe and analyze the epidemiological, behavioral, clinical, and microbiological characteristics of patients registered at the STI unit of a tertiary hospital. This was a retrospective, single-center descriptive study carried out between 2010 and 2013 in a multidisciplinary unit specialized in STIs, situated in a tertiary hospital. Epidemiological, clinical, and behavioral data were gathered using a face-to-face interview and a standardized questionnaire. Samples were collected for microbiology analysis. The study included 546 patients: 96% were men, 41% had human immunodeficiency virus (HIV) infection, and 56% were men who have sex with men. The reasons for consultation were the following: urethritis; genital, anal, or perianal ulcers; proctitis; oral ulcers; sexual contact with a person with a known STI; and high-risk sexual contact. The most common microbiological diagnoses were Neisseria gonorrhoeae in urethritis, Treponema pallidum in genital and anal or perianal ulcers, and Chlamydia trachomatis lymphogranuloma venereum serovars in proctitis. The highest prevalences of the main STIs studied occurred in homosexual men with HIV infection. This study confirms the increase in the incidence of STIs in recent years and the epidemiological characteristics of the HIV/STI epidemic in Spain. Copyright © 2015 AEDV. Published by Elsevier España, S.L.U. All rights reserved.

  7. [Efficacy and safety of tertiary hospital guided and community-driven family self-help cardiac rehabilitation model].

    PubMed

    Ding, R J; Gao, L M; Chu, L; Xie, W L; Wang, X R; Tang, Q; Wang, H L; Hu, D Y

    2017-03-24

    Objective: To explore the efficacy and safety of tertiary hospital guided and community-driven family self-help cardiac rehabilitation model. Methods: This study was a prospective randomized controlled study, 80 patients from Beijing Electrical Power Hospital and Beijing Jingmei Group General Hospital with acute coronary syndrome were included from June to December 2015 and divided into 2 groups. Patients in rehabilitation group ( n =52) received tertiary hospital(Peiking University Peoples' Hospital) guided and community-driven family self-help cardiac rehabilitation for 3 months, and patients in control group ( n =28) received routine secondary treatment for 3 months. Following parameters including 6 minutes walk distance, score of life quality (evaluated by Short Form-12), score of anxiety (evaluated by Generalized Anxiety Disorder-7), score of depression (evaluated by Perceived Health Questionnaire-9), self-management competency (evaluated by questionnaire) were collected at baseline and after treatment for 3 months. Results: Compared with control group, 6 minutes walk distance was longer in rehabilitation group((60.2±6.8) meters vs. (24.9±10.5)meters, P <0.01). The difference values between after and before intervention of life quality scores((0.14±3.90)scores vs.(-7.44±5.85)scores, P >0.05), anxiety scores((-0.16±2.12 ) scores vs.(0.70±1.13)scores, P >0.05) and depression scores((-1.17±2.79) scores vs.(0.60±0.36)scores, P >0.05) were similar between the 2 groups. The amplification of patients with regular exercise (50.26% vs. 0, P <0.05), limit sugary foods usually and always (53.22% vs. 3.98%, P <0.05), eat 200-400 g fruits usually and always (78.61 % vs. 0, P <0.05), eat 300-500 g vegetables usually and always (9.74% vs. 0, P <0.05), and answering very confident to questions such as let the physicians know about your diseases (40.17% vs. 5.00%, P <0.05), know how to take medicines (44.52% vs. 5.00%, P <0.05), know how much exercise was right for

  8. Utilization of arterial blood gas measurements in a large tertiary care hospital.

    PubMed

    Melanson, Stacy E F; Szymanski, Trevor; Rogers, Selwyn O; Jarolim, Petr; Frendl, Gyorgy; Rawn, James D; Cooper, Zara; Ferrigno, Massimo

    2007-04-01

    We describe the patterns of utilization of arterial blood gas (ABG) tests in a large tertiary care hospital. To our knowledge, no hospital-wide analysis of ABG test utilization has been published. We analyzed 491 ABG tests performed during 24 two-hour intervals, representative of different staff shifts throughout the 7-day week. The clinician ordering each ABG test was asked to fill out a utilization survey. The most common reasons for requesting an ABG test were changes in ventilator settings (27.6%), respiratory events (26.4%), and routine (25.7%). Of the results, approximately 79% were expected, and a change in patient management (eg, a change in ventilator settings) occurred in 42% of cases. Many ABG tests were ordered as part of a clinical routine or to monitor parameters that can be assessed clinically or through less invasive testing. Implementation of practice guidelines may prove useful in controlling test utilization and in decreasing costs.

  9. Availability of antidotes and key emergency drugs in tertiary care hospitals of Punjab and assessment of the knowledge of health care professionals in the management of poisoning cases.

    PubMed

    Arslan, Naheed; Khiljee, Sonia; Bakhsh, Allah; Ashraf, Muhammad; Maqsood, Iram

    2016-03-01

    This study was conducted to evaluate the availability of antidotes/key emergency drugs in tertiary care hospitals of the Punjab province, and to assess the knowledge of health care professionals in the stocking and administration of antidotes in the proper management of poisoning cases. Seventeen (n=17) tertiary care hospitals of Punjab Pakistan were selected. Two performas (A and B) were designed for 26 antidotes/key emergency drugs and given to the hospital pharmacists and physicians respectively. It was observed that Activated Charcoal, being the universal antidote was found only in 6 hospitals (41%). Digoxin Immune Fab, Edentate Calcium disodium and Glucagon were not available in emergency department of any hospital and even not included in the formulary of any hospital. About 80% pharmacists were aware of the method of preparation of Activated Charcoal and 85% physicians were familiar with its route of administration. Data showed that tertiary care hospitals of Punjab do not stock antidotes according to national drug policy. Moreover the study strongly suggests the development of health care centers and professional by organizing antidote awareness programs, continuous education and record keeping of poisonous cases and availability of emergency drugs around the clock.

  10. Striding Forward: Girls and Women in Ugandan Schools

    ERIC Educational Resources Information Center

    Rosenberg, David

    2006-01-01

    This article looks at the important role that teachers and headteachers can have as role models for children living with challenging circumstances. It focuses particularly on girls struggling against the odds to complete their education in Ugandan schools and improve their life chances. The commitment to women's rights espoused by Uganda's…

  11. Family practice obstetrics in a teaching hospital. Does a tertiary care environment make a difference?

    PubMed Central

    Jordan, J. M.; Gaspar, D.

    1995-01-01

    OBJECTIVE: To determine referral rates, to study the nature of consultations with obstetricians, and to examine how both patient and physician characteristics affect referrals. DESIGN: Case series. Retrospective review of hospital records. SETTING: Victoria Hospital, a tertiary care centre affiliated with the University of Western Ontario in London, Ont. PARTICIPANTS: Five hundred forty-two women admitted consecutively for delivery under the care of family physicians from October 1, 1990, to September 31, 1991. OUTCOME MEASURE: The number and types of obstetrical consultations obtained for the study population. RESULTS: Of the 50.7% of cases requiring consultation, half were delivered by obstetricians. The most common reasons for consultation were failure to progress in labour, induction of labour, posterior presentation, fetal distress, and pregnancy-induced hypertension. The most common reasons for obstetricians to attend delivery were to perform forceps rotations and cesarean sections. CONCLUSIONS: Parity and risk classification were the two most important factors for predicting whether consultation would occur. The high rate of consultation in this study might relate to ease of access to consultation in a tertiary care environment. More study is needed to examine the reasons for consultation because it seems that some of the situations for which obstetricians were consulted could have been safely managed by family physicians. PMID:7787491

  12. Evaluation of day care versus inpatient cataract surgery performed at a Jiangsu public Tertiary A hospital.

    PubMed

    Zhuang, Min; Cao, Juan; Cui, Minglan; Yuan, Songtao; Liu, Qinghuai; Fan, Wen

    2018-06-05

    High cataract incidence and low cataract surgical rate are serious public health problems in China, despite the fact that efficient day care cataract surgery has been implemented in some public Tertiary A hospitals in China. In this study, we compared not only clinical outcomes, hospitalization time and total costs but also payment manners between day care and inpatient procedures for cataract surgery in a Jiangsu public Tertiary A hospital to put forward several instructional suggestions for the improvement of government medical policies. In total, 4151 day care cases and 2509 inpatient cases underwent the same cataract surgery in the day care ward and ordinary ward respectively, and were defined as two groups. General information, complications, postoperative best corrected visual acuity (BCVA), hospitalization time, total costs and especially payment method were analyzed to compare day care versus inpatient. The general data display no significant differences (P > 0.05), and no significant difference between complications and postoperative BCVA were observed between the two groups (P > 0.05). The period of stay in hospital was significantly different (P < 0.001). The total costs were lower for day care than for inpatients (P < 0.001). To avoid sampling error, we analyzed the data of payment manner for each patient among this period. Day care patients tended to pay for the procedure using the Urban Employees Basic Medical Insurance (UEBMI) method, while inpatients tended to use the Out-of-Pocket Medical Treatment (OMT) payment method (P < 0.001). Day surgery of cataract is more cost-effective and efficient than inpatient surgery with equivalent clinical outcomes. As an efficient therapeutic regimen, day care surgery should be further promoted and supported by the government policies.

  13. Referrals to integrative medicine in a tertiary hospital: findings from electronic health record data and qualitative interviews.

    PubMed

    Griffin, Kristen H; Nate, Kent C; Rivard, Rachael L; Christianson, Jon B; Dusek, Jeffery A

    2016-07-25

    To examine patterns of, and decision-making processes, informing referrals for inpatient access to integrative medicine (IM) services at a large, acute care hospital. Retrospective electronic health record review and structured qualitative interviews. A 630-bed tertiary care hospital with an IM service available to inpatients. IM referrals of all inpatients aged ≥18 years between July 2012 and December 2014 were identified using the hospital's electronic health record. Fifteen physicians, 15 nurses and 7 administrators were interviewed to better understand roles and perspectives in referring patients for IM services. In the study hospital, primary sources of referrals for IM services were the orthopaedic and neuroscience/spine service lines. While the largest absolute number of IM referrals was made for patients with lengths of stay of 3 days or fewer, a disproportionate number of total IM referrals was made for patients with long lengths of stay (≥10 days), compared with a smaller percentage of patients in the hospital with lengths of stay ≥10 days. Physicians and nurses were more likely to refer patients who displayed strong symptoms (eg, pain and anxiety) and/or did not respond to conventional therapies. IM referrals were predominantly nurse-initiated. A built-in delay in the time from referral initiation to service delivery discouraged referrals of some patients. Conventional providers refer patients for IM services when these services are available in a tertiary hospital. Referral patterns are influenced by patient characteristics, operational features and provider perspectives. Nurses play a key role in the referral process. Overcoming cultural and knowledge differences between conventional and IM providers is likely to be a continuing challenge to providing IM in inpatient settings. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  14. A Description of Weekend Physiotherapy Services in Three Tertiary Hospitals in the Greater Toronto Area

    PubMed Central

    Hill, Kylie

    2010-01-01

    ABSTRACT Purpose: The aims of this study were (1) to describe the cardiorespiratory physiotherapy weekend service (PWS) at three tertiary hospitals in the Greater Toronto Area (GTA) and (2) to compare measures of staff burden among the clinical service areas in one of the hospitals that had a programme-based management structure. Method: Two focus-group meetings were held with physiotherapists from hospitals within the GTA. Thereafter, variables characterizing the PWS were collected over 8 months, using a standardized data-collection form. Results: A total of 632 data-collection forms were received. Response rates exceeded 75% at each hospital. Workload variables, including the number of patient visits, new referrals per hour, and the proportion of staff completing unpaid overtime, differed between the hospitals (p<0.002). There was no difference in any variable when data were compared between Saturday, Sunday, and statutory holidays (p>0.13). Workload measures varied between clinical service areas at the hospital that provided PWS using a programme-based approach. Conclusions: These findings highlight the important shortcomings of a programme-based management approach to providing PWS and may constitute a catalyst for change. PMID:21359048

  15. Imprudent Gastro-protective Approach in Majority of Specialists’ Clinics of a Tertiary Hospital

    PubMed Central

    Patel, Hardik Rameshbhai

    2016-01-01

    Introduction One out of four prescriptions in out-patient departments contains a gastro-protective drug (APUD) - PPI/ H2 Blockers/ Antacids/ Ulcer Protective’s. These drugs should be prescribed only when there is a justified indication. To assess the prescriptions of gastro-protective agents for appropriateness and rationality, in a tertiary care hospital setup. Materials and Methods It was a cross-sectional observational study conducted from Aug 2013 to Dec 2013 at OPDs of a Tertiary Care Teaching Hospital, Pune. A total of 260 prescriptions containing gastro-protective agents were analysed for appropriateness and rationality. Rationality of drug use was assessed by referring to standard textbooks and guidelines. Cost difference data was analysed by Wilcoxon signed rank test using GraphPad Prism 6. Results Most common class of gastro-protective agents was Proton pump inhibitors (PPIs)-73.77% (Pantoprazole & Dexrabeprazole). Only 37.3% prescriptions had an adequate indication for these drugs {GI prophylaxis (29.6%) and Acid Peptic Disease treatment (7.7%)}. Two irrational Fixed dose combinations found in the study were PPI with prokinetic agent (n=65) and Proton Pump Inhibitor + NSAID combination (n=2). Formulation, spelling and strength errors were found with 75 prescribed drugs. Medication instructions were lacking with most of the drugs. Drug interactions with co-prescribed drugs could be anticipated in 79 cases. Injudicious use of anti-peptic ulcer agents significantly increased the cost of prescriptions (p<0.0001). Conclusion Anti-ulcer drugs are overenthusiastically prescribed by all specialties which can predispose to adverse effects, drug interactions, increased cost and even erroneous prescriptions. PMID:27134889

  16. Point Prevalence of Chronic Wounds at a Tertiary Hospital in Nigeria.

    PubMed

    Iyun, Ayodele O; Ademola, Samuel A; Olawoye, Olayinka A; Michael, Afie I; Oluwatosin, Odunayo M

    2016-02-01

    Chronic wounds are a drain on resources both for the patient and health institution. Management of chronic wounds based on evidence-based practice requires baseline data for adequate planning. This study was carried out to determine the point prevalence of chronic wounds in a tertiary hospital (University College Hospital, Ibadan, Nigeria) and utilize this information for subsequent wound care planning. The study was carried out within a 1-month period and included all patients seen in the hospital with chronic wounds. The data obtained was entered into a designed form and was subsequently analyzed. There were 48 patients with 78 wounds representing approximately 11% of patients seen in the Department of Plastic, Reconstructive, and Aesthetic Surgery each month. Their ages ranged from 3 months to 80 years; the median age was 48 years. The male to female ratio was 1.6 to 1. The duration of the wounds ranged from 6 weeks to 780 weeks; the median duration of the wounds was 10 weeks. The area of the wounds ranged from 1 cm(2) -1,248 cm(2) (median 24 cm(2)). The most common chronic wounds were diabetic wounds, followed by pressure ulcers, postinfection ulcers, posttraumatic ulcers, burn wounds, malignant ulcers, and venous ulcers. The point prevalence data serves as a basis for wound care planning. This, in turn, should result in improved wound management grounded in evidence-based practices.

  17. Methicillin-resistant Staphylococcus aureus bacteraemia at a tertiary teaching hospital.

    PubMed

    Cheong, I; Samsudin, L M; Law, G H

    1996-01-01

    Between July and December 1994, 25 patients with MRSA bacteraemia were treated at the Hospital Kuala Lumpur, a tertiary hospital in Malaysia with 3000 beds. The patients included 15 males and 10 females whose mean age was 46.7 years (range 13-75). The sources of their MRSA were: Urology/Nephrology, 11; General ICU, six; Orthopaedic, four; Medicine, three; Surgery, one. Their underlying diseases were: end-stage and chronic renal failure, 11; burns, three; acute necrotising pancreatitis, two; haematological malignancies, two; and one each of fracture of the neck of the femur, pustular psoriasis, alcoholic cirrhosis, liver abscess, peptic ulcer (antrectomy), choledochol cyst, and abdominal aneurysm with gangrene of the legs. Six patients were also diabetic. A total of 19 infections were considered nosocomial. The duration of hospital stay ranged from one to 60 days, mean 16 days. On the day of blood culture, 20 patients (80%) were febrile and 15(60%) had leucocytosis. A total of 14 patients were considered to have received prolonged broad-spectrum antibiotics before the bacteraemia; of these, 11 had had either a third-generation cephalosporin and/or a quinolone. The primary foci of infection were: vascular access dialysis catheters, six; infected AV fistulae, three; non-surgical wounds, five; orthopaedic pin, one; multiple venous lines and catheters, nine; unknown, one. The sensitivities to anti-MRSA antibiotics were: vancomycin, 100%; fusidic acid, 96%; rifampicin, 96%; ciprofloxacin and perfloxacin 28% each. In all, 13 patients (52%) eventually died; nine of these deaths were directly attributed to MRSA bacteraemia. The microbiological eradication rate was 88%. Mortality was significantly associated with duration of hospital stay and failure to remove the infected catheters/peripheral lines after the development of MRSA bacteraemia.

  18. [How do Turkish immigrants evaluate cultural sensitivity in a German tertiary hospital?].

    PubMed

    Giese, Arnd; Uyar, Müberra; Henning, Bernhard F; Uslucan, Haci H; Westhoff, Timm; Pagonas, Nikolaos

    2015-01-01

    Culturally adequate medical care is a goal in Germany, but quantitative data concerning inpatients is lacking. Inpatients of a German tertiary hospital: Turkish migrants (T) and Germans (G) were interviewed in their respective native language. 121 T and 121 G were interviewed. 97.5% of T were Muslims, 82.6% of G were Christians. 88.5% of T judged religion as "important" or "very important" (G: 35.8%). 50.8% of T saw their opportunity to pray in the hospital as "bad" or "very bad" (G: 0.9%). Keeping to Islamic dietary rules in the hospital was "difficult" or "very difficult" for 90% of T. For 79.0% of female T care by a same-sex staff was "important" or "very important" (female G: 36.3%, male T: 40.0%, male G: 7.7%). The presence of a same-sex person during examinations or treatments was "much" or "very much" appreciated by 69.7% of female T, if same-sex care was impossible (female G: 25.4%, male T: 28.9%, male G: 6.1%). A retrospective analysis revealed that 5.8% of all 8988 hospital admissions during the period of study recruitment were Turkish migrants. To meet the needs of Turkish migrants German hospitals should improve the opportunity for Muslims to pray. Additionally, the cooperation with local imams should be sought. Precise descriptions of food ingredients or an adapted menu could help T to deal with Muslim dietary commandments. A culturally sensitive hospital should take into account that female as well as male T prefer to be cared of by same-sex physicians and nurses. Georg Thieme Verlag Stuttgart.

  19. Anesthesia-related and perioperative mortality: An audit of 8493 cases at a tertiary pediatric teaching hospital in South Africa.

    PubMed

    Meyer, Heidi M; Thomas, Jenny; Wilson, Graeme S; de Kock, Marianna

    2017-10-01

    This study aimed to quantify the incidence of anesthesia-related and perioperative mortality at a large tertiary pediatric hospital in South Africa. This study included all children aged <18 years who died prior to discharge from hospital and within 30 days of their last anesthetic at the Red Cross War Memorial Children's Hospital between January 1, 2015 to December 31, 2015. A panel of three senior anesthetists reviewed each death to reach a consensus as to whether: (i) anesthesia caused the death; (ii) anesthesia may have contributed to or influenced the timing of death; or (iii) anesthesia was entirely unrelated to the death. There were 47 deaths within 30 days of anesthesia prior to discharge from hospital during this 12-month period. The in-hospital mortality within 24 h of administration of anesthesia was 16.5 per 10 000 cases (95% confidence intervals [CI]=7.8-25.1) and within 30 days of administration of anesthesia was 55.3 per 10 000 cases (95% CI=39.5-71.2). Age under 1 year (OR 4.5; 95% CI=2.5-8.0, P=.012) and cardiac surgery and interventional cardiology procedures (OR 2.5; 95% CI=1.2-5.2, P<.01) were both independent predictors of increased risk of perioperative mortality. The overall 24-h and 30-day anesthesia-related and in-hospital perioperative mortality rates in our study are comparable with other similar studies from tertiary pediatric centers. © 2017 John Wiley & Sons Ltd.

  20. Fungal Profile of Vulvovaginal Candidiasis in a Tertiary Care Hospital.

    PubMed

    Kalaiarasan, Krishnapriya; Singh, Rakesh; Chaturvedula, Latha

    2017-03-01

    Vulvovaginal Candidiasis (VVC) is a common medical health problem of adult women. It is most commonly caused by Candida albicans . But there is a change in fungal profile. Sabouraud's Dextrose Agar (SDA) is the most common culture medium used where mixed fungal infection may be missed. It can be detected easily by using chromogenic culture medium. To know the fungal profile of vulvovaginal candidiasis using Candida CHROMagar and antifungal susceptibility pattern in patients attending tertiary care hospital. Culture confirmed cases of VVC presented at Department of Obstetrics and Gynaecology of Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER), Puducherry, India, from July 2015 to December 2015 were included in the cross-sectional study. Two high vaginal swabs were collected and inoculated on SDA and Candida CHROMagar (Hi-Media, Mumbai, India). After overnight incubation the colonies were counted and colour of the colonies were recorded from Candida CHROMagar. Candida spp. were identified by sugar fermentation and assimilation tests and other conventional tests. Antifungal susceptibility tests were performed by the disc diffusion method using fluconazole (25 μg) and voriconazole (1μg) as per the Clinical and Laboratory Standards Institute (CLSI - M44-A2) guidelines. A total of 50 culture confirmed (23.7%) cases were detected from 211 clinically suspected VVC cases. Candida glabrata (45.1%) was the most common isolate, followed by Candida tropicalis (23.5%) , Candida albicans (17.6%) , Candida krusei (9.8%) and Candida parapsilosis (3.9%) . One mixed infection of C. glabrata and C. albicans was identified on Candida CHROMagar. Mixed fungal infection was observed in 2% of positive culture and 0.5% of VVC cases. The antifungal susceptibility testing revealed that 15.7% and 9.8% isolates of Candida spp. were resistant and Susceptible Dose Dependent (S-DD) respectively to fluconazole. The increase resistant against fluconazole was because of

  1. The discourses on induced abortion in Ugandan daily newspapers: a discourse analysis.

    PubMed

    Larsson, Sofia; Eliasson, Miriam; Klingberg Allvin, Marie; Faxelid, Elisabeth; Atuyambe, Lynn; Fritzell, Sara

    2015-06-25

    Ugandan law prohibits abortion under all circumstances except where there is a risk for the woman's life. However, it has been estimated that over 250 000 illegal abortions are being performed in the country yearly. Many of these abortions are carried out under unsafe conditions, being one of the most common reasons behind the nearly 5000 maternal deaths per year in Uganda. Little research has been conducted in relation to societal views on abortion within the Ugandan society. This study aims to analyze the discourse on abortion as expressed in the two main daily Ugandan newspapers. The conceptual content of 59 articles on abortion between years 2006-2012, from the two main daily English-speaking newspapers in Uganda, was studied using principles from critical discourse analysis. A religious discourse and a human rights discourse, together with medical and legal sub discourses frame the subject of abortion in Uganda, with consequences for who is portrayed as a victim and who is to blame for abortions taking place. It shows the strong presence of the Catholic Church within the medial debate on abortion. The results also demonstrate the absence of medial statements related to abortion made by political stakeholders. The Catholic Church has a strong position within the Ugandan society and their stance on abortion tends to have great influence on the way other actors and their activities are presented within the media, as well as how stakeholders choose to convey their message, or choose not to publicly debate the issue in question at all. To decrease the number of maternal deaths, we highlight the need for a more inclusive and varied debate that problematizes the current situation, especially from a gender perspective.

  2. Biomedical waste management: study on the awareness and practice among healthcare workers in a tertiary teaching hospital.

    PubMed

    Joseph, L; Paul, H; Premkumar, J; Paul, R; Michael, J S

    2015-01-01

    Bio-medical waste has a higher potential of infection and injury to the healthcare worker, patient and the surrounding community. Awareness programmes on their proper handling and management to healthcare workers can prevent the spread of infectious diseases and epidemics. This study was conducted in a tertiary care hospital to assess the impact of training, audits and education/implementations from 2009 to 2012 on awareness and practice of biomedical waste segregation. Our study reveals focused training, strict supervision, daily surveillance, audits inspections, involvement of hospital administrators and regular appraisals are essential to optimise the segregation of biomedical waste.

  3. [Relationship between occupational stress, recovery experience, and physiological health of nurses in a municipal grade A tertiary hospital].

    PubMed

    He, L; Zhang, C L; Yang, T; Lan, Y J

    2017-06-20

    Objective: To examine the relationship between recovery experience, occupational stress, and physiological health of nurses in a municipal grade A tertiary hospital. Methods: A total of 296 in-service nurses from 7 municipal grade A tertiary hospitals were selected from October 2015 to February 2016. Individual characteristics of the subjects were collected using a self-made questionnaire. The recovery experience, occupational stress, and physiological health of the subjects were assessed based on the physiological health dimensions in the Chinese version of Recovery Experience Questionnaire (REQ-C) , Job Content Questionnaire (JCQ) , and Quality of Work Life (QWL7-32) . Results: The mean recovery experience score of nurses from the municipal grade A tertiary hospital was 45.04±7.72, and 51.35% of the nurses had satisfactory recovery experience. Occupational stress was identified in 81.76% of the nurses. Based on the four categories of occupational stress, 65 nurses were identified with high-strain jobs (21.95%) , 56 with relaxed (low-strain) jobs (18.92%) , 49 with passive jobs (16.55%) , and 126 with active jobs (42.57%) . In addition, the mean physiological health score of the nurses was 21.20±4.24. Physiological health was negatively correlated with occupational stress ( r =-0.173, P <0.05) , but positively correlated with recovery experience ( r =0.198, P <0.01) . Recovery experience was negatively correlated with occupational stress ( r =-0.116, P <0.05) . Job demand was the major contributor to occupational stress, where subjects with high-demand active jobs had the poorest recovery experience ( F =2.610, P <0.05) and physiological health ( F =8.166, P <0.01) . Conclusion: Job demand has a great impact on the occupational stress of nurses, where increased job demand can lead to stronger stress response, reduced recovery experience, and poorer physiological health.

  4. Characteristics of patients with diabetes screened for tuberculosis in a tertiary care hospital in South India

    PubMed Central

    Kumpatla, S.; Sekar, A.; Achanta, S.; Sharath, B. N.; Kumar, A. M. V.; Harries, A. D.

    2013-01-01

    Setting: Tertiary care hospital for diabetes mellitus (DM) in Tamil Nadu, South India. Objective: To compare the socio-demographic, clinical and biochemical characteristics in DM patients with and without tuberculosis (TB). Design: A descriptive study involving a review of routinely maintained records to capture the results of screening of DM patients for TB between March and December 2012. DM patients were first asked whether they already had TB, and if not they were screened for TB symptoms, followed by investigations for and possible diagnosis of TB. Results: Of 7083 DM patients, 38 already had TB. Of the remainder, 125 (1.8%) had TB symptoms; 71 were investigated and 12 were newly diagnosed with TB. Of the 50 TB patients, 64% had smear-positive pulmonary TB (PTB). DM-TB patients were older, and had lower education level and economic status, a higher frequency of alcohol use, lower body mass index, a longer duration of DM, a greater likelihood of receiving insulin and poorer glycaemic control. Conclusion: Screening of DM patients for TB was feasible in a tertiary care hospital. The yield of new TB cases was low and merits further investigation. Socio-demographic and clinical characteristics were different in patients with DM and TB compared to those with DM only. PMID:26393064

  5. Tribal ethnicity and CYP2B6 genetics in Ugandan and Zimbabwean populations in the UK: implications for efavirenz dosing in HIV infection.

    PubMed

    Jamshidi, Y; Moreton, M; McKeown, D A; Andrews, S; Nithiyananthan, T; Tinworth, L; Holt, D W; Sadiq, S T

    2010-12-01

    To determine differences in CYP2B6 loss of function (LoF) single nucleotide polymorphisms (SNPs) and haplotypes between Zimbabweans and Ugandans, and within Ugandan populations (Bantu and Nilotic). Genetic epidemiological study enrolling adult black African Ugandan and Zimbabwean patients attending a UK HIV-1 clinic, irrespective of antiretroviral therapy status. Genomic DNA was extracted from whole blood and the presence of CYP2B6 alleles was determined by direct sequencing of all nine exons of the CYP2B6 gene. Blood was also collected, where appropriate, for determination of efavirenz concentrations. Frequency of SNPs in all patients and LoF haplotype frequencies were calculated. The relationship between the number of LoF haplotype alleles possessed and efavirenz trough concentration (ETC) was determined. Thirty-six Zimbabweans and 74 Ugandans (58 Bantu and 16 Nilotic) were recruited. The definite haplotypes determined were *6, *18, *20 and *27 as LoF and *4 as gain of function. Among those with definite genotypes, the frequency of LoF alleles was 65% [95% confidence interval (95% CI): 51-80] of Zimbabweans versus 22% (95% CI: 12-31) of Ugandan Bantus (P = 10(-6)) and versus 39% (95% CI: 14-64) of Ugandan Nilotics (P = 0.09). Among the 19 patients with definite genotype and with available ETCs, log ETCs were associated with a greater number of LoF haplotype alleles [848 ng/mL (n = 12), 1069 ng/mL (n = 4) and 1813 ng/mL (n = 3) for 0, 1 or 2 LoF haplotypes, respectively (P = 0.016)]. Among Zimbabweans, LoF haplotypes constitute the majority of CYP2B6 alleles and are significantly higher in prevalence compared with Ugandans. Frequencies of LoF haplotypes and SNPs in Ugandan Nilotics appear to lie between those of Zimbabweans and Ugandan Bantus. These findings may have relevance to pharmacokinetics and dosing of efavirenz in African populations.

  6. Factors predicting quality of work life among nurses in tertiary-level hospitals, Bangladesh.

    PubMed

    Akter, N; Akkadechanunt, T; Chontawan, R; Klunklin, A

    2018-06-01

    This study examined the level of quality of work life and predictability of years of education, monthly income, years of experience, job stress, organizational commitment and work environment on quality of work life among nurses in tertiary-level hospitals in the People's Republic of Bangladesh. There is an acute shortage of nurses worldwide including Bangladesh. Quality of work life is important for quality of patient care and nurse retention. Nurses in Bangladesh are fighting to provide quality care for emerging health problems for the achievement of sustainable development goals. We collected data from 288 randomly selected registered nurses, from six tertiary-level hospitals. All nurses were requested to fill questionnaire consisted of Demographic Data Sheet, Quality of Nursing Work Life Survey, Expanded Nursing Stress Scale, Questionnaire of Organizational Commitment and Practice Environment Scale of the Nursing Work Index. Data were analysed by descriptive statistics and multiple regression. The quality of work life as perceived by nurses in Bangladesh was at moderate level. Monthly income was found as the best predictor followed by work environment, organizational commitment and job stress. A higher monthly income helps nurses to fulfil their personal needs; positive work environment helps to provide quality care to the patients. Quality of work life and predictors measured by self-report only may not reflect the original picture of the quality of work life among nurses. Findings provide information for nursing and health policymakers to develop policies to improve quality of work life among nurses that can contribute to quality of nursing care. This includes the working environment, commitment to the organization and measures to reduce job stress. © 2017 International Council of Nurses.

  7. Bacterial bloodstream infections in a tertiary infectious diseases hospital in Northern Vietnam: aetiology, drug resistance, and treatment outcome.

    PubMed

    Dat, Vu Quoc; Vu, Hieu Ngoc; Nguyen The, Hung; Nguyen, Hoa Thi; Hoang, Long Bao; Vu Tien Viet, Dung; Bui, Chi Linh; Van Nguyen, Kinh; Nguyen, Trung Vu; Trinh, Dao Tuyet; Torre, Alessandro; van Doorn, H Rogier; Nadjm, Behzad; Wertheim, Heiman F L

    2017-07-12

    Bloodstream infections (BSIs) are associated with high morbidity and mortality worldwide. However their aetiology, antimicrobial susceptibilities and associated outcomes differ between developed and developing countries. Systematic data from Vietnam are scarce. Here we present aetiologic data on BSI in adults admitted to a large tertiary referral hospital for infectious diseases in Hanoi, Vietnam. A retrospective study was conducted at the National Hospital for Tropical Diseases between January 2011 and December 2013. Cases of BSI were determined from records in the microbiology department. Case records were obtained where possible and clinical findings, treatment and outcome were recorded. BSI were classified as community acquired if the blood sample was drawn ≤48 h after hospitalization or hospital acquired if >48 h. A total of 738 patients with BSI were included for microbiological analysis. The predominant pathogens were: Klebsiella pneumoniae (17.5%), Escherichia coli (17.3%), Staphylococcus aureus (14.9%), Stenotrophomonas maltophilia (9.6%) and Streptococcus suis (7.6%). The overall proportion of extended spectrum beta-lactamase (ESBL) production among Enterobacteriaceae was 25.1% (67/267 isolates) and of methicillin-resistance in S. aureus (MRSA) 37% (40/108). Clinical data was retrieved for 477 (64.6%) patients; median age was 48 years (IQR 36-60) with 27.7% female. The overall case fatality rate was 28.9% and the highest case fatality was associated with Enterobacteriaceae BSI (34.7%) which accounted for 61.6% of all BSI fatalities. Enterobacteriaceae (predominantly K. pneumoniae and E. coli) are the most common cause of both community and hospital acquired bloodstream infections in a tertiary referral clinic in northern Vietnam.

  8. Thyroid autoimmunity and function among Ugandan children and adolescents with type-1 diabetes mellitus.

    PubMed

    Muhame, Rugambwa Michael; Mworozi, Edison Arwanire; McAssey, Karen; Lubega, Irene

    2014-01-01

    Up to 30% of type-1 diabetes mellitus (T1DM) patients have co-existent thyroid autoimmunity with up to 50% of them having associated thyroid dysfunction. Routine screening for thyroid autoimmunity and dysfunction is recommended in all T1DM patients. However, this was not currently practiced in Ugandan paediatric diabetes clinics. There was also paucity of data regarding thyroid autoimmunity and dysfunction in African children and adolescents with diabetes mellitus. The objective of this study was to quantify the magnitude of thyroid autoimmunity and dysfunction in Ugandan children with TIDM. This was a cross sectional descriptive study to determine the prevalence of thyroid autoantibodies and describe thyroid function among children and adolescents aged 1-19 years with diabetes mellitus attending the paediatric diabetes clinic at Mulago National Referral Hospital, Kampala, Uganda. Following enrollment, we obtained details of clinical history and performed physical examination. Blood (plasma) was assayed to determine levels of antibodies to thyroid peroxidase (antiTPO), free thyroxine (FT4) and thyrotropin (TSH). The prevalence of thyroid autoimmunity was 7.3% (5/69). All antiTPO positive subjects were post pubertal, aged between 13-17 years with females comprising 3/5 of the antiTPO positive subjects. All study subjects were clinically euthyroid; however, 7.3% (5/69) of the study subjects had subclinical hypothyroidism. These data strengthen the argument for routine screening of all diabetic children and adolescents for thyroid autoimmunity (particularly anti-TPO) as recommended by international guidelines. We also recommend evaluation of thyroid function in diabetic children and adolescents to minimize the risk of undiagnosed thyroid dysfunction.

  9. Listeriosis at a Tertiary Care Hospital in Beijing, China: High Prevalence of Nonclustered Healthcare-Associated Cases Among Adult Patients

    PubMed Central

    Wang, Huan-ling; Ghanem, Khalil G.; Wang, Peng; Yang, Shuang; Li, Tai-sheng

    2013-01-01

    Background. Listeriosis is an emerging infectious disease associated with high mortality. There are few published reports from East Asia and developing countries. Our goal was to describe the clinical characteristics and outcomes of patients diagnosed with Listeria monocytogenes at a tertiary care hospital in Beijing, China. Methods. Peking Union Medical College Hospital (PUMCH), an 1800-bed hospital, consists of 2 campuses that house different medical departments. We retrospectively reviewed all culture-proven cases of listeriosis occurring at PUMCH between 1999 and 2011. Point estimates and 95% confidence intervals are presented. Results. There were 38 patients with listeriosis: 5 neonatal, 8 maternal, and 25 nonmaternal. The median age of the adult nonmaternal patients was 47 (range, 18–79) years with a female predominance (72%). Forty percent (n = 10) had an underlying rheumatic disease. Forty-four percent of cases (n = 11) were healthcare-associated infections occurring a median of 20 (range, 3–44) days after hospital admission. Only 2 of the 11 healthcare-associated cases clustered in space and time. One healthcare-associated case occurred in a patient receiving KHI-272 therapy, an oral, irreversible dual EGFR/HER2 inhibitor. The neonatal and maternal listeriosis cases were similar to those reported in the literature. Conclusions. Nonclustered healthcare-associated cases of L. monocytogenes occurred at a large tertiary care hospital in Beijing, China. The source of these infections is unclear. Although rare, in the setting of immunosuppression, Listeria should be considered in the differential diagnosis of healthcare-associated infections, even in the absence of a point-source outbreak. PMID:23175565

  10. Listeriosis at a tertiary care hospital in beijing, china: high prevalence of nonclustered healthcare-associated cases among adult patients.

    PubMed

    Wang, Huan-Ling; Ghanem, Khalil G; Wang, Peng; Yang, Shuang; Li, Tai-Sheng

    2013-03-01

    Listeriosis is an emerging infectious disease associated with high mortality. There are few published reports from East Asia and developing countries. Our goal was to describe the clinical characteristics and outcomes of patients diagnosed with Listeria monocytogenes at a tertiary care hospital in Beijing, China. Peking Union Medical College Hospital (PUMCH), an 1800-bed hospital, consists of 2 campuses that house different medical departments. We retrospectively reviewed all culture-proven cases of listeriosis occurring at PUMCH between 1999 and 2011. Point estimates and 95% confidence intervals are presented. There were 38 patients with listeriosis: 5 neonatal, 8 maternal, and 25 nonmaternal. The median age of the adult nonmaternal patients was 47 (range, 18-79) years with a female predominance (72%). Forty percent (n = 10) had an underlying rheumatic disease. Forty-four percent of cases (n = 11) were healthcare-associated infections occurring a median of 20 (range, 3-44) days after hospital admission. Only 2 of the 11 healthcare-associated cases clustered in space and time. One healthcare-associated case occurred in a patient receiving KHI-272 therapy, an oral, irreversible dual EGFR/HER2 inhibitor. The neonatal and maternal listeriosis cases were similar to those reported in the literature. Nonclustered healthcare-associated cases of L. monocytogenes occurred at a large tertiary care hospital in Beijing, China. The source of these infections is unclear. Although rare, in the setting of immunosuppression, Listeria should be considered in the differential diagnosis of healthcare-associated infections, even in the absence of a point-source outbreak.

  11. Urgent tracheostomy: four-year experience in a tertiary hospital.

    PubMed

    Costa, Liliana; Matos, Ricardo; Júlio, Sara; Vales, Fernando; Santos, Margarida

    2016-01-01

    Urgent airway management is one of the most important responsibilities of otolaryngologists, often requiring a multidisciplinary approach. Urgent surgical airway intervention is indicated when an acute airway obstruction occurs or there are intubation difficulties. In these situations, surgical tracheostomy becomes extremely important. We retrospectively studied the patients who underwent surgical tracheostomy from 2011 to 2014 by an otolaryngologist team at the operating theater of the emergency department of a tertiary hospital. Indications, complications and clinical evolution of the patients were reviewed. The study included 56 patients (44 men and 12 women) with a median age of 55 years. The procedure was performed under local anesthesia in 21.4% of the patients. Two (3.6%) patients were subjected to conversion from cricothyrostomy to tracheostomy. Head and neck neoplasm was indicated in 44.6% of the patients, deep neck infection in 19.6%, and bilateral vocal fold paralysis in 10.7%. Stridor was the most frequent signal (51.8%). Of the 56 patients, 15 were transferred to another hospital. Among the other 41 patients, 21 were decannulated (average time: 4 months), and none of them were cancer patients. Complications occurred in 5 (12.2%) patients: hemorrhage in 3, surgical wound infection in 1, and cervico-thoracic subcutaneous emphysema in 1. No death was related to the procedure. Urgent tracheostomy is a life-saving procedure for patients with acute airway obstruction or with difficult intubation. It is a safe and effective procedure, with a low complication rate, and should be performed before the patient's clinical status turns into a surgical emergency situation.

  12. Nurses’ Perceptions of Spirituality and Spiritual Care at Five Tertiary Care Hospitals in Riyadh, Saudi Arabia: A Cross-Sectional Study

    PubMed Central

    Kaddourah, Bayan; Abu-Shaheen, Amani; Al-Tannir, Mohamad

    2018-01-01

    Objectives To identify the perceptions towards spirituality and spiritual care among nurses at tertiary care hospitals in Riyadh, Saudi Arabia. Methods A cross-sectional study was conducted on nurses at five tertiary care hospitals in Riyadh. The data were collected using the Spirituality and Spiritual Care Rating Scale (SSCRS). Results We recruited 978 nurses, of which 896 (91.6%) were female. The mean SSCRS score was 3.8±0.5 (the spirituality and spiritual care statements fell within the ‘agree’ category). A statistically significant difference was found only between perceptions of spirituality and spiritual care among nurses and their nursing experience duration. Conclusions The findings of this study revealed that nurses were oriented to spirituality, and respected the importance of providing spiritual care to their patients. The nurses believed that spirituality exists in all religions and spiritual care means showing concern while treating the patients by focusing on respecting patients’ religious beliefs. PMID:29657685

  13. Medical Device-Associated Candida Infections in a Rural Tertiary Care Teaching Hospital of India.

    PubMed

    Deorukhkar, Sachin C; Saini, Santosh

    2016-01-01

    Health care associated infections (HCAIs) add incrementally to the morbidity, mortality, and cost expected of the patient's underlying diseases alone. Approximately, about half all cases of HCAIs are associated with medical devices. As Candida medical device-associated infection is highly drug resistant and can lead to serious life-threatening complications, there is a need of continuous surveillance of these infections to initiate preventive and corrective measures. The present study was conducted at a rural tertiary care hospital of India with an aim to evaluate the rate of medical device-associated Candida infections. Three commonly encountered medical device-associated infections (MDAI), catheter-associated urinary tract infection (CA-UTI), intravascular catheter-related blood stream infections (CR-BSI), and ventilator-associated pneumonia (VAP), were targeted. The overall rate of MDAI in our hospital was 2.1 per 1000 device days. The rate of Candida related CA-UTI and CR-BSI was noted as 1.0 and 0.3, respectively. Untiring efforts taken by team members of Hospital Acquired Infection Control Committee along with maintenance of meticulous hygiene of the hospital and wards may explain the low MDAI rates in our institute. The present surveillance helped us for systematic generation of institutional data regarding MDAI with special reference to role of Candida spp.

  14. Cost analysis of in-patient cancer chemotherapy at a tertiary care hospital.

    PubMed

    Wani, Mohammad Ashraf; Tabish, S A; Jan, Farooq A; Khan, Nazir A; Wafai, Z A; Pandita, K K

    2013-01-01

    Cancer remains a major health problem in all communities worldwide. Rising healthcare costs associated with treating advanced cancers present a significant economic challenge. It is a need of the hour that the health sector should devise cost-effective measures to be put in place for better affordability of treatments. To achieve this objective, information generation through indigenous hospital data on unit cost of in-patient cancer chemotherapy in medical oncology became imperative and thus hallmark of this study. The present prospective hospital based study was conducted in Medical Oncology Department of tertiary care teaching hospital. After permission from the Ethical Committee, a prospective study of 6 months duration was carried out to study the cost of treatment provided to in-patients in Medical Oncology. Direct costs that include the cost of material, labor and laboratory investigations, along with indirect costs were calculated, and data analyzed to compute unit cost of treatment. The major cost components of in-patient cancer chemotherapy are cost of drugs and materials as 46.88% and labor as 48.45%. The average unit cost per patient per bed day for in-patient chemotherapy is Rs. 5725.12 ($125.96). This includes expenditure incurred both by the hospital and the patient (out of pocket). The economic burden of cancer treatment is quite high both for the patient and the healthcare provider. Modalities in the form of health insurance coverage need to be established and strengthened for pooling of resources for the treatment and transfer of risks of these patients.

  15. [Streptococcal toxic shock syndrome: ten years' experience at a tertiary hospital].

    PubMed

    Vallalta-Morales, Manuel; Salavert-Lletí, Miguel; Artero-Mora, Arturo; Mahiques-Santos, Laura; Solaz-Moreno, Elena; Pérez-Bellés, Carmen

    2005-11-01

    In the last two decades there has been a reported increase in the incidence of streptococcal toxic shock syndrome (STSS). The objective of this study was to determine the clinical and epidemiological characteristics of this infection. Retrospective study of all cases of STSS diagnosed at a single tertiary hospital over the last ten years. We report 13 cases of STSS (8 men, mean age 62 years). The mean annual incidence was 0.19 episodes/100,000 population from 1994 to 1998 and 0.53 episodes/100,000 population from 1999 to 2003 (p = 0.059). All patients had at least one underlying disease and there were no intravenous drug users. The most common portals of entry were the skin and soft tissues (85%) and all but one patient had a positive blood culture. Two cases were nosocomial and five patients required surgery (amputation and/or debridement). There was a high mortality rate (85%) and a rapid course from onset to death; nine patients died within four days after establishing the diagnosis. The incidence of SSTS has increased over the last five years at our hospital. Elderly patients with underlying medical conditions were more susceptible to acquiring this infection. Early mortality was very high.

  16. Tertiary paediatric hospital health professionals' attitudes to lesbian, gay, bisexual and transgender parents seeking health care for their children.

    PubMed

    Nicol, Pam; Chapman, Rose; Watkins, Rochelle; Young, Jeanine; Shields, Linda

    2013-12-01

    To ascertain health professionals' knowledge, attitudes and beliefs towards lesbian, gay, bisexual and transgender parents seeking health care for their children in a paediatric tertiary hospital setting which practises family-centred care. Lesbian, gay, bisexual and transgender parents are often reluctant to disclose their sexual orientation to health professionals for fear of discrimination and compromised quality of care. Staff knowledge, attitudes and beliefs can influence disclosure by parents, but little is known about knowledge, attitudes and beliefs in paediatric tertiary hospital staff towards lesbian, gay, bisexual and transgender parents accessing care for their children. Descriptive comparative study of health staff using a cross-sectional survey. A set of validated anonymous questionnaires was used to assess knowledge about homosexuality, attitudes towards lesbians and gay men, and gay affirmative practice. Three open-ended questions were also used to assess beliefs about encouraging disclosure of lesbian, gay, bisexual and transgender parenting roles and how this may impact on care. Of the 646 staff surveyed, 212 (32.8%) responded. Knowledge and attitudes were significantly associated with professional group, gender, Caucasian race, political voting behaviour, presence of religious beliefs, the frequency of attendance at religious services, the frequency of praying, and having a friend who was openly lesbian, gay, bisexual and transgender. This study highlighted that staff working in a tertiary paediatric hospital setting, with family-centred care models in place, held attitudes and beliefs that may impact on the experience of hospitalisation for lesbian, gay, bisexual and transgender parents, and the quality of care received by their children. To promote equitable care to all families, organisations should ensure that family-centred care policies and guidelines are adopted and appropriately implemented. In addition to formal education, affirmative

  17. Microbiological profile and risk factors for in-hospital mortality of infective endocarditis in tertiary care hospitals of south Vietnam.

    PubMed

    Tran, Hoang M; Truong, Vien T; Ngo, Tam M N; Bui, Quoc P V; Nguyen, Hoang C; Le, Trung T Q; Mazur, Wojciech; Chung, Eugene; Cafardi, John M; Pham, Khanh P N; Duong, Hoang H N; Nguyen, Thach; Nguyen, Vu T; Pham, Vinh N

    2017-01-01

    We aimed to evaluate the microbiological characteristics and risk factors for mortality of infective endocarditis in two tertiary hospitals in Ho Chi Minh City, south Vietnam. A retrospective study of 189 patients (120 men, 69 women; mean age 38 ± 18 years) with the diagnosis of probable or definite infective endocarditis (IE) according to the modified Duke Criteria admitted to The Heart Institute or Tam Duc Hospital between January 2005 and December 2014. IE was related to a native valve in 165 patients (87.3%), and prosthetic valve in 24 (12.7%). Of the 189 patients in our series, the culture positive rate was 70.4%. The most common isolated pathogens were Streptococci (75.2%), Staphylococci (9.8%) followed by gram negative organism (4.5%). The sensitivity rate of Streptococci to ampicillin, ceftriaxone or vancomycin was 100%. The rate of methicillin resistant Staphylococcus aureus was 40%. There was a decrease in penicillin sensitivity for Streptococci over three eras: 2005-2007 (100%), 2008-2010 (94%) and 2010-2014 (84%). The in-hospital mortality rate was 6.9%. Logistic regression analysis found prosthetic valve and NYHA grade 3 or 4 heart failure and vegetation size of more than 15 mm as strong predictors of in-hospital mortality. Streptococcal species were the major pathogen of IE in the recent years with low rates of antimicrobial resistance. Prosthetic valve involvement, moderate or severe heart failure and vegetation size of more than 15 mm were independent predictors for in-hospital mortality in IE.

  18. Primary Immunodeficiency Diseases in Oman: 10-Year Experience in a Tertiary Care Hospital.

    PubMed

    Al-Tamemi, Salem; Naseem, Shafiq Ur Rehman; Al-Siyabi, Nabila; El-Nour, Ibtisam; Al-Rawas, Abdulhakim; Dennison, David

    2016-11-01

    Primary immunodeficiency (PID) diseases are rare, complex medical disorders that often are overlooked in clinical settings. There are emerging reports of PID from Middle Eastern populations. This study describes the features of PID patients in a tertiary care setting in Oman and compares them with regional and worldwide reports. Sultan Qaboos University Hospital (SQUH) is an academic tertiary care-level hospital for specialized healthcare, including PID patients. At the time of diagnosis, patients' sociodemographics, clinical features, laboratory investigations, and management were entered in electronic form. This study included patients seen between August 2005 and July 2015. One hundred forty patients were registered with a minimum estimated population prevalence of 7.0/100,000. The male/female ratio was 1.6:1, the median age of onset of symptoms was 8 months, and diagnosis was 21 months with a delay of 13 months. Family history was positive in 44 %, consanguinity was present in 76 %, death of a previous sibling was present in 36 %, and there was an overall mortality in 18 %, with an 85 % probability of survival 10 years following diagnosis. The most common type of immunodeficiency was phagocytic disorders (35.0 %), followed by predominantly antibody disorders (20.7 %), combined immunodeficiency (17.8 %), other well-defined PID syndromes (15.0 %), immune dysregulation syndromes (3.5 %), complement deficiencies (3.5 %), and unclassified immunodeficiency (4.2 %). The commonest presenting infection was pneumonia (47.1 %). PID is not a rare condition in Oman. The prevalence is in concordance with reports from the region but higher than in Western populations. The findings of the current study would help to improve the awareness and management of, and policy making for PID.

  19. Transfer from primary maternity unit to tertiary hospital in New Zealand - timing, frequency, reasons, urgency and outcomes: Part of the Evaluating Maternity Units study.

    PubMed

    Grigg, Celia P; Tracy, Sally K; Tracy, Mark; Schmied, Virginia; Monk, Amy

    2015-09-01

    to examine the transfers from primary maternity units to a tertiary hospital in New Zealand by describing the frequency, timing, reasons and outcomes of those who had antenatal or pre-admission birthplace plan changes, and transfers in labour or postnatally. mixed methods prospective (concurrent) cohort study, which analysed transfer and clinical outcome data (407 primary unit cohort, 285 tertiary hospital cohort), and data from the six week postpartum survey (571 respondents). well, pregnant women booked to give birth in a tertiary maternity hospital or primary maternity unit in one region in New Zealand (2010-2012). All women received midwifery continuity of care, regardless of their intended or actual birthplace. fewer than half of the women who planned a primary unit birth gave birth there (191 or 46.9%). A change of plan may have been made either antenatally or before admission in labour; and transfers were made after admission to the primary unit in labour or during the postnatal stay (about 48 hours). Of the 117 (28.5%) planning a primary unit birth who changed their planned birthplace type antenatally 73 (62.4%) were due to a clinical indication. Earthquakes accounted for 28.1% of birthplace change (during the research period major earthquakes occurred in the study region). Most (73.8%) labour changes occurred before admission in labour to the primary unit. For the 76 women who changed plan at this stage the most common reasons to do so were a rapid labour (25.0%) or prolonged rupture of membranes (23.7%). Transfers in labour from primary unit to tertiary hospital occurred for 27 women (12.6%) of whom 26 (96.3%) were having their first baby. "Slow progress" of labour accounted for 21 (77.8%) of these and 17 (62.9%) were classified as 'non-emergency'. The average transfer time for 'emergency' transfers was 58 minutes. The average time for all labour transfers from specialist consultation to birth was 4.5 hours. Nine postnatal transfers (maternal or neonatal

  20. Perceptual Influence of Ugandan Biology Students' Understanding of HIV/AIDS

    NASA Astrophysics Data System (ADS)

    Mutonyi, Harriet; Nashon, Samson; Nielsen, Wendy S.

    2010-08-01

    In Uganda, curbing the spread of HIV/AIDS has largely depended on public and private media messages about the disease. Media campaigns based on Uganda’s cultural norms of communication are metaphorical, analogical and simile-like. The topic of HIV/AIDS has been introduced into the Senior Three (Grade 11) biology curriculum in Uganda. To what extent do students’ pre-conceptions of the disease, based on these media messages influence students’ development of conceptual understanding of the disease, its transmission and prevention? Of significant importance is the impact the conceptions students have developed from the indirect media messages on classroom instruction on HIV/AIDS. The study is based in a theoretical framework of conceptual change in science learning. An interpretive case study to determine the impact of Ugandan students’ conceptions or perceptions on classroom instruction about HIV/AIDS, involving 160 students aged 15-17, was conducted in four different Ugandan high schools: girls boarding, boys boarding, mixed boarding, and mixed day. Using questionnaires, focus group discussions, recorded biology lessons and informal interviews, students’ preconceptions of HIV/AIDS and how these impact lessons on HIV/AIDS were discerned. These preconceptions fall into four main categories: religious, political, conspiracy and traditional African worldviews. Results of data analysis suggest that students’ prior knowledge is persistent even after biology instructions. This has implications for current teaching approaches, which are mostly teacher-centred in Ugandan schools. A rethinking of the curriculum with the intent of offering science education programs that promote understanding of the science of HIV/AIDS as opposed to what is happening now—insensitivity to misconceptions about the disease—is needed.

  1. Comparison of stress and burnout among anesthesia and surgical residents in a tertiary care teaching hospital in North India.

    PubMed

    Gandhi, K; Sahni, N; Padhy, S K; Mathew, P J

    2017-10-23

    The residents undergoing training at hospitals in our country face challenges in terms of infrastructure and high workload with undefined working hours. The aim of the study was to compare the stress and burnout levels in trainee doctors doing residency in surgical fields and anesthesia at a tertiary care academic center in North India. A comparative, observational study was conducted in a tertiary care teaching hospital in North India. After Ethics Committee approval, 200 residents (100 each from surgical branches and anesthesia) were required to fill a questionnaire with information about age, sex, year of residency, marital status, and the Perceived Stress Scale-10, and Burnout Clinical Subtype Questionnaire-12. Burnout and perceived stress were compared between residents of anesthesia and surgical specialties. Residents of both surgical and anesthesia branches scored high in perceived stress, namely 21 and 18, respectively. The score was significantly higher in surgical residents (P = 0.03) and increased progressively with the year of residency. The majority of residents (90% surgical, 80% anesthesia) felt that they were being overloaded with work. However, only 20%-30% of respondents felt that there was lack of development of individual skills and still fewer (<10%) reported giving up in view of difficulties. There is high level of stress and overload dimension of burnout among the residents of anesthesia and surgical branches at our tertiary care academic institution and the surgical residents score marginally higher than anesthesia residents.

  2. The impact of reducing intensive care unit length of stay on hospital costs: evidence from a tertiary care hospital in Canada.

    PubMed

    Evans, Jessica; Kobewka, Daniel; Thavorn, Kednapa; D'Egidio, Gianni; Rosenberg, Erin; Kyeremanteng, Kwadwo

    2018-02-23

    To use theoretical modelling exercises to determine the effect of reduced intensive care unit (ICU) length of stay (LOS) on total hospital costs at a Canadian centre. We conducted a retrospective cost analysis from the perspective of one tertiary teaching hospital in Canada. Cost, demographic, clinical, and LOS data were retrieved through case-costing, patient registry, and hospital abstract systems of The Ottawa Hospital Data Warehouse for all new in-patient ward (30,483) and ICU (2,239) encounters between April 2012 and March 2013. Aggregate mean daily variable direct (VD) costs for ICU vs ward encounters were summarized by admission day number, LOS, and cost centre. The mean daily VD cost per ICU patient was $2,472 (CAD), accounting for 67.0% of total daily ICU costs per patient and $717 for patients admitted to the ward. Variable direct cost is greatest on the first day of ICU admission ($3,708), and then decreases by 39.8% to plateau by the fifth day of admission. Reducing LOS among patients with ICU stays ≥ four days could potentially result in an annual hospital cost saving of $852,146 which represents 0.3% of total in-patient hospital costs and 1.2% of ICU costs. Reducing ICU LOS has limited cost-saving potential given that ICU costs are greatest early in the course of admission, and this study does not support the notion of reducing ICU LOS as a sole cost-saving strategy.

  3. [Current status of job burnout in clinical nurses in a grade A tertiary hospital and related influencing factors].

    PubMed

    Ye, L Y; Fan, C L; Wang, L G; Tao, T; Gao, W B; Li, Y H

    2017-10-20

    Objective: To investigate the current status of job burnout in clinical nurses in a grade A tertiary hospitalin Shaoxing,China and related influencing factors. Methods: In October 2016, the Nursing Burnout Scale (NBS)was used for the investigation of 304 clinical nurses in a grade A tertiary hospital.The contents of the investigation included general data(including age,education background,working years,marital status, frequency of night shifts,professional title, and way of employment), characteristics of working environment,burnout, personality characteristics,coping strategy,and psychosomatic symptoms.SPSS 18.0 was used to conduct Pearson correlation analysis of the scores of each dimension of NBS. A multivariate regression analysis was performed with the demographic features of clinical nurses as the independent variable and the scores of each dimension of NBS as the dependent variable. Results: Among the clinical nurses in this grade A tertiary hospital, the incidence rate of severe burnout was 74%.The Pearson correlation analysis showed that burnout,pessimistic personality,negative coping,and psychosomatic symptoms were positively correlated with working environment( r =0.530,0.316,0.116,and 0.502); pessimistic personality and psychosomatic symptoms were positively correlated with burnout( r =0.618 and 0.675); psychosomatic symptoms were positively correlated withpessimistic personality( r =0.540); negative coping was negatively correlated with pessimistic personality( r =-0.145).The multivariate linear regression analysis showed that department(Department of Internal Medicine or Department of Surgery, B =-0.364 and -0.428)and frequency of night shifts(<6 times/month and 6 - 10 times/month, B =0.199 and 0.256)were influencing factors for the score of working environment; department(Department of Internal Medicine or Department of Surgery, B =-0.350 and -0.360)was an influencing factor for the score of burnout; 1 - 3 working years( B =-0.238)was an influencing

  4. Clinicomycological Characterization of Superficial Mycoses from a Tertiary Care Hospital in Nepal.

    PubMed

    Khadka, Sundar; Sherchand, Jeevan Bahadur; Pokharel, Dinesh Binod; Pokhrel, Bharat Mani; Mishra, Shyam Kumar; Dhital, Subhash; Rijal, Basista

    2016-01-01

    Background . Superficial mycosis is a common fungal infection worldwide, mainly caused by dermatophytes. However, the prevalence of species varies geographically. In addition, fungal treatment is best guided according to species isolated. This study was carried out to determine the clinical as well as mycological profile of superficial mycoses in a tertiary care hospital, Nepal. Methods . This was a prospective case-control laboratory based study conducted over a period of six months from January to June 2014 at Tribhuvan University Teaching Hospital, Nepal. A total of 200 specimens were collected from the patients suspected of superficial mycoses. The specimens were macroscopically as well as microscopically examined. The growth was observed up to 4 weeks. Results. Out of total 200 specimens from the patients suspected of superficial mycoses, tinea corporis 50 (25%) was most common clinical types. KOH mount was positive in 89 (44.5%) and culture was positive in 111 (55.5%). Trichophyton mentagrophytes 44 (39.6%) was the most common isolate. Conclusions. The diagnostic yields of KOH mount and culture were found to be complementary to each other. Thus both the methods added with clinical findings are equally important to establish superficial mycosis.

  5. Burnout and quality of life in nurses of a tertiary care hospital in Pakistan.

    PubMed

    Naz, Shahana; Hashmi, Ali Madeeh; Asif, Aftab

    2016-05-01

    To determine the relationship of burnout and quality of life among nurses of different departments at a tertiary care hospital. The observational, cross-sectional study was conducted at Mayo Hospital, Lahore, from November 2013 to May2014, and comprised nurses recruited by convenience sampling. Maslach Burnout Inventory was used to assess burnout and World Health Organisation Quality of life instrument's BREF version was used to assess quality of life of the subjects. Data was analysed using SPSS 16. Of the 106 nurses with a mean age of 35.5±7 years, 83(79%) were experiencing severe burnout and a low quality of life. Nurses of Surgery and Obstetrics/Gynaecology departments who worked longer hours on the night shift scored higher on burnout and lower on quality of life. Burnout in nurses was very common because of increasing workload and can negatively affect their quality of life leading to compromised patient care.

  6. Determinants of mortality and prolonged hospital stay among dengue patients attending tertiary care hospital: a cross-sectional retrospective analysis

    PubMed Central

    Khan, Amer Hayat; Sarriff, Azmi; Adnan, Azreen Syazril; Khan, Yusra Habib

    2017-01-01

    Objectives Dengue imposes substantial economic, societal and personal burden in terms of hospital stay, morbidity and mortality. Early identification of dengue cases with high propensity of increased hospital stay and death could be of value in isolating patients in need of early interventions. The current study was aimed to determine the significant factors associated with dengue-related prolonged hospitalisation and death. Design Cross-sectional retrospective study. Setting Tertiary care teaching hospital. Participants Patients with confirmed dengue diagnosis were stratified into two categories on the basis of prolonged hospitalisation (≤3 days and >3 days) and mortality (fatal cases and non-fatal cases). Clinico-laboratory characteristics between these categories were compared by using appropriate statistical methods. Results Of 667 patients enrolled, 328 (49.2%) had prolonged hospitalisation. The mean hospital stay was 4.88±2.74 days. Multivariate analysis showed that dengue haemorrhagic fever (OR 2.3), elevated alkaline phosphatase (ALP) (OR 2.3), prolonged prothrombin time (PT) (OR 1.7), activated partial thromboplastin time (aPTT) (OR 1.9) and multiple-organ dysfunctions (OR 2.1) were independently associated with prolonged hospitalisation. Overall case fatality rate was 1.1%. Factors associated with dengue mortality were age >40 years (p=0.004), secondary infection (p=0.040), comorbidities (p<0.05), acute kidney injury (p<0.001), prolonged PT (p=0.022), multiple-organ dysfunctions (p<0.001), haematocrit >20% (p=0.001), rhabdomyolosis (p<0.001) and respiratory failure (p=0.007). Approximately half of the fatal cases in our study had prolonged hospital stay of greater than three days. Conclusions The results underscore the high proportion of dengue patients with prolonged hospital stay. Early identification of factors relating to prolonged hospitalisation and death will have obvious advantages in terms of appropriate decisions about treatment and

  7. Paediatric mild head injury: is routine admission to a tertiary trauma hospital necessary?

    PubMed

    Tallapragada, Krishna; Peddada, Ratna Soundarya; Dexter, Mark

    2018-03-01

    Previous studies have shown that children with isolated linear skull fractures have excellent clinical outcomes and low risk of surgery. We wish to identify other injury patterns within the spectrum of paediatric mild head injury, which need only conservative management. Children with low risk of evolving neurosurgical lesions could be safely managed in primary hospitals. We retrospectively analysed all children with mild head injury (i.e. admission Glasgow coma score 13-15) and skull fracture or haematoma on a head computed tomography scan admitted to Westmead Children's Hospital, Sydney over the years 2009-2014. Data were collected regarding demographics, clinical findings, mechanism of injury, head computed tomography scan findings, neurosurgical intervention, outcome and length of admission. Wilcoxon paired test was used with P value <0.05 considered significant. Four hundred and ten children were analysed. Three hundred and eighty-one (93%) children were managed conservatively, 18 (4%) underwent evacuation of extradural haematoma (TBI surgery) and 11 (3%) needed fracture repair surgery. Two children evolved a surgical lesion 24 h post-admission. Only 17 of 214 children transferred from peripheral hospitals needed neurosurgery. Overall outcomes: zero deaths, one needed brain injury rehabilitation and 63 needed child protection unit intervention. Seventy-five percentage of children with non-surgical lesions were discharged within 2 days. Eighty-three percentage of road transfers were discharged within 3 days. Children with small intracranial haematomas and/or skull fractures who need no surgery only require brief inpatient symptomatic treatment and could be safely managed in primary hospitals. Improved tertiary hospital transfer guidelines with protocols to manage clinical deterioration could have cost benefit without risking patient safety. © 2017 Royal Australasian College of Surgeons.

  8. Methicillin-resistant Staphylococcus aureus (MRSA) in a tertiary surgical and trauma hospital in Benghazi, Libya.

    PubMed

    Buzaid, Najat; Elzouki, Abdel-Naser; Taher, Ibrahim; Ghenghesh, Khalifa Sifaw

    2011-10-13

    Methicillin resistant Staphylococcus aureus (MRSA) is a multidrug resistant organism that threatens the continued effectiveness of antibiotics worldwide and causes a threat almost exclusively in hospitals and long-term care settings. This study investigated the prevalence of MRSA strains and their sensitivity patterns against various antibiotics used for treating hospitalized patients in a major tertiary surgical hospital in Benghazi, Libya. We investigated 200 non-duplicate S. aureus strains isolated from different clinical specimens submitted to the Microbiology Laboratory at Aljala Surgical and Trauma Hospital, Benghazi, Libya from April to July 2007. Isolates were tested for methicillin resistance by the oxacillin disc-diffusion assay according to Clinical and Laboratory Standards Institute guidelines. MRSA strains were tested for antimicrobial resistance (i.e., vancomycin, ciprofloxacin, erythromycin, chloramphenicol and fusidic acid) using commercial discs. Information on patient demographics and clinical disease was also collected. Of the isolates examined 31% (62/200) were MRSA. No significant differences were observed in the prevalence of MRSA among S. aureus from females or males or from different age groups. Most MRSA were isolated from burns and surgical wound infections. Antibiotic resistance patterns of 62 patients with MRSA to vancomycin, ciprofloxacin, fusidic acid, chloramphenicol and erythromycin were 17.7%, 33.9%, 41.9%, 38.7% and 46.8% of cases, respectively. MRSA prevalence in our hospital was high and this may be the case for other hospitals in Libya. A sound surveillance program of nosocomial infections is urgently needed to reduce the incidence of infections due to MRSA and other antimicrobial-resistant pathogens in Libyan hospitals.

  9. Cost effectiveness of screening of all newly recruited employees for diabetes at a tertiary care hospital.

    PubMed

    Ali, Niloufer Sultan; Khuwaja, Ali Khan

    2007-01-01

    Diabetes Mellitus is a disease which remains asymptomatic for long duration of time and usually diagnosed either when gets complicated or by routine or opportunistic screening. The practice of universal screening is not recommended, particularly in constraint resources. However, we embarked with a study to assess the yield of recommended screening for Type 2 diabetes in all the newly recruited employees at a tertiary care hospital in Karachi. All the information required for this study was collected from medical records of all newly recruited employees of nursing services department of a tertiary care hospital of Karachi, Pakistan, over a period of 5 months (August 2004 to December 2004). Out of 360 subjects, 326, whose information was found to be complete, were included for final analysis. Mean age of the study subjects was 25.3 +/- 4.7 years and their mean casual plasma glucose level was 99.1 +/- 16.3 mg/dl. 315 (96.6%) study subjects had casual plasma glucose level of 139 mg/dl or less. Only 10 (3.1%) study subjects had casual plasma glucose levels between 140 to 199 mg/dl. Just one employee, 41 years old, was found to have casual plasma glucose level of 213 mg/dl. In this study, screening of all individuals for diabetes had a very low yield. Recommendation of universal screening for diabetes does not represent a good use of resources and perhaps not cost-effective. However, periodic screening of high risk individuals should be warranted.

  10. Severe Plasmodium knowlesi Malaria in a Tertiary Care Hospital, Sabah, Malaysia

    PubMed Central

    William, Timothy; Menon, Jayaram; Rajahram, Giri; Chan, Leslie; Ma, Gordon; Donaldson, Samantha; Khoo, Serena; Fredrick, Charlie; Jelip, Jenarun; Anstey, Nicholas M.

    2011-01-01

    The simian parasite Plasmodium knowlesi causes severe human malaria; the optimal treatment remains unknown. We describe the clinical features, disease spectrum, and response to antimalarial chemotherapy, including artemether-lumefantrine and artesunate, in patients with P. knowlesi malaria diagnosed by PCR during December 2007–November 2009 at a tertiary care hospital in Sabah, Malaysia. Fifty-six patients had PCR-confirmed P. knowlesi monoinfection and clinical records available for review. Twenty-two (39%) had severe malaria; of these, 6 (27%) died. Thirteen (59%) had respiratory distress; 12 (55%), acute renal failure; and 12, shock. None experienced coma. Patients with uncomplicated disease received chloroquine, quinine, or artemether-lumefantrine, and those with severe disease received intravenous quinine or artesunate. Parasite clearance times were 1–2 days shorter with either artemether-lumefantrine or artesunate treatment. P. knowlesi is a major cause of severe and fatal malaria in Sabah. Artemisinin derivatives rapidly clear parasitemia and are efficacious in treating uncomplicated and severe knowlesi malaria. PMID:21762579

  11. Family caregivers in public tertiary care hospitals in Bangladesh: Risks and opportunities for infection control

    PubMed Central

    Islam, M. Saiful; Luby, Stephen P.; Sultana, Rebeca; Rimi, Nadia Ali; Zaman, Rashid Uz; Uddin, Main; Nahar, Nazmun; Rahman, Mahmudur; Hossain, M. Jahangir; Gurley, Emily S.

    2015-01-01

    Background Family caregivers are integral to patient care in Bangladeshi public hospitals. This study explored family caregivers’ activities and their perceptions and practices related to disease transmission and prevention in public hospitals. Methods Trained qualitative researchers conducted a total of 48 hours of observation in 3 public tertiary care hospitals and 12 in-depth interviews with family caregivers. Results Family caregivers provided care 24 hours a day, including bedside nursing, cleaning care, and psychologic support. During observations, family members provided 2,065 episodes of care giving, 75% (1,544) of which involved close contact with patients. We observed family caregivers washing their hands with soap on only 4 occasions. The majority of respondents said diseases are transmitted through physical contact with surfaces and objects that have been contaminated with patient secretions and excretions, and avoiding contact with these contaminated objects would help prevent disease. Conclusion Family caregivers are at risk for hospital-acquired infection from their repeated exposure to infectious agents combined with their inadequate hand hygiene and knowledge about disease transmission. Future research should explore potential strategies to improve family caregivers’ knowledge about disease transmission and reduce family caregiver exposures, which may be accomplished by improving care provided by health care workers. PMID:24406254

  12. Family caregivers in public tertiary care hospitals in Bangladesh: risks and opportunities for infection control.

    PubMed

    Islam, M Saiful; Luby, Stephen P; Sultana, Rebeca; Rimi, Nadia Ali; Zaman, Rashid Uz; Uddin, Main; Nahar, Nazmun; Rahman, Mahmudur; Hossain, M Jahangir; Gurley, Emily S

    2014-03-01

    Family caregivers are integral to patient care in Bangladeshi public hospitals. This study explored family caregivers' activities and their perceptions and practices related to disease transmission and prevention in public hospitals. Trained qualitative researchers conducted a total of 48 hours of observation in 3 public tertiary care hospitals and 12 in-depth interviews with family caregivers. Family caregivers provided care 24 hours a day, including bedside nursing, cleaning care, and psychologic support. During observations, family members provided 2,065 episodes of care giving, 75% (1,544) of which involved close contact with patients. We observed family caregivers washing their hands with soap on only 4 occasions. The majority of respondents said diseases are transmitted through physical contact with surfaces and objects that have been contaminated with patient secretions and excretions, and avoiding contact with these contaminated objects would help prevent disease. Family caregivers are at risk for hospital-acquired infection from their repeated exposure to infectious agents combined with their inadequate hand hygiene and knowledge about disease transmission. Future research should explore potential strategies to improve family caregivers' knowledge about disease transmission and reduce family caregiver exposures, which may be accomplished by improving care provided by health care workers. Copyright © 2014 Association for Professionals in Infection Control and Epidemiology, Inc. All rights reserved.

  13. Comparison of two public sector tertiary care hospitals' management in reducing direct medical cost burden on breast carcinoma patients in Lahore, Pakistan.

    PubMed

    Hameed Khaliq, Imran; Zahid Mahmood, Hafiz; Akhter, Naveed; Danish Sarfraz, Muhammad; Asim, Khadija; Masood Gondal, Khalid

    2018-01-01

    Breast cancer is one of the major causes of death incurring highest morbidity and mortality amongst women of Pakistan. The purpose of this study was to assess and compare the role of two public sector tertiary care hospitals' management in reducing out of pocket (OOP) expenses on direct medical costs borne by breast carcinoma patients' household from diagnosis through treatment. Moreover, the study intended to explore the reasons of opting private diagnostic facilities by the said patients during the services taken from the foresaid tertiary care centers. A purposive sample of 164 primary breast carcinoma patients was recruited for data collection of this cross-sectional study. Face to face interviews and semistructured questionnaires were adopted as method of data gathering tools. Major cost components of direct medical costs were used to compare the financial strain on the patients' households of both targeted hospitals. In addition, information was collected regarding the reasons of opting private diagnostic centers for investigations. Frequency, percentages, median and inter quartile range (IQR) were calculated for the data. Non-parametric variables were compared using the Mann-Whitney U test. It was observed that overall direct medical cost borne by the breast carcinoma patients' households in Jinnah hospital (median US$1153.93 / Rs. 118,589) was significantly higher than Mayo hospital (median US$427.93 /Rs. 43,978), p<0.001; r=0.623. Moreover, spending on almost all of the components of direct medical cost were found smaller in case of Mayo hospital's patients as compared to Jinnah hospital. This study indicates that OOP direct medical cost burden was found considerably less in Mayo hospital as compared to Jinnah hospital. The OOP expenditures on chemotherapy were overwhelmingly high. However, high spending on privately opted investigations procedures was the common issue of the patients under treatment in both hospitals.

  14. Assessment of maternal risk factors associated with low birth weight neonates at a tertiary hospital, Nanded, Maharashtra.

    PubMed

    Domple, Vijay Kishanrao; Doibale, Mohan K; Nair, Abhilasha; Rajput, Pinkesh S

    2016-01-01

    To assess the maternal risk factors associated with low birth weight (LBW) neonates at a tertiary hospital, Nanded, Maharashtra. This study was carried out in a tertiary care hospital in Nanded city of Maharashtra between January 2014 and July 2014 among 160 cases (LBW-birth weight ≤2499 g) and 160 controls (normal birth weight-birth weight >2499. Data collection was done by using predesigned questionnaire and also related health documents were checked and collected the expected information during the interview after obtaining informed consent from mothers. The data were analyzed by Epi Info 7 Version. The present study found the significant association among gestational age, sex of baby, type of delivery, maternal age, religion, education of mother and husband, occupation of mother and husband, type of family, maternal height, weight gain, hemoglobin level, planned/unplanned delivery, bad obstetric history, interval between pregnancies, previous history of LBW, underlying disease, tobacco chewing, timing of first antenatal care (ANC) visit, total number of ANC visit, and iron and folic acid (IFA) tablets consumption with LBW. No significant association was found among maternal age, residence, caste, consanguinity of marriage, socioeconomic status, gravida, birth order, multiple pregnancy, and smoking with LBW in our study. It was concluded that hemoglobin level, weight gain during pregnancy, gestational age, planned/unplanned delivery, bad obstetric history, and IFA tablets consumption during pregnancy were independent risk factors for LBW.

  15. Bloodstream infections at a tertiary referral hospital in Yangon, Myanmar.

    PubMed

    Myat, Tin Ohn; Prasad, Namrata; Thinn, Kyi Kyi; Win, Kyu Kyu; Htike, Wah Win; Zin, Khwar Nyo; Murdoch, David R; Crump, John A

    2014-11-01

    Data regarding characteristics of bloodstream infections in Myanmar are limited. Blood culture results from all outpatients and inpatients were extracted from records of the Clinical Microbiology Laboratory, Yangon General Hospital, for the period 2005 through 2013. Of 3865 blood cultures performed, 449 (11.6%) were positive for a pathogenic organism. Gram-negative bacteria was the most common organism group, accounting for 246 (55.5%) of 449 isolations. Staphylococcus aureus was the most common isolate, detected in 171 (38.1%) of 449 blood cultures. From 2005-2008 to 2009-2013 the proportion of all pathogenic isolates that were Gram-positive declined from 52.8% (167/316) to 20.3% (27/133) (p<0.001), whereas the proportion of Gram-negative bacteria rose from 45.6% (144/316) to 78.9% (105/133) (p<0.001), with non-fermentative bacilli accounting for much of this increase. Antimicrobial susceptibility testing demonstrated a high prevalence resistance of S. aureus to first-line antimicrobials such as erythromycin, penicillin and oxacillin. More than half of tested Escherichia coli and Citrobacter species showed resistance to amoxicillin-clavulanic acid, ceftriaxone or gentamicin. Bloodstream infections are common among patients receiving blood culture at a tertiary hospital in Yangon, Myanmar. Our findings suggest that antimicrobial resistance among invasive bacteria is common, similar to patterns described elsewhere in the region, and highlight the need for locally adapted antimicrobial guidelines for sepsis management. © The Author 2014. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Pregnancy of unknown location: Outcome in a tertiary care hospital.

    PubMed

    Amer, Nuzhat; Amer, Muhammad; Kolkaila, Mohamed Abdoh; Yaqoob, Shahida

    2015-10-01

    To find out the outcome of a cohort of women with pregnancy of unknown location presenting to a tertiary care hospital. The prospective study was conducted from January to December, 2011, at Early Pregnancy Assessment Unit, King Faisal Military Hospital, Khamis Mushait, Saudi Arabia. Data was collected for women with early pregnancy or with history of amenorrhoea, bleeding or pain. These women were investigated with serum beta-human chorionic gonadotrophin levels twice weekly and transvaginal ultrasonography weekly. Expectant management was done for failing pregnancy of unknown location while medical or surgical management was considered for persistent pregnancy of unknown location and ectopic pregnancy. During study period, 7215 patients were admitted, and, of them, 2212(30.6%) were patients with early pregnancy. Meeting the inclusion criteria were 183(2.53%) patients who formed the study sample. There were 131(71.6%) patients presenting with amenorrhoea, 90(49.2%) had bleeding and 93(50.8%) presented with pain. Outcome of 100(54.6%) patients was failing pregnancy of unknown location, 58(31.7%) had intrauterine pregnancy, 14(7.7%) converted to ectopic pregnancy, while 11(6%) had persistent pregnancy of unknown location. All patients with persistent pregnancy of unknown location and 5(36%) patients with ectopic pregnancy were medically treated. Five (36%) patients having ectopic pregnancy were managed surgically. Management of choice for asymptomatic patients having pregnancy of unknown location is expectant management. Most of the patients suspected to have Most of the patients with persistent pregnancy of unknown location and ectopic pregnancy can be managed medically.

  17. Utilization of physiotherapy in the continuum of stroke care at a tertiary hospital in Ibadan, Nigeria.

    PubMed

    Olaleye, Olubukola Adebisi; Lawal, Zainab Iyabo

    2017-03-01

    To investigate the pattern of referral for and utilisation of physiotherapy in the continuum of stroke care at a tertiary hospital in Ibadan, Nigeria. Referral notes and medical records of patients admitted in the University College Hospital, Ibadan with a clinical diagnosis of stroke between January, 2009 and December, 2013 were retrospectively reviewed. Information on age, sex, type of stroke, length of hospital stay, referral for physiotherapy and utilisation of physiotherapy were retrieved. Data were summarised using descriptive statistics and analysed using Chi-square test. A total of 783 patients with stroke were admitted in the hospital during the period under study. The in-patient mortality rate was 37.2%. The mean Length of Hospital Stay (LoHS) was 16.17±12.34 days. Referral rate for physiotherapy was high (75.8%) and the mean time from admission to referral for physiotherapy was three days. Majority of patients referred utilised physiotherapy (63.4%) and mean number of physiotherapy sessions received during in-patient care was 8.69±6.45. There was a significant association between LoHS and utilisation of in-patientphysiotherapy (p=0.02). The referral rate of stroke patients for physiotherapy was relatively high. Utilisation of in-patient physiotherapy reduced length of hospital stay among patients with stroke. Utilisation of out-patient physiotherapy was low. Strategies to enhance out-patient utilisation should be explored.

  18. Impact of an educational program on antibiotic use in a tertiary care hospital in a developing country.

    PubMed

    Thamlikitkul, V; Danchaivijitr, S; Kongpattanakul, S; Ckokloikaew, S

    1998-09-01

    A multi-cross-sectional study was conducted in a 2000-bed tertiary care university hospital in Bangkok, Thailand, from September 1993 to May 1994 to assess the effectiveness of an educational program on the use of antibiotics. Data on the study covered antibiotic usage both in-patients and out-patients. Data were collected for a 24-hour period every 2 weeks for 7 days for each 3-month period. The target population were residents, general practitioners, and sixth-year medical students. The educational program provided information derived from the data of inappropriate use of antibiotics during the pre-intervention period and guidelines on the use of antibiotics which were agreed to by a consensus among the faculty in all clinical departments. The study revealed: (1) the prevalence of antibiotic use and the cost of antibiotics during post-intervention period was significantly decreased by 20%; (2) the use of antibiotic prophylaxis for obstetrics patients and patients undergoing cataract surgery decreased significantly; (3) there was a shift from second or third generation cephalosporins to cefazolin for surgical prophylaxis; (4) the duration of perioperative antibiotic prophylaxis was reduced to under 2 days; (5) there was a shift from netilmicin or amikacin to gentamicin for the treatment of community acquired infection; and (6) the mortality, median length of hospital stay, and nosocomial infection rate among the patients who received antibiotics during the post-intervention period were not significantly different from those during the pre-intervention period. These results suggest that this educational program comprising information feedback and antibiotic usage guidelines was effective in improving antibiotic use at this tertiary care university hospital in Thailand.

  19. Relationship between maternal pelvis height and other anthropometric measurements in a multisite cohort of Ugandan mothers

    PubMed Central

    Munabi, Ian Guyton; Byamugisha, Josaphat; Luboobi, Livingstone; Luboga, Samuel Abilemech; Mirembe, Florence

    2016-01-01

    Introduction In sub Saharan Africa, childbirth remains a challenge that creates the need for additional screening tools. Maternal pelvis height, which is currently in use by automotive engineers has previously been shown to have significant associations with various childbirth related outcomes and events. This study set out to determine the associations between maternal: Age, height, weight and number of pregnancies with maternal pelvis height in Ugandan mothers. Methods This was a secondary analysis of maternal birth records from nine Ugandan hospitals, of mothers with singleton pregnancies. Data was analyzed using multilevel regression with respect to maternal pelvis height and additional analysis for tribe and site of childbirth intraclass correlations (ICCs). Results The mean maternal pelvis height was 7.30cm for the 2068 records. Maternal pelvis height was associated with: a 0.01cm reduction per centimeter of maternal height (P=0.02), 0.01cm increase per kg of maternal weight (P<0.01), 0.04cm increase for each additional pregnancy (P=0.03) and 0.03cm increase with respect to tribe of mother (P=0.27), for a constant of 7.97cm (P<0.01). The ICC for tribe was 0.20 (SE=0.08) and 0.37 (SE=0.11) for site. Conclusion Maternal pelvis height was associated with maternal height, maternal weight and number of pregnancies. The site of childbirth had a moderate effect on the above associations with maternal pelvis height. More study on the public health screening value of these measurements in these settings is required. PMID:27800110

  20. Relationship between maternal pelvis height and other anthropometric measurements in a multisite cohort of Ugandan mothers.

    PubMed

    Munabi, Ian Guyton; Byamugisha, Josaphat; Luboobi, Livingstone; Luboga, Samuel Abilemech; Mirembe, Florence

    2016-01-01

    In sub Saharan Africa, childbirth remains a challenge that creates the need for additional screening tools. Maternal pelvis height, which is currently in use by automotive engineers has previously been shown to have significant associations with various childbirth related outcomes and events. This study set out to determine the associations between maternal: Age, height, weight and number of pregnancies with maternal pelvis height in Ugandan mothers. This was a secondary analysis of maternal birth records from nine Ugandan hospitals, of mothers with singleton pregnancies. Data was analyzed using multilevel regression with respect to maternal pelvis height and additional analysis for tribe and site of childbirth intraclass correlations (ICCs). The mean maternal pelvis height was 7.30cm for the 2068 records. Maternal pelvis height was associated with: a 0.01cm reduction per centimeter of maternal height (P=0.02), 0.01cm increase per kg of maternal weight (P<0.01), 0.04cm increase for each additional pregnancy (P=0.03) and 0.03cm increase with respect to tribe of mother (P=0.27), for a constant of 7.97cm (P<0.01). The ICC for tribe was 0.20 (SE=0.08) and 0.37 (SE=0.11) for site. Maternal pelvis height was associated with maternal height, maternal weight and number of pregnancies. The site of childbirth had a moderate effect on the above associations with maternal pelvis height. More study on the public health screening value of these measurements in these settings is required.

  1. Explaining the uptake of paediatric guidelines in a Kenyan tertiary hospital--mixed methods research.

    PubMed

    Irimu, Grace W; Greene, Alexandra; Gathara, David; Kihara, Harrison; Maina, Christopher; Mbori-Ngacha, Dorothy; Zurovac, Dejan; Santau, Migiro; Todd, Jim; English, Mike

    2014-03-10

    Evidence-based standards for management of the seriously sick child have existed for decades, yet their translation in clinical practice is a challenge. The context and organization of institutions are known determinants of successful translation, however, research using adequate methodologies to explain the dynamic nature of these determinants in the quality-of-care improvement process is rarely performed. We conducted mixed methods research in a tertiary hospital in a low-income country to explore the uptake of locally adapted paediatric guidelines. The quantitative component was an uncontrolled before and after intervention study that included an exploration of the intervention dose-effect relationship. The qualitative component was an ethnographic research based on the theoretical perspective of participatory action research. Interpretive integration was employed to derive meta-inferences that provided a more complete picture of the overall study results that reflect the complexity and the multifaceted ontology of the phenomenon studied. The improvement in health workers' performance in relation to the intensity of the intervention was not linear and was characterized by improved and occasionally declining performance. Possible root causes of this performance variability included challenges in keeping knowledge and clinical skills updated, inadequate commitment of the staff to continued improvement, limited exposure to positive professional role models, poor teamwork, failure to maintain professional integrity and mal-adaptation to institutional pressures. Implementation of best-practices is a complex process that is largely unpredictable, attributed to the complexity of contextual factors operating predominantly at professional and organizational levels. There is no simple solution to implementation of best-practices. Tackling root causes of inadequate knowledge translation in this tertiary care setting will require long-term planning, with emphasis on

  2. Beta-Lactam Antibiotic Sensitization and Its Relationship to Allergic Diseases in Tertiary Hospital Nurses

    PubMed Central

    Han, Eui-Ryoung; Lim, Seong-Wook; Lim, Seong-Ryoon; Kim, Ji-Na; Park, Sin-Young; Chae, Su-Kyoung; Lim, Hye-Hyeun; Seol, Young-Ae; Bae, You-In; Won, Young-Ho

    2010-01-01

    Purpose Skin allergies through type 1 and 4 hypersensitivity reactions are the most frequent manifestations of drug allergies. We had previously experienced a case of a nurse with cefotiam-induced contact urticaria syndrome. To aid in preventing the progression of drug-induced allergic disease in nurses, we conducted a survey of tertiary hospital nurses who were likely to have been exposed professionally to antibiotics. Methods All 539 staff nurses at a tertiary hospital were asked to respond to a questionnaire regarding antibiotic exposure. Of the 457 nurses (84.8%) who responded, 427 (79.2%) received a physical examination of the hands and 318 (59.0%) received skin prick tests with the β-lactam antibiotics cefotiam, cefoperazone, ceftizoxime, flomoxef, piperacillin and penicillin G. Results A positive response to at least one of the antibiotics occurred in 8 (2.6%) of the 311 subjects included in the analysis and stages 1 and 2 contact urticaria syndrome were observed in 38 (8.9%) and 3 (0.7%) of 427 nurses, respectively. The frequencies of a positive antibiotic skin test (6.9 versus 1.3%, χ2=7.15, P=0.018), stage 1 contact urticaria syndrome (14.4 versus 7.4%, χ2=4.33, P=0.038) and drug allergy (15.3 versus 3.6%, χ2=18.28, P=0.000) were higher in subjects with a positive skin allergy history than in those without. Allergic rhinitis (P=0.02, OR=3.86, CI=1.23-12.06), night cough (P=0.04, OR=3.12, CI=1.03-9.41) and food allergy (P=0.00, OR=9.90, CI=3.38-29.98) were significant risk factors for drug allergy. Conclusions Antibiotic sensitization and drug allergy occurred more frequently in nurses with a positive skin allergy history. Atopy may be an important risk factor for drug allergy. PMID:20358025

  3. Direct and indirect cost of myasthenia gravis: A prospective study from a tertiary care teaching hospital in India.

    PubMed

    Sonkar, Kamlesh Kumar; Bhoi, Sanjeev Kumar; Dubey, Deepanshu; Kalita, Jayantee; Misra, Usha Kant

    2017-04-01

    Myasthenia gravis (MG) requires lifelong treatment. The cost of management MG is very high in developed countries but there is no information on the cost of management of MG in the developing countries. This study reports the direct and indirect cost and predictors of cost of MG in a tertiary care teaching hospital in India. In a prospective hospital based study, from a tertiary hospital in India 66 consecutive patient during 2014-2015 were included. The age of the patients ranged between 6 and 75years. The severity of MG was assessed by myasthenia gravis foundation association (MGFA) class (MGFA) I-V. The patient data was collected s and their direct cost was calculated from the computerized Hospital information system. The indirect cost was calculated from patient's memory, checking the bills of transportation and wages loss by the patient or the care giver. Total annual cost of MG ranged between INR (4560-532227) with median INR 61390.5 (US$911.64). The median cost of outpatient department (OPD) consultation of 16 patients was INR 20439.9 (US$303.53), of 50 admitted patients was INR 44311.8 (US$658.03) and 21 intensive care unit (ICU) patients was INR 59574.3 (US$ 884.6) and the direct cost of thymectomy was INR 45000 (US$ 668.25). Direct cost was related to indirect cost (r=0.55; p=0.0001). Predictors of patient outcome were severity of MG, ICU admission, and thymectomy. The total median cost for management of myasthenia gravis was INR 61390.5 (4560-532227, US$911.64) per year, and the cost was mainly determined by the severity of MG. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Referral practices and perceived barriers to timely obstetric care among Ugandan traditional birth attendants (TBA).

    PubMed

    Keri, L; Kaye, D; Sibylle, K

    2010-03-01

    To assess current beliefs, knowledge and practices of Ugandan traditional birth attendants (TBAs) and their pregnant patients regarding referral of obstructed labors and fistula cases. Six focus groups were held in rural areas surrounding Kampala, the capital city of Uganda. While TBAs, particularly those with previous training, appear willing to refer problematic pregnancies and labors, more serious problems exist that could lessen any positive effects of training. These problems include reported abuse by doctors and nurses, and seeing fistula as a disease caused by hospitals. Training of TBAs can be helpful to standardize knowledge about and encourage timely emergency obstetric referrals, as well as increase knowledge about the causes and preventions of obstetric fistula. However, for full efficacy, training must be accompanied by greater collaboration between biomedical and traditional health personnel, and increased infrastructure to prevent mistreatment of pregnant patients by medical staff.

  5. Laryngoscope illuminance in a tertiary children's hospital: implications for quality laryngoscopy.

    PubMed

    Volsky, Peter G; Murphy, Michael K; Darrow, David H

    2014-07-01

    Laryngoscopes are used by otolaryngologists in a variety of hospital emergency and critical care settings. However, only rarely have quality-related aspects of laryngoscope function and application been studied. To compare the illuminance of laryngoscopes commonly used in a hospital setting to established standards and to assess the potential effects of maintenance practices on laryngoscope illuminance. Observational study of laryngoscope light output and cross-sectional survey of individuals charged with laryngoscope maintenance in a tertiary care children's hospital. Illuminance was chosen as the unit of measurement (lux). Laryngoscopes in the operating room, emergency department, and pediatric intensive care unit were tested according to a standard technique. Illuminance standards for laryngoscopes, published by the International Organization for Standardization (ISO) (500 lux) and in the medical literature (867 lux) were used as benchmarks. Mean laryngoscope illuminance by type of laryngoscope and light source and percentage of laryngoscopes with illuminance below established standards as well as nonfunctioning units. Maintenance practices were evaluated as a secondary outcome. A total of 319 laryngoscopes were tested; 283 were incandescent bulb units used by anesthesiologists, emergency physicians, and intensivists and 36 were xenon light units used by otolaryngologists. Mean (SD) illuminance was 1330 (1160) lux in the incandescent group and 16,600 (13,000) lux in the xenon group (P < .001). Substandard illuminance was observed only in the incandescent group, in 29% to 43% of laryngoscopes; 5% of the incandescent group did not turn on at all. Maintenance of laryngoscopes was performed on a reactive rather than a preventive basis. At our facility, approximately one-third of incandescent laryngoscopes exhibited substandard light output. On the basis of these findings, our hospital has converted all of its incandescent laryngoscopes to light-emitting diode (LED

  6. [Nutritional status at the time of admission among patients admitted to a tertiary-care paediatric hospital].

    PubMed

    Durá Travé, Teodoro; San Martín García, Isabel; González Benavides, Aida; Vaquero Iñigo, Ibone; Herranz Aguirre, Mercedes; Iceta Elízaga, Ainhoa

    2015-06-01

    To analyze the nutrition status of the pediatric patients at the time of hospital admission throughout a calendar year in a tertiary level hospital and to identify those patients and/or groups of pathologies with a higher risk of malnutrition. Retrospective evaluation of nutrition status of 852 patients hospitalized in 2013 in a pediatric hospital (462 males and 390 females). Sex, age, body mass index at the moment of admission and days of hospitalization and diagnosis codified according to the International Classification of Diseases were registered. The prevalence of malnutrition patients registered at the moment of admission was 8.2%. Excess body weight (overweight and obesity) was detected in 18% of the patients. The diseases of the nervous system (22.9%), together with the diseases of the respiratory system, the infectious diseases (18.6%), the congenital malformations (11.4%) and the diseases of the genitorurinary system (8.6%) account for 84.4% of the cases with malnutrition. The overall prevalence rate for malnutrition in pediatric patients at the moment of admission in our hospital was 8.2%, being this figure similar to those published in occidental countries. It should be mandatory to accomplish an initial screening and follow up during hospitalization of younger patients and those suffering from diseases of the nervous and/or respiratory system and, especially, from congenital diseases. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  7. Finding a path through the health unit: practical experience of Ugandan patients.

    PubMed

    Mogensen, Hanne O

    2005-01-01

    Finding one's way through a health facility is not necessarily an easy task for Ugandan patients. Our understanding of how people succeed in doing so, and of the obstacles they encounter on their way, is incomplete if we focus only on the cognitive level of the clinical encounter. Much research in public health and medical anthropology implicitly works with the notion that agency is located in the mind and that cognitive understanding is a precondition for practice. Based on material from eastern Uganda, this article explores the practical experience of Ugandan patients and their relatives and reflects upon the ways in which this notion of agency has often caused us to confuse the spectator's point of view with the actor's point of view. Thus, as Pierre Bourdieu has argued, we are made to look for answers to "questions that practice never asks because it has no need to ask them."

  8. "...No stone left unturned:" how the public explains the Ugandan success story.

    PubMed

    Chapman, Elizabeth; Kipp, Walter; Rubaale, Tom

    2008-01-01

    We conducted a public poll to assess the public's perception about changes in HIV prevalence and its causes in a township in western Uganda. The main questions related to the declining HIV prevalence and its interpretation, as well as to the "Ugandan success story." The study used a qualitative methodology; we interviewed 68 citizens in eight focus group discussions. The majority stated that the HIV prevalence had declined in their town. Of those respondents, most cited behaviour changes related to Uganda's ABC strategy as their explanation of the declining trends. Those who said that a decline in HIV had taken place also stated that they believed in the Ugandan success story. Our study concludes that it is important to involve the public on important health issues such as HIV/AIDS in order to obtain more valid results by combining scientific findings with public/indigenous knowledge.

  9. Assessment of new drugs in a tertiary hospital using a standardized tool.

    PubMed

    González-Bueno, J; Chamorro-de-Vega, E; Alfaro-Lara, E R; Galván-Banqueri, M; Santos-Ramos, B

    2013-01-01

    To describe the profile of new drugs evaluated by the Pharmacy and Therapeutics committee in a tertiary hospital using a standardized tool, the Guideline for the Introduction of New Drugs in the Formulary (GINF form), as main objective. Retrospective observational study of drugs was assessed during 2008-2011. Variables related to the drug, the request, and the result of the evaluation were collected based on information contained in the GINF form and in the assessment reports. 63 of 75 assessed drugs (84%) were included in the hospital formulary. Only one drug (1%) was included without any restrictions. The rest of them were included as therapeutic equivalents (23%) or under specific recommendations (61%). Half of the drugs (6) not included had insufficient evidence of effectiveness compared with current treatments. Haematology and Medical Oncology were found to be the most active medical services in the application process. There was a high prevalence of drugs that had more than one advanced clinical trial (phase III and/or phase IV). Furthermore, 28% of assessed drugs were associated with a financial burden of more than ?10,000 per year for our hospital. Highquality information was provided by applicants to the P&T committee for drugs that were finally included. However, the relationship between the information provided to the P&T committee and its decision was not statistical significance. The requests received were primarily related to drugs intended for parenteral use and most of them were antineoplastic drugs. The medical departments most heavily represented were Haematology and Oncology. Copyright © 2013 SEFH. Published by AULA MEDICA. All rights reserved.

  10. Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt.

    PubMed

    Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; El-Mahallawy, Hadir Ahmed; Amin, Magdy Aly; El Din Ashour, Seif

    2015-03-12

    Pseudomonas aeruginosa is an important nosocomial pathogen, commonly causing infections in immunocompromised patients. The aim of this study was to examine the genetic relatedness of metallo-beta-lactamase (MBL) producing carbapenem resistant Pseudomonas aeruginosa clinical isolates collected from 2 tertiary hospitals in Cairo, Egypt using Multi Locus sequence typing (MLST). Phenotypic and genotypic detection of metallo-beta-lactamase for forty eight non-duplicate carbapenem resistant P. aeruginosa isolates were carried out. DNA sequencing and MLST were done. The bla VIM-2 gene was highly prevalent (28/33 strains, 85%) among 33 MBL-positive P.aeruginosa isolates. MLST revealed eleven distinct Sequence Types (STs). A unique ST233 clone producing VIM-2 was documented by MLST in P.aeruginosa strains isolated from Cairo university hospitals. The high prevalence of VIM-2 producers was not due to the spread of a single clone. The findings of the present study clearly demonstrate that clones of VIM-2 positive in our hospitals are different from those reported from European studies. Prevalence of VIM-2 producers of the same clone was detected from surgical specimens whereas oncology related specimens were showing diverse clones.

  11. Knowledge, perception and practices of healthcare professionals at tertiary level hospitals in Kingston, Jamaica, regarding neonatal pain management.

    PubMed

    Young, J; Barton, M; Richards-Dawson, M A; Trotman, H

    2008-01-01

    To determine knowledge, perception and practices of healthcare professionals at tertiary level hospitals in Kingston, Jamaica, regarding neonatal pain management. Physicians and nurses actively involved in providing neonatal care at three tertiary level hospitals were invited to participate. A 21-item self-administered questionnaire was used to obtain information on knowledge, perception and practice of neonatal pain management. Descriptive analyses were performed. A total of 147 healthcare workers participated giving a response rate of 85%. Male to female ratio was 1: 4.4. Nurses accounted for 76 (52%) of the respondents while 70 (48%) were physicians. Seventy-three (50%) individuals were unaware of the degree of pain neonates were capable of experiencing and only 38 (27%) knew that premature infants were capable of feeling pain. One hundred and four (71%) respondents were able to identify physiological markers of pain and most respondents were able to discriminate between painful and non-painful procedures. However, 100 (68%) respondents rarely prescribed analgesia for procedures previously rated as painful. Seventy-one (51%) respondents admitted to not using analgesia for alleviating procedural pain in neonates. Twenty-five (18%) individuals thought that the procedure was too short to require analgesic support while 41 (30%) stated that medication was not usually prescribed for procedural pain. Physician scores were significantly higher than those attained by nurses for knowledge (p = 0.003) and for pain perception (p = 0.001) but no significant differences were noted for practice (p = 0.18). There is an overwhelming deficiency in the knowledge, perception and practice of neonatal pain management at tertiary level institutions in Kingston, Jamaica. There is the urgent need for the education of health professionals on neonatal pain management. This will in turn facilitate change in perception and eventually, along with the institution of local policies and

  12. Neonatal Transport - Experience of a Tertiary Care Hospital of Bangladesh.

    PubMed

    Dey, S K; Sharker, S; Jahan, I; Moni, S C; Shabuj, K H; Chisti, M J; Mannan, M A; Shahidullah, M

    2017-01-01

    Safe transportation is mostly an unnoticed neonatal health issue in Bangladesh and no documentation is available regarding the existing practices. So this study was intended to document transport status of the referred newborn to a tertiary care hospital. This observational study included 150 out born neonates over 12 months period transported from various places to NICU, Bangabandhu Sheikh Mujib Medical University (BSMMU) from May 2015 to April 2016. A structured data collection form was used to record information categorized into pre-transport, during transport and at admission. At admission detailed clinical assessment of the baby was done and recorded. Outcome was determined as discharge or death. Of 150 transported neonates, two-third were preterm 115(77%) & LBW 113(75%). Common indications for referral were prematurity and sepsis. Most of the patients were referred from private hospital 107(71%). Majority of newborns (86%) were referred from hospitals of Dhaka city while only 14% were referred from outside Dhaka. Referral notes were supplied in most of the cases 134(89%) but comprehensive information was obtainable only in 3 cases. Although main transport vehicle was ambulance 130(87%), medical personnel accompanied the sick baby only in 6(4%) of cases. The distance traveled was less than 10 kilometers (kms) in 95(63%) and more than 100 km in 10(7%) of enrolled neonates. Transport time was less than 1 hour in 72(48%), 1-6 hours in 66(44%) and more than 6 hours in 12(8%) of cases. Nearly two third of newborn were transported after office period, 107(72%). At admission 21(14%) babies had hypothermia, 8(7.62%) hypoglycemia, 16(11%), poor perfusion 28(19%), low saturation 27(18%). Hyperthermia & hyperglycemia were observed in 8(5%) & 7(5%) cases respectively. Of the total 150 babies referred, 17(11%) died. While comparing with discharged newborn, died newborn were more frequent sufferer of hypothermia (p value 0.007) and low saturation (p value 0.049) at

  13. Creativity across Cultures: A Comparison between Ugandan and Italian Students

    ERIC Educational Resources Information Center

    Tomassoni, Rosella; Treglia, Eugenia; Tomao, Manuela

    2018-01-01

    The purpose of this research was to compare the creative performance of students belonging to 2 different cultures, Italian and Ugandan. The participants were 462 children between the ages of 6 and 14 (231 in each group). The children were distributed across the age groups, between the 1st and 7th years of primary school. This study used a…

  14. Constructing English as a Ugandan Language through an English Textbook

    ERIC Educational Resources Information Center

    Stranger-Johannessen, Espen

    2015-01-01

    English is a national language in Uganda and is widely used in elite areas such as politics and business, but most Ugandans master English to only a limited degree. In this situation, English can be seen as either a foreign language or a second language--influencing how English is taught. One goal of language teaching espoused in this article is…

  15. Direct hospital costs of total laparoscopic hysterectomy compared with fast-track open hysterectomy at a tertiary hospital: a retrospective case-controlled study.

    PubMed

    Rhou, Yoon J J; Pather, Selvan; Loadsman, John A; Campbell, Neil; Philp, Shannon; Carter, Jonathan

    2015-12-01

    To assess the direct intraoperative and postoperative costs in women undergoing total laparoscopic hysterectomy and fast-track open hysterectomy. A retrospective review of the direct hospital-related costs in a matched cohort of women undergoing total laparoscopic hysterectomy (TLH) and fast-track open hysterectomy (FTOH) at a tertiary hospital. All costs were calculated, including the cost of advanced high-energy laparoscopic devices. The effect of the learning curve on cost in laparoscopic hysterectomy was also assessed, as was the hospital case-weighted cost, which was compared with the actual cost. Fifty women were included in each arm of the study. TLH had a higher intraoperative cost, but a lower postoperative cost than FTOH (AUD$3877 vs AUD$2776 P < 0.001, AUD$3965 vs AUD$6233 P < 0.001). The total cost of TLH was not different from FTOH (AUD$7842 vs AUD$9009 P = 0.068) and after a learning curve; TLH cost less than FTOH (AUD$6797 vs AUD$8647, P < 0.001). The use of high-energy devices did not impact on the cost benefit of TLH, and hospital case-weight-based funding correlated poorly with actual cost. Despite the use of fast-track recovery protocols, the cost of TLH is no different to FTOH and after a learning curve is cheaper than open hysterectomy. Judicious use of advanced energy devices does not impact on the cost, and hospital case-weight-based funding model in our hospital is inaccurate when compared to directly calculated hospital costs. © 2013 The Authors ANZJOG © 2013 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.

  16. Self esteem and organizational commitment among health information management staff in tertiary care hospitals in Tehran.

    PubMed

    Sadoughi, Farahnaz; Ebrahimi, Kamal

    2014-12-12

    Self esteem (SE) and organizational commitment (OC)? have significant impact on the quality of work life. This study aims to gain a better understanding of the relationships between SE and OC among health information management staff in tertiary care hospitals in Tehran (Iran). This was a descriptive correlational and cross sectional study conducted on the health information management staff of tertiary care hospitals in Tehran, Iran. A total of 155 participants were randomly selected from 400 staff. Data were collected by two standard questionnaires. The SE and OC was measured using Eysenck SE scale and Meyer and Allen's three component model, respectively. The collected data were analyzed with the SPSS (version 16) using statistical tests of of independent T-test, Pearson Correlation coefficient, one way ANOVA and F tests. The OC and SE of the employees' were 67.8?, out of 120 (weak) and 21.0 out of 30 (moderate), respectively. The values for affective commitment, normative commitment, and continuance commitment were respectively 21.3 out of 40 (moderate), 23.9 out of 40 (moderate), and 22.7 out of 40 (moderate). The Pearson correlation coefficient test showed a significant OC and SE was statistically significant (P<0.05). The one way ANOVA test (P<0.05) did not show any significant difference between educational degree and work experience with SE and OC. This research showed that SE and OC ?are moderate. SE and OC have strong correlation with turnover, critical thinking, job satisfaction, and individual and organizational improvement. Therefore, applying appropriate human resource policies is crucial to reinforce these measures.

  17. Experience of Oesophageal atresia management in a tertiary Bangladeshi hospital.

    PubMed

    Islam, Md Kabirul

    2018-01-16

    Background and aim: This study has been conducted to determine the clinical presentations and surgical outcome of patients with OA admitted in a tertiary level hospital in Bangladesh. A prospective analysis was conducted for 32 patients with confirmed OA between July 2007 and June 2015. Of them surgical correction was done in 25 cases. The other 7, in whom surgery could not be done, were excluded from the study. Of the 25 cases, that had been operated, 15 were full term and 52% were more than 48 hours old. Type-C OA with TOF was the commonest type (96%). 24 cases were operated through Right Thoracotomy. Of them 52% were done by Single Lung (left) ventilation. 'Division of the fistula' with 'end to end anastomosis' was done in all of them. Only 1 patient had a Gastric pull up surgery. Of the 25 cases, 16 survived (64%). In follow up all the patients were found thriving and showed no problem in swallowing. Our study which shows 64% survival is a great achievement for us but not satisfactory in international standard. However, the experience and encouragement that we are gathering, will guide us to achieve better result in near future.

  18. Extent, Nature, and Risk Factors of Workplace Violence in Public Tertiary Hospitals in China: A Cross-Sectional Survey

    PubMed Central

    Liu, He; Zhao, Siqi; Jiao, Mingli; Wang, Jingtao; Peters, David H.; Qiao, Hong; Zhao, Yuchong; Li, Ye; Song, Lei; Xing, Kai; Lu, Yan; Wu, Qunhong

    2015-01-01

    Using a cross-sectional survey design from 11 public tertiary hospitals (a specialist hospital, four Chinese medicine hospitals, and six general hospitals) in the urban areas of Heilongjiang, we determined the nature of workplace violence that medical staff have encountered in Chinese hospitals and identified factors associated with those experiences of violence. A total of 1129 health workers participated. The specialist hospital had the highest prevalence of physical violence (35.4%), while the general hospitals had the highest prevalence of non-physical violence (76%). Inexperienced medical staff (p < 0.001) were more likely to suffer non-physical violence than physical violence in Chinese medicine hospitals compared to experienced staff. Medical units (p = 0.001) had a high risk of non-physical violence, while surgical units (p = 0.005) had a high risk of physical violence. In general hospitals, staff with higher levels of anxiety about workplace violence were more vulnerable to both physical violence (1.67, 95% CI 1.36–2.10) and non-physical violence (1.309, 95% CI 1.136–1.508) compared to those with lower levels of anxiety, while rotating shift workers had a higher odds of physical violence (2.2, 95% CI 1.21–4.17) and non-physical violence (1.65, 95% CI 1.13–2.41) compared to fixed day shift workers. Thus, prevention should focus not only on high-risk sections of hospitals, but also on the nature of the hospital itself. PMID:26086703

  19. Chicken pox outbreak in the Intensive Care Unit of a tertiary care hospital: Lessons learnt the hard way.

    PubMed

    Sarit, Sharma; Shruti, Sharma; Deepinder, Chhina; Chhina, R S

    2015-12-01

    Varicella-zoster virus (VZV) causes 2 clinically and epidemiologically distinct forms of diseases. Chickenpox (varicella) is the disease that results from primary infection with the VZV. Herpes zoster (HZ) results from the reactivation of VZV latently infecting the dorsal root ganglia. We are reporting an outbreak of varicella infection among the health care workers (HCWs) in the Intensive Care Unit (ICU) of a tertiary care hospital. We found transmission of varicella among eight HCWs of pulmonary ICU. They had a history of contact with a patient having HZ infection. Investigation of the outbreak was conducted as per guidelines. Better dissemination of information on disease transmission, isolation of infected patients inside the hospital, and adequate protection (including vaccination) for susceptible employees are important to prevent such outbreaks.

  20. Application of Lean Healthcare methodology in a urology department of a tertiary hospital as a tool for improving efficiency.

    PubMed

    Boronat, F; Budia, A; Broseta, E; Ruiz-Cerdá, J L; Vivas-Consuelo, D

    To describe the application of the Lean methodology as a method for continuously improving the efficiency of a urology department in a tertiary hospital. The implementation of the Lean Healthcare methodology in a urology department was conducted in 3 phases: 1) team training and improvement of feedback among the practitioners, 2) management by process and superspecialisation and 3) improvement of indicators (continuous improvement). The indicators were obtained from the Hospital's information systems. The main source of information was the Balanced Scorecard for health systems management (CUIDISS). The comparison with other autonomous and national urology departments was performed through the same platform with the help of the Hospital's records department (IASIST). A baseline was established with the indicators obtained in 2011 for the comparative analysis of the results after implementing the Lean Healthcare methodology. The implementation of this methodology translated into high practitioner satisfaction, improved quality indicators reaching a risk-adjusted complication index (RACI) of 0.59 and a risk-adjusted mortality rate (RAMR) of 0.24 in 4 years. A value of 0.61 was reached with the efficiency indicator (risk-adjusted length of stay [RALOS] index), with a savings of 2869 stays compared with national Benchmarking (IASIST). The risk-adjusted readmissions index (RARI) was the only indicator above the standard, with a value of 1.36 but with progressive annual improvement of the same. The Lean methodology can be effectively applied to a urology department of a tertiary hospital to improve efficiency, obtaining significant and continuous improvements in all its indicators, as well as practitioner satisfaction. Team training, management by process, continuous improvement and delegation of responsibilities has been shown to be the fundamental pillars of this methodology. Copyright © 2017 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

  1. Indications and outcome of pediatric tracheostomy: results from a Nigerian tertiary hospital.

    PubMed

    Adoga, Adeyi A; Ma'an, Nuhu D

    2010-01-12

    There is a change in the concept of pediatric tracheostomy. This study investigates the indications and outcomes of pediatric tracheostomy in a Nigerian teaching hospital finding out whether there is also a change in the trend in our environment as compared to other centers. A retrospective chart review of 46 patients aged between 2 months and 15 years who presented to our Otorhinolaryngological facility and had tracheostomy between January 2000 and December 2008. The age range was 2 months to 15 years. There were 29 males and 17 females. Thirty two (69.6%) patients were in the age range 6-10 years. Forty tracheostomies (87%) were performed as emergency while 6 (13%) as elective procedures. The commonest indication for tracheostomy was upper airway obstruction (n = 29, 63%). Transverse skin incision was employed in all the cases. No intra-operative complication was recorded. The post-operative complication rate was 15.2%. The duration of tracheostomy ranged from 5 days to 3 months. All the patients were successfully decannulated. The overall mortality was 8 (17.4%). There was no tracheostomy related mortality. There is no increase in the incidence of tracheostomy in patients under 1 year of age and the commonest indication for the procedure in Nigeria has remained relief of upper airway obstruction. Pediatric tracheostomy is safe when performed in the tertiary hospital setting.

  2. Pattern of medical diseases and determinants of prognosis of hospitalization during 2005 Muslim pilgrimage Hajj in a tertiary care hospital. A prospective cohort study.

    PubMed

    Khan, Nasim A; Ishag, Adam M; Ahmad, Maha S; El-Sayed, Fifi M; Bachal, Zakeyah A; Abbas, Tahir G

    2006-09-01

    To document the pattern of medical diseases necessitating admission in a tertiary care hospital during Muslim pilgrimage (Hajj). To assess the risk factors associated with mortality during hospitalization. The study was conducted at Al Noor Specialist Hospital, a 550-bed tertiary care teaching hospital, in Makkah, KSA. The participants included all Hajj patients admitted in the Department of Medicine in a 5-week period (January 3 to February 6, 2005) during the 2005 (1425 AH) Hajj. Information about demographics; past medical history; pre-Hajj functional status; presence of language barrier and translator availability; diagnosis for admission and complications during hospitalization including mortality was obtained prospectively using a standardized form. Six hundred and eighty-nine patients, belonging to 49 countries, with mean age of 62 years and male:female ratio of 1.8:1 were admitted. Two hundred-twenty (31.9%) had diabetes mellitus, 256 (37.2%) had hypertension, 219 (31.8%) had cardiac disease, and 103 (14.9%) patients had chronic lung disease. Of the 449 (65.2%) patients assessed, 284 (63.2%) patients had language barrier, and translator was not available for 152 (53.5%) of them. Pre-Hajj functional status assessment of 240 patients showed that 20 (8.3%) required assistance in performing activities of daily living (ADL), and 40 (16.7%) could not walk for half kilometer without difficulty. Common causes of morbidity were: 235 (34.1%) cardiovascular, 137 (19.9%) infectious and 85 (12.3%) neurological diseases. One hundered and fourteen (16.5%) patients died, with the common causes being pneumonia (28 patients), acute coronary syndrome (21), and stroke (20). The risk factors associated with higher mortality were older age (65 +/- 1 versus 61 +/- 0.6 years, p=0.008), prior history of chronic lung disease (crude odds ratio, 1.81, p=0.034), dependence in any ADLs (4.90, p=0.025), inability to ambulate for half kilometer without difficulty (4.17, p=0.017) and non

  3. Academic Achievement of Ugandan Sixth Grade Students: Influence of Parents' Education Levels

    ERIC Educational Resources Information Center

    Wamala, Robert; Kizito, Omala Saint; Jjemba, Evans

    2013-01-01

    The study investigates the influence of a father and mother's education on the academic achievement of their child. The investigation is based on data sourced from the 2009 Southern African Consortium for Monitoring Education Quality survey comprising 5,148 records of sixth grade students enrolled in Ugandan primary schools. Students' percentage…

  4. The process, logistics and challenges of implementing clinical supervision in a generalist tertiary referral hospital.

    PubMed

    Brunero, Scott; Lamont, Scott

    2012-03-01

    Clinical supervision (CS) has been identified within nursing as a process for improving clinical practice and reducing the emotional burden of nursing practice. Little is known about its implementation across large tertiary referral hospitals. The purpose of this study is to evaluate the implementation of clinical supervision across several different nursing specialities at a teaching hospital in Sydney, Australia. Using a model of nursing implementation science, a process was developed at the study site that facilitated the development, implementation and evaluation of the project. After a 6-month study period, the CS groups were postevaluated using a survey tool developed for the project. A total of nine CS groups were in operation over the 6-month study period. A predominant focus within the sessions was one of the collegial support and developing standards of practice. The process was able to achieve wide hospital-based support for the role of CS from the senior nurse executives to junior nurses. Whilst there was overall positive support for the CS groups, logistical and resource challenges remain, in the effective roll out of CS to large numbers of nurses. © 2011 The Authors. Scandinavian Journal of Caring Sciences © 2011 Nordic College of Caring Science.

  5. Risk factors and biofilm detection on central venous catheters of patients attended at tertiary hospital.

    PubMed

    Pérez-Zárate, Pamela; Aragón-Piña, Antonio; Soria-Guerra, Ruth Elena; González-Amaro, Ana María; Pérez-Urizar, José; Pérez-González, Luis Fernando; Martinez-Gutierrez, Fidel

    2015-11-01

    To determinate the significance of risk factors with the presence of biofilm on catheters of patients attended at tertiary hospital cares. A total of 126 patients were included, data collection by observing the handling of the CVC, clinical history and microbiological isolation methods of CVCs tips (Roll-plate, sonication and scanning electron microscopy) were evaluated. Certain factors, such as the lack of proper hand washing, the use of primary barriers and preparing medications in the same hospital service, showed an important relationship between biofilm formation in CVCs. The sonication method presented that most of the samples had isolation of multispecies 29 samples (64%); in contrast with the roll-plate method, just one sample (3%) was isolated. The importance of the strict aseptic techniques of insertion and of the handlings of CVC was highlighted, the failure of both techniques was related to the biofilm formation and was evidenced using the scanning electron microscopy. Since this tool is not available in most hospitals, we present the correlation of those evidences with other standard microbiological methods and risk factors, which are necessary for the sensible detection of the different steps of the biofilm formation on CVC and their correct interpretation with clinical evidences. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Bio-Medical Waste Managment in a Tertiary Care Hospital: An Overview.

    PubMed

    Pandey, Anita; Ahuja, Sanjiv; Madan, Molly; Asthana, Ajay Kumar

    2016-11-01

    Bio-Medical Waste (BMW) management is of utmost importance as its improper management poses serious threat to health care workers, waste handlers, patients, care givers, community and finally the environment. Simultaneously, the health care providers should know the quantity of waste generated in their facility and try to reduce the waste generation in day-to-day work because lesser amount of BMW means a lesser burden on waste disposal work and cost saving. To have an overview of management of BMW in a tertiary care teaching hospital so that effective interventions and implementations can be carried out for better outcome. The observational study was carried out over a period of five months from January 2016 to May 2016 in Chhatrapati Shivaji Subharti Hospital, Meerut by the Infection Control Team (ICT). Assessment of knowledge was carried out by asking set of questions individually and practice regarding awareness of BMW Management among the Health Care Personnel (HCP) was carried out by direct observation in the workplace. Further, the total BMW generated from the present setup in kilogram per bed per day was calculated by dividing the mean waste generated per day by the number of occupied beds. Segregation of BMW was being done at the site of generation in almost all the areas of the hospital in color coded polythene bags as per the hospital protocol. The different types of waste being collected were infectious solid waste in red bag, soiled infectious waste in yellow bag and sharp waste in puncture proof container and blue bag. Though awareness (knowledge) about segregation of BMW was seen in 90% of the HCP, 30%-35% did not practice. Out of the total waste generated (57912 kg.), 8686.8 kg. (15%) was infectious waste. Average infectious waste generated was 0.341 Kg per bed per day. The transport, treatment and disposal of each collected waste were outsourced and carried out by 'Synergy' waste management Pvt. Ltd. The practice of BMW Management was lacking in 30

  7. Bio-Medical Waste Managment in a Tertiary Care Hospital: An Overview

    PubMed Central

    Ahuja, Sanjiv; Madan, Molly; Asthana, Ajay Kumar

    2016-01-01

    Introduction Bio-Medical Waste (BMW) management is of utmost importance as its improper management poses serious threat to health care workers, waste handlers, patients, care givers, community and finally the environment. Simultaneously, the health care providers should know the quantity of waste generated in their facility and try to reduce the waste generation in day-to-day work because lesser amount of BMW means a lesser burden on waste disposal work and cost saving. Aim To have an overview of management of BMW in a tertiary care teaching hospital so that effective interventions and implementations can be carried out for better outcome. Materials and Methods The observational study was carried out over a period of five months from January 2016 to May 2016 in Chhatrapati Shivaji Subharti Hospital, Meerut by the Infection Control Team (ICT). Assessment of knowledge was carried out by asking set of questions individually and practice regarding awareness of BMW Management among the Health Care Personnel (HCP) was carried out by direct observation in the workplace. Further, the total BMW generated from the present setup in kilogram per bed per day was calculated by dividing the mean waste generated per day by the number of occupied beds. Results Segregation of BMW was being done at the site of generation in almost all the areas of the hospital in color coded polythene bags as per the hospital protocol. The different types of waste being collected were infectious solid waste in red bag, soiled infectious waste in yellow bag and sharp waste in puncture proof container and blue bag. Though awareness (knowledge) about segregation of BMW was seen in 90% of the HCP, 30%-35% did not practice. Out of the total waste generated (57912 kg.), 8686.8 kg. (15%) was infectious waste. Average infectious waste generated was 0.341 Kg per bed per day. The transport, treatment and disposal of each collected waste were outsourced and carried out by ‘Synergy’ waste management Pvt. Ltd

  8. Initiation of a medical toxicology consult service at a tertiary care children's hospital.

    PubMed

    Wang, George Sam; Monte, Andrew; Hatten, Benjamin; Brent, Jeffrey; Buchanan, Jennie; Heard, Kennon J

    2015-05-01

    Currently, only 10% of board-certified medical toxicologists are pediatricians. Yet over half of poison center calls involve children < 6 years, poisoning continues to be a common pediatric diagnosis and bedside toxicology consultation is not common at children's hospitals. In collaboration with executive staff from Department of Pediatrics and Emergency Medicine, regional poison center, and our toxicology fellowship, we established a toxicology consulting service at our tertiary-care children's hospital. There were 139 consultations, and the service generated 13 consultations in the first month; median of 11 consultations per month thereafter (range 8-16). The service increased pediatric cases seen by the fellowship program from 30 to 94. The transition to a consult service required a culture change. Historically, call center advice was the mainstay of consulting practice and the medical staff was not accustomed to the availability of bedside medical toxicology consultations. However, after promotion of the service and full attending and fellowship coverage, consultations increased. In collaboration with toxicologists from different departments, a consultation service can be rapidly established. The service filled a clinical need that was disproportionately utilized for high acuity patients, immediately utilized by the medical staff and provided a robust pediatric population for the toxicology fellowship.

  9. Tuberculosis incidence and treatment completion among Ugandan prison inmates

    PubMed Central

    Schwitters, A.; Kaggwa, M.; Omiel, P.; Nagadya, G.; Kisa, N.; Dalal, S.

    2016-01-01

    SUMMARY BACKGROUND The Uganda Prisons Service (UPS) is responsible for the health of approximately 32 500 inmates in 233 prisons. In 2008 a rapid UPS assessment estimated TB prevalence at 654/100 000, three times that of the general population (183/100 000). Although treatment programs exist, little is known about treatment completion in sub-Saharan African prisons. METHODS We conducted a retrospective study of Ugandan prisoners diagnosed with TB from June 2011 to November 2012. We analyzed TB diagnosis, TB-HIV comorbidity and treatment completion from national registers and tracked prison transfers and releases. RESULTS A total of 469 prisoners were diagnosed with TB over the 1.5-year period (incidence 955/100 000 person-years). Of 466 prisoners starting treatment, 48% completed treatment, 43% defaulted, 5% died and 4% were currently on treatment. During treatment, 12% of prisoners remaining in the same prison defaulted, 53% of transfers defaulted and 81% of those released were lost to follow-up. The odds of defaulting were 8.36 times greater among prisoners who were transferred during treatment. CONCLUSIONS TB incidence and treatment default are high among Ugandan prisoners. Strategies to improve treatment completion and prevent multidrug resistance could include avoiding transfer of TB patients, improving communications between prisons to ensure treatment follow-up after transfer and facilitating transfer to community clinics for released prisoners. PMID:24902552

  10. Parental satisfaction in Ugandan children with cleft lip and palate following synchronous lip and palatal repair.

    PubMed

    Luyten, Anke; D'haeseleer, Evelien; Budolfsen, Dorte; Hodges, Andrew; Galiwango, George; Vermeersch, Hubert; Van Lierde, Kristiane

    2013-01-01

    The purpose of the present case control study was to assess parental satisfaction with speech and facial appearance in Ugandan children with complete unilateral or bilateral cleft lip and palate (CLP), who underwent a synchronous lip and palatal closure. The results are compared with an age- and gender-matched control group. The experimental group consisted of the parents or guardians of 44 Ugandan patients (21 males, 23 females) with complete unilateral or bilateral CLP (mean age: 3;1 years). The control group included the foster mothers of 44 orphan children matched by age and gender (mean age: 3;7 years). A survey based on the Cleft Evaluation Profile was used to assess the perceived satisfaction for individual features related to cleft care. Overall high levels of satisfaction were observed in the experimental group for all features (range: 56-100%). No significant differences could be established regarding age, gender, age of lip and palatal closure, cleft type or maternal vs. paternal judgments. In participants who were dissatisfied with the appearance of the lip, the time period between the cleft closure and the survey was significantly larger compared with satisfied participants. Furthermore, significantly lower levels of satisfaction were observed in the cleft group for speech and the appearance of the teeth and the nose compared with the control group. Satisfaction with speech and facial appearance in Ugandan children with cleft lip and/or palate is important since normal esthetics and speech predominantly determine the children's social acceptance in the Ugandan society. As a result of reading this manuscript, the reader will be able to explain the attitudes of parents toward the surgical repair of their children's cleft lip and palate. As a result of reading this manuscript, the reader will be able to identify differences in parental attitudes toward synchronous lip and palate repair. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. An analysis of 3105 Medico Legal Cases at Tertiary Care Hospital, Rawalpindi.

    PubMed

    Malik, Romana; Atif, Iffat; Rashid, Farah; Abbas, Maqbool

    2017-01-01

    Medico legal cases are essential component of medical practice and comprise most important constituent of emergencies. The reporting of such cases is imperative to recognize theirsocioeconomic burden on any country. The present study was conducted to scrutinize different categories of medico legal cases and characteristics of the victims at casualty department oftertiary care hospital Rawalpindi. The objective of the study was to find out the frequency ofvarious categories of medico legal cases and major characteristics ofvictims at tertiary care hospital, Rawalpindi. This was a cross-sectional study on 3105 registered cases in medico legal record of the casualty department of Benazir Bhutto hospital, Rawalpindi from January 2015 to December 2015. The hospital is located on the main road in densely populated central area of the city. The data wascollected on age, sex, month-wise distribution of various medico legal cases, weapon inflicting the injury, blunt trauma or physical assault, firearm injuries and road traffic accidents. The data thus obtained was analyzed using SPSS; observations were presented in tables and graphs. Out of all 3105 registered medico legal cases, reported cases caused by Road Traffic Accident 1230 (40%) followed by blunt injury or physical assault 966 (32%) cases, 19% by sharp weapons, 5% by poisoning, and 4% by firearm injuries. In our study out of 3105 cases, almost three quarter of victims (73%) were below 30 years of age, with a decreasing frequency beyond this age, males were predominantly inflicted 2516(81%) as compared to females 589 (19%). The reported road traffic accidents cases from urban areas were high (74%) as compared to those from rural locality (37%). In cases of blunt trauma, sharp weapon injuries and firearm injuries, there was a huge preponderance of victims from rural areas (65%), (62%) and 61% respectively, with urban cases constituting less. Road traffic injuries are one of the foremost causes of medico legal cases

  12. Self Esteem and Organizational Commitment Among Health Information Management Staff in Tertiary Care Hospitals in Tehran

    PubMed Central

    Sadoughi, Farahnaz; Ebrahimi, Kamal

    2015-01-01

    Background: Self esteem (SE) and organizational commitment (OC) have significant impact on the quality of work life. Aim: This study aims to gain a better understanding of the relationships between SE and OC among health information management staff in tertiary care hospitals in Tehran (Iran). Methods: This was a descriptive correlational and cross sectional study conducted on the health information management staff of tertiary care hospitals in Tehran, Iran. A total of 155 participants were randomly selected from 400 staff. Data were collected by two standard questionnaires. The SE and OC was measured using Eysenck SE scale and Meyer and Allen’s three component model, respectively. The collected data were analyzed with the SPSS (version 16) using statistical tests of of independent T-test, Pearson Correlation coefficient, one way ANOVA and F tests. Results: The OC and SE of the employees’ were 67.8, out of 120 (weak and 21.0 out of 30 (moderate), respectively. The values for affective commitment, normative commitment, and continuance commitment were respectively 21.3 out of 40 (moderate), 23.9 out of 40 (moderate), and 22.7 out of 40 (moderate). The Pearson correlation coefficient test showed a significant OC and SE was statistically significant (P<0.05). The one way ANOVA test (P<0.05) did not show any significant difference between educational degree and work experience with SE and OC. Conclusion: This research showed that SE and OC are moderate. SE and OC have strong correlation with turnover, critical thinking, job satisfaction, and individual and organizational improvement. Therefore, applying appropriate human resource policies is crucial to reinforce these measures. PMID:25716374

  13. [Visa at a tertiary hospital].

    PubMed

    Martínez-Jiménez, S; Lluch-Colomer, A; Desongles-Corrales, T; Bernal-González, D; Santos-Rubio, M D; Alfaro-Lara, E R; Galván-Banqueri, M

    2013-01-01

    To analyze the visa application process and his activity at a tertiary hosipital. Descriptive study of the drug s visa activity during the period April 2011-April 2012. We designed a database and defined categories on the study variables: patients and recipes. For patients admitted to the Visa Unit, issues detected were recorded based on a previously established classification. 6738 patients were included. They involved the visa of 8,465 recipes. The visa was applied to 170 drugs and nutrition products different, being the majority Tacrolimus. During this period, we detected a total of 420 incidents being the most frequent «No clinical document» (46.67%) and the «Formal completion errors» (28.57%). This work has allowed a more detailed analysis of the activity, the types of incidents and the identification of areas for improvement. Copyright © 2013 SEFH. Published by AULA MEDICA. All rights reserved.

  14. Near-peer mentorship for undergraduate training in Ugandan medical schools: views of undergraduate students

    PubMed Central

    Rukundo, Godfrey Zari; Burani, Aluonzi; Kasozi, Jannat; Kirimuhuzya, Claude; Odongo, Charles; Mwesigwa, Catherine; Byona, Wycliff; Kiguli, Sarah

    2016-01-01

    Introduction Masters Students are major stakeholders in undergraduate medical education but their contribution has not been documented in Uganda. The aim of the study was to explore and document views and experiences of undergraduate students regarding the role of masters students as educators in four Ugandan medical schools. Methods This was a cross-sectional descriptive study using qualitative data collection methods. Eight Focus Group Discussions were conducted among eighty one selected preclinical and clinical students in the consortium of four Ugandan medical schools: Mbarara University of Science and Technology, Makerere College of Health Sciences, Gulu University and Kampala International University, Western Campus. Data analysis was done using thematic analysis. Participants’ privacy and confidentiality were respected and participant identifiers were not included in data analysis. Results Undergraduate students from all the medical schools viewed the involvement of master's students as very important. Frequent contact between masters and undergraduate students was reported as an important factor in undergraduate students’ motivation and learning. Despite the useful contribution, master’ students face numerous challenges like heavy workload and conflicting priorities. Conclusion According to undergraduate students in Ugandan medical schools, involvement of master's students in the teaching and learning of undergraduate students is both useful and challenging to masters and undergraduate students. Masters students provide peer mentorship to the undergraduate students. The senior educators are still needed to do their work and also to support the master's students in their teaching role. PMID:27347289

  15. Male hypogonadism at a tertiary care hospital in Karachi, Pakistan.

    PubMed

    Ram, Nanik; Asghar, Ali; Hashmi, Fauzan; Islam, Najmul

    2012-01-01

    Male hypogonadism is defined as 'inadequate gonadal function, manifested by deficiency in gametogenesis and/or secretion of gonadal hormones'. Signs and symptoms of hypogonadism depend primarily on the age of onset. It can be classified according to the site primarily involved: the gonads, the hypothalamus, or the pituitary gland. The objective this study was to determine the presentation and aetiology of male hypogonadism seen in a tertiary care hospital. This cross-sectional study was conducted at Endocrine Clinics, Aga Khan University Hospital Karachi. Data of male patients with hypogonadism who attended clinics during January 2009 to August 2011 were reviewed. All male patients with clinical and biochemical evidence of hypogonadism were included in the study. Patients with Diabetes Mellitus, Metabolic Syndrome, Andropause, AIDS, Chronic Renal Failure, and Cirrhosis were excluded. Mean +/- SD were computed for quantitative variables. Frequency and percentages were computed for qualitative variables. Aetiology of male hypogonadism was categorised as primary and secondary hypogonadism. A total of 85 patients with male hypogonadism attended the endocrine clinic. Mean age of patients was 25 +/- 10 years. Clinical presentations were small genitalia (65%), absent secondary sexual characteristics (53%), not attained puberty (47%), infertility (53%), erectile dysfunction (41%) and loss of libido (29%). Seventy-three (86%) patients had hypogonadotrophic hypogonadism (secondary hypogonadism) and 12 (14%) patients had hypergonadotrophic hypogonadism (primary hypogonadism). Among the patients with hypogonadotrophic hypogonadism 38 had idiopathic hypogonadotrophic hypogonadsim, 7 had pituitary adenoma, 6 had empty sella syndrome, 3 had Kallman's syndrome, and 1 patient had haemosiderosis due to thalassaemia major; 18 patients did not undergo brain imaging. Small genitalia, absent secondary sexual characteristics and infertility were the main presenting features of hypogonad

  16. Delay in presentation to the hospital and factors affecting it in breast cancer patients attending tertiary care center in Central India.

    PubMed

    Thakur, N A; Humne, A Y; Godale, L B

    2015-01-01

    Despite lower incidence of breast cancer in India, the total number of cases and the net mortality is high. To reduce this increasing load of mortality due to breast cancer we need to lay emphasis on early detection and increased use of systemic therapy. Early detection itself depends on early presentation to a health facility; thus, it is important to identify factors affecting delay in a presentation to hospital. To study the clinico-social profile of breast carcinoma patients attending a tertiary care hospital and to study the time lag since detection of lump by women and presentation to the hospital and factors affecting them. A total of 120 primary breast cancer patients visiting a tertiary care hospital over a period of 7 months (August 2010 to February 2011) were taken up for study. A detailed retrospective analysis of patients was done according to planned proforma. Maximum study subjects were in the age group of 41-50 years. Right and left breasts were equally affected. The most common histo-pathological type of breast carcinoma observed was invasive ductal carcinoma (NOS) in 105 (87.50%) cases. Majority of the cases were in stage III or stage II. The median time lag self-detection of lump in the breast by women and presentation to the hospital was 6 months. Women living in a rural area, those with lower socio-economic status and those with older age tend to assess health-care late. Carcinoma of the breast is a common cancer affecting young to middle age group with invasive ductal carcinoma being the most common histological type. Delay in presentation and late stage presentation is a major concern. Hence, proper awareness and screening programmers are needed to identify, inform and educate these categories of women.

  17. A Qualitative Study of Psychosocial Problems among Parents of Children with Cerebral Palsy Attending Two Tertiary Care Hospitals in Western India

    PubMed Central

    Panchal, Dhara Antani

    2014-01-01

    Objective. To explore the psychosocial problems faced by the parents of children with cerebral palsy (CP) in rural and urban settings. Design. Qualitative research design using focus group discussions (FGDs) was used for the study. Setting. Two FGDs comprising one at a rural tertiary level care hospital and the other at an urban tertiary level care hospital were conducted. Participants. A total of thirteen parents participated in the two FGDs. Main Outcome Measured. Psychosocial problems experienced by the parents of children suffering from CP were measured. Results. The problems experienced by the mothers were associated with common themes such as disturbed social relationships, health problems, financial problems, moments of happiness, worries about future of the child, need for more support services, and lack of adequate number of trained physiotherapists. All the parents had children with problems since birth and most had approached various health care providers for a cure for their child. Conclusions. A wide range of psychosocial problems are experienced by the parents of children with CP. Studies like this can provide valuable information for designing a family centered care programme for children with CP. PMID:24967331

  18. Occupational Exposure to Infection: A study on Healthcare Waste Handlers of a Tertiary Care Hospital in South India.

    PubMed

    Shivalli, Siddharudha; Sowmyashree, H

    2015-11-01

    Occupational exposure to infection is an important public health concern. Such accidents are associated with a few, but pose significant risk to worker's health, family and the community. 1) To assess the knowledge and attitude of waste handlers regarding healthcare waste management in tertiary care hospital of Mangalore. 2) To assess the occupational risk of exposure to infection in their work setting. A cross-sectional study was conducted among healthcare waste handlers (involved in collection, storage and safe disposal) in a tertiary care hospital of Mangalore, India. A semi-structured and pre-tested proforma was used to assess respondents' knowledge and percentage score was calculated based on a scoring system. Chi square and independent sample t tests were applied to judge the association of study variables with knowledge and occupational risk of infection. A total of 43 healthcare waste handlers participated in the study and all were females. Almost half of them had poor knowledge (< 50% score) about healthcare waste management. As much as 41.8% of them had exposure to healthcare waste and 'needle stick injury' was the most common type. Age, literacy and experience did not significantly (p>0.05) influence the knowledge and occupational risk of infection. Respondents' knowledge regarding healthcare waste management was unsatisfactory. They were at high risk of occupational exposure to infection. It emphasizes the need of refresher training and reinforcement of personal protection measures in their work setting. © Journal of the Association of Physicians of India 2011.

  19. Supply chain management with cost-containment & financial-sustainability in a tertiary care hospital.

    PubMed

    Chandra, Hem; Rinkoo, Arvind Vashishta; Verma, Jitendra Kumar; Verma, Shuchita; Kapoor, Rakesh; Sharma, R K

    2013-01-01

    Financial crunch in the present recession results in the non-availability of the right materials at the right time in large hospitals. However due to insufficient impetus towards systems development, situation remains dismal even when funds are galore. Cost incurred on materials account for approximately one-third of the total recurring expenditures in hospitals. Systems development for effective and efficient materials management is thus tantamount to cost-containment and sustainability. This scientific paper describes an innovative model, Hospital Revolving Fund (HRF), developed at a tertiary care research institute in Asia. The main idea behind inception of HRF was to ensure availability of all supplies in the hospital so that the quality of healthcare delivery was not affected. The model was conceptualized in the background of non-availability of consumables in the hospital leading to patient as well as staff dissatisfaction. Hospital supplies have been divided into two parts, approximately 3250 unit items and 1750 miscellaneous items. This division is based on cost, relative-utility and case-specific utilization. 0.1 Million USD, separated from non-planned budget, was initially used as seed money in 1998. HRF procures supplies from reputed firms on concessional rates (8-25%) and make them available to patients at much lesser rates vis-à-vis market rates, levying minimal maintenance charges. In 2009-10, total annual purchases of 14 Million USD were made. The balance sheet reflected 1.4 Million USD as fixed deposit investment. The minimal maintenance charges levied on the patients along with the interest income were sufficient to pay for all recurring expenses related to HRF. Even after these expenses, HRF boosted of 0.2 Million USD as cash-in-hand in financial year 2009-10. In-depth analysis of 'balance sheet' and 'Income and Expenditure' statement of the fund for last five financial years affirms that HRF is a self-sustainable and viable supply chain

  20. Experience of Emergency Peripartum Hysterectomies at a Tertiary Care Hospital in Quetta, Pakistan

    PubMed Central

    Fatima, Mahrukh; Kasi, Pashtoon Murtaza; Baloch, Shahnaz Naseer; Afghan, Abaseen Khan

    2011-01-01

    Emergency peripartum hysterectomy (EPH) is associated with significant morbidity and mortality worldwide. The purpose of our paper was to determine the incidence, morbidity, and mortality of EPH done at our institution; the largest tertiary care government hospital in the city of Quetta, Pakistan. During the study period there were 12,642 deliveries, out of which 46 women had undergone an EPH, translating into an incidence of ∼4 per 1,000 births. Disturbingly, 82.6% of these patients had received no antenatal care prior to their presentation. There were 4 (8.7%) maternal deaths and 31 (67.4%) perinatal deaths. The commonest indication noted was uterine rupture in 21 (45.7%) cases. Lack of antenatal care is indeed a modifiable factor that needs to be addressed to help reduce maternal and fetal morbidity/mortality not only from emergency hysterectomies but also from all other preventable causes. PMID:21977328

  1. Malnutrition is common in Ugandan children with cerebral palsy, particularly those over the age of five and those who had neonatal complications.

    PubMed

    Kakooza-Mwesige, Angelina; Tumwine, James K; Eliasson, Ann-Christin; Namusoke, Hanifa K; Forssberg, Hans

    2015-12-01

    Poor growth and malnutrition are frequently reported in children with cerebral palsy in developed countries, but there is limited information from developing countries. We investigated the nutritional status of Ugandan children with cerebral palsy and described the factors associated with poor nutrition. We examined 135 children from two to 12 years with cerebral palsy, who attended Uganda's national referral hospital. A child was considered underweight, wasted, stunted or thin if the standard deviation scores for their weight for age, weight for height, height for age and body mass index for age were ≤-2.0 using World Health Organization growth standards. Multivariable logistic regression identified the factors associated with nutritional indicators. Over half (52%) of the children were malnourished, with underweight (42%) being the most common category, followed by stunting (38%), thinness (21%) and wasting (18%). Factors that were independently associated with being malnourished were as follows: presence of cognitive impairment, with an adjusted odds ratio (aOR) of 4.5, being 5 years or older (aOR = 3.4) and feeding difficulties in the perinatal period (aOR = 3.2). Malnutrition was common in Ugandan children with cerebral palsy and more likely if they were 5 years or more or had experienced neonatal complications. ©2015 The Authors. Acta Paediatrica published by John Wiley & Sons Ltd on behalf of Foundation Acta Paediatrica.

  2. Prevalence and risk factors for CTX-M gram-negative bacteria in hospitalized patients at a tertiary care hospital in Kilimanjaro, Tanzania.

    PubMed

    Sonda, Tolbert; Kumburu, Happiness; van Zwetselaar, Marco; Alifrangis, Michael; Mmbaga, Blandina T; Lund, Ole; Aarestrup, Frank M; Kibiki, Gibson

    2018-05-01

    Emergence and spread of extended spectrum beta-lactamase (ESBL)-producing gram-negative bacteria, mainly due to CTX-M, is a major global public health problem. Patients infected with ESBL-producing gram-negative bacteria have an increased risk of treatment failure and death. We investigated the prevalence and risk factors for CTX-M gram-negative bacteria isolated from clinical specimens of patients hospitalized at a tertiary care hospital in Kilimanjaro, Tanzania. Isolated gram-negative bacteria from inpatients admitted at Kilimanjaro Christian Medical Centre (KCMC) between August 2013 and August 2015 were fully genome sequenced. The prevalence of ESBL-producing gram-negative bacteria was determined based on the presence of bla CTX-M . The odds ratio (OR) and risk factors for ESBL-producing gram-negative bacteria due to CTX-M were assessed using logistic regression models. The overall CTX-M prevalence (95% CI) was 13.6% (10.1-18.1). Adjusted for other factors, the OR of CTX-M gram-negative bacteria for patients previously hospitalized was 0.26 (0.08-0.88), p = 0.031; the OR for patients currently on antibiotics was 4.02 (1.29-12.58), p = 0.017; the OR for patients currently on ceftriaxone was 0.14 (0.04-0.46), p = 0.001; and the OR for patients with wound infections was 0.24 (0.09-0.61), p = 0.003. The prevalence of ESBL-producing gram-negative bacteria due to CTX-M in this setting is relatively low compared to other previous reports in similar settings. However, to properly stop further spread in the hospital, we recommend setting up a hospital surveillance system that takes full advantage of the available next-generation sequencing facility to routinely screen for all types of bacterial resistance genes.

  3. Presentations and Outcome of Thyroiditis from a Tertiary Care Hospital of Karachi.

    PubMed

    Mahar, Saeed Ahmed; Shahid, Muhammad; Sarfaraz, Aqiba; Shaikh, Zuhaib-u-Ddin; Shaikh, Shiraz; Shahid, Nadia

    2015-10-01

    To assess the clinical presentations and short-term outcomes of patients with thyroiditis presenting to a tertiary care hospital in Karachi, Pakistan. Case series. Department of Endocrinology, Liaquat National Hospital, Karachi, from June 2014 to February 2015. Patients between 18 and 70 years of age with acute onset of thyroiditis confirmed on thyroid scan or clinical judgment presenting to the outpatient services were included in the study. Pregnant females, psychiatric patients and patients having other chronic illnesses were excluded from the study. A total of 26 patients with thyroiditis attended the endocrine clinic. Mean age of patients was 41.2 ± 11.12 years. There were 18 (69.2%) females. Clinical presentations were fever (65.4%), tender neck (23.1%), goiter (19.2%), localized tenderness in neck and palpable lymph nodes (26.9%). Major symptoms reported were: sore throat (69.2%), weight loss (38.5%), upper respiratory tract infection, thyroid pain, tremor, sweating and fever of unknown origin in 26.9% cases. All the patients had raised Erythrocyte Sedimentation Rate (ESR). Low Thyroid Stimulating Hormone (TSH) < 0.4 mlU/L was seen in 88.5% and 57.7% had raised Free T4 > 1.8 ng/dL. Complete recovery was seen in 88.5% patients while 11.5% had early hypothyroidism. Fever and sore throat were the main presenting features of thyroiditis patients. ESR was raised in all patients. A majority of patients had complete recovery with appropriate management; however, few cases developed hypothyroidism.

  4. Vision Screening of Ophthalmic Nursing Staff in a Tertiary Eye Care Hospital

    PubMed Central

    Khan, Ruhi A.; Souru, Ches; Vaghese, Sejo; Yasir, Ziaul; Khandekar, Rajiv

    2017-01-01

    Objectives This study aimed to evaluate ocular healthcare-seeking behaviours and vision screening outcomes of nursing staff at a tertiary eye care hospital. Methods This study was conducted between April and September 2016 among all 500 nurses employed at the King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia. Data were collected on age, gender, use of visual aids, the presence of diabetes, a history of refractive surgery and date of last ocular health check-up. Participants were tested using a handheld Spot™ Vision Screener (Welch Allyn Inc., Skaneateles Falls, New York, USA). Results A total of 150 nurses participated in the study (response rate: 30.0%). The mean age was 41.2 ± 8.9 years old. Distance spectacles, reading spectacles and both types of spectacles were used by 37 (24.7%), 32 (21.3%) and 10 (6.7%) nurses, respectively. A total of 58 nurses (38.7%) failed the vision screening test. Visual defects were detected for the first time in 13 nurses (8.7%). With regards to regular eye checkups, 77 participants (51.3%) reported acceptable ocular healthcare-seeking behaviours; this factor was significantly associated with age and the use of visual aids (P <0.01 each). Conclusion A high proportion of participants failed the vision screening tests and only half displayed good ocular healthcare-seeking behaviours. This is concerning as ophthalmic nurses are likely to face fewer barriers to eye care services than the general population. PMID:28417032

  5. β-Lactamases in amoxicillin-clavulanate-resistant Escherichia coli strains isolated from a Chinese tertiary hospital.

    PubMed

    Ding, Juanjuan; Ma, Xitao; Chen, Zhuochang; Feng, Keqing

    2013-08-01

    A total of 52 strains were resistant to amoxicillin-clavulanate by disk diffusion method in a Chinese tertiary hospital from July 2011 to December 2011. Among these isolates, 2 isolates possessed a phenotype consistent with production of inhibitor-resistant temoniera (TEM) (IRT) β-lactamase, and the TEM-type gene was cloned into strains of Escherichia coli JM109 cells. Both had no blaTEM mutations and were identified as TEM-1 β-lactamase producers. As a result, no IRT β-lactamase was detected. Multiplex PCR detected most of these strains produced TEM-1 enzymes, and plasmid-mediated AmpC β-lactamase and oxacillinase-1 β-lactamases are important mechanisms of resistance as well. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Severity and frequency of community-onset Clostridium difficile infection on an Australian tertiary referral hospital campus.

    PubMed

    Clohessy, Penny; Merif, Juan; Post, Jeffrey John

    2014-12-01

    Clostridium difficile infection (CDI) is increasingly being found in populations without traditional risk factors. We compared the relative frequency, risk factors, severity, and outcomes of community-onset CDI with hospital-acquired infection. This was a retrospective, observational study of CDI at a tertiary hospital campus in Sydney, Australia. Patients aged 15 years and older with a first episode of CDI from January 1 to December 31, 2011 were included. CDI was defined as the presence of diarrhoea with a positive enzyme immunoassay in conjunction with a positive cell cytotoxicity assay, toxin culture, or organism culture. Main outcome measures were onset of infection (hospital or community), risk factors, markers of severity, and outcomes for the two groups. One hundred and twenty-nine cases of CDI infection were identified, of which 38 (29%) were community-onset. The community-onset infection group were less likely to have a recent history of antibiotic use (66% vs. 98%; p<0.001) or proton pump inhibitor use (38% vs. 69%; p=0.03) than the hospital-acquired infection group. Markers of severity and outcomes were similar in the two groups, with an overall mortality of 9%. Community-onset CDI accounts for a large proportion of C. difficile infections and has a similar potential for severe disease as hospital-acquired infection. Using a history of previous antibiotic use, proton pump inhibitor use, or recent hospitalization to predict cases is unreliable. We recommend that patients with diarrhoea being investigated in emergency departments and community practice are tested for Clostridium difficile infection. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  7. Industrial accident-related ocular emergencies in a tertiary hospital in Singapore.

    PubMed

    Ngo, C S; Leo, S W

    2008-04-01

    We present a review of industrial accident-related ocular trauma, from the perspective of the emergency setting of a tertiary hospital in Singapore. A retrospective analysis of patients seen by Tan Tock Seng Hospital's emergency ophthalmology service over a six-month period was performed. Data on clinical presentation, cause of injury, use of protective eyewear and subsequent losses of days-of-work were collected via a standardised telephone interview and review of case-sheets. A total of 300 persons presented with a diagnosis of industrial accident-related ocular trauma, out of the 1,460 patients seen during the study period. 95.7 percent were non-residents and the average age was 31 years. 99.3 percent were males. 66.0 percent were provided with protective eyewear, while 44.7 percent of those were non-compliant. The most common types of injuries were superficial foreign body (71.3 percent), chemical injury (10 percent) and blunt trauma (4 percent), while severe injury requiring admission and emergency surgery occurred in 15 cases. Average loss of days of work was 3.4 days. Industrial accident-related ocular trauma comprises a relatively large proportion of the patients requiring ophthalmic review at the emergency service level in Singapore. These patients are mainly young, non-resident men and the injuries were generally minor. These are largely preventable with the use of well-fitting protective eyewear and strict compliance. This would greatly reduce the unnecessary loss of workdays. Therefore, there is a need to review the design, and reinforce the strict implementation of occupational eye safety programmes, especially among non-resident workers.

  8. Prevalence of Clostridium difficile infection and colonization in a tertiary hospital and elderly community of North-Eastern Peninsular Malaysia.

    PubMed

    Zainul, N H; Ma, Z F; Besari, A; Siti Asma, H; Rahman, R A; Collins, D A; Hamid, N; Riley, T V; Lee, Y Y

    2017-10-01

    Little is known about Clostridium difficile infection (CDI) in Asia. The aims of our study were to explore (i) the prevalence, risk factors and molecular epidemiology of CDI and colonization in a tertiary academic hospital in North-Eastern Peninsular Malaysia; (ii) the rate of carriage of C. difficile among the elderly in the region; (iii) the awareness level of this infection among the hospital staffs and students. For stool samples collected from hospital inpatients with diarrhea (n = 76) and healthy community members (n = 138), C. difficile antigen and toxins were tested by enzyme immunoassay. Stool samples were subsequently analyzed by culture and molecular detection of toxin genes, and PCR ribotyping of isolates. To examine awareness among hospital staff and students, participants were asked to complete a self-administered questionnaire. For the hospital and community studies, the prevalence of non-toxigenic C. difficile colonization was 16% and 2%, respectively. The prevalence of CDI among hospital inpatients with diarrhea was 13%. Out of 22 C. difficile strains from hospital inpatients, the toxigenic ribotypes 043 and 017 were most common (both 14%). In univariate analysis, C. difficile colonization in hospital inpatients was significantly associated with greater duration of hospitalization and use of penicillin (both P < 0·05). Absence of these factors was a possible reason for low colonization in the community. Only 3% of 154 respondents answered all questions correctly in the awareness survey. C. difficile colonization is prevalent in a Malaysian hospital setting but not in the elderly community with little or no contact with hospitals. Awareness of CDI is alarmingly poor.

  9. Ugandan Adolescents' Sources, Interpretation and Evaluation of Sexual Content in Entertainment Media Programming

    ERIC Educational Resources Information Center

    Miller, Ann Neville; Nalugya, Evangeline; Gabolya, Charles; Lagot, Sarah; Mulwanya, Richard; Kiva, Joseph; Nabasaaka, Grace; Chibita, Monica

    2016-01-01

    Although mounting evidence in Western nations indicates that entertainment media influence young people's sexual socialisation, virtually no research has addressed the topic in sub-Saharan Africa. The present study employed 14 focus groups of Ugandan high school students to identify media through which they were exposed to sexual content, how they…

  10. Reducing waiting time and raising outpatient satisfaction in a Chinese public tertiary general hospital-an interrupted time series study.

    PubMed

    Sun, Jing; Lin, Qian; Zhao, Pengyu; Zhang, Qiongyao; Xu, Kai; Chen, Huiying; Hu, Cecile Jia; Stuntz, Mark; Li, Hong; Liu, Yuanli

    2017-08-22

    It is globally agreed that a well-designed health system deliver timely and convenient access to health services for all patients. Many interventions aiming to reduce waiting times have been implemented in Chinese public tertiary hospitals to improve patients' satisfaction. However, few were well-documented, and the effects were rarely measured with robust methods. We conducted a longitudinal study of the length of waiting times in a public tertiary hospital in Southern China which developed comprehensive data collection systems. Around an average of 60,000 outpatients and 70,000 prescribed outpatients per month were targeted for the study during Oct 2014-February 2017. We analyzed longitudinal time series data using a segmented linear regression model to assess changes in levels and trends of waiting times before and after the introduction of waiting time reduction interventions. Pearson correlation analysis was conducted to indicate the strength of association between waiting times and patient satisfactions. The statistical significance level was set at 0.05. The monthly average length of waiting time decreased 3.49 min (P = 0.003) for consultations and 8.70 min (P = 0.02) for filling prescriptions in the corresponding month when respective interventions were introduced. The trend shifted from baseline slight increasing to afterwards significant decreasing for filling prescriptions (P =0.003). There was a significant negative correlation between waiting time of filling prescriptions and outpatient satisfaction towards pharmacy services (r = -0.71, P = 0.004). The interventions aimed at reducing waiting time and raising patient satisfaction in Fujian Provincial Hospital are effective. A long-lasting reduction effect on waiting time for filling prescriptions was observed because of carefully designed continuous efforts, rather than a one-time campaign, and with appropriate incentives implemented by a taskforce authorized by the hospital managers. This

  11. Acinetobacter baumannii: Epidemiological and Beta-Lactamase Data From Two Tertiary Academic Hospitals in Tshwane, South Africa

    PubMed Central

    Lowe, Michelle; Ehlers, Marthie M.; Ismail, Farzana; Peirano, Gisele; Becker, Piet J.; Pitout, Johann D. D.; Kock, Marleen M.

    2018-01-01

    Acinetobacter baumannii is an opportunistic pathogen that is increasingly responsible for hospital-acquired infections. The increasing prevalence of carbapenem resistant A. baumannii has left clinicians with limited treatment options. Last line antimicrobials (i.e., polymyxins and glycylcyclines) are often used as treatment options. The aim of this study was to determine the prevalence of selected β-lactamase genes from A. baumannii isolates obtained from patients with hospital-acquired infections and to determine the genetic relationship and epidemiological profiles among clinical A. baumannii isolates collected from two tertiary academic hospitals in the Tshwane region, South Africa (SA). Multiplex-PCR (M-PCR) assays were performed to detect selected resistance genes. The collected isolates’ genetic relatedness was determined by using pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). The acquired oxacillinase (OXA) genes, notably blaOXA-23-like were prevalent in the A. baumannii isolates. The M-PCR assays showed that the isolates collected from hospital A contained the OXA-23-like (96%; n = 69/72) genes and the isolates collected from hospital B contained the OXA-23-like (91%; n = 63/69) and OXA-58-like (4%; n = 3/69) genes. Colistin resistance was found in 1% of the isolates (n = 2/141) and tigecycline intermediate resistance was found in 6% of the isolates (n = 8/141). The A. baumannii isolates were genetically diverse. Molecular epidemiological data showed that specific sequence types (STs) (ST106, ST229, ST258 and ST208) were established in both hospitals, while ST848 was established in hospital A and ST502, ST339 and the novel ST1552 were established in hospital B. ST848 (established in hospital A) was predominately detected in ICU wards whereas ST208, ST339 and the novel ST1552 (established in hospital B) were detected in ICUs and the general wards. The origin of the A. baumannii isolates in the hospitals may be due to the

  12. [Results of pulmonary embolism treatment in a tertiary hospital short stay unit. Is this the right place?].

    PubMed

    Rosa Salazar, V; Bernal Martínez, L; García Pino, M J; Hernández Contreras, M E; García Méndez, M M; García Pérez, B; Marras Fernández-Cid, C

    2016-01-01

    To determine the mean stay (MS) of patients with pulmonary embolism (PE) in a thrombosis unit (TU) with a short stay unit (SSU) in a tertiary hospital. To compare the data collected with those of other hospitals in the same region, of other regions (Autonomous Communities [AACC]), and within the same hospital in the year before the SSU opened. A descriptive retrospective observational study that included patients with a diagnosis of PE in the University Hospital Virgen de la Arrixaca (HCUVA) in 2012. These data were classified by hospital department, and used for calculating the mean stay. This was then compared with that of other hospitals in our region, with the rest of the regions, and with the data in 2007 (the last year without a TU). A total of 113patients with PE were included, 60 (53%) in the TU with an MS of 4.39, in Oncology, 7.45, and Internal Medicine (IM), 15.38days. There were no deaths in the TU and only 3 (5%) readmissions. Published data showed that the MS in all hospitals in our region was 8.25, 5.18 in our hospital, and higher in the rest of hospitals. The best AACC was the Basque Country with an MS of 6.85days. In 2007, there were 70patients with PE in the HCUVA, 34 (49%) in IM, with an MS of 8.50, Oncology 11 (31%) with an MS 9.64, and Chest Diseases 3 (4.3%) with an MS 19days, and with an overall mortality of 11% and a rate of readmissions in IM of 6%. The mean stay for a PE in the SSU of a TU was lower than in the rest of the hospital departments, lower than the rest hospitals of our region, lower than the rest of the regions, and lower than any department of our hospital before the SSU existed, without increasing the readmission or mortality rate. Copyright © 2015 SECA. Publicado por Elsevier España, S.L.U. All rights reserved.

  13. Complications of hypospadias surgery: Experience in a tertiary hospital of a developing country

    PubMed Central

    Appeadu-Mensah, William; Hesse, Afua Adwo Jectey; Glover-Addy, Hope; Osei-Nketiah, Samuel; Etwire, Victor; Sarpong, Pokua Ama

    2015-01-01

    Background: Over 300 different operations have been described for the management of hypospadias. In recent times, the numbers of operations used in various centres have gradually reduced as the principles necessary to ensure adequate cosmetic and functional results with minimum complications are better understood. The aim of this article was to review the different types of operations used for managing hypospadias in a tertiary hospital in a developing country, to analyse the complications of surgery and discuss the factors that contribute to complications. Materials and Methods: Patient folders, theatre, and ward records were used to obtain the required information. The age at surgery, types of hypospadias at presentation, types of operations done and complications were analysed. Results and Conclusion: With three main types of operations, tubularised incised plate urethroplasty and meatal advancement and glanuloplasty incorporated for anterior hypospadias (glanular, coronal, subcoronal, distal, midpenile), and lateral based flap urethroplasty for posterior hypospadias (proximal penile, penoscrotal, scrotal, perineal), most hypospadias were corrected with acceptable complication rates. PMID:26712282

  14. Financial impact of tertiary care in an academic medical center.

    PubMed

    Huber, T S; Carlton, L M; O'Hern, D G; Hardt, N S; Keith Ozaki, C; Flynn, T C; Seeger, J M

    2000-06-01

    To analyze the financial impact of three complex vascular surgical procedures to both an academic hospital and a department of surgery and to examine the potential impact of decreased reimbursements. The cost of providing tertiary care has been implicated as one potential cause of the financial difficulties affecting academic medical centers. Patients undergoing revascularization for chronic mesenteric ischemia, elective thoracoabdominal aortic aneurysm repair, and treatment of infected aortic grafts at the University of Florida were compared with those undergoing elective infrarenal aortic reconstruction and carotid endarterectomy. Hospital costs and profit summaries were obtained from the Clinical Resource Management Office. Departmental costs and profit summary were estimated based on the procedural relative value units (RVUs), the average clinical cost per RVU ($33.12), surgeon charges, and the collection rate for the vascular surgery division (30.2%) obtained from the Faculty Group Practice. Surgeon work effort was analyzed using the procedural work RVUs and the estimated total care time. The analyses were performed for all payors and the subset of Medicare patients, and the potential impact of a 15% reduction in hospital and physician reimbursement was analyzed. Net hospital income was positive for all but one of the tertiary care procedures, but net losses were sustained by the hospital for the mesenteric ischemia and infected aortic graft groups among the Medicare patients. In contrast, the estimated reimbursement to the department of surgery for all payors was insufficient to offset the clinical cost of providing the RVUs for all procedures, and the estimated losses were greater for the Medicare patients alone. The surgeon work effort was dramatically higher for the tertiary care procedures, whereas the reimbursement per work effort was lower. A 15% reduction in reimbursement would result in an estimated net loss to the hospital for each of the tertiary

  15. Missed or Delayed Cervical Spine or Spinal Cord Injuries Treated at a Tertiary Referral Hospital in Rwanda.

    PubMed

    Nkusi, Agabe Emmy; Muneza, Sévérien; Hakizimana, David; Nshuti, Steven; Munyemana, Paulin

    2016-03-01

    This study was aimed at 1) reporting cases of missed cervical spine injuries treated at a tertiary-level hospital, King Faisal Hospital, Rwanda (KFH-R), and 2) identifying the causes of delaying the diagnosis. We prospectively collected data from patients with a missed or delayed cervical spine and/or cord injury treated at King Faisal Hospital, Kigali for a 12-month period (January 2012 to December 2012). The total number of cervical spine injury patients treated at our center was retrieved from the hospital admission registry. Forty-two patients with cervical spine or spinal cord injuries were treated at KFH-R in 2012, and 4 of them had a missed or delayed diagnosis. Clinical and radiologic findings of all 4 patients are presented, and the reasons for delaying diagnosis are identified. This study found that the cervical spine injuries were missed in 9.5% of the cervical spine trauma patients and resulted in a longer hospital stay for all 4 patients and severe disability in 1 patient (25%). The reasons for missed diagnoses in this study were 1) lack of cervical spine radiographic evaluation, 2) inadequate cervical spine radiographs to show the level of injury, 3) poor sensitivity of cervical spine plain radiography, 4) poor physical examination, 5) the presence of a distracting injury, and 6) poor sensitivity of radiographs and computed tomography scans for soft tissue injuries. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Do doctors have hidden distress; a study conducted at tertiary care hospital at Lahore.

    PubMed

    Atif, Khaula; Khan, Habib Ullah; Malik, Adeela Farid

    2016-01-01

    Toanalyse the prevalence of distress in doctors serving in a tertiary care hospital and studying the factors having significant impact on the subject. The cross-sectional study was conducted at the Combined Military Hospital, Lahore, from February to December 2014, and comprised doctors serving for at least six months who volunteered to fill out the standardised General Health Questionnaire-12Demographic features and level of job satisfaction were taken as independent variables. Outcome variable was the questionnaire score. SPSS 20 was used for data analysis. The mean questionnaire score of the 97 respondents in the study was 12.27±6.397. Of them, 19(19.6%) and 11(11.3%) had distress and severe distress respectively. Marital status (p=0.006), age (p=0.029), income per month (p=0.010) and levels of job satisfaction (p=0.001) had significant impact on the scores. Variables having insignificant impact were gender (p=0.529), number of children (p=0.220), education (p=0.816), service years (p=0.155), current employment (p=0.504), nature of job (p=0.531), working hours (p=0.632), additional duties (p=0.663), and socioeconomic class (p=0.935). Almost one-third of the doctors had distress under the significant impact of multiple factors.

  17. Epidemiology of road traffic injury patients presenting to a tertiary hospital in Hyderabad, India.

    PubMed

    Howley, Isaac W; Gupta, Shivam; Tetali, Shailaja; Josyula, Lakshmi K; Wadhwaniya, Shirin; Gururaj, Gopalkrishna; Rao, Mohan; Hyder, Adnan A

    2017-12-01

    Road traffic injuries kill more people in India than in any other country in the world, and these numbers are rising with increasing population density and motorization. Official statistics regarding road traffic injuries are likely subject to underreporting. This study presents results of a surveillance program based at a public tertiary hospital in Hyderabad, India. All consenting patients who presented to the casualty ward after a road traffic injury over a 9-month period were enrolled. Interviews were performed and data abstracted from clinical records by trained research assistants. Data included demographics, injury characteristics, risk factors, safety behaviors, and outcomes. A total of 5,298 patients were enrolled; their mean age was 32.4 years (standard deviation 13.8) and 87.3% were men; 58.2% of patients were injured while riding a motorcycle or scooter, 22.5% were pedestrians, and 9.2% used motorized rickshaws. The most frequent collision type was skid or rollover (40.9%). Male victims were younger than female victims and were overrepresented among motorized 2-wheeler users. Patients were most frequently injured from 1600 to 2400. A total of 27.3% of patients were admitted. Hospital mortality was 5.3%, and 48.2% of deaths were among motorized 2-wheeler users. This is one of the few prospective, hospital-based studies of road traffic injury epidemiology in India. The patient population in this study was similar to prior hospital-based studies. When compared to government surveillance systems, this study showed motorized 2-wheeler users to be more frequently represented among the overall population and among fatalities. Further research should be done to develop interventions to decrease mortality associated with 2-wheeled vehicles in India. Copyright © 2017. Published by Elsevier Inc.

  18. Explaining the uptake of paediatric guidelines in a Kenyan tertiary hospital – mixed methods research

    PubMed Central

    2014-01-01

    Background Evidence-based standards for management of the seriously sick child have existed for decades, yet their translation in clinical practice is a challenge. The context and organization of institutions are known determinants of successful translation, however, research using adequate methodologies to explain the dynamic nature of these determinants in the quality-of-care improvement process is rarely performed. Methods We conducted mixed methods research in a tertiary hospital in a low-income country to explore the uptake of locally adapted paediatric guidelines. The quantitative component was an uncontrolled before and after intervention study that included an exploration of the intervention dose-effect relationship. The qualitative component was an ethnographic research based on the theoretical perspective of participatory action research. Interpretive integration was employed to derive meta-inferences that provided a more complete picture of the overall study results that reflect the complexity and the multifaceted ontology of the phenomenon studied. Results The improvement in health workers’ performance in relation to the intensity of the intervention was not linear and was characterized by improved and occasionally declining performance. Possible root causes of this performance variability included challenges in keeping knowledge and clinical skills updated, inadequate commitment of the staff to continued improvement, limited exposure to positive professional role models, poor teamwork, failure to maintain professional integrity and mal-adaptation to institutional pressures. Conclusion Implementation of best-practices is a complex process that is largely unpredictable, attributed to the complexity of contextual factors operating predominantly at professional and organizational levels. There is no simple solution to implementation of best-practices. Tackling root causes of inadequate knowledge translation in this tertiary care setting will require long

  19. Audit of anesthetic trainees' 'hands-on' operating room experience in an Australian tertiary children's hospital.

    PubMed

    Hogan, Bridget; Keating, Matthew; Chambers, Neil A; von Ungern-Sternberg, Britta

    2016-05-01

    There are no internationally accepted guidelines about what constitutes adequate clinical exposure during pediatric anesthetic training. In Australia, no data have been published on the level of experience obtained by anesthetic trainees in pediatric anesthesia. There is, however, a new ANZCA (Australian and New Zealand College of Anaesthetists) curriculum that quantifies new training requirements. To quantify our trainees' exposure to clinical work in order to assess compliance with new curriculum and to provide other institutions with a benchmark for pediatric anesthetic training. We performed a prospective audit to estimate and quantify our anesthetic registrars' exposure to pediatric anesthesia during their 6-month rotation at our institution, a tertiary pediatric hospital in Perth, Western Australia. Our data suggest that trainees at our institution will achieve the new ANZCA training standards comfortably, in terms of the required volume and breadth of exposure. Experience, however, of some advanced pediatric anesthetic procedures appears limited. Experience gained at our hospital easily meets the new College requirements. Experience of fiber-optic intubation and regional blocks would appear insufficient to develop sufficient skills or confidence. The study provides other institutions with information to benchmark against their own trainee experience. © 2016 John Wiley & Sons Ltd.

  20. Level of adherence to an extravasation protocol over 10 years in a tertiary care hospital.

    PubMed

    Molas-Ferrer, Gloria; Farré-Ayuso, Elisabet; doPazo-Oubiña, Fernando; deAndrés-Lázaro, Ana; Guell-Picazo, Jaume; Borrás-Maixenchs, Núria; Corominas-Bosch, Lourdes; Valverde-Bosch, Montserrat; Creus-Baró, Natalia

    2015-04-01

    Extravasation of chemotherapy is an undesirable complication related to the administration of antineoplastic therapy. Establishing the real incidence is difficult. Because of the importance of a quick intervention after an extravasation, every hospital should have an extravasation protocol. The purpose of this study was to determine the degree of observance of an extravasation protocol by nursing staff and to determine extravasation incidence. This descriptive, longitudinal, retrospective study was set in a tertiary-level hospital. The researchers reviewed 117 extravasation notification forms received by the pharmacy department during a 10-year period. Nursing actuation, particularly observance of the extravasation protocol, was analyzed. Protocol adherence was 89%. Twelve deviations from the protocol in the application of recommended measures were detected. An antidote was used in 41 patients, and temperature measures were applied in 14 cases. Ninety-nine patients had at least one episode of reported follow-up. No cases of necrosis or skin ulcers were described, except by one patient, who developed a delayed skin ulcer to vinorelbine. Drugs most frequently reported were etoposide, carboplatin, and paclitaxel. Nursing staff should be continuously trained in extravasation protocol because a rapid actuation can prevent skin lesions.

  1. Distribution of 16S rRNA Methylases Among Different Species of Aminoglycoside-Resistant Enterobacteriaceae in a Tertiary Care Hospital in Poland.

    PubMed

    Piekarska, Katarzyna; Zacharczuk, Katarzyna; Wołkowicz, Tomasz; Rzeczkowska, Magdalena; Bareja, Elżbieta; Olak, Monika; Gierczyński, Rafał

    2016-01-01

    Aminoglycosides are a group of antimicrobial agents still the most commonly used in the treatment of life-threatening bacterial infections in human and animals. The emergence and spread of 16S rRNA methylases, which confer high-level resistance to the majority of clinically relevant aminoglycosides, constitute a major public health concern. Our goal was to evaluate the distribution of 16S rRNA methylases among different species of Enterobacteriaceae during a five month-long survey in a tertiary hospital in Warszawa, Poland. In the survey, a total of 1770 non-duplicate clinical isolates were collected from all hospital wards in a tertiary hospital in Warszawa, Poland. The survey was conducted between 19 April and 19 September 2010. The ability to produce 16S rRNA methylase was examined by determining MICs for gentamicin, kanamycin, amikacin by means of the agar dilution method. The isolates resistant to high concentration of aminoglycosides were PCR tested for genes: armA, rmtA, rmtB and rmtC. PCR products were subjected to DNA sequencing by the Sanger method. The genetic similarity of the ArmA-producing isolates was analysed by pulsed-filed gel electrophoresis (PFGE). ArmA was the only 16S rRNA methylase detected in 20 of 1770 tested isolates. The overall prevalence rate of ArmA was 1.13%. In K. pneumoniae (n = 742), P. mirabilis (n = 130), and E. cloacae (n = 253) collected in the survey, the prevalence of ArmA was 0.4%, 0.8% and 5.9%, respectively. The PFGE revealed both horizontal and clonal spread of the armA gene in the hospital. The prevalence of 16S rRNA methylase ArmA reported in this study is significantly higher than observed in other countries in Europe.

  2. Homophobia as a barrier to comprehensive media coverage of the Ugandan anti-homosexual bill.

    PubMed

    Strand, Cecilia

    2012-01-01

    The Ugandan Anti-Homosexuality Bill of October 2009 caused an international outcry and sparked intense debate in the local media. This article explores to what degree a discriminatory social environment manifests itself in the Ugandan print media and discusses the potential implications for media's coverage of contentious policy options such as the Anti-Homosexuality Bill. A content analysis of 115 items from two daily newspapers (the government-owned New Vision and the privately owned the Daily Monitor, between October and December 2009) indicates the existence of two separate house styles; this is in spite of the fact that both newspapers reproduce the surrounding society's homophobia, albeit with different frequency. Unlike the New Vision, the Daily Monitor includes coverage on homophobia and discrimination, as well as provides space for criticism of the Bill. By acknowledging discrimination and its negative impact, the newspaper de-legitimizes homophobia and problematizes the proposed Anti-homosexuality Bill for their readers.

  3. Epidemiology of epistaxis in the emergency department of a southern European tertiary care hospital.

    PubMed

    Reis, Luis Roque; Correia, Filipe; Castelhano, Luis; Escada, Pedro

    2018-05-05

    Epistaxis is the most common rhinological emergency seen in the emergency department. The purpose of this study was to evaluate epidemiological data of epistaxis in a southern European tertiary care hospital. A retrospective study was conducted during the period between January 2009 and December 2015. We analyzed the distribution by cross-referencing the demographic variables, destination after medical discharge, inpatient characteristics (major comorbid diseases, medication, bleeding localization and treatment) and health-care costs with the disease. Epistaxis accounted for approximately 1 in 30 visits to the ED and 77 out of a population of 100,000 was served by that ED. Overall, 71,624 patients were treated and 2371 patients presented with epistaxis (3.31%). One-thousand three-hundred and twenty-seven cases were male and 1044 female (p <.001). The mean age was 56 years (±26). Age distribution was bimodal, with peaks among those <10 years and >70 (p <.001). Epistaxis was more common in the winter months (p < 0.001). The main referral destinations (6.8%) included outpatient (2.9%) and inpatient (1.9%) services. Hospitalization was more frequent between the ages of 60 and 80 years (p =.029), and the major comorbidity was hypertension (47.8%). Medication interfering with haemostasis was documented in 30.4%. Most inpatient epistaxis was managed in a non-interventional manner and only. 5% of patients needed surgery. The mean total health-care cost was 69.8 € per episode. Emergency epistaxis was more frequent in men, the elderly, patients with underlying comorbidities, during the winter months, and showed a higher risk of referral and hospitalization with increasing age (as a result of an aging population in western countries). The main hospital expenses for epistaxis are related to hospitalization and health care costs. Copyright © 2018 Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. Publicado por Elsevier España, S.L.U. All rights

  4. Cardiac Surgery in Jehovah's Witness Patients: Experience of a Brazilian Tertiary Hospital.

    PubMed

    Valle, Felipe Homem; Pivatto, Fernando; Gomes, Bruna Sessim; Freitas, Tanara Martins de; Giaretta, Vanessa; Gus, Miguel

    2017-01-01

    The outcomes of Jehovah's Witness (JW) patients submitted to open heart surgery may vary across countries and communities. The aim of this study was to describe the morbidity and mortality of JW patients undergoing cardiac surgery in a tertiary hospital center in Southern Brazil. A case-control study was conducted including all JW patients submitted to cardiac surgery from 2008 to 2016. Three consecutive surgical non-JW controls were matched to each selected JW patient. The preoperative risk of death was estimated through the mean EuroSCORE II. We studied 16 JW patients with a mean age of 60.6±12.1 years. The non-JW group included 48 patients with a mean age of 63.3±11.1 years (P=0.416). Isolated coronary artery bypass graft surgery was the most frequent surgery performed in both groups. Median EuroSCORE II was 1.29 (IQR: 0.66-3.08) and 1.43 (IQR: 0.72-2.63), respectively (P=0.988). The mortality tended to be higher in JW patients (18.8% vs. 4.2%, P=0.095), and there was a higher difference between the predicted and observed mortality in JW patients compared with controls (4.1 and 18.8% vs. 2.1 and 4.2%). More JW patients needed hemodialysis in the postoperative period (20.0 vs. 2.1%, P=0.039). We showed a high rate of in-hospital mortality in JW patients submitted to cardiac surgery. The EuroSCORE II may underestimate the surgical risk in these patients.

  5. Cardiac Surgery in Jehovah's Witness Patients: Experience of a Brazilian Tertiary Hospital

    PubMed Central

    Valle, Felipe Homem; Pivatto Júnior, Fernando; Gomes, Bruna Sessim; de Freitas, Tanara Martins; Giaretta, Vanessa; Gus, Miguel

    2017-01-01

    Introduction The outcomes of Jehovah's Witness (JW) patients submitted to open heart surgery may vary across countries and communities. The aim of this study was to describe the morbidity and mortality of JW patients undergoing cardiac surgery in a tertiary hospital center in Southern Brazil. Methods A case-control study was conducted including all JW patients submitted to cardiac surgery from 2008 to 2016. Three consecutive surgical non-JW controls were matched to each selected JW patient. The preoperative risk of death was estimated through the mean EuroSCORE II. Results We studied 16 JW patients with a mean age of 60.6±12.1 years. The non-JW group included 48 patients with a mean age of 63.3±11.1 years (P=0.416). Isolated coronary artery bypass graft surgery was the most frequent surgery performed in both groups. Median EuroSCORE II was 1.29 (IQR: 0.66-3.08) and 1.43 (IQR: 0.72-2.63), respectively (P=0.988). The mortality tended to be higher in JW patients (18.8% vs. 4.2%, P=0.095), and there was a higher difference between the predicted and observed mortality in JW patients compared with controls (4.1 and 18.8% vs. 2.1 and 4.2%). More JW patients needed hemodialysis in the postoperative period (20.0 vs. 2.1%, P=0.039). Conclusion We showed a high rate of in-hospital mortality in JW patients submitted to cardiac surgery. The EuroSCORE II may underestimate the surgical risk in these patients. PMID:29211216

  6. Awareness of Patients' Rights among Inpatients of a Tertiary Care Teaching Hospital- A Cross-sectional Study.

    PubMed

    Agrawal, Upasana; D'Souza, Brayal C; Seetharam, Arun Mavaji

    2017-09-01

    The rights of a patient are a set of rules of conduct which govern the interaction between the patients' and healthcare professionals. Every patient has a right to be informed about their rights and also the responsibility of the healthcare provider. To assess awareness among inpatient about patients' rights at an academic accredited hospital. A questionnaire based cross-sectional study was carried out among 350 patients admitted to the wards of a Tertiary Care Teaching Hospital. A 21-point questionnaire was developed based on standards of the National Accreditation Board for Hospitals and Healthcare Providers (NABH) and patients' charter of rights and validated. This charter of rights is also displayed in the hospital for patient's awareness. Frequencies and percentages were depicted. Chi-square test was used for statistical analysis. Positive awareness among the patients ranged from 28% to 97.4%. Females were more aware of their rights than males for 11 out of the 21 patient rights items. Younger adults were more aware than any other age group participants. Participants who were admitted to wards of higher categories (deluxe rooms) had high degree of awareness about patients' rights and education. Patients from urban areas and higher educational status were more aware than patients coming from rural areas. The study concludes that effective measures should be taken to improve the overall awareness not only among patients but also among different stakeholders in the healthcare delivery system. Readability of the patients' rights charter with good readability score, developing and distributing patient education materials in simple language about the rights and responsibilities to the patient and their family/relatives during their stay in the hospital or at the time of registration.Continuing nursing and medical education in medical teaching institutions and hospitals should focus on patients' rights and its importance, its need for awareness and its consequences

  7. RETINAL DISEASES IN A TERTIARY HOSPITAL IN SOUTHERN NIGERIA.

    PubMed

    Uhumwangho, O M; Itina, E I

    2015-01-01

    Retinal diseases are an important and common cause of ophthalmic consultation. To determine the pattern of retinal diseases in the ophthalmic department of a tertiary hospital in Southern Nigeria. A retrospective review of the case folders of patients with retinal pathologies seen between 2012 and 2013 was performed. Relevant demographic and clinical data was recorded. Analysis was performed for frequencies, proportions and percentages with the GraphPad Instat Software, Inc. version V2.05a program, San Diego, CA. There were 185 patients made of 94 (50.8%) males and 91 (49.2%) females with a peak age group of 61-70 years, (range 1-85 years) who made consultations for retinal diseases. Age related macular degeneration, 37(15.0%), and macula hole, 10(4.0%), were the common macula pathologies while retinal detachment, 11(4.5%), was the most common condition that required emergency vitreo-retinal surgical intervention. Diabetic retinopathy/maculopathy, 31(12.6%), hypertensive retinopathy 22(8.9%), and retinal vascular occlusion 12(4.8%), were the common retinal vascular diseases found. Bilateral visual impairment (low vision and blindness) from retinal diseases was present in 28(14.4%) persons. The common vitreo-retinal treatment options were use of intravitreal antivascular endothelial growth factors 32(13.0%), laser 16(6.5%), and vitreoretinal surgery in 22(8.9%) eyes. Retinal diseases remain an important cause of ophthalmic consultation and visual loss. Provision of facilities to manage these conditions will improve service delivery and quality of lives of affected patients.

  8. Hearing Screening in a Tertiary Care Hospital in India

    PubMed Central

    Shah, Neha; Patel, Kalpesh B.; Vishwakarma, Rajesh

    2015-01-01

    Introduction: To study the incidence of hearing loss among children and to determine and confirm the distribution of common risk factors in children with hearing loss presenting at a tertiary care hospital in India. Materials and Methods: Babies underwent hearing screening using Transient Evoked Otoacoustic Emission (TEOAE) and Automated Auditory Brainstem Response (AABR) from November 2009 to September 2011. It was a cross-sectional study carried out at our institute involving 500 babies (≤2 y). To identify the high risk babies, Joint Committee on Infant Hearing (2007) High risk registry was used. Results: In our study 110 (22%) babies belonged to high risk category and 11(2.2%) of total screened babies had significant hearing loss. Total number of babies who passed the initial screening with TEOAE was 284 (56.8%). On diagnostic AABR screening of TEOAE REFERRED babies, the babies with no risk factor showed normal AABR tracings whereas from among those with one or multiple risk factors (110 babies), 11(10%) showed different levels of hearing impairment. Hearing loss was highly associated with Neonatal Intensive Care Unit (NICU) admission i.e. 8/11(72.7%), followed by Low Birth Weight (LBW) and hypoxia (6/11 i.e. 54.5% each). Conclusion: Hearing loss is more common in those babies with risk factors (majority being NICU admission, LBW and hypoxia). OAE and ABR screening of infants at risk for significant hearing loss is a clinically efficient and cost effective approach for early detection of significant hearing loss. PMID:25954639

  9. Distinguishing between tertiary and secondary facilities: a case study of cardiac diagnostic-related groups (DRGs).

    PubMed

    Rouse, Paul; Arulambalam, Ajit; Correa, Ralph; Ullman, Cornelia

    2010-05-14

    To develop a classification of tertiary cardiac DRGs in order to investigate differences in tertiary/secondary product mix across New Zealand district health boards (DHBs). 67 DRGs from 85,442 cardiac cases were analysed using cost weights and patient comorbidity complexity levels, which were used as a proxy for complexity. The research found high variability of severity within some DRGs. 5 DHBs are the main providers of 27 DRGs which are high cost and identified as tertiary by several ADHB clinicians; the same 5 DHBs have on average higher severity by DRG than the other DHBs. NZ tertiary hospitals have a product mix of DRGs with higher complexity than secondary hospitals. Funding based on case weights needs to recognise the additional resource requirements for this higher complexity.

  10. Non-Escherichia coli versus Escherichia coli community-acquired urinary tract infections in children hospitalized in a tertiary center: relative frequency, risk factors, antimicrobial resistance and outcome.

    PubMed

    Marcus, Nir; Ashkenazi, Shai; Yaari, Arnon; Samra, Zmira; Livni, Gilat

    2005-07-01

    Currently hospitalization for children with urinary tract infections (UTIs) is reserved for severe or complicated cases. Changes may have taken place in the characteristics and causative uropathogens of hospital-treated community-acquired UTI. To study children hospitalized in a tertiary center with community-acquired UTI, compare Escherichia coli and non-E. coli UTI, define predictors for non-E. coli UTI and elucidate the appropriate therapeutic approach. A prospective clinical and laboratory study from 2001 through 2002 in a tertiary pediatric medical center. Patients were divided by results of the urine culture into E. coli and non-E. coli UTI groups, which were compared. Of 175 episodes of culture-proved UTI, 70 (40%) were caused by non-E. coli pathogens. Non-E. coli UTI was more commonly found in children who were male (P = 0.005), who had underlying renal abnormalities (P = 0.0085) and who had received antibiotic therapy in the prior month (P = 0.0009). Non-E. coli uropathogens were often resistant to antibiotics usually recommended for initial therapy for UTI, including cephalosporins and aminoglycosides; 19% were initially treated with inappropriate empiric intravenous antibiotics (compared with 2% for E. coli UTI, P = 0.0001), with a longer hospitalization. Current treatment routines are often inappropriate for hospitalized children with non-E. coli UTI, which is relatively common in this population. The defined risk factors associated with non-E. coli UTIs and its antimicrobial resistance patterns should be considered to improve empiric antibiotic therapy for these infections.

  11. Increasing prevalence of infectious diseases in asylum seekers at a tertiary care hospital in Switzerland

    PubMed Central

    Bloch-Infanger, Constantine; Bättig, Veronika; Kremo, Jürg; Widmer, Andreas F.; Egli, Adrian; Bingisser, Roland; Battegay, Manuel; Erb, Stefan

    2017-01-01

    Objective The increasing number of refugees seeking asylum in Europe in recent years poses new challenges for the healthcare systems in the destination countries. The goal of the study was to describe the evolution of medical problems of asylum seekers at a tertiary care centre in Switzerland. Methods At the University Hospital Basel, we compared all asylum seekers during two 1-year time periods in 2004/05 and 2014/15 concerning demographic characteristics and reasons for referrals and hospitalizations. Results Hundred ninety five of 2’544 and 516 of 6’243 asylum seekers registered at the national asylum reception and procedure centre Basel were referred to the University Hospital Basel in 2004/05 and 2014/15, and originated mainly from Europe (62.3%, mainly Turkey) and Africa (49.1%, mainly Eritrea), respectively. Median age was similar in both study periods (26.9 and 26.2 years). Infectious diseases in asylum seekers increased from 22.6% to 36.6% (p<0.001) and were the main reasons for hospitalizations (33.3% of 45 and 55.6% of 81 hospitalized patients, p = 0.017) in 2004/05 compared to 2014/15. The leading infectious diseases in hospitalized patients were tuberculosis (n = 4) and bacterial skin infections (n = 2) in 2004/05; Malaria (n = 9), pneumonia (n = 6), Chickenpox (n = 5), other viral infections (n = 5) and bacterial skin infections (n = 5) in 2014/15. Infectious diseases like malaria, cutaneous diphtheria, louseborne-relapsing fever or scabies were only found in the second study period. Almost one third of the admitted asylum seekers required isolation precautions with median duration of 6–9.5 days in both study periods. Conclusions The changing demography of asylum seekers arriving in Switzerland in the current refugee crisis has led to a shift in disease patterns with an increase of infectious diseases and the re-emergence of migration-associated neglected infections. Physicians should be aware of these new challenges. PMID:28617860

  12. Risk factors and costs of oral cancer in a tertiary care hospital in Delhi.

    PubMed

    Goyal, Sandeep; Tiwari, Vijay Kumar; Nair, Kesavan Sreekantan; Raj, Sherin

    2014-01-01

    The present study conducted with 100 oral cancer patients at a private tertiary care hospital in Delhi demonstrated that stage III cancer was associated with longer use of tobacco and poor oral hygiene. There was also statistically significant association (p<.05) between consumption of tobacco and alcohol. More than 60% treatment expenditure was on surgery followed by accommodation (9%) and investigations (8%). The effect of tobacco was well known among patients as 76% of the patients knew that common cancer in tobacco chewer is 'oral cancer', 22% of the patients however responded that they did not know which cancer is common in tobacco chewers. 58% said that they learnt about ill effects of tobacco from media while 24% said they learnt from family and friends. Out of 78 tobacco users, 60 (77%) said that they never received help to quit tobacco while 18(23%) have received help to quit.

  13. Deep Sequencing Reveals a Divergent Ugandan cassava brown streak virus Isolate from Malawi

    PubMed Central

    Winter, Stephan; Mukasa, Settumba; Tairo, Fred; Sseruwagi, Peter; Ndunguru, Joseph; Duffy, Siobain

    2017-01-01

    ABSTRACT Illumina sequencing of RNA from a cassava cutting from northern Malawi produced a genome of Ugandan cassava brown streak virus (UCBSV-MW-NB7_2013). Sequence comparisons revealed stronger similarity to an isolate from nearby Tanzania (93.4% pairwise nucleotide identity) than to those previously reported from Malawi (86.9 to 87.0%). PMID:28818908

  14. Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.

    PubMed

    Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M

    Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for

  15. Distribution, genetic diversity and antibiotic resistance of clinically important bacteria from the environment of a tertiary hospital.

    PubMed

    Phoon, Hannah Y P; Hussin, Hazilawati; Hussain, Baizurah Mohd; Lim, Shu Yong; Woon, Jia Jie; Er, Yi Xian; Thong, Kwai Lin

    2018-03-11

    Hospital environments are potential reservoirs of bacteria associated with nosocomial infections. Here, we determined the distribution of cultivable environmental bacteria of clinical importance from a Malaysian tertiary hospital and to investigate their resistotypes and genotypes. Swab and fluid samples (n=358) from healthcare workers' hands, frequently touched surfaces, medical equipment, patients' immediate surroundings, ward sinks and toilets and solutions or fluids of 12 selected wards were collected. Biochemical tests, PCR and 16S rRNA sequencing were used for identification after isolation from CHROMagar TM Orientation medium. Clinically important bacteria such as Enterococcus spp., Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter spp., Pseudomonas aeruginosa, and Enterobacter spp. were further characterised by disk diffusion method and REP-PCR. The 32 Gram negative and 21 Gram positive bacteria species identified were widely distributed in the hospital environment. Staphylococci were predominant followed by Bacillus spp., and P. aeruginosa. Frequently touched surfaces, medical equipment and ward sinks and toilets were the top three sources of bacterial species. Nine S. aureus, four Acinetobacter spp., one K. pneumoniae, and one Enterobacter spp., were multidrug resistant (MDR). The ESKAPE organisms were genetically diverse and widely dispersed across the hospital wards. An MDR MRSA clone was detected in a surgical ward isolation room. The large variety of cultivable, clinically important bacteria, especially the genetically related MDR S. aureus, K. pneumoniae, Acinetobacter spp., and Enterobacter spp. from various sampling sites indicated that the surfaces and fomites in the hospital were potential exogenous sources of nosocomial infections in the hospital. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  16. Analysis on Inpatient Health Expenditures of Renal Cell Carcinoma in a Grade-A Tertiary Hospital in Beijing.

    PubMed

    Liu, Xin; Mao, Yong-Hui; He, Xue-Mei; Zhang, Yan-Jing; Sun, Ying

    2017-10-20

    Renal cell carcinoma (RCC) is the most common type of malignant renal tumors with a growing incidence in the recent years. This study aimed to investigate the influencing factors and variation trend of hospitalization expenditures among RCC patients in a single-centered hospital in Beijing during 5 consecutive years and to find the major cost items and fluctuation tendency of inpatient medical expenditures. The information of medical expenditures among RCC patients in a Grade-A tertiary hospital during the years 2012-2016 was investigated to find the main cost items and changes affecting the medical cost structure. Gray correlation method was adopted in quantitative analysis to analyze the composition of medical expenditures, and the variation of hospitalization expense structure during the five years was studied by analyzing the degree of structural variation. The cost item constitution of the hospitalization expenditures among RCC patients was relatively stable in the sample hospital during the past five years. To be specific, drug costs accounted for the largest proportion of medical expenditures each year, with the highest of 37.81% in 2012, and showed a slowly declining tendency in the coming years. The cost item with the highest correlation degree was drug costs, with the value of 1.0000; followed by the costs of surgeries, 0.8423. Furthermore, drug costs shared the largest proportion (40.95%) of structural variation, followed by the costs of surgeries (18.35%). Drug costs are the major influencing factors of the hospitalization expenditures among RCC patients. Thus, reasonable control on excessive drugs as well as the standardization of the diagnosis and treatment behaviors is conducive in reducing medical expenditures as well as easing patients' economic burdens. Besides, the positive growth on surgery costs suggests that the labor value of medical staffs has been gradually recognized.

  17. Pattern of episiotomy use & its immediate complications among vaginal deliveries in 18 tertiary care hospitals in India

    PubMed Central

    Singh, Shalini; Thakur, Tushita; Chandhiok, Nomita; Dhillon, Balwan Singh

    2016-01-01

    Background & objectives: In developed countries, efforts have been made to restrict episiotomy practice. However, in developing countries the episiotomy rates continue to be high. This study was conducted to evaluate the pattern of episiotomy use and its immediate complications among women delivering at tertiary level public hospitals in India. Methods: Prospective data of all women undergoing vaginal delivery including instrumental delivery were collected daily from the labour room registers of the 18 tertiary care hospitals on a structured proforma. Weekly data from all sites were sent to a central unit for compilation and analysis. Odds ratio was used to compare the proportion of genital trauma among women with and without episiotomy both in nulliparous and multiparous women. Results: Among 1,20,243 vaginal deliveries, episiotomy was performed in 63.4 per cent (n=76,305) cases. Nulliparaous women were 8.8 times more likely to undergo episiotomy than multiparous women. The various genital tract injuries reported were first degree perineal tear (n=4805, 3.9%), second degree perineal tear (n=1082, 0.9%), third and fourth degree perineal tear (n=186, 0.2%), anterior vaginal trauma requiring suturing (n=490, 0.4%), extension of episiotomy/vaginal laceration/excessive bleeding from episiotomy or tear (n=177, 0.15%), vulval/vaginal haematoma (n=70, 0.06%) and cervical tear (n=108, 0.08%). The combined rate of third and fourth degree perineal tears was observed to be significantly lower (P<0.001) among nullipara who received episiotomy (0.13%) compared to those who delivered without episiotomy (0.62%). Interpretations & conclusions: Significantly lower rates of third or fourth degree perineal tear were seen among nulliparous women undergoing episiotomy. The risk and benefit of episiotomy and its complications need to be evaluated through randomized clinical trials in the Indian context. PMID:27377504

  18. Outcome and hospital cost for infants weighing less than 500 grams: a tertiary centre experience in Taiwan.

    PubMed

    Hsieh, Wu-Shiun; Jeng, Suh-Fang; Hung, Yi-Li; Chen, Pau-Chung; Chou, Hung-Chieh; Tsao, Po-Nien

    2007-09-01

    To determine the outcome and hospital cost for infants weighing < or =500 g at a tertiary centre in Taiwan. We retrospectively reviewed the medical records of infants who were born alive with birthweight < or =500 g at the National Taiwan University Hospital from 1997 to 2004. Their outcome and hospital cost were analysed. A total of 168 infants were included for analysis that 146 of them died after compassionate care in the delivery room and 22 received postnatal resuscitation. The infants who received resuscitation were more likely to have higher birthweights, older gestational ages and multiple births compared with those who received compassionate care. After resuscitation, five of the infants died and 17 were admitted to neonatal intensive care unit (NICU) for further management. Subsequently, 12 infants died and five infants survived to discharge. Two infants were discharged against advice and died within days. After exclusion of those receiving compassionate care, the NICU survival rate was 22.7% and the long-term survival rate was 13.6%. The most common early morbidities were respiratory distress syndrome, intraventricular haemorrhage and patent ductus arteriosus, whereas the late morbidities included cholestatic jaundice, retinopathy of prematurity and chronic lung disease. The average total hospital costs for the NICU survivors with birthweight < or =500 g was US $42,411 and the average hospital cost per day was US $350. Exclusive compassionate care was given to the majority of the infants weighing < or =500 g in Taiwan. The survival rate remained low in these marginally viable infants.

  19. Inpatient antibiotic consumption in a regional secondary hospital in New Zealand.

    PubMed

    Hopkins, C J

    2014-02-01

    Reporting of antibiotic consumption in hospitals is a crucial component of antibiotic stewardship, but data from Australasian secondary hospitals are scarce. The hypothesis of this audit is that antibiotic consumption in secondary hospitals would be lower than in tertiary centres. The study aims to present the first published audit of antibiotic consumption from a secondary hospital in New Zealand compared with two tertiary centres. Hospital population-level data were retrospectively accessed to identify all systemic antibiotics dispensed to adult inpatients at Taranaki District Health Board during 2011. Consumption was calculated in defined daily doses per 100 inpatient-days and per 100 admissions, stratified by drug class. Comparison was against published data from two tertiary centres. Total consumption was lower, but that of high-risk antibiotic classes was higher than both tertiary centres. The relative consumption of lincosamides was 4.0 and 2.6 times higher than the two tertiary centres, with an associated 14% incidence of Clostridium difficile associated diarrhoea within 3 months. Our secondary hospital appears to consume the wrong types of antibiotic rather than too much. Data from all Australasian hospitals, stratified by clinical service area and hospital level, are required for clinically relevant benchmarking. © 2014 The Author; Internal Medicine Journal © 2014 Royal Australasian College of Physicians.

  20. Toward Better Pain Management: The Development of a "Pain Stewardship Program" in a Tertiary Children's Hospital.

    PubMed

    Brenn, B Randall; Choudhry, Dinesh K; Sacks, Karen; Como-Fluehr, Sandra; Strain, Robert

    2016-09-01

    Despite increased focus on pediatric pain, uncontrolled pain is still a problem for hospitalized pediatric inpatients. A program was designed to find patients with uncontrolled pain and develop a framework to oversee their pain management. This report details the development of a pain stewardship program with data from the first year of its activity. Hospitalized inpatients in a tertiary care pediatric center in the mid-Atlantic region were included in the study. Pain scores are recorded every 4 hours in the hospital electronic health record. A report was constructed to find all patients with an average pain score ≥7 in the preceding 12 hours. The charts of these patients were reviewed by our anesthesia pain service, and all patients were grouped into 1 of the following action categories: (1) no action required; (2) telephone call to the patient's attending physician; (3) one-time consultation; (4) consultation with ongoing management; or (5) patient was already on the anesthesia pain service. Demographic data, pain regimens, and outcomes were recorded in a prospectively collected database. There were 843 records on 441 unique patients. Only 22% required action to be taken by the anesthesia pain service. The pain stewardship database revealed that patients with sickle cell disease or abdominal pain required more frequent attention. An electronic health record-based pain stewardship program is an important step in identifying all children in the hospital with undermanaged pain, and it provides a warning system that may improve patient care, outcomes, and satisfaction. Copyright © 2016 by the American Academy of Pediatrics.

  1. Clinical and microbiological profile of a retrospective cohort of enteric fever in 2 Spanish tertiary hospitals.

    PubMed

    Sánchez-Montalvá, Adrián; Martínez-Pérez, Ángela; Pérez-Molina, José Antonio; González-López, Juan José; Lopez-Vélez, Rogelio; Salvador, Fernando; Sánchez, Irene; Planes, Anna M; Molina, Israel

    2015-05-01

    Enteric fever in high-income countries is diagnosed mainly in patients returning from endemic countries. We assess the clinical, microbiological, and prognosis aspects of enteric fever in 2 Spanish tertiary hospitals. A retrospective observational study was conducted at Vall d'Hebron University Hospital and Ramón y Cajal University Hospital in Spain. We reviewed medical records of all patients who were diagnosed with enteric fever from January 2000 to January 2014 at these hospitals. We identified 47 patients with enteric fever episodes. According to their travel history, 35 (74.5%) patients had travelled to highly endemic countries. Imported enteric fever was acquired mainly in Asia (70.3%). Imported infections were implicated in travelers (48.6%), visiting friends and relatives (40%) and immigrants (11.4%). We found that 12 patients were diagnosed with enteric fever without a travel history (autochthonous infection). The resistance profile of the isolates showed decreased ciprofloxacin susceptibility in 66.7% of the imported group and 8.3% of the autochthonous group (P = 0.001). Salmonella strains from patients returning from Asia had an increased risk of having decreased ciprofloxacin susceptibility (odds ratio, 52.25; 95% confidence interval: 8.6-317.7). Patients with imported enteric fever are at higher risk for having a Salmonella strain with decreased ciprofloxacin susceptibility, especially in patients returning from Asia. Initial treatment with third-generation cephalosporin or azithromycin is strongly recommended until a drug-susceptibility test is available. Prevention strategies such as pretravel counseling and immunization before travel may be beneficial.

  2. Valued experiences of graduate students in their role as educators in undergraduate training in Ugandan medical schools.

    PubMed

    Rukundo, Godfrey Zari; Kasozi, Jannat; Burani, Aluonzi; Byona, Wycliff; Kirimuhuzya, Claude; Kiguli, Sarah

    2017-11-25

    In most medical schools, graduate students, sometimes referred to as graduate teaching assistants, often participate in the training of undergraduate students. In developing countries like Uganda, are typically involved in undergraduate training. However, prior to this study there were no standard guidelines for this involvement. At the same time, the views and experiences of the graduate students in their role as educators had not been documented. Therefore, the aim of this study was to explore the views and experiences of graduate students about their involvement in undergraduate training in three Ugandan medical schools. The findings of this study will contribute to the development of policies for training in Ugandan medical schools. This was a qualitative study in which thirty in-depth-interviews were conducted among second and third year graduate students in three Ugandan medical schools in the MESAU consortium (Medical Education Services to all Ugandans) including Mbarara University of Science and Technology, Makerere College of Health Sciences and Kampala International University, Western Campus. All graduate students from all the three medical schools viewed their involvement in undergraduate training as important. The study also revealed that graduate students increase available human resources and often compensate for the teaching missed when senior educators were absent. The graduate students expressed important views that need to be considered in the design of educational programs where they are to be involved. The respondents also reported a number of challenges in this undertaking that included lack of motivation, lack of orientation and having heavy workloads. The presence and commitment of senior educators to guide and support the graduate students in teaching activities was viewed as one significant intervention that would increase the effectiveness of their educational contributions. Graduate students enjoy their involvement in the training of

  3. Incidence, duration and cost of futile treatment in end-of-life hospital admissions to three Australian public-sector tertiary hospitals: a retrospective multicentre cohort study.

    PubMed

    Carter, Hannah E; Winch, Sarah; Barnett, Adrian G; Parker, Malcolm; Gallois, Cindy; Willmott, Lindy; White, Ben P; Patton, Mary Anne; Burridge, Letitia; Salkield, Gayle; Close, Eliana; Callaway, Leonie; Graves, Nicholas

    2017-10-16

    To estimate the incidence, duration and cost of futile treatment for end-of-life hospital admissions. Retrospective multicentre cohort study involving a clinical audit of hospital admissions. Three Australian public-sector tertiary hospitals. Adult patients who died while admitted to one of the study hospitals over a 6-month period in 2012. Incidences of futile treatment among end-of-life admissions; length of stay in both ward and intensive care settings for the duration that patients received futile treatments; health system costs associated with futile treatments; monetary valuation of bed days associated with futile treatment. The incidence rate of futile treatment in end-of-life admissions was 12.1% across the three study hospitals (range 6.0%-19.6%). For admissions involving futile treatment, the mean length of stay following the onset of futile treatment was 15 days, with 5.25 of these days in the intensive care unit. The cost associated with futile bed days was estimated to be $AA12.4 million for the three study hospitals using health system costs, and $A988 000 when using a decision maker's willingness to pay for bed days. This was extrapolated to an annual national health system cost of $A153.1 million and a decision maker's willingness to pay of $A12.3 million. The incidence rate and cost of futile treatment in end-of-life admissions varied between hospitals. The overall impact was substantial in terms of both the bed days and cost incurred. An increased awareness of these economic costs may generate support for interventions designed to reduce futile treatments. We did not include emotional hardship or pain and suffering, which represent additional costs. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  4. [Triage evaluation making in a pediatric emergency department of a tertiary hospital].

    PubMed

    Pascual-Fernández, Ma Cristina; Ignacio-Cerro, Ma Carmen; Jiménez-Carrascosa, Ma Amalia

    2014-03-01

    Evaluation triage level assignments depending level of the professionals' education and experience in the unit. This was a retrospective and observational study to triages making from January to March 2012 in Pediatric Emergency Department of tertiary hospital in Madrid. The collection data included variables from Pediatric Canadian Triage with five levels, triage tool using in the unit. 6443 triages were evaluated. The most common mistakes was: not to register pain level, 1445 (22.4%); not to register hydration level, 377 (5.9%); principal symptoms inappropriate, 232 (3.6%). Didn't indicate pain level 140 (5.6%) nurses with 12 hour formal training on triage; 492 (14.5%) with training in the unit, and 92 (16.3%) without training in the last year (p < 0.001). Among the nurses working in the unit more than 7 years did not register pain level 472 (12.3%), identified inappropriate principal symptoms 197 (5%) and did not register hydration level 296 (7.7%). The triage education favors better adaptation in the triage assignment. The most common errors are: not to register level pain and hydration when it's needed for the principal symptoms.

  5. Prevalence of Clostridium difficile infection among the patients attending a tertiary care teaching hospital.

    PubMed

    Segar, Lavanya; Easow, Joshy M; Srirangaraj, Sreenivasan; Hanifah, Mohammad; Joseph, Noyal M; Seetha, K S

    2017-01-01

    Clostridium difficile, a most important nosocomial enteric pathogen, is recognized globally as responsible for antibiotic-associated diarrhea and colitis. It is associated with considerable morbidity and mortality due to widespread use of antibiotics. The study was done to determine the prevalence of C. difficile infection (CDI) among the patients attending a tertiary care teaching hospital in Puducherry. We performed a prospective cohort study in Mahatma Gandhi Medical College and Research Institute. Around 150 patients were evaluated along with the patient details. C. difficile toxin detection was done as per the standard algorithm using the C. Diff Quik Chek Complete® assay (TECHLAB, Blacksburg, VA, USA). Analysis was done using statistics software (SPSS 16.0, SPSS Inc., Chicago, IL, USA). The prevalence of CDI was found to be 4%. More toxin-positive cases were between 50 and 60 years of age, and there was no difference in gender. Intensive Care Unit showed more toxin-positive cases; however, there was no significant association between the occurrence of CDI and the primary diagnosis of the patients. The prevalence of CDI in our hospital was found to be 4%, which was relatively lower compared to other Indian studies. However, awareness of the risk factors may assist in identifying patients at higher risk for CDI, guide implementation of appropriate preventive measures, and modulate potential intervention measure during management.

  6. Evaluation of patients' satisfaction after laparoscopic surgery in a tertiary hospital in Cameroon (Africa).

    PubMed

    Fouogue, Jovanny Tsuala; Tchounzou, Robert; Fouelifack, Florent Ymele; Fouedjio, Jeanne Hortence; Dohbit, Julius Sama; Sando, Zacharie; Mboudou, Emile Telesphore

    2017-01-01

    Access to laparoscopy is low in Cameroon where customers' satisfaction has not been reported so far. We assessed patients' satisfaction with the process of care during laparoscopic surgery in a new tertiary hospital. A questionnaire was addressed to consenting patients (guardians for patients under 18) with complete medical records who underwent laparoscopy at the Douala Gynaeco-Obstetric and Paediatric Hospital (Cameroon) from November 1, 2015 to July 31, 2016. The following modified Likert's scale was used to assess satisfaction: very weak: 0-2.5; weak 2.6-5; good: 5.1-7.5; very good: 7.6-10. Only descriptive statistics were used. Response rate was 90% (45/50). Of the 45 respondents, 39 (86.7%) were female, 14(31.1%) were referred and 39 (86.7%) paid by direct cash deposit. Mean age was 36.8±11.9 years. Laparoscopies were carried out in emergency for 3 (6.7%) patients. Digestive abnormalities indicated 13 (28.9%) laparoscopies while gynaecologic diseases accounted for 32 (71.1%) cases. Perception of the overall care process was good with a mean satisfaction score of 6.8 ± 1.4. Scores in categories were: 0% (Very weak); 13.3% (weak); 57.8% (good) and 28.9% (very good). Specifically mean satisfaction scores were: 7.8 ± 1.0 with doctors' care; 7.1 ± 1.3 with hospital administration; 7.0 ± 1.2 with nursing and 4.7 ± 1.4 with the costs. Main complaints were: long waiting time (73.3%), constraining geographical access (66.7%) and expensiveness (48.9%). Patients were globally satisfied with the process of care but financial and geographical barriers should be addressed.

  7. Questionnaire survey about use of an online appointment booking system in one large tertiary public hospital outpatient service center in China

    PubMed Central

    2014-01-01

    Background As a part of nationwide healthcare reforms, the Chinese government launched web-based appointment systems (WAS) to provide a solution to problems around outpatient appointments and services. These have been in place in all Chinese public tertiary hospitals since 2009. Methods Questionnaires were collected from both patients and doctors in one large tertiary public hospital in Shanghai, China.Data were analyzed to measure their satisfaction and views about the WAS. Results The 1000 outpatients randomly selected for the survey were least satisfied about the waiting time to see a doctor. Even though the WAS provided a much more convenient booking method, only 17% of patients used it. Of the 197 doctors surveyed, over 90% thought it was necessary to provide alternative forms of appointment booking systems for outpatients. However, about 80% of those doctors who were not associated professors would like to provide an ‘on-the-spot’ appointment option, which would lead to longer waits for patients. Conclusions Patients were least satisfied about the waiting times. To effectively reduce appointment-waiting times is therefore an urgent issue. Despite the benefits of using the WAS, most patients still registered via the usual method of queuing, suggesting that hospitals and health service providers should promote and encourage the use of the WAS. Furthermore, Chinese health providers need to help doctors to take others’ opinions or feedback into consideration when treating patients to minimize the gap between patients’ and doctors’ opinions. These findings may provide useful information for both practitioners and regulators, and improve recognition of this efficient and useful booking system, which may have far-reaching and positive implications for China’s ongoing reforms. PMID:24912568

  8. Neonatal arterial hypertension in nephro-urological malformations in a tertiary care hospital.

    PubMed

    Lanzarini, V V; Furusawa, E A; Sadeck, L; Leone, C R; Vaz, F A C; Koch, V H

    2006-09-01

    An increase in the survival of neonates with antenatal diagnosis of malformations was achieved by the recent technical advances in neonatal intensive care units. The aim of this article is to describe the experience with neonatal arterial hypertension, in newborns with nephro-urological malformations, in a tertiary care referral Nursery, in a period of 4 years. Newborn medical records from the Nursery Annex to the Maternity of Hospital das Clinicas, School of Medicine, University of Sao Paulo, with the diagnosis of nephro-urological malformations and systemic arterial hypertension (SAH) at hospital discharge, in a period from January 1999 to January 2003, were retrospectively analysed. Among 10.278 live newborns in the studied period, 15 (0.15%) newborns were compatible with our inclusion criteria. Of these 15 newborns, 12 (80%) were male and three were premature (20%). In relation to aetiology, 13 (87%) showed urological malformations, 1 (6%) chronic renal insufficiency secondary to kidney dysplasia and one (6%) autosomal recessive polycystic kidney disease. SAH control was achieved with monotherapy in eight patients (53%), five patients (33%) needed an association of two drugs (calcium-channel blocker and angiotensin converting enzyme (ACE) inhibitor), one child used three types of antihypertensive drugs (calcium-channel blocker, ACE inhibitor and hydrochlorothiazide) for pressoric control and one child's blood pressure (BP) was controlled exclusively by peritoneal dialysis. The incidence of nephro-urological malformations in our service during the studied period was 0.89%. SAH incidence among these newborns was 19%. Our data reinforce previous studies pointing to the necessity to consider children with nephro-urological malformations as a risk group for SAH, who should have the BP evaluated since the neonatal period.

  9. Microbiological Surveillance of Operation Theatres: Five Year Retrospective Analysis from a Tertiary Care Hospital in North India

    PubMed Central

    Najotra, Dipender Kaur; Malhotra, Aneeta Singh; Slathia, Poonam; Raina, Shivani; Dhar, Ashok

    2017-01-01

    Introduction: Microbiological contamination of air and environment in the operation theaters (OTs) are major risk factor for surgical site and other hospital-associated infections. Objectives: The aim was to identify bacterial colonization of surfaces and equipment and to determine the microbial contamination of air in the OTs of a tertiary care hospital. Materials and Methods: Five years (January 2010–December 2014) retrospective analysis of the data obtained from routine microbiological surveillance of the five OTs of the hospital was done. Surface samples were taken with wet swabs from different sites and equipment. Bacterial species were isolated and identified by conventional methods. Air quality surveillance of OTs was done by settle plate method. Results: A total of 4387 samples were collected from surfaces and articles of various OTs. Out of these only 195 (4.4%), samples showed bacterial growth and yielded 210 isolates. The predominant species isolated was Bacillus with 184 (87.6%) isolates followed by coagulase-negative Staphylococcus 17 (8.1%), Staphylococcus aureus 6 (2.9%), and Enteroccoccus spp. 3 (1.4%). Analysis of the OT air samples showed least colony forming unit (cfu) rate of air (27 cfu/m3) in ophthalmology OT and highest rate of 133 cfu/m3 in general surgery OT. Conclusion: The study shows that OTs of our hospital showed a very low bacterial contamination rate on surface swabbing and a cfu count per m3 of air well within permissible limits. PMID:28904915

  10. Listeriosis in pregnancy: a secular trend in a tertiary referral hospital in Barcelona.

    PubMed

    Sisó, C; Goncé, A; Bosch, J; Salvia, M D; Hernández, S; Figueras, F

    2012-09-01

    The purpose of this study was to describe the variation in listeriosis infection incidence during pregnancy over a 25-year period based on salient clinical and laboratory features compiled in a tertiary referral hospital and to depict the clinical characteristics of these cases. A cohort was created of all cases of listeriosis in pregnant women or their neonates (early-onset form) diagnosed between 1985 and 2010. Forty-three cases of perinatal listeriosis were diagnosed among the 82,320 hospitalised pregnant women (incidence 0.5‰). Whereas the incidence remained almost constant at 0.24‰ until 2000, an increasing incidence was observed from then on, reaching 0.86‰ during the last years of the study period. A four-fold increase in listeriosis rate during pregnancy has occurred in recent years, with poorer outcome for those cases occurring before 28 weeks and for those in which early antibiotic treatment was not provided. These results should raise the awareness of the agencies and professionals involved in prenatal care.

  11. Awareness of the role of general practitioners in primary care among outpatient populations: evidence from a cross-sectional survey of tertiary hospitals in China.

    PubMed

    Liu, Xiaojun; Tan, Anran; Towne, Samuel D; Hou, Zhaoxun; Mao, Zongfu

    2018-03-16

    General practitioners (GPs) are highly underutilised in China with many patients going directly to hospitals when seeking routine care. Multiple countries around the world have successfully used GPs in routine care, and as such, China may benefit from the use of GPs. This study examines the status of, and factors associated with, knowledge related to GPs among outpatient populations from China's tertiary hospitals. This is a cross-sectional survey study. The questionnaires were completed by 565 outpatients from four tertiary hospitals in China during 2016. Convenience sampling on different floors and throughout the outpatient building was carried out. We used the logistic regression models to identify GP-related knowledge among different populations. Overall, 50.27% of respondents said they had never heard of GPs. This was also true among females (adjusted OR (AOR)=1.57, 95% CI 1.43 to 2.71), older adults (AOR 46-65 =1.61, 95% CI 1.39 to 2.98; AOR >65 =2.01, 95% CI 1.62 to 3.59), those with lower education level (AOR Bachelor's degree =0.61, 95% CI 0.20 to 0.81; AOR ≥Master's degree =0.49, 95% CI 0.23 to 0.76), rural residents (AOR=1.51, 95% CI 1.35 to 2.82) and those with chronic disease (AOR without chronic disease =0.61, 95% CI 0.22 to 0.71). What is more, less than one-in-ten (9.03%) outpatients were able to accurately describe what a GP was, with less than 30% accurately describing a GP among those receiving GPs' services. Outpatients who could have received less costly health services from GPs in primary medical institutions were more likely to choose costlier specialist physicians in tertiary hospitals, which is likely linked to limited knowledge about GPs. Policy makers should invest in outreach efforts to improve public awareness of GPs, while at the same time conducting continued surveillance of these efforts to evaluate progress towards this goal. © Article author(s) (or their employer(s) unless otherwise stated in the text of the

  12. Prevalence of stroke in children admitted with sickle cell anaemia to Mulago Hospital.

    PubMed

    Munube, Deogratias; Katabira, Elly; Ndeezi, Grace; Joloba, Moses; Lhatoo, Samden; Sajatovic, Martha; Tumwine, James K

    2016-09-17

    Stroke is a major complication of sickle cell anaemia (SCA). It occurs commonly in childhood with about 10 % of children with sickle cell anaemia getting affected by this complication. In Uganda, there is paucity of data on the prevalence of stroke in children admitted in a tertiary institution. We determined the prevalence of stroke amongst children with SCA admitted to Mulago National Referral Hospital in Uganda and described the ir co-morbidities. We conducted a retrospective record review of children with SCA admitted from August 2012 to August 2014 to the Paediatric Haematology Ward of Mulago Hospital in Kampala, Uganda. The target population was SCA children age 6 months-17 years of age. A descriptive analysis was used to summarize the demographic characteristics and clinical diagnosis. There were 2,176 children with SCA admitted who were included in this study. There were 147 children with stroke. Their mean age 6.1, (SD 3), with a male to female ratio was 1:1 (71 males and 76 females). The M: F ratio of non-stroke children was 1.1:1 (1084 males and 945 females) with a mean age of 5.2, (SD 3). The prevalence of stroke was 6.8 % (147 of 2176). Amongst the children with stroke, 72.1 % (106 of 147) had co-morbidities which included severe anaemia 21.7 % (23 of 106), bacteraemia and vaso-occlusive crisis 17 % (18 of 106), pneumonia 8.4 % (9 of 106) and malaria 6.6 % (7 of 106). The prevalence of stroke in hospitalized Ugandan children with SCA was 6.8 %. Children with stroke were often admitted with other medical conditions such as severe anaemia, bacteraemia and vaso-occlusion.

  13. Work related stress and its anticipated solutions among post-graduate medical resident doctors: a cross-sectional survey conducted at a tertiary municipal hospital in Mumbai, India.

    PubMed

    Rajan, Pavithra; Bellare, Bharati

    2011-03-01

    It is now known that resident doctors registered for postgraduate studies are prone to work related stress and eventual burnout. Though stress can happen in any profession, reduced performance of resident doctors due to vocational stress could cause an increase in medical errors and thus affect the quality of life of the patients. Resident doctors at a Municipal hospital in India form a unique population as number of stresses they undergo are many and varied. To study the prevalence of work-related stress and its anticipated solutions among the resident doctors registered for postgraduate studies in clinical subjects at a tertiary Municipal hospital. A stratified sampling cross-sectional survey was conducted at the Inpatient, Outpatient, and Intensive Care Units at a tertiary Municipal hospital in Mumbai, India. Data collection was done using a validated 20-point questionnaire to assess the factors causing stress and their anticipated solutions. Simple percentage analysis of stress questionnaire. 71 resident doctors completed the survey. The major stressors in this cohort were inadequate hostel/quarter facilities (92.1%), and the need to perform extra duties (80.0%). Also, non-conducive environment for clinical training and studies (81.7%), inadequate study (78.9%) and break (81.2%), threat from deadly infections (74.6%), and overburdening with work (69.0%) were the other major stress causing factors. The perceived stress busters were good music (40.8%) and family and friends (40.8%). Eighty-seven percent of the respondents perceived regular physical exercise to be an effective mode of stress management and 83.8% expressed their need to have a simple therapeutic gymnasium established within the campus with a qualified trainer. There is a high level of work related stress among the resident doctors registered for postgraduate clinical studies at a tertiary Municipal hospital in Mumbai. One of the perceived stress busters is regular physical exercise that is

  14. Awareness about basic life support and emergency medical services and its associated factors among students in a tertiary care hospital in South India.

    PubMed

    Aroor, Akshatha Rao; Saya, Rama Prakash; Attar, Nazir Rahim; Saya, Ganesh Kumar; Ravinanthanan, Manikandan

    2014-07-01

    The knowledge and skills about the basic life support (BLS) and the advanced life support are the most important determining factors of the cardiopulmonary resuscitation (CPR) success rates. To determine the level of awareness on BLS and skills among undergraduate and postgraduate students of medical and dental profession, as well as nursing students and interns in a tertiary care hospital. This descriptive cross-sectional study was conducted in a tertiary care hospital in South India. The awareness level on BLS and factors associated which include age, sex, level of training (undergraduate, internship, and postgraduate groups), course of study (nursing, dental, and medical groups), and previous exposure to BLS were assessed by using a structured questionnaire. The association of these variables with awareness level was assessed by independent t test, analysis of variance, and linear regression analysis. Among 520 study subjects, 229 were students, 171 were interns, and 120 were postgraduate students. The overall mean score of awareness was 4.16 ± 1.40 (score range: 0-10). Age, sex, level of training, course of study, and previous exposure to BLS were significantly associated with awareness level in univariate analysis (P < 0.05). Linear regression model also showed that all the above variables were significantly associated with awareness level (P < 0.05). About 322 (61.9%) subjects attributed lack of awareness about BLS to lack of available professional training. About 479 (92.1%) responded that BLS training should be a part of medical curriculum. Awareness level on BLS is below average indicating the importance of professional training at all levels in a tertiary care health institution.

  15. Analysis of functioning and efficiency of a code blue system in a tertiary care hospital.

    PubMed

    Monangi, Srinivas; Setlur, Rangraj; Ramanathan, Ramprasad; Bhasin, Sidharth; Dhar, Mridul

    2018-01-01

    "Code blue" (CB) is a popular hospital emergency code, which is used by hospitals to alert their emergency response team of any cardiorespiratory arrest. The factors affecting the outcomes of emergencies are related to both the patient and the nature of the event. The primary objective was to analyze the survival rate and factors associated with survival and also practical problems related to functioning of a CB system (CBS). After the approval of hospital ethics committee, an analysis and audit was conducted of all patients on whom a CB had been called in our tertiary care hospital over 24 months. Data collected were demographic data, diagnosis, time of cardiac arrest and activation of CBS, time taken by CBS to reach the patient, presenting rhythm on arrival of CB team, details of cardiopulmonary resuscitation (CPR) such as duration and drugs given, and finally, events and outcomes. Chi-square test and logistic regression analysis were used to analyze the data. A total of 720 CB calls were initiated during the period. After excluding 24 patients, 694 calls were studied and analyzed. Six hundred and twenty were true calls and 74 were falls calls. Of the 620, 422 were cardiac arrests and 198 were medical emergencies. Overall survival was 26%. Survival in patients with cardiac arrests was 11.13%. Factors such as age, presenting rhythm, and duration of CPR were found to have a significant effect on survival. Problems encountered were personnel and equipment related. A CBS is effective in improving the resuscitation efforts and survival rates after inhospital cardiac arrests. Age, presenting rhythm at the time of arrest, and duration of CPR have significant effect on survival of the patient after a cardiac arrest. Technical and staff-related problems need to be considered and improved upon.

  16. How Do Patients Perceive and Expect Quality of Surgery, Diagnostics, and Emergency Services in Tertiary Care Hospitals? An Evidence of Gap Analysis From Pakistan.

    PubMed

    Fatima, Iram; Humayun, Ayesha; Anwar, Muhammad Imran; Iftikhar, Adil; Aslam, Muhammad; Shafiq, Muhammad

    2017-07-01

    Service quality is one of the important gears to appraise services and determine the gray areas that need improvement. In countries with a resource-poor health system, the first step of measuring quality is yet to be taken. This study seeks to inform policy makers in developing contextual service quality models by identifying service quality gaps in tertiary care teaching hospitals using patients' perspective. A cross-sectional study was performed using multistage cluster sampling, and a modified version of the SERVQUAL (SERV-service, QUAL-quality) instrument was administered to determine patient's expectations and perceptions. A total of 817 completed questionnaires were obtained from patients and/or their attendants using convenience sampling. Data analysis revealed statistically significant negative quality gaps between expectations and perceptions of tangibility, reliability, empathy, assurance, responsiveness, and communication. The difference in mean expectation and perception for responsiveness across the sexes was significant ( p < 0.003; p < 0.037, respectively) as well as in perception of communication ( p < 0.026). Other dimensions and overall hospital expected and perceived quality were independent of sex. Educational status showed significant difference in expectation and perception in responsiveness ( p < 0.005), but the perception of each dimension was significantly different in different educational categories (assurance: p < 0.001; empathy: p < 0.001; reliability: p < 0.001; tangibility: p < 0.001; responsiveness: p < 0.001; communication: p < 0.001; and for overall service quality: p < 0.001). Age and service departments showed no relationship with any of the perceived or expected dimension of service quality of hospitals. Tertiary care hospitals failed to meet patients' expectations in all major areas of service quality, posing a question of how hospitals implement and evaluate their quality assurance policy.

  17. How Do Patients Perceive and Expect Quality of Surgery, Diagnostics, and Emergency Services in Tertiary Care Hospitals? An Evidence of Gap Analysis From Pakistan

    PubMed Central

    Fatima, Iram; Humayun, Ayesha; Anwar, Muhammad Imran; Iftikhar, Adil; Aslam, Muhammad; Shafiq, Muhammad

    2017-01-01

    Objectives Service quality is one of the important gears to appraise services and determine the gray areas that need improvement. In countries with a resource-poor health system, the first step of measuring quality is yet to be taken. This study seeks to inform policy makers in developing contextual service quality models by identifying service quality gaps in tertiary care teaching hospitals using patients’ perspective. Methods A cross-sectional study was performed using multistage cluster sampling, and a modified version of the SERVQUAL (SERV-service, QUAL-quality) instrument was administered to determine patient’s expectations and perceptions. A total of 817 completed questionnaires were obtained from patients and/or their attendants using convenience sampling. Results Data analysis revealed statistically significant negative quality gaps between expectations and perceptions of tangibility, reliability, empathy, assurance, responsiveness, and communication. The difference in mean expectation and perception for responsiveness across the sexes was significant (p < 0.003; p < 0.037, respectively) as well as in perception of communication (p < 0.026). Other dimensions and overall hospital expected and perceived quality were independent of sex. Educational status showed significant difference in expectation and perception in responsiveness (p < 0.005), but the perception of each dimension was significantly different in different educational categories (assurance: p < 0.001; empathy: p < 0.001; reliability: p < 0.001; tangibility: p < 0.001; responsiveness: p < 0.001; communication: p < 0.001; and for overall service quality: p < 0.001). Age and service departments showed no relationship with any of the perceived or expected dimension of service quality of hospitals. Conclusions Tertiary care hospitals failed to meet patients’ expectations in all major areas of service quality, posing a question of how hospitals implement and evaluate their quality assurance

  18. Current status of nutritional support for hospitalized children: a nationwide hospital-based survey in South Korea.

    PubMed

    Kim, Seung; Lee, Eun Hye; Yang, Hye Ran

    2018-06-01

    The prevalence of malnutrition among hospitalized children ranges between 12% and 24%. Although the consequences of hospital malnutrition are enormous, it is often unrecognized and untreated. The aim of this study was to identify the current status of in-hospital nutrition support for children in South Korea by carrying out a nationwide hospital-based survey. Out of 345 general and tertiary hospitals in South Korea, a total of 53 institutes with pediatric gastroenterologists and more than 10 pediatric inpatients were selected. A questionnaire was developed by the nutrition committee of the Korean Society of Pediatric Gastroenterology, Hepatology and Nutrition. The questionnaires were sent to pediatric gastroenterologists in each hospital. Survey was performed by e-mails. Forty hospitals (75.5%) responded to the survey; 23 of them were tertiary hospitals, and 17 of them were general hospitals. Only 21 hospitals (52.5%) had all the required nutritional support personnel (including pediatrician, nutritionist, pharmacist, and nurse) assigned to pediatric patients. Routine nutritional screening was performed in 22 (55.0%) hospitals on admission, which was lower than that in adult patients (65.8%). Nutritional screening tools varied among hospitals; 33 of 40 (82.5%) hospitals used their own screening tools. The most frequently used nutritional assessment parameters were weight, height, hemoglobin, and serum albumin levels. In our nationwide hospital-based survey, the most frequently reported main barriers of nutritional support in hospitals were lack of manpower and excessive workload, followed by insufficient knowledge and experience. Although this nationwide hospital-based survey targeted general and tertiary hospitals with pediatric gastroenterologists, manpower and medical resources for nutritional support were still insufficient for hospitalized children, and nutritional screening was not routinely performed in many hospitals. More attention to hospital malnutrition

  19. [Classification and monitoring of the appropriateness of emergency admissions in a tertiary hospital].

    PubMed

    López-Picazo Ferrer, J J; Tomás García, N; Cubillana Herrero, J D; Gómez Company, J A; de Dios Cánovas García, J

    2014-01-01

    To measure the appropriateness of hospital admissions, to classify its Clinical Services (CS) according to the level of inappropriateness, and to determine the usefulness of applying rapid assessment techniques (lot quality assurance sampling) in these types of measurements. A descriptive, retrospective study was conducted in a tertiary hospital to assess the clinical records of emergency admissions to the 12 CS with a higher volume of admissions, using the Appropriateness Evaluation Protocol (AEP). A four-level («A» to «D») increasingly inadequate admissions scale was constructed setting both standard and threshold values in every stratum. Every CS was classified in one of them using lot quality assurance sampling (LQAS). A total of 156 cases (13 cases from every CS) were assessed. The assessment effort (devoted time) was also estimated. There were 22.4±6.3% of inadequate admissions. In the CS classification, 9 (75%) got a good or acceptable appropriateness level, and only 1 (8%) got an inacceptable level. The time devoted was estimated at 17 hours. AEP is useful to assess the admission appropriateness and may be included in the «Emergencies» process management, although its variability prevents the use for external comparisons. If both LQAS and the appropriateness classification level and the global estimation (by unifying lot samples) are combined, the monitoring is affordable without a great effort. To extend these tools to other quality indicators requiring direct observation or clinical records, manual assessment could improve the monitoring efficiency. Copyright © 2013 SECA. Published by Elsevier Espana. All rights reserved.

  20. Treatment of patients with a history of penicillin allergy in a large tertiary-care academic hospital.

    PubMed

    Picard, Matthieu; Bégin, Philippe; Bouchard, Hugues; Cloutier, Jonathan; Lacombe-Barrios, Jonathan; Paradis, Jean; Des Roches, Anne; Laufer, Brian; Paradis, Louis

    2013-01-01

    Prescribing antibiotics to patients with a history of penicillin allergy is common in clinical practice. Opting for non-beta-lactam antibiotics has its inconveniences and is often unnecessary, because most of these patients are in fact not allergic. This study aimed to determine how physicians in a large Canadian tertiary-care academic hospital without allergists on staff treat patients with a history of penicillin allergy. A retrospective study was conducted during a 1-year period among all patients hospitalized in the intensive care unit, coronary care unit, and internal medicine wards. Files of patients with a record of penicillin allergy were reviewed to assess the need for antibiotics during their hospitalization and the decision-making process underlying the choice of antibiotic. The additional costs of alternative antibiotics were calculated. The files of 1738 patients admitted over a 1-year period were hand reviewed. A history of penicillin allergy was found in 172 patients (9.9%). The allergic reaction was described in only 30% of cases and left unmentioned in 20.7%. Beta-lactam antibiotics were used on 56 occasions despite a history of penicillin allergy. The use of alternative antibiotics in place of the beta-lactam standard of care carried an additional cost of $15,672 Canadian. Alleged penicillin allergy is common among hospitalized patients and leads to substantial additional costs. Poor documentation of penicillin allergy likely reflects a lack of knowledge on this issue in the medical community, which impairs optimal treatment of these patients. Increased education on this matter is needed, and allergists on staff could be part of the solution. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  1. Pruritus as a leading symptom: clinical characteristics and quality of life in German and Ugandan patients.

    PubMed

    Weisshaar, E; Apfelbacher, C; Jäger, G; Zimmermann, E; Bruckner, T; Diepgen, T L; Gollnick, H

    2006-11-01

    Pruritus is the most frequent and distressing symptom associated with dermatoses and various internal and neurological diseases. To investigate two different populations of patients with pruritus, one in Germany and one in Uganda, with a particular focus on clinical characteristics, aetiology and quality of life. We investigated by questionnaire 132 patients (59 men, 73 women, mean age 54.5 years) who were referred to the Department of Dermatology at the University Hospital of Magdeburg, Germany, with the diagnosis of pruritus as a leading symptom. The questionnaire was also applied in 84 patients who consulted the Dermatology Clinic at Mbarara, Uganda for pruritus. The questions referred to personal data and disease history of the individual, history and present occurrence of concomitant diseases, present and past therapy, quality, frequency and triggers of itching and scratching, other disorders and complaints, quality of life and impact on work and disability. Seventy-five (57%) of the German patients had pruritus due to dermatoses, 47 patients (36%) had pruritus due to a systemic disease and in 10 patients (8%) pruritus was of unknown origin. Most had a history of pruritus of several months up to years. Pruritus associated with dermatoses mostly affected the whole body and was permanent with an undulatory character. Affective reactions such as aggression and depression occurred more frequently in dermatological patients compared with those with systemic pruritus. The former group felt that pruritus had a greater impact on their lives. Almost all Ugandan patients had pruritus due to dermatoses except for three patients with pruritus of unknown origin. Eczema and prurigo were the most frequently observed dermatoses in both German and Ugandan patients. Patients with pruritus in both populations showed an impaired quality of life. There was no pronounced difference between the populations with regard to feelings of depression and suicidal thoughts. A great deal of

  2. Prevalence of malnutrition at the time of admission among patients admitted to a Canadian tertiary-care paediatric hospital

    PubMed Central

    Baxter, Jo-Anna B; Al-Madhaki, Fatma Ibrahim; Zlotkin, Stanley H

    2014-01-01

    BACKGROUND: Malnutrition among hospitalized children is known to negatively influence their response to therapy and to prolong their admission. It also has short- and long-term consequences for growth, development and well-being. It is commonly regarded as a condition affecting children in low-income countries; however, malnutrition has been found to be variably prevalent among hospitalized children in higher-income countries. At the time the present study was conducted, it had been >30 years since the nutritional status of Canadian hospitalized children was last published. OBJECTIVES: To determine and communicate the prevalence of malnutrition among children in a Canadian tertiary-care paediatric hospital at the time of their admission. METHODS: In the present cross-sectional study, anthropometric measures were obtained from 322 children admitted to The Hospital for Sick Children in Toronto, Ontario. Nutritional indexes (BMI for age, weight for age, weight for length/height and length/height for age) were generated from anthropometric measures using the WHO igrowup software, and summarized according to WHO definitions. RESULTS: The overall prevalence of malnutrition using BMI for age was 39.6% (95% CI 33% to 46%), of which 8.8% and 30.8% of participants were under- and overnourished, respectively. Furthermore, 6.9% (95% CI 3% to 13%) were determined to be acutely malnourished (weight for length/height <−2 SD) and 13.4% (95% CI 10% to 18%) chronically malnourished (length/height for age <−2 SD). CONCLUSION: The high prevalence of overall malnutrition observed among study participants suggests that initial screening using simple anthropometric measures should be conducted on hospital admission so that patients can receive appropriate nutrition-specific care. PMID:25382997

  3. Knowledge of Kidney Donation Among Care Givers in Two Tertiary Hospitals in Southwest Nigeria.

    PubMed

    Adejumo, Oluseyi A; Solarin, Adaobi U; Abiodun, Moses T; Akinbodewa, Ayodeji A

    2017-05-01

    One of the major challenges of kidney transplantation is shortage of kidney donors. Care givers (CGs) are potential kidney donors, but the majority of them are unwilling to donate due to inadequate knowledge on kidney donation. This study evaluated the knowledge of kidney donation and its determinants among CGs in two tertiary hospitals in Southwest Nigeria. This was a cross-sectional study that was carried out in the Kidney Care Centre (KCC), Ondo and Babcock University Teaching Hospital (BUTH), Ilishan-Remo using a self-administered pretested questionnaire that assessed knowledge of kidney donation and its determinants. Pvalue of <0.05 was taken as significant. A total of 244 respondents participated in the study. The majority were below 40 years, married, and female. The proportion of respondents with adequate knowledge of kidney donation was 63.4%. More respondents from BUTH compared to KCC had adequate knowledge of kidney donation (80% vs. 46.7%, P ≤ 0.001). Similarly, the mean knowledge score was higher in respondents from BUTH (P ≤ 0.001). Factors that determined knowledge of kidney donation were female gender (AOR: 3.43, 95% CI: 1.25-9.40, P = 0.02) and social class (AOR: 1.22, 95% CI: 0.50-2.95, P ≤ 0.001). There was positive correlation between knowledge of kidney donation among the respondents from both hospitals and their willingness to donate kidneys (r = 0.439, P ≤ 0.001). Knowledge of kidney donation was better among BUTH's respondents. Gender and social class were predictors of knowledge of kidney donation. Improving knowledge of kidney donation may improve willingness to donate among the public. © 2016 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

  4. Management of penile cancer in a Singapore tertiary hospital.

    PubMed

    Tan, Teck Wei; Chia, Sing Joo; Chong, Kian Tai

    2017-06-01

    To present our experience of managing penile squamous cell carcinoma (SCC) in a tertiary hospital in Singapore and to evaluate the prognostic value of the inflammatory markers neutrophil-lymphocyte ratio (NLR) and lymphocyte-monocyte ratio (LMR). We reviewed our prospectively maintained Institutional Review Board-approved urological cancer database to identify men treated for penile SCC at our centre between January 2007 and December 2015. For all the patients identified, we collected epidemiological and clinical data. In all, 39 patients were identified who were treated for penile SCC in our centre. The median [interquartile range (IQR)] follow-up was 34 (16.5-66) months. Although very few (23%) of our patients with high-risk clinical node-negative underwent prophylactic inguinal lymph node dissection (ILND), they still had excellent 5-year recurrence-free survival (RFS; 90%) and cancer-specific survival (CSS; 90%). At multivariate analysis, higher N stage was significantly associated with worse RFS and CSS. Patients with a high NLR (≥2.8) had significantly higher T-stage ( P  = 0.006) and worse CSS ( P  < 0.001) than those with a low NLR. Patients with a low LMR (<3.3) had significantly higher T-stage ( P  = 0.013) and worse RFS ( P  = 0.009) and CSS ( P  < 0.022) than those with a high LMR. Although very few of our patients with intermediate- and high-risk clinical node-negative SCC underwent prophylactic ILND, they still had excellent 5-year RFS and CSS. However, survival was poor in patients with node-positive disease. The pre-treatment NLR and LMR could serve as biomarkers to predict the prognosis of patients with penile cancer.

  5. Doping knowledge, attitudes, and practices of Ugandan athletes': a cross-sectional study.

    PubMed

    Muwonge, Haruna; Zavuga, Robert; Kabenge, Peninnah Aligawesa

    2015-09-22

    Despite the development of advanced drug testing systems, both deliberate and inadvertent doping in sports is increasing in elite, amateur and school sports. As a result, alternative approaches that seek to influence an athlete's attitudes are needed to address the growing doping concerns that threaten both the health and well being of the athlete as well as the legitimacy of the sport. Therefore, the current study set out to establish the doping attitudes, knowledge and practices of professional Ugandan athletes, gathering information that may guide the design of more efficient doping prevention programs. This was a cross-sectional study of 384 professional Ugandan athletes from four contact team sports (basketball, football, handball and rugby) and two individual sports (athletics and cycling). An Interviewer administered questionnaire used contained; questions about the doping behavior, the performance enhancement attitude scale (PEAS), and doping use belief (DUB) statements. Approximately 60 % of the athletes reported familiarity with information on doping and that most of this information came from fellow colleagues (41.9 %), individual or team coaches (29.7 %) or the media (15.6 %). However, nearly 80 % of these athletes could not correctly define doping. The overall mean PEAS score, a measure of doping attitudes, for all study participants was 39.8 ± 14.8. Female athletes (PEAS: 41.1 ± 15.1), athletes with a prior doping history (PEAS: 44.1 ± 15.6) and athletes from the sport of athletics (PEAS: 56.6 ± 17.4) had higher mean PEAS scores than their respective counterparts. Regarding doping behaviors/practices, 9.3 % of the study participants had been offered a doping agent at some point, although only 3.9 % of the athletes acknowledged recent use. The confessed use of doping agents in this study was low, which may suggest that fewer athletes use doping agents in Uganda. However, there is still an urgent need for educational anti

  6. Work-related hand injuries treated at a tertiary care hospital.

    PubMed

    Mostafa, Nayera S; Sayed, Amany M; Osman, Amr A

    2014-08-01

    The hands are known to be the most commonly injured body parts in traumatic occupational injuries. They can be disabling, leading to major adverse social and economic consequences for the worker and for his or her family. The aim of the study was to describe work-related hand injuries and their potential risk factors and also investigate lines of management in relation to the type of injury. Patients who presented to the emergency room of a tertiary hospital over a 6-month period with occupational hand injuries were interviewed using a predesigned questionnaire. It included questions pertaining to the sociodemographic, occupational, and medical aspects related to the injury. A total of 163 patients were interviewed. More than 50% had injuries from cuts. Almost 60% of work-related hand injuries occurred in the absence of machines. The most common causes of hand injuries mentioned by workers were lack of concentration (68.7%), wearing no or ill-fitting gloves (63.2%), and a defect in the work place (51.5%). On examination, fingers were the most affected site (66.7%). About half of the cases were managed in the emergency room, 28.8% were managed with minor procedures, and 21.9% were managed with major procedures. Work-related hand injuries have multifactorial causes; lack of concentration was the most common in this study. Injuries from cuts were the most common and fingers were the most affected part. Modifications of the possible risk factors may reduce the incidence of acute hand injury at work.

  7. Tertiary paediatric emergency department use in children and young people with cerebral palsy.

    PubMed

    Meehan, Elaine; Reid, Susan M; Williams, Katrina; Freed, Gary L; Babl, Franz E; Sewell, Jillian R; Rawicki, Barry; Reddihough, Dinah S

    2015-10-01

    The aim of this study was to describe the pattern of tertiary paediatric emergency department (ED) use in children and young people with cerebral palsy (CP). A retrospective analysis of ED data routinely collected at the two tertiary paediatric hospitals in Victoria, Australia, cross-matched with the Victorian Cerebral Palsy Register. Data pertaining to the ED presentations of 2183 registered individuals born 1993-2008 were obtained. Between 2008 and 2012, 37% (n = 814) of the CP cohort had 3631 tertiary paediatric ED presentations. Overall, 40% (n = 332) of presenters were residing in inner metropolitan Melbourne; 44% (n = 356) in outer Melbourne; and 13% (n = 108) in regional Victoria. Presenters were more likely than non-presenters to be younger, non-ambulant and have epilepsy. In total, 71% of presentations were triaged as Australasian Triage Scale 1-3 (urgent), and 44% resulted in a hospital admission. Disorders of the respiratory, neurological and gastrointestinal systems, and medical device problems were responsible for 72% of presentations. Many of the tertiary paediatric ED presentations in this group were appropriate based on the high admission rate and the large proportion triaged as urgent. However, there is evidence that some families are bypassing local services and travelling long distances to attend the tertiary paediatric ED, even for less urgent complaints that do not require hospital admission. Alternative pathways of care delivery, and strategies to promote the management of common problems experienced by children and young people with CP in non-paediatric EDs or primary care settings, may go some way towards reducing unnecessary tertiary paediatric ED use in this group. © 2015 The Authors. Journal of Paediatrics and Child Health © 2015 Paediatrics and Child Health Division (Royal Australasian College of Physicians).

  8. Head and Neck Tuberculosis: Scenario in a Tertiary Care Hospital of North Eastern India

    PubMed Central

    Das, Debajit; Bhuyan, Uttal Taranga; Saikia, Nabajyoti

    2016-01-01

    Introduction Tuberculosis has affected mankind since time immemorial and with emergence of AIDS both extrapulmonary and pulmonary tuberculosis presents increased morbidity and mortality along with an increased financial burden upon the developing nations. Materials and Methods The study is a hospital based observational study of one year duration carried out in the Department of ENT in a tertiary care hospital of North Eastern India. Results Total of 63 cases were detected. Females comprised 60.3% of the study population as against 39.7% males. Most commonly affected age group were of 15 to 24 years age (57.1%). Cervical tubercular lymphadenitis was the most common lesion 90.5% (57 cases) followed by laryngeal tuberculosis 7.9% (5 cases) and tubercular otitis media with mastoiditis 1.6% (1 case). Level II lymph node was mostly affected either single or in groups (75.4%) followed by level III node (57.9%). Successful outcome of the treatment with Category I regimen was achieved in 96.8% of the cases. Conclusion Head and neck tuberculosis is not an uncommon disease and though cervical lymphadenitis is the most common presentation, isolated involvement of the larynx, ear and other subsites are not an entirely unknown entity. The clinical presentation of tuberculosis of the head and neck region can be varied and often misleading. It is therefore important for the clinician to be aware of the condition and consider it in their differential diagnosis. PMID:26894099

  9. Prevalence of intestinal parasites and bacteria among food handlers in a tertiary care hospital

    PubMed Central

    Zaglool, D. A.; Khodari, Y. A.; Othman, R. A. M.; Farooq, M. U.

    2011-01-01

    Objectives: The aim of this work is to determine the prevalence of intestinal parasites and bacteria among the food handlers. Materials and Methods: Two hundred food-handlers were subjected to a cross-sectional study working in the kitchen of a tertiary care hospital, i.e., Alnoor Specialist Hospital, Makkah, Saudi Arabia from February 2 to 27, 2009. The stool samples were examined for intestinal parasites following direct microscopic examination, formol ether concentration (Ritchie), and staining with modified acid fast staining techniques. For enteropathogenic bacteria samples were inoculated onto MacConkey's agar, deoxycholate citrate agar, xylose lysine deoxycholate agar as per the World Health Organization protocol. Fingernail materials were examined microscopically for enteropathogenic bacteria and parasites. Results: The majority (80%) of the food-handlers were young adults aged from 22 to 42 years. No intestinal parasites were detected from fingernail contents. Forty six (23%) stool specimens were positive for intestinal para¬sites. Giardia lamblia 18 (9%) was most frequent among the 10 different types of detected intestinal parasites followed by Entamoeba histolytica 9 (4.5%). No pathogenic bacteria were detected in all stool samples, whereas finger nails showed isolation of microorganisms as coagulase-negative staphylococci 79 (39.5%), followed by Staphylococcus aureus 35 (17.5%). Conclusion: The findings emphasized the importance of food handlers as potential sources of infections and suggested health institutions for appropriate hygienic and sanitary control measures. PMID:22529512

  10. An epidemiological study of road traffic accident cases admitted in a tertiary care hospital.

    PubMed

    Pathak, S M; Jindal, A K; Verma, A K; Mahen, A

    2014-01-01

    Road traffic accidents are a leading cause of mortality and morbidity globally. In India, more than a million are injured annually and about a lakh are killed in road traffic accidents.(1) It causes the country to lose around 55,000 crores annually which is 2-3% of Gross Domestic Production (GDP).(2) This cross sectional study was conducted to elucidate the role of various factors involved in road traffic accidents. Road traffic accident cases admitted to a tertiary care hospital between 01 Oct 2009 and 28 Feb 2011 were included in the study. A total of 182 patients were studied. Information was collected through questionnaire, hospital records and on-site visit. OPD cases, comatose patients and deaths were excluded. Two-wheelers were the commonest vehicle involved in vehicular accidents. Most accidents happened at a speed of 40-60 km/h (37.9%). Most of the patients were aged between 20 and 30 years. Majority had a driving experience of less than 5 years. Monsoons witnessed 46.7% cases. Most cases occurred between 6 and 10 pm. Among severe injuries, the commonest was lower limb fractures (19.8%). There are multiple factors associated with road traffic accidents which due to the lack of road safety measures in the country are playing their role. It is the need of the hour to address this issue and formulate comprehensive, scientific and practical rules and regulations as well as evaluate its enforcement.

  11. Assessment of cost of illness for diabetic patients in South Indian tertiary care hospital.

    PubMed

    Acharya, Leelavathi D; Rau, N R; Udupa, N; Rajan, M Surulivel; Vijayanarayana, K

    2016-01-01

    The impact of diabetes on health-care expenditures has been increasingly recognized. To formulate an effective health planning and resource allocation, it is important to determine economic burden. The objective of this study is to assess the cost of illness (COI) for diabetic inpatients with or without complications. The study was conducted in the medicine wards of tertiary care hospital after ethical approval by the Institutional Ethical Committee. A total of 116 each diabetic with or without complications were selected and relevant data were collected using COI questionnaire and data were analyzed using SPSS version 20. Mann-Whitney U test is used to assess the statistical significant difference in the cost of treatment of diabetes alone and with complications'. P ≤ 0.05 was considered statistically significant. Total COI includes the cost of treatment, investigation, consultation fee, intervention cost, transportation, days lost due to work, and hospitalization. The median of total COI for diabetic care without any complication was Rs. 22,456.97/- per patient per annum and with complication was Rs. 30,634.45/-. Patients on dialysis had to spend 7.3 times higher, and patients with cardiac intervention had to spend 7.4 times higher than diabetic patients without any complication. Treatment costs were many times higher in patients with complications and with cardiac and renal interventions. Complications in diabetic patients will increase the economic burden to family and also to the society.

  12. Criteria-based audit on management of eclampsia patients at a tertiary hospital in Dar es Salaam, Tanzania

    PubMed Central

    Kidanto, Hussein Lesio; Mogren, Ingrid; Massawe, Siriel N; Lindmark, Gunilla; Nystrom, Lennarth

    2009-01-01

    Background Criteria-based audits have been used to improve clinical management in developed countries, but have only recently been introduced in the developing world. This study discusses the introduction of a criteria-based audit in a tertiary hospital in an African setting, assesses the quality of care among eclampsia patients and discusses possible interventions in order to improve the quality of care. Methods We conducted a criteria based audit of 389 eclampsia patients admitted to Muhimbili National Hospital (MNH), Dar es Salaam Tanzania between April 14, 2006 and December 31, 2006. Cases were assessed using evidence-based criteria for appropriate care. Results Antepartum, intrapartum and postpartum eclampsia constituted 47%, 41% and 12% of the eclampsia cases respectively. Antepartum eclampsia was mostly (73%) preterm whereas the majority (71%) of postpartum eclampsia cases ware at term. The case fatality rate for eclampsia was 7.7%. Medical histories were incomplete, the majority (75%) of management plans were not reviewed by specialists in obstetrics, specialist doctors live far from the hospital and do not spend nights in hospital even when they are on duty, monitoring of patients on magnesium sulphate was inadequate, and important biochemical tests were not routinely done. Two thirds of the patient scheduled for caesarean section did not undergo surgery within agreed time. Conclusion Potential areas for further improvement in quality of emergency care for eclampsia relate to standardizing management guidelines, greater involvement of specialists in the management of eclampsia and continued medical education on current management of eclampsia for junior staff. PMID:19323846

  13. Clinical presentation and treatment outcome of molar pregnancy: Ten years experience at a Tertiary Care Hospital in Dammam, Saudi Arabia.

    PubMed

    Al-Talib, Ayman A

    2016-01-01

    To study the clinical presentation and treatment outcome of molar pregnancy at a Tertiary Care Hospital in Dammam, Saudi Arabia. Reviewed medical records of all molar pregnancy cases among all the deliveries at a tertiary care hospital in Dammam from 2005 to 2014, after approval by institutional ethical review committee. Data abstracted included patient's age, parity, presenting symptoms, gestational age at diagnosis, uterine size, ultrasonographic findings, BhCG level at the time of diagnosis and at follow-up after evacuation, and blood loss during evacuation. Data was entered and analyzed using Excel; frequency distribution for categorical variables and descriptive statistics for continuous variables were computed. Of a total of 25,000 deliveries in ten years, 22 cases of complete molar pregnancy were encountered: 0.9 cases of molar pregnancy per 1000 pregnancies. Majority of patients (63.7%) were older than 35 years, and were nulliparous (45.5%). The commonest symptom was vaginal bleeding (86.4%) followed by hyperemesis gravidarum (41.0%); Hyperthyroidism was seen in 1 patient (4.5%). Ovarian enlargement by theca-lutin cyst was seen in 3 patients (13.6%). The majority of patients (63.6%) had normal BhCG within 9 weeks (63 days) after suction curettage. The majority of the cases followed a benign course. Aged older than 35 years seems a risk factor and vaginal bleeding is the commonest presenting symptom. Early booking of pregnant women to antenatal care clinics and routine first trimester ultrasound made diagnosis easier and earlier before complications appear.

  14. [Occupational exposure investigation and protective measures in a tertiary infectious disease hospital].

    PubMed

    Ding, H M; Zhou, X P; Huang, J Z

    2018-02-20

    Objective: To investigate the cause of occupational exposure among 136 nurses in a tertiary infectious disease hospital, and puts forward the prevention strategy. Methods: A total of 136 nurses exposed to occupational exposure between 2014 and 2016 were included in the study. Analysis was conducted from the years of work of nurses, exposure routes, and the pathogens. Results: The nurses suffer from the highest risk of occupational exposures (73.91%) .Nurses working for less than 5 years and interns are most likely to suffer occupational exposure (45.59% and 35.29% respectively) . Occupational exposure was mainly caused by needle injuries, in which infusion was the main route of occupational exposure (36.76%) . The improper treatment of needle pulling after infusion is the main link of needle puncture (36.76%) . Occupational exposure pathogens were mainly HBV (63.24%) . Conclusion: Nursing staff is the high-risk group of occupational exposure. Irregular operation, lack of awareness of protection, improper disposal after the needle withdrawal and poor safety assessment of the operating environment are the main causes of occupational exposure. It is suggested to strengthen the training of occupational safety and protection, enhance clinical nurses occupational safety protection consciousness, standardize medical operation, so as to prevent the occurrence of occupational exposure.

  15. Awareness and practices regarding bio-medical waste management among health care workers in a tertiary care hospital in Delhi.

    PubMed

    Bhagawati, G; Nandwani, S; Singhal, S

    2015-01-01

    Health care institutions are generating large amount of Bio-Medical Waste (BMW), which needs to be properly segregated and treated. With this concern, a questionnaire based cross-sectional study was done to determine the current status of awareness and practices regarding BMW Management (BMWM) and areas of deficit amongst the HCWs in a tertiary care teaching hospital in New Delhi, India. The correct responses were graded as satisfactory (more than 80%), intermediate (50-80%) and unsatisfactory (less than 50%). Some major areas of deficit found were about knowledge regarding number of BMW categories (17%), mercury waste disposal (37.56%) and definition of BMW (47%).

  16. Non-use of contraception: determinants among Ugandan university students.

    PubMed

    Mehra, Devika; Agardh, Anette; Petterson, Karen Odberg; Östergren, Per-Olof

    2012-10-08

    In Uganda, adolescent pregnancy often results in adverse maternal and neonatal health outcomes. In this context, low use of contraception and high rates of maternal mortality rate make preventing unwanted pregnancies critical. The objective was to determine the relationship between non-use of contraception and sociodemographic factors, alcohol consumption, and types of partner(s) among Ugandan university students. In 2010, 1,954 students at Mbarara University of Science and Technology in southwestern Uganda participated in a cross-sectional study whereby a self-administered questionnaire was used to assess sociodemographic factors, alcohol consumption, and sexual behaviour including the use of contraceptives. Multivariable logistic regression was used for the analysis and data were stratified by sex. 1,179 students (60.3% of the study population) reported that they were sexually active. Of these, 199 (18.6%) did not use contraception in their last sexual encounter. Students currently not in a relationship had higher odds of non-use of contraception (odds ratio 1.8, 95% confidence interval 1.2-2.7). The association remained statistically significant for both males and females after controlling for age, sexual debut, area of growing up, and educational level of the household head. Socio-demographic determinants of age (22 or younger), early sexual debut (at age 16 years or earlier), and a rural background were significant for males but not for females. A synergistic effect between not currently being in a relationship and early sexual debut were also observed to have an effect on the non-use of contraception. Non-use of contraception among Ugandan university students differs for males and females, possibly due to gendered power relations. Sexual and reproductive health policies and programmes should be designed to take these differences into account.

  17. Non-use of contraception: determinants among Ugandan university students

    PubMed Central

    Mehra, Devika; Agardh, Anette; Petterson, Karen Odberg; Östergren, Per-Olof

    2012-01-01

    Background In Uganda, adolescent pregnancy often results in adverse maternal and neonatal health outcomes. In this context, low use of contraception and high rates of maternal mortality rate make preventing unwanted pregnancies critical. Objective The objective was to determine the relationship between non-use of contraception and socio-demographic factors, alcohol consumption, and types of partner(s) among Ugandan university students. Design In 2010, 1,954 students at Mbarara University of Science and Technology in southwestern Uganda participated in a cross-sectional study whereby a self-administered questionnaire was used to assess socio-demographic factors, alcohol consumption, and sexual behaviour including the use of contraceptives. Multivariable logistic regression was used for the analysis and data were stratified by sex. Results 1,179 students (60.3% of the study population) reported that they were sexually active. Of these, 199 (18.6%) did not use contraception in their last sexual encounter. Students currently not in a relationship had higher odds of non-use of contraception (odds ratio 1.8, 95% confidence interval 1.2–2.7). The association remained statistically significant for both males and females after controlling for age, sexual debut, area of growing up, and educational level of the household head. Socio-demographic determinants of age (22 or younger), early sexual debut (at age 16 years or earlier), and a rural background were significant for males but not for females. A synergistic effect between not currently being in a relationship and early sexual debut were also observed to have an effect on the non-use of contraception. Conclusion Non-use of contraception among Ugandan university students differs for males and females, possibly due to gendered power relations. Sexual and reproductive health policies and programmes should be designed to take these differences into account. PMID:23058273

  18. A study of antimicrobial use in children admitted to pediatric medicine ward of a tertiary care hospital.

    PubMed

    Baidya, Sandip; Hazra, Avijit; Datta, Supratim; Das, Amal Kanti

    2017-01-01

    Antimicrobials are frequently used in tertiary care hospitals. We conducted an observational study on children admitted to a teaching hospital in Eastern India, to generate a profile of antimicrobial use and suspected adverse drug reactions (ADRs) attributable to them. Hospitalized children of either sex, aged between 1 month and 12 years, were studied. Baseline demographic and clinical features, duration of hospital stay, antimicrobials received in hospital along with dosing and indications and details of suspected ADRs attributable to their use were recorded. Every patient was followed up till discharge, admission to the Pediatric Intensive Care Unit, or death. Over the 1 year study period, 332 admissions were screened. The prevalence of antimicrobial use was 79.82%. The majority of the 265 children who received antimicrobials were males (61.10%) and hailed from rural and low socioeconomic background. Median age was 36 months. Six children died, 43 were transferred out, and the rest discharged. In most instances, either 2 (40%) or a single antibiotic (39.6%) was used. Ceftriaxone, co-amoxiclav, amikacin, vancomycin, and ampicillin were predominantly used. Antivirals, antimalarials, and antiprotozoals were used occasionally. Average number of antimicrobials per patient was 2.0 ± 1.27; the majority (84.1%) were by parenteral route and initial choice was usually empirical. Prescriptions were usually in generic name. The antimicrobial treatment ranged between 1 and 34 days, with a median of 7 days. Six ADRs were noted of which half were skin rash and the rest loose stools. The profile of antimicrobial use is broadly similar to earlier Indian studies. Apparent overuse of multiple antimicrobials per prescription and the parenteral route requires exploration. Antimicrobials are being used empirically in the absence of policy. ADRs to antimicrobials are occasional and usually mild. The baseline data can serve in situation analysis for antibiotic prescribing guidelines.

  19. Clinical predictors of anticipatory emesis in patients treated with chemotherapy at a tertiary care cancer hospital.

    PubMed

    Qureshi, Fawad; Shafi, Azhar; Ali, Sheeraz; Siddiqui, Neelam

    2016-01-01

    To determine the clinical predictors of anticipatory emesis in patients treated with chemotherapy at a tertiary care cancer hospital. This was a cross-sectional study conducted on 200 patients undergoing first line chemotherapy with minimum of two cycles at inpatient department and chemotherapy bay of Shaukat Khanum Memorial Cancer Hospital and Research Centre Pakistan. Anticipatory nausea and vomiting develops before administration of chemotherapy. Clinical signs and symptoms in patients with or without anticipatory emesis were compared using chi square test statistics. The mean age of the study participants was 36.68 years (SD±12.23). The mean numbers of chemotherapy cycles administered were 3.23 (SD±1.2). Chemotherapy related nausea and vomiting was experienced by 188 (94%) patients and anticipatory nausea vomiting was reported in 90 (45%) of patients. Greater proportions of patients with anticipatory emesis were females. Fourteen (15.5%) p-value=0.031 patients with anticipatory emesis had history of anxiety and depression. Fifty nine (65.5%) p-value =< 0.0001 patients with anticipatory emesis had severe nausea after last chemotherapy cycle. Forty six (51.11%) p=<0.0001 patients had motion sickness. Female gender, history of motion sickness, anxiety and depression, severe nausea and vomiting experienced in pervious cycle of chemotherapy were clinical predictors of anticipatory nausea and vomiting.

  20. Evaluation of prevalence and risk factors of gestational diabetes in a tertiary care hospital in Kerala.

    PubMed

    Mohan, Manju A; Chandrakumar, Abin

    2016-01-01

    The prospective study was conducted with the aim to evaluate the prevalence and risk factors of gestational diabetes mellitus in a tertiary care referral hospital in Kerala. A prospective observational study was conducted with the aim to study the prevalence, risk factors, complications, treatment pattern and cost analysis of GDM. The study was carried out in the Obstetrics & Gynecology dDepartment of Al Shifa hHospital located in northern Kerala. Over an eight-month period, 201 patients who met the inclusion criteria were enrolled for study from which prevalence of GDM was estimated at 15.9%. The study revealed higher prevalence of risk factors and complications such as age >25 years, BMI >26kg/m(2), family history of DM, past history GDM, history of big baby, gestational hypertension, vaginal candidiasis, premature rupture of membranes and hyperbilirubinemia in GDM group as compared to non-GDM group. The study also demonstrated that modern life-style was a major influencing factor for development of diabetes in the study population. The study reveals the necessity of proper screening diagnosis and management of GDM in pregnant women by the clinicians so as to prevent the future burden of type 2 diabetes. Copyright © 2015 Diabetes India. Published by Elsevier Ltd. All rights reserved.

  1. Characteristics and management of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemase in a tertiary hospital.

    PubMed

    Pang, Feng; Jia, Xiu-Qin; Song, Zhen-Zhu; Li, Yan-Hua; Wang, Bin; Zhao, Qi-Gang; Wang, Chuan-Xin; Zhang, Yi; Wang, Le-Xin

    2016-03-01

    The emergence of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemases is rare. We report an occurrence of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemases in a Chinese tertiary care hospital from November 2010 to December 2012. The clinical characteristics of 30 patients were described. The genetic relationship of isolates was determined by pulsed-field gel electrophoresis (PFGE). Carbapenemases were detected by modified Hodge test (MHT) and polymerase chain reactions (PCRs). Amplicons were sequenced and blasted to determine the genotype. Most infected patients were from intensive care unit and had complex and serious underlying illnesses requiring mechanical ventilation. PFGE revealed that Klebsiella pneumoniae showed two major PFGE types. Two Klebsiella oxytoca had an indistinguishable PFGE pattern, while four Enterobacter cloacae were different strains. The sequencing studies showed Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemase in the 23 infected patients. The majority of patients had infections with the carbapenemase-producing Enterobacteriaceae (CPE) strain, most were successfully treated with a range of antibiotics and discharged. It is important to maintain a high index of suspicion to screen for carbapenemase-producing Enterobacteriaceae strains. Rapid identification of these strains and implementation of stringent procedures are the key to prevent major outbreaks in a hospital setting.

  2. Treatment of Pancreatic and Periampullary Cancers at a Community Hospital: Successful Application of Tertiary Care Treatment Standards

    PubMed Central

    Moesinger, Robert C.; Davis, Jan W.; Hill, Britani; Johnston, W. Cory; Gray, Carl; Johnson, Harold; Ingersoll, Leslye; Whipple, Gary; Reilly, Mark; Harris, Robert; Hansen, Vincent

    2011-01-01

    Background. The treatment of pancreatic cancer and other periampullary neoplasms is complex and challenging. Major high-volume cancer centers can provide excellent multidisciplinary care of these patients but almost two-thirds of pancreatic cancer patients are treated at low volume centers. There is very little published data from low volume community cancer programs in regards to the treatment of periampullary cancer. In this study, a review of comprehensive periampullary cancer care at two low volume hospitals with comparison to national standards is presented. Methods. This is a retrospective review of 70 consecutive patients with periampullary neoplasms who underwent surgery over a 5-year period (2006–2010) at two community hospitals. Results. There were 51 successful resections of 70 explorations (73%) including 34 Whipple procedures. Mortality rate was 2.9%. Comparison of these patients to national standards was made in terms of operative mortality, resectability rate, administration of adjuvant therapy, clinical trial participation and overall survival. The results in these patients were comparable to national standards. Conclusions. With adequate commitment of resources and experienced surgical and oncologic practitioners, community cancer centers can meet national tertiary care standards in terms of pancreatic and periampullary cancer care. PMID:22312532

  3. Epidemiology of Surgically Managed Mandibular Condylar Fractures at a Tertiary Referral Hospital in Urban Southwest China.

    PubMed

    Thapa, Swosti; Wang, Jun; Hu, Hong-Tao; Zhang, Fu-Gui; Ji, Ping

    2017-01-01

    Mandibular condylar fracture is one of the commonest maxillofacial fractures treated by maxillofacial surgeons. Demography of the patients, causation, and characteristics of the fracture depends on various socio-economic factors. Hence, maxillofacial surgeons should be familiar with epidemiology of mandibular condylar fracture. This study retrospectively describes the demography, etiology, fracture characteristics, and hospital utilization of surgically treated mandibular condylar fractures in a tertiary referral hospital in urban China in past five years. Data of all patients who underwent surgical management between 2011 and 2015 were collected. This included aetiology, characteristics of fracture, time, age, sex, associated injuries, and hospital utilization of 166 patients with 208 mandibular condylar fractures. These patients had undergone open reduction and internal fixation with either miniplates or lag screws. Among the fracture of head of mandibular condyle, 21.28% of the patients had the fracture segments removed. These data were statistically analyzed to describe the epidemiology of mandibular condylar fracture. Most of the patients had unilateral mandibular condylar fractures (74.7%). Male patients (76.51%) outnumbered female patients (23.49%) in this cohort. The average age of the patients was 37 years. The fractures were mostly caused by fall from height (60.84%) and were located at the condylar neck (53.61%). Most of the patients had other associated maxillofacial injuries (71.08%) which were mostly located at symphysis and parasymphysis (44.59%). It took 12.58 +/- 0.35 days of hospitalization for the treatment. Fall from height was the most prevalent cause of mandibular condylar injury in mountainous urban China. The people at highest risk were middle-aged men. Mandibular condylar fracture was mostly located at the condylar neck and was usually associated with fracture at the symphysis and parasymphysis.

  4. Prevalence of epilepsy and seizure disorders as causes of apparent life- threatening event (ALTE) in children admitted to a tertiary hospital.

    PubMed

    Anjos, Alessandra Marques dos; Nunes, Magda Lahorgue

    2009-09-01

    To determine the prevalence and describe clinical characteristics of seizure disorders and epilepsy as causes of apparent life- threatening event (ALTE) in children admitted at the emergency and followed in a tertiary hospital. Cross-sectional study with prospective data collection using specific guidelines to determine the etiology of ALTE. During the study, 30 (4.2%) children admitted to the hospital had a diagnosis of ALTE. There was a predominance of males (73%) and term infants (70%). Neonatal neurological disorders and neuropsychomotor development delay were found respectively in 13.4% and 10% of the cases. Etiological investigation revealed that 50% of the cases were idiopathic, and 13.4% were caused by epilepsy or seizure disorders. Although all patients had recurrent ALTE events, epilepsy had not been previously suspected. Epilepsy should be included in the differential diagnosis of ALTE, particularly when events are recurrent.

  5. Cost of influenza hospitalization at a tertiary care children's hospital and its impact on the cost-benefit analysis of the recommendation for universal influenza immunization in children age 6 to 23 months.

    PubMed

    Hall, Jennifer L; Katz, Ben Z

    2005-12-01

    To calculate the costs of influenza hospitalization at a tertiary care children's hospital as the basis of a cost-benefit analysis of the new influenza vaccine recommendation for children age 6 to 23 months. We reviewed the medical records of all patients admitted to Children's Memorial Hospital (CMH) in 2002 diagnosed with influenza. Total hospital costs were obtained from the Business Development Office. Thirty-five charts were analyzed. Both of the 2 patients requiring mechanical ventilation and 4 of 6 patients admitted to the intensive care unit had high-risk underlying medical conditions. Nine children were age 6 to 23 months; 4 of these 9 had no preexisting medical conditions. Had all 18 high-risk children over age 6 months been protected from influenza, approximately $350,000 in hospital charges could have been saved. Preventing the additional 4 hospitalizations in the otherwise low-risk children age 6 to 23 months for whom vaccine is currently recommended would have cost approximately $281,000 ($46/child) more than the hospital charges saved. When all children age 6 to 23 months are considered, influenza vaccination is less costly than other prophylactic measures. Addition of indirect costs, deaths, outpatient costs, and the cost of secondary cases would favor the cost:benefit ratio for influenza vaccination of all children age 6 to 23 months.

  6. Educational Module Intervention for Radiographers to Reduce Repetition Rate of Routine Digital Chest Radiography in Makkah Region of Saudi Arabia Tertiary Hospitals: Protocol of a Quasi-Experimental Study.

    PubMed

    Almalki, Abdullah A; Abdul Manaf, Rosliza; Hanafiah Juni, Muhamad; Kadir Shahar, Hayati; Noor, Noramaliza Mohd; Gabbad, Abdelsafi

    2017-09-26

    Repetition of an image is a critical event in any radiology department. When the repetition rate of routine digital chest radiographs is high, radiation exposure of staff and patients is increased. In addition, repetition consumes the equipment's life span, thus affecting the annual budget of the department. The aim of this study is to determine the impact of a printed educational module on reducing the repetition rate of routine digital chest radiography among radiographers in Makkah Region tertiary hospitals. A quasi-experimental time series with a control group will be conducted in Makkah Region tertiary hospitals for 8 months starting in the second quarter of 2017. Four hospitals out of 5 in the region will be selected; 2 of them will be selected as the control group and the other 2 as the intervention group. Stratification and a simple random sampling technique will be used to sample 56 radiographers in each group. Pre- and postintervention assessments will be conducted to determine the radiographer knowledge, motivation, and skills and repetition rate of chest radiographs. Radiographs of the chest performed by sampled radiographers in the selected hospitals will be collected for 2 weeks before and after the intervention. A piloted questionnaire will be distributed and collected by a researcher in both groups. One-way multivariate analysis of variance and 2-way repeated multivariate analysis of variance will be used to analyze the data. It is expected that the repetition rate in the intervention group will decline after implementing the intervention and the change will be statistically significant (P<.05). Furthermore, it is expected that the knowledge, motivation, and skill levels in the intervention group will increase significantly among radiographers after implementation of the intervention (P<.05). Meanwhile, knowledge, motivation, and skills in the control group will not change. A quasi-experimental time series with a control will be conducted to

  7. Dengue fever in patients admitted in tertiary care hospitals in Pakistan.

    PubMed

    Munir, Muhammad Arif; Alam, Syed Ejaz; Khan, Zareef Uddin; Saeed, Quaid; Arif, Ambreen; Iqbal, Rizwan; Saqib, Muhammad Arif Nadeem; Qureshi, Huma

    2014-05-01

    To assess the gaps in the diagnosis and management of dengue fever cases. The retrospective descriptive analytical study was done with a case record analysis of patients with dengue fever admitted from January to December 2010 at five tertiary care hospitals in different Pakistani cities. Using a questionnaire, information was gathered on demography, haematological profile, management, use of blood and platelet transfusions and the outcome. For comparison, data of serologically-confirmed dengue patients from a private laboratory in Islamabad was collected to see the age, gender and month-wise distribution of cases tested over the same period. SPSS 16 was used for statistical analysis. Out of the 841 confirmed dengue cases, 514 (79%) were males and 139 (21%) females. The overall mean age was 31.3 +/- 14.0 years. Dengue fever was seen in 653 (78%) and dengue haemorrhagic fever (DHF) in 188 (22%) patients. Most cases were between 20 and 49 years of age. A gradual increase in dengue fever and dengue haemorrhagic fever was seen from August, with a peak in October/November. Tourniquet test was done only in 20 (2.3%) cases, out of which 11 (55%) were positive and 9 (45%) were negative. Serial haematocrit was not done in any case. Total deaths were 5 (0.6%). Most cases were seen in October/November with the majority being in the 20-39 age group. Tourniquet test and serial haematocrit were infrequently used. No standard national guidelines were employed.

  8. A tertiary care-primary care partnership model for medically complex and fragile children and youth with special health care needs.

    PubMed

    Gordon, John B; Colby, Holly H; Bartelt, Tera; Jablonski, Debra; Krauthoefer, Mary L; Havens, Peter

    2007-10-01

    To evaluate the impact of a tertiary care center special needs program that partners with families and primary care physicians to ensure seamless inpatient and outpatient care and assist in providing medical homes. Up to 3 years of preenrollment and postenrollment data were compared for patients in the special needs program from July 1, 2002, through June 30, 2005. A tertiary care center pediatric hospital and medical school serving urban and rural patients. A total of 227 of 230 medically complex and fragile children and youth with special needs who had a wide range of chronic disorders and were enrolled in the special needs program. Care coordination provided by a special needs program pediatric nurse case manager with or without a special needs program physician. Preenrollment and postenrollment tertiary care center resource utilization, charges, and payments. A statistically significant decrease was found in the number of hospitalizations, number of hospital days, and tertiary care center charges and payments, and an increase was found in the use of outpatient services. Aggregate data revealed a decrease in hospital days from 7926 to 3831, an increase in clinic visits from 3150 to 5420, and a decrease in tertiary care center payments of $10.7 million. The special needs program budget for fiscal year 2005 had a deficit of $400,000. This tertiary care-primary care partnership model improved health care and reduced costs with relatively modest institutional support.

  9. Efficacy and Safety of Deferasirox in Pediatric Patients of Thalassemia at a Tertiary Care Teaching Hospital.

    PubMed

    Thakor, Dhaval R; Desai, Chetna K; Kapadia, Jigar D; Dikshit, Ram K; Mehariya, K M

    2017-01-01

    To evaluate efficacy, safety and utilization pattern of deferasirox in paediatric patients of transfusion dependant β Thalassemia Major at a tertiary care teaching hospital in Gujarat. This observational, prospective-retrospective, single centre, continuous study was conducted in a tertiary care teaching hospital among paediatric patients of transfusion dependent β Thalassemia Major. Patients treated with deferasirox for not more than 12 weeks were enrolled. Details of blood transfusions, relevant investigations performed every 3 weeks and 3 months and drugs used were recorded in a pretested case record form. Parents were provided with a diary to record the details of ADRs. Data were analyzed for demographic characteristics, number and mean volume of blood transfusions, changes in serum ferritin and iron levels, number and types of ADRs and progression, causality, severity and preventability of ADRs. Of the 60 patients enrolled, one patient was lost to follow up and four withdrew their consent. Of the remaining 55 patients, 36 were boys and 19 were girls (mean age: 6 ± 3.14 years), including patients of 1-3 years (11), 4-6 years (24), 7-10 years (12) and 11-12 years (8). Thirty six patients were born of consanguineous marriages. Adherence to blood transfusion guidelines and deferasirox prescribing and administration guidelines was observed. A serial and significant decrease in mean serum ferritin and serum iron at 3 weeks and 3 months with deferasirox treatment was observed in all age groups except that of 11-12 years. A total of 117 ADRs were observed in 52 patients from 19498 doses, most common being diarrhea (24), raised serum creatinine (15), raised hepatic enzymes (14), abdominal pain (14) and rashes (14). A reduction in dose was required in 32 cases, while a temporary stoppage was indicated in 41 cases. Deferasirox was the possible and probable cause of 65 and 51 ADRs respectively as assessed by WHO-UMC scale. Majority of ADRs were definitely preventable

  10. Surveillance of Candida spp Bloodstream Infections: Epidemiological Trends and Risk Factors of Death in Two Mexican Tertiary Care Hospitals

    PubMed Central

    Corzo-Leon, Dora E.; Alvarado-Matute, Tito; Colombo, Arnaldo L.; Cornejo-Juarez, Patricia; Cortes, Jorge; Echevarria, Juan I.; Guzman-Blanco, Manuel; Macias, Alejandro E.; Nucci, Marcio; Ostrosky-Zeichner, Luis; Ponce-de-Leon, Alfredo; Queiroz-Telles, Flavio; Santolaya, Maria E.; Thompson-Moya, Luis; Tiraboschi, Iris N.; Zurita, Jeannete; Sifuentes-Osornio, Jose

    2014-01-01

    Introduction Larger populations at risk, broader use of antibiotics and longer hospital stays have impacted on the incidence of Candida sp. bloodstream infections (CBSI). Objective To determine clinical and epidemiologic characteristics of patients with CBSI in two tertiary care reference medical institutions in Mexico City. Design Prospective and observational laboratory-based surveillance study conducted from 07/2008 to 06/2010. Methods All patients with CBSI were included. Identification and antifungal susceptibility were performed using CLSI M27-A3 standard procedures. Frequencies, Mann-Whitney U test or T test were used as needed. Risk factors were determined with multivariable analysis and binary logistic regression analysis. Results CBSI represented 3.8% of nosocomial bloodstream infections. Cumulative incidence was 2.8 per 1000 discharges (incidence rate: 0.38 per 1000 patient-days). C. albicans was the predominant species (46%), followed by C. tropicalis (26%). C. glabrata was isolated from patients with diabetes (50%), and elderly patients. Sixty-four patients (86%) received antifungals. Amphotericin-B deoxycholate (AmBD) was the most commonly used agent (66%). Overall mortality rate reached 46%, and risk factors for death were APACHE II score ≥16 (OR = 6.94, CI95% = 2.34–20.58, p<0.0001), and liver disease (OR = 186.11, CI95% = 7.61–4550.20, p = 0.001). Full susceptibility to fluconazole, AmBD and echinocandins among C. albicans, C. tropicalis, and C. parapsilosis was observed. Conclusions The cumulative incidence rate in these centers was higher than other reports from tertiary care hospitals from Latin America. Knowledge of local epidemiologic patterns permits the design of more specific strategies for prevention and preemptive therapy of CBSI. PMID:24830654

  11. Phenotypic Characterization and Antifungal Susceptibility Pattern to Fluconazole in Candida species Isolated from Vulvovaginal Candidiasis in a Tertiary Care Hospital

    PubMed Central

    Poongothai, G.K; Sinazer, Annie Rofeena; Kannaiyan, Kavitha; Gurumurthy, Hemalatha; Jaget, Nirmala; Kuthalaramalingam, Sethumadhavan

    2014-01-01

    Background: Vaginal candidiasis is a common gynecological finding among women worldwide. This study was carried out to determine the prevalence of vulvovaginal candidiasis (VVC) along with speciation of Candida with special reference to its antifungal susceptibility pattern to fluconazole and also to evaluate the risk factors responsible for VVC in patients attending our tertiary care hospital in Puducherry, India. Materials and Methods: This study was carried out in the tertiary care hospital in Puducherry during the period of August 2010 to September 2012.The study group consisted of 180 women between the age group of 15 to 56 years with the complaints of excessive vaginal discharge, pruritis and pain. Materials used for this study consisted of high vaginal swabs from patients with relevant history, attending Obstetrics & Gynecology department. High vaginal swabs were subjected to direct 10% KOH wet mount microscopy, Gram stain, culture onto Sabouraud’s dextrose agar (SDA) & 5% sheep blood agar and susceptibility testing to fluconazole was performed using E-test. Results: Candida was isolated in 40 (22.2 %) women & these consisted of C. albicans 26 (65%), C. glabrata 9 (22.5%), C.tropicalis 3 (7.5%) & C. parapsilosis 2 (5%). Susceptibility test carried out on the 40 isolates revealed that 35 (87.5%) Candida isolates were sensitive to fluconazole, 3 (7.5%) were moderately sensitive and 2 (2.5%) were resistant. Thirty one percent patients had itching as the presenting complaints followed by vaginal discharge (29.4%). Conclusion: The high frequency with which C. albicans was recovered in our study and its susceptibility to fluconazole supports the continued use of azole agents for empirical therapy of uncomplicated candidal vulvovaginitis in the community. PMID:24995172

  12. Vaginal Prostate Specific Antigen (PSA) Is a Useful Biomarker of Semen Exposure Among HIV-Infected Ugandan Women.

    PubMed

    Woolf-King, Sarah E; Muyindike, Winnie; Hobbs, Marcia M; Kusasira, Adrine; Fatch, Robin; Emenyonu, Nneka; Johnson, Mallory O; Hahn, Judith A

    2017-07-01

    The practical feasibility of using prostate specific antigen (PSA) as a biomarker of semen exposure was examined among HIV-infected Ugandan women. Vaginal fluids were obtained with self-collected swabs and a qualitative rapid test (ABAcard ® p30) was used to detect PSA. Trained laboratory technicians processed samples on-site and positive PSA tests were compared to self-reported unprotected vaginal sex (UVS) in the last 48 h. A total of 77 women submitted 126 samples for PSA testing at up to three study visits. Of these samples, 31 % (n = 39/126) were PSA positive, and 64 % (n = 25/39) of the positive PSA samples were accompanied by self-report of no UVS at the study visit the PSA was collected. There were no reported difficulties with specimen collection, storage, or processing. These findings provide preliminary data on high levels of misreported UVS among HIV-infected Ugandan women using practically feasible methods for PSA collection and processing.

  13. Prevalence and Risk Factors for Peripheral Neuropathy among Type 2 Diabetes Mellitus Patients at a Tertiary Care Hospital in Coastal Karnataka.

    PubMed

    Gogia, Sonalika; Rao, Chythra R

    2017-01-01

    In view of the growing burden of type 2 diabetes mellitus (T2DM) globally and associated microvascular and macrovascular complications, the study was done to assess the prevalence and risk factors for diabetic neuropathy among T2DM patients attending a tertiary care hospital. T2DM patients' ≥30 years of both gender, presenting to the Medicine Department at a tertiary care hospital were included in the study. Diabetic Neuropathy Symptom (DNS) questionnaire to assess symptoms and Diabetic Neuropathy Examination (DNE) scoring to assess clinical signs were used. A total of 273 patients were included. The mean age was 57.8 ± 11.5 years. The male to female distribution was 75% (202) and 25% (71), respectively. According to DNS instrument, 41.4% patients scored positive for the presence of neuropathy while only 24.5% had neuropathy according to DNE score. The proportion of males affected by neuropathy was more than females. 43.1% males had a positive DNS score while only 27.2% of them had a positive DNE score. Duration of the disease was positively correlated with neuropathy. Neuropathy was more prevalent among people who had higher systolic and diastolic blood pressure as per DNS and DNE instruments. The present study identified a higher proportion of males to be affected by neuropathy. Hence, more detailed evaluation must be accorded to elderly male diabetic patients with longer duration of the disease. Lifestyle modifications and watchful screening need to be incorporated as part of routine patient health education during follow-up clinic visits.

  14. Awareness of cervical cancer and Pap smear among nursing staff at a rural tertiary care hospital in Central India.

    PubMed

    Jain, S M; Bagde, M N; Bagde, N D

    2016-01-01

    Cancer cervix is the leading cause of cancer deaths in females in developing countries and one in five women suffering from cervical cancer lives in India. The aim of this study is to determine the awareness about cervical cancer and Pap smear among nurses working in a tertiary care institute. Study Setting and Design: Cross-sectional survey in a tertiary care institute. Nurses working at our institute excluding those who have worked or working in the Obstetrics and Gynecology department were provided with a pre-designed questionnaire testing their knowledge about cervical cancer. Approximately, 86% were aware about cancer cervix and 69% were aware of a pre-cancerous stage. 42.3% were not aware of any risk factor and 27.6% were not aware of any symptom of cancer cervix. 86.2% were aware about Pap smear, but only 58.6% were aware that facilities of Pap smear were available at our hospital. Knowledge about cervical cancer and awareness of Pap smear as screening test was inadequate in nursing staff. Awareness programs about cervical cancer and screening are needed to increase awareness for this preventable condition. There is a need to arrange reorientation programs to sensitize nurses and establish cytology clinics to offer facilities for easily accessible and affordable screening.

  15. Cost Analysis of Cervical Cancer Patients with Different Medical Payment Modes Based on Gamma Model within a Grade A Tertiary Hospital.

    PubMed

    Wu, Suo-Wei; Chen, Tong; Pan, Qi; Wei, Liang-Yu; Wang, Qin; Song, Jing-Chen; Li, Chao; Luo, Ji

    2018-02-20

    Cervical cancer shows a growing incidence and medical cost in recent years that has increased severe financial pressure on patients and medical insurance institutions. This study aimed to investigate the medical economic characteristics of cervical cancer patients with different payment modes within a Grade A tertiary hospital to provide evidence and suggestions for inpatient cost control and to verify the application of Gamma model in medical cost analysis. The basic and cost information of cervical cancer cases within a Grade A tertiary hospital in the year 2011-2016 were collected. The Gamma model was adopted to analyze the differences in each cost item between medical insured patient and uninsured patients. Meanwhile, the marginal means of different cost items were calculated to estimate the influence of payment modes toward different medical cost items among cervical cancer patients in the study. A total of 1321 inpatients with cervical cancer between the 2011 and 2016 were collected through the medical records system. Of the 1321 cases, 65.9% accounted for medical insured patients and 34.1% were uninsured patients. The total inpatient medical expenditure of insured patients was RMB 29,509.1 Yuan and uninsured patients was RMB 22,114.3 Yuan, respectively. Payment modes, therapeutic options as well as the recurrence and metastasis of tumor toward the inpatient medical expenditures between the two groups were statistically significant. To the specifics, drug costs accounted for 37.7% and 33.8% of the total, surgery costs accounted for 21.5% and 25.5%, treatment costs accounted for 18.7% and 16.4%, whereas the costs of imaging and laboratory examinations accounted for 16.4% and 15.2% for the insured patient and uninsured patients, respectively. As the effects of covariates were controlled, the total hospitalization costs, drug costs, treatment costs as well as imaging and laboratory examination costs showed statistical significance. The total hospitalization

  16. Screening for retinopathy of prematurity and treatment outcome in a tertiary hospital in Hong Kong.

    PubMed

    Iu, L Pl; Lai, C Hy; Fan, M Cy; Wong, I Yh; Lai, J Sm

    2017-02-01

    Studies on the prevalence and severity of retinopathy of prematurity in the local population are scarce. This study aimed to evaluate the prevalence, screening, and treatment outcome of retinopathy of prematurity in a tertiary hospital in Hong Kong. This cross-sectional study with internal comparison was conducted at Queen Mary Hospital, Hong Kong. The study evaluated 89 premature infants who were born at the hospital and were screened for retinopathy of prematurity, in accordance with the 2008 British Guidelines, between January 2013 and December 2013. The prevalences of retinopathy of prematurity and severe retinopathy requiring treatment were studied. The mean (± standard deviation) gestational age at birth was 30 +2 weeks ± 16.5 days (range, 24 +1 to 35 +5 weeks). The mean birth weight was 1285 g ± 328 g (range, 580 g to 2030 g). A total of 15 (16.9%) infants developed retinopathy of prematurity and three (3.4%) required treatment. In a subgroup analysis of extremely-low-birth-weight infants of <1000 g, 70.6% developed retinopathy of prematurity and 17.6% required treatment. Multivariate logistic regression analysis suggested low birth weight and patent ductus arteriosus were significantly associated with development of retinopathy of prematurity (P<0.001 and P=0.035, respectively). Among the three infants who received treatment for severe retinopathy of prematurity, all regressed successfully after one laser treatment. Retinopathy of prematurity is a significant problem among premature infants in Hong Kong, especially those with extremely low birth weight. Our screening service for retinopathy of prematurity was satisfactory and treatment results were good. Strict adherence to international screening guidelines and vigilance in infants at risk are key to successful management of retinopathy of prematurity.

  17. Distribution and predictors of emergency department charges: the case of a tertiary hospital in Lebanon.

    PubMed

    Saleh, Shadi; Mourad, Yara; Dimassi, Hani; Hitti, Eveline

    2016-03-18

    As health care costs continue to increase worldwide, health care systems, and more specifically hospitals are facing continuous pressure to operate more efficiently. One service within the hospital sector whose cost structure has been modestly investigated is the Emergency Department (ED). The study aims to report on the distribution of ED resource use, as expressed in charges, and to determine predictors of/contributors to total ED charges at a major tertiary hospital in Lebanon. The study used data extracted from the ED discharge database for visits between July 31, 2012 and July 31, 2014. Patient visit bills were reported under six major categories: solutions, pharmacy, laboratory, physicians, facility, and radiology. Characteristics of ED visits were summarized according to patient gender, age, acuity score, and disposition. Univariate and multivariate analyses were conducted with total charges as the dependent variable. Findings revealed that the professional fee (40.9 %) followed by facility fee (26.1 %) accounted for the majority of the ED charges. While greater than 80 % of visit charges went to physician and facility fee for low acuity cases, these contributed to only 52 and 54 % of the high acuity presentations where ancillary services and solutions' contribution to the total charges increased. The total charges for males were $14 higher than females; age was a predictor of higher charges with total charges of patients greater than 60 years of age being around $113 higher than ages 0-18 after controlling for all other variables. Understanding the components and determinants of ED charges is essential to developing cost-containment interventions. Institutional modeling of charging patterns can be used to offer price estimates to ED patients who request this information and ultimately help create market competition to drive down costs.

  18. Intensity of interprofessional collaboration among intensive care nurses at a tertiary hospital.

    PubMed

    Serrano-Gemes, G; Rich-Ruiz, M

    To measure the intensity of interprofessional collaboration (IPC) in nurses of an intensive care unit (ICU) at a tertiary hospital, to check differences between the dimensions of the Intensity of Interprofessional Collaboration Questionnaire, and to identify the influence of personal variables. A cross-sectional descriptive study was conducted with 63 intensive care nurses selected by simple random sampling. Explanatory variables: age, sex, years of experience in nursing, years of experience in critical care, workday type and work shift type; variable of outcome: IPC. The IPC was measured by: Intensity of Interprofessional Collaboration Questionnaire. Descriptive and bivariate statistical analysis (IPC and its dimensions with explanatory variables). 73.8% were women, with a mean age of 46.54 (±6.076) years. The average years experience in nursing and critical care was 23.03 (±6.24) and 14.25 (±8.532), respectively. 77% had a full time and 95.1% had a rotating shift. 62.3% obtained average IPC values. Statistically significant differences were found (P<.05) between IPC (overall score) and overall assessment with years of experience in critical care. This study shows average levels of IPC; the nurses with less experience in critical care obtained higher IPC and overall assessment scores. Copyright © 2016 Sociedad Española de Enfermería Intensiva y Unidades Coronarias (SEEIUC). Publicado por Elsevier España, S.L.U. All rights reserved.

  19. Physician job satisfaction in Saudi Arabia: insights from a tertiary hospital survey.

    PubMed

    Aldrees, Turki; Al-Eissa, Sami; Badri, Motasim; Aljuhayman, Ahmed; Zamakhshary, Mohammed

    2015-01-01

    Job satisfaction refers to the extent to which people like or dislike their job. Job satisfaction varies across professions. Few studies have explored this issue among physicians in Saudi Arabia. The objective of this study is to determine the level and factors associated with job satisfaction among Saudi and non-Saudi physicians. In this cross-sectional study conducted in a major tertiary hospital in Riyadh, a 5-point Likert scale structured questionnaire was used to collect data on a wide range of socio-demographic, practice environment characteristics and level and consequences of job satisfaction from practicing physicians (consultants or residents) across different medical specialties. Logistic regression models were fitted to determine factors associated with job satisfaction. Of 344 participants, 300 (87.2%) were Saudis, 252 (73%) males, 255 (74%) married, 188 (54.7%) consultants and age [median (IQR)] was 32 (27-42.7) years. Overall, 104 (30%) respondents were dissatisfied with their jobs. Intensive care physicians were the most dissatisfied physicians (50%). In a multiple logistic regression model, income satisfaction (odds ratio [OR]=0.448 95% CI 0.278-0.723, P < .001) was the only factor independently associated with dissatisfaction. Factors adversely associated with physicians job satisfaction identified in this study should be addressed in governmental strategic planning aimed at improving the healthcare system and patient care.

  20. Integrating Emerging Technologies in Teaching Ugandan Traditional Dances in K-12 Schools in New York City

    ERIC Educational Resources Information Center

    Mabingo, Alfdaniels

    2015-01-01

    Schools in New York City have made attempts to embrace and support the strand of "making connections", which is laid out in the New York City Department of Dance blueprint for teaching and learning in dance for grades PreK-12. Accordingly, some schools have integrated Ugandan traditional dances into the dance curriculum, and dance…

  1. Clinical characteristics of hospital-onset Pneumocystis pneumonia and genotypes of Pneumocystis jirovecii in a single tertiary centre in Korea.

    PubMed

    Kim, Tark; Lee, Sang-Oh; Hong, Hyo-Lim; Lee, Ju Young; Kim, Sung-Han; Choi, Sang-Ho; Kim, Mi-Na; Kim, Yang Soo; Woo, Jun Hee; Sung, Heungsup

    2015-02-26

    Pneumocystis pneumonia (PCP) may develop as a clinical manifestation of nosocomial pneumonia by means of either reactivation of resident P. jirovecii or de novo infection. However, there have been no studies describing the clinical characteristics of hospital-onset PCP. A retrospective review of medical records was performed to identify episodes of hospital-onset PCP in a tertiary care centre in Korea between May 2007 and January 2013. We investigated whether human-to-human contact during hospitalisation contributed to PCP development by molecular analysis of the genes encoding mitochondrial large ribosomal subunit (mtLSU) rRNA and dihydropteroate synthase (DHPS) and a review of hospitalisation history. During the study period, 129 patients (130 episodes) were diagnosed with PCP. Of these, respiratory specimens from 94 patients during 95 PCP episodes were available for analysis. Sixteen episodes (16.8%) were categorised as hospital-onset PCP. There was a trend toward a higher proportion of haematological malignancy (43.8% [7/16] vs. 20.3% [16/79]; P = 0.058) in patients with hospital-onset PCP compared to patients with community-onset PCP. mtLSU genotype 1 was the most common, occurring in 41 (43.2%) patients. There were four possible cases of nosocomial transmission. Mutation in DHPS was not observed in any PCP episode. PCP can be one of the causes of nosocomial pneumonia, although the mode of acquisition and transmission of P. jirovecii remains uncertain. mtLSU genotype 1 is the predominant P. jirovecii strain in Korea.

  2. Large-scale human immunodeficiency virus rapid test evaluation in a low-prevalence ugandan blood bank population.

    PubMed

    Eller, Leigh A; Eller, Michael A; Ouma, Benson J; Kataaha, Peter; Bagaya, Bernard S; Olemukan, Robert L; Erima, Simon; Kawala, Lilian; de Souza, Mark S; Kibuuka, Hannah; Wabwire-Mangen, Fred; Peel, Sheila A; O'Connell, Robert J; Robb, Merlin L; Michael, Nelson L

    2007-10-01

    The use of rapid tests for human immunodeficiency virus (HIV) has become standard in HIV testing algorithms employed in resource-limited settings. We report an extensive HIV rapid test validation study conducted among Ugandan blood bank donors at low risk for HIV infection. The operational characteristics of four readily available commercial HIV rapid test kits were first determined with 940 donor samples and were used to select a serial testing algorithm. Uni-Gold Recombigen HIV was used as the screening test, followed by HIV-1/2 STAT-PAK for reactive samples. OraQuick HIV-1 testing was performed if the first two test results were discordant. This algorithm was then tested with 5,252 blood donor samples, and the results were compared to those of enzyme immunoassays (EIAs) and Western blotting. The unadjusted algorithm sensitivity and specificity were 98.6 and 99.9%, respectively. The adjusted sensitivity and specificity were 100 and 99.96%, respectively. This HIV testing algorithm is a suitable alternative to EIAs and Western blotting for Ugandan blood donors.

  3. Depressive disorder in patients attending the outpatient department of a tertiary care hospital in Colombo.

    PubMed

    Anandakumar, D; Ratnatunga, S S; Dayabandara, M; Hanwella, Raveen; de Silva, Varuni A

    2016-01-01

    Lifetime prevalence of depression varies across countries and different populations. Depression is a common comorbidity of physical illness. Patients with depression are known to present with somatic symptoms. Depression is under-diagnosed in primary care settings. Objectives To estimate the prevalence of depression in patients attending the outpatient department (OPD) of a tertiary care hospital in the Western Province of Sri Lanka. A cross-sectional descriptive study was conducted in the OPD of the National Hospital of Sri Lanka (NHSL). Sample size was 205. Every fifth patient aged between 18 and 60 years who attended the OPD was recruited until the required number was met. Centre for Epidemiologic Studies Depression Scale (CES-D) was used to identify depression. There were 114 (55.6%) females. Mean age was 50 years (SD 13.68).Overall prevalence of depression in the sample was 22.4% (95% CI 16.68-28.20). Prevalence of depression was higher among females 25.4% (95% CI 17.32-33.56) than in males 18.7% (95% CI 10.52- 26.84). Prevalence of severe depression was 15.1% (95% CI 10.18-20.07). Adjusted odds ratios showed that pain related presenting complaints were significantly associated with depression [adjusted OR 1.99 (95% CI 1.01-3.96)]. Prevalence of depression in outpatients is similar to that reported in other parts of the world. None of the patients with depression presented seeking help for depressive symptoms.

  4. Periodontal conditions, low birth weight and preterm birth among postpartum mothers in two tertiary health facilities in Uganda

    PubMed Central

    2014-01-01

    Background Literature reports have indicated an increase in research evidence suggesting association between periodontal disease and the risk of pre-term birth (PTB) and low birth weight (LBW). Periodontal diseases in Uganda have been documented as a public health problem, but their association to adverse pregnancy outcomes is unknown. This study was conducted to assess the association between periodontital diseases in postpartum mothers and PTB and LBW of babies in Mulago and Mbarara referral hospitals. Methods This was a cross sectional study using medical records, clinical examination and oral interview of mothers at the two tertiary health facilities. Mothers with singleton babies from Mulago (n = 300) and Mbarara Hospital (n = 100) were recruited for the study. The women were clinically examined for periodontal disease by 2 trained and calibrated dentists. Data on PTB and LBW were retrieved from medical records. The data were analyzed to determine the relationship between the four parameters for periodontal disease (bleeding gingiva, periodontal pockets, gingival recession and calculus with plaque deposits) and the adverse pregnancy outcomes. Frequency distribution was used to describe the data. Bivariate and multivariate analyses were used to study the association between the periodontal diseases and adverse pregnancy outcomes. Results Approximately 26% and 29% of the postpartum mothers examined had bleeding gingiva and periodontal pockets of 4 mm or more deep, respectively. Advanced periodontitis i.e. pocket depth ≥ 6 mm was recorded in 13 (3.6%) of the mothers. Calculus with plaque deposits were recorded in 86% (n = 343) of the mothers. Gingival recession was recorded in 9.0% of the mothers and significantly and directly related to birth weight (p < 0.05). Conclusion Periodontal conditions of postpartum mothers in this study were found to be better than previously reported amongst the Ugandan population. Bivariate analysis showed a

  5. Does gynecologic malignancy predict likelihood of a tertiary palliative care unit hospital admission? A comparison of local, provincial and national death rates.

    PubMed

    Pilkey, Jana; Demers, Chantale; Chochinov, Harvey; Venkatesan, Nithya

    2012-12-01

    The purpose of this study was to determine whether the presence of gynecologic malignancies predicts the likelihood of a tertiary palliative care unit hospital admission. In this study, patients admitted to a specialized tertiary palliative care unit (TPCU) with gynecologic malignancies were compared to national and provincial death rates to determine if gynecologic malignancy predicts admission, and subsequent death, in a TPCU. Eighty-two gynecologic cancer patients were admitted to our TPCU over the 5- year study period. Out of all cancer deaths in the TPCU, death from ovarian cancer was 3.7% compared with 2.4% (p = 0.0068) of all cancer deaths in Manitoba and 2.3% (p = 0.0043) of all cancer deaths in Canada. Cervical cancer accounted for 1.7% of all our patients deaths compared with 0.7% (p = 0.0001) provincially and 0.6% (p = 0.0001) nationally. Uterine cancer deaths were not significantly different from the provincial and national death rates, whereas vulvar and fallopian cancers were too rare to allow for statistical analysis. Gynecologic cancers may be predictive of admission to a palliative care unit.

  6. Assessment of motivation levels and associated factors among the nursing staff of tertiary-level government hospitals.

    PubMed

    Pandey, Rahul; Goel, Sonu; Koushal, Vipin

    2018-04-15

    The present study assessed the motivation level of nurses working in 3 highly decorated tertiary-level government hospitals of India and also underpins the factors attributing to motivation levels. A sequential mixed-method design was used in this study wherein 400 nurses working in 5 units of nursing care in the hospitals were enrolled based upon proportionate random stratified sampling techniques. A self-administered questionnaire with Likert scale was developed based upon scale used by Mbindyo et al. The attributes of motivation were then categorized into external and internal attributes. For the qualitative component, participants with varied responses in quantitative data were selected and interviewed. Overall mean motivation score of the nursing staff was found 3.57 ± 0.93, which was higher for extrinsic motivational attributes (3.67 ± 0.88) as compared with intrinsic attributes (3.47 ± 0.98). The intrinsic motivational attribute of organizational commitment was rated highest followed by general motivation, conscientiousness, and self-efficacy. Personal issues, timeliness, and burnout were prime discouraging attributes among study participants. Sociodemographic characteristics and work profile characteristics showed significant relationship with the attributes of motivation. This study underscores the significance of different attributes of motivation which needs to be considered while framing administrative strategies and policy guidelines by authorities. Copyright © 2018 John Wiley & Sons, Ltd.

  7. The common causes leading to pancytopenia in patients presenting to tertiary care hospital.

    PubMed

    Das Makheja, Kirpal; Kumar Maheshwari, Bharat; Arain, Shafique; Kumar, Suneel; Kumari, Sangeeta; Vikash

    2013-09-01

    The objective of this study was to determine the frequency of common causes leading to Pancytopenia in patients presenting to tertiary care hospital at Karachi. A total of 62 patients with the diagnosis of Pancytopenia of more than one week duration were enrolled in the study. All patients underwent a detailed medical history and full physical examination followed by blood sampling for the investigations i.e. complete blood count with peripheral film, erythrocyte sedimentation rate (ESR), Malarial parasites (MP), liver function test, Renal function tests, PT and viral profile (HBsAg, Anti-HCV), Ultrasonography of abdomen. All patients underwent bone marrow aspiration and trephine biopsy for reporting and interpretation. Duration of study was six months, from May 2010 to November 2010. The average age of the patients was 37.76 ± 16.38years. Out of 62 patients, 36 (58%) were male and 26 (42%) were female. Megaloblastic anemia was the commonest cause that was observed in 41.9% cases followed by acute myeloid leukemia 27.4%, aplastic anemia 19.4% and erythroid hyperplasia 11.3%. Conclusion : This study concluded that most common cause of pancytopenia is Megaloblastic anemia, followed by acute myeloid leukemia and aplastic anemia. Bone marrow examination is a single useful investigation which reveals the underlying cause in patients with pancytopenia.

  8. Profile of catering staff at a tertiary care hospital in Mumbai.

    PubMed

    Bobhate, Prateek S; R Shrivastava, Saurabh; Gupta, Pankaj

    2011-01-01

    Food borne illnesses, even today, continue to be a major public health problem in both developing and developed nations. Food handlers play an important role in ensuring food safety throughout the chain of production, processing, storage and preparation.Health of food handlers is of great importance for maintaining hygienic quality of food prepared and served by them. Thus, the present study was conducted to study socio-demographic characteristics, morbidity pattern and immunization status of catering staff at a tertiary care hospital in Mumbai A cross sectional study was conducted from August 2010 to November 2010. Out of the total of 162 food handlers working in 11 food service establishments, 137 were interviewed face to face using a semi-structured questionnaire, while remaining 25 food handlers were excluded because of either their absence or not giving consent. The food handlers were assessed clinically for personal hygiene and investigated for hemoglobin, stool routine and sputum AFB examination. 82 (59.8%) food handlers were from the age group 10 - 29 years, 113 (82.5%) male, 95 (69%) married, 59 (43.1%) educated up to primary level. Only 7 (5.1%) had ever received a dose of typhoid vaccine. 103 (75.2%) had an addiction, majority consuming gutkha 59 (57.3%). Dental caries 32 (23.4%) was the most common morbidity identified. Entamoeba histolytica was isolated in 13 (9.5%) subjects. This study has confirmed an association between educational status and personal hygiene suggesting the need for greater personal hygiene in this group. Preemployment and periodical medical examination should be encouraged.

  9. Determinants and outcome of fetal macrosomia in a Nigerian tertiary hospital.

    PubMed

    Olokor, Oghenefegor Edwin; Onakewhor, Joseph Ubini; Aderoba, Adeniyi Kolade

    2015-01-01

    To determine the incidence and risk factors of fetal macrosomia and maternal and perinatal outcome. This was a 1-year prospective case-control study of singleton pregnancies in a Nigerian tertiary hospital. Only women who gave consent were recruited for the study. The maternal and perinatal outcomes in women who delivered macrosomic infants (birth weight ≥ 4000 g) were compared with the next consecutive delivery of normal birth weight (2500-3999 g) infants. The total deliveries for the study period were 2437, of which 135 were macrosomic babies. The incidence of fetal macrosomia was 5.5%. The mean birth weights of macrosomic and nonmacrosomic babies were 4.26 ± 0.29 kg and 3.20 ± 0.38 kg, respectively, P = 0.000. Mothers with macrosomic babies were more likely to be older (P = 0.047), of higher parity (0.001), taller (P = 0.007), and weighed more at delivery (P = 0.000). Previous history of fetal macrosomia (P = 0.000) and maternal diabetes (P = 0.007) were factors strongly associated with the delivery of macrosomic infants. Pregnancies associated with fetal macrosomia had increased duration of labor (P = 0.007), interventional deliveries (P = 0.000), shoulder dystocia, and genital laceration (P = 0.000). There was no significant difference in the incidence of primary postpartum hemorrhage (P = 0.790), birth asphyxia, and perinatal mortality (P = 0.197). Fetal macrosomia is associated with maternal and fetal morbidities. The presence of the observed risk factors should elicit the suspicion of a macrosomic fetus and the need for appropriate management to reduce maternal and fetal morbidities.

  10. Analysis of association between type of amblyopia and gender at a tertiary care hospital in Karachi.

    PubMed

    Siddiqui, Abdul Hameed; Raza, Syed Akhtar; Ghazipura, Arifa; Hussain, Muhammad Azhar; Iqbal, Sarwat; Ahsan, Kamran; Nadeem, Adnan

    2016-05-01

    To analyse the frequency of different types of amblyopia and its association with gender. The cross-sectional study was conducted from March 2014 to October 2014 at the Department of Ophthalmology of a tertiary care hospital inKarachi. The patients were classified into different types of amblyopia like anisometropic, strabismic, sensory deprivation and meridional amblyopia. Stratification was done according to age, gender and type of amblyopia by using SPSS version 21. Out of 130 patients, 71 were male and 59 were female. The amblyopia rate determined was anisometropic 69.23%, strabismic amblyopia 21.51% and others 9.23%. The mean age of subjects was 18.02±9 years. Type of amblyopia was independent of gender, and anisometropic amblyopia was the most common type of amblyopia found in both genders. This study found no significant association between gender and types of amblyopia and anisometropic amblyopia was the most common type of amblyopia in the data collected.

  11. Incidence & prognosis of acute kidney injury in individuals of snakebite in a tertiary care hospital in India.

    PubMed

    Pulimaddi, Ramulu; Parveda, Amruth Rao; Brahmanpally, Balkishan; Kalakanda, Paul Marx; Ramakrishna, K; Chinnapaka, Venkata Ramana Devi

    2017-12-01

    The snakebites are considered to be an occupational hazard in agriculture workers and the snake handlers, resulting in a considerable morbidity, mortality and economical implications. This study was conducted to determine the incidence, clinical presentation, renal injury and clinical outcome in snakebite victims who developed acute kidney injury (AKI). This hospital-based prospective, observational study was done on 100 cases who were admitted for the management of snakebite and found to develop AKI in a tertiary care hospital at Hyderabad, India. Renal function tests, complete blood picture, urine routine examination, ultrasound examination of abdomen and coagulation profile were done and the prognosis was assessed by noting recovery, mortality, morbidity and/or progress to chronic stage. A total of 100 patients with a mean age of 43.80±12.63 yr (range 18-70); 62 males and 38 females were studied. All had bites on lower limbs. A total of 86 patients arrived in the hospital within 24 h, and 14 arrived after 24 h. Oliguria was found in 60, bleeding tendencies in 64, haemodynamic instability noted - tachycardia in 86. Systolic blood pressure (BP) was <120 mm Hg in 68 and BP was not recordable in four patients. Twelve patients were in stage III kidney disease and needed haemodialysis. Of the 100 cases of snakebite-induced acute kidney failure, 86 recovered and six died. On follow up, after six months eight patients developed chronic kidney failure. A cascade of events tends to occur in severe haemotoxic envenomation such as bleeding disorders, hypotension/circulatory shock, intravascular haemolysis, disseminated intravascular coagulation and acute respiratory disease syndrome (ARDS). The findings of this study showed that early hospitalization, quick antisnake venom administration and adequate supporting care provided promising results.

  12. Hidden Costs of Hospital Based Delivery from Two Tertiary Hospitals in Western Nepal.

    PubMed

    Acharya, Jeevan; Kaehler, Nils; Marahatta, Sujan Babu; Mishra, Shiva Raj; Subedi, Sudarshan; Adhikari, Bipin

    2016-01-01

    Hospital based delivery has been an expensive experience for poor households because of hidden costs which are usually unaccounted in hospital costs. The main aim of this study was to estimate the hidden costs of hospital based delivery and determine the factors associated with the hidden costs. A hospital based cross-sectional study was conducted among 384 post-partum mothers with their husbands/house heads during the discharge time in Manipal Teaching Hospital and Western Regional Hospital, Pokhara, Nepal. A face to face interview with each respondent was conducted using a structured questionnaire. Hidden costs were calculated based on the price rate of the market during the time of the study. The total hidden costs for normal delivery and C-section delivery were 243.4 USD (US Dollar) and 321.6 USD respectively. Of the total maternity care expenditures; higher mean expenditures were found for food & drinking (53.07%), clothes (9.8%) and transport (7.3%). For postpartum women with their husband or house head, the total mean opportunity cost of "days of work loss" were 84.1 USD and 81.9 USD for normal delivery and C-section respectively. Factors such as literate mother (p = 0.007), employed house head (p = 0.011), monthly family income more than 25,000 NRs (Nepalese Rupees) (p = 0.014), private hospital as a place of delivery (p = 0.0001), C-section as a mode of delivery (p = 0.0001), longer duration (>5days) of stay in hospital (p = 0.0001), longer distance (>15km) from house to hospital (p = 0.0001) and longer travel time (>240 minutes) from house to hospital (p = 0.007) showed a significant association with the higher hidden costs (>25000 NRs). Experiences of hidden costs on hospital based delivery and opportunity costs of days of work loss were found high. Several socio-demographic factors, delivery related factors (place and mode of delivery, length of stay, distance from hospital and travel time) were associated with hidden costs. Hidden costs can be a

  13. Disaster content in Australian tertiary postgraduate emergency nursing courses: a survey.

    PubMed

    Ranse, Jamie; Shaban, Ramon Z; Considine, Julie; Hammad, Karen; Arbon, Paul; Mitchell, Belinda; Lenson, Shane

    2013-05-01

    Emergency nurses play a pivotal role in disaster relief during the response to, and recovery of both in-hospital and out-of-hospital disasters. Postgraduate education is important in preparing and enhancing emergency nurses' preparation for disaster nursing practice. The disaster nursing content of Australian tertiary postgraduate emergency nursing courses has not been compared across courses and the level of agreement about suitable content is not known. To explore and describe the disaster content in Australian tertiary postgraduate emergency nursing courses. A retrospective, exploratory and descriptive study of the disaster content of Australian tertiary postgraduate emergency nursing courses conducted in 2009. Course convenors from 12 universities were invited to participate in a single structured telephone survey. Data was analysed using descriptive statistics. Ten of the twelve course convenors from Australian tertiary postgraduate emergency nursing courses participated in this study. The content related to disasters was varied, both in terms of the topics covered and duration of disaster content. Seven of these courses included some content relating to disaster health, including types of disasters, hospital response, nurses' roles in disasters and triage. The management of the dead and dying, and practical application of disaster response skills featured in only one course. Three courses had learning objectives specific to disasters. The majority of courses had some disaster content but there were considerable differences in the content chosen for inclusion across courses. The incorporation of core competencies such as those from the International Council of Nurses and the World Health Organisation, may enhance content consistency in curriculum. Additionally, this content could be embedded within a proposed national education framework for disaster health. Copyright © 2013 College of Emergency Nursing Australasia Ltd. Published by Elsevier Ltd. All rights

  14. HIV counseling and testing in a tertiary care hospital in Ganjam district, Odisha, India.

    PubMed

    Dash, M; Padhi, S; Sahu, S; Mohanty, I; Panda, P; Parida, B; Sahoo, M K

    2013-01-01

    Human immunodeficiency virus (HIV) counseling and testing (HCT) conducted at integrated counseling and testing centers (ICTCs) is an entry point, cost-effective intervention in preventing transmission of HIV. To study the prevalence of HIV among ICTC attendees, sociodemographic characteristics, and risk behaviors of HIV-seropositive clients. It was hospital record-based cross-sectional study of 26,518 registered ICTC clients at a tertiary care hospital in Ganjam district, Odisha, India over a 4-year period from January 2009 to September 2012. A total of 1732 (7.5%) out of 22,897 who were tested for HIV were seropositive. Among HIV-seropositives, 1138 (65.7%) were males, while 594 (34.3%) were females. Majority (88.3%) of seropositives were between the age group of 15-49 years. Client-initiated HIV testing (12.1%) was more seropositive compared to provider-initiated (2.9%). Among discordant couples, majority (95.5%) were male partner/husband positive and female partner/wife negative. Positives were more amongst married, less educated, low socioeconomic status, and outmigrants (P<0.0001). Risk factors included heterosexual promiscuous (89.3%), parent-to-child transmission 5.8%, unknown 3.1%, infected blood transfusion 0.8%, homosexual 0.5%, and infected needles (0.5%). There is need to encourage activities that promote HCT in all health facilities. This will increase the diagnosis of new HIV cases. The data generated in ICTC provide an important clue to understand the epidemiology in a particular geographic region and local planning for care and treatment of those infected with HIV and preventive strategies for those at risk especially married, young adults, and outmigrants to reduce new infections.

  15. HBV and HIV co-infection: Prevalence and clinical outcomes in tertiary care hospital Malaysia.

    PubMed

    Akhtar, Ali; Khan, Amer Hayat; Sulaiman, Syed Azhar Syed; Soo, Chow Ting; Khan, Kashifullah

    2016-03-01

    According to WHO, Malaysia has been classified as a concentrated epidemic country due to progression of HIV infection in the population of injecting drug users. The main objectives of current study are to determine the prevalence of HBV among HIV-positive individuals in a tertiary care hospital of Malaysia and to assess the predictors involved in the outcomes of HIV-HBV co-infected patients. A retrospective, cross-sectional study is conducted at Hospital Palau Pinang, Malaysia. The collection of socio-demographic data as well as clinical data is done with the help of data collection form. Data were analyzed after putting the collected values of required data by using statistical software SPSS version 20.0 and P > 0.05 is considered as significant. Results show that the overall prevalence of HBV was 86 (13%) including 495 (74.5%) males and 169 (25.5%) females among a total of 664 HIV-infected patients. It was observed that there is a high prevalence of HIV-HBV co-infection in males 76 (11.4%) as compared to females 10 (1.5%) (P = 0.002). The median age of the study population was 39 years. The statistical significant risk factors involved in the outcomes of HIV-HBV co-infected patients were observed in the variables of gender, age groups, and injecting drug users. The findings of the present study shows that the prevalence of HBV infection among HIV-positive patients was 13% and the risk factors involved in the outcomes of HIV-HBV co-infected patients were gender, age, and intravenous drug users. © 2015 Wiley Periodicals, Inc.

  16. Surgical therapies for corneal perforations: 10 years of cases in a tertiary referral hospital

    PubMed Central

    Yokogawa, Hideaki; Kobayashi, Akira; Yamazaki, Natsuko; Masaki, Toshinori; Sugiyama, Kazuhisa

    2014-01-01

    Purpose To report surgical therapies for corneal perforations in a tertiary referral hospital. Methods Thirty-one eyes of 31 patients (aged 62.4±18.3 years) with surgically treated corneal perforations from January 2002 to July 2013 were included in this study. Demographic data such as cause of corneal perforation, surgical procedures, and visual outcomes were retrospectively analyzed. Results The causes of corneal perforation (n=31) were divided into infectious (n=8, 26%) and noninfectious (n=23, 74%) categories. Infectious causes included fungal ulcer, herpetic stromal necrotizing keratitis, and bacterial ulcer. The causes of noninfectious keratopathy included corneal melting after removal of a metal foreign body, severe dry eye, lagophthalmos, canaliculitis, the oral anticancer drug S-1, keratoconus, rheumatoid arthritis, neurotrophic ulcer, atopic keratoconjunctivitis, and unknown causes. Initial surgical procedures included central large corneal graft (n=17), small corneal graft (n=7), and amniotic membrane transplantation (n=7). In two cases the perforation could not be sealed during the first surgical treatment and required subsequent procedures. All infectious keratitis required central large penetrating keratoplasty to obtain anatomical cure. In contrast, several surgical options were used for the treatment of noninfectious keratitis. After surgical treatment, anatomical cure was obtained in all cases. Mean postoperative best corrected visual acuity was better at 6 months (logMAR 1.3) than preoperatively (logMAR 1.8). Conclusion Surgical therapies for corneal perforations in our hospital included central large lamellar/penetrating keratoplasty, small peripheral patch graft, and amniotic membrane transplantation. All treatments were effective. Corneal perforation due to the oral anticancer drug S-1 is newly reported. PMID:25378903

  17. Enabling student placement through strategic partnerships between a health-care organization and tertiary institutions.

    PubMed

    Henderson, Amanda; Heel, Alison; Twentyman, Michelle

    2007-01-01

    Nursing management needs to demonstrate its commitment to clinical education for undergraduate nursing students. The vision for the nursing leadership and management team at Princess Alexandra Hospital is to guide and support the development of hospital clinicians, at all levels in the organization, to effectively facilitate undergraduate students' learning during their clinical practical experiences. This paper examines the evolution of the meaning, commitment and practices that have been intrinsic to the development of strategic partnerships between the health-care organization and tertiary institutions to ensure that hospital staff who consistently facilitate student learning in the clinical context are well supported. The partnerships are based on open channels of communication between the health-care organization and the tertiary institutions whereby each party identifies its needs and priorities. This has resulted in increased hospital staff satisfaction through greater involvement by them in the placements of students, and enhanced understanding of clinicians of the student placement process that has contributed to improved satisfaction and outcomes for the students.

  18. Antibiotic Susceptibility Patterns of Bacterial Isolates from Pus Samples in a Tertiary Care Hospital of Punjab, India

    PubMed Central

    Trojan, Rugira; Razdan, Lovely

    2016-01-01

    We determined the prevalence and antibiotic susceptibilities patterns of bacterial isolates from pus samples collected from patients in a tertiary care hospital of Punjab, India. E. coli was the most prevalent pathogen (51.2%) followed by Staphylococcus aureus (21%), Klebsiella pneumoniae (11.6%), Pseudomonas aeruginosa (5.8%), Citrobacter spp. (3.5%), Acinetobacter baumannii (2.3%), Proteus mirabilis (2.3%), and Streptococcus spp. (2.3%). E. coli, K. pneumoniae, A. baumannii, and Citrobacter isolates were resistant to multiple antibiotics including higher generation cephalosporins. S. aureus and Streptococcus isolates were sensitive to cloxacillin and vancomycin. However, P. aeruginosa, P. mirabilis, and Streptococcus isolates were found to be less resistant to the spectrum of antibiotics tested. Overall, our findings indicate the prevalence of resistance to different classes of antibiotics in bacterial isolates from pus infections and hence highlight the need for effective surveillance, regulator reporting, and antibiogram-guided antibiotic prescription. PMID:27872643

  19. Antibiotic Susceptibility Patterns of Bacterial Isolates from Pus Samples in a Tertiary Care Hospital of Punjab, India.

    PubMed

    Trojan, Rugira; Razdan, Lovely; Singh, Nasib

    2016-01-01

    We determined the prevalence and antibiotic susceptibilities patterns of bacterial isolates from pus samples collected from patients in a tertiary care hospital of Punjab, India. E. coli was the most prevalent pathogen (51.2%) followed by Staphylococcus aureus (21%), Klebsiella pneumoniae (11.6%), Pseudomonas aeruginosa (5.8%), Citrobacte r spp. (3.5%), Acinetobacter baumannii (2.3%), Proteus mirabilis (2.3%), and Streptococcus spp. (2.3%). E. coli , K. pneumoniae , A. baumannii , and Citrobacter isolates were resistant to multiple antibiotics including higher generation cephalosporins. S. aureus and Streptococcus isolates were sensitive to cloxacillin and vancomycin. However, P. aeruginosa , P. mirabilis , and Streptococcus isolates were found to be less resistant to the spectrum of antibiotics tested. Overall, our findings indicate the prevalence of resistance to different classes of antibiotics in bacterial isolates from pus infections and hence highlight the need for effective surveillance, regulator reporting, and antibiogram-guided antibiotic prescription.

  20. "Talk What Others Think You Can't Talk": HIV/AIDS Clubs as Peer Education in Ugandan Schools

    ERIC Educational Resources Information Center

    Norton, Bonny; Mutonyi, Harriet

    2007-01-01

    In this article, we make the case that HIV/AIDS clubs in Ugandan schools provide valuable information to students who may not have easy access to health services. As one club motto suggests, the clubs "talk what others think you can't talk". The innovative peer education methods, which include drama, popular culture and community…

  1. Prevalence and risk factors of hepatitis D virus infection in patients with chronic hepatitis B infection attending the three main tertiary hospitals in Libya.

    PubMed

    Elzouki, Abdel-Naser; Bashir, Saleh M; Elahmer, Omar; Elzouki, Islam; Alkhattali, Fathi

    2017-12-01

    Globally, More than 350 million individuals are chronically infected with hepatitis B virus (HBV), and >20 million of them are co-infected with hepatitis D virus (HDV). The aim of this study was to determine the pattern of HDV infection in patients with chronic hepatitis B in three main tertiary hospitals in Tripoli and Benghazi, Libya. This cross sectional and descriptive study was conducted on 162 patients with chronic hepatitis B positive for more than six months) who were followed up at hepatitis clinics of the three main tertiary hospitals in Tripoli city (88 patients from Tripoli Medical Centre and Tripoli Central Hospital) and Benghazi city (74 patients from Aljomhoria Hospital) during the period from January 2010 to June 2012. HBV and HDV markers were detected by enzyme linked fluorescent assay (ELFA) or enzyme-linked immunosorbent assay and HBV-DNA was quantified by real-time PCR techniques. The mean age of patients was 36,92 ± 15,35. One hundred and three (63.6%) of them were males and 59 (36,4%) were females. Four patients (2,5%) were tested positive for anti-HD antibodies, all of them have had clinical and/or histological diagnosis of cirrhosis. In multivariable regression analysis, age (p = .04), elevation of serum ALT (p = .03), elevation of serum AST (p = .04), and presence of cirrhosis (p = .003) were significantly related to HDV seropositivity. Although the study demonstrated that Libya has low to moderate prevalence of HDV (2,5%), it is important for policy makers and health care providers to continue the preventive measures for HDV spread, and HBV prevention program including utilization of HBV vaccine. Furthermore, it is imperative to screen chronic HBV patients for HDV for close observation for early diagnosis of subsequent development of liver cirrhosis. Moreover, further epidemiologic and genetic studies are needed to explore the trend for HDV infection in Libya. Copyright © 2017 Pan-Arab Association of Gastroenterology

  2. Study of Incidence and Prevalence of Musculoskeletal Anomalies in a Tertiary Care Hospital of Eastern India

    PubMed Central

    Mohanty, Biswa Bhusan; Sarangi, Rachita; Kumar, Sanjay; Mahapatra, Susanta Kumar; Chinara, Prafulla Kumar

    2014-01-01

    Introduction: Congenital anomalies or malformations are anatomical. Structural or functional defects present at birth leads to physical and mental disabilities. With the advent of newer drugs, infectious diseases have taken the backseat and congenital defects have emerged as an important cause of neonatal morbidity and mortality. In India, anomalies of musculoskeletal system have been most commonly reported. Aims and Objectives: With this in view, the present study was carried out to find the incidence and types of musculoskeletal defects in a tertiary care hospital in Eastern India. Various maternal factors were also correlated and analyzed. The purpose of this communication is to report these defects so as to help doctors and parents to prevent unexpected fetal loss and better parental counseling. Materials and Methods: This study was done in the Department of Obstetrics and Gynaecology in association with Department of Paediatrics of a tertiary care hospital in Odisha from for a period of 1 year. The newborns were examined within 1st three days of delivery for congenital malformations. The study group included all live borns along with still borns after 28 weeks of gestation or those dead babies whose weight was about 1kg. A thorough physical examination from head to toe was done to look for musculoskeletal defects within 24hrs of delivery. Observation and Results: Out of total 7268 babies delivered, 116 babies were found to have anomalies. Thirty two of these had musculoskeletal defects. Talipes equinovarus was the commonest anomaly observed followed by polydactyly. The ratio of male babies with musculoskeletal defects to female babies was found to be 1.28:1.The malformed babies were mainly born to term mothers (77.6%), who were mostly unbooked (62.5%) and belonged to lower or middle class. But no significant relationship could be established between these factors and defects. Most mothers were in the age group of 20-35 years and there was no history of drug

  3. Does the physician order-entry system increase the revenue of a general hospital?

    PubMed

    Park, Woong-Sub; Kim, Joon S; Chae, Young Moon; Yu, Seung-Hum; Kim, Chang-Yup; Kim, Sang-A; Jung, Sang Hyuk

    2003-08-01

    The purpose of this study was to examine whether the physician order-entry system (POE) could increase the outpatient and inpatient revenue of hospitals. We analyzed the inpatient and outpatient revenue data of all general hospitals (212) in South Korea obtained from the Korean National Health Insurance Corporation (KNHIC) during the period from 1996 to 1999 using the mixed model for repeated measure data. Analysis of the 4-years' panel data showed that both outpatient and inpatient revenues increased significantly after POE introduction. The hospital characteristics significantly influencing inpatient revenue were the number of beds, number of physicians and the tertiary status of a hospital; whereas those for outpatient revenue were the number of beds, number of physicians, the private status of a hospital, the tertiary status of a hospital and the urban status of a hospital. The revenues from both outpatients and inpatients were found to be increased after the introduction of the POE, while controlling for population size, competition, income, hospital location, hospital size, tertiary status and public status.

  4. Priority setting in developing countries health care institutions: the case of a Ugandan hospital

    PubMed Central

    Kapiriri, Lydia; Martin, Douglas K

    2006-01-01

    Background Because the demand for health services outstrips the available resources, priority setting is one of the most difficult issues faced by health policy makers, particularly those in developing countries. However, there is lack of literature that describes and evaluates priority setting in these contexts. The objective of this paper is to describe priority setting in a teaching hospital in Uganda and evaluate the description against an ethical framework for fair priority setting processes – Accountability for Reasonableness. Methods A case study in a 1,500 bed national referral hospital receiving 1,320 out patients per day and an average budget of US$ 13.5 million per year. We reviewed documents and carried out 70 in-depth interviews (14 health planners, 40 doctors, and 16 nurses working at the hospital). Interviews were recorded and transcribed. Data analysis employed the modified thematic approach to describe priority setting, and the description was evaluated using the four conditions of Accountability for Reasonableness: relevance, publicity, revisions and enforcement. Results Senior managers, guided by the hospital strategic plan make the hospital budget allocation decisions. Frontline practitioners expressed lack of knowledge of the process. Relevance: Priority is given according to a cluster of factors including need, emergencies and patient volume. However, surgical departments and departments whose leaders "make a lot of noise" are also prioritized. Publicity: Decisions, but not reasons, are publicized through general meetings and circulars, but this information does not always reach the frontline practitioners. Publicity to the general public was through ad hoc radio programs and to patients who directly ask. Revisions: There were no formal mechanisms for challenging the reasoning. Enforcement: There were no mechanisms to ensure adherence to the four conditions of a fair process. Conclusion Priority setting decisions at this hospital do not

  5. Clinicodemographic Profile of Children with Seizures in a Tertiary Care Hospital: A Cross-Sectional Observational Study.

    PubMed

    Chaudhary, Nagendra; Gupta, Murli Manohar; Shrestha, Sandeep; Pathak, Santosh; Kurmi, Om Prakash; Bhatia, B D; Agarwal, K N

    2017-01-01

    Seizures are one of the common causes for hospital admissions in children with significant mortality and morbidity. This study was conducted to study the prevalence and clinicodemographic profile of children with seizures in a tertiary care hospital of western Nepal. This prospective cross-sectional study conducted over a period of 2 years included all admitted children (2 months-16 years) with seizures. Among 4962 admitted children, seizures were present in 3.4% ( n = 168) of children, with male preponderance. 138 (82.1%) children had generalized tonic-clonic seizures (GTCS) and 30 (17.9%) children had partial seizures. GTCS were more common than partial seizures in both sexes (male = 82.7%; female = 81.2%) and age groups. There was no statistical significance in the distribution of seizures (GTCS and partial seizures) with sexes ( P = 0.813) and age groups ( P = 0.955). Mean ages of children having GTCS and partial seizures were 8.2 ± 4.6 years and 8.2 ± 4.2 years, respectively. Loss of consciousness (55.4%), fever (39.9%), vomiting (35.1%), and headache (16.1%) were common complaints in seizure patients. Significant number of GTCS cases had fever ( P = 0.041) and neurocysticercosis ( n = 72; 43%) was the most common etiology in seizure patients. Idiopathic epilepsy (38 (22.6%)), meningoencephalitis (26 (15.5%)), and febrile convulsions (14 (8.33%)) were other leading disorders in children with seizures.

  6. Mental health consumers' with medical co‐morbidity experience of the transition through tertiary medical services to primary care

    PubMed Central

    Cranwell, Kate; Polacsek, Meg

    2016-01-01

    Abstract Medical comorbidity in people with long‐term mental illness is common and often undetected; however, these consumers frequently experience problems accessing and receiving appropriate treatment in public health‐care services. The aim of the present study was to understand the lived experience of mental health consumers with medical comorbidity and their carers transitioning through tertiary medical to primary care services. An interpretative, phenomenological analysis approach was used, and semistructured, video‐recorded, qualitative interviews were used with 12 consumers and four primary caregivers. Four main themes and related subthemes were abstracted from the data, highlighting consumer's and carers’ experience of transition through tertiary medical to primary care services: (i) accessing tertiary services is difficult and time consuming; (ii) contrasting experiences of clinician engagement and support; (iii) lack of continuity between tertiary medical and primary care services; and (iv) Mental Health Hospital Admission Reduction Programme (MH HARP) clinicians facilitating transition. Our findings have implications for organisational change, expanding the role of MH HARP clinicians (whose primary role is to provide consumers with intensive support and care coordination to prevent avoidable tertiary medical hospital use), and the employment of consumer and carer consultants in tertiary medical settings, especially emergency departments. PMID:26735771

  7. Microsatellite Instability Occurs Rarely in Patients with Cholangiocarcinoma: A Retrospective Study from a German Tertiary Care Hospital.

    PubMed

    Winkelmann, Ria; Schneider, Markus; Hartmann, Sylvia; Schnitzbauer, Andreas A; Zeuzem, Stefan; Peveling-Oberhag, Jan; Hansmann, Martin Leo; Walter, Dirk

    2018-05-09

    Immune-modulating therapy is a promising therapy for patients with cholangiocarcinoma (CCA). Microsatellite instability (MSI) might be a favorable predictor for treatment response, but comprehensive data on the prevalence of MSI in CCA are missing. The aim of the current study was to determine the prevalence of MSI in a German tertiary care hospital. Formalin-fixed paraffin-embedded tissue samples, obtained in the study period from 2007 to 2015 from patients with CCA undergoing surgical resection with curative intention at Johann Wolfgang Goethe University hospital, were examined. All samples were investigated immunohistochemically for the presence of MSI (expression of MLH1, PMS2, MSH2, and MSH6) as well as by pentaplex polymerase chain reaction for five quasimonomorphic mononucleotide repeats ( BAT-25 , BAT-26 , NR-21 , NR-22 , and NR-24 ). In total, 102 patients were included, presenting intrahepatic ( n = 35, 34.3%), perihilar ( n = 42, 41.2%), and distal CCA ( n = 25, 24.5%). In the immunohistochemical analysis, no loss of expression of DNA repair enzymes was observed. In the PCR-based analysis, one out of 102 patients was found to be MSI-high and one out of 102 was found to be MSI-low. Thus, MSI seems to appear rarely in CCA in Germany. This should be considered when planning immune-modulating therapy trials for patients with CCA.

  8. Complications of external cephalic version: a retrospective analysis of 1121 patients at a tertiary hospital in Sydney.

    PubMed

    Rodgers, R; Beik, N; Nassar, N; Brito, I; de Vries, B

    2017-04-01

    To report the complication rate associated with external cephalic version (ECV) at term. Single-centre retrospective study. A major tertiary hospital in Sydney, Australia. All women who underwent an ECV at Royal Prince Alfred Hospital from 1995-2013 were included. ECV was attempted on all consenting women with a breech presentation at term in the absence of contraindications. Complications were classified as minor (transient cardiotocography abnormalities, ruptured membranes, small antepartum haemorrhage) or serious (fetal death, placental abruption, fetal distress requiring emergency caesarean section, fetal bone injury, cord prolapse). ECV success rates and rate of reversion to breech were recorded. The primary outcome was the incidence of serious complications. Secondary outcome measures were the rate of minor complications and reversion to breech. Of 1121 patients that underwent ECV, five (0.45%) experienced a serious complication. There was one placental abruption, one emergency caesarean section for fetal distress and two cord prolapses. There was one fetal death attributable to a successful ECV. Forty-eight women (4.28%) experienced a minor complication. Reversion to the breech occurred in sixteen patients (3.32%). ECV at term is associated with a low rate of serious complications. Study of 1121 consecutive ECV attempts shows low rate of complications although one fetal death reported. © 2016 Royal College of Obstetricians and Gynaecologists.

  9. Current Trends of Using Antimicrobial Drugs in the ICU at a Tertiary Level Teaching Hospital in Mymensingh.

    PubMed

    Saha, S K; Shaha, K C; Haque, M F; Khatun, S; Akhter, S M; Akhter, H

    2016-10-01

    The aim of the present study was to investigate the current trends of using antimicrobial drugs in the ICU at a tertiary level teaching hospital in Mymensingh. The study of prescribing patterns seeks to monitor, evaluate and suggest modifications in clinicians prescribing habits so as to make medical care rational. It was an observational type of descriptive study, conducted in the Mymensingh medical college hospital, Mymensingh, during the study period of June 2016 to September 2016.The study was approved by the institutional ethical committee. Most patients in the ICU belonged to the older age group >60 years. Male patients were more than the female patients in ICU. Average duration of stay in ICU was 4.35 days. Admissions in ICU were common due to respiratory system related diseases and the present study showed that 31.68% of the reported cases belong to the respiratory system. Average number of drugs per prescription was 6.46. Average number of anti-microbial drugs per prescription was 1.38. Cephalosporin group and individually ceftriaxone was the most frequently prescribed antimicrobial group and agent respectively in the ICU. Most commonly used antimicrobial combination was Cephalosporin and Metronidazole (43.33%) followed by Carbapenem (Meropenem) and Metronidazole (13.33%). Most antimicrobial agents were prescribed without bacteriological culture and sensivity testing evidence. There is a need for motivating the physicians to prescribe antimicrobial agents with supportive bacteriological evidences.

  10. The common causes leading to pancytopenia in patients presenting to tertiary care hospital

    PubMed Central

    Das Makheja, Kirpal; Kumar Maheshwari, Bharat; Arain, Shafique; Kumar, Suneel; Kumari, Sangeeta; Vikash

    2013-01-01

    Objective: The objective of this study was to determine the frequency of common causes leading to Pancytopenia in patients presenting to tertiary care hospital at Karachi. Methods: A total of 62 patients with the diagnosis of Pancytopenia of more than one week duration were enrolled in the study. All patients underwent a detailed medical history and full physical examination followed by blood sampling for the investigations i.e. complete blood count with peripheral film, erythrocyte sedimentation rate (ESR), Malarial parasites (MP), liver function test, Renal function tests, PT and viral profile (HBsAg, Anti-HCV), Ultrasonography of abdomen. All patients underwent bone marrow aspiration and trephine biopsy for reporting and interpretation. Duration of study was six months, from May 2010 to November 2010. Results: The average age of the patients was 37.76 ± 16.38years. Out of 62 patients, 36 (58%) were male and 26 (42%) were female. Megaloblastic anemia was the commonest cause that was observed in 41.9% cases followed by acute myeloid leukemia 27.4%, aplastic anemia 19.4% and erythroid hyperplasia 11.3%. Conclusion : This study concluded that most common cause of pancytopenia is Megaloblastic anemia, followed by acute myeloid leukemia and aplastic anemia. Bone marrow examination is a single useful investigation which reveals the underlying cause in patients with pancytopenia. PMID:24353701

  11. Incidence and risk factors of ventilator associated pneumonia in a tertiary care hospital.

    PubMed

    Charles, Mv Pravin; Easow, Joshy M; Joseph, Noyal M; Ravishankar, M; Kumar, Shailesh; Umadevi, Sivaraman

    2013-01-01

    Ventilator associated pneumonia (VAP) is a type of nosocomial pneumonia associated with increased morbidity and mortality. Knowledge about the incidence and risk factors is necessary to implement preventive measures to reduce mortality in these patients. A prospective study was conducted at a tertiary care teaching hospital for a period of 20 months from November 2009 to July 2011. Patients who were on mechanical ventilation (MV) for more than 48 hours were monitored at frequent intervals for development of VAP using clinical and microbiological criteria until discharge or death. Of the 76 patients, 18 (23.7%) developed VAP during their ICU stay. The incidence of VAP was 53.25 per 1,000 ventilator days. About 94% of VAP cases occurred within the first week of MV. Early-onset and late-onset VAP was observed in 72.2% and 27.8%, respectively. Univariate analysis showed chronic lung failure, H2 blockers usage, and supine head position were significant risk factors for VAP. Logistic regression revealed supine head position as an independent risk factor for VAP. VAP occurred in a sizeable number of patients on MV. Chronic lung failure, H2 blockers usage, and supine head position were the risk factors associated with VAP. Awareness about these risk factors can be used to inform simple and effective preventive measures.

  12. Auditing surgical service provision at a South African tertiary institution: Implications for the development of district services.

    PubMed

    Laing, G L; Skinner, D L; Bruce, J L; Aldous, C; Govindasamy, V; Thomson, S R; Clarke, D L

    2017-11-01

    The optimal management of resources within South African state hospitals has been hampered by a paucity of data due to a lack of robust auditing information systems. This study reviews the use of a Hybrid Electronic Medical Record (HEMR) system to capture and aggregate data pertaining to the inpatient service demands on a South African tertiary surgical service. This dataset was used to analyse the appropriateness of tertiary surgical resource utilisation. The HEMR system was implemented at Greys Hospital, in the city of Pietermaritzburg, Kwa-Zulu Natal, South Africa on 1 January 2013. Inpatient data pertaining to surgical admissions and operative interventions were captured prospectively. Following an 18-month study period, the data were extracted, aggregated and analysed. The district referral hospitals were mapped, and district surgical procedures performed within the tertiary center were identified and quantified. Results: 7314 patients were admitted and managed by the tertiary surgical service during the study period. The median patient age was 33 years (IQR 6.5-42.4 years). 59.7% were male and 40.3% were female. General, trauma and paediatric surgical admissions constituted 54.8%, 28.6% and 16.6% respectively. Emergency admissions constituted 62.4% and elective admissions 37.6%. Referral sources were captured for 6653 (91%) of the cohort. 4338 (65.2%) patients were referred from district hospitals. The district hospital (Northdale) closest to Greys Hospital was responsible for 1675 (25.2%) of surgical referrals. 4174 operative procedures were performed during the study period, 54.7% performed as an emergency, 34.1% electively and 11.2% semi-electively. The median waiting time for emergency operative intervention was 535 minutes (IQR 130-663). A total of 1272 (30.5%) operative procedures performed were assessed as district-level operations. The time intervals of 07:00-07:59 and 17:00-17:59 were identified as the time periods during which the least number of

  13. Antimicrobial resistance pattern in a tertiary care hospital: An observational study

    PubMed Central

    Saravanan, Revathy; Raveendaran, Vinod

    2013-01-01

    Context: The number of organisms developing resistance to commonly used antibiotics is increasing among the various generations. The exact national scenario of antimicrobial resistance (AMR) is not known in India owing to the absence of a central monitoring agency. Aims: The aim of this study is to identify the group of organisms developing resistance, to know the classes of drugs against, which resistance has emerged and to assess the possible factors that can favor the development of AMR so that antibiotic policy can be formulated for the proper and effective use of antibiotics. Settings and Design: An observational study was conducted for a period of 1 year from August 2011 to July 2012 in a tertiary care hospital in Pondicherry. Subjects and Methods: Data regarding culture and sensitivity of the organisms isolated from different sources such as urine, blood, wound swab/pus, stool, sputum and tracheal aspirations were collected from the records of the Microbiology Department. Sample processing, identification of organisms to the genus and/or species level and antimicrobial sensitivity were carried out as per the Clinical and Laboratory Standards Institute guidelines on the 999 samples received. Results: Out of 999 samples, 125 (12.5%) showed significant growth of organisms exhibiting resistance to either single or multiple drugs. Out of 84 (67.2%) in-patients and 41 (32.8%) out-patient samples, Escherichia was the most common organism isolated with a total of 41 (32.8%), followed by Methicillin sensitive Staphylococcus aureus, 26 (20.8%), Klebsiella 25 (20%), Methicillin resistant Staphylococcus aureus 17 (13.6%), Pseudomonas 10 (8%), Proteus 2 (1.6%), 1 (0.8%) each of Citrobacter and Enterococci. Maximum resistance was observed with commonly used first line antimicrobials such as co-trimoxazole, ampicillin, amoxicillin, amoxyclav, fluoroquinolones, third generation cephalosporins and nalidixic acid. Least resistant or highly sensitive were amikacin

  14. Quality of Care of Hospitalized Infective Endocarditis Patients: Report from a Tertiary Medical Center.

    PubMed

    Kashef, Mohammad Amin; Friderici, Jennifer; Hernandez-Montfort, Jaime; Atreya, Auras R; Lindenauer, Peter; Lagu, Tara

    2017-06-01

    There have been no recent studies describing the management and outcomes of patients with infective endocarditis (IE). We conducted a retrospective cohort study of adult patients admitted to a tertiary medical center from 2007 to 2011 with a Duke criteria consistent discharge diagnosis of IE. We examined concordance with guideline recommendations. Outcomes included embolic events, inhospital and 1-year mortality, length of stay (LOS) and cardiac surgery. We used descriptive statistics to describe the cohort and Fisher exact and unpaired t tests to compare native valve endocarditis (NVE) with prosthetic valve endocarditis (PVE). Of 170 patients, definite IE was present in 135 (79.4%) and possible IE in 35 (20.6%); 74.7% had NVE, and 25.3% had PVE. Mean ± standard deviation age was 60.0 ± 17.9 years. Comparing PVE to NVE, patients with PVE were less likely to have embolic events (14.0% vs. 32.3%; P = 0.03), had shorter LOS (median 12.0 days vs. 14.0 days; P = 0.047), but they did not show a statistically significant difference in inhospital mortality (20.9% vs. 12.6%; P = 0.21). Of 170, patients 27.6% (n = 47) underwent valve surgery. Most patients received timely blood cultures and antibiotics. Guideline-recommended consults were underused, with 86.5%, 54.1%, and 47.1% of patients receiving infectious disease, cardiac surgery, and cardiology consultation, respectively. As the number of consultations increased (from 0 to 3), we observed a nonsignificant trend toward reduction in 6-month readmission and 12-month mortality. IE remains a disease with significant morbidity and mortality. There are gaps in the care of IE patients, most notably underuse of specialty consultation. Journal of Hospital Medicine 2017;12:414-420. © 2017 Society of Hospital Medicine

  15. Initial outcomes of provider-initiated routine HIV testing and counseling during outpatient care at a rural Ugandan hospital: risky sexual behavior, partner HIV testing, disclosure, and HIV care seeking.

    PubMed

    Kiene, Susan M; Bateganya, Moses; Wanyenze, Rhoda; Lule, Haruna; Nantaba, Harriet; Stein, Michael D

    2010-02-01

    Provider-initiated routine HIV testing is being scaled up throughout the world, however, little is known about the outcomes of routine HIV testing on subsequent behavior. This study examined the initial outcomes of provider-initiated routine HIV testing at a rural Ugandan hospital regarding partner HIV testing, sexual risk behavior, disclosure, and HIV care seeking. In a prospective cohort study, 245 outpatients receiving routine HIV testing completed baseline and 3-month follow-up interviews. After receiving routine HIV testing the percentage of participants engaging in risky sex decreased from 70.1% to 50.3% among HIV-negative and from 75.0% to 53.5% among HIV-positive participants, the percentage knowing their partner(s)' HIV status increased from 18.7% to 34.3% of HIV-negative and from 14.3% to 35.7% of HIV-positive participants. Among those reporting risky sex at baseline, HIV-positive participants were more likely to eliminate risky sex in general and specifically to become abstinent at follow-up than were HIV-negative participants. Similarly, unmarried participants who were risky at baseline were more likely to become safe in general, become abstinent, and start 100% condom use than were married/cohabitating participants. Rates of disclosure were high. Over 85% of those who tested HIV positive enrolled in care. Routine HIV testing in this setting may promote earlier HIV diagnosis and access to care but leads to only modest reductions in risky sexual behavior. To fully realize the potential HIV prevention benefits of routine HIV testing an emphasis on tailored risk-reduction counseling may be necessary.

  16. A qualitative study into the impact of fasting within a large tertiary hospital in Australia--the patients' perspective.

    PubMed

    Carey, Sharon K; Conchin, Simone; Bloomfield-Stone, Susan

    2015-07-01

    This qualitative study aims to explore the physical and emotional impact of fasting from the patients' perspective. Fasting patients in hospital is common practice and generally viewed as necessary for symptom management or for safety of healthcare provision. Negative impacts of repeated or prolonged fasting on nutritional status have been well researched, but little is documented as to how fasting impacts an individual patient's psyche. Qualitative descriptive design within a tertiary hospital in Sydney, Australia. Twelve patients having had prolonged periods of continuous or intermittent fasting were invited to participate in a semi-structured interview between January-September 2012. Questions for interview explored each patient's experience of fasting, including physical and emotional impacts, interpretation of communication regarding fasting and the process of recommencing on fluids or foods. An inductive thematic analysis approach was used. Analyses showed six main themes: physical impacts; emotional impacts; food as structure; nil by mouth as jargon; fear of food re-introduction; and dissatisfaction regarding unnecessary fasting. Overwhelmingly, thirst was reported as the worst physical effect of fasting. In the first few days of fasting, patients became emotionally fixated on food. This quickly dissipated leading to a lack of appetite and fear of starting to eat again. Discomfort experienced by patients coupled with lack of appetite resulting from prolonged fasting and difficulty with food re-introduction strengthens the argument for reducing fasting times in hospital. When patients are fasted, proper hydration and establishing alternate routes of medication administration should be a priority. It is well recognised that fasting for prolonged periods is detrimental to health outcomes, but this study also shows the distress that fasting can cause. Inadequate hospital systems and out-dated practices need to be replaced with evidence-based, patient

  17. Acute Febrile Illness Surveillance in a Tertiary Hospital Emergency Department: Comparison of Influenza and Dengue Virus Infections

    PubMed Central

    Lorenzi, Olga D.; Gregory, Christopher J.; Santiago, Luis Manuel; Acosta, Héctor; Galarza, Ivonne E.; Hunsperger, Elizabeth; Muñoz, Jorge; Bui, Duy M.; Oberste, M. Steven; Peñaranda, Silvia; García-Gubern, Carlos; Tomashek, Kay M.

    2013-01-01

    In 2009, an increased proportion of suspected dengue cases reported to the surveillance system in Puerto Rico were laboratory negative. As a result, enhanced acute febrile illness (AFI) surveillance was initiated in a tertiary care hospital. Patients with fever of unknown origin for 2–7 days duration were tested for Leptospira, enteroviruses, influenza, and dengue virus. Among the 284 enrolled patients, 31 dengue, 136 influenza, and 3 enterovirus cases were confirmed. Nearly half (48%) of the confirmed dengue cases met clinical criteria for influenza. Dengue patients were more likely than influenza patients to have hemorrhage (81% versus 26%), rash (39% versus 9%), and a positive tourniquet test (52% versus 18%). Mean platelet and white blood cell count were lower among dengue patients. Clinical diagnosis can be particularly difficult when outbreaks of other AFI occur during dengue season. A complete blood count and tourniquet test may be useful to differentiate dengue from other AFIs. PMID:23382160

  18. Use of smoke-less tobacco amongst the staff of tertiary care hospitals in the largest city of Pakistan.

    PubMed

    Valliani, Arif; Ahmed, Bilawal; Nanji, Kashmira; Valliani, Salimah; Zulfiqar, Beenish; Fakih, Misbah; Mehdi, Mehwish; Khan, Anam; Sheikh, Sana Arshad; Fatima, Nida; Ahmad, Sobia; Farah, Fariya; Saleem, Shaheera; Ather, Sana; Majid, Syed Khubaib; Hashmi, Syed Salman; Arjan, Sunil

    2012-01-01

    Use of smoke-less tobacco (SLT) is very common in South and South-East Asian countries. It is significantly associated with various types of cancers. The objectives of this study were to assess the proportion of hospital staff that use SLT, and to identify the factors associated with its use and their practices. In a cross-sectional study, 560 staff of two tertiary care hospitals were interviewed in the year 2009. Nurses, ward boys and technicians were counted as a paramedic staff while drivers, peons, security guards and housekeeping staff were labeled as non-paramedic staff. SLT use was considered as usage of any of the following: betel quid (paan) with or without tobacco, betel nuts with or without tobacco (gutkha) and snuff (naswar). About half (48.6%) of the hospital staff were using at least one type of SLT. Factors found to be statistically significant with SLT were being a male (OR=2.5; 95% CI=1.8-3.7); having no/fewer years of education (OR=1.7; 95% CI=1.2-2.4) and working as non-paramedic staff (OR=2.6; 95% CI=1.8-3.8). Majority of SLT users were using it on regular basis, for >5 years and keeping the tobacco products in the oral cavity for >30 minutes. About half of the users started due to peer pressure and had tried to quit this habit but failed. In this study, about half of the study participants were using SLT in different forms. We suggest educational and behavioral interventions for control of SLT usage.

  19. Effectiveness of an intervention package on knowledge, attitude, and practices of food handlers in a tertiary care hospital of north India: A before and after comparison study.

    PubMed

    Dudeja, Puja; Singh, Amarjeet; Sahni, Nancy; Kaur, Sukhpal; Goel, Sonu

    2017-01-01

    Food-borne illnesses have been a recognized hazard for decades. Recent promulgation of Food Safety and Standards Act (FSSA), 2006, indicates the concern of our Govt. for food safety. Research on effectiveness of food safety interventions in our country is remarkably scarce. Hence, the present study was conducted in a tertiary care hospital of north India to create evidence-based results for food safety interventions. The study was before and after intervention trial which was registered with CTRI. Data collection was paperless using a software. All food handlers ( n  = 280) working inside the hospital were recruited. Intervention package comprised Self-Instructional Manual in Hindi for food handlers, short film for sensitization of food handlers on food safety titled 'Gravy Extra', and a documentary titled 'Food Safety from farm to Fork'. Chi square test, paired t test, and Wilcoxon sign rank test were used. The mean age of food handlers was 35 ± 2 years. Majority (61.7%) of food handlers were educated less than 10th standard. Nearly 60% of them had up to five years of experience. At base line majority (68.9%) had a fair knowledge about food safety issues. There was a significant improvement in food safety knowledge and practice score of food handlers after the intervention ( p  < 0.05). Their attitude toward food safety changed in a positive direction ( p  < 0.05). The intervention package was useful in improving the knowledge, creating a positive attitude and enhancing the food safety practices of food handlers working inside a tertiary care hospital.

  20. Culture, Context and Stereotype Threat: A Comparative Analysis of Young Ugandan Women in Coed and Single-Sex Schools

    ERIC Educational Resources Information Center

    Picho, Katherine; Stephens, Jason M.

    2012-01-01

    Stereotype threat (ST) has been linked to under performance and academic disidentification among girls in mathematics and science as well as African Americans in academics. However, it is still unclear whether ST and its negative effects extend to non-Western cultures. The authors explored the effects of ST on Ugandan females in coed and…

  1. A descriptive study on evaluation of bio-medical waste management in a tertiary care public hospital of North India

    PubMed Central

    2014-01-01

    Background Proper management of Biomedical waste (BMW) generated in a healthcare facility is one of the most important functions of a healthcare worker (HCW) as its improper management not only poses risk to human beings and environment, but may also invite legal action against HCW as well as hospital administration. This study was carried out to evaluate quality of BMW management in 1100-bedded hospital attached to a tertiary care public institute in North India. Methods A checklist, including 29 parameters related to various functions to be carried out at source of generation by a HCW for BMW management was prepared by researcher and used after validation to record observations in all the 70 areas of hospital. A total of 6 visits were made to each area and mean percentage score was calculated for each area and each category of waste management. Results It was found that summated mean percentage score of ‘Treatment Room of Wards’, which were used exclusively by resident doctors, was significantly lower than Operation Theatres (p value: 0.033) and ‘Central Waste Collection Points of Wards’ (p value: 0.018) for the function of ‘mutilation of recyclable waste’ and it was significantly lower than all other areas (p value: 0.006 to 0.017) for the function of ‘disinfection of waste’. Conclusion It is concluded that more emphasis needs to be laid on ‘mutilation of recyclable waste’ and disinfection of waste’ by HCWs especially resident doctors. PMID:24742274

  2. [Changes in the demand for paediatric neurology care in a spanish tertiary care hospital over a 20-year period].

    PubMed

    Monge Galindo, L; López-Pisón, J; Samper Villagrasa, P; Peña Segura, J L

    2014-01-01

    The purpose of this study is to determine the profile of the demand for paediatric neurology care in a Spanish tertiary hospital over the past 20 years. We studied epidemiological data, reasons for consultation, diagnoses and complementary tests from all patients examined by our Paediatric Neurology Unit in its 20 years of service (from May 1990 to March 2010). We also reviewed data from patients whose first visit took place within the last five years (2005-2010) and compared them to data obtained from a prior study carried out in this Unit from 1990 to 1995. To compare the first 5 years (group 1) with the last 5 years (group 2), we calculated confidence intervals, P<.05, for the frequency distribution (%) in each category. Main reasons for consultation and principal diagnoses for the 12726 patients evaluated in the 20-year period, as well as results from group 1 (2046 patients) and group 2 (4488 patients) corresponding to first and the last 5 years of activity respectively, are presented with their confidence intervals in a series of tables. Variations in the reasons for consultation, diagnoses and complementary tests over time reflect changes determined by medical, scientific and social progress, and organisational changes specific to each hospital. This explains the difficulty of comparing different patient series studied consecutively, which are even more pronounced between different hospitals. Copyright © 2012 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.

  3. Early Detection of Chronic Obstructive Pulmonary Disease in Apparently Healthy Attendants of Tertiary Care Hospital and Assessment of its Severity.

    PubMed

    Zubair, Tahira; Abbassi, Amanullah; Khan, Osama Ahsan

    2017-05-01

    Early detection of Chronic Obstructive Pulmonary Disease in apparently healthy attendants of tertiary care hospital and assessment of its severity. Cross-sectional, observational study. Study was conducted from January 2015 to July 2015 at Dow University Hospital, Ojha campus. Ascreening method was designed for apparently healthy individuals including attendants of patients, hospital staff, faculty and students, belonging to age group 18-60 years after excluding severe obesity and already diagnosed respiratory and cardiovascular diseases by means of history. Each participant performed pulmonary function tests via spirometer after filling a questionnaire based on various risk factors and symptoms of chronic obstructive pulmonary disease (COPD). Data was entered and analysed by SPSS-20. Out of the 517 participants, 122 (23.6%) were found to have COPD diagnosed by means of spirometry. Out of these, 23 (4.4%) had COPD stage I, 42 (8.1%) had COPD II, 34 (6.6%) had COPD III, and 23 (4.4%) had COPD IV. Exposure to smoking, wooden stoves, pesticides, biomass fuel, aerosol sprays, gas grill and vehicle exhaust were found to be statistically significant factors in relation to development of COPD. Apparently healthy individuals may have underlying COPD and active screening by means of spirometry plays vital role in early detection of COPD. Smoking and exposure to certain hazardous environmental pollutants are responsible for the development and progression of COPD.

  4. Factors Affecting Compliance to Antihypertensive Treatment among Adults in a Tertiary Care Hospital in Mumbai.

    PubMed

    Shah, Ayushi Jayesh; Singh, Vijaykumar; Patil, Subita P; Gadkari, Mithila R; Ramchandani, Varun; Doshi, Karan Janak

    2018-01-01

    Compliance to antihypertensive therapy reduces the risk of complications. It is important to understand the factors affecting compliance in patients so that the goal of successful treatment is not jeopardized. To determine the proportion of participants' compliant to treatment and various factors associated with compliance of antihypertensive treatment. A cross-sectional study of 330 hypertensive patients on treatment attending the outpatient department of a tertiary care hospital in Mumbai. It was conducted over 8 weeks using a validated, pretested questionnaire including information on the individual's sociodemographic profile, compliance to antihypertensive therapy and lifestyle advice assessed using a 4-point Likert scale. Data were entered into MS Excel 2007 and analyzed using SPSS 20. Participants' mean age was 55.2 ± 12.6 years. 39.4% were compliant to their treatment. Common reasons for frequently skipping the dose - forgetfulness (41.2%) and discontinued the medication when feeling well (30.3%). Factors positively associated with compliance were gender and illiteracy. The proportion of noncompliance among smokers and alcoholics was statistically significant. Forgetfulness and subjective feeling of wellness were the prevalent reasons for noncompliance. Controlling habits such as smoking and alcohol may prove as key factors for compliance.

  5. Inpatient satisfaction and usage patterns of personalized smart bedside station system for patient-centered service at a tertiary university hospital.

    PubMed

    Ryu, Borim; Kim, Seok; Lee, Kee-Hyuck; Hwang, Hee; Yoo, Sooyoung

    2016-11-01

    Bedside stations, also known as bedside terminals, are in place to enhance the quality and experience of a hospital's healthcare service delivery. The purpose of this study was to identify information needs and overall satisfaction with the personalized patient bedside system, called Smart Bedside Station (SBS) system, embedded in a tertiary general university hospital. End-user responses on the satisfaction survey and system usage logs of the SBS system were collected and analyzed. For the user opinion survey, 156 nurses and 1914 patients, their family members, or caregivers participated during the evaluation period of 2013 to 2014 in this study. All working nurses in the SBS-installed ward were answered the paper-based evaluation, for complete enumeration survey. Inpatients were voluntary participated to deliver the online questionnaire on the SBS menu. We also explored system log data including page calls and usage time from December 2013 to 2015. Regarding the relationship of overall satisfaction of the SBS with patient's characteristics, patient's education status and degree of familiarity with the smart device were statistically significant. From the analysis of system logs, Personalized My Menu(28.0%) was the most frequently used menu item (except for TV and Internet entertainment service use of 62.7%),it provides individual health information, such as laboratory test results, hospital fee check, message logs, daily medication information, and meal information. Next frequently used menus were information support(4.9%) which deliver hospital guide and health information and convenience service ordering(4.4%) such as meal order, bed sheet change. Satisfaction survey results and log data results show that the personalized service enhances the user satisfaction during hospital admission. Our post-implementation experience and subsequent assessment of SBS system is capable of providing insights into improving the hospital information system and service contents

  6. Interactional aspects of care during hospitalization: perspectives of family caregivers of psychiatrically ill in a tertiary care setting in India.

    PubMed

    Dinakaran, P; Mehrotra, Seema; Bharath, Srikala

    2014-12-01

    There are very few studies on user-perspectives about mental health care services that explore perspectives of family caregivers in India. An exploratory study was undertaken to understand the perceived importance of various aspects of interactions with mental health service providers during hospitalization, from the perspectives of family caregivers. In addition, it also aimed at documenting their actual experience of interactional aspects of care during the hospitalization of their relatives. The study was conducted on fifty family caregivers of patients with varied psychiatric diagnoses hospitalized in a tertiary psychiatric care setting in South India. Measures of Interactional aspects of care were developed to assess perceived importance of six different interactional domains of care and the actual experience of care in these domains. Provision of informational inputs and addressing of concerns raised emerged as the domains of care given highest importance. The item pertaining to 'sharing with the caregiver about different alternatives for treatment' received negative ratings in terms of actual experience by maximum number of participants (18%). Significant differences on perceived importance of four domains of interactional aspects of care (dignity, confidentiality and fairness, addressing concerns raised, informational inputs and prompt attention and consistent care) emerged between caregiver subgroups based on educational level of the caregiver, socio-economic status, hospitalization history and broad diagnostic categories. In addition, the care givers of patients with psychoses assigned significantly more positive ratings on actual experience for all the domains of interactional aspects of care. The findings have implications for further research and practice. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Study of variables affecting critical value notification in a laboratory catering to tertiary care hospital.

    PubMed

    Agarwal, Rachna; Chhillar, Neelam; Tripathi, Chandra B

    2015-01-01

    During post-analytical phase, critical value notification to responsible caregiver in a timely manner has potential to improve patient safety which requires cooperative efforts between laboratory personnel and caregivers. It is widely accepted by hospital accreditors that ineffective notification can lead to diagnostic errors that potentially harm patients and are preventable. The objective of the study was to assess the variables affecting critical value notification, their role in affecting it's quality and approaches to improve it. In the present study 1,187 critical values were analysed in the Clinical Chemistry Laboratory catering to tertiary care hospital for neuropsychiatric diseases. During 25 months of study period, we evaluated critical value notification with respect to clinical care area, caregiver to whom it was notified and timeliness of notification. During the study period (25 months), the laboratory obtained 1,279 critical values in clinical chemistry. The analytes most commonly notified were sodium and potassium (20.97 & 20.8 % of total critical results). Analysis of critical value notification versus area of care showed that critical value notification was high in ICU and emergency area followed by inpatients and 64.61 % critical values were notified between 30 and 120 min after receiving the samples. It was found that failure to notify the responsible caregiver in timely manner represent an important patient safety issue and may lead to diagnostic errors. The major area of concern are notification of critical value for outpatient samples, incompleteness of test requisition forms regarding illegible writing, lack of information of treating physician and location of test ordering and difficulty in contacting the responsible caregiver.

  8. Physicians' tobacco intervention counseling in a tertiary care hospital of South India.

    PubMed

    Akshaya, K M; Majra, J P

    2014-10-01

    The tobacco epidemic is one of the biggest public health threats in the present world with a substantial contribution to mortality and morbidity. Patients' visits to their doctors for illnesses and health check-ups offer a great opportunity to screen them for tobacco use and also counsel them to quit tobacco use. This cross sectional study was carried out in out-patient departments of General Medicine and Pulmonary Medicine of a tertiary care medical college teaching hospital in Dakshina Kannada district of Karnataka state of India between April 2012 and July 2012 among the patients aged 18 years or above who were diagnosed as suffering from tobacco related diseases. Exit interview was conducted on the patients after obtaining a written informed consent using a pre designed semi-structured questionnaire. Data was entered, analyzed using SPSS v17 and Descriptive statistics, Fisher Exact test, Bivariate and multivariable logistic regression analyses were used. The present study reveals that 305 (87.1 %), 281 (80.3 %) and 257 (73.1 %) of the 350 participants were asked, assessed and advised respectively by the treating physicians to quit tobacco use where as only 18 (15.1 %) were assisted in their efforts to quit tobacco. Physician's counseling inventions were significantly associated with patient's age, sex, education, marital status and socio economic status of the patients as well as the treating physician's experience of more than 3 years. There is a need to incorporate tobacco history taking as a vital sign during medical history taking and this should be made as a routine in medical schools.

  9. Enteric Fever in a Tertiary Paediatric Hospital: A Retrospective Six-Year Review.

    PubMed

    Ahmad Hatib, Nur Adila; Chong, Chia Yin; Thoon, Koh Cheng; Tee, Nancy Ws; Krishnamoorthy, Subramania S; Tan, Natalie Wh

    2016-07-01

    Enteric fever is a multisystemic infection which largely affects children. This study aimed to analyse the epidemiology, clinical presentation, treatment and outcome of paediatric enteric fever in Singapore. A retrospective review of children diagnosed with enteric fever in a tertiary paediatric hospital in Singapore was conducted from January 2006 to January 2012. Patients with positive blood cultures for Salmonella typhi or paratyphi were identified from the microbiology laboratory information system. Data was extracted from their case records. Of 50 enteric fever cases, 86% were due to Salmonella typhi, with 16.3% being multidrug resistant (MDR) strains. Sixty-two percent of S. typhi isolates were of decreased ciprofloxacin susceptibility (DCS). Five cases were both MDR and DCS. The remaining 14% were Salmonella paratyphi A. There were only 3 indigenous cases. Ninety-four percent had travelled to typhoid-endemic countries, 70.2% to the Indian subcontinent and the rest to Indonesia and Malaysia. All patients infected with MDR strains had travelled to the Indian subcontinent. Anaemia was a significant finding in children with typhoid, as compared to paratyphoid fever (P = 0.04). Although all children were previously well, 14% suffered severe complications including shock, pericardial effusion and enterocolitis. None had typhoid vaccination prior to their travel to developing countries. Enteric fever is largely an imported disease in Singapore and has contributed to significant morbidity in children. The use of typhoid vaccine, as well as education on food and water hygiene to children travelling to developing countries, needs to be emphasised.

  10. Laryngoscope Illuminance in a Tertiary Care Medical Center: Industry Standards and Implications for Quality Laryngoscopy.

    PubMed

    Murphy, Michael K; Volsky, Peter G; Darrow, David H

    2015-11-01

    To test the hypothesis that a substantial proportion of laryngoscopes exhibit substandard illuminance by comparing laryngoscope illuminance in a tertiary-level medical center to established standards and identifying features associated with poor illuminance. Cross-sectional observational study. Academic tertiary care medical center (level 1 trauma center, specialty cardiac hospital, and general hospital). Laryngoscopes from main, cardiac, and outpatient operating rooms; emergency department; and code carts were tested using a standard technique. Illuminance (lux) was chosen as the outcome measure. Benchmarks were derived from the International Standards Organization and medical literature. Light types included incandescent bulb, light-emitting diode, and xenon. Personnel were surveyed regarding maintenance practices. Across all hospitals, 691 laryngoscopes were tested. Mean (SD) illuminance was 810 (700) lux for incandescent bulb-on-blade designs (n = 237), 1860 (1220) lux for incandescent bulb in-handle designs (n = 79), 4730 (3210) lux for LED (n = 354), and 28,800 (34,500) lux for xenon (n = 21). Seven percent of units failed to turn on (n = 45). Using an established threshold of 867 lux, 28% of devices (47% of incandescent, 12% of LED, and 10% of xenon) were substandard. All laryngoscopes were cleaned according to standard protocols following use; no preventive maintenance was reported. Twenty-eight percent of laryngoscopes in a tertiary care hospital exhibit substandard illuminance; these results corroborate the findings of our inaugural study on this subject. Consequently, our hospital is instituting changes to reduce the likelihood of substandard performance by laryngoscopes in circulation. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2015.

  11. Anaemia in pregnancy: a cross-sectional study of pregnant women in a Sahelian tertiary hospital in Northeastern Nigeria.

    PubMed

    Kagu, M B; Kawuwa, M B; Gadzama, G B

    2007-10-01

    This prospective study was carried out between June 2005 and June 2006, to determine the prevalence and determinants of anaemia among pregnant women attending a tertiary Sahelian Hospital in Northeastern Nigeria. A total of 1,040 pregnant women enrolled at their first antenatal visit were monitored through pregnancy for anaemia. The overall prevalence of anaemia, malaria parasitaemia and schistosomiasis was 72.0%, 22.1% and 3.8%, respectively. Mild, moderate and severe anaemia constituted 31.8%, 39.4% and 0.9%, respectively. Anaemia was most common among the multipara and women presenting in late stages of pregnancy. More multipara and primigravidae had malaria parasitaemia than grandmultipara. Schistosomiasis, malaria infestation and a short birth interval as well as illiteracy are additional risk factors for anaemia in pregnancy. This study confirms the high prevalence of anaemia in pregnancy in this area. Appropriate intervention strategies are necessary to reduce the prevalence of anaemia.

  12. Chronic Liver Disease is One of the Leading Causes of Death in Bangladesh: Experience by Death Audit from a Tertiary Hospital.

    PubMed

    Abedin, Mohammed Forhad; Hoque, Mohammad Mahfuzul; Md Sadequl Islam, Abu Saleh; Islam Chowdhury, Md Forhadul; Chandra das, Dulal; Begum, Syeda Anwara; Mamun, Ayub Al; Mamun-Al-Mahtab; Rahman, Salimur; Saha, Anup Kumar

    2014-01-01

    In industrialized countries, the audit has become an integral part of medical care. The experience from developing countries like Bangladesh is still inadequate. This study had been carried out to find out relation among some factors like age, sex, causes, diurenal variation, duration of hospital stay with death and errors in certification process. It was a cross-sectional study conducted at the Department of Medicine, Sir Salimullah Medical College (SSMC) and Mitford Hospital from March 2010 to August 2010. Information of consecutive 100 deaths was collected in a predesigned clinical data sheet within half an hour of every occurrence. Necessary data were collected from hospital case records (admission registrar, case files and death certificates) using structured checklist. Patients who were brought dead were excluded from the study. Among 100 deaths, 48% were males (n = 48) and 52% were females (n = 52). Within this group, 66.7% were males and 33.3% were females. First day (within 24 hours of admission) death accounted for 46% (n = 46) of all death and by the second day 23% (n = 23) of all deaths occurred. The highest underlying cause of death was cerebrovascular diseases (29% of total death), infectious disease contributed 20%, chronic liver disease 13%, malignancy 7%, poisoning 6%, cor pulmonale 5%, while others were 20%. In this studychronic liver disease was found to be one of the leading causes of death in our hospital and most of them occurred due to hepatic encephalopathy. So, early detection of hepatic encephalopathy and treatment is necessary to reduce hospital mortality. How to cite this article: Abedin MF, Hoque MM, Islam ASMS, Chowdhury MFI, Das DC, Begum SA, Mamun AA, Mahtab MA, Rahman S, Saha AK. Chronic Liver Disease is One of the Leading Causes of Death in Bangladesh: Experience by Death Audit from a Tertiary Hospital. Euroasian J Hepato-Gastroenterol 2014;4(1):14-17.

  13. Pediatric retinal detachment in the Eastern Province of Saudi Arabia: experience of a tertiary care hospital.

    PubMed

    Cheema, Rizwan A; Al-Khars, Wajeeha; Al-Askar, Essam; Amin, Yasir M

    2009-01-01

    Because no previous studies have addressed the issue, we describe clinical characteristics and surgical outcome of patients with rhegmatogenous retinal detachment (RRD) in a pediatric population of the Eastern province of Saudi Arabia. We conducted a retrospective review of all consecutive cases of pediatric RRD (0-18 years) patients presenting at Dhahran Eye Specialist Hospital, a tertiary care hospital, in the Eastern Province of Saudi Arabia over a period of 3 years. Twenty patients were included in the study, accounting for 9.4% of all retinal detachment surgery cases performed over a period of 3 years (January 2006 to December 2008). The median age was 11.0 years, (range, birth to 18 years). Trauma, (45%) myopia/vitreoretinal degeneration (10%) and prior ocular surgery (25%) were significant risk factors for RRD. Proliferative vitreoretinopathy (PVR) more than grade C was present in 14/20 (70%) of cases. Most patients (15/20, 75%) were treated with pars plana vitrectomy and placement of an encircling buckle, while silicone oil or gas was used as tamponade in 13/20 (65%) patients. Surgery was successful in 17/20 (85%) cases in achieving retinal re-attachment. Visual acuity improved significantly following surgery (Mean preop 2.146 LogMAR, Mean postop 1.497 LogMAR) ( P= .014). Longer duration of RRD ( P =.007) and macular involvement ( P =.05) were associated with worse anatomical outcomes following surgery. Pediatric RRD in the Eastern province is often associated with predisposing pathology. Surgery is successful in achieving anatomical reattachment of the retina in a majority of cases with improvement of visual acuity.

  14. Fresh-Frozen Plasma: Ordering Patterns and Utilization in the Operating Rooms of a Tertiary Referral Hospital.

    PubMed

    Meyer, Matthew J; Dzik, Walter H; Levine, Wilton C

    2017-02-01

    Blood product transfusion is the most commonly performed hospital procedure. Intraoperative blood product utilization varies between institutions and anesthesiologists. In the United States in 2011, nearly 4 million plasma units were transfused. A retrospective analysis of intraoperative plasma ordering patterns and utilization (thawing and transfusing) was performed at a tertiary, academic hospital between January 2015 and March 2016. Over 15 months, 46,002 operative procedures were performed. In 1540 of them, plasma was thawed or transfused: 8297 plasma units were thawed and 3306 of those units were transfused. These 3306 plasma units were transfused in 749 cases with a median of 2 plasma units (interquartile range, 2-4) transfused. The percentage of average monthly procedures with plasma thawed and none transfused was 51.3% (confidence interval, 49.0%-53.6%). The cardiac surgery service requested the greatest number of plasma units to be thawed (2143) but only transfused 712 (33.2%) of them. Of all plasma units not transfused, 45% were generated by procedures with 1 to 4 units of plasma thawed; 95.7% of these units were thawed as even integers (ie, 2, 4). For operative procedures, far more plasma was thawed than was transfused and this practice occurred across surgical specialties and anesthesiologists. Considering the plasma that was not transfused, 45% occurred in procedures with 4 or fewer units of plasma requested suggesting these low-volume requests were a primary source of potential waste. Further studies are needed to examine associations between plasma utilization and clinical outcomes.

  15. Analysis of Drug Resistance Determinants in Klebsiella pneumoniae Isolates from a Tertiary-Care Hospital in Beijing, China

    PubMed Central

    Wang, Qi; Woo, Patrick C. Y.; Tan, Lin; Jing, Hua; Gao, George F.; Liu, Cui Hua

    2012-01-01

    Background The rates of multidrug-resistant (MDR), extensively drug-resistant (XDR) and pandrug-resistant (PDR) isolates among Enterobacteriaceae isolates, particularly Klebsiella pneumoniae, have risen substantially worldwide. Methodology/Principal Findings To better understand the molecular mechanisms of drug resistance in K. pneumoniae, we analyzed the drug resistance determinants for K. pneumoniae isolates collected from the 306 Hospital, a tertiary-care hospital in Beijing, China, for the period of September 1, 2010-October 31, 2011. Drug susceptibility testing, PCR amplification and sequencing of the drug resistance determinants were performed. Conjugation experiments were conducted to examine the natural ability of drug resistance to disseminate among Enterobacteriaceae strains using a sodium azide-resistant Escherichia coli J53 strain as a recipient. Among the 223 consecutive non-repetitive K. pneumoniae isolates included in this study, 101 (45.3%) were extended-spectrum beta-lactamases (ESBLs) positive. The rates of MDR, XDR, and PDR isolates were 61.4% (n = 137), 22.0% (n = 49), and 1.8% (n = 4), respectively. Among the tested drug resistance-associated genes, the following ones were detected at relatively high rates bla CTX-M-10 (80, 35.9%), aacC2 (73, 32.7%), dhfr (62, 27.8%), qnrS (58, 26.0%), aacA4 (57, 25.6%), aadA1 (56, 25.1%). Results from conjugation experiments indicate that many of the drug resistance genes were transmissible. Conclusions/Significance Our data give a “snapshot” of the complex genetic background responsible for drug resistance in K. pneumoniae in China and demonstrate that a high degree of awareness and monitoring of those drug resistance determinants are urgently needed in order to better control the emergence and transmission of drug-resistant K. pneumoniae isolates in hospital settings. PMID:22860106

  16. Relationship between occupational stress and depressive mood among interns and residents in a tertiary hospital, Seoul, Korea.

    PubMed

    Kim, Keon; Lee, Sunhwa; Choi, Yoon Hee

    2015-06-01

    Occupational stress can have a harmful effect on the individual both physically and psychologically. In Korea, occupational stress of physician is rarely demonstrated. Although it is well reported that physicians tend to have a high incidence of minor psychiatric disorders, the magnitude of the problem remains unclear. Interns and residents are thought to be under substantial amount of stress, and tend to have psychiatric disorder. In this paper, we aimed to evaluate the relationship between the occupational stress and depression of residents. The participants of this study were surgical and medical residents in a tertiary hospital in Korea. For measurement of occupational stress, we used an occupational stress scale. In addition, to evaluate the prevalence of depression, we used the Beck Depression Inventory. Female doctors showed higher degree of occupational stress than the males. The interns and chief residents showed higher degree of occupational stress than the other residents. Interestingly, in this study, most of the participants experienced a depressive mood. Compared with the general population, job demand and culture of workplace were high. Occupational stress was the only significant predictor of a depressive mood. Hospital residents experience a high degree of occupational stress leading to a depressed mood due to various risk factors. Therefore, it is essential to recognize the occupational stress of residents early, to encourage positive competition and peer and social support, and to help improve the residents' ability to cope with stress.

  17. Features of central serous chorioretinopathy presenting at a tertiary care hospital in Lahore.

    PubMed

    Jamil, Ahmad Zeeshan; Mirza, Khurram Azam; Qazi, Zaheer Uddin Aqil; Iqbal, Wasim; Khaliq, Javed; Fawad-ur-Rahman; Ahmed, Arslan

    2013-04-01

    To evaluate the clinical, angiographic and optical coherence tomographic features of central serous chorioretinopathy in patients presenting at a tertiary care centre in Lahore. The observational study was conducted at the Layton Rehmatulla Benevolent Trust Eye and Cancer Hospital Lahore from July 15, 2010 to December 15, 2011. Patients who had received prior treatment for the condition and allergy to fluorescein were excluded. There were 86 eyes of 64 adult patients with central serous chorioretinopathy. The following data was recorded: history, signs and symptoms, best corrected visual acuity, fundus fluorescein angiography, and central macular thickness measurement with optical coherence tomography. Data was analyzed using SPSS 17. Mean age of patients who presented during the study duration was 39.52 +/- 8.85 years.There were 53 (82.8%) males and 11(17.2%) females. Of the total, 42 (65.6%) cases had unilateral and 22 (34.4%) cases had bilateral involvement. Chronic central serous chorioretinopathy was seen in 27 (42.2%) cases while 37 (57.8%) cases were acute presentations. Retinal pigment epithelial detachment was observed in 29 (45.3%) cases. On fundus fluorescein angiography, there were 62 (72.1%) eyes that showed ink blot pattern. Median visual acuity at presentation was 0.25. Median central macular thickness at presentation was 550.5micro. Central serous chorioretinopathy in the study sample was associated with pigment epithelial detachment, bilateral involvement, and presence of systemic diseases.

  18. Tertiary survey in polytrauma patients should be an ongoing process.

    PubMed

    Ferree, Steven; Houwert, Roderick M; van Laarhoven, Jacqueline J E M; Smeeing, Diederik P J; Leenen, Luke P H; Hietbrink, Falco

    2016-04-01

    Due to prioritisation in the initial trauma care, non-life threatening injuries can be overlooked or temporally neglected. Polytrauma patients in particular might be at risk for delayed diagnosed injuries (DDI). Studies that solely focus on DDI in polytrauma patients are not available. Therefore the aim of this study was to analyze DDI and determine risk factors associated with DDI in polytrauma patients. In this single centre retrospective cohort study, patients were considered polytrauma when the Injury Severity Score was ≥ 16 as a result of injury in at least 2 body regions. Adult polytrauma patients admitted from 2007 until 2012 were identified. Hospital charts were reviewed to identify DDI. 1416 polytrauma patients were analyzed of which 12% had DDI. Most DDI were found during initial hospital admission after tertiary survey (63%). Extremities were the most affected regions for all types of DDI (78%) with the highest intervention rate (35%). Most prevalent DDI were fractures of the hand (54%) and foot (38%). In 2% of all patients a DDI was found after discharge, consisting mainly of injuries other than a fracture. High energy trauma mechanism (OR 1.8, 95% CI 1.2-2.7), abdominal injury (OR 1.5, 95% CI 1.1-2.1) and extremity injuries found during initial assessment (OR 2.3, 95% CI 1.6-3.3) were independent risk factors for DDI. In polytrauma patients, most DDI were found during hospital admission but after tertiary survey. This demonstrates that the tertiary survey should be an ongoing process and thus repeated daily in polytrauma patients. Most frequent DDI were extremity injuries, especially injuries of the hand and foot. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Circulation of Highly Drug-Resistant Clostridium difficile Ribotypes 027 and 001 in Two Tertiary-Care Hospitals in Mexico.

    PubMed

    Martínez-Meléndez, Adrián; Tijerina-Rodríguez, Laura; Morfin-Otero, Rayo; Camacho-Ortíz, Adrián; Villarreal-Treviño, Licet; Sánchez-Alanís, Hugo; Rodríguez-Noriega, Eduardo; Baines, Simon D; Flores-Treviño, Samantha; Maldonado-Garza, Héctor Jesús; Garza-González, Elvira

    2018-05-01

    To assess drug susceptibility and characterize Clostridium difficile ribotypes in isolates from two tertiary-care hospitals in Mexico. Isolates were evaluated for genotyping, antimicrobial susceptibility testing and detection of mutations associated with drug resistance. PCR ribotyping was performed using a combination of gel-based and capillary electrophoresis-based approaches. MIC 50 and MIC 90 were ≥128 mg/L for ciprofloxacin, erythromycin, clindamycin, and rifampicin. There was no reduced susceptibility to metronidazole or tetracycline; however, reduced susceptibility to vancomycin (≥4 mg/L) and fidaxomicin (≥2 mg/L) was detected in 50 (40.3%) and 4 (3.2%) isolates, respectively. Furthermore, the rpoB Arg505Lys mutation was more frequently detected in isolates with high minimum inhibitory concentration (MIC) to rifampicin (≥32 mg/L) (OR = 52.5; 95% CI = 5.17-532.6; p < 0.000). Of the 124 C. difficile isolates recovered, 84 (66.7%) were of ribotype 027, 18 (14.5%) of ribotype 001, and the remainder were other ribotypes (353, 255, 220, 208, 176, 106, 076, 020, 019, 017, 014, 012, 003, and 002). Ribotypes 027 and 001 were the most frequent C. difficile isolates recovered in this study, and demonstrated higher MICs. Furthermore, we found four isolates with reduced susceptibility to fidaxomicin, raising a concern since this drug is currently unavailable in Mexican Hospitals.

  20. Analysis of pattern of mortality in Medicine and Allied Departments at a tertiary care hospital in Islamabad: A losing battle against sepsis.

    PubMed

    Azim, Saad; Zahoor, Sidra; Janjua, Jamal; Majeed, Azer; Hussain, Syed Waqar

    2017-01-01

    To identify the pattern of mortality in medical wards of a tertiary care hospital. This retrospective study was conducted at the Khan Research Laboratories Hospital, Islamabad, Pakistan, and comprised medical records of people who died during hospital stay between December 2013 and November 2014.SPSS 11 was used for data analysis. Of the 3,228 admissions, 105(3.25%) patients expired. Of them, 41(39.04%) were men with a mean age of 55±13.48 years (range: 17-88 years) and 64±11.76 (60.9%) were women with a mean age of 61±15.5 years (range: 23-91 years). The mean length of time between admission and death was 6.58±3.7 days (range: 1-33 days). The causes of death were categorised as infectious in 37(35.23%) patients, cancer-related in 20(19.045%), pulmonary in 19(18.09%), cardiovascular in 18(17.14%), gastrointestinal and neurological in 13(12.38%) each, nephrology in 10(9.52%), autoimmune disorders in 6(5.71%) and miscellaneous in 9(8.57%). Complications of sepsis were the most common cause of death in 38(36.19%) cases. Sepsis, primarily from pneumonia, was the major cause of mortality.

  1. Susceptibility of Rubella Among Pregnant Women Attending the Antenatal Clinic in a Tertiary Care Hospital, Jabalpur, Central India.

    PubMed

    Kori, Bhupesh K; Singh, Kavita N; Sharma, Ravendra K; Sharma, Bhagwati S; Badkur, Poorva; Barde, Pradip V

    2017-03-01

    The purpose of this study was to evaluate rubella susceptibility of pregnant women from central India as rubella infection can be devastating for the newborn if it occurs in the mother in the first trimester of pregnancy, which may lead to congenital rubella syndrome (CRS). There are very few studies about seroprevalence of rubella from India and none from central India. The study was conducted among women attending the obstetric department of a tertiary care hospital, in which 369 antenatal cases were tested for the presence of immunoglobulin G antibody for rubella and its titer. Data were analyzed using statistical tests. A total of 141 (38.2%) women were found susceptible to rubella. There was no significant difference in rubella susceptibility among different socioeconomic classes, ages, and gravidity. A large proportion of pregnant women were found to be rubella susceptible, posing immense threat of CRS to their newborns. A robust program for rubella immunization targeting young adult women is needed to avoid CRS.

  2. Study of adverse drug reactions in patients with diabetes attending a tertiary care hospital in New Delhi, India.

    PubMed

    Singh, Abhishank; Dwivedi, Shridhar

    2017-02-01

    The present prospective observational study was carried out in a tertiary care hospital in New Delhi, India from May 2014 to June 2015 to report adverse drug reactions (ADRs) in patients with type 2 diabetes mellitus (T2DM) using antidiabetic drugs. A total of 220 patients (121 males, 99 females) were enrolled. ADRs were recorded on the prescribed form. Causality and severity assessment was done using Naranjo's probability scale and modified Hartwig and Siegel's severity scale, respectively. Commonly prescribed drugs were biguanides, peptide hormone and sulphonylurea. A total of 26 ADRs were recorded (16 in males and 10 in females). Most commonly observed ADRs were related to endocrine and gastrointestinal system. Severity assessment of ADRs showed seven (26.9%) ADRs as moderate, and 19 (73.1%) as mild. No severe reactions were observed. ADRs were mostly related to endocrine and gastrointestinal system. More information on prescribed drugs and their side effects is required for ensuring patient safety.

  3. In vitro activity of tigecycline and comparators against gram-negative bacteria isolated from a tertiary hospital in Alexandria, Egypt.

    PubMed

    Mohamed, Nelly M; Youssef, Alaa A F

    2011-12-01

    The emergence of infections caused by multidrug-resistant Gram-negative bacteria, in particular Pseudomonas aeruginosa, Acinetobacter baumannii, and Klebsiella pneumoniae, has necessitated the search for alternative therapy by either introducing new agents or renewing interest in old agents. This study compares the in vitro activity of tigecycline (TIG), recently introduced to Egyptian market, to other potentially active antimicrobials as Colistin (COL), imipenem (IPM), levofloxacin (LEV), and piperacillin/tazobactam (PIP/TAZ) against 67 Gram-negative clinical isolates obtained from El- Meery Hospital in Alexandria, Egypt. El-Meery Hospital is a 1,500-bed tertiary teaching hospital where TIG has not been previously used. Based on MIC(90)s, TIG was found to be a comparator to IPM and COL (MIC(90)= 8 μg/ml). LEV and PIP/TAZ were less active than TIG exhibiting high MIC(90)s. TIG inhibited 100% of Escherichia coli and K. pneumoniae and 60% of Ps. aeruginosa and A. baumannii isolates. In time-kill studies against IPM-resistant isolates, TIG showed bactericidal activity after 6 hours of contact against the Enterobacteriaceae isolates and after 3 hours for the tested Ps. aeruginosa isolates at 4× and 8× MIC. Against A. baumannii, TIG exerted a bacteriostatic effect. TIG demonstrated variable ability to suppress biofilm formation affecting mainly E. coli and A. baumannii isolates. These results point TIG to be a promising agent in treatment of infections caused by strains for which adequate therapy has been limited. As far as we know, this is the first report evaluating the in vitro activity of TIG against Egyptian clinical isolates.

  4. Blood and Blood Product Conservation: Results of Strategies to Improve Clinical Outcomes in Open Heart Surgery Patients at a Tertiary Hospital.

    PubMed

    Khan, Junaid H; Green, Emily A; Chang, Jimmin; Ayala, Alexandria M; Barkin, Marilyn S; Reinys, Emily E; Stanton, Jeffrey; Stanten, Russell D

    2017-12-01

    Blood product usage is a quality outcome for patients undergoing cardiac surgery. To address an increase in blood product usage since the discontinuation of aprotinin, blood conservation strategies were initiated at a tertiary hospital in Oakland, CA. Improving transfusion rates for open heart surgery patients requiring Cardiopulmonary bypass (CPB) involved multiple departments in coordination. Specific changes to conserve blood product usage included advanced CPB technology upgrades, and precise individualized heparin dose response titration assay for heparin and protamine management. Retrospective analysis of blood product usage pre-implementation, post-CPB changes and post-Hemostasis Management System (HMS) implementation was done to determine the effectiveness of the blood conservation strategies. Statistically significant decrease in packed red blood cells, fresh frozen plasma, cryoprecipitate, and platelet usage over the stepped implementation of both technologies was observed. New oxygenator and centrifugal pump technologies reduced active circuitry volume and caused less damage to blood cells. Individualizing heparin and protamine dosing to a patient using the HMS led to transfusion reductions as well. Overall trends toward reductions in hospital length of stay and intensive care unit stay, and as a result, blood product cost and total hospitalization cost are positive over the period of implementation of both CPB circuit changes and HMS implementation. Although they are multifactorial in nature, these trends provide positive enforcement to the changes implemented.

  5. Staff Perception on Biomedical or Health Care Waste Management: A Qualitative Study in a Rural Tertiary Care Hospital in India

    PubMed Central

    Joshi, Rita; Shah, Harshada; Sharma, Megha; Pathak, Ashish; Macaden, Ragini; Stålsby Lundborg, Cecilia

    2015-01-01

    Background Health care or biomedical waste, if not managed properly, can be of high risk to the hospital staff, the patients, the community, public health and the environment, especially in low and middle income settings where proper disposal norms are often not followed. Our aim was to explore perceptions of staff of an Indian rural tertiary care teaching hospital on hospital waste management. Method A qualitative study was conducted using 10 focus group discussions (FGDs), with different professional groups, cleaning staff, nurses, medical students, doctors and administrators. The FGD guide included the following topics: (i) role of Health Care Waste Management (HCWM) in prevention of health care associated infections, (ii) awareness of and views about HCWM-related guidelines/legislation, (iii) current HCWM practices, (iv) perception and preparedness related to improvements of the current practices, and (v) proper implementation of the available guidelines/legislation. The FGDs were recorded, transcribed verbatim, translated to English (when conducted in Hindi) and analysed using content analysis. Results Two themes were identified: Theme (A), ‘Challenges in integration of HCWM in organizational practice,’ with the categories (I) Awareness and views about HCWM, (II) Organizational practices regarding HCWM, and (III) Challenges in Implementation of HCWM; and Theme (B), ‘Interventions to improve HCWM,’ with three categories, (I) Educational and motivational interventions, (II) Organizational culture change, and (III) Policy-related interventions. Conclusion A gap between knowledge and actual practice regarding HCWM was highlighted in the perception of the hospital staff. The participants suggested organizational changes, training and monitoring to address this. The information generated is relevant not merely to the microsystem studied but to other institutions in similar settings. PMID:26023783

  6. Psychosocial Factors in End-Stage Kidney Disease Patients at a Tertiary Hospital in Australia

    PubMed Central

    Bale, Charan; Jegatheesan, Dev; Pham, Linh; Huynh, Sonny; Mulay, Atul

    2016-01-01

    Aim. This study seeks to review the psychosocial factors affecting patients with end-stage kidney disease (ESKD) from a tertiary hospital in Australia. Methods. We audited patients with ESKD, referred to social work services from January 2012 to December 2014. All patients underwent psychosocial assessments by one, full-time renal social worker. Patient demographics, cumulative social issues, and subsequent interventions were recorded directly into a database. Results. Of the 244 patients referred, the majority were >60 years (58.6%), male (60.7%), born in Australia (62.3%), on haemodialysis (51.6%), and reliant on government financial assistance (88%). Adjustment issues (41%), financial concerns (38.5%), domestic assistance (35.2%), and treatment nonadherence (21.3%) were the predominant reasons for social work consultation. Younger age, referral prior to start of dialysis, and unemployment were significant independent predictors of increased risk of adjustment issues (p = 0.004, <0.001, and =0.018, resp.). Independent risk factors for treatment nonadherence included age and financial and employment status (p = 0.041, 0.052, and 0.008, resp.). Conclusion. Psychosocial and demographic factors were associated with treatment nonadherence and adjustment difficulties. Additional social work support and counselling, in addition to financial assistance from government and nongovernment agencies, may help to improve adjustment to the diagnosis and treatment plans as patients approach ESKD. PMID:27807482

  7. Management and outcomes of acute ST-segment-elevation myocardial infarction at a tertiary-care hospital in Sri Lanka: an observational study.

    PubMed

    Bandara, Ruwanthi; Medagama, Arjuna; Munasinghe, Ruwan; Dinamithra, Nandana; Subasinghe, Amila; Herath, Jayantha; Ratnayake, Mahesh; Imbulpitiya, Buddhini; Sulaiman, Ameena

    2015-01-15

    Sri Lanka is a developing country with a high rate of cardiovascular mortality. It is still largely dependent on thrombolysis for primary management of acute myocardial infarction. The aim of this study was to present current data on the presentation, management, and outcomes of acute ST-segment-elevation myocardial infarction (STEMI) at a tertiary-care hospital in Sri Lanka. Eighty-one patients with acute STEMI presenting to a teaching hospital in Peradeniya, Sri Lanka, were included in this observational study. Median interval between symptom onset and hospital presentation was 60 min (mean 212 min). Thrombolysis was performed in 73% of patients. The most common single reason for not performing thrombolysis was delayed presentation. Median door-to-needle time was 64 min (mean, 98 min). Only 16.9% of patients received thrombolysis within 30 min, and none underwent primary PCI. Over 98% of patients received aspirin, clopidogrel, and a statin on admission. Intravenous and oral beta blockers were rarely used. Follow-up data were available for 93.8% of patients at 1 year. One-year mortality rate was 12.3%. Coronary intervention was performed in only 7.3% of patients post infarction. Late presentation to hospital remains a critical factor in thrombolysis of STEMI patients in Sri Lanka. Thrombolysis was not performed within 30 min of admission in the majority of patients. First-contact physicians should receive further training on effective thrombolysis, and there is an urgent need to explore the ways in which PCI and post-infarction interventions can be incorporated into treatment protocols.

  8. Ready for School? Trauma Exposure and Mental Health in a Group of War-Affected Ugandan Adolescents Re-Attending School

    ERIC Educational Resources Information Center

    Schultz, Jon-Hakon; Sorensen, Peer Moller; Waaktaar, Trine

    2012-01-01

    The objective of this study was to assess trauma-related symptoms and mental health among war-exposed Ugandan adolescents (n = 81) as a basis for planning their re-attendance at school. Self-reports of exposure to traumatic events, trauma-related symptoms, and indicators of mental health were collected. While about half of the youths (51.9%)…

  9. Factors Relating to Acceptance of Hepatitis B Virus Vaccination by Nursing Students in a Tertiary Hospital, Pakistan

    PubMed Central

    Mengal, Hafeez-ur-Rehman; Howteerakul, Nopporn; Suwannapong, Nawarat; Rajatanun, Thitipat

    2008-01-01

    This cross-sectional study aimed at assessing the prevalence of, and factors relating to, the acceptance of hepatitis B virus (HBV) vaccination by nursing students in a tertiary hospital in Pakistan. In total, 210 nursing students of Year 2 to Year 4 were invited to participate in the study; of them, 196 (93.3%) returned completed questionnaires. Overall, the prevalence of acceptance of HBV vaccination among them was 75.0%. Of these, 37.2% (73/196) were completely vaccinated, and 25.0% (49/196) had not been vaccinated at all. More than half (27/49, 55.1%) of the unvaccinated nursing students stated that they would accept vaccination if offered. Multiple logistic regression analysis indicated three variables significantly related to acceptance of HBV vaccination: history of accidental exposure to blood or blood products, acceptable knowledge about HBV infection, and adequate budget for HBV vaccination. Health institutions should allocate adequate budgets to vaccinate their nursing students. Effective intervention programmes designed to increase knowledge about HBV infection and adhering to universally-accepted precautions are needed. PMID:18637527

  10. The pattern of the discovery of medication errors in a tertiary hospital in Hong Kong.

    PubMed

    Samaranayake, N R; Cheung, S T D; Chui, W C M; Cheung, B M Y

    2013-06-01

    The primary goal of reducing medication errors is to eliminate those that reach the patient. We aimed to study the pattern of interceptions to tackle medication errors along the medication use processes. Tertiary care hospital in Hong Kong. The 'Swiss Cheese Model' was used to explain the interceptions targeting medication error reporting over 5 years (2006-2010). Proportions of prescribing, dispensing and drug administration errors intercepted by pharmacists and nurses; proportions of prescribing, dispensing and drug administration errors that reached the patient. Our analysis included 1,268 in-patient medication errors, of which 53.4% were related to prescribing, 29.0% to administration and 17.6% to dispensing. 34.1% of all medication errors (4.9% prescribing, 26.8% drug administration and 2.4% dispensing) were not intercepted. Pharmacy staff intercepted 85.4% of the prescribing errors. Nurses detected 83.0% of dispensing and 5.0% of prescribing errors. However, 92.4% of all drug administration errors reached the patient. Having a preventive measure at each stage of the medication use process helps to prevent most errors. Most drug administration errors reach the patient as there is no defense against these. Therefore, more interventions to prevent drug administration errors are warranted.

  11. Pre‐pandemic planning survey of healthcare workers at a tertiary care children’s hospital: ethical and workforce issues

    PubMed Central

    Cowden, Jessica; Crane, Lori; Lezotte, Dennis; Glover, Jacqueline; Nyquist, Ann‐Christine

    2010-01-01

    Please cite this paper as: Cowden et al. (2010). Pre‐pandemic planning survey of healthcare workers at a tertiary care children’s hospital: ethical and workforce issues. Influenza and Other Respiratory Viruses 4(4), 213–222. Background  Prior to the development of written policies and procedures for pandemic influenza, worker perceptions of ethical and workforce issues must be identified. Objective  To determine the relationship between healthcare worker (HCW) reporting willingness to work during a pandemic and perception of job importance, belief that one will be asked to work, and sense of professionalism and to assess HCW’s opinions regarding specific policy issues as well as barriers and motivators to work during a pandemic. Methods  A survey was conducted in HCWs at The Children’s Hospital in Denver, Colorado, from February to June 2007. Characteristics of workers reporting willingness to work during a pandemic were compared with those who were unwilling or unsure. Importance of barriers and motivators was compared by gender and willingness to work. Results Sixty percent of respondents reported willingness to work (overall response rate of 31%). Belief one will be asked to work (OR 4·6, P < 0·0001) and having a high level of professionalism (OR 8·6, P < 0·0001) were associated with reporting willingness to work. Hospital infrastructure support staffs were less likely to report willingness to work during a pandemic than clinical healthcare professionals (OR 0·39, P < 0·001). Concern for personal safety, concern for safety of family, family’s concern for safety, and childcare issues were all important barriers to coming to work. Conclusions  Educational programs should focus on professional responsibility and the importance of staying home when ill. Targeted programs toward hospital infrastructure support and patient and family support staff stressing the essential nature of these jobs may improve willingness to work. PMID

  12. Pre-treatment loss to follow-up among smear-positive TB patients in tertiary hospitals, Quetta, Pakistan.

    PubMed

    Wali, A; Kumar, A M V; Hinderaker, S G; Heldal, E; Qadeer, E; Fatima, R; Ullah, A; Safdar, N; Yaqoob, A; Anwar, K; Ul Haq, M

    2017-03-21

    Setting: Three public sector tertiary care hospitals in Quetta, Balochistan, Pakistan, with anecdotal evidence of gaps between the diagnosis and treatment of patients with tuberculosis (TB). Objectives: To assess the proportion of pre-treatment loss to follow-up (LTFU), defined as no documented evidence of treatment initiation or referral in TB registers, among smear-positive pulmonary TB patients diagnosed in 2015, and the associated sociodemographic factors. Design: A retrospective cohort study involving the review of laboratory and TB registers. Results: Of 1110 smear-positive TB patients diagnosed (58% female, median age 40 years, 5% from outside the province or the country), 235 (21.2%) were lost to follow-up before starting treatment. Pre-treatment LTFU was higher among males; in patients residing far away, in rural areas, outside the province or the country; and in those without a mobile phone number. Conclusion: About one fifth of the smear-positive TB patients were lost to follow-up before starting treatment. Strengthening the referral and feedback mechanisms and using information technology to improve the tracing of patients is urgently required. Further qualitative research is needed to understand the reasons for pre-treatment LTFU from the patient's perspective.

  13. Pre-treatment loss to follow-up among smear-positive TB patients in tertiary hospitals, Quetta, Pakistan

    PubMed Central

    Kumar, A. M. V.; Hinderaker, S. G.; Heldal, E.; Qadeer, E.; Fatima, R.; Ullah, A.; Safdar, N.; Yaqoob, A.; Anwar, K.; Ul Haq, M.

    2017-01-01

    Setting: Three public sector tertiary care hospitals in Quetta, Balochistan, Pakistan, with anecdotal evidence of gaps between the diagnosis and treatment of patients with tuberculosis (TB). Objectives: To assess the proportion of pre-treatment loss to follow-up (LTFU), defined as no documented evidence of treatment initiation or referral in TB registers, among smear-positive pulmonary TB patients diagnosed in 2015, and the associated sociodemographic factors. Design: A retrospective cohort study involving the review of laboratory and TB registers. Results: Of 1110 smear-positive TB patients diagnosed (58% female, median age 40 years, 5% from outside the province or the country), 235 (21.2%) were lost to follow-up before starting treatment. Pre-treatment LTFU was higher among males; in patients residing far away, in rural areas, outside the province or the country; and in those without a mobile phone number. Conclusion: About one fifth of the smear-positive TB patients were lost to follow-up before starting treatment. Strengthening the referral and feedback mechanisms and using information technology to improve the tracing of patients is urgently required. Further qualitative research is needed to understand the reasons for pre-treatment LTFU from the patient's perspective. PMID:28775939

  14. Healthcare waste management: qualitative and quantitative appraisal of nurses in a tertiary care hospital of India.

    PubMed

    Shivalli, Siddharudha; Sanklapur, Vasudha

    2014-01-01

    The nurse's role in healthcare waste management is crucial. (1) To appraise nurses quantitatively and qualitatively regarding healthcare waste management; (2) to elicit the determinants of knowledge and attitudes of healthcare waste management. A cross-sectional study was undertaken at a tertiary care hospital of Mangalore, India. Self-administered pretested questionnaire and "nonparticipatory observation" were used for quantitative and qualitative appraisals. Percentage knowledge score was calculated based on their total knowledge score. Nurses' knowledge was categorized as excellent (>70%), good (50-70%), and poor (<50%). Chi square test was applied to judge the association of study variables with their attitudes and knowledge. Out of 100 nurses 47 had excellent knowledge (>70% score). Most (86%) expressed the need of refresher training. No study variable displayed significant association (P > 0.05) with knowledge. Apt segregation practices were followed except in casualty. Patients and entourages misinterpreted the colored containers. Nurses' knowledge and healthcare waste management practices were not satisfactory. There is a need of refresher trainings at optimum intervals to ensure sustainability and further improvement. Educating patients and their entourages and display of segregation information board in local language are recommended.

  15. Ocular knowledge and practice among type 2 diabetic patients in a tertiary care hospital in Bangladesh.

    PubMed

    Ahmed, Kazi Rumana; Jebunessa, Fatema; Hossain, Sharmin; Chowdhury, Hasina Akhter

    2017-09-19

    Diabetes mellitus is likely to have a major effect on vision, and adequate knowledge of its ocular manifestations is of substantial importance to diabetic patients. The study aimed to assess the ocular knowledge and practices among Type 2 diabetic patients of Bangladesh. This cross-sectional study included 122 diabetic patients from the outpatient department (OPD) of the apex diabetic healthcare hospital of the country under the sponsorship of the Diabetic Association of Bangladesh (BIRDEM). A questionnaire was used for collecting data on knowledge on and practices relating to diabetes mellitus with particular emphasis on ocular issues. A predefined score was used for categorizing levels of knowledge and practices as poor, average, and good. Of the 122 respondents, 63%, 55%, 40%, 44%, and 30% reported, blindness, retinopathy, cataracts, glaucoma, and double vision respectively, as complications of diabetes mellitus. About 50% were aware of the need for eye screening for people with the complications. Only 8% monitored their blood glucose levels daily, 15% monitored weekly, and 10% reported checking their blood pressure daily and 43% took their medications as prescribed. The level of diabetic knowledge was poor, moderate and good, respectively, among 24%, 56%, and 20% of the respondents, whereas the practice standards showed that 47%, 31%, and 22% had poor, average, and good levels respectively. The knowledge score was significantly associated with the practice score (r = 0.460, p = 0.001). The results indicate that the ocular knowledge and practices among diabetic patients attending a tertiary-care hospital in Bangladesh is average. Health and eye-care practitioners need to expand diabetic health education and promotion among diabetic patients.

  16. Technology-related medication errors in a tertiary hospital: a 5-year analysis of reported medication incidents.

    PubMed

    Samaranayake, N R; Cheung, S T D; Chui, W C M; Cheung, B M Y

    2012-12-01

    Healthcare technology is meant to reduce medication errors. The objective of this study was to assess unintended errors related to technologies in the medication use process. Medication incidents reported from 2006 to 2010 in a main tertiary care hospital were analysed by a pharmacist and technology-related errors were identified. Technology-related errors were further classified as socio-technical errors and device errors. This analysis was conducted using data from medication incident reports which may represent only a small proportion of medication errors that actually takes place in a hospital. Hence, interpretation of results must be tentative. 1538 medication incidents were reported. 17.1% of all incidents were technology-related, of which only 1.9% were device errors, whereas most were socio-technical errors (98.1%). Of these, 61.2% were linked to computerised prescription order entry, 23.2% to bar-coded patient identification labels, 7.2% to infusion pumps, 6.8% to computer-aided dispensing label generation and 1.5% to other technologies. The immediate causes for technology-related errors included, poor interface between user and computer (68.1%), improper procedures or rule violations (22.1%), poor interface between user and infusion pump (4.9%), technical defects (1.9%) and others (3.0%). In 11.4% of the technology-related incidents, the error was detected after the drug had been administered. A considerable proportion of all incidents were technology-related. Most errors were due to socio-technical issues. Unintended and unanticipated errors may happen when using technologies. Therefore, when using technologies, system improvement, awareness, training and monitoring are needed to minimise medication errors. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  17. The financial burden of cancer: estimates from patients undergoing cancer care in a tertiary care hospital.

    PubMed

    Zaidi, Adnan A; Ansari, Tayyaba Z; Khan, Aziz

    2012-10-15

    The emotional burden associated with the diagnosis of cancer is sometimes overshadowed by financial burden sustained by patient and the family. This is especially relevant for a developing country as there is limited state support for cancer treatment. We conducted this study to estimate the cost of cancer care for two major types of cancer and to assess the perception of patients and families regarding the burden of the cost for undergoing cancer treatment at a private tertiary care hospital. This cross-sectional study was conducted at day care and radiotherapy unit of Aga Khan University, Hospital (AKUH) Karachi, Pakistan. All adult patients with breast and head & neck cancers diagnosed for 3 months or more were included. Data was collected using a structured questionnaire and analysed using SPSS. Sixty seven patients were interviewed during the study period. The mean and median monthly income of these patients was 996.4 USD and 562.5 USD respectively. Comparatively the mean and median monthly cost of cancer care was 1093.13 USD and 946.42 USD respectively. The cost of the treatment either fully or partially was borne by the family in most cases (94%). The financial burden of cancer was perceived as significant by 28 (42%) patients and unmanageable by 18 (27%) patients. This perceived level of burden was associated significantly with average monthly income (p = <0.001). Our study indicates that the financial burden of cancer care is substantial and can be overwhelming. There is a desperate need for treatment support programs either by the government or other welfare organisations to support individuals and families who are already facing a difficult and challenging situation.

  18. Social media use profile, social skills, and nurse-patient interaction among Registered Nurses in tertiary hospitals: A structural equation model analysis.

    PubMed

    Mariano, Micah Celine O; Maniego, John Christian M; Manila, Hariette Lou Marie D; Mapanoo, Ram Cedrick C; Maquiran, Kerwin Miguel A; Macindo, John Rey B; Tejero, Lourdes Marie S; Torres, Gian Carlo S

    2018-04-01

    Social media has become increasingly important over the past decades and has been integrated in various environments, including the healthcare setting. Yet, the influence of social media use on the social skills and nurse-patient interaction of nurses is an area in nursing that requires further studies. This study determined the interrelationships among social media use profile, social skills, and nurse-patient interaction of Registered Nurses in tertiary hospitals. Employing structural equation modeling, a descriptive-correlational study was conducted among 212 consecutively-selected nurses from two tertiary hospitals. Consenting respondents completed a two-part survey composed of the respondent profile sheet and the Social Skills Inventory. The respondent profile sheet assessed demographic profile and social media use profile in terms of the mode, frequency, and duration of utilization. Three trained team members observed each nurse-patient dyad and completed the Nurse-Patient Bonding Instrument. A good fit model illustrated the negative effects of frequent social media use to patient openness (β = -0.18, p < 0.05) and engagement (β = -0.11, p ≤ 0.05). Longer use of social media on a daily basis, however, positively affected both dimensions of social skills. Accessing social media platforms using non-handheld devices showed the most influential positive effects to social skills and nurse-patient interaction. Additionally, although verbal social skills positively affected most dimensions of nurse-patient interaction, non-verbal social skills negatively influenced patient engagement (β = -0.19, p = 0.019) and nurse openness (β = -0.38, p ≤ 0.05). The structural model illustrates the effects of using social media on the social skills and nurse-patient interaction of nurses and emphasizes the need for implementing institutional policies on the judicious use and application of social media in the workplace. Further, social

  19. A Study of Workplace Violence Experienced by Doctors and Associated Risk Factors in a Tertiary Care Hospital of South Delhi, India

    PubMed Central

    Kumar, Mukesh; Das, Timiresh; Pardeshi, Geeta; Kishore, Jugal; Padmanandan, Arun

    2016-01-01

    Introduction The increasing incidences of violence against doctors in their workplaces are an important reason for stress among these healthcare workers. Many incidences of workplace violence against doctors have been reported in the past and are also being continuously reported from different parts of the country as well as the world. Aim To determine the prevalence of workplace violence among doctors and to study the associated risk factors in a tertiary care hospital of Delhi, India. Material and Methods A cross-sectional study was conducted using a self-administered semi-structured questionnaire. The contents were: data related to the workplace, incidences at work, violence prevention policy of the institution, reporting of incidences and follow-up, education and training for violence management. A total of 151 doctors participated in the study. Results Total participants in the study were 151. The mean age of study participants was 26.73±4.24 years. Almost half (47.02%; 44.56% of males and 50.84% of females) of the doctors reported having an experience of violence during work hours in past 12 months. Among the cases, 39.4% were reported from Department of Obstetrics and Gynaecology while Surgery, Medicine and other departments reported 29.6%, 26.8% and 4.2% respectively. Patients or their relatives were perpetrators in most of the cases. Maximum (87.3%) of the reported cases were of verbal violence while 8.6% of the cases were of physical violence. Younger doctors with less work experience were more prone to physical violence. Regarding the time of violence, 35.1% of such cases occurred during afternoon while 30.1% of them took place at night. Conclusion A large number of doctors had experienced violence in past 12 months in a tertiary care hospital of South Delhi, India. Verbal violence came out to be most common form of violence experienced by the doctors. Afternoon or night hours were the timings when majority of such cases were reported. PMID:28050406

  20. Diagnostic Value of the Serum Anti-Toxocara IgG Titer for Ocular Toxocariasis in Patients with Uveitis at a Tertiary Hospital in Korea.

    PubMed

    Bae, Ki Woong; Ahn, Seong Joon; Park, Kyu Hyung; Woo, Se Joon

    2016-08-01

    This study evaluated the prevalence of ocular toxocariasis (OT) in patients with uveitis of unknown etiology who visited a tertiary hospital in South Korea and assessed the success of serum anti-Toxocara immunoglobulin G (IgG) enzyme-linked immunosorbent assay (ELISA) as a diagnostic test for OT. The records of consecutive patients with intraocular inflammation of unknown etiology were reviewed. All participants underwent clinical and laboratory investigations, including ELISA for serum anti-Toxocara IgG. OT was diagnosed based on typical clinical findings. Clinical characteristics, seropositivity, and IgG titers were compared between patients diagnosed with OT and non-OT uveitis. The seropositivity and the diagnostic value of anti-Toxocara IgG was investigated among patients with different types of uveitis. Of 238 patients with uveitis of unknown etiology, 71 (29.8%) were diagnosed with OT, and 80 (33.6%) had positive ELISA results for serum anti-Toxocara IgG. The sensitivity and specificity of the ELISA test were 91.5% (65 / 71) and 91.0% (152 / 167), respectively. The positive predictive value of the serum anti-Toxocara IgG assay was 81.3%. Among patients with anterior, intermediate, posterior, and panuveitis, the prevalence rates of OT were 8.3%, 47.1%, 44.8%, and 7.1%, respectively; the seropositivity percentages were 18.1%, 47.1%, 43.7%, and 17.9%; and the positive predictive values were 38.5%, 95.8%, 92.1%, and 40.0%. The serum anti-Toxocara IgG titer also significantly decreased following albendazole treatment. OT is a common cause of intraocular inflammation in the tertiary hospital setting. Considering that OT is more prevalent in intermediate and posterior uveitis, and that the positive predictive value of the anti-Toxocara IgG assay is high, a routine test for anti-Toxocara IgG might be necessary for Korean patients with intermediate and posterior uveitis.

  1. The patterns and causes of neonatal mortality at a tertiary hospital in oman.

    PubMed

    Abdellatif, Mohamed; Ahmed, Masood; Bataclan, Maria Flordeliz; Khan, Ashfaq Ahmed; Al Battashi, Abeer; Al Maniri, Abdullah

    2013-11-01

    To report the patterns and causes of neonatal death from a tertiary care neonatal intensive care unit over a period of four years. This is a retrospective cohort study where four years data (January 2006 - December 2009) of all inborn neonatal admissions and deaths were collected from the neonatal intensive care unit at Sultan Qaboos University hospital on predesigned forms. All out born admissions and deaths were excluded. The causes of neonatal death were classified using Wigglesworth's classification. The number of inborn live births during the study period was 10064 and the total number of inborn neonatal admissions was 1475. The total deaths (neonatal and post neonatal) at the neonatal intensive care unit was 73 (63 inborn and 10 out born). Among the inborn, five deaths were post neonatal deaths and hence, excluded from analysis. Among the remaining inborn neonatal deaths (n=58), 34 (59%) were males and 24 (41%) were females. The number of neonatal admissions increased over the years during the study period from 248 to 356, while the number of deaths also increased from 10 deaths in 2006, to 20 deaths in 2009. The primary causes of neonatal deaths were prematurity and its complications 52% (n=30). Lethal congenital malformations lead to 17 (29%) newborn deaths, specific diagnosis in 7 newborns (12%), and birth asphyxia in four (7%) of cases. There was an increasing trend of neonatal admissions and deaths among inborn babies. Prematurity, with sepsis as its major complication and congenital malformations were the leading cause of neonatal mortality.

  2. The Patterns and Causes of Neonatal Mortality at a Tertiary Hospital in Oman

    PubMed Central

    Abdellatif, Mohamed; Ahmed, Masood; Bataclan, Maria Flordeliz; Khan, Ashfaq Ahmed; Al Battashi, Abeer; Al Maniri, Abdullah

    2013-01-01

    Objective To report the patterns and causes of neonatal death from a tertiary care neonatal intensive care unit over a period of four years. Methods This is a retrospective cohort study where four years data (January 2006 - December 2009) of all inborn neonatal admissions and deaths were collected from the neonatal intensive care unit at Sultan Qaboos University hospital on predesigned forms. All out born admissions and deaths were excluded. The causes of neonatal death were classified using Wigglesworth's classification. Results The number of inborn live births during the study period was 10064 and the total number of inborn neonatal admissions was 1475. The total deaths (neonatal and post neonatal) at the neonatal intensive care unit was 73 (63 inborn and 10 out born). Among the inborn, five deaths were post neonatal deaths and hence, excluded from analysis. Among the remaining inborn neonatal deaths (n=58), 34 (59%) were males and 24 (41%) were females. The number of neonatal admissions increased over the years during the study period from 248 to 356, while the number of deaths also increased from 10 deaths in 2006, to 20 deaths in 2009. The primary causes of neonatal deaths were prematurity and its complications 52% (n=30). Lethal congenital malformations lead to 17 (29%) newborn deaths, specific diagnosis in 7 newborns (12%), and birth asphyxia in four (7%) of cases. Conclusion There was an increasing trend of neonatal admissions and deaths among inborn babies. Prematurity, with sepsis as its major complication and congenital malformations were the leading cause of neonatal mortality. PMID:24223246

  3. A multilevel model of methicillin-resistant Staphylococcus aureus acquisition within the hierarchy of an Australian tertiary hospital.

    PubMed

    Kong, Fiona; Paterson, David L; Coory, Michael; Clements, Archie C A

    2012-11-01

    Hospitals without universal single room accommodations typically contain multibed cubicles within wards. In this study, we examined whether the variation in a patient's risk for acquiring methicillin-resistant Staphylococcus aureus (MRSA) in a major tertiary hospital was greatest at the bed, cubicle, or ward level, and quantified the risk of MRSA acquisition associated with exposure to MRSA-colonized/infected patients within the same bed, cubicle, and ward at differently distributed lag times. Nested tri-level hierarchical logistic regression models with random effects were used for non-multiresistant MRSA (nmMRSA) and multiresistant MRSA (mMRSA). The models were internally validated. Receiver operating characteristic curves were used to compare the models' predictive capability The odds of new nmMRSA acquisition were 6.06-fold (95% credible intervals [CrI], 3.93- to 9.34-fold) greater in bed-weeks when a nmMRSA-colonized/infected patient was in the same cubicle 2 weeks earlier. The odds of mMRSA acquisition were 5.12-fold (95% CrI, 4.02- to 6.51-fold) greater in bed-weeks when a colonized/infected patient was in the same ward 2 weeks earlier. The between-cluster variance was highest at the ward level. Patients were at greater risk if there was a colonized/infected patient in the same cubicle or ward 2 weeks earlier. Our findings indicate that focusing on the relevant cubicles and wards during this high-risk period can help target infection control resources more efficiently. Copyright © 2012 Association for Professionals in Infection Control and Epidemiology, Inc. All rights reserved.

  4. Midwives' experiences of transfer in labour from a Western Australian birth centre to a tertiary maternity hospital.

    PubMed

    Kuliukas, Lesley J; Lewis, Lucy; Hauck, Yvonne L; Duggan, Ravani

    2016-02-01

    When transfer in labour takes place from a woman-centred, midwifery led centre to a tertiary maternity hospital it is accepted that women are negatively affected, however the midwife's role is unevaluated, there is no published literature exploring their experience. This study aimed to describe these experiences. Giorgi's descriptive phenomenological method of analysis was used to explore the 'lived' experiences of the midwives. Seventeen interviews of transferring midwives took place and data saturation was achieved. The overall findings suggest that midwives find transfer in labour challenging, both emotionally and practically. Five main themes emerged: (1) 'The midwife's internal conversation' with subtheme: 'Feeling under pressure', (2) 'Challenged to find a role in changing circumstances' with subtheme: 'Varying degrees of support', (3) 'Feeling out of place' with subtheme: 'Caught in the middle of different models of care, (4) 'A constant support for the parents across the labour and birth process' with subthemes: 'Acknowledging the parents' loss of their desired birth' and (5) 'The midwives' need for debrief'. Midwives acknowledged the challenge of finding the balance between fulfilling parents' birth plan wishes with hospital protocol and maintaining safety. Transfer for fetal or maternal compromise caused anxiety and concern. The benefits of providing continuity of care were acknowledged by the midwife's knowledge of the woman and her history but these were not always recognised by the receiving team. Discussing the transfer story afterwards helped midwives review their practice. Effective communication between all stakeholders is essential throughout the transfer process. Copyright © 2015 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.

  5. Six-month outcome in unstable angina patients without previous myocardial infarction according to the use of tertiary cardiologic resources. RESCATE Investigators. Recursos Empleados en el Síndrome Coronario Agudo y Tiempos de Espera.

    PubMed

    Lupón, J; Valle, V; Marrugat, J; Elosua, R; Serés, L; Pavesi, M; Freixa, R; Sanz, G; Masiá, R; Molina, L; Sala, J; Serra, J

    1999-12-01

    The study assessed whether varying accessibility of patients with unstable angina (UA) to coronary angiography and revascularization determined differing usages and outcomes. The appropriate use rate of coronary angiography and revascularization procedures in UA remains to be established. A total of 791 consecutive patients with UA without previous acute myocardial infarction (AMI) admitted to four reference teaching hospitals (one with tertiary facilities) were followed for six months. End points were six-month mortality and readmission for AMI, UA, heart failure, or severe ventricular arrhythmias. Patients admitted to the tertiary hospital were 3.27 (95% confidence interval [CI] 2.32 to 4.62) times more likely to undergo coronary angiography after adjustment for comorbidity and severity than were those admitted to nontertiary facilities (overall six-month use rates 70.1% and 48.3%, respectively). Revascularization procedures were performed in 36.2% of patients in the tertiary hospital and 24.6% in the others (p = 0.0007); adjusted relative risk (RR) 2.37 (95% CI 1.55 to 3.63). Median delay for urgent coronary angiography was shorter in the tertiary hospital (24 h vs. 4 days, p < 0.0002). Six-month mortality and readmission rates were similar in tertiary and nontertiary hospitals: 3.9% versus 5.3% and 16.9% versus 21.2%, respectively. Adjusted RR of death or readmission for the nontertiary hospitals was 1.23 (95% CI 0.57 to 2.67). The use of coronary angiography and revascularization procedures in UA patients with no previous AMI is higher in tertiary than in nontertiary hospitals, but the more selective use of these procedures in nontertiary centers does not imply worse outcome.

  6. The Impact of Hospital Closures and Hospital and Population Characteristics on Increasing Emergency Department Volume: A Geographic Analysis.

    PubMed

    Lee, David C; Carr, Brendan G; Smith, Tony E; Tran, Van C; Polsky, Daniel; Branas, Charles C

    2015-12-01

    Emergency visits are rising nationally, whereas the number of emergency departments is shrinking. However, volume has not increased uniformly at all emergency departments. It is unclear what factors account for this variability in emergency volume growth rates. The objective of this study was to test the association of hospital and population characteristics and the effect of hospital closures with increases in emergency department volume. The study team analyzed emergency department volume at New York State hospitals from 2004 to 2010 using data from cost reports and administrative databases. Multivariate regression was used to evaluate characteristics associated with emergency volume growth. Spatial analytics and distances between hospitals were used in calculating the predicted impact of hospital closures on emergency department use. Among the 192 New York hospitals open from 2004 to 2010, the mean annual increase in emergency department visits was 2.7%, but the range was wide (-5.5% to 11.3%). Emergency volume increased nearly twice as fast at tertiary referral centers (4.8%) and nonurban hospitals (3.7% versus urban at 2.1%) after adjusting for other characteristics. The effect of hospital closures also strongly predicted variation in growth. Emergency volume is increasing faster at specific hospitals: tertiary referral centers, nonurban hospitals, and those near hospital closures. This study provides an understanding of how emergency volume varies among hospitals and predicts the effect of hospital closures in a statewide region. Understanding the impact of these factors on emergency department use is essential to ensure that these populations have access to critical emergency services.

  7. Implementation of Bubble CPAP in a Rural Ugandan Neonatal ICU.

    PubMed

    McAdams, Ryan M; Hedstrom, Anna B; DiBlasi, Robert M; Mant, Jill E; Nyonyintono, James; Otai, Christine D; Lester, Debbie A; Batra, Maneesh

    2015-03-01

    Respiratory distress is a leading cause of neonatal death in low-income and middle-income countries. CPAP is a simple and effective respiratory support modality used to support neonates with respiratory failure and can be used in low-income and middle-income countries. The goal of this study was to describe implementation of the Silverman-Andersen respiratory severity score (RSS) and bubble CPAP in a rural Ugandan neonatal NICU. We sought to determine whether physicians and nurses in a low-income/middle-income setting would assign similar RSS in neonates after an initial training period and over time. We describe the process of training NICU staff to use the RSS to assist in decision making regarding initiation, titration, and termination of bubble CPAP for neonates with respiratory distress. Characteristics of all neonates with respiratory failure treated with bubble CPAP in a rural Ugandan NICU from January to June 2012 are provided. Nineteen NICU staff members (4 doctors and 15 nurses) received RSS training. After this, the Spearman correlation coefficient for respiratory severity scoring between doctor and nurse was 0.73. Twenty-one infants, all < 3 d of age, were treated with CPAP, with 17 infants starting on the day of birth. The majority of infants (16/21, 76%) were preterm, 10 (48%) were <1,500 g (birthweight), and 13 (62%) were outborn. The most common diagnoses were respiratory distress syndrome (16/21, 76%) and birth asphyxia (5/21, 24%). The average RSS was 7.4 ± 1.3 before starting CPAP, 5.2 ± 2.3 after 2-4 h of CPAP, 4.9 ± 2.7 after 12-24 h of CPAP, and 3.5 ± 1.9 before CPAP was discontinued. Duration of treatment with CPAP averaged 79 ± 43 h. Approximately half (11/21, 52%) of infants treated with CPAP survived to discharge. Implementing bubble CPAP in a low-income/middle-income setting is feasible. The RSS may be a simple and useful tool for monitoring a neonate's respiratory status and for guiding CPAP management. Copyright © 2015 by Daedalus

  8. Comparision between bed side testing of blood glucose by glucometer vs centralized testing in a tertiary care hospital.

    PubMed

    Baig, Ayaz; Siddiqui, Imran; Jabbar, Abdul; Azam, Syed Iqbal; Sabir, Salman; Alam, Shahryar; Ghani, Farooq

    2007-01-01

    To determine the accuracy, turnaround time and cost effectiveness of bedside monitoring of blood glucose levels by non-laboratory health care workers and centralized testing of blood glucose by automated analyzer in a tertiary care hospital. The study was conducted in Section of Chemical Pathology, Department of Pathology and Microbiology and Section of Endocrinology Department of Medicine, Aga Khan University and Hospital Karachi, from April 2005 to March 2006. One hundred and ten patients were included in the study. The blood glucose levels were analyzed on glucometer (Precision Abbott) by finger stick, using Biosensor Technology. At the same time venous blood was obtained to analyze glucose in clinical laboratory on automated analyzer (SYNCHRON CX7) by glucose oxidase method. We observed good correlation between bed side glucometer and laboratory automated analyzer for glucose values between 3.3 mmol/L (60 mg/dl) and 16.7 (300 mg/dl). A significant difference was observed for glucose values less than 3.3 mmol/L (p = 0.002) and glucose values more than 16.67 mmol/l (p = 0.049). Mean Turnaround time for glucometer and automated analyzer were 0.08 hours and 2.49 hours respectively. The cost of glucose testing with glucometer was 48.8% lower than centralized lab based testing. Bedside glucometer testing, though less expensive does not have good accuracy in acutely ill patient with either very high or very low blood glucose levels.

  9. Vision Screening of Ophthalmic Nursing Staff in a Tertiary Eye Care Hospital: Outcomes and ocular healthcare-seeking behaviours.

    PubMed

    Khan, Ruhi A; Souru, Ches; Vaghese, Sejo; Yasir, Ziaul; Khandekar, Rajiv

    2017-02-01

    This study aimed to evaluate ocular healthcare-seeking behaviours and vision screening outcomes of nursing staff at a tertiary eye care hospital. This study was conducted between April and September 2016 among all 500 nurses employed at the King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia. Data were collected on age, gender, use of visual aids, the presence of diabetes, a history of refractive surgery and date of last ocular health check-up. Participants were tested using a handheld Spot ™ Vision Screener (Welch Allyn Inc., Skaneateles Falls, New York, USA). A total of 150 nurses participated in the study (response rate: 30.0%). The mean age was 41.2 ± 8.9 years old. Distance spectacles, reading spectacles and both types of spectacles were used by 37 (24.7%), 32 (21.3%) and 10 (6.7%) nurses, respectively. A total of 58 nurses (38.7%) failed the vision screening test. Visual defects were detected for the first time in 13 nurses (8.7%). With regards to regular eye checkups, 77 participants (51.3%) reported acceptable ocular healthcare-seeking behaviours; this factor was significantly associated with age and the use of visual aids ( P <0.01 each). A high proportion of participants failed the vision screening tests and only half displayed good ocular healthcare-seeking behaviours. This is concerning as ophthalmic nurses are likely to face fewer barriers to eye care services than the general population.

  10. Herbal medicine use and linked suspected adverse drug reactions in a prospective cohort of Ugandan inpatients.

    PubMed

    Kiguba, Ronald; Ononge, Sam; Karamagi, Charles; Bird, Sheila M

    2016-05-26

    Clinical history-taking can be employed as a standardized approach to elucidate the use of herbal medicines and their linked suspected adverse drug reactions (ADRs) among hospitalized patients. We sought to identify herbal medicines nominated by Ugandan inpatients; compare nomination rates by ward and gender; confirm the herbs' known pharmacological properties from published literature; and identify ADRs linked to pre-admission use of herbal medicines. Prospective cohort of consented adult inpatients designed to assess medication use and ADRs on one gynaecological and three medical wards of 1790-bed Mulago National Referral Hospital. Baseline and follow-up data were obtained on patients' characteristics, including pre-admission use of herbal medicines. Fourteen percent (26/191) of females in Gynaecology nominated at least one specific herbal medicine compared with 20 % (114/571) of inpatients on medical wards [20 % (69/343) of females; 20 % (45/228) of males]. Frequent nominations were Persea americana (30), Mumbwa/multiple-herb clay rods (23), Aloe barbadensis (22), Beta vulgaris (12), Vernonia amygdalina (11), Commelina africana (7), Bidens pilosa (7), Hoslundia opposita (6), Mangifera indica (4), and Dicliptera laxata (4). Four inpatients experienced 10 suspected ADRs linked to pre-admission herbal medicine use including Commelina africana (4), multiple-herb-mumbwa (1), or unspecified local-herbs (5): three ADR-cases were abortion-related and one kidney-related. The named herbal medicines and their nomination rates generally differed by specialized ward, probably guided by local folklore knowledge of their use. Clinical elicitation from inpatients can generate valuable safety data on herbal medicine use. However, larger routine studies might increase the utility of our method to assess herbal medicine use and detect herb-linked ADRs. Future studies should take testable samples of ADR-implicated herbal medicines for further analysis.

  11. Interventional Pain Management in Rheumatological Diseases - A Three Years Physiatric Experience in a Tertiary Medical College Hospital in Bangladesh

    PubMed Central

    Hasan, Suzon Al; Das, Gautam; Khan, Amin Uddin A

    2011-01-01

    Background Interventional pain management (IPM) is a branch of medical science that deals with management of painful medical conditions using specially equipped X-ray machines and anatomical landmarks. Interventional physiatry is a branch of physical medicine and rehabilitation that treats painful conditions through intervention in peripheral joints, the spine, and soft tissues. Methods A cross-sectional study was conducted using three years of hospital records (2006 to 2008) from the Physical Medicine and Rehabilitation Department at Chittagong Medical College Hospital in Bangladesh, with a view toward highlighting current interventional pain practice in a tertiary medical college hospital. Results The maximum amount of intervention was done in degenerative peripheral joint disorders (600, 46.0%), followed by inflammatory joint diseases (300, 23.0%), soft tissue rheumatism (300, 23.0%), and radicular or referred lower back conditions (100, 8.0%). Of the peripheral joints, the knee was the most common site of intervention. Motor stimulation-guided intralesional injection of methylprednisolone into the piriformis muscle was given in 10 cases of piriformis syndrome refractory to both oral medications and therapeutic exercises. Soft tissue rheumatism of unknown etiology was most common in the form of adhesive capsulitis (90, 64.3%), and is discussed separately. Epidural steroid injection was practiced for various causes of lumbar radiculopathy, with the exception of infective discitis. Conclusions All procedures were performed using anatomical landmarks, as there were no facilities for the C-arm/diagnostic ultrasound required for accurate and safe intervention. A dedicated IPM setup should be a requirement in all PMR departments, to provide better pain management and to reduce the burden on other specialties. PMID:22220242

  12. Analysis of HIV tropism in Ugandan infants

    PubMed Central

    Church, Jessica D.; Huang, Wei; Mwatha, Anthony; Musoke, Philippa; Jackson, J. Brooks; Bagenda, Danstan; Omer, Saad B.; Donnell, Deborah; Nakabiito, Clemensia; Eure, Chineta; Guay, Laura A.; Taylor, Allan; Bakaki, Paul M.; Matovu, Flavia; McConnell, Michelle; Fowler, Mary Glenn; Eshleman, Susan H.

    2010-01-01

    HIV-infected infants may have CXCR4-using (X4-tropic) HIV, CCR5-using (R5-tropic) HIV, or a mixture of R5-tropic and X4-tropic HIV (dual/mixed, DM HIV). The level of infectivity for R5 virus (R5-RLU) varies among HIV-infected infants. HIV tropism and R5-RLU were measured in samples from HIV-infected Ugandan infants using a commercial assay. DM HIV was detected in 7/72 (9.7%) infants at the time of HIV diagnosis (birth or 6–8 weeks of age, 4/15 (26.7%) with subtype D, 3/57 (5.3 %) with other subtypes, P=0.013). A transition from R5-tropic to DM HIV was observed in only two (6.7%) of 30 infants over 6–12 months. Six (85.7%) of seven infants with DM HIV died, compared to 21/67 (31.3%) infants with R5-tropic HIV (p=0.09). Higher R5-RLU at 6–8 weeks was not associated with decreased survival. Infants with in utero infection had a higher median R5-RLU than infants who were HIV-uninfected at birth (p=0.025). PMID:21073438

  13. Workplace violence against resident doctors in a tertiary care hospital in Delhi.

    PubMed

    Anand, Tanu; Grover, Shekhar; Kumar, Rajesh; Kumar, Madhan; Ingle, Gopal Krishna

    2016-01-01

    Healthcare workers particularly doctors are at high risk of being victims of verbal and physical violence perpetrated by patients or their relatives. There is a paucity of studies on work-related violence against doctors in India. We aimed to assess the exposure of workplace violence among doctors, its consequences among those who experienced it and its perceived risk factors. This study was done among doctors working in a tertiary care hospital in Delhi. Data were collected by using a self-administered questionnaire containing items for assessment of workplace violence against doctors, its consequences among those who were assaulted, reporting mechanisms and perceived risk factors. Of the 169 respondents, 104 (61.4%) were men. The mean (SD) age of the study group was 28.6 (4.2) years. Sixty-nine doctors (40.8%) reported being exposed to violence at their workplace in the past 12 months. However, there was no gender-wise difference in the exposure to violence (p=0.86). The point of delivery of emergency services was reported as the most common place for experiencing violence. Verbal abuse was the most common form of violence reported (n=52; 75.4%). Anger, frustration and irritability were the most common symptoms experienced by the doctors who were subjected to violence at the workplace. Only 44.2% of doctors reported the event to the authorities. 'Poor communication skills' was considered to be the most common physician factor responsible for workplace violence against doctors. A large proportion of doctors are victims of violence by their patients or relatives. Violence is being under-reported. There is a need to encourage reporting of violence and prepare healthcare facilities to tackle this emerging issue for the safety of physicians.

  14. Service Quality Of Diagnostic Fine Needle Aspiration Cytology In A Tertiary Care Hospital Of Lahore (Process Measure As Patient's Perspective).

    PubMed

    Rizvi, Zainab; Usmani, Rabia Arshed; Rizvi, Amna; Wazir, Salim; Zahra, Taskeen; Rasool, Hafza

    2017-01-01

    Quality of any service is the most important aspect for the manufacturer as well as the consumer. The primary objective of any nation's health system is to provide supreme quality health care services to its patients. The objective of this study was to assess the quality of diagnostic fine needle aspiration cytology service in a tertiary care hospital. As Patient's perspectives provide valuable information on quality of process, therefore, patient's perception in terms of satisfaction with the service was measured. In this cross sectional analytical study, 291 patients undergoing fine needle aspiration cytology in Mayo Hospital were selected by systematic sampling technique. Information regarding satisfaction of patients with four dimensions of service quality process, namely "procedure, sterilization, conduct and competency of doctor" was collected through interview on questionnaire. The questionnaire was developed on SERVQUAL model, a measurement tool, for quality assessment of services provided to patients. All items were assessed on 2- point likert scale (0=dissatisfied, 1=satisfied). Frequencies and percentages of satisfied and dissatisfied patients were recorded for each item and all items in each dimension were scored. If the percentage of sum of all item scores of a dimension was ≥60, the dimension was 'good quality'. Whereas <60% was 'poor quality' dimension. Data was analysed using epi-info-3.5.1. Fisher test was applied to check statistical significance. (p-value <0.05). Out of the 4 dimensions of service quality process, Procedure (48.8%), Sterilization (51.5%) and practitioner conduct (50.9%) were perceived as 'poor' by the patients. Only practitioner competency (67.4%) was perceived as 'good'. Comparison of dimensions of service quality scoring with overall level of patient satisfaction revealed that all 4 dimensions were significantly related to patient dissatisfaction (p<.05). The study suggests that service quality of therapeutic and diagnostic

  15. Emergence of extended-spectrum β-lactamase producing Enterobacter spp. in patients with bacteremia in a tertiary hospital in southern Brazil.

    PubMed

    Nogueira, Keite da Silva; Paganini, Maria Cristina; Conte, Andréia; Cogo, Laura Lúcia; Taborda de Messias Reason, Iara; da Silva, Márcio José; Dalla-Costa, Libera Maria

    2014-02-01

    Extended-spectrum β-lactamases (ESBLs) are increasingly prevalent in Enterobacter spp., posing a challenge to the treatment of infections caused by this microorganism. The purpose of this retrospective study was to evaluate the prevalence, risk factors, and clinical outcomes of inpatients with bacteremia caused by ESBL and non ESBL-producing Enterobacter spp. in a tertiary hospital over the period 2004-2008. The presence of blaCTX-M, blaTEM, blaSHV, and blaPER genes was detected by polymerase chain reaction (PCR) and nucleotide sequence analysis. Genetic similarity between strains was defined by pulsed-field gel electrophoresis (PFGE). Enterobacter spp. was identified in 205 of 4907 of the patients who had positive blood cultures during hospitalization. Of those cases, 41 (20%) were ESBL-producing Enterobacter spp. Nosocomial pneumonia was the main source of bacteremia caused by ESBL-producing Enterobacter spp. The presence of this microorganism was associated with longer hospital stays. The ESBL genes detected were: CTX-M-2 (23), CTX-M-59 (10), CTX-M-15 (1), SHV-12 (5), and PER-2 (2). While Enterobacter aerogenes strains showed mainly a clonal profile, Enterobacter cloacae strains were polyclonal. Although no difference in clinical outcomes was observed between patients with infections by ESBL-producing and non-ESBL-producing strains, the detection of ESBL in Enterobacter spp. resulted in the change of antimicrobials in 75% of cases, having important implications in the decision-making regarding adequate antimicrobial therapy. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  16. Frequency of color blindness in pre-employment screening in a tertiary health care center in Pakistan.

    PubMed

    Chhipa, Shaukat Ali; Hashmi, Farzeen K; Ali, Shehreen; Kamal, Mustafa; Ahmad, Khabir

    2017-01-01

    To describe the frequency of color vision deficiency among Pakistani adults presenting for pre-employment health screening in a tertiary care hospital. The cross-sectional study was carried out at the Aga Khan University Hospital, Karachi, and the data was collected for color vision deficiency, age, gender, and job applied for from pre-employment examination during 2013-2014. IBM SPSS 20 was used for statistical analysis. Three thousand four hundred and thirty seven persons underwent pre-employment screening during 2013 and 2014; 1837 (53.44%) were males and 1600 (46.65%) females. The mean age was 29.01 (±6.53) years. A total of 0.9% (32/3437) persons had color vision deficiency with male being 1.4% and female 0.4%. Color vision deficiency was observed in 0.9% of candidates screened for pre-employment health check up in a tertiary care hospital. The color vision deficiency was predominantly present in male individuals.

  17. The contribution of multiple pregnancies from overseas fertility treatment to obstetric services in a Western Australian tertiary obstetric hospital.

    PubMed

    Waller, Kylie Anne; Dickinson, Jan E; Hart, Roger J

    2017-08-01

    Increasingly couples are travelling overseas to access assisted reproductive technology, known as cross border reproductive care, although the incidence, pregnancy outcomes and healthcare costs are unknown. To determine obstetric and neonatal outcomes for multiple pregnancies conceived through fertility treatment overseas, and estimate cost of these pregnancies to the health system. Retrospective study of women receiving care for a multiple gestation between July 2013 and June 2015 at Western Australia's sole tertiary obstetric hospital, where conception was by overseas fertility treatment. Obstetric and neonatal outcomes were recorded and cost estimates calculated. Of 11 710 births, 422 were multiple pregnancies. Thirty-seven pregnancies were conceived with fertility treatment, with 11 (29.7%) conceived overseas. Median antenatal clinic attendances, ultrasound examinations, and fetal assessments for the overseas fertility cases were six, 10, and nine, respectively. The gestational age at delivery ranged from 30 to 38 weeks (median 34 + 1). Median neonatal admission duration was 18 days (range 0-47). Cost for obstetric care was estimated between $170 000 and $216 000, and cost of neonatal care was estimated as $810 000, giving a combined total cost of between $980 000 and $1 026 000. At the sole tertiary obstetric centre in WA, approximately one-third of all multiple pregnancies conceived with fertility treatment resulted from treatment overseas. The Australian healthcare cost for these 11 women and their infants exceeded $1 000 000. This study suggests that overseas fertility treatment has a significant health-related cost to the mother and infant, and the local healthcare system. © 2017 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.

  18. Pattern of traumatic brain injury treated by general surgeons in a tertiary referral hospital.

    PubMed

    Chattopadhyay, Shankar Das; Karmakar, Nisith Chandra; Sengupta, Ritankar; SenGupta, Tamal Kanti; Ray, Debasis; Basus, Shibaji

    2013-09-01

    The number of polytrauma patient with associated brain injury or commonly referred as 'head injury' has increased tremendously in recent times courtesy to road traffic accident or other causes. This prospective observational study was conducted in patients of head injury admitted through emergency in the department of general surgery in NRS Medical College, Kolkata during the year 2011 to determine the pattern of head injury patients admitted and nature of intervention. A total number of 3861 patients were admitted in a single year. Obviously this represents the tip of the iceburg. Traumatic brain injury was the highest in the age group of 31-40 years (33.5%) followed by 21-30 years (29.1%) in the most fruitful phase of life. The traumatic brain injury death was more common in males. The maximum number of cases was from rural areas ie, farmers and labours. To minimise the morbidity and mortality resulting from head injury there is need for better maintenance of roads, improvement of road visibility and lighting, rigid enforcement of traffic rules and imparting road safety education to school children. Despite valiant efforts and advancement in medical sciences and infrastructure in the form of neurosurgery departments and trauma care units to cope with the changing world of trauma, there still remains a huge responsibility and a definite part to be played by the general surgeons to manage head injury patient even in tertiary hospitals.

  19. Distribution and clinical aspects of primary immunodeficiencies in a Taiwan pediatric tertiary hospital during a 20-year period.

    PubMed

    Lee, Wen-I; Kuo, Ming-Ling; Huang, Jing-Long; Lin, Syh-Jae; Wu, Cheng-Jang

    2005-03-01

    Recent advances in immunologic techniques have lead to increased recognition of primary immunodeficiencies. A review of patients with suspected immunodeficiencies in a Taiwan tertiary hospital from January 1985 to October 2004 and molecular/genetic analyses done on some patients were investigated. Of the 403 patients selected based on the International Classification of Disease, Ninth Revision, 37 patients with PID (8 females and 29 males) were identified: 17 (46%) with antibody production deficiencies, nine (24%) with defective phagocyte function, four (11%) with combined B and T cell immunodeficiencies, seven (19%) with T cell deficiencies, but none with primary complement deficiencies. Those with secondary immunodeficiencies were excluded from the study. Recurrent sinopulmonary infections (62%) were the most common clinical manifestation, followed by sepsis (57%), severe skin infection (40%), splenomegaly/hepatomegaly (27%), central nervous system dysfunction (22%), chronic diarrhea (22%), and failure to thrive (19%). Seven (19%) patients died, five of infections, one of disseminated intravascular coagulopathy and one of hepatocellular carcinoma. Six novel mutations were found from 11 agreed patients. This is the first report on primary immunodeficiencies in Taiwan covering a 20-year period.

  20. Evaluation of hand hygiene adherence in a tertiary hospital.

    PubMed

    Novoa, Ana M; Pi-Sunyer, Teresa; Sala, Maria; Molins, Eduard; Castells, Xavier

    2007-12-01

    Although hand hygiene is the most important measure in the prevention of nosocomial infection, adherence to recommendations among health care workers (HCW) is low. Evaluation of compliance with hand hygiene was carried out in a Spanish teaching hospital. In 2005, adherence to hand hygiene was evaluated hospital wide through direct observation, collecting data on hand hygiene carried out whenever indicated (opportunity for hand hygiene). Compliance was defined as handwashing/disinfection in an opportunity for hand hygiene according to hospital protocols. The results were analyzed using mixed effects models, with the HCW observed as the random effect. A total of 1254 opportunities for hand hygiene were observed in 247 HCWs. Mean compliance was 20%. Although few differences were observed among types of HCW, compliance varied according to hospital area (69% in the intensive care unit [ICU]) and timing with respect to patient contact (compliance after contact was twice that before contact). Multivariate analyses revealed a protective odds ratio (OR) for nonadherence in ICUs (OR, 0.04; 95% confidence interval (95% CI): 0.01-0.10) and after patient contact (OR, 0.25; 95% CI: 0.17-0.38). Low adherence observed suggests that new interventions should focus in modification of HCWs' habits and attitudes, working at several levels: individual and institutional.

  1. An outbreak of Burkholderia cepacia complex in the paediatric unit of a tertiary care hospital.

    PubMed

    Mali, Swapna; Dash, Lona; Gautam, Vikas; Shastri, Jayanthi; Kumar, Sunil

    2017-01-01

    Burkholderia cepacia complex (Bcc) has emerged as a serious nosocomial pathogen worldwide especially in patients with indwelling catheters and cystic fibrosis. Bcc is a common contaminant of pharmaceutical products. We describe an outbreak of Bcc bacteraemia amongst children admitted in Paediatric Intensive Care Unit (PICU) and paediatric ward at a tertiary care hospital, Mumbai, in Western India. Blood culture samples from paediatric patients yielded growth of non-fermenting, oxidase positive, motile, Gram negative bacilli (NFGNB) (76/909) over a period of 8 months. Based on conventional biochemical tests and antimicrobial susceptibility testing, these isolates were provisionally identified as Bcc. The increased, repeated and continued isolation of Bcc alerted the possibility of an outbreak confined to PICU and paediatric ward. Active surveillance was undertaken to trace the source and contain the outbreak. Isolates were subjected to recA polymerase chain reaction (PCR) and Expanded multilocus sequence typing (EMLST). Surveillance revealed the presence of Bcc on the upper surface of rubber stopper of sealed multidose amikacin vials. Isolates from blood culture and rubber stoppers were confirmed as Bcc by recA PCR. EMLST revealed that these isolates shared an identical novel sequence type 824 proving clonality. Timely interventions instituted led to control of the outbreak. This study highlights the importance of identification and molecular characterization of Bcc to establish its role in infection and outbreak.

  2. Complications associated with blood donations in a blood bank at an Indian tertiary care hospital.

    PubMed

    Meena, Monika; Jindal, Tarun

    2014-09-01

    Blood donation, though safe, has a few potentially avoidable complications associated with it. They are important reasons for the failure of the donors to return for repeat donations. The aim of this study was to assess the frequency and identify the possible factors associated with increased risk of blood donation related complications so that they can be minimized. A prospective study was done over a period of four months in the blood bank of an Indian tertiary care hospital to record the donation related complications. Out of 7450 blood donations, total donation associated complications were 74, of which majority were vasovagal reactions (VVRs) (n=48), followed by venous hematomas (n=24) and arterial punctures (n=2). The incidence of VVRs was more, though not statistically significant, in females, replacement/repeat donors, donors between 21-30 y of age and who had a body-mass-index (BMI) of 18.5-24.9. VVRs were more common in April (p=0.002) and in those who donated 450ml of blood (p<0.001). Though hematomas were more frequent in females, voluntary donors, donors in age-group of 41-50, those with BMI<18.5 and in those who donated 350ml of blood, statistically significant association was seen only in repeat donors (p<0.001). Our study emphasizes that blood donation in our country has a complication rate of nearly 1%.

  3. Severe maternal morbidity and near misses in tertiary hospitals, Kelantan, Malaysia: a cross-sectional study.

    PubMed

    Norhayati, Mohd Noor; Nik Hazlina, Nik Hussain; Sulaiman, Zaharah; Azman, Mohd Yacob

    2016-03-05

    Severe maternal conditions have increasingly been used as alternative measurements of the quality of maternal care and as alternative strategies to reduce maternal mortality. We aimed to study severe maternal morbidity and maternal near miss among women in two tertiary hospitals in Kota Bharu, Kelantan, Malaysia. A cross-sectional study with record review was conducted in 2014. Severe maternal morbidity and maternal near miss were classified using the new World Health Organization criteria. Health indicators for obstetric care were calculated and descriptive analyses were performed using SPSS version 22.0. In total, 21,579 live births, 395 women with severe maternal morbidity, 47 women with maternal near miss and two maternal deaths were analysed. The severe maternal morbidity incidence ratio was 18.3 per 1000 live births and the maternal near miss incidence ratio was 2.2 per 1000 live births. The maternal near miss mortality ratio was 23.5 and the mortality index was 4.1 %. The process indicators for essential interventions were almost 100.0 %. Haemorrhagic disorders were the most common event for severe maternal morbidity (68.6 %) and maternal near miss (80.9 %) and management-based criteria accounted for 85.1 %. Comprehensive emergency care and intensive care as well as overall improvements in the quality of maternal health care need to be achieved to substantial reduce maternal death.

  4. Puerperal sepsis, the leading cause of maternal deaths at a Tertiary University Teaching Hospital in Uganda.

    PubMed

    Ngonzi, Joseph; Tornes, Yarine Fajardo; Mukasa, Peter Kivunike; Salongo, Wasswa; Kabakyenga, Jerome; Sezalio, Masembe; Wouters, Kristien; Jacqueym, Yves; Van Geertruyden, Jean-Pierre

    2016-08-05

    Maternal mortality is highest in sub-Saharan Africa. In Uganda, the WHO- MDG 5 (aimed at reducing maternal mortality by 75 % between 1990 and 2015) has not been attained. The current maternal mortality ratio (MMR) in Uganda is 438 per 100,000 live births coming from 550 per 100,000 in 1990. This study sets out to find causes and predictors of maternal deaths in a tertiary University teaching Hospital in Uganda. The study was a retrospective unmatched case control study which was carried out at the maternity unit of Mbarara Regional Referral Hospital (MRRH). The sample included pregnant women aged 15-49 years admitted to the Maternity unit between January 2011 and November 2014. Data from patient charts of 139 maternal deaths (cases) and 417 controls was collected using a standard audit/data extraction form. Multivariable logistic regression analysis was used to assess for the factors associated with maternal mortality. Direct causes of mortality accounted for 77.7 % while indirect causes contributed 22.3 %. The most frequent cause of maternal mortality was puerperal sepsis (30.9 %), followed by obstetric hemorrhage (21.6 %), hypertensive disorders in pregnancy (14.4 %), abortion complications (10.8 %). Malaria was the commonest indirect cause of mortality accounting for 8.92 %. On multivariable logistic regression analysis, the factors associated with maternal mortality were: primary or no education (OR 1.9; 95 % CI, 1.0-3.3); HIV positive sero-status (OR, 3.6; 95 % CI, 1.9-7.0); no antenatal care attendance (OR 3.6; 95 % CI, 1.8-7.0); rural dwellers (OR, 4.5; 95 % CI, 2.5-8.3); having been referred from another health facility (OR 5.0; 95 % CI, 2.9-10.0); delay to seek health care (delay-1) (OR 36.9; 95 % CI, 16.2-84.4). Most maternal deaths occur among mothers from rural areas, uneducated, HIV positive, unbooked mothers (lack of antenatal care), referred mothers in critical conditions and mothers delaying to seek health care. Puerperal sepsis is

  5. Workplace violence, job satisfaction, burnout, perceived organisational support and their effects on turnover intention among Chinese nurses in tertiary hospitals: a cross-sectional study

    PubMed Central

    Zhang, Zhong; Liu, Xinyan; Li, Li; Duan, Xiaojian; Li, Guoqiang; Lou, Fengge; Jia, Xiaoli; Fan, Lihua; Sun, Tao; Ni, Xin

    2018-01-01

    Objectives Our aims were to assess the relationship between workplace violence, job satisfaction, burnout, organisational support and turnover intention, and to explore factors associated with turnover intention among nurses in Chinese tertiary hospitals. Methods The purposive sampling method was used to collect data from August 2016 through January 2017. A total of 1761 nurses from 9 public tertiary hospitals in 4 provinces (municipalities) located in eastern (Beijing), central (Heilongjiang, Anhui) and western (Shaanxi) regions of China completed the questionnaires (effective response rate=85.20%). A cross-sectional study was conducted using the Workplace Violence Scale, Chinese Maslach Burnout Inventory General Survey, Minnesota Job Satisfaction Questionnaire Revised Short Version, Perceived Organizational Support-Simplified Version Scale and Turnover Intention Scale. Results A total of 1216 of 1706 (69.1%) participants had high turnover intention. During the previous 12 months, the prevalence of physical violence and psychological violence towards nurses was 9.60% and 59.64%, respectively. As expected, the level of turnover intention was negatively correlated with participants’ scores on job satisfaction (r=−0.367, p<0.001) and perceived organisational support (r=−0.379, p<0.001), respectively. Burnout was positively associated with turnover intention (r=0.444, p<0.001). Workplace violence was positively associated with turnover intention (β=0.035, p<0.001) in linear regression analysis. The total effect (β=0.53) of workplace violence on turnover intention comprised its direct effect (β=0.36) and its indirect effect (β=0.17). Conclusions Perceived organisational support served as a mediator between workplace violence, job satisfaction, burnout and turnover intention, and it had a significantly negative impact on turnover intention. Therefore, nursing managers should understand the importance of the organisation’s support and establish a reasonable

  6. Prospective observational study of emergent endotracheal intubation practice in the intensive care unit and emergency department of an Australian regional tertiary hospital.

    PubMed

    Phillips, Luke; Orford, Neil; Ragg, Michael

    2014-08-01

    The present study aimed to describe the characteristics and outcomes of intubation occurring in the ICU and ED of an Australian tertiary teaching hospital. This was a prospective observational study of intubation practice across the Geelong Hospital over a 6 month period from 1 August 2012 to 31 January 2013. Data were entered by the intubating team through an online data collection form. There were 119 patients intubated and 134 attempts at intubation in the ED and ICU over a 6 month period. The first-pass success rate was 104/119 (87.4%), and all but a single patient was intubated by the second attempt. Propofol, fentanyl, midazolam and suxamethonium were the most common drugs used in rapid sequence induction. AEs were reported in 44/134 (32.8%) of intubation attempts, with transient hypoxia and hypotension being the most common. A significant adverse outcome, namely aspiration pneumonitis, occurred in one patient. There were no peri-intubation deaths. The majority of airways are managed by ICU and ED consultants and trainees, with success rates and AE rates comparable with other published studies. © 2014 Australasian College for Emergency Medicine and Australasian Society for Emergency Medicine.

  7. Water, socioeconomic factors, and human herpesvirus 8 infection in Ugandan children and their mothers.

    PubMed

    Mbulaiteye, Sam M; Biggar, Robert J; Pfeiffer, Ruth M; Bakaki, Paul M; Gamache, Christine; Owor, Anchilla M; Katongole-Mbidde, Edward; Ndugwa, Christopher M; Goedert, James J; Whitby, Denise; Engels, Eric A

    2005-04-01

    Human herpesvirus 8 (HHV-8) infection is common in sub-Saharan Africa, but its distribution is uneven. Transmission occurs during childhood within families by unclear routes. We evaluated 600 Ugandan children with sickle cell disease and their mothers for factors associated with HHV-8 seropositivity in a cross-sectional study. HHV-8 serostatus was determined using an HHV-8 K8.1 glycoprotein enzyme immunoassay. Odds ratios for seropositivity were estimated using logistic regression, and factor analysis was used to identify clustering among socioeconomic variables. One hundred seventeen (21%) of 561 children and 166 (34%) of 485 mothers with definite HHV-8 serostatus were seropositive. For children, seropositivity was associated with age, mother's HHV-8 serostatus (especially for children aged 6 years or younger), lower maternal education level, mother's income, and low-status father's occupation (P < 0.05 for all). Using communal standpipe or using surface water sources were both associated with seropositivity (OR 2.70, 95% CI 0.80-9.06 and 4.02, 95% CI 1.18-13.7, respectively) as compared to using private tap water. These associations remained, albeit attenuated, after adjusting for maternal education and child's age (P = 0.08). In factor analysis, low scores on environmental and family factors, which captured household and parental characteristics, respectively, were positively associated with seropositivity (P(trend) < 0.05 for both). For mothers, HHV-8 seropositivity was significantly associated with water source and maternal income. HHV-8 infection in Ugandan children was associated with lower socioeconomic status and using surface water. Households with limited access to water may have less hygienic practices that increase risk for HHV-8 infection.

  8. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    PubMed

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  9. The Current Working Conditions in Ugandan Apparel Assembly Plants.

    PubMed

    Tebyetekerwa, Mike; Akankwasa, Nicholus Tayari; Marriam, Ifra

    2017-12-01

    The present rapid shift of industrialization from developed to developing countries requires developing countries to understand issues related to work organization, management, and working conditions. There are many factors slackening production, of which working conditions is part. A complete inquiry into the workers' working conditions can enable managements to reduce risks in the workplaces and improve productivity. Understanding and awareness of the benefits of workplace research and a probe into the working conditions in the Ugandan apparel assembly plants are urgently required. A total of 103 (70 women and 33 men) workers from five different plants were interviewed. Together with the top management of various plants, questionnaires about the workers' opinions of their physical working conditions were prepared. Data was collected using two methods: (1) questionnaire; and (2) observation of the workers during their work. The results indicated that poor plant working conditions were mainly contributed by the workers' social factors and the management policies. The government, together with the management, should work to improve the working conditions in the apparel assembly plants, as it greatly affects both.

  10. Revisiting profile of deliberate self-harm at a tertiary care hospital after an interval of 10 years.

    PubMed

    Singh, Paramjeet; Shah, Raghav; Midha, Purav; Soni, Ajitabh; Bagotia, Sunil; Gaur, Kusum Lata

    2016-01-01

    Sociocultural factors complement psychopathological factors that result in deliberate self-harm (DSH). A study of change in these factors over time is essential for preventive action. To identify factors influencing DSH, which have shown significant variation over a period of 10 years. Two hospital-based cross-sectional analytic types of observational studies were performed at two different times at an interval of 10 years. Sociodemographic profile, factors related to DSH, stressful life events, and psychiatric disorders were assessed in two groups of patients drawn from the same tertiary care hospital, 100 consecutive patients in 2002 and 117 in 2012. The observations were compared to identify factors that have undergone significant change. Descriptive statistics along with Chi-square test was used in this study. A significant decrease in the overall number of married subjects (60% vs. 43%) and an increase in the number of unmarried females (34% vs. 61%) were seen. A significant increase in the overall number of rural subjects (17% vs. 34%) and especially in a number of rural females (7% vs. 23%) was also seen. An increase in subjects from middle socioeconomic class (15% vs. 29%) and education up to secondary school (9% vs. 25%) was also seen. A significantly higher number of subjects had a psychiatric disorder (50% vs. 81%) with a significant increase in diagnoses of depression (36% vs. 67%). Family and social issues remain the most common antecedent stressful events. Chemical methods are still the most preferred means, but a higher number (8% vs. 18%) report a history of self-harm. Variations in factors responsible for DSH identified in this comparative study have preventive implications.

  11. Trends of Do-Not-Resuscitate consent and hospice care utilization among noncancer decedents in a tertiary hospital in Taiwan between 2010 and 2014: A Hospital-based observational study.

    PubMed

    Chang, Hsiao-Ting; Lin, Ming-Hwai; Chen, Chun-Ku; Chou, Pesus; Chen, Tzeng-Ji; Hwang, Shinn-Jang

    2016-11-01

    Do-Not-Resuscitate (DNR) and hospice care are not only applied to cancer patients but also to patients with noncancer progressive illness. However, the trends of DNR consent and hospice utilization are not well explored for noncancer patients. This study aimed to explore the trends of DNR consent and hospice care utilization among noncancer decedents in a tertiary hospital in Taiwan. We analyzed the Death and Hospice Palliative Care Database from the Taipei Veterans General Hospital in Taiwan. The Death and Hospice Palliative Care Database contains information including patient sex, major diagnosis, admission date, date of death, age at death, department at discharge, status of DNR consent, and status of hospice care of patients who died in the Taipei Veterans General Hospital. Data on patients aged 20 years old or more who died of major terminal noncancer diseases, including brain diseases, amyotrophic lateral sclerosis, dementia, chronic obstructive pulmonary disease (COPD) and other lung diseases, heart failure, chronic liver diseases and cirrhosis, and renal failure between 2010 and 2014 were extracted for analysis. A total of 1416 patients aged 20 years or more died of major noncancer diseases in Taipei Veterans General Hospital during the study period. The most common diagnosis was brain diseases, amyotrophic lateral sclerosis, and dementias (n = 510, 36%) followed by chronic obstructive pulmonary disease and other lung diseases (n = 322, 22.7%). Among these noncancer decedents, 1045 (73.8%) had DNR consents, while 134 (9.5%) received hospice care. Patients diagnosed with renal failure had the highest percentage of DNR consent (80%), followed by chronic liver diseases and cirrhosis (77.7%). Patients diagnosed with chronic liver diseases and cirrhosis had the highest percentage of hospice utilization (17.4%), followed by renal failure (15.8%). The percentages of DNR consent and hospice utilization were significantly different across different disease

  12. Characterization of Enterobacteriaceae isolates obtained from a tertiary care hospital in Mexico, which produces extended-spectrum β-lactamase.

    PubMed

    Morfín-Otero, Rayo; Mendoza-Olazarán, Soraya; Silva-Sánchez, Jesús; Rodríguez-Noriega, Eduardo; Laca-Díaz, Jorge; Tinoco-Carrillo, Perla; Petersen, Luis; López, Perla; Reyna-Flores, Fernando; Alcantar-Curiel, Dolores; Garza-Ramos, Ulises; Garza-González, Elvira

    2013-10-01

    The prevalence and genetic characteristics of Escherichia coli and Klebsiella pneumoniae clinical isolates producing extended-spectrum β-lactamase (ESBL) were examined. Between October 2010 and March 2011, E. coli (n=460) and K. pneumoniae (n=78) isolates were collected at a tertiary care hospital in Guadalajara, Mexico. The minimum inhibitory concentration (MIC) for each isolate was determined using a broth microdilution method, and ESBL production was assayed. The presence of β-lactamase genes, blaSHV, blaCTX-M, and blaTLA-1, was detected by PCR and confirmed with sequencing. Only ESBL-producing isolates were further subjected to pulsed-field gel electrophoresis (PFGE) and plasmid profiling. All of the ESBL isolates were multidrug resistant and 75/460 (16.3%) E. coli isolates and 21/78 (26.9%) K. pneumoniae isolates were found to produce ESBL. For the E. coli isolates, >95% susceptibility to amikacin, meropenem, fosfomycin, imipenem, and nitrofurantoin was observed. For K. pneumoniae, similar results were obtained, with discrepancies observed for gentamicin and nitrofurantoin. PFGE further identified eleven pulsotypes for E. coli and three clusters of K. pneumoniae. CTX-M-15 was detected in 85% of ESBL-producing E. coli and in 76% of ESBL-producing K. pneumoniae. In contrast, SHV-5 ESBL was identified in 17% of E. coli isolates and in 86% of K. pneumoniae isolates. The bla-TLA-1 gene was not detected in any of the 96 isolates analyzed. Overall, CTX-M-15 and SHV-5 were found to have a high rate of spread throughout the hospital and were associated with strong multidrug resistance.

  13. Depression and posttraumatic stress disorder among road traffic accident victims managed in a Tertiary hospital in Southern Nigeria.

    PubMed

    Asuquo, J E; Edet, B E; Abang, I E; Essien, E A; Osakwe, O G; Aigbomain, E J; Chigbundu, K C

    2017-02-01

    Psychological responses to traumatic events vary widely across different cultures but studies in the developing countries are scant. The objective of this study is to determine prevalence of depression and posttraumatic stress disorder (PTSD) among patients involved in road traffic accident (RTA) compared with that of the general population using a matched control group. The study design was case control and employed the convenient sampling technique. All consecutive attendees of the trauma clinic of a Tertiary Hospital who had been involved in RTA in the previous year and met inclusion criteria were recruited to participate in the study. Controls were drawn from patient relatives attending other clinics in the same hospital. The final sample comprised of 46 cases and controls, totaling 92 participants. A Sociodemographic questionnaire, the PTSD, and depression modules of the Mini International neuropsychiatric interview were administered to both groups by trained research assistants. The data were analyzed using IBM SPSS version 22. Statistical significance was set at 0.05. The prevalence of PTSD among cases was 41.3% compared with 13% among controls, whereas the prevalence of depression among cases was 63% compared with 30.4% among the controls. Both of these findings were statistically significant (P < 0.002). Sociodemographic variables such as age, sex, marital status, religion, level of education, and occupation did not have statistically significant relationship with neither PTSD nor depression. Mental disorders such as PTSD and depression are common in victims of RTA. They would benefit from comanagement with mental health specialists.

  14. Neglect Contributing to Tertiary Hospitalization in Childhood Asthma.

    ERIC Educational Resources Information Center

    Boxer, Gary H.; And Others

    1988-01-01

    The study examined the extent to which child neglect and family dysfunction have contributed to the need for hospitalization of asthmatic children. Using a measure of global functioning, psychologic morbidity is associated with medical neglect. (Author/DB)

  15. [Spectrum of primary immunodeficiencies in a tertiary hospital over a period of 10 years].

    PubMed

    Martín-Nalda, A; Soler-Palacín, P; Español Borén, T; Caragol Urgelles, I; Díaz de Heredia Rubio, C; Figueras Nadal, C

    2011-02-01

    More than 200 primary immunodeficiencies (PID) have been described and about 60% present during childhood. Early diagnosis and treatment have been shown to improve patient outcome. Analysis of patients with a PID diagnosed in a paediatric tertiary care hospital-referral centre over a period of 10 years. Medical records of all paediatric patients followed up in our unit were retrospectively reviewed. Clinical and epidemiological features, laboratory tests, therapy and outcome were analysed. One hundred and eighty nine patients were followed up in this period of time. Antibody disorders were the most common diagnosis. In our series, clinical presentation at diagnosis were: recurrent respiratory infections in selective IgA deficiency and common variable immunodeficiency (CVID) patients, failure to thrive and opportunistic infections (mainly viral infections) in patients with severe combined immunodeficiency (SCID), skin abscesses (Staphylococcus aureus, Serratia spp.) and complicated pneumonia (Aspergillus spp., Rhodococcus equi) in chronic granulomatous disease, congenital heart disease and consistent phenotype in 22q11 deletion syndrome, skin abscesses and ecthyma gangrenosum in severe congenital neutropenia and opportunistic infections and sepsis (Pseudomonas aeruginosa) in children with X-linked agammaglobulinaemia (XLA). Lymphoproliferative disorders were common in CVID. No malignancies were observed during this period. One patient with XLA developed chronic encephalitis. All patients with CVID and XLA were receiving immunoglobulin replacement therapy (8 intravenous and 14 (since 2006) subcutaneous route) and in all but two SCID patients, stem cell transplantation was performed. Outcome was good in most of them except 8 SCID (2 prior and 6 after transplantation), 3 Wiskott-Aldrich syndrome, 1 complete DiGeorge, 1 chronic granulomatous disease and 1 ataxia-telangiectasia patients who died during follow-up. The vast majority of patients included in this series

  16. Addressing the midwifery workforce crisis: evaluating an employment model for undergraduate midwifery students at a tertiary maternity hospital in Melbourne, Australia.

    PubMed

    McLachlan, Helen L; Forster, Della A; Ford, Rachael L; Farrell, Tanya

    2011-12-01

    In Victoria, maternity services are under significant strain due to increased numbers of women giving birth and critical workforce shortages. Hospitals have experienced challenges in adequately staffing maternity units, particularly on postnatal wards. In 2008, a tertiary maternity hospital in Melbourne introduced a model where undergraduate midwifery students were employed as Division 2 nurses (SMW_Div2) (enrolled nurses), to work in the postnatal area only. This study explored the pilot employment model from the perspective of the SMW_Div2 and hospital midwives. A web-based survey was administered to hospital midwives and the SMW_Div2s in the employment model in January 2010. The survey explored the views of midwives and SMW_Div2s regarding the perceived impact of the model on workforce readiness, recruitment and retention, and clinical competence and confidence. Forty-seven of 158 midwives (30%) and five of nine SMW_Div2s employed in the model responded to the survey. Both groups considered the model to have benefits for the organisation, including increased: student workforce readiness; clinical confidence and competence; and organisational loyalty. Both groups also considered that the model would facilitate: workforce recruitment; a teaching and learning culture within the organisation; and enhanced partnerships between students, hospitals and universities. Caution was expressed regarding workload and the need for ongoing support for SMW_Div2s working in the model. SMW_Div2s and midwives were positive about the introduction of the paid employment model at the Women's. The findings are consistent with evaluations of similar programs in the nursing setting. The employment model has potential short and long term individual and organisational advantages, which is important in the context of increasing births and workforce shortages. Progression of such models will be contingent on the collaboration and cooperation of the various stakeholders involved in maternity

  17. Evaluation of request forms submitted to the haematology laboratory in a Ghanaian tertiary hospital.

    PubMed

    Olayemi, Edeghonghon; Asiamah-Broni, Rebecca

    2011-01-01

    Laboratory request forms provide information about the laboratory test being requested for. They carry demographic data and other information such as location of patient, laboratory number, doctor's name, signature of the doctor, telephone number of the requesting doctor. Omission of information on the forms may lead to laboratory errors. The aim of this study was to evaluate the level of completion of laboratory request forms at the haematology department of a Ghanaian tertiary hospital. Three thousand request forms submitted to the haematology department between January and April 2010 were retrieved and studied. The information provided on each request form was recorded in a spread sheet and analyzed. The patient's age and sex were missing in 25.6% and 32.7% of the forms respectively. About half of the request forms did not have the patient's location. No clinical detail was provided on 22.7% of the forms. Doctors were more likely to sign their request forms and provide a name but they all failed to provide an address or a contact telephone number. This study demonstrates that, the standard of completion of request forms was poor. Essential information required on the forms was often missing. This can lead to limited advice given by laboratory physicians and may increase the potential for errors. Conversely, provision of all the information needed on the forms will aid laboratory diagnosis and enhance patient care and save time and resources. There should be closer interaction between clinicians and laboratory personnel to improve quality of services.

  18. Evaluating Nurses Acceptance of Hospital Information Systems: A Case Study of a Tertiary Care Hospital.

    PubMed

    Khalifa, Mohamed

    2016-01-01

    This study aims at evaluating hospital information systems (HIS) acceptance factors among nurses, in order to provide suggestions for successful HIS implementation. The study used mainly quantitative survey methods to collect data directly from nurses through a questionnaire. The availability of computers in the hospital was one of the most influential factors, with a special emphasis on the unavailability of laptop computers and computers on wheels to facilitate immediate data entry and retrieval when nurses are at the point of care. Nurses believed that HIS might frequently slow down the process of care delivery and increase the time spent by patients inside the hospital especially during slow performance and responsiveness phases. Recommendations were classified into three main areas; improving system performance and availability of computers in the hospital, increasing organizational support in the form of providing training and protected time for nurses' to learn and enhancing users' feedback by listening to their complaints and considering their suggestions.

  19. Diagnostic Value of the Serum Anti-Toxocara IgG Titer for Ocular Toxocariasis in Patients with Uveitis at a Tertiary Hospital in Korea

    PubMed Central

    Bae, Ki Woong; Ahn, Seong Joon; Park, Kyu Hyung

    2016-01-01

    Purpose This study evaluated the prevalence of ocular toxocariasis (OT) in patients with uveitis of unknown etiology who visited a tertiary hospital in South Korea and assessed the success of serum anti-Toxocara immunoglobulin G (IgG) enzyme-linked immunosorbent assay (ELISA) as a diagnostic test for OT. Methods The records of consecutive patients with intraocular inflammation of unknown etiology were reviewed. All participants underwent clinical and laboratory investigations, including ELISA for serum anti-Toxocara IgG. OT was diagnosed based on typical clinical findings. Clinical characteristics, seropositivity, and IgG titers were compared between patients diagnosed with OT and non-OT uveitis. The seropositivity and the diagnostic value of anti-Toxocara IgG was investigated among patients with different types of uveitis. Results Of 238 patients with uveitis of unknown etiology, 71 (29.8%) were diagnosed with OT, and 80 (33.6%) had positive ELISA results for serum anti-Toxocara IgG. The sensitivity and specificity of the ELISA test were 91.5% (65 / 71) and 91.0% (152 / 167), respectively. The positive predictive value of the serum anti-Toxocara IgG assay was 81.3%. Among patients with anterior, intermediate, posterior, and panuveitis, the prevalence rates of OT were 8.3%, 47.1%, 44.8%, and 7.1%, respectively; the seropositivity percentages were 18.1%, 47.1%, 43.7%, and 17.9%; and the positive predictive values were 38.5%, 95.8%, 92.1%, and 40.0%. The serum anti-Toxocara IgG titer also significantly decreased following albendazole treatment. Conclusions OT is a common cause of intraocular inflammation in the tertiary hospital setting. Considering that OT is more prevalent in intermediate and posterior uveitis, and that the positive predictive value of the anti-Toxocara IgG assay is high, a routine test for anti-Toxocara IgG might be necessary for Korean patients with intermediate and posterior uveitis. PMID:27478352

  20. Evaluation of pneumococcal vaccination rates after vaccine protocol changes and nurse education in a tertiary care teaching hospital.

    PubMed

    Smith, Jennifer G; Metzger, Nicole L

    2011-11-01

    Pneumococcal vaccination in eligible patients is recommended by the Infectious Disease Society of America and the Centers for Disease Control (CDC) Advisory Committee on Immunization Practices. Because hospitalization provides an opportunity to vaccinate patients at high risk for developing serious pneumonia complications, eligibility screening and administration of the pneumococcal vaccine prior to discharge in qualified patients are evaluated by the Joint Commission and the Centers for Medicare Medicaid Services (CMS) as part of pneumococcal vaccination core quality measures. Among patients with an inpatient diagnosis of pneumonia in 2008, 56% in our 580-bed tertiary care teaching hospital, compared with 84% nationwide, received pneumococcal vaccination. To improve pneumococcal vaccination rates for all patients in the study facility and not just those with pneumonia, a multifaceted intervention including a revised nurse screening tool, rescheduling of the vaccine order, storage of the vaccine in automated dispensing cabinets on the nursing unit, and creation of a vaccine tracking system was developed and implemented between August 2009 and October 2009. To determine the impact of a multifaceted intervention on pneumococcal vaccine screening and administration rates in eligible patients according to the CDC recommendations who were admitted to an internal medicine unit of a tertiary care teaching hospital. All patients aged 18 years or older from 2 internal medicine units were identified during 4-month time intervals before (pre-intervention, April through July 2009) and after (post-intervention, November 2009 through February 2010) implementation of the multifaceted pneumococcal vaccine protocol. Of these, 150 patients from each 4-month period were randomly selected for electronic medical record review. Eligibility for pneumococcal vaccination was derived from the CDC recommendations and consensus of the vaccine steering committee at the study institution; the

  1. Assessment of pediatric residents burnout in a tertiary academic centre

    PubMed Central

    Jamjoom, Roaa S.; Park, Yoon S.

    2018-01-01

    Objectives: To study burnout among pediatric residents at King Abdulazaiz University Hospital in Jeddah, Saudi Arabia. Methods: This is a cross-sectional survey that was administered to all pediatric residents enrolled in the Saudi Paediatric Board program (PGY1-PGY4) in a large tertiary academic hospital in the Western region of Saudi Arabia (King Abdulaziz University Hospital). The survey were sent via E-mail to 50 registered general pediatric residents. Results: Seventy percent of the pediatric residents completed the survey. More than 70% of residents experiencing severe burnout. Forty-three percent suffering emotional exhaustion, 71.8% experiencing depersonalization and 40.6% suffering from low accomplishment. Conclusion: Burnout syndrome appear to be a serious threat to resident well-being in our program. Moreover, pediatric residents in our institute experienced higher levels of depersonalization than their peers nationally and internationally. PMID:29543309

  2. Genome-wide population structure and admixture analysis reveals weak differentiation among Ugandan goat breeds.

    PubMed

    Onzima, R B; Upadhyay, M R; Mukiibi, R; Kanis, E; Groenen, M A M; Crooijmans, R P M A

    2018-02-01

    Uganda has a large population of goats, predominantly from indigenous breeds reared in diverse production systems, whose existence is threatened by crossbreeding with exotic Boer goats. Knowledge about the genetic characteristics and relationships among these Ugandan goat breeds and the potential admixture with Boer goats is still limited. Using a medium-density single nucleotide polymorphism (SNP) panel, we assessed the genetic diversity, population structure and admixture in six goat breeds in Uganda: Boer, Karamojong, Kigezi, Mubende, Small East African and Sebei. All the animals had genotypes for about 46 105 SNPs after quality control. We found high proportions of polymorphic SNPs ranging from 0.885 (Kigezi) to 0.928 (Sebei). The overall mean observed (H O ) and expected (H E ) heterozygosity across breeds was 0.355 ± 0.147 and 0.384 ± 0.143 respectively. Principal components, genetic distances and admixture analyses revealed weak population sub-structuring among the breeds. Principal components separated Kigezi and weakly Small East African from other indigenous goats. Sebei and Karamojong were tightly entangled together, whereas Mubende occupied a more central position with high admixture from all other local breeds. The Boer breed showed a unique cluster from the Ugandan indigenous goat breeds. The results reflect common ancestry but also some level of geographical differentiation. admixture and f 4 statistics revealed gene flow from Boer and varying levels of genetic admixture among the breeds. Generally, moderate to high levels of genetic variability were observed. Our findings provide useful insights into maintaining genetic diversity and designing appropriate breeding programs to exploit within-breed diversity and heterozygote advantage in crossbreeding schemes. © 2018 The Authors. Animal Genetics published by John Wiley & Sons Ltd on behalf of Stichting International Foundation for Animal Genetics.

  3. Media ownership and news framing: an analysis of HIV/AIDS coverage by Ugandan press.

    PubMed

    Kiwanuka-Tondo, James; Albada, Kelly F; Payton, Fay Cobb

    2012-12-01

    Applying framing theory, the present research analyzes trends in Ugandan news coverage and the prominent issue frames for HIV/AIDS-related stories. In order to determine the influence of other factors, such as media ownership and journalist origin, nearly 800 articles, from 2000 to 2004, were gathered from the major private newspaper and government-owned newspaper in Uganda. After systematic sampling, 365 articles constitute the sample. The results indicate that print news coverage of HIV and AIDS followed a non-linear trajectory, declining from 2000-2002 and then increasing from 2003-2004. Curative medicine emerged as the most prominent issue frame. Higher-risk behaviour was the least prominent issue frame overall. The 'solutions' issue frame nearly doubled in prominence from 2000-2004, while the HIV-prevention frame decreased from 2000-2002 and then rebounded from 2003-2004. Concerning HIV-related topics, the private newspaper included more features, printed lengthier articles, incorporated a greater variety of news frames, and published more articles by foreign journalists than the government-owned newspaper. The private newspaper employed the 'HIV-prevention,' 'action,' and 'victims' frames more often than the government-owned newspaper. Journalists at the government-owned newspaper adopted a 'solutions' frame more often than their private-press counterparts. Though foreign journalists were more likely than local journalists to employ the HIV-prevention frame, additional tests revealed that the news organisation for which the journalists worked contributed to issue framing to a greater extent than did either a local or foreign reporting origin. Local (Ugandan) journalists working for the two news organisations differed in their tendencies to apply the HIV-prevention, action, victims, and tragedy frames in news stories on HIV and AIDS, with journalists at the private newspaper using these frames more often than did journalists at the government-owned newspaper.

  4. Parental Satisfaction with Pediatric Day-Care Surgery and its Determinants in a Tertiary Care Hospital

    PubMed Central

    Sam, Cenita James; Arunachalam, Pavai A.; Manivasagan, Sivamani; Surya, T.

    2017-01-01

    Objective: The objective is to assess the level of parental satisfaction of pediatric day-care surgery and its different determinants. Materials and Methods: This is a descriptive study performed in a tertiary care hospital in India among parents of pediatric day-care surgery patients from June 2013 to March 2015. The core questionnaire for the assessment of patient satisfaction for general day care (COPS-D) was used. Variables related to surgery, overall satisfaction, one open-ended question, and socio-demographic data were also collected. Calculated sample size was 121. Results: The mean and standard deviation of parental satisfaction were estimated in eight domains of day care (COPS-D) using Likert scale 1–5. Preadmission visit had a mean of 4.63 (0.52), day of surgery 4.65 (0.58), operating room 4.76 (0.51), nursing care 4.46 (0.79), medical care 4.89 (0.48), information 4.51 (0.68), autonomy 4.64 (0.56), and discharge 4.50 (0.72). In elder children, there was less satisfaction on the information and discharge domains. Overall satisfaction was good in 88% of patients and was less than satisfactory when they had significant pain. Conclusion: Perception of quality of pediatric day-care surgery was assessed with a questionnaire and was found to be good. Variables related to surgery such as pain may be included in the questionnaire for assessing satisfaction in the day-care surgery. PMID:28974875

  5. [Registry of non-ST elevation acute coronary syndromes in a tertiary hospital (RESCATA-SEST registry)].

    PubMed

    González-Pliego, José Angel; Gutiérrez-Díaz, Gonzalo Israel; Celis, Alfredo; Gudiño-Amezcua, Diego Armando

    2014-01-01

    To describe the clinical-epidemiologic profile and the process of care of the non-ST elevation acute coronary syndromes in a tertiary hospital. We analyzed the clinical information, the risk stratification and diagnostic methods, the revascularization therapy and the prescription trends at discharge, of patients with non-ST elevation acute coronary syndromes cared for in one year. Two hundred and eighty-three patients with mean age of 58 years were included (63% men). The largest number of non-ST elevation acute coronary syndromes (88.6%) was found between 50 to 59 years of age. The most common risk factor was hypertension; 82.5% of the patients had a low-intermediate TIMI score; residual ischemia was demonstrated in 37% and coronary obstructions were seen in 80 patients (70%). In 90%, a percutaneous coronary intervention was performed, mainly with drug-eluting Stents (87.5%). At discharge, even though antiplatelet agents and statins were prescribed in more than 90%, other drugs were indicated in a few more than 50% of patients. In this population, non-ST elevation acute coronary syndromes predominates in relatively young men, often with hypertension. To stratify risk, to look for residual ischemia and to revascularize with drug-eluting stents are common practices, but the evidence-based guidelines compliance is still suboptimal. Copyright © 2013 Instituto Nacional de Cardiología Ignacio Chávez. Published by Masson Doyma México S.A. All rights reserved.

  6. Complicated jejunal diverticula as surgical emergency: experience at a tertiary care hospital in Peshawar, Pakistan.

    PubMed

    Ahmed, Ijaz; Naeem, Mohammad; Samad, Ambreen; Nasir, Amir; Aman, Zahid; Ahmed, Siddique; Manan, Fazal

    2010-01-01

    Diverticula of small intestine are rare. Jejunal diverticula can be single or multiple. Diverticula in the jejunum tend to be large and multiple. Clinically they may be asymptomatic or may give rise to symptoms like pain, flatulence and borborygmi, may produce malabsorption syndrome or may present in emergency with different acute pathologies like perforation, haemorrhage, obstruction, enterolith formation and inflammation. The Objective was to see the pattern of complications in jejunal diverticula presenting as a surgical emergency. This descriptive study was conducted at Surgical Units of the 3 tertiary care Hospitals of Peshawar, for 7 years from January 1, 2002 to December 31, 2008. Study included all patients presenting to and admitted in Surgical Unit, Hayatabad Medical Complex, Peshawar with complicated jejunal diverticula during the above mentioned period. Name, age, sex, other relevant data, history and examination findings and results of investigation were recorded. Uncomplicated jejuna diverticula were excluded from study. The operative findings and the type of complication were recorded. Ten patients were admitted during 7 years of study. Out of all patients 9 were male and 1 was female. Eight out of 10 patients presented with perforation of diverticula while 1 patient had severe inflammation of diverticulum causing pain, ileus and acute abdomen. One patient had acute pain due to adhesion formation. It is seen that complicated jejunal diverticulae are quite rare and the most common complication is perforation. Inflammation and adhesion are other complications with which jejunal diverticula presented during this study.

  7. Denosumab-associated hypocalcaemia: incidence, severity and patient characteristics in a tertiary hospital setting.

    PubMed

    Huynh, Andrew Liem Hieu; Baker, Scott Thomas; Stewardson, Andrew James; Johnson, Douglas Forsyth

    2016-11-01

    Denosumab-associated hypocalcaemia (DAH) has been reported in patients with osteoporosis or metastatic bone disease and is associated with stages 4 and 5 chronic kidney disease (CKD, estimated glomerular filtration rate <30 mL/min/1.73m 2 ). Other risk factors for hypocalcaemia have not been fully elucidated. We aimed to investigate the incidence of hypocalcaemia amongst patients receiving denosumab and to identify clinical features associated with this adverse event. Retrospective cohort study between June 2013 and June 2014 of patients administered denosumab (60/120 mg) at a tertiary hospital in Melbourne, Australia, to identify the incidence of an albumin-adjusted serum calcium concentration <2.10 mmol/L or ionized calcium <1.13 mmol/L within 6 months of treatment. Univariable and multivariable logistic regression analyses were performed to identify clinical features associated with DAH. One hundred and fifty-five patients were administered denosumab (100 osteoporosis, 55 bone metastases). Twenty-two patients (14% [95%CI 9.1-20.7]) developed hypocalcaemia: 55% were men, and 55% had osteoporosis. Eighty-six per cent had a 25-hydroxyvitamin D concentration >50 nmol/L, and 91% were on calcium/colecalciferol supplementation. Stages 4 and 5 CKD (adjusted odd ratio [aOR] 4.71, 95%CI 1.61-13.79, p = 0.005) and male sex (aOR 4.30, 95%CI 1.69-10.96, p = 0.002) were associated with DAH. No patients were documented as having hypocalcaemic symptoms. One patient received intravenous calcium gluconate treatment. The incidence of denosumab-associated hypocalcaemia was 14% (95%CI 9.1-20.7) within 6 months of treatment despite widespread use of appropriate calcium/colecalciferol supplementation. Stages 4 and 5 CKD and male sex were associated with subsequent hypocalcaemia. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  8. Welfare, wellness, and job satisfaction of Chinese physicians: A national survey of public tertiary hospitals in China.

    PubMed

    Sun, Jing; Ma, Jing; Hu, Guangyu; Zhao, Qi; Yuan, Changzheng; Si, Wen; Zhang, Xinqing; Liu, Yuanli

    2017-07-01

    Little national data are available on Chinese physicians' welfare, wellness, and job satisfaction. We conducted a self-administered smartphone-based national survey in early 2016 of 17 945 physicians from 136 tertiary hospitals across 31 provinces in China. In addition to collecting the physicians' basic information, we also measured 5 domains (the ethical and working environments, welfare, wellness, and job satisfaction). Half of the physicians reported a hospital-based annual income of less than RMB 72 000 ($10 300), and 60.31% of them did not think that the current medical pricing system reflects physicians' value. More than half (58.64%) of them did not have or did not know about medical malpractice insurance. These physicians worked long hours (an average of 10 h) and slept short hours (average 6 h). Only 35.78% of them thought that they were in good health, and 51.03% were in good mental health. Approximately, a quarter of them had helped to pay medical bills for patients who could not afford care, and 1 in 7 has been penalised for seeing patients who generated bad debts. Only 33.42% of them thought that their occupation receives social recognition and respect, and 70.98% would not encourage their children to pursue a medical career. The top 3 factors that may influence physician job satisfaction as chosen by the physicians were as follows: (1) the income distribution policy (45.92%), (2) working environment safety (25.86%), and (3) public trust and respect for their job (16.10%). In conclusion, we found that Chinese physicians bear heavy physical, mental, and financial stress, and many of them lack confidence that they receive trust and respect from society. Copyright © 2017 John Wiley & Sons, Ltd.

  9. Long-term and clinical profile of heart failure with recovered ejection fraction in a non-tertiary hospital.

    PubMed

    Martínez-Mateo, Virgilio; Fernández-Anguita, Manuel; Cejudo, Laura; Martín-Barrios, Eugenia; Paule, Antonio J

    2018-06-05

    Heart failure (HF) with recovered ejection fraction (EF) is emerging as a different HF subtype. There is little information about his clinical profile in hospitals that are not a reference. We analysed characteristics and prognosis in patients with recovered HF followed prospectively in the HF Unit of a non-tertiary hospital. A total of 431 patients with HF with reduced EF were followed (median 50 months, 79.3% males, mean age 70.3±12.2years). Of the patients, 26.9% (N 116) recovered EF, mainly in the first year of follow-up (76.7%). Compared with patients that did not recovered EF in the follow-up, they were younger, rate of ischemic origin of cardiomyopathy was less frequent and presented less comorbidity. Mortality was lower in patients with recovered HF (survival median of 85.2±2.1 vs. 74.2±1.9 months [log-rank χ 2 11.5, P=0.001], hazard ratio 0.37, 95% confidence interval [CI]: 0.21-0.67, P=0.002). Aetiology of deaths was not mainly secondary to HF. Younger age of 68 years (odds ratio [OR] 0-98, 95% CI: 0.96-0,99; P=0.025), ischemic origin (OR 1.12, 95% CI: 1.01-1.21; P=0.003) and use of aldosterone antagonists (OR 1.89, 95% CI: 1.09-3.26; P=0.023) were the variables independently associated to normalisation of EF. HF with recovered EF is a frequent phenomenon. It has a more favourable clinical course, prognosis and basal characteristics than HF with persistent reduced EF. Further studies are needed to identify natural history and optimal medications for HF-recovered patients. Copyright © 2018 Elsevier España, S.L.U. All rights reserved.

  10. Peri-operative management of high-risk paediatric adenotonsillectomy patients: A survey of 35 UK tertiary referral centres.

    PubMed

    Cheong, Ryan Chin Taw; Bowles, Philippe; Moore, Andrew; Watts, Simon

    2017-05-01

    Peri-operative management of high-risk paediatric patients undergoing adenotonsillectomy for treatment of obstructive sleep apnoea varies between tertiary referral hospitals. 'Day of surgery cancellation' (DoSC) rates of up to 11% have been reported due to pre-booked critical care being unavailable on the day of surgery as a result of competing needs from other hospital departments. We report the results of a survey of peri-operative management in UK tertiary care centres of high-risk paediatric patients undergoing adenotonsillectomy for obstructive sleep apnoea (OSA). An 8-point questionnaire was developed using a cloud-based software platform (www.surveymonkey.com). A web-link to the survey was embedded in a customised e-mail which was sent via secure server to the Clinical Leads for Paediatric Otolaryngology at 35 United Kingdom (UK) Tertiary referral centres. The survey response rate was 60% (n = 21). Almost all (94.1%) of centres considered paediatric critical care facilities to be limited, with 70.6% (n = 12) stating that DoSC often occurred due to unavailable paediatric critical care capacity. There was variation between tertiary referral units in the practice applied for pre-booking critical care beds (our survey identifies 6 variations) (Table 1). The most frequent selection method reported (47.1%) was at the discretion of the booking clinician at the time of listing the patient for surgery. In the context of limited critical care resources, variation in practice and difficulty in accurately predicting which patients will require post-operative critical care beds, a review and consensus on best practice in the peri-operative management of high risk paediatric adenotonsillectomy patients may offer a safe means of reducing cancellations and improving patient care, resource allocation and hospital efficiency. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Women's experience of intrapartum transfer from a Western Australian birth centre co-located to a tertiary maternity hospital.

    PubMed

    Kuliukas, Lesley; Duggan, Ravani; Lewis, Lucy; Hauck, Yvonne

    2016-02-08

    The aim of this Western Australian study was to describe the overall labour and birth experience of women who were transferred during the first and second stages of labour from a low risk woman-centred, midwifery-led birth centre to a co-located tertiary maternity referral hospital. Using a descriptive phenomenological design, fifteen women were interviewed up to 8 weeks post birth (July to October, 2013) to explore their experience of the intrapartum transfer. Giorgi's method of analysis was used. The following themes and subthemes emerged: 1) The midwife's voice with subthemes, a) The calming effect and b) Speaking up on my behalf; 2) In the zone with subthemes, a) Hanging in there and b) Post birth rationalizing; 3) Best of both worlds with subthemes a) The feeling of relief on transfer to tertiary birth suite and b) Returning back to the comfort and familiarity of the birth centre; 4) Lost sense of self; and 5) Lost birth dream with subthemes a) Narrowing of options and b) Feeling of panic. Women found the midwife's voice guided them through the transfer experience and were appreciative of continuity of care. There was a sense of disruption to expectations and disappointment in not achieving the labour and birth they had anticipated. There was however appreciation that the referral facility was nearby and experts were close at hand. The focus of care altered from woman to fetus, making women feel diminished. Women were glad to return to the familiar birth centre after the birth with the opportunity to talk through and fully understand their labour journey which helped them contextualise the transfer as one part of the whole experience. Findings can inform midwives of the value of a continuity of care model within a birth centre, allowing women both familiarity and peace of mind. Maternity care providers should ensure that the woman remains the focus of care after transfer and understand the significance of effective communication to ensure women are included

  12. Using survival analysis to determine association between maternal pelvis height and antenatal fetal head descent in Ugandan mothers.

    PubMed

    Munabi, Ian Guyton; Luboga, Samuel Abilemech; Mirembe, Florence

    2015-01-01

    Fetal head descent is used to demonstrate the maternal pelvis capacity to accommodate the fetal head. This is especially important in low resource settings that have high rates of childbirth related maternal deaths and morbidity. This study looked at maternal height and an additional measure, maternal pelvis height, from automotive engineering. The objective of the study was to determine the associations between maternal: height and pelvis height with the rate of fetal head descent in expectant Ugandan mothers. This was a cross sectional study on 1265 singleton mothers attending antenatal clinics at five hospitals in various parts of Uganda. In addition to the routine antenatal examination, each mother had their pelvis height recorded following informed consent. Survival analysis was done using STATA 12. It was found that 27% of mothers had fetal head descent with an incident rate of 0.028 per week after the 25th week of pregnancy. Significant associations were observed between the rate of fetal head descent with: maternal height (Adj Haz ratio 0.93 P < 0.01) and maternal pelvis height (Adj Haz ratio 1.15 P < 0.01). The significant associations observed between maternal: height and pelvis height with rate of fetal head descent, demonstrate a need for further study of maternal pelvis height as an additional decision support tool for screening mothers in low resource settings.

  13. Using survival analysis to determine association between maternal pelvis height and antenatal fetal head descent in Ugandan mothers

    PubMed Central

    Munabi, Ian Guyton; Luboga, Samuel Abilemech; Mirembe, Florence

    2015-01-01

    Introduction Fetal head descent is used to demonstrate the maternal pelvis capacity to accommodate the fetal head. This is especially important in low resource settings that have high rates of childbirth related maternal deaths and morbidity. This study looked at maternal height and an additional measure, maternal pelvis height, from automotive engineering. The objective of the study was to determine the associations between maternal: height and pelvis height with the rate of fetal head descent in expectant Ugandan mothers. Methods This was a cross sectional study on 1265 singleton mothers attending antenatal clinics at five hospitals in various parts of Uganda. In addition to the routine antenatal examination, each mother had their pelvis height recorded following informed consent. Survival analysis was done using STATA 12. Results It was found that 27% of mothers had fetal head descent with an incident rate of 0.028 per week after the 25th week of pregnancy. Significant associations were observed between the rate of fetal head descent with: maternal height (Adj Haz ratio 0.93 P < 0.01) and maternal pelvis height (Adj Haz ratio 1.15 P < 0.01). Conclusion The significant associations observed between maternal: height and pelvis height with rate of fetal head descent, demonstrate a need for further study of maternal pelvis height as an additional decision support tool for screening mothers in low resource settings. PMID:26918071

  14. Diagnosis of imported Ugandan typhoid fever based on local outbreak information: A case report.

    PubMed

    Ota, Shinichiro; Maki, Yohei; Mori, Kazuma; Hamamoto, Takaaki; Kurokawa, Atsushi; Ishihara, Masashi; Yamamoto, Takayuki; Imai, Kazuo; Misawa, Kazuhisa; Yuki, Atsushi; Fujikura, Yuji; Maeda, Takuya; Kawana, Akihiko

    2016-11-01

    Re-emerging multidrug-resistant typhoid fever is becoming a worldwide threat, especially in East Africa. At the beginning of 2015, an outbreak of typhoid fever started in the capital city of Uganda, and 1940 suspected cases were reported by 5 March 2015. In this report, we describe a case of typhoid fever caused by a MDR strain with HIV infection and hemoglobin S-syndrome thalassemia in an Ugandan from Kampala City. It is essential to consider MDR strains of Salmonella enterica serovar Typhi infections, including fluoroquinolone-resistant strains, in patients from Africa and Southeast Asia. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  15. Characteristics of Travel-Related Severe Plasmodium vivax and Plasmodium falciparum Malaria in Individuals Hospitalized at a Tertiary Referral Center in Lima, Peru.

    PubMed

    Llanos-Chea, Fiorella; Martínez, Dalila; Rosas, Angel; Samalvides, Frine; Vinetz, Joseph M; Llanos-Cuentas, Alejandro

    2015-12-01

    Severe Plasmodium falciparum malaria is uncommon in South America. Lima, Peru, while not endemic for malaria, is home to specialized centers for infectious diseases that admit and manage patients with severe malaria (SM), all of whom contracted infection during travel. This retrospective study describes severe travel-related malaria in individuals admitted to one tertiary care referral hospital in Lima, Peru; severity was classified based on criteria published by the World Health Organization in 2000. Data were abstracted from medical records of patients with SM admitted to Hospital Nacional Cayetano Heredia from 2006 to 2011. Of 33 SM cases with complete clinical data, the mean age was 39 years and the male/female ratio was 2.8. Most cases were contracted in known endemic regions within Peru: Amazonia (47%), the central jungle (18%), and the northern coast (12%); cases were also found in five (15%) travelers returning from Africa. Plasmodium vivax was most commonly identified (71%) among the severe infections, followed by P. falciparum (18%); mixed infections composed 11% of the group. Among the criteria of severity, jaundice was most common (58%), followed by severe thrombocytopenia (47%), hyperpyrexia (32%), and shock (15%). Plasmodium vivax mono-infection predominated as the etiology of SM in cases acquired in Peru. © The American Society of Tropical Medicine and Hygiene.

  16. Appropriateness of gram-negative agent use at a tertiary care hospital in the setting of significant antimicrobial resistance.

    PubMed

    Vora, Neil M; Kubin, Christine J; Furuya, E Yoko

    2015-01-01

    Background.  Practicing antimicrobial stewardship in the setting of widespread antimicrobial resistance among gram-negative bacilli, particularly in urban areas, is challenging. Methods.  We conducted a retrospective cross-sectional study at a tertiary care hospital with an established antimicrobial stewardship program in New York, New York to determine appropriateness of use of gram-negative antimicrobials and to identify factors associated with suboptimal antimicrobial use. Adult inpatients who received gram-negative agents on 2 dates, 1 June 2010 or 1 December 2010, were identified through pharmacy records. Clinical data were collected for each patient. Use of gram-negative agents was deemed optimal or suboptimal through chart review and according to hospital guidelines. Data were compared using χ(2) or Fischer's exact test for categorical variables and Student t test or Mann-Whitney U test for continuous variables. Results.  A total of 356 patients were included who received 422 gram-negative agents. Administration was deemed suboptimal in 26% of instances, with the most common reason being spectrum of activity too broad. In multivariable analysis, being in an intensive care unit (adjusted odds ratio [aOR], .49; 95% confidence interval [CI], .29-.84), having an infectious diseases consultation within the previous 7 days (aOR, .52; 95% CI, .28-.98), and having a history of multidrug-resistant gram-negative bacilli within the past year (aOR, .24; 95% CI, .09-.65) were associated with optimal gram-negative agent use. Beta-lactam/beta-lactamase inhibitor combination drug use (aOR, 2.6; 95% CI, 1.35-5.16) was associated with suboptimal use. Conclusions.  Gram-negative agents were used too broadly despite numerous antimicrobial stewardship program activities.

  17. Evaluation and Improvement of the Nurse Satisfactory Status in a Tertiary Hospital using the Professional Practice Environment Scale.

    PubMed

    Liu, Jun; Zhou, Hui; Yang, Xiaoqin

    2017-02-18

    The present study was performed to quantitatively examine nurse satisfaction, to investigate the associated factors influencing satisfaction, and to evaluate the effect of improvement measures based on these factors. A survey using the 38-item Chinese version of the Practice Environment Scale (CPPE-38) was performed in a university-affiliated tertiary hospital in Shanghai, China in 2013. Linear regression analysis was performed to screen for associated factors related to each CPPE-3 score and the total satisfaction score. Several improvement measures were established to improve nurse satisfaction, and the CPPE-38 survey was again performed in 2015 to evaluate the effect of these improvement measures. A total of 1,050 respondents were recruited in 2013, with a response rate of 87.6%. The total satisfaction score of the CPPE-38 was 2.99±0.64. The lowest score in a subscale of the CPPE-38 was 2.40±0.59 for interpersonal interaction and the highest score was 3.15±0.40 for internal work motivation. Work location was associated with scores for work motivation and total satisfaction, while the highest education degree was associated with scores for internal relationship and autonomy. The scores for internal work motivation, control over practice, interpersonal interaction, and internal relationship and autonomy were significantly improved in 2015 after two years of improvement efforts, while the total satisfaction score was not significantly different compared to the 2013 score. Working location and education degree were two factors correlated with CPPE-38 scores in our hospital. Humanistic concerns, continuing education, and pay raise may improve the practice satisfaction of nurses.

  18. Phenotypic and genotypic characteristics of carbapenem-resistant Enterobacteriaceae in a tertiary-level reference hospital in Turkey.

    PubMed

    Baran, Irmak; Aksu, Neriman

    2016-04-06

    Enterobacteriaceae are among the most common pathogens that are responsible for serious community-acquired, hospital-acquired, and health-care associated infections. The emergence and spread of carbapenem-resistant Enterobacteriaceae (CRE) have become an increasing concern for healthcare services worldwide. Infections caused by these bacteria have been associated with significant morbidity and mortality and treatment options have been limited. The rapid and accurate detection of carbapenem resistance in these bacteria is important for infection control. The aim of this study was to investigate the phenotypic and genotypic features of CRE strains isolated in a tertiary-level reference hospital in Turkey. A total of 181 CRE strains were included in the study. Antimicrobial susceptibility rates were tested using Vitek 2 system. Modified Hodge test (MHT) was performed using meropenem and ertapenem discs. Metallo-β-lactamase antimicrobial gradient test (E-test MBL strips) were used for evaluation of metallo-β-lactamase production. A multiplex PCR was used for detection of carbapenems resistance genes (IMP, VIM, KPC, NDM-1 and OXA-48). The OXA-48 gene was detected in 86 strains, NDM-1 gene in six strains, VIM gene in one strain. IMP and KPC genes were not identified. Three strains produced both OXA-48 and NDM-1 and one strain produced both OXA-48 and VIM. In two patients more than one genus of OXA-48 positive CREs was isolated. Ninety-two of the isolates were multidrug-resistant. One hundred and ten isolates were MHT with meropenem (MEM-MHT) positive and 109 isolates were MHT with ertapenem (ERT-MHT) positive. Nine of the isolates were positive with E-test MBL strips. The sensitivity of MEM-MHT and ERT-MHT for detection of OXA-48 was 70.9 and 70.6 %, respectively. MEM-MHT was found highly discriminative for OXA-48 Escherichia coli (p < 0.001). The sensitivity of E-test MBL for NDM-1 was 66.7 %. A statistically significant correlation was observed between OXA-48

  19. Quality of acute asthma care in two tertiary hospitals in a state in South Western Nigeria: A report of clinical audit.

    PubMed

    Desalu, Olufemi Olumuyiwa; Adeoti, Adekunle Olatayo; Ogunmola, Olarinde Jeffrey; Fadare, Joseph Olusesan; Kolawole, Tolutope Fasanmi

    2016-01-01

    To audit the quality of acute asthma care in two tertiary hospitals in a state in the southwestern region of Nigeria and to compare the clinical practice against the recommendations of the Global Initiative for Asthma (GINA) guideline. We carried out a retrospective analysis of 101 patients who presented with acute exacerbation of asthma to the hospital between November 2010 and October 2015. Majority of the cases were females (66.3%), <45 years of age (60.4%), and admitted in the wet season (64.4%). The median duration of hospital stay was 2 days (interquartile range; 1-3 days) and the mortality was 1.0%. At admission, 73 (72.3%) patients had their triggering factors documented and 33 (32.7%) had their severity assessed. Smoking status, medication adherence, serial oxygen saturation, and peak expiratory flow rate measurement were documented in less than half of the cases, respectively. Seventy-six (75.2%) patients had nebulized salbutamol, 89 (88.1%) had systemic corticosteroid, and 78 (77.2%) had within 1 h. On discharge, 68 (67.3%) patients were given follow-up appointment and 32 (31.7%) were reviewed within 30 days after discharge. Less than half were prescribed an inhaled corticosteroid (ICS), a self-management plan, or had their inhaler technique reviewed or controller medications adjusted. Overall, adherence to the GINA guideline was not satisfactory and was very poor among the medical officers. The quality of acute asthma care in our setting is not satisfactory, and there is a low level of compliance with most recommendations of asthma guidelines. This audit has implicated the need to address the non-performing areas and organizational issues to improve the quality of care.

  20. Parents' Perceived Satisfaction of Care, Communication and Environment of the Pediatric Intensive Care Units at a Tertiary Children's Hospital.

    PubMed

    Abuqamar, Maram; Arabiat, Diana H; Holmes, Sandra

    2016-01-01

    This study aims to identify parental perceptions on pediatric intensive care-related satisfaction within three domains: environment, child's care provided and communication. In addition, it aims to identify whether parent's socio-demographics and child's clinical variables predict parents' perceived satisfaction. In this study, a total of 123 parents whose child received care in the PICU of a tertiary children's hospital in Amman completed the Arabic version of the parents satisfaction survey (PSS). A cross-sectional, descriptive-correlational design was used to collect data. All data were collected between June and October of 2013. Central tendency measures and percentages of replies for each domain revealed that at least 7 items were rated poorly satisfied. More than half of the parents were not satisfied with the noise level of the PICU, the time nurses spent at the child's bedside, as well as the way the healthcare team prepare them for the child's admission. Almost 90% of the parents believed that the nurses ignored their child's needs by not listening to parents and by responding slowly to child's needs. Stepwise regression analysis showed that that the number of hospital admissions, health insurance and the severity of illness was the main predictor of parents' satisfaction. In conclusion, the availability of health care professionals, the support and the information they share with the child's parents are all significant to parent's satisfaction and hence to better quality of care. Targeting the domains of low satisfaction reported by the parents could increase parent's satisfaction and achieve quality improvement required for this population. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Tertiary work-up of apparent treatment-resistant hypertension.

    PubMed

    Heimark, Sondre; Eskås, Per Anders; Mariampillai, Julian Eek; Larstorp, Anne Cecilie K; Høieggen, Aud; Fadl Elmula, Fadl Elmula M

    2016-10-01

    Treatment-resistant hypertension (TRH) has regained attention with development of new methods for treatment. However, the prevalence of TRH varies considerably from primary to secondary and tertiary care. We aimed to assess the prevalence of true TRH in a population of patients with apparent TRH in a university hospital setting of tertiary work-up and also investigate reasons for poor BP control and evaluate how work-up can be performed in general practice and secondary care. In this cohort study, we characterize a study population from Oslo Renal Denervation (RDN) Study. Patients (n = 83) were referred for RDN from secondary care. All patients underwent thorough medical investigation and 24-h ambulatory blood pressure measurements (24ABPM) after directly observed therapy (DOT). We then assessed reasons for lack of BP control. Fifty-three of 83 patients did not have true TRH. Main reasons for non-TRH were poor drug adherence (32%), secondary hypertension (30%) and white coat hypertension (15%). Forty-seven percent achieved blood pressure control after DOT with subsequent 24ABPM. There were otherwise no statistically significant differences in patient characteristics between the true TRH and the non-TRH group. Despite being a highly selected cohort referred for tertiary work-up of apparent TRH, BP control was achieved or secondary causes were identified in almost two thirds of the patients. Thorough investigation according to guidelines and DOT with subsequent 24ABPM is needed in work-up of apparent TRH.

  2. Evaluation of Central Macular Thickness and Retinal Nerve Fiber Layer Thickness using Spectral Domain Optical Coherence Tomography in a Tertiary Care Hospital

    PubMed Central

    Saini, VK; Gupta, Saroj; Sharma, Anjali

    2014-01-01

    ABSTRACT Purpose: To evaluate the normative data of macular thickness and retinal nerve fiber layer thickness (RNFL) among normal subjects using spectral domain optical coherence tomography (OCT). Materials and methods: Normal subjects presenting to a tertiary medical hospital were included in the study. All patient underwent clinical examination followed by study of macular thickness and RN FL thick ness by spectral domain Topc on OCT. The data was collected and analyzed for variations in gender and age. The data was also compared with available literature. Results: Total numbers of patients enrolled in the study were 154 (308 eyes). Numbers of males were 79 (158 eyes) and numbers of females were 75 (150 eyes). The mean age among males was 42.67 ± 12.15 years and mean age among females was 42.88 ± 11.73 years. Overall the mean mac ular thickness (central 1 mm zone) with SD - OCT was 241.75 ± 17.3 microns. The mean macular volume was 7.6 cu. mm ± 0.33. On analysis of the RNFL thickness, we observed that the RNFL was thickest in the inferior quadrant (138.58) followed by superior (122.30) nasal (116.32) and temporal quadrant (73.04). Gender-wise comparison of the data revealed no statistically significant difference for age, macular thickness parameters, volume and RFNL values except outer temporal thickness among males and females. No age-related difference was noted in the above parameters. On comparison with available norma tive data from India and elsewhere, we found significant variations with different machines. Conclusion: The study is the first to provide normative data using SD-OCT from central India. The data from spectral domain OCT correlated well with the values obtained from similar studies with SD - OCT. Values obtained from time domain OCT machines are different and are not comparable. How to cite this article: Agarwal P, Saini VK, Gupta S, Sharma A. Evaluation of Central Macular Thickness and Retinal Nerve Fiber Layer Thickness using Spectral

  3. [Delirium in Patients Over 60 Years of Age in a Tertiary Level Public Hospital in the City of Pereira (Colombia): Under-Diagnosed and Under-Recorded].

    PubMed

    César Sánchez, Julio; Isabel González, Martha; César Gutiérrez, Julio

    2013-06-01

    Delirium is a common disorder in the hospitalized geriatric population and it has a great importance on the clinical outcome of inpatients; however, delirium is not diagnosed properly. To clarify the state of delirium diagnosis and records in a tertiary level public hospital in the city of Pereira. A cross-sectional descriptive study was performed by searching the clinical records of hospitalized patients older than 60 years 2010 and 2011, using the ICD-10 classification as a filter, and verifying the diagnostic criteria of DSM-IV in the clinical records. In the years 2010 and 2011, 5325 patients older than 60 years were hospitalized (19.3%). According to the official statistical records; 0.08% of them were reported with an unspecified diagnosis of delirium (F059). In the clinical records search 455 additional delirium patients were found using the same criteria (40.2%), of which 90.1% had delirium, and only 29.5% were classified with the code F059. The diagnoses and recording of delirium patients over 60 years old patients are underestimated, which is demonstrated by the incongruence of the data obtained from the official records and those obtained from the clinical records. This fact increases the risk and vulnerability of patients with undetected delirium or diagnosed but not reported delirium in hospital statistical sources. Liaison psychiatry is a necessity in third level health institutions, as well as a program of continued education for the health staff about prevention, diagnosis criteria and treatment of delirium. Copyright © 2013 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  4. Workplace violence, job satisfaction, burnout, perceived organisational support and their effects on turnover intention among Chinese nurses in tertiary hospitals: a cross-sectional study.

    PubMed

    Liu, Wenhui; Zhao, Shihong; Shi, Lei; Zhang, Zhong; Liu, Xinyan; Li, Li; Duan, Xiaojian; Li, Guoqiang; Lou, Fengge; Jia, Xiaoli; Fan, Lihua; Sun, Tao; Ni, Xin

    2018-06-09

    Our aims were to assess the relationship between workplace violence, job satisfaction, burnout, organisational support and turnover intention, and to explore factors associated with turnover intention among nurses in Chinese tertiary hospitals. The purposive sampling method was used to collect data from August 2016 through January 2017. A total of 1761 nurses from 9 public tertiary hospitals in 4 provinces (municipalities) located in eastern (Beijing), central (Heilongjiang, Anhui) and western (Shaanxi) regions of China completed the questionnaires (effective response rate=85.20%). A cross-sectional study was conducted using the Workplace Violence Scale, Chinese Maslach Burnout Inventory General Survey, Minnesota Job Satisfaction Questionnaire Revised Short Version, Perceived Organizational Support-Simplified Version Scale and Turnover Intention Scale. A total of 1216 of 1706 (69.1%) participants had high turnover intention. During the previous 12 months, the prevalence of physical violence and psychological violence towards nurses was 9.60% and 59.64%, respectively. As expected, the level of turnover intention was negatively correlated with participants' scores on job satisfaction (r=-0.367, p<0.001) and perceived organisational support (r=-0.379, p<0.001), respectively. Burnout was positively associated with turnover intention (r=0.444, p<0.001). Workplace violence was positively associated with turnover intention (β=0.035, p<0.001) in linear regression analysis. The total effect (β=0.53) of workplace violence on turnover intention comprised its direct effect (β=0.36) and its indirect effect (β=0.17). Perceived organisational support served as a mediator between workplace violence, job satisfaction, burnout and turnover intention, and it had a significantly negative impact on turnover intention. Therefore, nursing managers should understand the importance of the organisation's support and establish a reasonable incentive system to decrease turnover intention

  5. Stereoinversion of tertiary alcohols to tertiary-alkyl isonitriles and amines.

    PubMed

    Pronin, Sergey V; Reiher, Christopher A; Shenvi, Ryan A

    2013-09-12

    The SN2 reaction (bimolecular nucleophilic substitution) is a well-known chemical transformation that can be used to join two smaller molecules together into a larger molecule or to exchange one functional group for another. The SN2 reaction proceeds in a very predictable manner: substitution occurs with inversion of stereochemistry, resulting from the 'backside attack' of the electrophilic carbon by the nucleophile. A significant limitation of the SN2 reaction is its intolerance for tertiary carbon atoms: whereas primary and secondary alcohols are viable precursor substrates, tertiary alcohols and their derivatives usually either fail to react or produce stereochemical mixtures of products. Here we report the stereochemical inversion of chiral tertiary alcohols with a nitrogenous nucleophile facilitated by a Lewis-acid-catalysed solvolysis. The method is chemoselective against secondary and primary alcohols, thereby complementing the selectivity of the SN2 reaction. Furthermore, this method for carbon-nitrogen bond formation mimics a putative biosynthetic step in the synthesis of marine terpenoids and enables their preparation from the corresponding terrestrial terpenes. We expect that the general attributes of the methodology will allow chiral tertiary alcohols to be considered viable substrates for stereoinversion reactions.

  6. Time to presentation, pattern and immediate health effects of alleged child sexual abuse at two tertiary hospitals in Addis Ababa, Ethiopia

    PubMed Central

    2014-01-01

    Background Children are vulnerable to abuse and violence because their level of development makes them unable to protect themselves. Such adversities during early childhood may have a negative impact on the future lives of the victims. This study was done to determine the delay to hospital presentation, clinical manifestations and immediate health effects of child sexual abuse in two tertiary care hospitals in Ethiopia. Methods We reviewed records of all cases of child sexual and physical abuse between January 2011 and December 2012. Bivariate and multivariate logistic regression models were used to test the presence and strength of association between time to reporting to hospital and, age and sex of the victim, place of residence and relation of the victim to the perpetrator. Odds ratio and 95% confidence intervals were generated. Significance was taken as p-value < 0.05. Results During the study period, we identified records of 275 children who were seen for alleged physical and sexual abuse; they accounted for 0.6% of the outpatient department (OPD) visits. The majority of the victims were cases of sexual abuse (97.3%) and most of them were female (75.7%). The mean age of the victims was 9.5 years (standard deviation (SD) = 4.2 years). The majority of the abusers were known to the victim (73.0%) and male (98.8%). Neighbors (38.95%), teachers (7.9%) and relatives (13.4%) were the most commonly reported perpetrators. The median length of time taken to present to hospital after the abuse incident was 4 days (range = 2 hours to 3 years). Male victims were 2.4 times more likely to have a delay of greater than one week to present to hospital (Adjusted Odds Ratio (AOR), 2.40; 95% Confidence interval (CI), 1.34-4.31; P-value = 0.002). Sexual abuse was associated with various immediate health effects, for example, hymenal tear, urinary tract infection and, perineal laceration or tear. Conclusion Presentation for care was often delayed. Male sex was

  7. Development of a Surgical Infection Surveillance Program at a Tertiary Hospital in Ethiopia: Lessons Learned from Two Surveillance Strategies.

    PubMed

    Forrester, Jared A; Koritsanszky, Luca; Parsons, Benjamin D; Hailu, Menbere; Amenu, Demisew; Alemu, Seifu; Jiru, Fekadu; Weiser, Thomas G

    2018-01-01

    Surgical site infections (SSIs) are a leading cause of post-operative morbidity and mortality. We developed Clean Cut, a surgical infection prevention program, with two goals: (1) Increase adherence to evidence-based peri-operative infection prevention standards and (2) establish sustainable surgical infection surveillance. Here we describe our infection surveillance strategy. Clean Cut was piloted and evaluated at a 523 bed tertiary hospital in Ethiopia. Infection prevention standards included: (1) Hand and surgical site decontamination; (2) integrity of gowns, drapes, and gloves; (3) instrument sterility; (4) prophylactic antibiotic administration; (5) surgical gauze tracking; and (6) checklist compliance. Primary outcome measure was SSI, with secondary outcomes including other infection, re-operation, and length of stay. We prospectively observed all post-surgical wounds in obstetrics over a 12 day period and separately recorded post-operative complications using chart review. Simultaneously, we reviewed the written hospital charts after patient discharge for all patients whose peri-operative adherence to infection prevention standards was captured. Fifty obstetric patients were followed prospectively with recorded rates of SSI 14%, re-operation 6%, and death 2%. Compared with direct observation, chart review alone had a high loss to follow-up (28%) and decreased capture of infectious complications (SSI [n = 2], endometritis [n = 3], re-operations [n = 2], death [n = 1]); further, documentation inconsistencies failed to capture two complications (SSI [n = 1], mastitis [n = 1]). Concurrently, 137 patients were observed for peri-operative infection prevention standard adherence. Of these, we were able to successfully review 95 (69%) patient charts with recorded rates of SSI 5%, re-operation 1%, and death 1%. Patient loss to follow-up and poor documentation of infections underestimated overall infectious complications. Direct, prospective

  8. Tertiary vegetation history

    Treesearch

    C. I. Millar

    1996-01-01

    The Tertiary period, from 2.5 to 65 million years ago, was the time oforigin of the modern Sierra Nevada landscape. Climates, geology,and vegetation changed drastically in the Sierra Nevada during thistime, and analyses of this period provide both context for and insightinto vegetation dynamics of the current and future Sierra. During theearly Tertiary, warm-humid,...

  9. Interhospital transfer handoff practices among US tertiary care centers: A descriptive survey.

    PubMed

    Herrigel, Dana J; Carroll, Madeline; Fanning, Christine; Steinberg, Michael B; Parikh, Amay; Usher, Michael

    2016-06-01

    Interhospital transfer is an understudied area within transitions of care. The process by which hospitals accept and transfer patients is not well described. National trends and best practices are unclear. To describe the demographics of large transfer centers, to identify common handoff practices, and to describe challenges and notable innovations involving the interhospital transfer handoff process. A convenience sample of 32 tertiary care centers in the United States was studied. Respondents were typically transfer center directors surveyed by phone. Data regarding transfer center demographics, handoff communication practices, electronic infrastructure, and data sharing were obtained. The median number of patients transferred each month per receiving institution was 700 (range, 250-2500); on average, 28% of these patients were transferred to an intensive care unit. Transfer protocols and practices varied by institution. Transfer center coordinators typically had a medical background (78%), and critical care-trained registered nurse was the most prevalent (38%). Common practices included: mandatory recorded 3-way physician-to-physician conversation (84%) and mandatory clinical status updates prior to patient arrival (81%). However, the timeline of clinical status updates was variable. Less frequent transfer practices included: electronic medical record (EMR) cross-talk availability and utilization (23%), real-time transfer center documentation accessibility in the EMR (32%), and referring center clinical documentation available prior to transport (29%). A number of innovative strategies to address challenges involving interhospital handoffs are reported. Interhospital transfer practices vary widely amongst tertiary care centers. Practices that lead to improved patient handoffs and reduced medical errors need additional prospective evaluation. Journal of Hospital Medicine 2016;11:413-417. © 2016 Society of Hospital Medicine. © 2016 Society of Hospital Medicine.

  10. The Effect of Availability of Manpower on Trauma Resuscitation Times in a Tertiary Academic Hospital.

    PubMed

    Tan, Timothy Xin Zhong; Quek, Nathaniel Xin Ern; Koh, Zhi Xiong; Nadkarni, Nivedita; Singaram, Kanageswari; Ho, Andrew Fu Wah; Ong, Marcus Eng Hock; Wong, Ting Hway

    2016-01-01

    For trauma patients, delays to assessment, resuscitation, and definitive care affect outcomes. We studied the effects of resuscitation area occupancy and trauma team size on trauma team resuscitation speed in an observational study at a tertiary academic institution in Singapore. From January 2014 to January 2015, resuscitation videos of trauma team activated patients with an Injury Severity Score of 9 or more were extracted for review within 14 days by independent reviewers. Exclusion criteria were patients dead on arrival, inter-hospital transfers, and up-triaged patients. Data captured included manpower availability (trauma team size and resuscitation area occupancy), assessment (airway, breathing, circulation, logroll), interventions (vascular access, imaging), and process-of-care time intervals (time to assessment/intervention/adjuncts, time to imaging, and total time in the emergency department). Clinical data were obtained by chart review and from the trauma registry. Videos of 70 patients were reviewed over a 13-month period. The median time spent in the emergency department was 154.9 minutes (IQR 130.7-207.5) and the median resuscitation team size was 7, with larger team sizes correlating with faster process-of-care time intervals: time to airway assessment (p = 0.08) and time to disposition (p = 0.04). The mean resuscitation area occupancy rate (RAOR) was 1.89±2.49, and the RAOR was positively correlated with time spent in the emergency department (p = 0.009). Our results suggest that adequate staffing for trauma teams and resuscitation room occupancy are correlated with faster trauma resuscitation and reduced time spent in the emergency department.

  11. C. trachomatis in female reproductive tract infections and RFLP-based genotyping: a 16-year study from a tertiary care hospital.

    PubMed

    Gita, Satpathy; Suneeta, Mittal; Anjana, Sharma; Niranjan, Nayak; Sujata, Mohanty; Pandey, R M

    2011-01-01

    Presence of Chlamydia trachomatis in endocervix was determined in 2466 women attending a tertiary care hospital in New Delhi, India over a period of 16 years, using a monoclonal-based direct immunofluorescence assay, tissue culture isolation, and a conventional PCR assay. Chlamydia antigen could be detected in 391 out of 2466 (15.85%) of patients studied; in 27.27% women with PID, 16.74% women with cervicitis, 16.03% women with infertility, and 12.06% women with adverse pregnancy outcomes, respectively. There was a statistically significant decreasing trend in Chlamydia antigen positivity between the years 1994-1999 and 2000-2004; the apparent decline in antigen positivity between the years 2000-2004 and 2005-2010 was not statistically significant. Antigen detection assay detected equal number of positives as the PCR assay; tissue culture isolation demonstrated lower positivity. In a few representative specimens from cervicitis patients, genotyping was done using RFLP pattern analysis of C. trachomatis MOMP gene amplified by PCR assay, all of these belonged to Chlamydia trachomatis serovar E.

  12. C. trachomatis in Female Reproductive Tract Infections and RFLP-Based Genotyping: A 16-Year Study from a Tertiary Care Hospital

    PubMed Central

    Gita, Satpathy; Suneeta, Mittal; Anjana, Sharma; Niranjan, Nayak; Sujata, Mohanty; Pandey, R. M.

    2011-01-01

    Presence of Chlamydia trachomatis in endocervix was determined in 2466 women attending a tertiary care hospital in New Delhi, India over a period of 16 years, using a monoclonal-based direct immunofluorescence assay, tissue culture isolation, and a conventional PCR assay. Chlamydia antigen could be detected in 391 out of 2466 (15.85%) of patients studied; in 27.27% women with PID, 16.74% women with cervicitis, 16.03% women with infertility, and 12.06% women with adverse pregnancy outcomes, respectively. There was a statistically significant decreasing trend in Chlamydia antigen positivity between the years 1994–1999 and 2000–2004; the apparent decline in antigen positivity between the years 2000–2004 and 2005–2010 was not statistically significant. Antigen detection assay detected equal number of positives as the PCR assay; tissue culture isolation demonstrated lower positivity. In a few representative specimens from cervicitis patients, genotyping was done using RFLP pattern analysis of C. trachomatis MOMP gene amplified by PCR assay, all of these belonged to Chlamydia trachomatis serovar E. PMID:21747643

  13. Benchmarking pain outcomes for children with sickle cell disease hospitalized in a tertiary referral pediatric hospital

    PubMed Central

    Vijenthira, Abi; Stinson, Jennifer; Friedman, Jeremy; Palozzi, Lori; Taddio, Anna; Scolnik, Dennis; Victor, Charles; Kirby-Allen, Melanie; Campbell, Fiona

    2012-01-01

    BACKGROUND: Painful vaso-occlusive crisis (VOC) is the most common reason for hospitalization in children with sickle cell disease. OBJECTIVE: To benchmark pain outcomes in sickle cell disease, including process outcomes (eg, pain assessment and documentation practices, pain management interventions) and clinical outcomes (eg, pain intensity over hospital stay), to identify areas for improvement. METHODS: A retrospective study was conducted on electronic charts of children hospitalized with a primary diagnosis of VOC between July 2007 and August 2008. RESULTS: A convenience sample of 50 admissions was used. In terms of clinical outcomes, patients presented to the emergency department with an initial median pain intensity of 9/10 (interquartile range 8/10 to 10/10). Forty-three per cent had not used opioids for pain relief at home. The mean (± SD) length of stay was 4.0±2.3 days. For most patients, median scores for highest daily pain intensity remained moderate to high throughout hospitalization, although scores did decrease significantly per day of hospitalization. In terms of process outcomes, pain intensity was assessed according to hospital standards on 25% of days in both the emergency department and the ward. There was no discrepancy between prescribed and administered opioid doses and medication use. In 95% of cases, strong opioid use was in a subtherapeutic or low therapeutic dosage range. CONCLUSIONS: The results showed three areas to target for improvement: improved pain assessment and documentation using valid pain tools; more aggressive multimodal management for peak VOC pain; and better education and support for pain management at home. Further studies are required to evaluate optimal pain treatment practices. PMID:22891195

  14. A year-long caregiver training program improves cognition in preschool Ugandan children with human immunodeficiency virus.

    PubMed

    Boivin, Michael J; Bangirana, Paul; Nakasujja, Noeline; Page, Connie F; Shohet, Cilly; Givon, Deborah; Bass, Judith K; Opoka, Robert O; Klein, Pnina S

    2013-11-01

    To evaluate mediational intervention for sensitizing caregivers (MISC). MISC biweekly caregiver training significantly enhanced child development compared with biweekly training on health and nutrition (active control) and to evaluate whether MISC training improved the emotional well-being of the caregivers compared with controls. Sixty of 120 rural Ugandan preschool child/caregiver dyads with HIV were assigned by randomized clusters to biweekly MISC training, alternating between home and clinic for 1 year. Control dyads received a health and nutrition curriculum. Children were evaluated at baseline, 6 months, and 1 year with the Mullen Early Learning Scales and the Color-Object Association Test for memory. Caldwell Home Observation for Measurement of the Environment and videotaped child/caregiver MISC interactions also were evaluated. Caregivers were evaluated for depression and anxiety with the Hopkins Symptoms Checklist. Between-group repeated-measures ANCOVA comparisons were made with age, sex, CD4 levels, viral load, material socioeconomic status, physical development, and highly active anti-retroviral therapy treatment status as covariates. The children given MISC had significantly greater gains compared with controls on the Mullen Visual Reception scale (visual-spatial memory) and on Color-Object Association Test memory. MISC caregivers significantly improved on Caldwell Home Observation for Measurement of the Environment scale and total frequency of MISC videotaped interactions. MISC caregivers also were less depressed. Mortality was less for children given MISC compared with controls during the training year. MISC was effective in teaching Ugandan caregivers to enhance their children's cognitive development through practical and sustainable techniques applied during daily interactions in the home. Copyright © 2013 Mosby, Inc. All rights reserved.

  15. Hospital mortality following trauma: an analysis of a hospital-based injury surveillance registry in sub-Saharan Africa.

    PubMed

    Tyson, Anna F; Varela, Carlos; Cairns, Bruce A; Charles, Anthony G

    2015-01-01

    Injuries are a significant cause of death and disability, particularly in low- and middle-income countries. Health care systems in resource-poor countries lack personnel and are ill equipped to treat severely injured patients; therefore, many injury-related deaths occur after hospital admission. This study evaluates the mortality for hospitalized trauma patients at a tertiary care hospital in Malawi. This study is a retrospective analysis of prospectively collected trauma surveillance data. We performed univariate and bivariate analyses to describe the population and logistic regression analysis to identify predictors of mortality. Tertiary care hospital in sub-Saharan Africa. Patients with traumatic injuries admitted to Kamuzu Central Hospital between January 2010 and December 2012. Predictors of in-hospital mortality. The study population consisted of 7559 patients, with an average age of 27 years (±18 years) and a male predominance of 76%. Road traffic injuries, falls, and assaults were the most common causes of injury. The overall mortality was 4.2%. After adjusting for age, sex, type and mechanism of injury, and shock index, head/spine injuries had the highest odds of mortality, with an odds ratio of 5.80 (2.71-12.40). The burden of injuries in sub-Saharan Africa remains high. At this institution, road traffic injuries are the leading cause of injury and injury-related death. The most significant predictor of in-hospital mortality is the presence of head or spinal injury. These findings may be mitigated by a comprehensive injury-prevention effort targeting drivers and other road users and by increased attention and resources dedicated to the treatment of patients with head and/or spine injuries in the hospital setting. Copyright © 2015 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

  16. Clinical pathway across tertiary and community care after an interventional cardiology procedure.

    PubMed

    Doran, K; Sampson, B; Staus, R; Ahern, C; Schiro, D

    1997-01-01

    Many patients who receive medical interventional cardiology procedures at a tertiary hospital live outside the metropolitan area and may experience fragmentation in care, less emotional support by family members, inaccurate and delayed communication, and lack of educational follow-up on discharge from the hospital. A clinical pathway titled "Heart Health Care Patterns" was developed to link acute phase, recovery phase, rehabilitation phase, and enhancement/maintenance phase. The 12-month clinical pathway combines Gordon's Functional Health Patterns and the Omaha System developed by the Omaha Visiting Nurse Association. The rating scale for outcomes assesses the patient at different phases to provide objective data and information throughout the year.

  17. Evaluation of process excellence tools in improving donor flow management in a tertiary care hospital in South India

    PubMed Central

    Venugopal, Divya; Rafi, Aboobacker Mohamed; Innah, Susheela Jacob; Puthayath, Bibin T.

    2017-01-01

    BACKGROUND: Process Excellence is a value based approach and focuses on standardizing work processes by eliminating the non-value added processes, identify process improving methodologies and maximize capacity and expertise of the staff. AIM AND OBJECTIVES: To Evaluate the utility of Process Excellence Tools in improving Donor Flow Management in a Tertiary care Hospital by studying the current state of donor movement within the blood bank and providing recommendations for eliminating the wait times and to improve the process and workflow. MATERIALS AND METHODS: The work was done in two phases; The First Phase comprised of on-site observations with the help of an expert trained in Process Excellence Methodology who observed and documented various aspects of donor flow, donor turn around time, total staff details and operator process flow. The Second Phase comprised of constitution of a Team to analyse the data collected. The analyzed data along with the recommendations were presented before an expert hospital committee and the management. RESULTS: Our analysis put forward our strengths and identified potential problems. Donor wait time was reduced by 50% after lean due to better donor management with reorganization of the infrastructure of the donor area. Receptionist tracking showed that 62% of the total time the staff wastes in walking and 22% in other non-value added activities. Defining Duties for each staff reduced the time spent by them in non-value added activities. Implementation of the token system, generation of unique identification code for donors and bar code labeling of the tubes and bags are among the other recommendations. CONCLUSION: Process Excellence is not a programme; it's a culture that transforms an organization and improves its Quality and Efficiency through new attitudes, elimination of wastes and reduction in costs. PMID:28970681

  18. Evaluation of process excellence tools in improving donor flow management in a tertiary care hospital in South India.

    PubMed

    Venugopal, Divya; Rafi, Aboobacker Mohamed; Innah, Susheela Jacob; Puthayath, Bibin T

    2017-01-01

    Process Excellence is a value based approach and focuses on standardizing work processes by eliminating the non-value added processes, identify process improving methodologies and maximize capacity and expertise of the staff. To Evaluate the utility of Process Excellence Tools in improving Donor Flow Management in a Tertiary care Hospital by studying the current state of donor movement within the blood bank and providing recommendations for eliminating the wait times and to improve the process and workflow. The work was done in two phases; The First Phase comprised of on-site observations with the help of an expert trained in Process Excellence Methodology who observed and documented various aspects of donor flow, donor turn around time, total staff details and operator process flow. The Second Phase comprised of constitution of a Team to analyse the data collected. The analyzed data along with the recommendations were presented before an expert hospital committee and the management. Our analysis put forward our strengths and identified potential problems. Donor wait time was reduced by 50% after lean due to better donor management with reorganization of the infrastructure of the donor area. Receptionist tracking showed that 62% of the total time the staff wastes in walking and 22% in other non-value added activities. Defining Duties for each staff reduced the time spent by them in non-value added activities. Implementation of the token system, generation of unique identification code for donors and bar code labeling of the tubes and bags are among the other recommendations. Process Excellence is not a programme; it's a culture that transforms an organization and improves its Quality and Efficiency through new attitudes, elimination of wastes and reduction in costs.

  19. Prescribing pattern of analgesics in orthopedic in-patient department at tertiary care hospital in Guwahati, Assam, Northeast India

    PubMed Central

    Choudhury, Dwijen Kumar; Bezbaruah, Babul Kumar

    2016-01-01

    Objectives: The aim of this study is to evaluate the prescribing pattern of analgesics and analyze the rational use of analgesic in orthopedic in-patient department of tertiary care teaching hospital, Guwahati, Assam. Subjects and Methods: An observational and cross-sectional study was carried out for 1 month from April to May 2014. Collected data included age, sex, diagnosis and line of management during the study. The generic name and the average cost of treatment per patient were evaluated using Indian Drug Review, 2014. The prescribed drugs were assessed with respective National Model List of Essential Medicines (NLEM), 2011 and the rationality of prescriptions was determined using the World Health Organization indicators of drug utilization. The patients’ details were recorded in a predeigned data collection form and results were analyzed by descriptive statistics. Results: Out of 200 patients, 123 were male and 77 were female. The average number of analgesic per prescription was 1.46. In this study, 55.5% of patients had received single analgesic. Diclofenac was the most commonly prescribed analgesic (43.49%). During hospitalization, majority of the patients have received parenteral preparation. Gastroprotective agents and antimicrobials were frequently prescribed along with analgesics. Out of 292 analgesics prescribed, 183 (62.67%) were from the NLEM, India. Furthermore, 176 (57.19%) analgesics were prescribed by generic name. The average cost of treatment per patient was 2151.72 INR. Utilization of analgesic in terms of defined daily dose/100 bed-days was 104.01. Conclusion: The percentages of analgesics prescribing from NLEM and the use of analgesic by generic name were found satisfactory. Regular educational interventions to improve prescribing practices among physicians at different levels may further promote rational prescribing. PMID:27756947

  20. [The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

    PubMed

    Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

    2017-11-01

    Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1

  1. Skin, a mirror reflecting diabetes mellitus: A longitudinal study in a tertiary care hospital in Gujarat.

    PubMed

    Vahora, Roshni; Thakkar, Sejal; Marfatia, Yogesh

    2013-07-01

    Diabetes mellitus (DM) is the most common of the endocrine disorders. Mucocutaneous manifestations of diabetes mellitus are many and vary from trivial to life-threatening. Sometimes, mucocutaneous disorders may herald the onset of diabetes. To study the pattern of mucocutaneous manifestations in diabetics and role of it in diagnosing diabetes mellitus and its complications. It was a longitudinal observational study of patients having diabetes with skin complaints attending skin outdoor department or admitted in wards for any reason in a tertiary care hospital. Total 300 patients were included in the study. Detailed history, clinical examination, and relevant investigations were done to diagnose the mucocutaneous disorders, diabetes, and diabetic complications. The data was analyzed by using Epi info software. Demographic profile shown majority of cases (78.66%) in more than 40 years of age with almost equal male and female preponderance. Mucocutaneous manifestations as presenting feature of diabetes were observed in 21.67% cases. Infections were most common in 119 (39.66%) cases, followed by acanthosis nigricans in 46 (15.33%) cases. Various associated complications like hypertension, retinopathy, hyperlipidemia, coronary artery disease, neuropathy, nephropathy, and diabetic ketoacidosis were observed in 160 (53.3%). Skin is the mirror, which reflects internal diseases; this aptly applies to skin and diabetes mellitus. Through awareness about cutaneous manifestations of DM, dermatologist can not only take credit for detecting DM but also facilitate early diagnosis of systemic complications of DM. This is immensely beneficial to patients in long run.

  2. Clinical profiles and trend analysis of newly diagnosed lung cancer in a tertiary care hospital of East China during 2011-2015.

    PubMed

    Wang, Pingli; Zou, Jixia; Wu, Jingni; Zhang, Chengyan; Ma, Chengxi; Yu, Juan; Zhou, You; Li, Baizhou; Wang, Kai

    2017-07-01

    More than one-third of lung cancer worldwide occurring in China. However, the clinical profiles of lung cancer patients in the mainland of China are rarely reported and largely unknown. The objective of this study is to analyze the characteristics and time trends of newly diagnosed lung cancer cases during the past 5 years in East China. The data came from an academic tertiary care hospital of East China. Patients who were newly diagnosed as lung cancer from 2011 to 2015 were enrolled. All new cases got pathological supports by lung biopsy or surgery. Tumor staging was performed according to the seventh edition of the tumor node metastasis (TNM) classification of malignant tumors. The patients' disease information was collected from the database of the hospital information system (HIS). From 2011 to 2015, aggregately 5,779 patients, including 3,719 males and 2,060 females, were diagnosed as lung cancer. The major histologic subtypes of lung cancer were adenocarcinoma (ADC, 60.0%), squamous cell carcinoma (SCC, 25.6%), small cell lung cancer (SCLC, 8.5%), large cell carcinoma (0.6%), adenosquamous carcinoma (1%), other non-small cell carcinoma (1.6%) and unclassified or rare carcinoma (2.8%). ADC proportion of female was much higher than that of male. A higher proportion of advanced stage (stage IIIB, IV) of lung cancer existed in patients who were admitted to hospital due to respiratory or cancer related symptoms (RCRS) than those without RCRS. Smoking rate in male patients reached 80.2%, while it was only 2.7% in females. EGFR mutation existed in 66% of female and 37% of male patients with ADC. This study demonstrates the clinicopathologic characteristics of lung cancer patients from East China, including histologic composition, staging proportion, smoking prevalence and gene mutation status. During the past 5 years, the proportion of ADC has increased gradually whereas SCC decreased.

  3. Occupational stress, job satisfaction and job performance among hospital nurses in Kampala, Uganda.

    PubMed

    Nabirye, Rose C; Brown, Kathleen C; Pryor, Erica R; Maples, Elizabeth H

    2011-09-01

    To assess levels of occupational stress, job satisfaction and job performance among hospital nurses in Kampala, Uganda; and how they are influenced by work and personal characteristics. Occupational stress is reported to affect job satisfaction and job performance among nurses, thus compromising nursing care and placing patients' lives at risk. Although these factors have been studied extensively in the US and Europe, there was a need to explore them from the Ugandan perspective. A correlational study was conducted with 333 nurses from four hospitals in Kampala, Uganda. A questionnaire measuring occupational stress, job satisfaction and job performance was used. Data were analysed using descriptive statistics and anova. There were significant differences in levels of occupational stress, job satisfaction and job performance between public and private not-for-profit hospitals, nursing experience and number of children. Organizational differences between public and private not-for-profit hospitals influence the study variables. On-the-job training for nurse managers in human resource management to increase understanding and advocacy for organizational support policies was recommended. Research to identify organizational, family or social factors which contribute to reduction of perceived occupational stress and increase job satisfaction and job performance was recommended. 2011 Blackwell Publishing Ltd.

  4. High-risk sexual behavior among people living with HIV/AIDS attending tertiary care hospitals in district of Northern India

    PubMed Central

    Shukla, Mukesh; Agarwal, Monica; Singh, Jai Vir; Tripathi, Anil Kumar; Srivastava, Anand Kumar; Singh, Vijay Kumar

    2016-01-01

    Context: Prevention with a positive approach has been advocated as one of the main strategies to diminish the new instances of HIV and the target are those who are engaged in high-risk sexual behavior. Therefore, understanding the risky behaviors of the HIV-infected individual is important. Aims: This study aimed to assess the prevalence and the predictors of high-risk sexual behavior among people living with HIV/AIDS (PLHA). Settings and Design: A hospital-based cross-sectional study was conducted at antiretroviral therapy centers of two tertiary care hospitals in Lucknow. Materials and Methods: A total of 322 HIV-positive patients were interviewed about their sexual behaviors during last 3 months using a pretested questionnaire. Statistical Analysis Used: Probability (p) was calculated to test for statistical significance at 5% level of significance. Association between risk factors and high-risk sexual behavior was determined using bivariate analysis followed by multivariate logistic regression. Results: Prevalence of high-risk sexual behavior was 24.5%. Of these patients, multiple sexual partners were reported by 67.3% whereas about 46.9% were engaged in unprotected sex. Multivariate logistic regression analysis revealed that high-risk sexual behavior was significantly associated with nonsupporting attitude of spouse (odds ratio [OR]: 18; 95% confidence interval [CI]: 1.4–225.5; P = 0.02) and alcohol consumption (OR: 9.3; 95% CI: 2.4–35.4; P = 0.001). Conclusions: Specific intervention addressing alcohol consumption and encouragement of spouse and family support should be integrated in the routine HIV/AIDS care and treatment apart from HIV transmission and prevention knowledge. PMID:27190412

  5. VIM-1, VIM-2, and GES-5 Carbapenemases Among Pseudomonas aeruginosa Isolates at a Tertiary Hospital in Istanbul, Turkey.

    PubMed

    Malkoçoğlu, Gülşah; Aktaş, Elif; Bayraktar, Banu; Otlu, Bariş; Bulut, Mehmet Emin

    2017-04-01

    Worldwide increase in carbapenem resistance and transferable carbapenemases are significant challenges in treatment of Pseudomonas aeruginosa infections. In this study, investigation of carbapenemase production in carbapenem-resistant P. aeruginosa isolates recovered from clinical specimens in a tertiary hospital was aimed. A total of 84 carbapenem-resistant P. aeruginosa isolates were examined. "Carbapenem inactivation method" (CIM) was used for phenotypic detection of carbapenemase production. The existence of bla KPC , bla NDM , bla IMP , bla VIM , bla OXA-48 , and bla GES genes was investigated by polymerase chain reaction (PCR). Subtypes of the detected genes were identified by sequence analysis. Arbitrarily primed PCR (AP-PCR) was performed to evaluate the clonal relationship among the isolates. The presence of high-risk clones in carbapenemase producers was investigated by Matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS). Three isolates (3.5%) were identified as carbapenemase producers by CIM tests, while PCR tests demonstrated three isolates carrying carbapenemase genes as well. bla VIM gene was found in two isolates and bla GES gene was found in one isolate. Sequence analysis demonstrated that the carbapenemases were VIM-1, VIM-2, and GES-5. AP-PCR yielded high clonal diversity among the isolates. According to MALDI-TOF MS analysis, none of the carbapenemase-producing strains belonged to the high-risk clones. In conclusion, the presence of VIM-1, VIM-2, and GES-5 type carbapenemases in P. aeruginosa isolates was demonstrated for the first time in our hospital, GES-5 being reported for the second time in Turkey. Our results will lead strategies for controlling the spread of carbapenemases and contribute to epidemiological data from Turkey.

  6. Prevalence and types of preanalytical error in hematology laboratory of a tertiary care hospital in South India.

    PubMed

    Arul, Pitchaikaran; Pushparaj, Magesh; Pandian, Kanmani; Chennimalai, Lingasamy; Rajendran, Karthika; Selvaraj, Eniya; Masilamani, Suresh

    2018-01-01

    An important component of laboratory medicine is preanalytical phase. Since laboratory report plays a major role in patient management, more importance should be given to the quality of laboratory tests. The present study was undertaken to find the prevalence and types of preanalytical errors at a tertiary care hospital in South India. In this cross-sectional study, a total of 118,732 samples ([62,474 outpatient department [OPD] and 56,258 inpatient department [IPD]) were received in hematology laboratory. These samples were analyzed for preanalytical errors such as misidentification, incorrect vials, inadequate samples, clotted samples, diluted samples, and hemolyzed samples. The overall prevalence of preanalytical errors found was 513 samples, which is 0.43% of the total number of samples received. The most common preanalytical error observed was inadequate samples followed by clotted samples. Overall frequencies (both OPD and IPD) of preanalytical errors such as misidentification, incorrect vials, inadequate samples, clotted samples, diluted samples, and hemolyzed samples were 0.02%, 0.05%, 0.2%, 0.12%, 0.02%, and 0.03%, respectively. The present study concluded that incorrect phlebotomy techniques due to lack of awareness is the main reason for preanalytical errors. This can be avoided by proper communication and coordination between laboratory and wards, proper training and continuing medical education programs for laboratory and paramedical staffs, and knowledge of the intervening factors that can influence laboratory results.

  7. [Psychological violence and the family context of adolescent users of outpatient services in a public tertiary pediatric hospital].

    PubMed

    de Abranches, Cecy Dunshee; de Assis, Simone Gonçalves; Pires, Thiago de Oliveira

    2013-10-01

    The scope of this research was to investigate the association of psychological violence (PV) during adolescence with social and demographic factors, family structure/relationships and with other forms of maltreatment. A questionnaire was applied to 229 adolescents (11-18 years) in outpatient services in a state-run tertiary pediatric hospital. It was found that 26.4% of respondents suffered severe PV in the family context, and only 5 of the respondents reported they did not suffer any PV in the family context, illustrating how this kind of violence is seen as commonplace in the family relationship. The most common forms of PV behavior were: being criticized for what one does or says; not being encouraged when trying to act autonomously; being called nasty names, and having an adult saying one is wrong when one tries to act. Dissatisfaction of parents with the adolescent, the nuclear family structure, the position of the child among siblings sharing the same parents were associated with PV occurring within the family context. In order to enable it to detect signs of PV, the health sector can promote the right to comprehensive health of adolescents, confirming itself as one of the main social sectors capable of acting preventively on the forms of violence suffered and practiced by the family group.

  8. Failure mode and effects analysis of the universal anaesthesia machine in two tertiary care hospitals in Sierra Leone

    PubMed Central

    Rosen, M. A.; Sampson, J. B.; Jackson, E. V.; Koka, R.; Chima, A. M.; Ogbuagu, O. U.; Marx, M. K.; Koroma, M.; Lee, B. H.

    2014-01-01

    Background Anaesthesia care in developed countries involves sophisticated technology and experienced providers. However, advanced machines may be inoperable or fail frequently when placed into the austere medical environment of a developing country. Failure mode and effects analysis (FMEA) is a method for engaging local staff in identifying real or potential breakdowns in processes or work systems and to develop strategies to mitigate risks. Methods Nurse anaesthetists from the two tertiary care hospitals in Freetown, Sierra Leone, participated in three sessions moderated by a human factors specialist and an anaesthesiologist. Sessions were audio recorded, and group discussion graphically mapped by the session facilitator for analysis and commentary. These sessions sought to identify potential barriers to implementing an anaesthesia machine designed for austere medical environments—the universal anaesthesia machine (UAM)—and also engaging local nurse anaesthetists in identifying potential solutions to these barriers. Results Participating Sierra Leonean clinicians identified five main categories of failure modes (resource availability, environmental issues, staff knowledge and attitudes, and workload and staffing issues) and four categories of mitigation strategies (resource management plans, engaging and educating stakeholders, peer support for new machine use, and collectively advocating for needed resources). Conclusions We identified factors that may limit the impact of a UAM and devised likely effective strategies for mitigating those risks. PMID:24833727

  9. Obligation towards medical errors disclosure at a tertiary care hospital in Dubai, UAE

    PubMed Central

    Zaghloul, Ashraf Ahmad; Rahman, Syed Azizur; Abou El-Enein, Nagwa Younes

    2016-01-01

    OBJECTIVE: The study aimed to identify healthcare providers’ obligation towards medical errors disclosure as well as to study the association between the severity of the medical error and the intention to disclose the error to the patients and their families. DESIGN: A cross-sectional study design was followed to identify the magnitude of disclosure among healthcare providers in different departments at a randomly selected tertiary care hospital in Dubai. SETTING AND PARTICIPANTS: The total sample size accounted for 106 respondents. Data were collected using a questionnaire composed of two sections namely; demographic variables of the respondents and a section which included variables relevant to medical error disclosure. RESULTS: Statistical analysis yielded significant association between the obligation to disclose medical errors with male healthcare providers (X2 = 5.1), and being a physician (X2 = 19.3). Obligation towards medical errors disclosure was significantly associated with those healthcare providers who had not committed any medical errors during the past year (X2 = 9.8), and any type of medical error regardless the cause, extent of harm (X2 = 8.7). Variables included in the binary logistic regression model were; status (Exp β (Physician) = 0.39, 95% CI 0.16–0.97), gender (Exp β (Male) = 4.81, 95% CI 1.84–12.54), and medical errors during the last year (Exp β (None) = 2.11, 95% CI 0.6–2.3). CONCLUSION: Education and training of physicians about disclosure conversations needs to start as early as medical school. Like the training in other competencies required of physicians, education in communicating about medical errors could help reduce physicians’ apprehension and make them more comfortable with disclosure conversations. PMID:27567766

  10. Characterization of sleep patterns and problems in healthcare workers in a tertiary care hospital.

    PubMed

    Buscemi, Dolores; Anvari, Rezza; Raj, Rishi; Nugent, Kenneth

    2014-01-01

    Restrictions in sleep can have important adverse effects on health and job performance. We collected information about sleep from US healthcare workers to determine whether they had sleep difficulties. We used an Internet-based survey to collect information on sleep patterns and sleep quality in healthcare workers at a tertiary care hospital. We classified these workers into short sleepers (<7 hours), normal sleepers (7-8 hours), and long sleepers (≥9 hours). We compared these three groups using simple descriptive statistics. We used logistic regression to identify factors associated with short sleep times. Of 3012 questionnaires distributed, 376 healthcare workers (12.5%) replied to this survey. The median age was 38 years, the median body mass index was 28 kg/m, and 76% were women. The median sleep duration on weekdays was 7 hours. Sixty-nine respondents (18.4%) were short sleepers, 269 of the respondents (71.5%) were normal sleepers, and 38 respondents (10.1%) were long sleepers. A total of 113 (30.1%) had sleep difficulties more than 50% of the time and 140 respondents (37.3%) were bothered by lack of energy from poor sleep. Short sleepers were less likely than other types of sleepers to have normal bedtimes and regular mealtimes. Eighty-four respondents (22.3%) went to bed between 2 AM and 2 PM. These workers were younger; slept less on the weekdays and weekends; and reported more difficulty with sleeping, feeling depressed, overconsumption of alcoholic beverages, and personal stressors. Most healthcare workers have healthy sleep patterns; however, many workers have poor sleep quality. Workers with "odd" bedtimes have abnormal sleep patterns and abnormal sleep quality; these workers need additional evaluation to understand the causes and consequences of their sleep patterns.

  11. Implementation science in low-resource settings: using the interactive systems framework to improve hand hygiene in a tertiary hospital in Ghana.

    PubMed

    Kallam, Brianne; Pettitt-Schieber, Christie; Owen, Medge; Agyare Asante, Rebecca; Darko, Elizabeth; Ramaswamy, Rohit

    2018-05-19

    Low-resource clinical settings often face obstacles that challenge the implementation of recommended evidence-based practices (EBPs). Implementation science approaches are useful in identifying barriers and developing strategies to address them. Ridge Regional Hospital (RRH), a tertiary referral hospital in Accra, Ghana experienced a spike in rates of neonatal sepsis and launched a quality improvement (QI) initiative that identified poor adherence to hand hygiene in the neonatal intensive care unit as a potential source of infections. A multi-modal change package of World Health Organization-recommended solutions was created to address this issue. To ensure that the outputs of the QI effort were adopted within the organization, leaders at RRH and Kybele, Inc. used an implementation science framework called the 'Interactive Systems Framework for Dissemination and Implementation' (ISF) to create a package of locally acceptable implementation strategies. The ISF has never been used before to guide implementation in low-resource settings. Hand hygiene compliance rose from 67% to 92% overall, including a 36% increase during the night shifts-a group of healthcare workers with typically very low levels of compliance. The drastic improvement in adherence to hand hygiene suggests the potential value of the joint use of QI and implementation science to promote the creation and application of contextually appropriate EBPs in low-resource settings. Our results also suggest that using an implementation framework such as the ISF could rapidly increase the uptake of other evidence-based interventions in low-resource settings.

  12. Trends and patterns of antibiotic consumption in China's tertiary hospitals: Based on a 5 year surveillance with sales records, 2011-2015.

    PubMed

    Wushouer, Haishaerjiang; Tian, Ye; Guan, Xiao-Dong; Han, Sheng; Shi, Lu-Wen

    2017-01-01

    The consumption of antibiotics is a major driver in the development of antimicrobial resistance. This study aims to identify the trends and patterns of the total antibiotic consumption in China's tertiary hospitals from 2011 to 2015 by retrospectively analyzing aggregated monthly surveillance data on antibiotic sales made to 468 hospitals from 28 provinces. Antibiotic consumption was expressed in DDD per 1,000 inhabitants per day (DID). We compared population weighted antibiotic consumption patterns in China with European countries using indicators from the European Surveillance of Antimicrobial Consumption (ESAC). Total antibiotic consumption, including all the specific antibiotic class except for aminoglycoside antibacterials, were significantly increased during the study period from an average of 7.97 DID in 2011 to 10.08 DID in 2015. In 2015, the eastern regions of China consumed the most antibiotics using population denominator while the western regions consumed the most using inpatient denominator. Cephalosporins accounted for 28.6% of total DID, followed by beta-lactam-beta-lactamase inhibitor combinations (20.0%), macrolides (17.4%), and fluoroquinolones (10.5%). Antibiotic in parenteral form accounted for nearly half of all antibiotics. Although over the past few years major efforts had been made to reduce the risks of excessive antibiotic use through antibiotic stewardship, total antibiotic consumption showed a significant upward trend during the study period. A consistent preference for cephalosporins, macrolides, beta-lactam-beta-lactamase inhibitor combinations, as well as parenteral preparations was observed.

  13. Ethical issues recognized by critical care nurses in the intensive care units of a tertiary hospital during two separate periods.

    PubMed

    Park, Dong Won; Moon, Jae Young; Ku, Eun Yong; Kim, Sun Jong; Koo, Young-Mo; Kim, Ock-Joo; Lee, Soon Haeng; Jo, Min-Woo; Lim, Chae-Man; Armstrong, John David; Koh, Younsuck

    2015-04-01

    This research aimed to investigate the changes in ethical issues in everyday clinical practice recognized by critical care nurses during two observation periods. We conducted a retrospective analysis of data obtained by prospective questionnaire surveys of nurses in the intensive care units (ICU) of a tertiary university-affiliated hospital in Seoul, Korea. Data were collected prospectively during two different periods, February 2002-January 2003 (Period 1) and August 2011-July 2012 (Period 2). Significantly fewer cases with ethical issues were reported in Period 2 than in Period 1 (89 cases [2.1%] of 4,291 ICU admissions vs. 51 [0.5%] of 9,302 ICU admissions, respectively; P < 0.001). The highest incidence of cases with identified ethical issues in both Periods occurred in MICU. The major source of ethical issues in Periods 1 and 2 was behavior-related. Among behaviorrelated issues, inappropriate healthcare professional behavior was predominant in both periods and mainly involved resident physicians. Ethical issue numbers regarding end-oflife (EOL) care significantly decreased in the proportion with respect to ethical issues during Period 2 (P = 0.044). In conclusion, the decreased incidence of cases with identified ethical issues in Period 2 might be associated with ethical enhancement related with EOL and improvements in the ICU care environment of the studied hospital. However, behaviorrelated issues involving resident physicians represent a considerable proportion of ethical issues encountered by critical care nurses. A systemic approach to solve behavior-related issues of resident physicians seems to be required to enhance an ethical environment in the studied ICU.

  14. A Survey of Knowledge, Attitude, and Practice of Consumers at a Tertiary Care Hospital Regarding the Disposal of Unused Medicines

    PubMed Central

    Sonowal, Supriya; Desai, Chetna; Kapadia, Jigar D.; Desai, Mira K.

    2016-01-01

    Objectives: To evaluate the knowledge, attitude and practice of consumers in India about disposal of unused medicines. Materials and Methods: A questionnaire comprising 11 questions evaluating the Knowledge (2), Attitude (3) and Practice (6) of unused medicines was prepared and pre validated before administering to 200 consumers of medicines attending the outpatient department of Civil Hospital Ahmedabad, a tertiary care teaching hospital in Western India. Requisite permissions from Institutional Ethics Committee and informed consent were obtained prior to recruiting them for the study. Responses were recorded, in Microsoft Excel® spreadsheet and evaluated for percentage response. Results: Majority of the respondents (136, 68%) stored unused medicines at home. Analgesics (26.5%) were the most common unused medicine stored. Safe disposal of medicine was considered necessary by majority respondents (160, 80%) for different reasons like prevention of illegal/unintended use (84, 42%), prevention of environmental pollution (32, 16%) or possible ADR caused by old drugs (54, 27%). Only 78 (39%) respondents were aware of appropriate methods of disposal. Disposal in household trash (61, 30.5%) was the most common method used. Majority of respondents felt the need for a facility or programme to collect unused medicines (152, 76%) and an increased awareness among consumers regarding hazards and methods of disposal of unused medicines (154, 77%). Conclusion: Majority of consumers are aware about the need for safe disposal of unused medicines. But the right attitude for and practice of safe disposal of medicines is lacking. A need for increased awareness regarding safe disposal of medicines is acknowledged by majority of consumers. PMID:28104967

  15. A Survey of Knowledge, Attitude, and Practice of Consumers at a Tertiary Care Hospital Regarding the Disposal of Unused Medicines.

    PubMed

    Sonowal, Supriya; Desai, Chetna; Kapadia, Jigar D; Desai, Mira K

    2016-12-01

    To evaluate the knowledge, attitude and practice of consumers in India about disposal of unused medicines. A questionnaire comprising 11 questions evaluating the Knowledge (2), Attitude (3) and Practice (6) of unused medicines was prepared and pre validated before administering to 200 consumers of medicines attending the outpatient department of Civil Hospital Ahmedabad, a tertiary care teaching hospital in Western India. Requisite permissions from Institutional Ethics Committee and informed consent were obtained prior to recruiting them for the study. Responses were recorded, in Microsoft Excel ® spreadsheet and evaluated for percentage response. Majority of the respondents (136, 68%) stored unused medicines at home. Analgesics (26.5%) were the most common unused medicine stored. Safe disposal of medicine was considered necessary by majority respondents (160, 80%) for different reasons like prevention of illegal/unintended use (84, 42%), prevention of environmental pollution (32, 16%) or possible ADR caused by old drugs (54, 27%). Only 78 (39%) respondents were aware of appropriate methods of disposal. Disposal in household trash (61, 30.5%) was the most common method used. Majority of respondents felt the need for a facility or programme to collect unused medicines (152, 76%) and an increased awareness among consumers regarding hazards and methods of disposal of unused medicines (154, 77%). Majority of consumers are aware about the need for safe disposal of unused medicines. But the right attitude for and practice of safe disposal of medicines is lacking. A need for increased awareness regarding safe disposal of medicines is acknowledged by majority of consumers.

  16. Women's experiences of transfer from primary maternity unit to tertiary hospital in New Zealand: part of the prospective cohort Evaluating Maternity Units study.

    PubMed

    Grigg, Celia P; Tracy, Sally K; Schmied, Virginia; Monk, Amy; Tracy, Mark B

    2015-12-18

    There is worldwide debate regarding the appropriateness and safety of different birthplaces for well women. The Evaluating Maternity Units (EMU) study's primary objective was to compare clinical outcomes for well women intending to give birth in either a tertiary level maternity hospital or a freestanding primary level maternity unit. Little is known about how women experience having to change their birthplace plans during the antenatal period or before admission to a primary unit, or transfer following admission. This paper describes and explores women's experience of these changes-a secondary aim of the EMU study. This paper utilised the six week postpartum survey data, from the 174 women from the primary unit cohort affected by birthplace plan change or transfer (response rate 73%). Data were analysed using descriptive statistics and thematic analysis. The study was undertaken in Christchurch, New Zealand, which has an obstetric-led tertiary maternity hospital and four freestanding midwife-led primary maternity units (2010-2012). The 702 study participants were well, pregnant women booked to give birth in one of these facilities, all of whom received continuity of midwifery care, regardless of their intended or actual birthplace. Of the women who had to change their planned place of birth or transfer the greatest proportion of women rated themselves on a Likert scale as unbothered by the move (38.6%); 8.8% were 'very unhappy' and 7.6% 'very happy' (quantitative analysis). Four themes were identified, using thematic analysis, from the open ended survey responses of those who experienced transfer: 'not to plan', control, communication and 'my midwife'. An interplay between the themes created a cumulatively positive or negative effect on their experience. Women's experience of transfer in labour was generally positive, and none expressed stress or trauma with transfer. The women knew of the potential for change or transfer, although it was not wanted or planned

  17. [The 10-year stroke risk in hypertensive outpatients combined with diabetes in cardiovascular clinics of 36 tertiary hospitals in China].

    PubMed

    Bao, Bingnan; Zhou, Yingsheng; Liu, Jun; Huo, Yong

    2014-12-01

    To assess the estimated 10-year risk of stroke among hypertensive outpatients known with diabetes from cardiovascular clinics of 36 tertiary hospitals in China and to analyze the characteristics of the risk factors and the 10-year risk of stroke between the southern and the northern patients. A multi-center prevalence survey was conducted from October 2011 to June 2012. Hypertensive outpatients known with diabetes were enrolled from cardiovascular clinics of 36 tertiary hospitals in China. A total of 15 914 outpatients were included in the final analysis. The 10-year probability of stroke was evaluated by the Framingham stroke risk profile. According to the 10-year probability of stroke, patients were divided into low risk ( ≤ 5%), medium risk (6%∼9%) and high risk ( ≥ 10%). (1) Of all the hypertensive outpatients known with diabetes, the mean age was (64.6 ± 10.1) years and the mean systolic pressure was (138.7 ± 19.3) mmHg (1 mmHg = 0.133 kPa). Among them, 7.4% with atrial fibrillation, 11.2% with left ventricular hypertrophy, 57.2% with cardiovascular diseases, 17.1% smokers and 37.0% using mono-hypoglycemic agent. The southern patients who were older with more smokers had higher proportions of men and left ventricular hypertrophy, lower levels of systolic blood pressure, and lower proportions of other cardiovascular diseases than those of the northern patients ( all P < 0.05). (2) The mean 10-year probability of stroke was (20.9 ± 16.2) %. The southern patients had a higher mean 10-year probability of stroke than that of the northern patients [(22.4 ± 17.1) % vs (19.7 ± 15.2) %] (P < 0.01) . After adjusted by age and sex, the southern patients still had a higher mean 10-year probability of stroke (P < 0.05) . (3) All the patients had 7.7% with low risk, 17.4% with medium risk, and 74.9% with high risk. The southern patients had lower proportions of low and medium risk than those of the northern patients (6.7% vs 8.4%, 15.5% vs 18.9%), but had a

  18. Improving Pediatric Asthma Care and Outcomes Across Multiple Hospitals.

    PubMed

    Nkoy, Flory; Fassl, Bernhard; Stone, Bryan; Uchida, Derek A; Johnson, Joseph; Reynolds, Carolyn; Valentine, Karen; Koopmeiners, Karmella; Kim, Eun Hea; Savitz, Lucy; Maloney, Christopher G

    2015-12-01

    Gaps exist in inpatient asthma care. Our aims were to assess the impact of an evidence-based care process model (EB-CPM) 5 years after implementation at Primary Children's Hospital (PCH), a tertiary care facility, and after its dissemination to 7 community hospitals. Participants included asthmatics 2 to 17 years admitted at 8 hospitals between 2003 and 2013. The EB-CPM was implemented at PCH between January 2008 and March 2009, then disseminated to 7 community hospitals between January and June 2011. We measured compliance using a composite score (CS) for 8 quality measures. Outcomes were compared between preimplementation and postimplementation periods. Confounding was addressed through multivariable regression analyses. At PCH, the CS increased and remained at >90% for 5 years after implementation. We observed sustained reductions in asthma readmissions (P = .026) and length of stay (P < .001), a trend toward reduced costs (P = .094), and no change in hospital resource use, ICU transfers, or deaths. The CS also increased at the 7 community hospitals, reaching 80% to 90% and persisting >2 years after dissemination, with a slight but not significant readmission reduction (P = .119), a significant reduction in length of stay (P < .001) and cost (P = .053), a slight increase in hospital resource use (P = .032), and no change in ICU transfers or deaths. Our intervention resulted in sustained, long-term improvement in asthma care and outcomes at the tertiary care hospital and successful dissemination to community hospitals. Copyright © 2015 by the American Academy of Pediatrics.

  19. Awareness of Breast Cancer among Female Care Givers in Tertiary Cancer Hospital, China

    PubMed Central

    Dinegde, Negalign Getahun; Xuying, Li

    2017-01-01

    Objective: Breast cancer is a worldwide public health issue and most common cancer diagnosed among women including China, where advanced stages at diagnosis appears to be increasing and an ever-rising incidence twice as fast as global rates. The study was conducted to describe the awareness of breast cancer and associated factors among care giver women in tertiary Cancer Hospital, China. Methods: Institutional based cross-sectional study was conducted among 261 women selected by systematic random sampling. Information provided by the participants was converted into awareness scores for analysis using SPSS version 23. Awareness scores were dichotomized in to ‘good awareness and ‘poor awareness’ taking median score=11 as the cut-off point. Data analysis was performed using the binary logistic regression. A p-value of <0.05 was considered statistically significant. Result: The study showed that 46.7% of the respondents had good awareness. Breast lump was the most commonly known symptom of cancer by 61.7% of the respondents. Slightly more than half of the study participants acknowledged having a past history of breast cancer, drinking alcohol and having close relative with breast cancer as potential risk factors for breast cancer (63.6%, 58.6%, and 55.6% respectively). Nevertheless, a vast majority of the study participants were unable to appreciate modifiable risk factors of the disease. More than half of the participants had never/rarely checked their breasts and all of the participants wrongly answered breast cancer knowledge age related risk. Awareness level was significantly associated with entertainment preference (OR=3.57; 95%CI=1.71, 7.44) and residence setting areas (OR=2.4; 95%CI=1.04, 5.69). Conclusion: The study indicated suboptimal awareness while entertainment preference and residence setting were significantly associated with awareness level. Public awareness campaigns should be made by dissemination of information about breast cancer through

  20. Implementation of Enterprise Imaging Strategy at a Chinese Tertiary Hospital.

    PubMed

    Li, Shanshan; Liu, Yao; Yuan, Yifang; Li, Jia; Wei, Lan; Wang, Yuelong; Fei, Xiaolu

    2018-01-04

    Medical images have become increasingly important in clinical practice and medical research, and the need to manage images at the hospital level has become urgent in China. To unify patient identification in examinations from different medical specialties, increase convenient access to medical images under authentication, and make medical images suitable for further artificial intelligence investigations, we implemented an enterprise imaging strategy by adopting an image integration platform as the main tool at Xuanwu Hospital. Workflow re-engineering and business system transformation was also performed to ensure the quality and content of the imaging data. More than 54 million medical images and approximately 1 million medical reports were integrated, and uniform patient identification, images, and report integration were made available to the medical staff and were accessible via a mobile application, which were achieved by implementing the enterprise imaging strategy. However, to integrate all medical images of different specialties at a hospital and ensure that the images and reports are qualified for data mining, some further policy and management measures are still needed.

  1. Hometown Hospitals: The Weakest Link? Bioterrorism Readiness in America’s Rural Hospitals

    DTIC Science & Technology

    2004-06-01

    prophylaxis , and treatment. Eventually both public health and medical care systems were required to dispense antibiotics to an estimated 32,000...dispatched to the scene over 17 days in chaotic and feverish attempts to rescue and facilitate subsequent medical and surgical interventions to save...delivery of tertiary procedures for life-threatening diseases, hospitals face the quandary of terrorism preparedness and response with limited budgets

  2. Segregation of biomedical waste in an South Indian tertiary care hospital.

    PubMed

    Sengodan, Vetrivel Chezian

    2014-07-01

    Hospital wastes pose significant public health hazard if not properly managed. Hence, it is necessary to develop and adopt optimal waste management systems in the hospitals. Biomedical waste generated in Coimbatore Medical College Hospital was color coded (blue, yellow, and red) and the data was analyzed retrospectively on a daily basis for 3 years (January 2010-December 2012). Effective segregation protocols significantly reduced biomedical waste generated from 2011 to 2012. While biomedical waste of red category was significantly higher (>50%), the category yellow was the least. Per unit (per bed per day) total biomedical waste generated was 68.5, 68.8, and 61.3 grams in 2010, 2011, and 2012, respectively. Segregation of biomedical waste at the source of generation is the first and essential step in biomedical waste management. Continuous training, fixing the responsibility on the nursing persons, and constant supervision are the key criteria's in implementing biomedical waste segregation process, which can significantly reduce per unit biomedical waste generated. We highly recommend all hospitals to adopt our protocol and effectively implement them to reduce generation of biomedical waste.

  3. Evaluation of Health Status of Type 2 Diabetes Outpatients Receiving Care in a Tertiary Hospital in Nigeria.

    PubMed

    Adibe, Maxwell Ogochukwu; Anosike, Chibueze; Nduka, Sunday Odunke; Isah, Abdulmuminu

    2017-09-07

    The aim of this study was to determine the health status of type 2 diabetes patients in a Nigerian tertiary hospital, and examine the sociodemographic and clinical variables that predicted the health status of type 2 diabetes patients in terms of utility valuations and EuroQol Visual Analogue Scale (EQ-VAS) score. This was a cross-sectional study of 147 diabetes patients attending the University of Nigeria Teaching Hospital, Enugu State, Nigeria. The EQ-5D-5L instrument, version 2.1, was used to evaluate patients' self-reported health status, and patients who gave informed consent completed the questionnaire while waiting to see a doctor. Descriptive and multiple linear regression analyses were performed using SPSS version 20. Overall, 147 patients participated in this study, with a mean age (± standard deviation) of 56.7 years (± 10.33). Over half of the respondents were females (55.1%) and more than half were older than 60 years of age. The mean EQ-VAS and utility valuations of respondents were 72.59 ± 10.51 and 0.72 ± 0.13, respectively. The age of respondents independently and significantly predicted EQ-VAS by -2.659 per year, while the age of respondents, level of education, duration of diabetes, and presence of other illnesses independently and significantly predicted utility valuations by -0.020 per year, +0.029 per level of education, -0.008 per year, and -0.044 per illness, respectively. Less than 39% of patients experienced no problems for each of the dimensions, except self-care (68%). The results of this study revealed a relatively low health status among type 2 diabetic patients in Nigeria. Old age, duration of diabetes and the presence of other illnesses were major contributors to the negative impact on health status, while a higher level of education contributed positively to health status. Adequate family support, as well as regular and effective patient counseling and education, may be worthwhile.

  4. The development of hospital-based palliative care services in public hospitals in the Western Cape, South Africa.

    PubMed

    Gwyther, L; Krause, R; Cupido, C; Stanford, J; Grey, H; Credé, T; De Vos, A; Arendse, J; Raubenheimer, P

    2018-02-01

    With the recent approval of a South African (SA) National Policy Framework and Strategy for Palliative Care by the National Health Council, it is pertinent to reflect on initiatives to develop palliative care services in public hospitals. This article reviews the development of hospital-based palliative care services in the Western Cape, SA. Palliative care services in SA started in the non-governmental sector in the 1980s. The first SA hospital-based palliative care team was established in Charlotte Maxeke Johannesburg Academic Hospital in 2001. The awareness of the benefit of palliative care in the hospital setting led to the development of isolated pockets of excellence providing palliative care in the public health sector in SA. This article describes models for palliative care at tertiary, provincial and district hospital level, which could inform development of hospital-based palliative care as the national policy for palliative care is implemented in SA.

  5. Steroid profiling for congenital adrenal hyperplasia by tandem mass spectrometry as a second-tier test reduces follow-up burdens in a tertiary care hospital: a retrospective and prospective evaluation.

    PubMed

    Seo, Ja Young; Park, Hyung-Doo; Kim, Jong Won; Oh, Hyeon Ju; Yang, Jeong Soo; Chang, Yun Sil; Park, Won Soon; Lee, Soo-Youn

    2014-01-01

    Newborn screening for congenital adrenal hyperplasia (CAH) based on measuring 17-hydroxyprogesterone (17-OHP) by immunoassay generates a number of false-positive results, especially in preterm neonates. We applied steroid profiling by using liquid chromatography-tandem mass spectrometry (LC-MS/MS) as a second-tier test in newborns with positive CAH screening and evaluated its clinical utility in a tertiary care hospital setting. By performing a 4-year retrospective data review, we were able to test 121 dried blood spots from newborns with positive CAH screening for 17-OHP, androstenedione and cortisol levels by LC-MS/MS. We prospectively evaluated the clinical utility of steroid profiling after the implementation of steroid profiling as a second-tier test in our routine clinical practice. During the 2-year prospective study period, 104 cases with positive initial screening by FIA were tested by LC-MS/MS. Clinical and laboratory follow-up were performed for at least 6 months. The preterm neonates accounted for 50.7% (76/150) and 70.4% (88/125) of screening-positive cases in retrospective and prospective cohorts, respectively. By applying steroid profiling as a second-tier test for positive CAH screening, we eliminated all false-positive results and decreased the median follow-up time from 75 to 8 days. Our data showed that steroid profiling reduced the burden of follow-up exams by improving the positive predictive value of the CAH screening program. The use of steroid profiling as a second-tier test for positive CAH screening will improve clinical practice particularly in a tertiary care hospital setting where positive CAH screening from preterm neonates is frequently encountered.

  6. Cooperative Networks: Altruism, Group Solidarity, Reciprocity, and Sanctioning in Ugandan Producer Organizations.

    PubMed

    Baldassarri, Delia

    2015-09-01

    Repeated interaction and social networks are commonly considered viable solutions to collective action problems. This article identifies and systematically measures four general mechanisms--that is, generalized altruism, group solidarity, reciprocity, and the threat of sanctioning--and tests which of them brings about cooperation in the context of Ugandan producer organizations. Using an innovative methodological framework that combines "lab-in-the-field" experiments with survey interviews and complete social networks data, the article goes beyond the assessment of a relationship between social networks and collective outcomes to study the mechanisms that favor cooperative behavior. The article first establishes a positive relationship between position in the network structure and propensity to cooperate in the producer organization and then uses farmers' behavior in dictator and public goods games to test different mechanisms that may account for such a relationship. Results show that cooperation is induced by patterns of reciprocity that emerge through repeated interaction rather than other-regarding preferences like altruism or group solidarity.

  7. Pressure ulcer and patient characteristics--A point prevalence study in a tertiary hospital of India based on the European Pressure Ulcer Advisory Panel minimum data set.

    PubMed

    Mehta, Chitra; George, Joby V; Mehta, Yatin; Wangmo, Namgyal

    2015-08-01

    Pressure ulcers is a frequent problem in hospitalized patients. Several prevalence studies have been conducted across the globe. Little information is available regarding prevalence of pressure ulcers in India. The aim was to identify the prevalence of pressure ulcers in one of the tertiary hospital in northern India and the factors associated with its development. A cross sectional point prevalence study. European Pressure Ulcer Advisory Panel (EPUAP) data collection form. Ethics approval was obtained prior to start of the study. Total of 358 patients were enrolled in the study. All patients above 18 years of age admitted in intensive care units and wards were included in the study. Patients admitted in emergency, day care, coronary care unit were excluded because of their short duration of hospital stay (varies from 24 to 72 h usually). All patients admitted before midnight on the predetermined day were included. The Braden scale was used to identify the risk of developing pressure ulcers. European Pressure ulcer advisory panel (EPUAP) minimum data set was used to collect prevalence data. The overall prevalence rate was 7.8%.The sacrum and heel were more commonly affected. Grade III pressure ulcers were the most common (42.8%). The pressure ulcer prevalence rate in our hospital was lower than that published in international studies. Severe forms of pressure ulcers were commonly encountered This data provides background information that may help us in developing protocols for applying effective practices for prevention of pressure ulcers. Copyright © 2015 Tissue Viability Society. Published by Elsevier Ltd. All rights reserved.

  8. Clinical Features of Respiratory Viral Infections Among Inpatients at a Major US Tertiary Care Hospital.

    PubMed

    Malhotra, Prashant; Luka, Arthur; McWilliams, Carla S; Poeth, Kaitlin G; Schwartz, Rebecca; Elfekey, Mohammed; Balwan, Sandy

    2016-08-01

    Respiratory viral illnesses (RVI) are reliably diagnosed by respiratory viral panel using polymerase chain reaction (RVP-PCR); however, owing to the scant data, clinical presentation alone is unreliable in establishing viral etiology. The primary objective of this study was to characterize signs and symptoms of RVI among inpatients in a major tertiary care hospital. Between 2013 and 2015, adult inpatients with RVI undergoing RVP-PCR were prospectively enrolled in our study. Clinical data were collected by interviews and electronic medical record reviews. Data analysis was performed using χ(2) testing, analysis of variance for continuous variables, and logistic regression modeling. Of 421 patients analyzed, 175 (41.7%) had a positive RVP-PCR. Patients were evenly matched at baseline except for renal disease. Multivariate logistic regression modeling demonstrated the following positive correlations: positive RVP-PCR with renal disease (odds ratio [OR] 2.08), cough (OR 2.28), and wheezing (OR 1.8); influenza with cough (OR 5.04), and renal disease (OR 2.17); metapneumovirus with age older than 65 (OR 3.24); respiratory syncytial viruses with wheezing (OR 3.42) and immunosuppression (OR 3.11); and parainfluenza with smoking (OR 3.16). Negative correlations included influenza with anosmia (OR 0.41); rhinovirus/enterovirus with feeling confined to bed (OR 0.3); metapneumovirus with smoking (OR 0.29); and parainfluenza with male sex (OR 0.22). In this descriptive study, we noted specific viral associations with clinical signs and symptoms among 421 inpatients with RVIs. With increasing RVP-PCR use, studies similar to ours may be able to better define the clinical presentation of RVIs and lead to evidence-based, clinical presentation-guided diagnostic and management algorithms.

  9. Acute fibrinous and organizing pneumonia: A report of 13 cases in a tertiary university hospital.

    PubMed

    Gomes, Rita; Padrão, Eva; Dabó, Hans; Soares Pires, Filipa; Mota, Patrícia; Melo, Natália; Jesus, José Miguel; Cunha, Rui; Guimarães, Susana; Souto Moura, Conceição; Morais, António

    2016-07-01

    Acute fibrinous and organizing pneumonia (AFOP) is a rare diffuse pulmonary disease, but it is not yet known whether it is a distinct form of interstitial pneumonia or simply a reflection of a tissue sampling issue. Cross-sectional evaluation of clinical and radiological findings, treatments, and outcomes for patients with histologically confirmed AFOP at a tertiary university hospital between 2002 and 2015. Thirteen patients (7 women, 53.8%) with a mean ± SD age of 53.5 ± 16.1 years were included. The main symptoms were fever (69.2%), cough (46.2%), and chest pain (30.8%). All patients presented a radiological pattern of consolidation and 5 (38.5%) had simultaneous ground-glass areas. Histology was obtained by computed tomography-guided transthoracic biopsy in 61.5% of cases and by surgical lung biopsy in the remaining cases. Several potential etiologic factors were identified. Eight patients (61.5%) had hematologic disorders and 3 had undergone an autologous hematopoietic cell transplant. Two (15.4%) had microbiologic isolates, 5 (38.4%) had drug-induced lung toxicity, and 2 (15.4%) were classified as having idiopathic AFOP. In addition to antibiotics and diuretics used to treat the underlying disease, the main treatment was corticosteroids, combined in some cases with immunosuppressants. Median survival was 78 months and 6 patients (46.2%) were still alive at the time of analysis. Our findings for this series of patients confirm that AFOP is a nonspecific reaction to various agents with a heterogeneous clinical presentation and clinical course that seems to be influenced mainly by the severity of the underlying disorder.

  10. The Effect of Availability of Manpower on Trauma Resuscitation Times in a Tertiary Academic Hospital

    PubMed Central

    Quek, Nathaniel Xin Ern; Koh, Zhi Xiong; Nadkarni, Nivedita; Singaram, Kanageswari; Ho, Andrew Fu Wah; Ong, Marcus Eng Hock

    2016-01-01

    Background For trauma patients, delays to assessment, resuscitation, and definitive care affect outcomes. We studied the effects of resuscitation area occupancy and trauma team size on trauma team resuscitation speed in an observational study at a tertiary academic institution in Singapore. Methods From January 2014 to January 2015, resuscitation videos of trauma team activated patients with an Injury Severity Score of 9 or more were extracted for review within 14 days by independent reviewers. Exclusion criteria were patients dead on arrival, inter-hospital transfers, and up-triaged patients. Data captured included manpower availability (trauma team size and resuscitation area occupancy), assessment (airway, breathing, circulation, logroll), interventions (vascular access, imaging), and process-of-care time intervals (time to assessment/intervention/adjuncts, time to imaging, and total time in the emergency department). Clinical data were obtained by chart review and from the trauma registry. Results Videos of 70 patients were reviewed over a 13-month period. The median time spent in the emergency department was 154.9 minutes (IQR 130.7–207.5) and the median resuscitation team size was 7, with larger team sizes correlating with faster process-of-care time intervals: time to airway assessment (p = 0.08) and time to disposition (p = 0.04). The mean resuscitation area occupancy rate (RAOR) was 1.89±2.49, and the RAOR was positively correlated with time spent in the emergency department (p = 0.009). Conclusion Our results suggest that adequate staffing for trauma teams and resuscitation room occupancy are correlated with faster trauma resuscitation and reduced time spent in the emergency department. PMID:27136299

  11. Clinico-epidemiological profile of patients attending Suraksha Clinic of tertiary care hospital of North India

    PubMed Central

    Banger, H. S.; Sethi, Anisha; Malhotra, Sita; Malhotra, Suresh Kumar; Kaur, Tejinder

    2017-01-01

    Background: Sexually transmitted infections (STIs) are a global health problem. Trends of STIs vary from place to place depending on various epidemiological factors prevailing in that respective geographic area. Aims and Objectives: The present study was conducted to find the pattern and prevalence of different STIs out of total STI clinic attendees, to identify any change in the trend of STIs, various epidemiological factors, and behavior of individual diseases. Materials and Methods: Case records of the patients, attending the STI clinic (Suraksha Clinic) attached with Department of Dermatology, Venereology, and Leprosy of a tertiary care medical college and hospital of North India from April 2007 to March 2014, were analyzed. All the patients were thoroughly examined and investigated. Results: This study included a total of 5468 STI clinic attendees out of which 3908 were diagnosed to have STIs. Most of the patients were male, married, and in the third decade of their lives. In our study, the highest number of patients had herpes genitalis, i.e., 850 patients (21.75%) followed by 415 patients (10.61%) having genital warts. Molluscum contagiosum was present in 239 patients (6.11%), 106 patients (2.71%) had urethral discharge whereas 81 patients (2.07%) diagnosed to have syphilis. Viral infections accounted for 38.48% of cases. Human immunodeficiency virus (HIV) positivity was seen in 414 patients (10.59%) of total STI cases. Conclusion: The trend of STIs is changing from bacterial to viral diseases. This is because of the widespread use of antibacterial, self-medication, and treatment through national program. STIs enhance the susceptibility of an individual to acquire or transmit HIV through sexual contact. PMID:28442804

  12. Real-time automatic hospital-wide surveillance of nosocomial infections and outbreaks in a large Chinese tertiary hospital

    PubMed Central

    2014-01-01

    Background We aimed to develop a real-time nosocomial infection surveillance system (RT-NISS) to monitor all nosocomial infections (NIs) and outbreaks in a Chinese comprehensive hospital to better prevent and control NIs. Methods The screening algorithm used in RT-NISS included microbiological reports, antibiotic usage, serological and molecular testing, imaging reports, and fever history. The system could, in real-time, identify new NIs, record data, and produce time-series reports to align NI cases. Results Compared with a manual survey of NIs (the gold standard), the sensitivity and specificity of RT-NISS was 98.8% (84/85) and 93.0% (827/889), with time-saving efficiencies of about 200 times. RT-NISS obtained the highest hospital-wide monthly NI rate of 2.62%, while physician and medical record reviews reported rates of 1.52% and 2.35% respectively. It took about two hours for one infection control practitioner (ICP) to deal with 70 new suspicious NI cases; there were 3,500 inpatients each day in the study hospital. The system could also provide various updated data (i.e. the daily NI rate, surgical site infection (SSI) rate) for each ward, or the entire hospital. Within 3 years of implementing RT-NISS, the ICPs monitored and successfully controlled about 30 NI clusters and 4 outbreaks at the study hospital. Conclusions Just like the “ICPs’ eyes”, RT-NISS was an essential and efficient tool for the day-to-day monitoring of all NIs and outbreak within the hospital; a task that would not have been accomplished through manual process. PMID:24475790

  13. Moderating effects of coping on work stress and job performance for nurses in tertiary hospitals: a cross-sectional survey in China.

    PubMed

    Li, Li; Ai, Hua; Gao, Lei; Zhou, Hao; Liu, Xinyan; Zhang, Zhong; Sun, Tao; Fan, Lihua

    2017-06-12

    Work stress is a major problem for nurses and it can negatively influence job performance. Therefore, it is critical to explore variables that can reduce or buffer the negative effects of work stress. This study explores the moderating effects of coping strategies on the relationship between work stress and job performance for nurses in China. A cross-sectional survey of 852 nurses from four tertiary hospitals in Heilongjiang Province, China, was conducted in 2013. Descriptive statistics were reported for socioeconomic status and demographic characteristics, level of work stress, coping strategies, and job performance. Regression analysis was conducted to test the interaction between work stress and coping strategies on job performance. Three subscales of work stress were negatively related to job performance. Positive coping strategies moderated Patient Care and job performance while negative coping strategies moderated Workload and Time and performance, and between Working Environment and Resources and performance. Positive coping strategies reduce or buffer the negative effects of work stress on job performance and negative coping strategies increased the negative effects.

  14. The Influence of Beliefs About Health and Illness on Foot Care in Ugandan Persons with Diabetic Foot Ulcers

    PubMed Central

    Hjelm, Katarina; Beebwa, Esther

    2013-01-01

    Diabetes mellitus is becoming pandemic, particularly affecting Sub-Saharan Africa, and the prevalence of complications is increasing. Diabetic foot disorders are a major source of morbidity and disability. Delay in the health care process due to patients’ beliefs may have deleterious consequences for limb and life in persons with diabetic foot ulcers. No previous studies of beliefs about health and illness in persons with diabetic foot ulcers living in Africa have been found. The aim of the study was to explore beliefs about health and illness among Ugandans with diabetic foot ulcers that might affect self-care and care seeking behaviour. In an explorative study with consecutive sample semi-structured interviews were held with 14 Ugandan men and women, aged 40-79, with diabetic foot ulcer. Knowledge was limited about causes, management and prevention of diabetic foot ulcers. Foot ulcers were often detected as painful sores, perceived to heal or improve, and led to stress and social isolation due to smell and reduced mobility. Most lacked awareness of the importance of complete daily foot care and seldom practised self-care. Health was described as absence of disease and pain. Many feared future health and related it to contact with nurses in the professional sector from whom they sought information, blood tests and wound dressings and desired better organised diabetes clinics offering health education and more opening hours. Many have an underutilised potential for self-care and need education urgently, delivered in well-organised diabetes clinics working to raise awareness of the threat and prevent foot ulcers. PMID:24039644

  15. Assessment of hospital processes using a process mining technique: Outpatient process analysis at a tertiary hospital.

    PubMed

    Yoo, Sooyoung; Cho, Minsu; Kim, Eunhye; Kim, Seok; Sim, Yerim; Yoo, Donghyun; Hwang, Hee; Song, Minseok

    2016-04-01

    Many hospitals are increasing their efforts to improve processes because processes play an important role in enhancing work efficiency and reducing costs. However, to date, a quantitative tool has not been available to examine the before and after effects of processes and environmental changes, other than the use of indirect indicators, such as mortality rate and readmission rate. This study used process mining technology to analyze process changes based on changes in the hospital environment, such as the construction of a new building, and to measure the effects of environmental changes in terms of consultation wait time, time spent per task, and outpatient care processes. Using process mining technology, electronic health record (EHR) log data of outpatient care before and after constructing a new building were analyzed, and the effectiveness of the technology in terms of the process was evaluated. Using the process mining technique, we found that the total time spent in outpatient care did not increase significantly compared to that before the construction of a new building, considering that the number of outpatients increased, and the consultation wait time decreased. These results suggest that the operation of the outpatient clinic was effective after changes were implemented in the hospital environment. We further identified improvements in processes using the process mining technique, thereby demonstrating the usefulness of this technique for analyzing complex hospital processes at a low cost. This study confirmed the effectiveness of process mining technology at an actual hospital site. In future studies, the use of process mining technology will be expanded by applying this approach to a larger variety of process change situations. Copyright © 2016. Published by Elsevier Ireland Ltd.

  16. Portrayal of the Human Resource Crisis and Accountability in Healthcare: A Qualitative Analysis of Ugandan Newspapers

    PubMed Central

    Wojczewski, Silvia; Willcox, Merlin; Mubangizi, Vincent; Hoffmann, Kathryn; Peersman, Wim; Niederkrotenthaler, Thomas; Natukunda, Silvia; Maling, Samuel; Maier, Manfred; Mant, David; Kutalek, Ruth

    2015-01-01

    Background Uganda is one of the 57 countries with a critical shortage of health workers. The aim of this study was to determine how the human resources and health service crisis was covered in Ugandan newspapers and, in particular, how the newspapers attributed accountability for problems in the health services. Methods We collected all articles related to health workers and health services for the calendar year 2012 in the two largest national newspapers in Uganda (collection on daily basis) and in one local newspaper (collection on weekly basis). These articles were analysed qualitatively regarding the main themes covered and attribution of accountability. Results The two more urban national newspapers published 229 articles on human resources and health services in Uganda (on average over two articles per week), whereas the local more rural newspaper published only a single article on this issue in the 12 month period. The majority of articles described problems in the health service without discussing accountability. The question of accountability is raised in only 46% of articles (106 articles). The responsibility of the government was discussed in 50 articles (21%), and negligence, corruption and misbehaviour by individual health workers was reported in 56 articles (25%). In the articles about corruption (n=35), 60% (21 articles) mention corruption by health workers and 40% (14 articles) mention corruption by government officials. Six articles defended the situation of health workers in Uganda. Conclusions The coverage of accountability in the Ugandan newspapers surveyed is insufficient to generate informed debate on what political actions need to be taken to improve the crisis in health care and services. There exists not only an “inverse care law” but also an “inverse information law”: those sections of society with the greatest health needs and problems in accessing quality health care receive the least information about health services. PMID

  17. Portrayal of the human resource crisis and accountability in healthcare: a qualitative analysis of ugandan newspapers.

    PubMed

    Wojczewski, Silvia; Willcox, Merlin; Mubangizi, Vincent; Hoffmann, Kathryn; Peersman, Wim; Niederkrotenthaler, Thomas; Natukunda, Silvia; Maling, Samuel; Maier, Manfred; Mant, David; Kutalek, Ruth

    2015-01-01

    Uganda is one of the 57 countries with a critical shortage of health workers. The aim of this study was to determine how the human resources and health service crisis was covered in Ugandan newspapers and, in particular, how the newspapers attributed accountability for problems in the health services. We collected all articles related to health workers and health services for the calendar year 2012 in the two largest national newspapers in Uganda (collection on daily basis) and in one local newspaper (collection on weekly basis). These articles were analysed qualitatively regarding the main themes covered and attribution of accountability. The two more urban national newspapers published 229 articles on human resources and health services in Uganda (on average over two articles per week), whereas the local more rural newspaper published only a single article on this issue in the 12 month period. The majority of articles described problems in the health service without discussing accountability. The question of accountability is raised in only 46% of articles (106 articles). The responsibility of the government was discussed in 50 articles (21%), and negligence, corruption and misbehaviour by individual health workers was reported in 56 articles (25%). In the articles about corruption (n=35), 60% (21 articles) mention corruption by health workers and 40% (14 articles) mention corruption by government officials. Six articles defended the situation of health workers in Uganda. The coverage of accountability in the Ugandan newspapers surveyed is insufficient to generate informed debate on what political actions need to be taken to improve the crisis in health care and services. There exists not only an "inverse care law" but also an "inverse information law": those sections of society with the greatest health needs and problems in accessing quality health care receive the least information about health services.

  18. Factors that influence advance directives completion amongst terminally ill patients at a tertiary hospital in Kenya.

    PubMed

    Omondi, Stephen; Weru, John; Shaikh, Asim Jamal; Yonga, Gerald

    2017-01-25

    An advance directive (AD) is a written or verbal document that legally stipulates a person's health care preference while they are competent to make decisions for themselves and is used to guide decisions on life-sustaining treatment in the event that they become incapacitated. AD can take the form of a living will, a limitation of care document, a do-not-resuscitate order, or an appointment of a surrogate by durable power of attorney. The completion rate of AD varies from region to region, and it is influenced by multiple factors. The objectives of this study were to determine the proportion of terminally ill patients with AD and to identify the factors that influence the completion of AD amongst terminally ill patients at a tertiary hospital in Kenya. The study was a retrospective survey. All available records of terminally ill patients seen at Aga Khan University Hospital, Nairobi, between July 2010 and December 2015, and that met the inclusion criteria were included in the study. In total, 216 records of terminally ill patients were analyzed: 89 records were of patients that had AD and 127 records were of patients that did not have AD. The proportion of terminally ill patients that had completed AD was 41.2%. The factors that were associated with the completion of AD on bivariate analysis were history of ICU admission, history of endotracheal intubation, functional status of the patient, the medical specialty taking care of the patient, patient's caregiver discussing the AD with the patient, and a palliative specialist review. On multivariate regression analysis, discussion of AD with a caregiver and patient's functional impairment were the factors with statistically significant association with completion of AD. The proportion of terminally ill patients that had AD in their medical records was significant. However, most terminally ill patients did not have AD. Our data, perhaps the first on the subject in East Africa, suggest that most of the factors

  19. Getting the first birth right: A retrospective study of outcomes for low-risk primiparous women receiving standard care versus midwifery model of care in the same tertiary hospital.

    PubMed

    Wong, Nola; Browne, Jenny; Ferguson, Sally; Taylor, Jan; Davis, Deborah

    2015-12-01

    There is national and international concern for increasing obstetric intervention in childbirth and rising caesarean section rates. Repeat caesarean section is a major contributing factor, making primiparous women an important target for strategies to reduce unnecessary intervention and surgeries in childbirth. The aim was to compare outcomes for a cohort of low risk primiparous women who accessed a midwifery continuity model of care with those who received standard public care in the same tertiary hospital. A retrospective comparative cohort study design was implemented drawing on data from two databases held by a tertiary hospital for the period 1 January 2010 to 31 December 2011. Categorical data were analysed using the chi-squared statistic and Fisher's exact test. Continuous data were analysed using Student's t-test. Comparisons are presented using unadjusted and adjusted odds ratios, with 95% confidence intervals (CIs) and p-values with significance set at 0.05. Data for 426 women experiencing continuity of midwifery care and 1220 experiencing standard public care were compared. The study found increased rates of normal vaginal birth (57.7% vs. 48.9% p=0.002) and spontaneous vaginal birth (38% vs. 22.4% p=<0.001) and decreased rates of instrumental birth (23.5% vs. 28.5% p=0.050) and caesarean sections (18.8% vs. 22.5% p=0.115) in the midwifery continuity cohort. There were also fewer interventions in this group. No differences were found in neonatal outcomes. Strategies for reducing caesarean section rates and interventions in childbirth should focus on primiparous women as a priority. This study demonstrates the effectiveness of continuity midwifery models, suggesting that this is an important strategy for improving outcomes in this population. Copyright © 2015 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.

  20. Segregation of biomedical waste in an South Indian tertiary care hospital

    PubMed Central

    Sengodan, Vetrivel Chezian

    2014-01-01

    Introduction: Hospital wastes pose significant public health hazard if not properly managed. Hence, it is necessary to develop and adopt optimal waste management systems in the hospitals. Material and method: Biomedical waste generated in Coimbatore Medical College Hospital was color coded (blue, yellow, and red) and the data was analyzed retrospectively on a daily basis for 3 years (January 2010-December 2012). Results: Effective segregation protocols significantly reduced biomedical waste generated from 2011 to 2012. While biomedical waste of red category was significantly higher (>50%), the category yellow was the least. Per unit (per bed per day) total biomedical waste generated was 68.5, 68.8, and 61.3 grams in 2010, 2011, and 2012, respectively. Discussion: Segregation of biomedical waste at the source of generation is the first and essential step in biomedical waste management. Continuous training, fixing the responsibility on the nursing persons, and constant supervision are the key criteria's in implementing biomedical waste segregation process, which can significantly reduce per unit biomedical waste generated. Conclusion: We highly recommend all hospitals to adopt our protocol and effectively implement them to reduce generation of biomedical waste. PMID:25097419

  1. Managed care and the scale efficiency of US hospitals.

    PubMed

    Brown, H Shelton; Pagán, José A

    2006-12-01

    Managed care penetration has been partly responsible for slowing down increases in health care costs in recent years. This study uses a 1992-1996 Health Care Utilization Project sample of hospitals to analyze the relationship between managed care penetration in local insurance markets and hospital scale efficiency. After controlling for hospital and market area variables, we find that managed care insurance, particularly the preferred provider type, is associated with increases in hospital scale efficiency in tertiary cases. The results presented here are consistent with the view that managed care can lead to reductions in health cost inflation by controlling the diffusion of technology via improvements in the scale efficiency of hospitals.

  2. Striped tertiary storage arrays

    NASA Technical Reports Server (NTRS)

    Drapeau, Ann L.

    1993-01-01

    Data stripping is a technique for increasing the throughput and reducing the response time of large access to a storage system. In striped magnetic or optical disk arrays, a single file is striped or interleaved across several disks; in a striped tape system, files are interleaved across tape cartridges. Because a striped file can be accessed by several disk drives or tape recorders in parallel, the sustained bandwidth to the file is greater than in non-striped systems, where access to the file are restricted to a single device. It is argued that applying striping to tertiary storage systems will provide needed performance and reliability benefits. The performance benefits of striping for applications using large tertiary storage systems is discussed. It will introduce commonly available tape drives and libraries, and discuss their performance limitations, especially focusing on the long latency of tape accesses. This section will also describe an event-driven tertiary storage array simulator that is being used to understand the best ways of configuring these storage arrays. The reliability problems of magnetic tape devices are discussed, and plans for modeling the overall reliability of striped tertiary storage arrays to identify the amount of error correction required are described. Finally, work being done by other members of the Sequoia group to address latency of accesses, optimizing tertiary storage arrays that perform mostly writes, and compression is discussed.

  3. A survey on human papillomavirus awareness and acceptance of vaccination among nursing students in a tertiary hospital in Ankara, Turkey.

    PubMed

    Uzunlar, Özlem; Özyer, Şebnem; Başer, Eralp; Toğrul, Cihan; Karaca, Müjdegül; Güngör, Tayfun

    2013-04-19

    The purpose of this study was to assess the awareness and knowledge regarding human papillomavirus (HPV), HPV related conditions and HPV vaccine among nursing students, and to identify their attitudes towards HPV vaccination. The study was carried out at a tertiary Women's Health Care Center in Ankara, Turkey. Self-administered questionnaires were filled out individually by the nursing students and by a control group including similar aged women. Data regarding demographic information, knowledge and awareness about HPV infection and HPV vaccine, attitudes towards vaccination, acceptance of HPV vaccine and assessment of HPV vaccination attitudes of the nurses with respect to the gender of their children was assessed and recorded. A total of 752 participants was included in the analysis. Five hundred and twenty (69.14%) of the participants were nursing students and the rest (n=232; 30.8%) were control group. The mean ages of the nursing students and the control group were 19.4 (16-27) and 19.4 (16-25) years, respectively. Majority of the nursing students knew the causal relationship between HPV and cervical cancer. Seventy-eight percent of the nursing students and 22.4% of the control group stated that they had heard of HPV vaccine. While the rate of the willingness to be vaccinated was 33.7% in the nursing student group, it was only 13.4% in the control group. The awareness and knowledge about HPV, its relation with cervical cancer and prevention of cervical cancer by HPV vaccine were favorable among nursing students at a tertiary hospital in Ankara, Turkey. However, although aware of the theoretical implications, they did not seem to apply it to practice, such as not having regular gynecologic examinations and Pap smears. Thus, further studies are needed to evaluate the factors that affect practical applications of health care professionals responsible for providing health education to the public. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Performance of health workers in the management of seriously sick children at a Kenyan tertiary hospital: before and after a training intervention.

    PubMed

    Irimu, Grace W; Gathara, David; Zurovac, Dejan; Kihara, Harrison; Maina, Christopher; Mwangi, Julius; Mbori-Ngacha, Dorothy; Todd, Jim; Greene, Alexandra; English, Mike

    2012-01-01

    Implementation of WHO case management guidelines for serious common childhood illnesses remains a challenge in hospitals in low-income countries. The impact of locally adapted clinical practice guidelines (CPGs) on the quality-of-care of patients in tertiary hospitals has rarely been evaluated. We conducted, in Kenyatta National Hospital, an uncontrolled before and after study with an attempt to explore intervention dose-effect relationships, as CPGs were disseminated and training was progressively implemented. The emergency triage, assessment and treatment plus admission care (ETAT+) training and locally adapted CPGs targeted common, serious childhood illnesses. We compared performance in the pre-intervention (2005) and post-intervention periods (2009) using quality indicators for three diseases: pneumonia, dehydration and severe malnutrition. The indicators spanned four domains in the continuum of care namely assessment, classification, treatment, and follow-up care in the initial 48 hours of admission. In the pre-intervention period patients' care was largely inconsistent with the guidelines, with nine of the 15 key indicators having performance of below 10%. The intervention produced a marked improvement in guideline adherence with an absolute effect size of over 20% observed in seven of the 15 key indicators; three of which had an effect size of over 50%. However, for all the five indicators that required sustained team effort performance continued to be poor, at less than 10%, in the post-intervention period. Data from the five-year period (2005-09) suggest some dose dependency though the adoption rate of the best-practices varied across diseases and over time. Active dissemination of locally adapted clinical guidelines for common serious childhood illnesses can achieve a significant impact on documented clinical practices, particularly for tasks that rely on competence of individual clinicians. However, more attention must be given to broader implementation

  5. Perceptions and concerns of women undergoing Pap smear examination in a tertiary care hospital of India.

    PubMed

    Tiwari, A; Kishore, J; Tiwari, A

    2011-01-01

    Cervical cancer is one of the major causes of deaths due to cancer among women in India. Pap smear is one of the best methods to detect early changes in cervix. However, there is lack of data on awareness level of women about Pap smear and various risk factors for cervical cancer. To study the awareness about various risk factors for cervical cancer, health-seeking behavior and hygienic practices among women and to assess the distress experienced by these women before the Pap smear examination. This cross-sectional study was carried out on women coming for a Pap smear examination in a tertiary teaching hospital in New Delhi. A pretested interview schedule was used to get information after obtaining their informed consent. Fifty-seven percent stated that they did not consult a doctor when they noticed the symptoms the first time. Sixty-one percent did not know what a cervical cancer is and a same percentage of women did not know what a Pap smear examination was. Older age group, Muslim and literate women had higher number of abnormal Pap smear results. Women who reported being stressed in their lives had higher number of abnormal smears as compared to women who claimed to lead a stress free life. Poor hygienic practices among these women from urban areas were also associated with abnormal Pap smear results. The study concluded that factors such as poor awareness, shyness, poor hygiene, and old age could be responsible for abnormal Pap smears and this needs special attention in cancer prevention activities of the government.

  6. Characterisation and outcomes of adult patients with paracetamol overdose presenting to a tertiary hospital in Singapore.

    PubMed

    Tan, Christina Jiun-Yu; Sklar, Grant E

    2017-12-01

    Paracetamol is the most common pharmaceutical agent implicated in toxic exposure in Singapore. This study aimed to describe the characteristics of paracetamol overdose in the adult population managed at a tertiary healthcare facility in Singapore. Medical records of adult patients hospitalised with a diagnosis of paracetamol overdose at National University Hospital, Singapore, over a three-year period from January 2011 to December 2013 were retrospectively reviewed. A total of 177 patients had paracetamol overdose. The median age was 25 years, with a significant female predominance (71.2%). Intentional ingestion accounted for the majority (76.8%) of cases. The median dose of paracetamol ingested was 10 (interquartile range 8-15) g. Among patients who reported ingesting more than 10 g, 46.5% perceived the overdose as non-lethal. N-acetylcysteine was administered in 76.3% of patients, among whom 24.4% experienced an anaphylactoid reaction. Of the 10 (5.6%) patients who had severe hepatotoxicity, 2 (1.1%) developed acute liver failure. Most patients had resolving transaminases at discharge and none required liver transplantation. The median length of hospitalisation was three days. There were no fatalities. Paracetamol overdose occurred predominantly in young adults with intentional ingestion, suggesting that preventive measures targeted at promoting public awareness may not suffice. However, the perceived lack of lethality by many patients who ingested potentially toxic amounts of paracetamol reflects a certain knowledge gap. Healthcare providers should proactively educate consumers on the proper use of paracetamol and the consequences of its overdose. Copyright: © Singapore Medical Association

  7. Hospital-acquired infection in public hospital buildings in the Philippines: Is the type of ventilation increasing the risk?

    PubMed

    Vergeire-Dalmacion, Godofreda Ruiz; Itable, Jill Rafols; Baja, Emmanuel Saporna

    2016-11-24

    Hospital-acquired infections (HAIs) are associated with increased morbidity and mortality, especially in developing countries. However, limited information is available about the risk of HAIs in naturally ventilated wards (NVWs) and mechanically ventilated intensive care units (MVICUs) of public hospitals in the Philippines. We aimed to assess the association between HAIs and type of ventilation in an urban tertiary care hospital in the Philippines. A cross-sectional point-prevalence survey of infections was done in NVWs and MVICUs of a tertiary care hospital in December 2013. Multivariate analyses were done to examine the associations between HAIs and type of ventilation and other risk factors. Of the 224 patients surveyed, 63 (28%) patients had 69 HAIs. Pneumonia was the most common HAI (35%). Wards near areas with high vehicular activity had more respiratory HAI cases. Being immunocompromised is a risk factor for HAI for pediatric and adult patients. Among pediatric patients, staying in MVICUs had a lower risk for HAIs (adjusted odds ratio [AOR]: 0.33; 95% confidence interval [CI]: 0.10-1.08) compared to staying in NVWs. For adult patients, a higher risk for HAIs (AOR: 2.41; 95% CI: 0.29-18.20) was observed in MVICUs compared to NVWs. Type of ventilation is not a risk factor for HAIs. Patients who are immunocompromised may be at a higher risk for HAI. Indoor air pollution, proximity to congested main thoroughfare, and increased human foot traffic may contribute to the susceptibility of patients to HAIs. Hospital layout should be considered in infection control.

  8. Use of Rapid Ascertainment Process for Institutional Deaths (RAPID) to identify pregnancy-related deaths in tertiary-care obstetric hospitals in three departments in Haiti.

    PubMed

    Boyd, Andrew T; Hulland, Erin N; Grand'Pierre, Reynold; Nesi, Floris; Honoré, Patrice; Jean-Louis, Reginald; Handzel, Endang

    2017-05-16

    Accurate assessment of maternal deaths is difficult in countries lacking standardized data sources for their review. As a first step to investigate suspected maternal deaths, WHO suggests surveillance of "pregnancy-related deaths", defined as deaths of women while pregnant or within 42 days of termination of pregnancy, irrespective of cause. Rapid Ascertainment Process for Institutional Deaths (RAPID), a surveillance tool, retrospectively identifies pregnancy-related deaths occurring in health facilities that may be missed by routine surveillance to assess gaps in reporting these deaths. We used RAPID to review pregnancy-related deaths in six tertiary obstetric care facilities in three departments in Haiti. We reviewed registers and medical dossiers of deaths among women of reproductive age occurring in 2014 and 2015 from all wards, along with any additional available dossiers of deaths not appearing in registers, to capture pregnancy status, suspected cause of death, and timing of death in relation to the pregnancy. We used capture-recapture analyses to estimate the true number of in-hospital pregnancy-related deaths in these facilities. Among 373 deaths of women of reproductive age, we found 111 pregnancy-related deaths, 25.2% more than were reported through routine surveillance, and 22.5% of which were misclassified as non-pregnancy-related. Hemorrhage (27.0%) and hypertensive disorders (18.0%) were the most common categories of suspected causes of death, and deaths after termination of pregnancy were statistically significantly more common than deaths during pregnancy or delivery. Data were missing at multiple levels: 210 deaths had an undetermined pregnancy status, 48.7% of pregnancy-related deaths lacked specific information about timing of death in relation to the pregnancy, and capture-recapture analyses in three hospitals suggested that approximately one-quarter of pregnancy-related deaths were not captured by RAPID or routine surveillance. Across six

  9. Safety and cost savings of reducing adult dengue hospitalization in a tertiary care hospital in Singapore.

    PubMed

    Lee, Linda K; Earnest, Arul; Carrasco, Luis R; Thein, Tun L; Gan, Victor C; Lee, Vernon J; Lye, David C; Leo, Yee-Sin

    2013-01-01

    Previously, most dengue cases in Singapore were hospitalized despite low incidence of dengue hemorrhagic fever (DHF) or death. To minimize hospitalization, the Communicable Disease Centre at Tan Tock Seng Hospital (TTSH) in Singapore implemented new admission criteria which included clinical, laboratory, and DHF predictive parameters in 2007. All laboratory-confirmed dengue patients seen at TTSH during 2006-2008 were retrospectively reviewed for clinical data. Disease outcome and clinical parameters were compared over the 3 years. There was a 33.0% mean decrease in inpatients after the new criteria were implemented compared with the period before (p < 0.001). The proportion of inpatients with DHF increased significantly from 31.7% in 2006 to 34.4% in 2008 (p = 0.008); 68 DHF cases were managed safely on an outpatient basis after compared with none before implementation. DHF inpatients had more serious signs such as clinical fluid accumulation (15.5% vs 2.9% of outpatients), while most DHF outpatients had hypoproteinemia (92.7% vs 81.3% of inpatients). The eight intensive care unit admissions and five deaths during this time period all occurred among inpatients. The new criteria resulted in a median cost saving of US$1.4 million to patients in 2008. The new dengue admission criteria were effective in sustainably reducing length of hospitalization, yielding considerable cost savings. A minority of DHF patients with mild symptoms recovered uneventfully through outpatient management.

  10. Prevaccination antibody screening and immunization program for healthcare personnel against measles, mumps, rubella, and varicella in a Japanese tertiary care hospital.

    PubMed

    Kanamori, Hajime; Tokuda, Koichi; Ikeda, Shinobu; Endo, Shiro; Ishizawa, Chiyuki; Hirai, Yukari; Takahashi, Masami; Aoyagi, Tetsuji; Hatta, Masumitsu; Gu, Yoshiaki; Yano, Hisakazu; Weber, David J; Kaku, Mitsuo

    2014-10-01

    Susceptible healthcare personnel (HCP) are at high risk for acquiring and transmitting measles, mumps, rubella, and varicella (MMRV). Presumptive evidence of immunity to MMRV is recommended for HCP. The aim of this investigation was to examine the seroprevalence of MMRV in Japanese HCP and the association with history or vaccination in terms of occupational safety. To improve infection control at our hospital, we also assessed their immune status by implementing prevaccination antibody screening and an immunization program with postvaccination serological testing. We implemented seroprevalence surveys on MMRV antibodies among 243 newly and 2,664 previously hired HCP in a Japanese tertiary care hospital. Self-administered questionnaires about history of MMRV and vaccination with or without written documentation were completed for newly hired HCP. Prevaccination and postvaccination serological tests were performed using virus-specific IgG enzyme-linked immunosorbent assays. Indeed, only a few HCP accurately remembered or had written records of their disease or vaccination history. After our immunization program was implemented, the seropositivity rate reached levels as high as ~98% for measles, rubella, and varicella, and increased to ~80% for mumps. Our program was cost-effective, and no severe adverse reactions were reported. The prevaccination antibody screening for HCP would be helpful, given the lack of written vaccination records or documented disease history, and is also useful for the prevention of adverse reactions associated with unnecessary vaccination. It is important for infection control practitioners to comprehend the immune status of HCP against MMRV, and then provide an appropriate immunization program for susceptible HCP.

  11. A simple screening test for the detection of metallo-β-lactamase-producing Pseudomonas aeruginosa and Acinetobacter in a tertiary care hospital.

    PubMed

    Wan Nor Amilah, W A W; Noor Izani, N J; Ng, W K; Ashraful Haq, J

    2012-12-01

    Clinical utilization of carbapenems remains under threat with the emergence of acquired carbapenemase-producing bacteria, particularly metallo-β-lactamases (MBL). Rapid detection of MBL-producing Gram-negative bacilli is essential to prevent their widespread dissemination. However, no standardized detection method is available for routine laboratory use. The purpose of the study was to evaluate a chelating-agent based double disk synergic test and disk potentiation test for MBL-producing strain detection and to determine the isolation rate of MBL-producing Pseudomonas aeruginosa and Acinetobacter from clinical samples in our tertiary teaching hospital. A total of 22 and 66 imipenem-resistant P. aeruginosa and Acinetobacter isolates respectively were tested with ceftazidime (CAZ) disk by modified double disk synergic test and disk potentiation test using ethylenediaminetetraacetic acid (EDTA) and 2-mercaptopropionic acid (as chelating agents) to detect MBL production. The tests were compared with EDTA-phenanthroline-imipenem (EPI) microdilution MIC test as gold standard. MBL positive strains were detected in 17 (77.3%) P. aeruginosa and 2 (3.5%) Acinetobacter isolates. The disk potentiation test with 2-mercaptopropionic acid (2-MPA) dilution of 1:12 provided the most acceptable sensitivities and specificities (88.2% sensitivity and 100% specificity in P. aeruginosa; 100% sensitivity and specificity in Acinetobacter) compared to other screening methods used in this study. This study provided useful information on the local prevalence of MBL-producing P. aeruginosa and Acinetobacter in our hospital. Disc potentiation test with CAZ/2-MPA disc appears to be reliable and convenient MBL detection method in the routine clinical laboratory.

  12. Unit Cost of Medical Services at Different Hospitals in India

    PubMed Central

    Chatterjee, Susmita; Levin, Carol; Laxminarayan, Ramanan

    2013-01-01

    Institutional care is a growing component of health care costs in low- and middle-income countries, but local health planners in these countries have inadequate knowledge of the costs of different medical services. In India, greater utilisation of hospital services is driven both by rising incomes and by government insurance programmes that cover the cost of inpatient services; however, there is still a paucity of unit cost information from Indian hospitals. In this study, we estimated operating costs and cost per outpatient visit, cost per inpatient stay, cost per emergency room visit, and cost per surgery for five hospitals of different types across India: a 57-bed charitable hospital, a 200-bed private hospital, a 400-bed government district hospital, a 655-bed private teaching hospital, and a 778-bed government tertiary care hospital for the financial year 2010–11. The major cost component varied among human resources, capital costs, and material costs, by hospital type. The outpatient visit cost ranged from Rs. 94 (district hospital) to Rs. 2,213 (private hospital) (USD 1 = INR 52). The inpatient stay cost was Rs. 345 in the private teaching hospital, Rs. 394 in the district hospital, Rs. 614 in the tertiary care hospital, Rs. 1,959 in the charitable hospital, and Rs. 6,996 in the private hospital. Our study results can help hospital administrators understand their cost structures and run their facilities more efficiently, and we identify areas where improvements in efficiency might significantly lower unit costs. The study also demonstrates that detailed costing of Indian hospital operations is both feasible and essential, given the significant variation in the country’s hospital types. Because of the size and diversity of the country and variations across hospitals, a large-scale study should be undertaken to refine hospital costing for different types of hospitals so that the results can be used for policy purposes, such as revising payment rates

  13. Developing marketing strategies for university teaching hospitals.

    PubMed

    Fink, D J

    1980-07-01

    University teaching hospitals face increasing competition from community hospitals, expanding regulation of health care, a rising tide of consumerism, and in many cases a declining urban population base. These problems, which may threaten the teaching hospital's ability to continue tertiary care, teaching, and research functions, may be solved with the aid of new marketing strategies. In developing its marketing strategy, a hospital must assess its strengths and weaknesses, specify its goals in measurable terms, implement tactics to achieve these goals, and evaluate its marketing program. The strategies should be directed toward achieving better relationships with institutions, practitioners, and surrounding communities and increasing patient, visitor, and employee satisfaction. A wide variety of programs can be used to reach these goals and to help teaching hospitals meet the competitive challenges of this decade.

  14. Basic Risk Factors Awareness in Non-Communicable Diseases (BRAND) Study Among People Visiting Tertiary Care Centre in Mysuru, Karnataka.

    PubMed

    Thippeswamy, Thippeswamy; Chikkegowda, Prathima

    2016-04-01

    Non Communicable Diseases (NCDs) are the major causes of mortality and morbidity globally. Awareness about NCDs and their risk factors has an important role in prevention and management strategies of these NCDs. 1) To assess the awareness of risk factors contributing to NCDs among the patients visiting tertiary care hospital in Mysuru district; 2) To compare the difference in awareness of risk factors for NCDs among the urban and rural patients with/ without NCD visiting the tertiary care hospital. A cross- sectional study was conducted in a tertiary care centre- JSS Hospital, Mysuru, Karnataka from March 2013 - August 2013. The patients visiting Medicine OPD during the period were the study subjects. The subjects were allocated into 4 groups: Urban without any NCD, Urban with atleast one NCD, rural without NCD, rural with atleast one NCD. A pretested questionnaire regarding awareness of risk factors for NCDs was used in the study and frequency and proportions were used to analyse the data. A total of 400 subjects, 100 subjects in each group were included in the study. Out of these subjects about 65% of the urban group and 42% of the rural group subjects were aware of the NCDs and their risk factors. Least awareness was observed among the rural subjects without any NCDs (35%). The awareness of risk factors of NCDs and knowledge regarding prevention of NCDs was not satisfactory. The results highlighted the need and scope for health education and interventions to improve the awareness about NCDs and their risk factors.

  15. The algebra of healthcare reform: hospital-physician economic alignment.

    PubMed

    Goodroe, J H; Murphy, D A

    1999-01-01

    In summary the tertiary care programs in this nation are trapped in a difficult dilemma. On one side is the ongoing reduction in provider revenue driven by real and powerful market forces. On the other side is a traditional payment system governed by necessary laws that inhibit meaningful re-engineering of tertiary care delivery. If a remedy to this situation cannot be created then it is very likely that all aspects of quality as defined earlier will suffer. It is our hope that by very careful construction of a relationship, with attention to applicable statutes and careful measurement of utilization and quality, a limited business alignment of a hospital and a group of tertiary physicians can be approved in the care of Medicare, Medicaid and all federally funded patients.

  16. Antibiotic prescribing in women during and after delivery in a non-teaching, tertiary care hospital in Ujjain, India: a prospective cross-sectional study.

    PubMed

    Sharma, Megha; Sanneving, Linda; Mahadik, Kalpana; Santacatterina, Michele; Dhaneria, Suryaprakash; Stålsby Lundborg, Cecilia

    2013-01-01

    Antibacterial drugs (hereafter referred to as antibiotics) are crucial to treat infections during delivery and postpartum period to reduce maternal mortality. Institutional deliveries have the potential to save lives of many women but extensive use of antibiotics, add to the development and spread of antibiotic resistance. The aim of this study was to present antibiotic prescribing among inpatients during and after delivery in a non-teaching, tertiary care hospital in the city of Ujjain, Madhya Pradesh, India. A prospective cross-sectional study was conducted including women having had either a vaginal delivery or a cesarean section in the hospital. Trained nursing staff collected the data on daily bases, using a specific form attached to each patient file. Statistical analysis, including bivariate and multivariable logistic regression was conducted. Of the total 1077 women, 566 (53%) had a vaginal delivery and 511 (47%) had a cesarean section. Eighty-seven percent of the women that had a vaginal delivery and 98% of the women having a cesarean section were prescribed antibiotics. The mean number of days on antibiotics in hospital for the women with a vaginal delivery was 3.1 (±1.7) and for the women with cesarean section was 6.0 (±2.5). Twenty-eight percent of both the women with vaginal deliveries and the women with cesarean sections were prescribed antibiotics at discharge. The most commonly prescribed antibiotic group in the hospital for both the women that had a vaginal delivery and the women that had a cesarean section were third-generation cephalosporins (J01DD). The total number of defined daily doses (DDD) per100 bed days for women that had a vaginal delivery was 101, and 127 for women that had a cesarean section. The high percentage of women having had a vaginal delivery that received antibiotics and the deviation from recommendation for cesarean section in the hospital is a cause of concern. Improved maternal health and rational use of antibiotics are

  17. Trends of Do-Not-Resuscitate consent and hospice care utilization among noncancer decedents in a tertiary hospital in Taiwan between 2010 and 2014

    PubMed Central

    Chang, Hsiao-Ting; Lin, Ming-Hwai; Chen, Chun-Ku; Chou, Pesus; Chen, Tzeng-Ji; Hwang, Shinn-Jang

    2016-01-01

    Abstract Do-Not-Resuscitate (DNR) and hospice care are not only applied to cancer patients but also to patients with noncancer progressive illness. However, the trends of DNR consent and hospice utilization are not well explored for noncancer patients. This study aimed to explore the trends of DNR consent and hospice care utilization among noncancer decedents in a tertiary hospital in Taiwan. We analyzed the Death and Hospice Palliative Care Database from the Taipei Veterans General Hospital in Taiwan. The Death and Hospice Palliative Care Database contains information including patient sex, major diagnosis, admission date, date of death, age at death, department at discharge, status of DNR consent, and status of hospice care of patients who died in the Taipei Veterans General Hospital. Data on patients aged 20 years old or more who died of major terminal noncancer diseases, including brain diseases, amyotrophic lateral sclerosis, dementia, chronic obstructive pulmonary disease (COPD) and other lung diseases, heart failure, chronic liver diseases and cirrhosis, and renal failure between 2010 and 2014 were extracted for analysis. A total of 1416 patients aged 20 years or more died of major noncancer diseases in Taipei Veterans General Hospital during the study period. The most common diagnosis was brain diseases, amyotrophic lateral sclerosis, and dementias (n = 510, 36%) followed by chronic obstructive pulmonary disease and other lung diseases (n = 322, 22.7%). Among these noncancer decedents, 1045 (73.8%) had DNR consents, while 134 (9.5%) received hospice care. Patients diagnosed with renal failure had the highest percentage of DNR consent (80%), followed by chronic liver diseases and cirrhosis (77.7%). Patients diagnosed with chronic liver diseases and cirrhosis had the highest percentage of hospice utilization (17.4%), followed by renal failure (15.8%). The percentages of DNR consent and hospice utilization were significantly different across different

  18. An assessment of the safe delivery incentive program at a tertiary level hospital in Nepal.

    PubMed

    Baral, G

    2012-05-01

    Maternity incentive program of Nepal known as Safe Delivery Incentive Program (SDIP) was introduced nationwide in 2005 with the intention of increasing utilization of professional care at childbirth. The program provided both childbirth service as well as 'cash' to women giving birth in a health facility in addition to incentives to health provider for each delivery attended, either at home or the facility. Due to a lack of uniformity in its implementation and administrative delays, the program was reformed and even extended to many not-for-profit health institutions in early 2007, and implemented as a 'Safer Mother Program' popularly known as "Aama-Suraksha-Karyakram" since January 2009. This is a system research with observational and analytical components. Plausibility design is selected to evaluate the performance-based funding (PBF) as a system level intervention of maternity care using two instruments: Pay-For-Performance and Conditional-Cash-Transfer. It uses interrupted time-series to control for the natural trend. Research tools used are interviews, the focus group discussions and literature review. Numerical data are presented in simple graphs. While online random number generator was used partly, the purposive sampling was used for qualitative data. There is a gross discrepancy in non-targeted service delivery at the tertiary level health facility. Overflooding of maternity cases has hampered gynecological admission and surgical management delaying subspecialty care and junior physicians' training. With the same number and quality of physical facility and human resource, the additional program has put more strains to service providers and administrators. There should be adequate planning and preparation at all levels of health facilities; implementing a new program should not adversely affect another existing service delivery system. For the optional implementation, hospital organogram should be revised; and physical facilities and the low-risk birthing

  19. Combined Oral Contraceptive Pills: Profile of Acceptors in a Tertiary Hospital in South-South Nigeria.

    PubMed

    Abasiattai, A M; Utuk, M N; Ojeh, S O; Eyo, U E

    2011-01-01

    BACKGROUND: Combined oral contraceptive pills were the first contraceptive method to provide sexual freedom of choice for women through reliable, personal and private control of fertility. They are the most widely used hormonal contraceptives and also the most popular non-surgical method of contraception. OBJECTIVE: To review the profile of acceptors of combined oral contraceptive pills at the University of Uyo Teaching Hospital, Uyo. METHODOLOGY: An 8 year review of all clients that accepted combined oral contraceptive pills in the family planning clinic. RESULTS: There were 1,146 new contraceptive acceptors during the period of study out of which 309 (27.9%) accepted the pills. Majority of the clients were between 20 and 29 years of age (54.0%), were multiparous (72.8%), Christians (99.7%) and 61.2% had tertiary level education. Two hundred and fifty-five women (82.5%) desired to use combined oral contraceptive pills to space births while 7.8% wanted to limit child bearing. There was a high discontinuation rate among the women (45.0%) and out of these 87.9% of the clients changed to other contraceptive methods. All the clients commenced their pills within seven days of menstruation and only the low dose monophasic preparations were available in the family planning unit and thus were given to the clients. CONCLUSION: Women who accept to initiate combined oral contraceptive pills in our center are young, well educated, multiparous women who want to space their pregnancies. However, due to the high discontinuation rate among the clients, there is need for further studies evaluating reasons for the high discontinuation rate, exploring interactions between clients and providers' and also providers' attitude towards combined pills in our environment.

  20. Molecular, microbiological and clinical characterization of Clostridium difficile isolates from tertiary care hospitals in Colombia.

    PubMed

    Salazar, Clara Lina; Reyes, Catalina; Atehortua, Santiago; Sierra, Patricia; Correa, Margarita María; Paredes-Sabja, Daniel; Best, Emma; Fawley, Warren N; Wilcox, Mark; González, Ángel

    2017-01-01

    In Colombia, the epidemiology and circulating genotypes of Clostridium difficile have not yet been described. Therefore, we molecularly characterized clinical isolates of C.difficile from patients with suspicion of C.difficile infection (CDI) in three tertiary care hospitals. C.difficile was isolated from stool samples by culture, the presence of A/B toxins were detected by enzyme immunoassay, cytotoxicity was tested by cell culture and the antimicrobial susceptibility determined. After DNA extraction, tcdA, tcdB and binary toxin (CDTa/CDTb) genes were detected by PCR, and PCR-ribotyping performed. From a total of 913 stool samples collected during 2013-2014, 775 were included in the study. The frequency of A/B toxins-positive samples was 9.7% (75/775). A total of 143 isolates of C.difficile were recovered from culture, 110 (76.9%) produced cytotoxic effect in cell culture, 100 (69.9%) were tcdA+/tcdB+, 11 (7.7%) tcdA-/tcdB+, 32 (22.4%) tcdA-/tcdB- and 25 (17.5%) CDTa+/CDTb+. From 37 ribotypes identified, ribotypes 591 (20%), 106 (9%) and 002 (7.9%) were the most prevalent; only one isolate corresponded to ribotype 027, four to ribotype 078 and four were new ribotypes (794,795, 804,805). All isolates were susceptible to vancomycin and metronidazole, while 85% and 7.7% were resistant to clindamycin and moxifloxacin, respectively. By multivariate analysis, significant risk factors associated to CDI were, staying in orthopedic service, exposure to third-generation cephalosporins and staying in an ICU before CDI symptoms; moreover, steroids showed to be a protector factor. These results revealed new C. difficile ribotypes and a high diversity profile circulating in Colombia different from those reported in America and European countries.