47 CFR 73.4195 - Political advertising by UHF translators.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 47 Telecommunication 4 2010-10-01 2010-10-01 false Political advertising by UHF translators. 73.4195 Section 73.4195 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO... advertising by UHF translators. See Public Notice, FCC 76936, dated October 8, 1976. 62 FCC 2d 896; 41 FR...

The design and simulation of UHF RFID microstrip antenna

NASA Astrophysics Data System (ADS)

Chen, Xiangqun; Huang, Rui; Shen, Liman; Liu, Liping; Xiong, Dezhi; Xiao, Xiangqi; Liu, Mouhai; Renheng, Xu

2018-02-01

At present, China has delineated UHF RFID communicating frequency range which is 840 ∼ 845 MHz and 920 ∼ 925 MHz, but most UHF microstrip antenna don’t carry out this standard, that leads to radio frequency pollution. In order to solve the problems above, a method combining theory and simulation is adopted. Combining with a new ceramic material, a 925.5 MHz RFID microstrip antenna is designed, which is optimized and simulated by HFSS software. The results show that the VSWR of this RFID microstrip antenna is relatively small in the vicinity of 922.5 MHz, the gain is 2.1 dBi, which can be widely used in China’s UHF RFID communicating equipments.

Development of a large-area planar surface-wave plasma source with a cavity launcher driven by a 915 MHz UHF wave

NASA Astrophysics Data System (ADS)

Chang, Xijiang; Kunii, Kazuki; Liang, Rongqing; Nagatsu, Masaaki

2013-04-01

A large-area planar surface-wave plasma (SWP) source driven by a 915 MHz ultrahigh frequency (UHF) wave was developed. To avoid using large, thick dielectric plates as vacuum windows, we propose a cavity launcher consisting of a cylindrical cavity with several small quartz discs at the bottom. Three types of launchers with quartz discs located at different positions were tested to compare their plasma production efficiencies and spatial distributions of electron density. With the optimum launcher, large-area plasma discharges with a radial uniformity within ±10% were obtained in a radius of about 25-30 cm in Ar gas at 8 Pa for incident power in the range 0.5-2.5 kW. The maximum electron density and temperature were approximately (0.95-1.1) × 1011 cm-3 and 1.9-2.0 eV, respectively, as measured by a Langmuir probe located 24 cm below the bottom of the cavity launcher. Using an Ar/NH3 SWP with the optimum launcher, we demonstrated large-area amino-group surface modification of polyurethane sheets. Experimental results indicated that a uniform amino-group modification was achieved over a radius of approximately 40 cm, which is slightly larger than the radial uniformity of the electron density distribution.

Kinetic study of ion acoustic twisted waves with kappa distributed electrons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arshad, Kashif, E-mail: kashif.arshad.butt@gmail.com; Aman-ur-Rehman, E-mail: amansadiq@gmail.com; Mahmood, Shahzad, E-mail: shahzadm100@gmail.com

2016-05-15

The kinetic theory of Landau damping of ion acoustic twisted modes is developed in the presence of orbital angular momentum of the helical (twisted) electric field in plasmas with kappa distributed electrons and Maxwellian ions. The perturbed distribution function and helical electric field are considered to be decomposed by Laguerre-Gaussian mode function defined in cylindrical geometry. The Vlasov-Poisson equation is obtained and solved analytically to obtain the weak damping rates of the ion acoustic twisted waves in a non-thermal plasma. The strong damping effects of ion acoustic twisted waves at low values of temperature ratio of electrons and ions aremore » also obtained by using exact numerical method and illustrated graphically, where the weak damping wave theory fails to explain the phenomenon properly. The obtained results of Landau damping rates of the twisted ion acoustic wave are discussed at different values of azimuthal wave number and non-thermal parameter kappa for electrons.« less

Wind Turbine Clutter Mitigation in Coastal UHF Radar

PubMed Central

Wang, Caijun; Jiang, Dapeng; Wen, Biyang

2014-01-01

Coastal UHF radar provides a unique capability to measure the sea surface dynamic parameters and detect small moving targets, by exploiting the low energy loss of electromagnetic waves propagating along the salty and good conducting ocean surface. It could compensate the blind zone of HF surface wave radar at close range and reach further distance than microwave radars. However, its performance is susceptible to wind turbines which are usually installed on the shore. The size of a wind turbine is much larger than the wavelength of radio waves at UHF band, which results in large radar cross section. Furthermore, the rotation of blades adds time-varying Doppler frequency to the clutter and makes the suppression difficult. This paper proposes a mitigation method which is based on the specific periodicity of wind turbine clutter and performed mainly in the time-frequency domain. Field experimental data of a newly developed UHF radar are used to verify this method, and the results prove its effectiveness. PMID:24550709

Wind turbine clutter mitigation in coastal UHF radar.

PubMed

Yang, Jing; Pan, Chao; Wang, Caijun; Jiang, Dapeng; Wen, Biyang

2014-01-01

Coastal UHF radar provides a unique capability to measure the sea surface dynamic parameters and detect small moving targets, by exploiting the low energy loss of electromagnetic waves propagating along the salty and good conducting ocean surface. It could compensate the blind zone of HF surface wave radar at close range and reach further distance than microwave radars. However, its performance is susceptible to wind turbines which are usually installed on the shore. The size of a wind turbine is much larger than the wavelength of radio waves at UHF band, which results in large radar cross section. Furthermore, the rotation of blades adds time-varying Doppler frequency to the clutter and makes the suppression difficult. This paper proposes a mitigation method which is based on the specific periodicity of wind turbine clutter and performed mainly in the time-frequency domain. Field experimental data of a newly developed UHF radar are used to verify this method, and the results prove its effectiveness.

Magnetic field twist driven by remote convective motions: Characteristics and twist rates

NASA Technical Reports Server (NTRS)

Wang, Zheng-Zhi; Hassam, A. B.

1987-01-01

It is generally believed that convective motions below the solar photosphere induce a twist in the coronal magnetic field as a result of frozen-in physics. A question of interest is how much twist can one expect from a persistent convective motion, given the fact that dissipative effects will eventually figure. This question is examined by considering a model problem: two conducting plates, with finite resistivity, are set in sheared motion and forced at constant relative speed. A resistive plasma is between the plates and an initially vertical magnetic field connects the plates. The time rate of tilt experienced by the field is obtained as a function of Hartmann number and the resistivity ratio. Both analytical and numerical approaches are considered.

A System Implementation for Cooperation between UHF RFID Reader and TCP/IP Device

NASA Astrophysics Data System (ADS)

Lee, Sang Hoon; Jin, Ik Soo

This paper presents a system implementation for cooperation between UHF RFID reader and TCP/IP device that can be used as a home gateway. The system consists of an UHF RFID tag, an UHF RFID reader, a RF end-device, a RF coordinator and a TCP/IP I/F. The UHF RFID reader is compatible with EPC Class-0/Gen1, Class-1/Gen1, 2 and ISO18000-6B, operating at the 915MHz. In particular, UHF RFID reader can be combined with a RF end device/coordinator for ZigBee(IEEE 802.15.4) interface which is low power wireless standard. The TCP/IP device is communicated with RFID reader via wired type. On the other hand, it is connected with ZigBee end-device via wireless type. The experimental results show that the developed system can provide the right networking.

UHF FM receiver having improved frequency stability and low RFI emission

DOEpatents

Lupinetti, Francesco

1990-02-27

A UHF receiver which converts UHF modulated carrier signals to baseband video signals without any heterodyne or frequency conversion stages. A bandpass filter having a fixed frequency first filters the signals. A low noise amplifier amplifies the filtered signal and applies the signal through further amplification stages to a limited FM demodulator circuit. The UHF signal is directly converted to a baseband video signal. The baseband video signal is clamped by a clamping circuit before driving a monitor. Frequency stability for the receivers is at a theoretical maximum, and interference to adjacent receivers is eliminated due to the absence of a local oscillator.

Study of nonlinear MHD equations governing the wave propagation in twisted coronal loops

NASA Technical Reports Server (NTRS)

Parhi, S.; DeBruyne, P.; Goossens, M.; Zhelyazkov, I.

1995-01-01

The solar corona, modelled by a low beta, resistive plasma slab, sustains MHD wave propagations due to shearing footpoint motions in the photosphere. By using a numerical algorithm the excitation and nonlinear development of MHD waves in twisted coronal loops are studied. The plasma responds to the footpoint motion by sausage waves if there is no twist. The twist in the magnetic field of the loop destroys initially developed sausage-like wave modes and they become kinks. The transition from sausage to kink modes is analyzed. The twist brings about mode degradation producing high harmonics and this generates more complex fine structures. This can be attributed to several local extrema in the perturbed velocity profiles. The Alfven wave produces remnants of the ideal 1/x singularity both for zero and non-zero twist and this pseudo-singularity becomes less pronounced for larger twist. The effect of nonlinearity is clearly observed by changing the amplitude of the driver by one order of magnitude. The magnetosonic waves also exhibit smoothed remnants of ideal logarithmic singularities when the frequency of the driver is correctly chosen. This pseudo-singularity for fast waves is absent when the coronal loop does not undergo any twist but becomes pronounced when twist is included. On the contrary, it is observed for slow waves even if there is no twist. Increasing the twist leads to a higher heating rate of the loop. The larger twist shifts somewhat uniformly distributed heating to layers inside the slab corresponding to peaks in the magnetic field strength.

Low-cost passive UHF RFID tags on paper substrates

NASA Astrophysics Data System (ADS)

Sajal, Sayeed Zebaul Haque

To reduce the significant cost in the widespread deployment of UHF radio frequency identification (RFID) systems, an UHF RFID tag design is presented on paper substrates. The design is based on meander-line miniaturization techniques and open complementary split ring resonator (OCSRR) elements that reduce required conducting materials by 30%. Another passive UHF RFID tag is designed to sense the moisture based on the antenna's polarization. An inexpensive paper substrate and copper layer are used for flexibility and low-cost. The key characteristic of this design is the sensitivity of the antenna's polarization on the passive RFID tag to the moisture content in the paper substrate. In simulations, the antenna is circularly-polarized when the substrate is dry and is linearly-polarized when the substrate is wet. It was shown that the expected read-ranges and desired performance could be achieved reducing the over-all cost of the both designs.

Analysis strategies for high-resolution UHF-fMRI data.

PubMed

Polimeni, Jonathan R; Renvall, Ville; Zaretskaya, Natalia; Fischl, Bruce

2018-03-01

Functional MRI (fMRI) benefits from both increased sensitivity and specificity with increasing magnetic field strength, making it a key application for Ultra-High Field (UHF) MRI scanners. Most UHF-fMRI studies utilize the dramatic increases in sensitivity and specificity to acquire high-resolution data reaching sub-millimeter scales, which enable new classes of experiments to probe the functional organization of the human brain. This review article surveys advanced data analysis strategies developed for high-resolution fMRI at UHF. These include strategies designed to mitigate distortion and artifacts associated with higher fields in ways that attempt to preserve spatial resolution of the fMRI data, as well as recently introduced analysis techniques that are enabled by these extremely high-resolution data. Particular focus is placed on anatomically-informed analyses, including cortical surface-based analysis, which are powerful techniques that can guide each step of the analysis from preprocessing to statistical analysis to interpretation and visualization. New intracortical analysis techniques for laminar and columnar fMRI are also reviewed and discussed. Prospects for single-subject individualized analyses are also presented and discussed. Altogether, there are both specific challenges and opportunities presented by UHF-fMRI, and the use of proper analysis strategies can help these valuable data reach their full potential. Copyright © 2017 Elsevier Inc. All rights reserved.

UHF Signal Processing and Pattern Recognition of Partial Discharge in Gas-Insulated Switchgear Using Chromatic Methodology

PubMed Central

Wang, Xiaohua; Li, Xi; Rong, Mingzhe; Xie, Dingli; Ding, Dan; Wang, Zhixiang

2017-01-01

The ultra-high frequency (UHF) method is widely used in insulation condition assessment. However, UHF signal processing algorithms are complicated and the size of the result is large, which hinders extracting features and recognizing partial discharge (PD) patterns. This article investigated the chromatic methodology that is novel in PD detection. The principle of chromatic methodologies in color science are introduced. The chromatic processing represents UHF signals sparsely. The UHF signals obtained from PD experiments were processed using chromatic methodology and characterized by three parameters in chromatic space (H, L, and S representing dominant wavelength, signal strength, and saturation, respectively). The features of the UHF signals were studied hierarchically. The results showed that the chromatic parameters were consistent with conventional frequency domain parameters. The global chromatic parameters can be used to distinguish UHF signals acquired by different sensors, and they reveal the propagation properties of the UHF signal in the L-shaped gas-insulated switchgear (GIS). Finally, typical PD defect patterns had been recognized by using novel chromatic parameters in an actual GIS tank and good performance of recognition was achieved. PMID:28106806

UHF Signal Processing and Pattern Recognition of Partial Discharge in Gas-Insulated Switchgear Using Chromatic Methodology.

PubMed

Wang, Xiaohua; Li, Xi; Rong, Mingzhe; Xie, Dingli; Ding, Dan; Wang, Zhixiang

2017-01-18

The ultra-high frequency (UHF) method is widely used in insulation condition assessment. However, UHF signal processing algorithms are complicated and the size of the result is large, which hinders extracting features and recognizing partial discharge (PD) patterns. This article investigated the chromatic methodology that is novel in PD detection. The principle of chromatic methodologies in color science are introduced. The chromatic processing represents UHF signals sparsely. The UHF signals obtained from PD experiments were processed using chromatic methodology and characterized by three parameters in chromatic space ( H , L , and S representing dominant wavelength, signal strength, and saturation, respectively). The features of the UHF signals were studied hierarchically. The results showed that the chromatic parameters were consistent with conventional frequency domain parameters. The global chromatic parameters can be used to distinguish UHF signals acquired by different sensors, and they reveal the propagation properties of the UHF signal in the L-shaped gas-insulated switchgear (GIS). Finally, typical PD defect patterns had been recognized by using novel chromatic parameters in an actual GIS tank and good performance of recognition was achieved.

Twisted supersymmetry: Twisted symmetry versus renormalizability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dimitrijevic, Marija; Nikolic, Biljana; Radovanovic, Voja

We discuss a deformation of superspace based on a Hermitian twist. The twist implies a *-product that is noncommutative, Hermitian and finite when expanded in a power series of the deformation parameter. The Leibniz rule for the twisted supersymmetry transformations is deformed. A minimal deformation of the Wess-Zumino action is proposed and its renormalizability properties are discussed. There is no tadpole contribution, but the two-point function diverges. We speculate that the deformed Leibniz rule, or more generally the twisted symmetry, interferes with renormalizability properties of the model. We discuss different possibilities to render a renormalizable model.

Broad-band UHF dipole array

NASA Technical Reports Server (NTRS)

Bailey, M. C.

1985-01-01

A 6X6 array of fan-dipoles was designed to operate in the 510 to 660 MHz frequency range for aircraft flight test and evaluation of a UHF radiometer system. A broad-band dipole design operating near the first resonance is detailed. Measured VSWR and radiation patterns for the dipole array demonstrate achievable bandwidths in the 35 percent to 40 percent range.

High Latitude Scintillation Monitoring at UHF with the COMMX Experiment on TACSat4

NASA Astrophysics Data System (ADS)

Bernhardt, P. A.; Siefring, C. L.; Akins, K.; Nurnberger, M.

2013-12-01

UHF Beacon Transmissions at 253 MHz have provided high latitude scintillation monitoring from Gakona Alaska using the COMMX instrument on TACSat4. TACSat4 was constructed by the Naval Research Laboratory and was launched in September 2011 as an experimental communications satellite. Ground UHF transmissions are uplinked to TACSat4 using the 4 meter diameter antenna deployed to view the earth. These signals are coherently translated to other UHF frequency to be rebroadcast to the ground. Scintillation monitoring is achieved by taking the 401.25 MHz signals from ground DORIS beacons located in Cold Bay, Alaska; Yellowknife, Canada; Kauai, Hawaii; and Soccoro Island, Mexico. These signals are translated to 253 MHz and broadcast with the 4 meter antenna pointed to the UHF receiver located at Gakona, Alaska. The satellite antenna gain is 18 dB in this UHF band and the transmitter power is 2 Watts. The satellite is in an elliptical orbit with an inclination of 63 degrees and a perigee of 12,000 km. Doppler frequency shifts allow separation of each uplink from the ground DORIS beacons. This new scintillation monitoring system has been used to detect natural and artificial field aligned irregularity effects on the amplitude and phase of UHF carriers where typical scintillation amplitudes are 2dB or less. Using the HAARP transmitter in Alaska, TACSat4 was used to discover the artificial ionization clouds produce scintillation with as much as 16 dB and amplitude indices S4 greater than unity. This is the first demonstration of significant effects on radio scintillations using high power HF radio waves to disturb the ionosphere.

Ultra-Wideband UHF Microstrip Array for GeoSAR Application

NASA Technical Reports Server (NTRS)

Thomas, Robert F.; Huang, John

1998-01-01

GeoSAR is a program sponsored by DARPA (Defense Advanced Research Projects Agency) and NASA (National Aeronautics and Space Administration) to develop an airborne, radar- based, commercial terrain mapping system for identification of geologic, seismic, and environmental information, it has two (dual-band at X and UHF) state-of-the-art interferometric synthetic aperture radar (SAR) ground mapping systems. The UHF interferometric system is utilized to penetrate the vegetation canopy and obtain true ground surface height information, while the Xband system will provide capability of mapping the top foliage surface. This paper presents the UHF antenna system where the required center frequency is 350 MHz with a 160 MHz of bandwidth (46% from 270 MHz to 430 MHz). The antenna is required to have dual-linear polarization with a peak gain of 10 dB at the center frequency and a minimum gain of 8 dB toward two ends of the frequency band. One of the most challenging tasks, in addition to achieving the 46% bandwidth, is to develop an antenna with small enough size to fit in the wing-tip pod of a Gulfstream II aircraft.

Small Twisting Prominence

NASA Image and Video Library

2018-01-12

A small prominence rose up above the sun, appeared to twist around for several hours, and then began to send some streams of plasma back into the sun (Jan. 3-4, 2018). The action, observed in a wavelength of extreme ultraviolet light, lasted just about one day. Prominences like this one are quite common. In fact, there were several over the past few days. For a sense of scale, the prominence reached up more than several times the size of Earth. Movies are available at https://photojournal.jpl.nasa.gov/catalog/PIA22198

UHF wearable battery free sensor module for activity and falling detection.

PubMed

Nam Trung Dang; Thang Viet Tran; Wan-Young Chung

2016-08-01

Falling is one of the most serious medical and social problems in aging population. Therefore taking care of the elderly by detecting activity and falling for preventing and mitigating the injuries caused by falls needs to be concerned. This study proposes a wearable, wireless, battery free ultra-high frequency (UHF) smart sensor tag module for falling and activity detection. The proposed tag is powered by UHF RF wave from reader and read by a standard UHF Electronic Product Code (EPC) Class-1 Generation-2 reader. The battery free sensor module could improve the wearability of the wireless device. The combination of accelerometer signal and received signal strength indication (RSSI) from a reader in the passive smart sensor tag detect the activity and falling of the elderly very successfully. The fabricated smart sensor tag module has an operating range of up to 2.5m and conducting in real-time activity and falling detection.

The Anti-RFI Design of Intelligent Electric Energy Meters with UHF RFID

NASA Astrophysics Data System (ADS)

Chen, Xiangqun; Huang, Rui; Shen, Liman; chen, Hao; Xiong, Dezhi; Xiao, Xiangqi; Liu, Mouhai; Xu, Renheng

2018-03-01

In order to solve the existing artificial meter reading watt-hour meter industry is still slow and inventory of common problems, using the uhf radio frequency identification (RFID) technology and intelligent watt-hour meter depth fusion, which has a one-time read multiple tags, identification distance, high transmission rate, high reliability, etc, while retaining the original asset management functions, in order to ensure the uhf RFID and minimum impact on the operation of the intelligent watt-hour meter, proposed to improve the stability of the electric meter system while working at the same time, this paper designs the uhf RFID intelligent watt-hour meter radio frequency interference resistance, put forward to improve intelligent watt-hour meter electromagnetic compatibility design train of thought, and introduced its power and the hardware circuit design of printed circuit board, etc.

Twist limits for late twisting double somersaults on trampoline.

PubMed

Yeadon, M R; Hiley, M J

2017-06-14

An angle-driven computer simulation model of aerial movement was used to determine the maximum amount of twist that could be produced in the second somersault of a double somersault on trampoline using asymmetrical movements of the arms and hips. Lower bounds were placed on the durations of arm and hip angle changes based on performances of a world trampoline champion whose inertia parameters were used in the simulations. The limiting movements were identified as the largest possible odd number of half twists for forward somersaulting takeoffs and even number of half twists for backward takeoffs. Simulations of these two limiting movements were found using simulated annealing optimisation to produce the required amounts of somersault, tilt and twist at landing after a flight time of 2.0s. Additional optimisations were then run to seek solutions with the arms less adducted during the twisting phase. It was found that 3½ twists could be produced in the second somersault of a forward piked double somersault with arms abducted 8° from full adduction during the twisting phase and that three twists could be produced in the second somersault of a backward straight double somersault with arms fully adducted to the body. These two movements are at the limits of performance for elite trampolinists. Copyright © 2017 Elsevier Ltd. All rights reserved.

Study of comparison between Ultra-high Frequency (UHF) method and ultrasonic method on PD detection for GIS

NASA Astrophysics Data System (ADS)

Li, Yanran; Chen, Duo; Li, Li; Zhang, Jiwei; Li, Guang; Liu, Hongxia

2017-11-01

GIS (gas insulated switchgear), is an important equipment in power system. Partial discharge plays an important role in detecting the insulation performance of GIS. UHF method and ultrasonic method frequently used in partial discharge (PD) detection for GIS. However, few studies have been conducted on comparison of this two methods. From the view point of safety, it is necessary to investigate UHF method and ultrasonic method for partial discharge in GIS. This paper presents study aimed at clarifying the effect of UHF method and ultrasonic method for partial discharge caused by free metal particles in GIS. Partial discharge tests were performed in laboratory simulated environment. Obtained results show the ability of anti-interference of signal detection and the accuracy of fault localization for UHF method and ultrasonic method. A new method based on UHF method and ultrasonic method of PD detection for GIS is proposed in order to greatly enhance the ability of anti-interference of signal detection and the accuracy of detection localization.

The Twist Box Domain is Required for Twist1-induced Prostate Cancer Metastasis

PubMed Central

Gajula, Rajendra P.; Chettiar, Sivarajan T.; Williams, Russell D.; Thiyagarajan, Saravanan; Kato, Yoshinori; Aziz, Khaled; Wang, Ruoqi; Gandhi, Nishant; Wild, Aaron T.; Vesuna, Farhad; Ma, Jinfang; Salih, Tarek; Cades, Jessica; Fertig, Elana; Biswal, Shyam; Burns, Timothy F.; Chung, Christine H.; Rudin, Charles M.; Herman, Joseph M.; Hales, Russell K.; Raman, Venu; An, Steven S.; Tran, Phuoc T.

2013-01-01

Twist1, a basic helix-loop-helix transcription factor, plays a key role during development and is a master regulator of the epithelial-mesenchymal transition (EMT) that promotes cancer metastasis. Structure-function relationships of Twist1 to cancer-related phenotypes are underappreciated, so we studied the requirement of the conserved Twist box domain for metastatic phenotypes in prostate cancer (PCa). Evidence suggests that Twist1 is overexpressed in clinical specimens and correlated with aggressive/metastatic disease. Therefore, we examined a transactivation mutant, Twist1-F191G, in PCa cells using in vitro assays which mimic various stages of metastasis. Twist1 overexpression led to elevated cytoskeletal stiffness and cell traction forces at the migratory edge of cells based on biophysical single-cell measurements. Twist1 conferred additional cellular properties associated with cancer cell metastasis including increased migration, invasion, anoikis resistance, and anchorage-independent growth. The Twist box mutant was defective for these Twist1 phenotypes in vitro. Importantly, we observed a high frequency of Twist1-induced metastatic lung tumors and extra-thoracic metastases in vivo using the experimental lung metastasis assay. The Twist box was required for PCa cells to colonize metastatic lung lesions and extra-thoracic metastases. Comparative genomic profiling revealed transcriptional programs directed by the Twist box that were associated with cancer progression, such as Hoxa9. Mechanistically, Twist1 bound to the Hoxa9 promoter and positively regulated Hoxa9 expression in PCa cells. Finally, Hoxa9 was important for Twist1-induced cellular phenotypes associated with metastasis. These data suggest that the Twist box domain is required for Twist1 transcriptional programs and PCa metastasis. PMID:23982216

Artificial Ionization and UHF Radar Response Associated with HF Frequencies near Electron Gyro-Harmonics (Invited)

NASA Astrophysics Data System (ADS)

Watkins, B. J.; Fallen, C. T.; Secan, J. A.

2013-12-01

We present new results from O-mode ionospheric heating experiments at the HAARP facility in Alaska to demonstrate that the magnitude of artificial ionization production is critically dependent on the choice of HF frequency near gyro-harmonics. For O-mode heating in the lower F-region ionosphere, typically about 200 km altitude, artificial ionization enhancements are observed in the lower ionosphere (about 150 - 220 km) and also in the topside ionosphere above about 500 km. Lower ionosphere density enhancements are inferred from HF-enhanced ion and plasma-line signals observed with UHF radar. Upper ionospheric density enhancements have been observed with TEC (total electron content) experiments by monitoring satellite radio beacons where signal paths traverse the HF-modified ionosphere. Both density enhancements and corresponding upward plasma fluxes have also been observed in the upper ionosphere via in-situ satellite observations. The data presented focus mainly on observations near the third and fourth gyro-harmonics. The specific values of the height-dependent gyro-harmonics have been computed from a magnetic model of the field line through the HF heated volume. Experiments with several closely spaced HF frequencies around the gyro-harmonic frequency region show that the magnitude of the lower-ionosphere artificial ionization production maximizes for HF frequencies about 1.0 - 1.5 MHz above the gyro-harmonic frequency. The response is progressively larger as the HF frequency is increased in the frequency region near the gyro-harmonics. For HF frequencies that are initially greater than the gyro-harmonic value the UHF radar scattering cross-section is relatively small, and non-existent or very weak signals are observed; as the signal returns drop in altitude due to density enhancements the HF interaction region passes through lower altitudes where the HF frequency is less than the gyro-harmonic value, for these conditions the radar scattering cross-section is

Study of New Method Combined Ultra-High Frequency (UHF) Method and Ultrasonic Method on PD Detection for GIS

NASA Astrophysics Data System (ADS)

Li, Yanran; Chen, Duo; Zhang, Jiwei; Chen, Ning; Li, Xiaoqi; Gong, Xiaojing

2017-09-01

GIS (gas insulated switchgear), is an important equipment in power system. Partial discharge plays an important role in detecting the insulation performance of GIS. UHF method and ultrasonic method frequently used in partial discharge (PD) detection for GIS. It is necessary to investigate UHF method and ultrasonic method for partial discharge in GIS. However, very few studies have been conducted on the method combined this two methods. From the view point of safety, a new method based on UHF method and ultrasonic method of PD detection for GIS is proposed in order to greatly enhance the ability of anti-interference of signal detection and the accuracy of fault localization. This paper presents study aimed at clarifying the effect of the new method combined UHF method and ultrasonic method. Partial discharge tests were performed in laboratory simulated environment. Obtained results show the ability of anti-interference of signal detection and the accuracy of fault localization for this new method combined UHF method and ultrasonic method.

A signature correlation study of ground target VHF/UHF ISAR imagery

NASA Astrophysics Data System (ADS)

Gatesman, Andrew J.; Beaudoin, Christopher J.; Giles, Robert H.; Kersey, William T.; Waldman, Jerry; Carter, Steve; Nixon, William E.

2003-09-01

VV and HH-polarized radar signatures of several ground targets were acquired in the VHF/UHF band (171-342 MHz) by using 1/35th scale models and an indoor radar range operating from 6 to 12 GHz. Data were processed into medianized radar cross sections as well as focused, ISAR imagery. Measurement validation was confirmed by comparing the radar cross section of a test object with a method of moments radar cross section prediction code. The signatures of several vehicles from three vehicle classes (tanks, trunks, and TELs) were measured and a signature cross-correlation study was performed. The VHF/UHF band is currently being exploited for its foliage penetration ability, however, the coarse image resolution which results from the relatively long radar wavelengths suggests a more challenging target recognition problem. One of the study's goals was to determine the amount of unique signature content in VHF/UHF ISAR imagery of military ground vehicles. Open-field signatures are compared with each other as well as with simplified shapes of similar size. Signatures were also acquired on one vehicle in a variety of configurations to determine the impact of monitor target variations on the signature content at these frequencies.

A comparison of thunderstorm reflectivities measured at the VHF and UHF

NASA Technical Reports Server (NTRS)

Larsen, M. F.; Rottger, J.

1986-01-01

Observations of thunderstorms made with two radars operating at different wavelengths of 70 cm and 5.67 m are compared. The first set of observations was made with the UHF radar at the Arecibo Observatory in Puerto Rico, and the second set was made with the Max-Planck-Institut fur Aeronomie VHF radar in the Harz Mountains in West Germany. Both sets of observations show large echo strengths in the convective region above the -10 C isothem. At UHF, there appears to be a contribution from both the precipitation echoes and the normal echoes due to scatter from turbulent variations in the refractive index.

Special Semaphore Scheme for UHF Spacecraft Communications

NASA Technical Reports Server (NTRS)

Butman, Stanley; Satorius, Edgar; Ilott, Peter

2006-01-01

A semaphore scheme has been devised to satisfy a requirement to enable ultrahigh- frequency (UHF) radio communication between a spacecraft descending from orbit to a landing on Mars and a spacecraft, in orbit about Mars, that relays communications between Earth and the lander spacecraft. There are also two subsidiary requirements: (1) to use UHF transceivers, built and qualified for operation aboard the spacecraft that operate with residual-carrier binary phase-shift-keying (BPSK) modulation at a selectable data rate of 8, 32, 128, or 256 kb/s; and (2) to enable low-rate signaling even when received signals become so weak as to prevent communication at the minimum BPSK rate of 8 kHz. The scheme involves exploitation of Manchester encoding, which is used in conjunction with residual-carrier modulation to aid the carrier-tracking loop. By choosing various sequences of 1s, 0s, or 1s alternating with 0s to be fed to the residual-carrier modulator, one would cause the modulator to generate sidebands at a fundamental frequency of 4 or 8 kHz and harmonics thereof. These sidebands would constitute the desired semaphores. In reception, the semaphores would be detected by a software demodulator.

Interoperation of an UHF RFID Reader and a TCP/IP Device via Wired and Wireless Links

PubMed Central

Lee, Sang Hoon; Jin, Ik Soo

2011-01-01

A main application in radio frequency identification (RFID) sensor networks is the function that processes real-time tag information after gathering the required data from multiple RFID tags. The component technologies that contain an RFID reader, called the interrogator, which has a tag chip, processors, coupling antenna, and a power management system have advanced significantly over the last decade. This paper presents a system implementation for interoperation between an UHF RFID reader and a TCP/IP device that is used as a gateway. The proposed system consists of an UHF RFID tag, an UHF RFID reader, an RF end-device, an RF coordinator, and a TCP/IP I/F. The UHF RFID reader, operating at 915 MHz, is compatible with EPC Class-0/Gen1, Class-1/Gen1 and 2, and ISO18000-6B. In particular, the UHF RFID reader can be combined with the RF end-device/coordinator for a ZigBee (IEEE 802.15.4) interface, which is a low-power wireless standard. The TCP/IP device communicates with the RFID reader via wired links. On the other hand, it is connected to the ZigBee end-device via wireless links. The web based test results show that the developed system can remotely recognize information of multiple tags through the interoperation between the RFID reader and the TCP/IP device. PMID:22346665

Interoperation of an UHF RFID reader and a TCP/IP device via wired and wireless links.

PubMed

Lee, Sang Hoon; Jin, Ik Soo

2011-01-01

A main application in radio frequency identification (RFID) sensor networks is the function that processes real-time tag information after gathering the required data from multiple RFID tags. The component technologies that contain an RFID reader, called the interrogator, which has a tag chip, processors, coupling antenna, and a power management system have advanced significantly over the last decade. This paper presents a system implementation for interoperation between an UHF RFID reader and a TCP/IP device that is used as a gateway. The proposed system consists of an UHF RFID tag, an UHF RFID reader, an RF end-device, an RF coordinator, and a TCP/IP I/F. The UHF RFID reader, operating at 915 MHz, is compatible with EPC Class-0/Gen1, Class-1/Gen1 and 2, and ISO18000-6B. In particular, the UHF RFID reader can be combined with the RF end-device/coordinator for a ZigBee (IEEE 802.15.4) interface, which is a low-power wireless standard. The TCP/IP device communicates with the RFID reader via wired links. On the other hand, it is connected to the ZigBee end-device via wireless links. The web based test results show that the developed system can remotely recognize information of multiple tags through the interoperation between the RFID reader and the TCP/IP device.

Analysis of partial discharge activity by a conducting particle in liquid nitrogen under AC voltages adopting UHF technique

NASA Astrophysics Data System (ADS)

Sarathi, R.; Giridhar, A. V.; Sethupathi, K.

2010-01-01

Liquid nitrogen (LN 2) is used as an insulant as well as coolant in high temperature superconducting power equipments. Particle contamination in liquid nitrogen is one of the major cause for formation of partial discharges during operation. An attempt has been made in the present study to understand the feasibility of using Ultra High Frequency (UHF) sensors for identification of partial discharge (PD) formed due to particle movement in liquid nitrogen under AC voltages. It is observed that the partial discharge formed in LN 2 radiates UHF signal. The results of the study indicate that the conventional partial discharge measurement and UHF peak amplitude measurement have direct correlation. The Phase Resolved Partial Discharge (PRPD) analysis indicates that the partial discharge formed due to particle movement occurs in the entire phase windows of the AC voltage. The PD magnitude increases with increase in applied voltage. The frequency content of UHF signal generated due to particle movement in liquid nitrogen under AC voltages lies in the range of 0.5-1.5 GHz. The UHF sensor output signal analyzed using spectrum analyzer by operating it in zero-span mode, indicates that burst type PD occurs due to particle movement.

HF RFID versus UHF RFID--Technology for Library Service Transformation at City University of Hong Kong

ERIC Educational Resources Information Center

Ching, Steve H.; Tai, Alice

2009-01-01

Since libraries first used RFID systems in the late 1990s, more and more libraries have identified the advantages of the technology. With advances in HF and UHF RFID, both alternatives are now viable in library applications. While some librarians are still skeptical towards UHF RFID as unproven in the library arena, the City University of Hong…

A Quantitative Comparison of the Relative Performance of VHF and UHF Broadcast Systems. Technical Monograph Number 1.

ERIC Educational Resources Information Center

Rubin, Philip A.; And Others

A study was undertaken to: (1) assess problems with UHF television systems; and (2) identify problem-solving activities on which different broadcast institutions could cooperate, The model for comparing UHF with VHF broadcast/reception services assigned performance disparity figures to each of the following elements: (1) transmitter and…

Twist for Snyder space

NASA Astrophysics Data System (ADS)

Meljanac, Daniel; Meljanac, Stjepan; Mignemi, Salvatore; Pikutić, Danijel; Štrajn, Rina

2018-03-01

We construct the twist operator for the Snyder space. Our starting point is a non-associative star product related to a Hermitian realisation of the noncommutative coordinates originally introduced by Snyder. The corresponding coproduct of momenta is non-coassociative. The twist is constructed using a general definition of the star product in terms of a bi-differential operator in the Hopf algebroid approach. The result is given by a closed analytical expression. We prove that this twist reproduces the correct coproducts of the momenta and the Lorentz generators. The twisted Poincaré symmetry is described by a non-associative Hopf algebra, while the twisted Lorentz symmetry is described by the undeformed Hopf algebra. This new twist might be important in the construction of different types of field theories on Snyder space.

Kinetic Theory of quasi-electrostatic waves in non-gyrotropic plasmas

NASA Astrophysics Data System (ADS)

Arshad, K.; Poedts, S.; Lazar, M.

2017-12-01

The orbital angular momentum (OAM) is a trait of helically phased light or helical (twisted) electric field. Lasers carrying orbital angular momentum (OAM) revolutionized many scientific and technological paradigms like microscopy, imaging and ionospheric radar facility to analyze three dimensional plasma dynamics in ionosphere, ultra-intense twisted laser pulses, twisted gravitational waves and astrophysics. This trend has also been investigated in plasma physics. Laguerre-Gaussian type solutions are predicted for magnetic tornadoes and Alfvénic tornadoes which exhibit spiral, split and ring-like morphologies. The ring shape morphology is ideal to fit the observed solar corona, solar atmosphere and Earth's ionosphere. The orbital angular momentum indicates the mediation of electrostatic and electromagnetic waves in new phenomena like Raman and Brillouin scattering. A few years ago, some new effects have been included in studies of orbital angular momentum in plasma regimes such as wave-particle interaction in the presence of helical electric field. Therefore, kinetic studies are carried out to investigate the Landau damping of the waves and growth of the instabilities in the presence helical electric field carrying orbital angular momentum for the Maxwellian distributed plasmas. Recently, a well suited approach involving a kappa distribution function has been adopted to model the twisted space plasmas. This leads to the development of new theoretical grounds for the study of Lorentzian or kappa distributed twisted Langmuir, ion acoustic, dust ion acoustic and dust acoustic modes. The quasi-electrostatic twisted waves have been studied now for the non-gyrotropic dusty plasmas in the presence of the orbital angular momentum of the helical electric field using Generalized Lorentzian or kappa distribution function. The Laguerre-Gaussian (LG) mode function is employed to decompose the perturbed distribution function and electric field into planar (longitudinal) and

The electric field changes and UHF radiations caused by the triggered lightning in Japan

NASA Technical Reports Server (NTRS)

Kawasaki, Zen-Ichiro; Kanao, Tadashi; Matsuura, Kenji; Nakano, Minoru; Horii, Kenji; Nakamura, Koichi

1991-01-01

In the rocket triggered lightning experiment of fiscal 1989, researchers observed electromagnetic field changes and UHF electromagnetic radiation accompanying rocket triggered lightning. It was found that no rapid changes corresponding to the return stroke of natural lightning were observed in the electric field changes accompanying rocket triggered lightning. However, continuous currents were present. In the case of rocket triggered lightning to the tower, electromagnetic field changes corresponding to the initiation of triggered lightning showed a bipolar pulse of a relatively large amplitude. In contrast, the rocket triggered lightning to the ground did not have such a bipolar pulse. The UHF radiation accompanying the rocket triggered lightning preceded the waveform portions corresponding to the first changes in electromagnetic fields. The number of isolated pulses in the UHF radiation showed a correlation with the time duration from rocket launching up to triggered lightning. The time interval between consecutive isolated pulses tended to get shorter with the passage of time, just like the stepped leaders of natural lightning.

Determination of the Wavelength of u.h.f. TV Transmissions

ERIC Educational Resources Information Center

Gaskell, D. C.

1973-01-01

Describes an experiment suitable for high school physics classes in which students determine the wavelength of electromagnetic radiation of u.h.f. television transmissions. Elaborate equipment is not required, and details are given for the construction of a dipole. (JR)

Enhanced UHF RFID tags for drug tracing.

PubMed

Catarinucci, Luca; Colella, Riccardo; De Blasi, Mario; Patrono, Luigi; Tarricone, Luciano

2012-12-01

Radio Frequency Identification (RFID) technology is playing a crucial role for item-level tracing systems in healthcare scenarios. The pharmaceutical supply chain is a fascinating application context, where RFID can guarantee transparency in the drug flow, supporting both suppliers and consumers against the growing counterfeiting problem. In such a context, the choice of the most adequate RFID tag, in terms of shape, frequency, size and reading range, is crucial. The potential presence of items containing materials hostile to the electromagnetic propagation exasperates the problem. In addition, the peculiarities of the different RFID-based checkpoints make even more stringent the requirements for the tag. In this work, the performance of several commercial UHF RFID tags in each step of the pharmaceutical supply chain has been evaluated, confirming the expected criticality. On such basis, a guideline for the electromagnetic design of new high-performance tags capable to overcome such criticalities has been defined. Finally, driven by such guidelines, a new enhanced tag has been designed, realized and tested. Due to patent pending issues, the antenna shape is not shown. Nevertheless, the optimal obtained results do not lose their validity. Indeed, on the one hand they demonstrate that high performance item level tracing systems can actually be implemented also in critical operating conditions. On the other hand, they encourage the tag designer to follow the identified guidelines so to realize enhanced UHF tags.

Influence of barrier on partial discharge activity by a conducting particle in liquid nitrogen under AC voltages adopting UHF technique

NASA Astrophysics Data System (ADS)

Sarathi, R.; Giridhar, A. V.; Sethupathi, K.

2011-02-01

The UHF signals are generated due to PD formed by particle movement in liquid nitrogen under AC voltages. The levitation voltage of a particle in liquid nitrogen measured through UHF technique and by conventional PD measurement technique is the same, confirming the sensitivity of UHF technique for identification of PD activity. The frequency content of UHF signal generated due to particle movement in liquid nitrogen, under AC voltages, lies in the range 0.5-1.5 GHz. The characteristics of UHF signal generated due to particle movement between the barrier and high voltage/ground electrode is much similar to the signal generated by particle movement in clean electrode gap. Pseudo resonance phenomena can occur in liquid nitrogen due to particle movement. It is also observed that the partial discharge magnitude, in general, be high when the particle moves between the barrier and high voltage electrode when compared to the barrier and the ground electrode. Percentage of clay in epoxy nanocomposites has not altered the levitation voltage of the particle in the electrode gap. Zero span analysis clearly indicates that pseudo resonance occurs when particle moves (in a short gap) between the barrier and high voltage/ground electrode.

Field line twist and field-aligned currents in an axially symmetric equilibrium magnetosphere. [of Uranus

NASA Technical Reports Server (NTRS)

Voigt, Gerd-Hannes

1986-01-01

Field-aligned Birkeland currents and the angle of the magnetic line twist were calculated for an axially symmetric pole-on magnetosphere (assumed to be in MHD equilibrium). The angle of the field line twist was shown to have a strong radial dependence on the axisymmetric magnetotail as well as on the ionospheric conductivity and the amount of thermal plasma contained in closed magnetotail flux tubes. The field line twist results from the planetary rotation, which leads to the development of a toroidal magnetic B-sub-phi component and to differentially rotating magnetic field lines. It was shown that the time development of the toroidal magnetic B-sub-phi component and the rotation frequency are related through an induction equation.

The role of plasma chemistry on functional silicon nitride film properties deposited at low-temperature by mixing two frequency powers using PECVD.

PubMed

Sahu, B B; Yin, Y Y; Tsutsumi, T; Hori, M; Han, Jeon G

2016-05-14

Control of the plasma densities and energies of the principal plasma species is crucial to induce modification of the plasma reactivity, chemistry, and film properties. This work presents a systematic and integrated approach to the low-temperature deposition of hydrogenated amorphous silicon nitride films looking into optimization and control of the plasma processes. Radiofrequency (RF) and ultrahigh frequency (UHF) power are combined to enhance significantly the nitrogen plasma and atomic-radical density to enforce their effect on film properties. This study presents an extensive investigation of the influence of combining radiofrequency (RF) and ultrahigh frequency (UHF) power as a power ratio (PR = RF : UHF), ranging from 4 : 0 to 0 : 4, on the compositional, structural, and optical properties of the synthesized films. The data reveal that DF power with a characteristic bi-Maxwellian electron energy distribution function (EEDF) is effectively useful for enhancing the ionization and dissociation of neutrals, which in turn helps in enabling high rate deposition with better film properties than that of SF operations. Utilizing DF PECVD, a wide-bandgap of ∼3.5 eV with strong photoluminescence features can be achieved only by using a high-density plasma and high nitrogen atom density at room temperature. The present work also proposes the suitability of the DF PECVD approach for industrial applications.

Detection of moving humans in UHF wideband SAR

NASA Astrophysics Data System (ADS)

Sjögren, Thomas K.; Ulander, Lars M. H.; Frölind, Per-Olov; Gustavsson, Anders; Stenström, Gunnar; Jonsson, Tommy

2014-06-01

In this paper, experimental results for UHF wideband SAR imaging of humans on an open field and inside a forest is presented. The results show ability to detect the humans and suggest possible ways to improve the results. In the experiment, single channel wideband SAR mode of the UHF UWB system LORA developed by Swedish Defence Research Agency (FOI). The wideband SAR mode used in the experiment was from 220 to 450 MHz, thus with a fractional bandwidth of 0.68. Three humans walking and one stationary were available in the scene with one of the walking humans in the forest. The signature of the human in the forest appeared on the field, due to azimuth shift from the positive range speed component. One human on the field and the one in the forest had approximately the same speed and walking direction. The signatures in the SAR image were compared as a function of integration time based on focusing using the average relative speed of these given by GPS logs. A signal processing gain was obtained for the human in forest until approximately 15 s and 35 s for the human on the field. This difference is likely explained by uneven terrain and trees in the way, causing a non-straight walking path.

Wire harness twisting aid

NASA Technical Reports Server (NTRS)

Casey, E. J.; Commadore, C. C.; Ingles, M. E.

1980-01-01

Long wire bundles twist into uniform spiral harnesses with help of simple apparatus. Wires pass through spacers and through hand-held tool with hole for each wire. Ends are attached to low speed bench motor. As motor turns, operator moves hand tool away forming smooth twists in wires between motor and tool. Technique produces harnesses that generate less radio-frequency interference than do irregularly twisted cables.

Detection of Partial Discharge Sources Using UHF Sensors and Blind Signal Separation

PubMed Central

Boya, Carlos; Parrado-Hernández, Emilio

2017-01-01

The measurement of the emitted electromagnetic energy in the UHF region of the spectrum allows the detection of partial discharges and, thus, the on-line monitoring of the condition of the insulation of electrical equipment. Unfortunately, determining the affected asset is difficult when there are several simultaneous insulation defects. This paper proposes the use of an independent component analysis (ICA) algorithm to separate the signals coming from different partial discharge (PD) sources. The performance of the algorithm has been tested using UHF signals generated by test objects. The results are validated by two automatic classification techniques: support vector machines and similarity with class mean. Both methods corroborate the suitability of the algorithm to separate the signals emitted by each PD source even when they are generated by the same type of insulation defect. PMID:29140267

Twisting/Swirling Motions during a Prominence Eruption as Seen from SDO/AIA

NASA Astrophysics Data System (ADS)

Pant, V.; Datta, A.; Banerjee, D.; Chandrashekhar, K.; Ray, S.

2018-06-01

A quiescent prominence was observed at the northwest limb of the Sun using different channels of the Atmospheric Imaging Assembly on board the Solar Dynamics Observatory. We report and analyze twisting/swirling motions during and after the prominence eruption. We segregate the observed rotational motions into small and large scales. Small-scale rotational motions manifest in the barbs of the prominence, while the large-scale rotation manifests as the roll motion during the prominence eruption. We noticed that both footpoints of the prominence rotate in the counterclockwise direction. We propose that a similar sense of rotation in both footpoints leads to a prominence eruption. The prominence erupted asymmetrically near the southern footpoint, which may be due to an uneven mass distribution and location of the cavity near the southern footpoint. Furthermore, we study the swirling motion of the plasma along different circular paths in the cavity of the prominence after the prominence eruption. The rotational velocities of the plasma moving along different circular paths are estimated to be ∼9–40 km s‑1. These swirling motions can be explained in terms of twisted magnetic field lines in the prominence cavity. Finally we observe the twist built up in the prominence, being carried away by the coronal mass ejection, as seen in the Large Angle Spectrometric Coronagraph on board the Solar and Heliospheric Observatory.

UHF and VHF radar observations of thunderstorms

NASA Technical Reports Server (NTRS)

Holden, D. N.; Ulbrich, C. W.; Larsen, M. F.; Rottger, J.; Ierkic, H. M.; Swartz, W.

1986-01-01

A study of thunderstorms was made in the Summer of 1985 with the 430-MHz and 50-MHz radars at the Arecibo Observatory in Puerto Rico. Both radars use the 300-meter dish, which gives a beam width of less than 2 degrees even at these long wavelengths. Though the radars are steerable, only vertical beams were used in this experiment. The height resolution was 300 and 150 meters for the UHF and VHF, respectively. Lightning echoes, as well as returns from precipitation and clear-air turbulence were detected with both wavelengths. Large increases in the returned power were found to be coincident with increasing downward vertical velocities at UHF, whereas at VHF the total power returned was relatively constant during the life of a storm. This was attributed to the fact that the VHF is more sensitive to scattering from the turbulence-induced inhomogeneities in the refractive index and less sensitive to scatter from precipitation particles. On occasion, the shape of the Doppler spectra was observed to change with the occurrence of a lightning discharge in the pulse volume. Though the total power and mean reflectivity weighted Doppler velocity changed little during these events, the power is Doppler frequency bins near that corresponding to the updraft did increase substantially within a fraction of a second after a discharge was detected in the beam. This suggests some interaction between precipitation and lightning.

Study on Miniaturized UHF Antennas for Partial Discharge Detection in High-Voltage Electrical Equipment.

PubMed

Liu, Jingcun; Zhang, Guogang; Dong, Jinlong; Wang, Jianhua

2015-11-20

Detecting partial discharge (PD) is an effective way to evaluate the condition of high-voltage electrical equipment insulation. The UHF detection method has attracted attention due to its high sensitivity, strong interference resistance, and ability to locate PDs. In this paper, a miniaturized equiangular spiral antenna (ESA) for UHF detection that uses a printed circuit board is proposed. I-shaped, L-shaped, and C-shaped microstrip baluns were designed to match the impedance between the ESA and coaxial cable and were verified by a vector network analyzer. For comparison, three other types of UHF antenna were also designed: A microstrip patch antenna, a microstrip slot antenna, and a printed dipole antenna. Their antenna factors were calibrated in a uniform electric field of different frequencies modulated in a gigahertz transverse electromagnetic cell. We performed comparison experiments on PD signal detection using an artificial defect model based on the international IEC 60270 standard. We also conducted time-delay test experiments on the ESA sensor to locate a PD source. It was found that the proposed ESA sensor meets PD signal detection requirements. The sensor's compact size makes it suitable for internal installation in high-voltage electrical equipment.

Study on Miniaturized UHF Antennas for Partial Discharge Detection in High-Voltage Electrical Equipment

PubMed Central

Liu, Jingcun; Zhang, Guogang; Dong, Jinlong; Wang, Jianhua

2015-01-01

Detecting partial discharge (PD) is an effective way to evaluate the condition of high-voltage electrical equipment insulation. The UHF detection method has attracted attention due to its high sensitivity, strong interference resistance, and ability to locate PDs. In this paper, a miniaturized equiangular spiral antenna (ESA) for UHF detection that uses a printed circuit board is proposed. I-shaped, L-shaped, and C-shaped microstrip baluns were designed to match the impedance between the ESA and coaxial cable and were verified by a vector network analyzer. For comparison, three other types of UHF antenna were also designed: A microstrip patch antenna, a microstrip slot antenna, and a printed dipole antenna. Their antenna factors were calibrated in a uniform electric field of different frequencies modulated in a gigahertz transverse electromagnetic cell. We performed comparison experiments on PD signal detection using an artificial defect model based on the international IEC 60270 standard. We also conducted time-delay test experiments on the ESA sensor to locate a PD source. It was found that the proposed ESA sensor meets PD signal detection requirements. The sensor’s compact size makes it suitable for internal installation in high-voltage electrical equipment. PMID:26610506

Reproducing continuous radio blackout using glow discharge plasma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Kai; Li, Xiaoping; Liu, Donglin

2013-10-15

A novel plasma generator is described that offers large-scale, continuous, non-magnetized plasma with a 30-cm-diameter hollow structure, which provides a path for an electromagnetic wave. The plasma is excited by a low-pressure glow discharge, with varying electron densities ranging from 10{sup 9} to 2.5 × 10{sup 11} cm{sup −3}. An electromagnetic wave propagation experiment reproduced a continuous radio blackout in UHF-, L-, and S-bands. The results are consistent with theoretical expectations. The proposed method is suitable in simulating a plasma sheath, and in researching communications, navigation, electromagnetic mitigations, and antenna compensation in plasma sheaths.

`Twisted' electrons

NASA Astrophysics Data System (ADS)

Larocque, Hugo; Kaminer, Ido; Grillo, Vincenzo; Leuchs, Gerd; Padgett, Miles J.; Boyd, Robert W.; Segev, Mordechai; Karimi, Ebrahim

2018-04-01

Electrons have played a significant role in the development of many fields of physics during the last century. The interest surrounding them mostly involved their wave-like features prescribed by the quantum theory. In particular, these features correctly predict the behaviour of electrons in various physical systems including atoms, molecules, solid-state materials, and even in free space. Ten years ago, new breakthroughs were made, arising from the new ability to bestow orbital angular momentum (OAM) to the wave function of electrons. This quantity, in conjunction with the electron's charge, results in an additional magnetic property. Owing to these features, OAM-carrying, or twisted, electrons can effectively interact with magnetic fields in unprecedented ways and have motivated materials scientists to find new methods for generating twisted electrons and measuring their OAM content. Here, we provide an overview of such techniques along with an introduction to the exciting dynamics of twisted electrons.

Operator constraints for twist-3 functions and Lorentz invariance properties of twist-3 observables

DOE PAGES

Kanazawa, Koichi; Pitonyak, Daniel; Koike, Yuji; ...

2016-03-14

We investigate the behavior under Lorentz transformations of perturbative coefficient functions in a collinear twist-3 formalism relevant for high-energy observables including transverse polarization of hadrons. We argue that those perturbative coefficient functions can, a priori, acquire quite different yet Lorentz-invariant forms in various frames. This somewhat surprising difference can be traced back to a general dependence of the perturbative coefficient functions on light cone vectors which are introduced by the twist-3 factorization formulas and which are frame-dependent. One can remove this spurious frame dependence by invoking so-called Lorentz invariance relations (LIRs) between twist-3 parton correlation functions. Some of those relationsmore » for twist-3 distribution functions were discussed in the literature before. In this paper we derive the corresponding LIRs for twist-3 fragmentation functions. We explicitly demonstrate that these LIRs remove the light cone vector dependence by considering transverse spin observables in the single-inclusive production of hadrons in lepton-nucleon collisions, ℓN→hX. Furthermore, with the LIRs in hand, we also show that twist-3 observables in general can be written solely in terms of three-parton correlation functions.« less

Investigation into the effects of VHF and UHF band radiation on Hewlett-Packard (HP) Cesium Beam Frequency Standards

NASA Technical Reports Server (NTRS)

Dickens, Andrew

1995-01-01

This paper documents an investigation into reports which have indicated that exposure to VHF and UHF band radiation has adverse effects on the frequency stability of HP cesium beam frequency standards. Tests carried out on the basis of these reports show that sources of VHF and UHF radiation such as two-way hand held police communications devices do cause reproducible adverse effects. This investigation examines reproducible effects and explores possible causes.

Endothelial TWIST1 Promotes Pathological Ocular Angiogenesis

PubMed Central

Li, Jie; Liu, Chi-Hsiu; Sun, Ye; Gong, Yan; Fu, Zhongjie; Evans, Lucy P.; Tian, Katherine T.; Juan, Aimee M.; Hurst, Christian G.; Mammoto, Akiko; Chen, Jing

2014-01-01

Purpose. Pathological neovessel formation impacts many blinding vascular eye diseases. Identification of molecular signatures distinguishing pathological neovascularization from normal quiescent vessels is critical for developing new interventions. Twist-related protein 1 (TWIST1) is a transcription factor important in tumor and pulmonary angiogenesis. This study investigated the potential role of TWIST1 in modulating pathological ocular angiogenesis in mice. Methods. Twist1 expression and localization were analyzed in a mouse model of oxygen-induced retinopathy (OIR). Pathological ocular angiogenesis in Tie2-driven conditional Twist1 knockout mice were evaluated in both OIR and laser-induced choroidal neovascularization models. In addition, the effects of TWIST1 on angiogenesis and endothelial cell function were analyzed in sprouting assays of aortic rings and choroidal explants isolated from Twist1 knockout mice, and in human retinal microvascular endothelial cells treated with TWIST1 small interfering RNA (siRNA). Results. TWIST1 is highly enriched in pathological neovessels in OIR retinas. Conditional Tie2-driven depletion of Twist1 significantly suppressed pathological neovessels in OIR without impacting developmental retinal angiogenesis. In a laser-induced choroidal neovascularization model, Twist1 deficiency also resulted in significantly smaller lesions with decreased vascular leakage. In addition, loss of Twist1 significantly decreased vascular sprouting in both aortic ring and choroid explants. Knockdown of TWIST1 in endothelial cells led to dampened expression of vascular endothelial growth factor receptor 2 (VEGFR2) and decreased endothelial cell proliferation. Conclusions. Our study suggests that TWIST1 is a novel regulator of pathologic ocular angiogenesis and may represent a new molecular target for developing potential therapeutic treatments to suppress pathological neovascularization in vascular eye diseases. PMID:25414194

Gauge transformations for twisted spectral triples

NASA Astrophysics Data System (ADS)

Landi, Giovanni; Martinetti, Pierre

2018-05-01

It is extended to twisted spectral triples the fluctuations of the metric as bounded perturbations of the Dirac operator that arises when a spectral triple is exported between Morita equivalent algebras, as well as gauge transformations which are obtained by the action of the unitary endomorphisms of the module implementing the Morita equivalence. It is firstly shown that the twisted-gauged Dirac operators, previously introduced to generate an extra scalar field in the spectral description of the standard model of elementary particles, in fact follow from Morita equivalence between twisted spectral triples. The law of transformation of the gauge potentials turns out to be twisted in a natural way. In contrast with the non-twisted case, twisted fluctuations do not necessarily preserve the self-adjointness of the Dirac operator. For a self-Morita equivalence, conditions are obtained in order to maintain self-adjointness that are solved explicitly for the minimal twist of a Riemannian manifold.

Calibration of ultra-high frequency (UHF) partial discharge sensors using FDTD method

NASA Astrophysics Data System (ADS)

Ishak, Asnor Mazuan; Ishak, Mohd Taufiq

2018-02-01

Ultra-high frequency (UHF) partial discharge sensors are widely used for conditioning monitoring and defect location in insulation system of high voltage equipment. Designing sensors for specific applications often requires an iterative process of manufacturing, testing and mechanical modifications. This paper demonstrates the use of finite-difference time-domain (FDTD) technique as a tool to predict the frequency response of UHF PD sensors. Using this approach, the design process can be simplified and parametric studies can be conducted in order to assess the influence of component dimensions and material properties on the sensor response. The modelling approach is validated using gigahertz transverse electromagnetic (GTEM) calibration system. The use of a transient excitation source is particularly suitable for modeling using FDTD, which is able to simulate the step response output voltage of the sensor from which the frequency response is obtained using the same post-processing applied to the physical measurement.

Twisted complex superfluids in optical lattices

PubMed Central

Jürgensen, Ole; Sengstock, Klaus; Lühmann, Dirk-Sören

2015-01-01

We show that correlated pair tunneling drives a phase transition to a twisted superfluid with a complex order parameter. This unconventional superfluid phase spontaneously breaks the time-reversal symmetry and is characterized by a twisting of the complex phase angle between adjacent lattice sites. We discuss the entire phase diagram of the extended Bose—Hubbard model for a honeycomb optical lattice showing a multitude of quantum phases including twisted superfluids, pair superfluids, supersolids and twisted supersolids. Furthermore, we show that the nearest-neighbor interactions lead to a spontaneous breaking of the inversion symmetry of the lattice and give rise to dimerized density-wave insulators, where particles are delocalized on dimers. For two components, we find twisted superfluid phases with strong correlations between the species already for surprisingly small pair-tunneling amplitudes. Interestingly, this ground state shows an infinite degeneracy ranging continuously from a supersolid to a twisted superfluid. PMID:26345721

The Twist Limit for Bipolar Active Regions

NASA Technical Reports Server (NTRS)

Moore, Ron; Falconer, David; Gary, Allen

2008-01-01

We present new evidence that further supports the standard idea that active regions are emerged magnetic-flux-rope omega loops. When the axial magnetic twist of a cylindrical flux rope exceeds a critical amount, the flux rope becomes unstable to kinking, and the excess axial twist is converted into writhe twist by the kinking. This suggests that, if active regions are emerged omega loops, then (1) no active region should have magnetic twist much above the limit set by kinking, (2) active regions having twist near the limit should often arise from kinked omega loops, and (3) since active regions having large delta sunspots are outstandingly twisted, these arise from kinked omega loops and should have twist near the limit for kinking. From each of 36 vector magnetograms of bipolar active regions, we have measured (1) the total flux of the vertical field above 100 G, (2) the area covered by this flux, and (3) the net electric current that arches over the polarity inversion line. These three quantities yield an estimate of the axial magnetic twist in a simple model cylindrical flux rope that corresponds to the top of the active region s hypothetical omega loop prior to emergence. In all 36 cases, the estimated twist is below the critical limit for kinking. The 11 most twisted active regions (1) have estimated twist within a factor of approx.3 of the limit, and (2) include all of our 6 active regions having large delta sunspots. Thus, our observed twist limit for bipolar active regions is in good accord with active regions being emerged omega loops.

Parametric study on kink instabilities of twisted magnetic flux ropes in the solar atmosphere

NASA Astrophysics Data System (ADS)

Mei, Z. X.; Keppens, R.; Roussev, I. I.; Lin, J.

2018-01-01

Aims: Twisted magnetic flux ropes (MFRs) in the solar atmosphere have been researched extensively because of their close connection to many solar eruptive phenomena, such as flares, filaments, and coronal mass ejections (CMEs). In this work, we performed a set of 3D isothermal magnetohydrodynamic (MHD) numerical simulations, which use analytical twisted MFR models and study dynamical processes parametrically inside and around current-carrying twisted loops. We aim to generalize earlier findings by applying finite plasma β conditions. Methods: Inside the MFR, approximate internal equilibrium is obtained by pressure from gas and toroidal magnetic fields to maintain balance with the poloidal magnetic field. We selected parameter values to isolate best either internal or external kink instability before studying complex evolutions with mixed characteristics. We studied kink instabilities and magnetic reconnection in MFRs with low and high twists. Results: The curvature of MFRs is responsible for a tire tube force due to its internal plasma pressure, which tends to expand the MFR. The curvature effect of toroidal field inside the MFR leads to a downward movement toward the photosphere. We obtain an approximate internal equilibrium using the opposing characteristics of these two forces. A typical external kink instability totally dominates the evolution of MFR with infinite twist turns. Because of line-tied conditions and the curvature, the central MFR region loses its external equilibrium and erupts outward. We emphasize the possible role of two different kink instabilities during the MFR evolution: internal and external kink. The external kink is due to the violation of the Kruskal-Shafranov condition, while the internal kink requires a safety factor q = 1 surface inside the MFR. We show that in mixed scenarios, where both instabilities compete, complex evolutions occur owing to reconnections around and within the MFR. The S-shaped structures in current distributions

HF produced ionospheric electron density irregularities diagnosed by UHF radio star scintillations

NASA Technical Reports Server (NTRS)

Frey, A.; Gordon, W. E.

1982-01-01

Three observations of radio star intensity fluctuations at UHF are reported for HF ionospheric modification experiments carried out at the Arecibo Observatory. Two observations at 430 MHz and one at 1400 MHz suggest that the the thin phase screen theory is a good approximation to the observed power spectra. It is noted, however, that the theory has to be extended to include antenna filtering. This type of filtering is important for UHF radio star scintillations since the antenna usually has a narrow beamwidth. HF power densities of less than 37 microwatts/sq m incident on the ionosphere give rise to electron density irregularities larger than 13% of the ambient density (at 260 km) having scale sizes of approximately 510 m perpendicular to the geomagnetic field. The irregularities are found to form within 20-25 s after the HF power is turned on. The drift velocities of the irregularities can be estimated from the observed power spectra.

Hydrogen bonds and twist in cellulose microfibrils.

PubMed

Kannam, Sridhar Kumar; Oehme, Daniel P; Doblin, Monika S; Gidley, Michael J; Bacic, Antony; Downton, Matthew T

2017-11-01

There is increasing experimental and computational evidence that cellulose microfibrils can exist in a stable twisted form. In this study, atomistic molecular dynamics (MD) simulations are performed to investigate the importance of intrachain hydrogen bonds on the twist in cellulose microfibrils. We systematically enforce or block the formation of these intrachain hydrogen bonds by either constraining dihedral angles or manipulating charges. For the majority of simulations a consistent right handed twist is observed. The exceptions are two sets of simulations that block the O2-O6' intrachain hydrogen bond, where no consistent twist is observed in multiple independent simulations suggesting that the O2-O6' hydrogen bond can drive twist. However, in a further simulation where exocyclic group rotation is also blocked, right-handed twist still develops suggesting that intrachain hydrogen bonds are not necessary to drive twist in cellulose microfibrils. Copyright © 2017 Elsevier Ltd. All rights reserved.

View of the MPLM, Destiny and the UHF antenna taken during the second EVA of STS-100

NASA Image and Video Library

2001-04-24

STS100-398-017 (19 April-1 May 2001) --- Backdropped by the Earth with partial cloud cover, the Raffaello Multi-Purpose Logistics Module (MPLM) and the Ultra High Frequency (UHF) antenna are photographed by a crewmember during this STS-100 mission to the International Space Station (ISS). The Raffaello, which was built by the Italian Space Agency (ASI), is the second of three such pressurized modules that will serve as ISS "moving vans", carrying laboratory racks filled with equipment, experiments and supplies to and from the station aboard the space shuttle. The UHF antenna was attached to the station's U.S. Laboratory Destiny by space walking astronauts Chris A. Hadfield and Scott E. Parazynski during the mission's first spacewalk. The antenna, on a 1.2-meter (4-foot) boom, is part of the UHF Communications Subsystem of the station. It will interact with systems already aboard the station, including the Space-to-Space Station Radio transceivers. A second antenna will be delivered on the STS-115/11A next year.

Modeling and control of active twist aircraft

NASA Astrophysics Data System (ADS)

Cramer, Nicholas Bryan

The Wright Brothers marked the beginning of powered flight in 1903 using an active twist mechanism as their means of controlling roll. As time passed due to advances in other technologies that transformed aviation the active twist mechanism was no longer used. With the recent advances in material science and manufacturability, the possibility of the practical use of active twist technologies has emerged. In this dissertation, the advantages and disadvantages of active twist techniques are investigated through the development of an aeroelastic modeling method intended for informing the designs of such technologies and wind tunnel testing to confirm the capabilities of the active twist technologies and validate the model. Control principles for the enabling structural technologies are also proposed while the potential gains of dynamic, active twist are analyzed.

Anderson transition in a multiply-twisted helix.

PubMed

Ugajin, R

2001-06-01

We investigated the Anderson transition in a multiply-twisted helix in which a helical chain of components, i.e., atoms or nanoclusters, is twisted to produce a doubly-twisted helix, which itself can be twisted to produce a triply-twisted helix, and so on, in which there are couplings between adjacent rounds of helices. As the strength of the on-site random potentials increases, an Anderson transition occurs, suggesting that the number of dimensions is 3 for electrons running along the multiply-twisted helix when the couplings between adjacent rounds are strong enough. If the couplings are weakened, the dimensionality becomes less, resulting in localization of electrons. The effect of random connections between adjacent rounds of helices and random magnetic fields that thread the structure is analyzed using the spectral statistics of a quantum particle.

RFID antenna design for circular polarization in UHF band

NASA Astrophysics Data System (ADS)

Shahid, Hamza; Khan, Muhammad Talal Ali; Tayyab, Umais; Irshad, Usama Bin; Alkhazraji, Emad; Javaid, Muhammad Sharjeel

2017-05-01

A miniature half cross dipole antenna for defense and aerospace RFID applications in UHF band is presented. The dipole printed line arms are half crossed shape on top of dielectric substrate backed by reactive impedance surface. The antenna fed by a coaxial cable at the gap separating the dipole arms. Our design is intended to work at 2.42 GHz for RFID readers. The radiation pattern obtained has HPBW of 112, return loss of 22.24 dB and 90 MHz bandwidth.

Teaching Spatial Awareness for Better Twisting Somersaults.

ERIC Educational Resources Information Center

Hennessy, Jeff T.

1985-01-01

The barani (front somersault with one-half twist) and the back somersault with one twist are basic foundation skills necessary for more advanced twisting maneuvers. Descriptions of these movements on a trampoline surface are offered. (DF)

Demonstration Of Ultra HI-FI (UHF) Methods

NASA Technical Reports Server (NTRS)

Dyson, Rodger W.

2004-01-01

Computational aero-acoustics (CAA) requires efficient, high-resolution simulation tools. Most current techniques utilize finite-difference approaches because high order accuracy is considered too difficult or expensive to achieve with finite volume or finite element methods. However, a novel finite volume approach (Ultra HI-FI or UHF) which utilizes Hermite fluxes is presented which can achieve both arbitrary accuracy and fidelity in space and time. The technique can be applied to unstructured grids with some loss of fidelity or with multi-block structured grids for maximum efficiency and resolution. In either paradigm, it is possible to resolve ultra-short waves (less than 2 PPW). This is demonstrated here by solving the 4th CAA workshop Category 1 Problem 1.

Screen printed UHF antennas on flexible substrates

NASA Astrophysics Data System (ADS)

Janeczek, Kamil; Młożniak, Anna; Kozioł, Grażyna; Araźna, Aneta; Jakubowska, Małgorzata; Bajurko, Paweł

2010-09-01

Printed electronics belongs to the most important developing electronics technologies. It provides new possibilities to produce low cost and large area devices. In its range several applications can be distinguished like printed batteries, OLED, biosensors, photovoltaic cells or RFID tags. In the presented investigation, antennas working in UHF frequency range were elaborated. It can be applied in the future for flexible RFID tags. To produce these antennas polymer paste with silver flakes was used. It was deposited on two flexible substrates (foil and photo paper) with screen printing techniques. After printing process surface profile, electrical and microwave parameters of performed antennas were measured using digital multimeter and network analyzer, relatively. Furthermore, a thickness of printed layers was measured.

Spectral determinants for twist field correlators

NASA Astrophysics Data System (ADS)

Belitsky, A. V.

2018-04-01

Twist fields were introduced a few decades ago as a quantum counterpart to classical kink configurations and disorder variables in low dimensional field theories. In recent years they received a new incarnation within the framework of geometric entropy and strong coupling limit of four-dimensional scattering amplitudes. In this paper, we study their two-point correlation functions in a free massless scalar theory, namely, twist-twist and twist-antitwist correlators. In spite of the simplicity of the model in question, the properties of the latter are far from being trivial. The problem is reduced, within the formalism of the path integral, to the study of spectral determinants on surfaces with conical points, which are then computed exactly making use of the zeta function regularization. We also provide an insight into twist correlators for a massive complex scalar by means of the Lifshitz-Krein trace formula.

Genomic pathways modulated by Twist in breast cancer.

PubMed

Vesuna, Farhad; Bergman, Yehudit; Raman, Venu

2017-01-13

The basic helix-loop-helix transcription factor TWIST1 (Twist) is involved in embryonic cell lineage determination and mesodermal differentiation. There is evidence to indicate that Twist expression plays a role in breast tumor formation and metastasis, but the role of Twist in dysregulating pathways that drive the metastatic cascade is unclear. Moreover, many of the genes and pathways dysregulated by Twist in cell lines and mouse models have not been validated against data obtained from larger, independant datasets of breast cancer patients. We over-expressed the human Twist gene in non-metastatic MCF-7 breast cancer cells to generate the estrogen-independent metastatic breast cancer cell line MCF-7/Twist. These cells were inoculated in the mammary fat pad of female severe compromised immunodeficient mice, which subsequently formed xenograft tumors that metastasized to the lungs. Microarray data was collected from both in vitro (MCF-7 and MCF-7/Twist cell lines) and in vivo (primary tumors and lung metastases) models of Twist expression. Our data was compared to several gene datasets of various subtypes, classes, and grades of human breast cancers. Our data establishes a Twist over-expressing mouse model of breast cancer, which metastasizes to the lung and replicates some of the ontogeny of human breast cancer progression. Gene profiling data, following Twist expression, exhibited novel metastasis driver genes as well as cellular maintenance genes that were synonymous with the metastatic process. We demonstrated that the genes and pathways altered in the transgenic cell line and metastatic animal models parallel many of the dysregulated gene pathways observed in human breast cancers. Analogous gene expression patterns were observed in both in vitro and in vivo Twist preclinical models of breast cancer metastasis and breast cancer patient datasets supporting the functional role of Twist in promoting breast cancer metastasis. The data suggests that genetic

Plasma q -plate for generation and manipulation of intense optical vortices

NASA Astrophysics Data System (ADS)

Qu, Kenan; Jia, Qing; Fisch, Nathaniel J.

2017-11-01

An optical vortex is a light wave with a twisting wavefront around its propagation axis and null intensity in the beam center. Its unique spatial structure of field lends itself to a broad range of applications, including optical communication, quantum information, superresolution microscopy, and multidimensional manipulation of particles. However, accessible intensity of optical vortices have been limited to material ionization threshold. This limitation might be removed by using the plasma medium. Here we propose the design of suitably magnetized plasmas which, functioning as a q -plate, leads to a direct conversion from a high-intensity Gaussian beam into a twisted beam. A circularly polarized laser beam in the plasma accumulates an azimuthal-angle-dependent phase shift and hence forms a twisting wavefront. Our three-dimensional particle-in-cell simulations demonstrate extremely high-power conversion efficiency. The plasma q -plate can work in a large range of frequencies spanning from terahertz to the optical domain.

Plasma q -plate for generation and manipulation of intense optical vortices

DOE PAGES

Qu, Kenan; Jia, Qing; Fisch, Nathaniel J.

2017-11-28

An optical vortex is a light wave with a twisting wavefront around its propagation axis and null intensity in the beam center. Its unique spatial structure of field lends itself to a broad range of applications, including optical communication, quantum information, superresolution microscopy, and multidimensional manipulation of particles. However, accessible intensity of optical vortices have been limited to material ionization threshold. This limitation might be removed by using the plasma medium. Here in this paper, we propose the design of suitably magnetized plasmas which, functioning as a q-plate, leads to a direct conversion from a high-intensity Gaussian beam into amore » twisted beam. A circularly polarized laser beam in the plasma accumulates an azimuthal-angle-dependent phase shift and hence forms a twisting wavefront. Our three-dimensional particle-in-cell simulations demonstrate extremely high-power conversion efficiency. The plasma q-plate can work in a large range of frequencies spanning from terahertz to the optical domain.« less

Plasma q -plate for generation and manipulation of intense optical vortices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qu, Kenan; Jia, Qing; Fisch, Nathaniel J.

An optical vortex is a light wave with a twisting wavefront around its propagation axis and null intensity in the beam center. Its unique spatial structure of field lends itself to a broad range of applications, including optical communication, quantum information, superresolution microscopy, and multidimensional manipulation of particles. However, accessible intensity of optical vortices have been limited to material ionization threshold. This limitation might be removed by using the plasma medium. Here in this paper, we propose the design of suitably magnetized plasmas which, functioning as a q-plate, leads to a direct conversion from a high-intensity Gaussian beam into amore » twisted beam. A circularly polarized laser beam in the plasma accumulates an azimuthal-angle-dependent phase shift and hence forms a twisting wavefront. Our three-dimensional particle-in-cell simulations demonstrate extremely high-power conversion efficiency. The plasma q-plate can work in a large range of frequencies spanning from terahertz to the optical domain.« less

Witnessing magnetic twist with high-resolution observation from the 1.6-m New Solar Telescope

PubMed Central

Wang, Haimin; Cao, Wenda; Liu, Chang; Xu, Yan; Liu, Rui; Zeng, Zhicheng; Chae, Jongchul; Ji, Haisheng

2015-01-01

Magnetic flux ropes are highly twisted, current-carrying magnetic fields. They are crucial for the instability of plasma involved in solar eruptions, which may lead to adverse space weather effects. Here we present observations of a flaring using the highest resolution chromospheric images from the 1.6-m New Solar Telescope at Big Bear Solar Observatory, supplemented by a magnetic field extrapolation model. A set of loops initially appear to peel off from an overall inverse S-shaped flux bundle, and then develop into a multi-stranded twisted flux rope, producing a two-ribbon flare. We show evidence that the flux rope is embedded in sheared arcades and becomes unstable following the enhancement of its twists. The subsequent motion of the flux rope is confined due to the strong strapping effect of the overlying field. These results provide a first opportunity to witness the detailed structure and evolution of flux ropes in the low solar atmosphere. PMID:25919706

Electronic and Optical Properties of Twisted Bilayer Graphene

NASA Astrophysics Data System (ADS)

Huang, Shengqiang

The ability to isolate single atomic layers of van der Waals materials has led to renewed interest in the electronic and optical properties of these materials as they can be fundamentally different at the monolayer limit. Moreover, these 2D crystals can be assembled together layer by layer, with controllable sequence and orientation, to form artificial materials that exhibit new features that are not found in monolayers nor bulk. Twisted bilayer graphene is one such prototype system formed by two monolayer graphene layers placed on top of each other with a twist angle between their lattices, whose electronic band structure depends on the twist angle. This thesis presents the efforts to explore the electronic and optical properties of twisted bilayer graphene by Raman spectroscopy and scanning tunneling microscopy measurements. We first synthesize twisted bilayer graphene with various twist angles via chemical vapor deposition. Using a combination of scanning tunneling microscopy and Raman spectroscopy, the twist angles are determined. The strength of the Raman G peak is sensitive to the electronic band structure of twisted bilayer graphene and therefore we use this peak to monitor changes upon doping. Our results demonstrate the ability to modify the electronic and optical properties of twisted bilayer graphene with doping. We also fabricate twisted bilayer graphene by controllable stacking of two graphene monolayers with a dry transfer technique. For twist angles smaller than one degree, many body interactions play an important role. It requires eight electrons per moire unit cell to fill up each band instead of four electrons in the case of a larger twist angle. For twist angles smaller than 0.4 degree, a network of domain walls separating AB and BA stacking regions forms, which are predicted to host topologically protected helical states. Using scanning tunneling microscopy and spectroscopy, these states are confirmed to appear on the domain walls when inversion

Morphing wing structure with controllable twist based on adaptive bending-twist coupling

NASA Astrophysics Data System (ADS)

Raither, Wolfram; Heymanns, Matthias; Bergamini, Andrea; Ermanni, Paolo

2013-06-01

A novel semi-passive morphing airfoil concept based on variable bending-twist coupling induced by adaptive shear center location and torsional stiffness is presented. Numerical parametric studies and upscaling show that the concept relying on smart materials permits effective twist control while offering the potential of being lightweight and energy efficient. By means of an experimental characterization of an adaptive beam and a scaled adaptive wing structure, effectiveness and producibility of the structural concept are demonstrated.

Conical twist fields and null polygonal Wilson loops

NASA Astrophysics Data System (ADS)

Castro-Alvaredo, Olalla A.; Doyon, Benjamin; Fioravanti, Davide

2018-06-01

Using an extension of the concept of twist field in QFT to space-time (external) symmetries, we study conical twist fields in two-dimensional integrable QFT. These create conical singularities of arbitrary excess angle. We show that, upon appropriate identification between the excess angle and the number of sheets, they have the same conformal dimension as branch-point twist fields commonly used to represent partition functions on Riemann surfaces, and that both fields have closely related form factors. However, we show that conical twist fields are truly different from branch-point twist fields. They generate different operator product expansions (short distance expansions) and form factor expansions (large distance expansions). In fact, we verify in free field theories, by re-summing form factors, that the conical twist fields operator product expansions are correctly reproduced. We propose that conical twist fields are the correct fields in order to understand null polygonal Wilson loops/gluon scattering amplitudes of planar maximally supersymmetric Yang-Mills theory.

Twist planet drive

NASA Technical Reports Server (NTRS)

Vranish, John M. (Inventor)

1996-01-01

A planetary gear system includes a sun gear coupled to an annular ring gear through a plurality of twist-planet gears, a speeder gear, and a ground structure having an internal ring gear. Each planet gear includes a solid gear having a first half portion in the form of a spur gear which includes vertical gear teeth and a second half portion in the form of a spur gear which includes helical gear teeth that are offset from the vertical gear teeth and which contact helical gear teeth on the speeder gear and helical gear teeth on the outer ring gear. One half of the twist planet gears are preloaded downward, while the other half are preloaded upwards, each one alternating with the other so that each one twists in a motion opposite to its neighbor when rotated until each planet gear seats against the sun gear, the outer ring gear, the speeder gear, and the inner ring gear. The resulting configuration is an improved stiff anti-backlash gear system.

Aeromechanical Evaluation of Smart-Twisting Active Rotor

NASA Technical Reports Server (NTRS)

Lim, Joon W.; Boyd, D. Douglas, Jr.; Hoffman, Frauke; van der Wall, Berend G.; Kim, Do-Hyung; Jung, Sung N.; You, Young H.; Tanabe, Yasutada; Bailly, Joelle; Lienard, Caroline;

Renormalization constants for 2-twist operators in twisted mass QCD

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexandrou, C.; Computation-based Science and Technology Research Center, The Cyprus Institute, 15 Kypranoros Str., 1645 Nicosia; Constantinou, M.

2011-01-01

Perturbative and nonperturbative results on the renormalization constants of the fermion field and the twist-2 fermion bilinears are presented with emphasis on the nonperturbative evaluation of the one-derivative twist-2 vector and axial-vector operators. Nonperturbative results are obtained using the twisted mass Wilson fermion formulation employing two degenerate dynamical quarks and the tree-level Symanzik improved gluon action. The simulations have been performed for pion masses in the range of about 450-260 MeV and at three values of the lattice spacing a corresponding to {beta}=3.9, 4.05, 4.20. Subtraction of O(a{sup 2}) terms is carried out by performing the perturbative evaluation of thesemore » operators at 1-loop and up to O(a{sup 2}). The renormalization conditions are defined in the RI{sup '}-MOM scheme, for both perturbative and nonperturbative results. The renormalization factors, obtained for different values of the renormalization scale, are evolved perturbatively to a reference scale set by the inverse of the lattice spacing. In addition, they are translated to MS at 2 GeV using 3-loop perturbative results for the conversion factors.« less

Transverse kink oscillations in the presence of twist

NASA Astrophysics Data System (ADS)

Terradas, J.; Goossens, M.

2012-12-01

Context. Magnetic twist is thought to play an important role in coronal loops. The effects of magnetic twist on stable magnetohydrodynamic (MHD) waves is poorly understood because they are seldom studied for relevant cases. Aims: The goal of this work is to study the fingerprints of magnetic twist on stable transverse kink oscillations. Methods: We numerically calculated the eigenmodes of propagating and standing MHD waves for a model of a loop with magnetic twist. The azimuthal component of the magnetic field was assumed to be small in comparison to the longitudinal component. We did not consider resonantly damped modes or kink instabilities in our analysis. Results: For a nonconstant twist the frequencies of the MHD wave modes are split, which has important consequences for standing waves. This is different from the degenerated situation for equilibrium models with constant twist, which are characterised by an azimuthal component of the magnetic field that linearly increases with the radial coordinate. Conclusions: In the presence of twist standing kink solutions are characterised by a change in polarisation of the transverse displacement along the tube. For weak twist, and in the thin tube approximation, the frequency of standing modes is unaltered and the tube oscillates at the kink speed of the corresponding straight tube. The change in polarisation is linearly proportional to the degree of twist. This has implications with regard to observations of kink modes, since the detection of this variation in polarisation can be used as an indirect method to estimate the twist in oscillating loops.

Explicit formulae for Chern-Simons invariants of the twist-knot orbifolds and edge polynomials of twist knots

NASA Astrophysics Data System (ADS)

Ham, J.-Y.; Lee, J.

2016-09-01

We calculate the Chern-Simons invariants of twist-knot orbifolds using the Schläfli formula for the generalized Chern-Simons function on the family of twist knot cone-manifold structures. Following the general instruction of Hilden, Lozano, and Montesinos-Amilibia, we here present concrete formulae and calculations. We use the Pythagorean Theorem, which was used by Ham, Mednykh and Petrov, to relate the complex length of the longitude and the complex distance between the two axes fixed by two generators. As an application, we calculate the Chern-Simons invariants of cyclic coverings of the hyperbolic twist-knot orbifolds. We also derive some interesting results. The explicit formulae of the A-polynomials of twist knots are obtained from the complex distance polynomials. Hence the edge polynomials corresponding to the edges of the Newton polygons of the A-polynomials of twist knots can be obtained. In particular, the number of boundary components of every incompressible surface corresponding to slope -4n+2 turns out to be 2. Bibliography: 39 titles.

Twist-induced tuning in tapered fiber couplers.

PubMed

Birks, T A

1989-10-01

The power-splitting ratio of fused tapered single-mode fiber couplers can be reversibly tuned by axial twisting without affecting loss. The twist-tuning behavior of a range of different tapered couplers is described. A simple expression for twist-tuning can be derived by representing the effects of twist by a change in the refractive index profile. Good agreement between this expression and experimental results is demonstrated. Repeated tuning over tens of thousands of cycles is found not to degrade coupler performance, and a number of practical applications, including a freely tunable tapered coupler, are described.

Electrostatic contribution to twist rigidity of DNA.

PubMed

Mohammad-Rafiee, Farshid; Golestanian, Ramin

2004-06-01

The electrostatic contribution to the twist rigidity of DNA is studied, and it is shown that the Coulomb self-energy of the double-helical sugar-phosphate backbone makes a considerable contribution-the electrostatic twist rigidity of DNA is found to be C(elec) approximately 5 nm, which makes up about 7% of its total twist rigidity ( C(DNA) approximately 75 nm). The electrostatic twist rigidity is found, however, to depend only weakly on the salt concentration, because of a competition between two different screening mechanisms: (1) Debye screening by the salt ions in the bulk, and (2) structural screening by the periodic charge distribution along the backbone of the helical polyelectrolyte. It is found that, depending on the parameters, the electrostatic contribution to the twist rigidity could stabilize or destabilize the structure of a helical polyelectrolyte.

Twist number and order properties of periodic orbits

NASA Astrophysics Data System (ADS)

Petrisor, Emilia

2013-11-01

A less studied numerical characteristic of periodic orbits of area preserving twist maps of the annulus is the twist or torsion number, called initially the amount of rotation Mather (1984) [2]. It measures the average rotation of tangent vectors under the action of the derivative of the map along that orbit, and characterizes the degree of complexity of the dynamics. The aim of this paper is to give new insights into the definition and properties of the twist number and to relate its range to the order properties of periodic orbits. We derive an algorithm to deduce the exact value or a demi-unit interval containing the exact value of the twist number. We prove that at a period-doubling bifurcation threshold of a mini-maximizing periodic orbit, the new born doubly periodic orbit has the absolute twist number larger than the absolute twist of the original orbit after bifurcation. We give examples of periodic orbits having large absolute twist number, that are badly ordered, and illustrate how characterization of these orbits only by their residue can lead to incorrect results. In connection to the study of the twist number of periodic orbits of standard-like maps we introduce a new tool, called 1-cone function. We prove that the location of minima of this function with respect to the vertical symmetry lines of a standard-like map encodes a valuable information on the symmetric periodic orbits and their twist number.

Processing mechanics of alternate twist ply (ATP) yarn technology

NASA Astrophysics Data System (ADS)

Elkhamy, Donia Said

Ply yarns are important in many textile manufacturing processes and various applications. The primary process used for producing ply yarns is cabling. The speed of cabling is limited to about 35m/min. With the world's increasing demands of ply yarn supply, cabling is incompatible with today's demand activated manufacturing strategies. The Alternate Twist Ply (ATP) yarn technology is a relatively new process for producing ply yarns with improved productivity and flexibility. This technology involves self plying of twisted singles yarn to produce ply yarn. The ATP process can run more than ten times faster than cabling. To implement the ATP process to produce ply yarns there are major quality issues; uniform Twist Profile and yarn Twist Efficiency. The goal of this thesis is to improve these issues through process modeling based on understanding the physics and processing mechanics of the ATP yarn system. In our study we determine the main parameters that control the yarn twist profile. Process modeling of the yarn twist across different process zones was done. A computational model was designed to predict the process parameters required to achieve a square wave twist profile. Twist efficiency, a measure of yarn torsional stability and bulk, is determined by the ratio of ply yarn twist to singles yarn twist. Response Surface Methodology was used to develop the processing window that can reproduce ATP yarns with high twist efficiency. Equilibrium conditions of tensions and torques acting on the yarns at the self ply point were analyzed and determined the pathway for achieving higher twist efficiency. Mechanistic modeling relating equilibrium conditions to the twist efficiency was developed. A static tester was designed to zoom into the self ply zone of the ATP yarn. A computer controlled, prototypic ATP machine was constructed and confirmed the mechanistic model results. Optimum parameters achieving maximum twist efficiency were determined in this study. The

Theory of twisted trunks

NASA Astrophysics Data System (ADS)

Carlqvist, P.; Gahm, G. F.; Kristen, H.

2003-05-01

Using the 2.6 m Nordic Optical Telescope we have observed a large number of elephant trunks in several H II regions. Here, we present a small selection of this material consisting of a few large, well-developed trunks, and some smaller ones. We find that: (i) the well-developed trunks are made up of dark filaments and knots which show evidence of twisted structures, (ii) the trunks are connected with essentially two filamentary legs running in V-shape, and (iii) all trunks have the maximum extinction in their heads. We advance a theory of twisted elephant trunks which is based on the presence of magnetic flux ropes in molecular clouds where hot OB stars are formed. If the rope contains a local condensation it may adopt a V-shape as the H II region around the hot stars expands. If, in addition, the magnetic field in the rope is sufficiently twisted, the rope may form a double helix at the apex of the V. The double helix is identified with the twisted elephant trunks. In order to illustrate the mechanisms behind the double helix we have constructed a mechanical analogy model of the magnetic flux rope in which the rope has been replaced by a bundle of elastic strings loaded by a weight. Experiments with the model clearly show that part of the bundle will transform into a double helix when the twist of the bundle is sufficiently large. We have also worked out a simple theoretical model of a mass-loaded magnetic flux rope. Numerical calculations show that a double helix will indeed form when the twist of the rope exceeds a certain critical limit. Numerical model calculations are applied to both the analogy model experiments and one of the well-developed elephant trunks. On the basis of our model we also suggest a new interpretation of the so called EGGs. The double helix mechanism is quite general, and should be active also in other suitable environments. One such environment may be the shell of supernova remnants. Another example is the expanding bubble outlined by the

VHF/UHF imagery and RCS measurements of ground targets in forested terrain

NASA Astrophysics Data System (ADS)

Gatesman, Andrew J.; Beaudoin, Christopher J.; Giles, Robert H.; Waldman, Jerry; Nixon, William E.

2002-08-01

The monostatic VV and HH-polarized radar signatures of several targets and trees have been measured at foliage penetration frequencies (VHF/UHF) by using 1/35th scale models and an indoor radar range operating at X-band. An array of high-fidelity scale model ground vehicles and test objects as well as scaled ground terrain and trees have been fabricated for the study. Radar measurement accuracy has been confirmed by comparing the signature of a test object with a method of moments radar cross section prediction code. In addition to acquiring signatures of targets located on a smooth, dielectric ground plane, data have also been acquired with targets located in simulated wooded terrain that included scaled tree trunks and tree branches. In order to assure the correct backscattering behavior, all dielectric properties of live tree wood and moist soil were scaled properly to match the complex dielectric constant of the full-scale materials. The impact of the surrounding tree clutter on the VHF/UHF radar signatures of ground vehicles was accessed. Data were processed into high-resolution, polar-formatted ISAR imagery and signature comparisons are made between targets in open-field and forested scenarios.

UHF front-end feeding RFID-based body sensor networks by exploiting the reader signal

NASA Astrophysics Data System (ADS)

Pasca, M.; Colella, R.; Catarinucci, L.; Tarricone, L.; D'Amico, S.; Baschirotto, A.

2016-05-01

This paper presents an integrated, high-sensitivity UHF radio frequency identification (RFID) power management circuit for body sensor network applications. The circuit consists of a two-stage RF-DC Dickson's rectifier followed by an integrated five-stage DC-DC Pelliconi's charge pump driven by an ultralow start-up voltage LC oscillator. The DC-DC charge pump interposed between the RF-DC rectifier and the output load provides the RF to load isolation avoiding losses due to the diodes reverse saturation current. The RF-DC rectifier has been realized on FR4 substrate, while the charge pump and the oscillator have been realized in 180 nm complementary metal oxide semiconductor (CMOS) technology. Outdoor measurements demonstrate the ability of the power management circuit to provide 400 mV output voltage at 14 m distance from the UHF reader, in correspondence of -25 dBm input signal power. As demonstrated in the literature, such output voltage level is suitable to supply body sensor network nodes.

Acoustic Aspects of Active-Twist Rotor Control

NASA Technical Reports Server (NTRS)

Booth, Earl R., Jr.; Wilbur, Matthew L.

2002-01-01

The use of an Active Twist Rotor system to provide both vibration reduction and performance enhancement has been explored in recent analytical and experimental studies. Effects of active-twist control on rotor noise, however, had not been determined. During a recent wind tunnel test of an active-twist rotor system, a set of acoustic measurements were obtained to assess the effects of active-twist control on noise produced by the rotor, especially blade-vortex interaction (BVI) noise. It was found that for rotor operating conditions where BVI noise is dominant, active-twist control provided a reduction in BVI noise level. This BVI noise reduction was almost, but not quite, as large as that obtained in a similar test using HHC. However, vibration levels were usually adversely affected at operating conditions favoring minimum BVI noise. Conversely, operating conditions favoring minimum vibration levels affected BVI noise levels, but not always adversely.

Improved Absolute Radiometric Calibration of a UHF Airborne Radar

NASA Technical Reports Server (NTRS)

Chapin, Elaine; Hawkins, Brian P.; Harcke, Leif; Hensley, Scott; Lou, Yunling; Michel, Thierry R.; Moreira, Laila; Muellerschoen, Ronald J.; Shimada, Joanne G.; Tham, Kean W.;

A Magnetic Reconnection Event in the Solar Atmosphere Driven by Relaxation of a Twisted Arch Filament System

NASA Astrophysics Data System (ADS)

Huang, Zhenghua; Mou, Chaozhou; Fu, Hui; Deng, Linhua; Li, Bo; Xia, Lidong

2018-02-01

We present high-resolution observations of a magnetic reconnection event in the solar atmosphere taken with the New Vacuum Solar Telescope, Atmospheric Imaging Assembly (AIA), and Helioseismic and Magnetic Imager (HMI). The reconnection event occurred between the threads of a twisted arch filament system (AFS) and coronal loops. Our observations reveal that the relaxation of the twisted AFS drives some of its threads to encounter the coronal loops, providing inflows of the reconnection. The reconnection is evidenced by flared X-shape features in the AIA images, a current-sheet-like feature apparently connecting post-reconnection loops in the Hα + 1 Å images, small-scale magnetic cancelation in the HMI magnetograms and flows with speeds of 40–80 km s‑1 along the coronal loops. The post-reconnection coronal loops seen in the AIA 94 Å passband appear to remain bright for a relatively long time, suggesting that they have been heated and/or filled up by dense plasmas previously stored in the AFS threads. Our observations suggest that the twisted magnetic system could release its free magnetic energy into the upper solar atmosphere through reconnection processes. While the plasma pressure in the reconnecting flux tubes are significantly different, the reconfiguration of field lines could result in transferring of mass among them and induce heating therein.

Enhanced intersystem crossing in core-twisted aromatics.

PubMed

Nagarajan, Kalaivanan; Mallia, Ajith R; Muraleedharan, Keerthi; Hariharan, Mahesh

2017-03-01

We describe the design, bottom-up synthesis and X-ray single crystal structure of systematically twisted aromatics 1c and 2d for efficient intersystem crossing. Steric congestion at the cove region creates a nonplanar geometry that induces a significant yield of triplet excited states in the electron-poor core-twisted aromatics 1c and 2d . A systematic increase in the number of twisted regions in 1c and 2d results in a concomitant enhancement in the rate and yield of intersystem crossing, monitored using femtosecond and nanosecond transient absorption spectroscopy. Time-resolved absorption spectroscopic measurements display enhanced triplet quantum yields ( Φ T = 10 ± 1% for 1c and Φ T = 30 ± 2% for 2d ) in the twisted aromatics when compared to a negligible Φ T (<1%) in the planar analog 3c . Twist-induced spin-orbit coupling via activated out-of-plane C-H/C 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000

Twist functions in vertebral column formation in medaka, Oryzias latipes.

PubMed

Yasutake, Junichi; Inohaya, Keiji; Kudo, Akira

2004-07-01

Medaka twist, a basic helix-loop-helix (bHLH) transcription factor, is expressed in the sclerotome during embryogenesis. We previously established a line of twist-EGFP transgenic medaka, whose EGFP expression is regulated by the twist promoter; therefore, we could observe the behavior of sclerotomal cells in vivo. In the transgenic medaka embryos, EGFP-positive sclerotomal cells migrated dorsally around the notochord and the neural tube, where at a later stage the vertebral column would be formed. This finding strongly suggests that twist-expressing sclerotomal cells participate in vertebral column formation in medaka. To clarify the function of twist gene in the sclerotome, we performed knockdown analysis of twist by using two kinds of morpholino antisense oligonucleotides targeted against twist (MO1 and MO2). Both the MO1 and MO2 morphants exhibited absence of neural arches, which are bilaterally paired, dorsomedially oriented bones on the dorsal aspect of the centrum. In addition, MO2, which blocks translation of only endogenous twist mRNA in the twist-EGFP transgenic medaka, did not affect the migration pattern of EGFP-positive cells, revealing that the migration of sclerotome-derived cells were normal in the absence of twist gene function. These results demonstrate that medaka twist functions in vertebral column formation by regulating the sclerotomal cell differentiation.

Twisted Radio Waves and Twisted Thermodynamics

PubMed Central

Kish, Laszlo B.; Nevels, Robert D.

2013-01-01

We present and analyze a gedanken experiment and show that the assumption that an antenna operating at a single frequency can transmit more than two independent information channels to the far field violates the Second Law of Thermodynamics. Transmission of a large number of channels, each associated with an angular momenta ‘twisted wave’ mode, to the far field in free space is therefore not possible. PMID:23424647

Disordered redox metabolism of brain cells in rats exposed to low doses of ionizing radiation or UHF electromagnetic radiation.

PubMed

Burlaka, A P; Druzhyna, M O; Vovk, A V; Lukin, S М

2016-12-01

To investigate the changes of redox-state of mammalian brain cells as the critical factor of initiation and formation of radiation damage of biological structures in setting of continuous exposure to low doses of ionizing radiation or fractionated ultra high frequency electromagnetic radiation (UHF EMR) at non-thermal levels. The influence of low-intensity ionizing radiation was studied on outbred female rats kept for 1.5 years in the Chernobyl accident zone. The effects of total EMR in the UHF band of non-thermal spectrum were investigated on Wistar rats. The rate of formation of superoxide radicals and the rate of NO synthesis in mitochondria were determined by the EPR. After exposure to ionizing or UHF radiation, the levels of ubisemiquinone in brain tissue of rats decreased by 3 and 1.8 times, respectively. The content of NO-FeS-protein complexes in both groups increased significantly (р < 0.05). In the conditions of ionizing or EMR the rates of superoxide radical generation in electron-transport chain of brain cell mitochondria increased by 1.5- and 2-fold, respectively (р < 0.05). In brain tissue of rats kept in the Chernobyl zone, significant increase of NO content was registered; similar effect was observed in rats treated with UHFR (р < 0.05). The detected changes in the electron transport chain of mitochondria of brain cells upon low-intensity irradiation or UHF EMR cause the metabolic reprogramming of cell mitochondria that increases the rate of superoxide radical generation and nitric oxide, which may initiate the development of neurodegenerative diseases and cancer. This article is part of a Special Issue entitled "The Chornobyl Nuclear Accident: Thirty Years After".

Buildup of a highly twisted magnetic flux rope during a solar eruption.

PubMed

Wang, Wensi; Liu, Rui; Wang, Yuming; Hu, Qiang; Shen, Chenglong; Jiang, Chaowei; Zhu, Chunming

2017-11-06

The magnetic flux rope is among the most fundamental magnetic configurations in plasma. Although its presence after solar eruptions has been verified by spacecraft measurements near Earth, its formation on the Sun remains elusive, yet is critical to understanding a broad spectrum of phenomena. Here we study the dynamic formation of a magnetic flux rope during a classic two-ribbon flare. Its feet are identified unambiguously with conjugate coronal dimmings completely enclosed by irregular bright rings, which originate and expand outward from the far ends of flare ribbons. The expansion is associated with the rapid ribbon separation during the flare main phase. Counting magnetic flux through the feet and the ribbon-swept area reveals that the rope's core is more twisted than its average of four turns. It propagates to the Earth as a typical magnetic cloud possessing a similar twist profile obtained by the Grad-Shafranov reconstruction of its three dimensional structure.

Buildup of a highly twisted magnetic flux rope during a solar eruption

NASA Astrophysics Data System (ADS)

Wang, Wensi; Liu, Rui; Wang, Yuming; Hu, Qiang; Shen, Chenglong; Jiang, Chaowei; Zhu, Chunming

2017-11-01

The magnetic flux rope is among the most fundamental magnetic configurations in plasma. Although its presence after solar eruptions has been verified by spacecraft measurements near Earth, its formation on the Sun remains elusive, yet is critical to understanding a broad spectrum of phenomena. Here we study the dynamic formation of a magnetic flux rope during a classic two-ribbon flare. Its feet are identified unambiguously with conjugate coronal dimmings completely enclosed by irregular bright rings, which originate and expand outward from the far ends of flare ribbons. The expansion is associated with the rapid ribbon separation during the flare main phase. Counting magnetic flux through the feet and the ribbon-swept area reveals that the rope's core is more twisted than its average of four turns. It propagates to the Earth as a typical magnetic cloud possessing a similar twist profile obtained by the Grad-Shafranov reconstruction of its three dimensional structure.

Lifshits Tails for Randomly Twisted Quantum Waveguides

NASA Astrophysics Data System (ADS)

Kirsch, Werner; Krejčiřík, David; Raikov, Georgi

2018-03-01

We consider the Dirichlet Laplacian H_γ on a 3D twisted waveguide with random Anderson-type twisting γ . We introduce the integrated density of states N_γ for the operator H_γ , and investigate the Lifshits tails of N_γ , i.e. the asymptotic behavior of N_γ (E) as E \\downarrow \\inf supp dN_γ . In particular, we study the dependence of the Lifshits exponent on the decay rate of the single-site twisting at infinity.

Characterization of sequences in human TWIST required for nuclear localization

PubMed Central

Singh, Shalini; Gramolini, Anthony O

2009-01-01

Background Twist is a transcription factor that plays an important role in proliferation and tumorigenesis. Twist is a nuclear protein that regulates a variety of cellular functions controlled by protein-protein interactions and gene transcription events. The focus of this study was to characterize putative nuclear localization signals (NLSs) 37RKRR40 and 73KRGKK77 in the human TWIST (H-TWIST) protein. Results Using site-specific mutagenesis and immunofluorescences, we observed that altered TWISTNLS1 K38R, TWISTNLS2 K73R and K77R constructs inhibit nuclear accumulation of H-TWIST in mammalian cells, while TWISTNLS2 K76R expression was un-affected and retained to the nucleus. Subsequently, co-transfection of TWIST mutants K38R, K73R and K77R with E12 formed heterodimers and restored nuclear localization despite the NLSs mutations. Using a yeast-two-hybrid assay, we identified a novel TWIST-interacting candidate TCF-4, a basic helix-loop-helix transcription factor. The interaction of TWIST with TCF-4 confirmed using NLS rescue assays, where nuclear expression of mutant TWISTNLS1 with co-transfixed TCF-4 was observed. The interaction of TWIST with TCF-4 was also seen using standard immunoprecipitation assays. Conclusion Our study demonstrates the presence of two putative NLS motifs in H-TWIST and suggests that these NLS sequences are functional. Furthermore, we identified and confirmed the interaction of TWIST with a novel protein candidate TCF-4. PMID:19534813

Twisting short dsDNA with applied tension

NASA Astrophysics Data System (ADS)

Zoli, Marco

2018-02-01

The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.

An uncertainty budget for VHF and UHF reflectometers

NASA Astrophysics Data System (ADS)

Ridler, N. M.; Medley, C. J.

1992-05-01

Details of the derivation of an uncertainty budget for one port immittance or complex voltage reflection coefficient measuring instruments, operating at VHF and UHF in the 14 mm 50 ohm coaxial line size, are reported. The principles of the uncertainty budget are given along with experimental results obtained using six ports and a network analyzer as the measuring instruments. Details of the types of calibration for which the uncertainty budget is suitable are reported. Various aspects of the uncertainty budget are considered and general principles and treatment of the type A and type B contributions are discussed. Experimental results obtained using the uncertainty budget are given. A summary of uncertainties for the six ports and HP8753B automatic network analyzer are also given.

Partial Discharge Spectral Characterization in HF, VHF and UHF Bands Using Particle Swarm Optimization.

PubMed

Robles, Guillermo; Fresno, José Manuel; Martínez-Tarifa, Juan Manuel; Ardila-Rey, Jorge Alfredo; Parrado-Hernández, Emilio

2018-03-01

The measurement of partial discharge (PD) signals in the radio frequency (RF) range has gained popularity among utilities and specialized monitoring companies in recent years. Unfortunately, in most of the occasions the data are hidden by noise and coupled interferences that hinder their interpretation and renders them useless especially in acquisition systems in the ultra high frequency (UHF) band where the signals of interest are weak. This paper is focused on a method that uses a selective spectral signal characterization to feature each signal, type of partial discharge or interferences/noise, with the power contained in the most representative frequency bands. The technique can be considered as a dimensionality reduction problem where all the energy information contained in the frequency components is condensed in a reduced number of UHF or high frequency (HF) and very high frequency (VHF) bands. In general, dimensionality reduction methods make the interpretation of results a difficult task because the inherent physical nature of the signal is lost in the process. The proposed selective spectral characterization is a preprocessing tool that facilitates further main processing. The starting point is a clustering of signals that could form the core of a PD monitoring system. Therefore, the dimensionality reduction technique should discover the best frequency bands to enhance the affinity between signals in the same cluster and the differences between signals in different clusters. This is done maximizing the minimum Mahalanobis distance between clusters using particle swarm optimization (PSO). The tool is tested with three sets of experimental signals to demonstrate its capabilities in separating noise and PDs with low signal-to-noise ratio and separating different types of partial discharges measured in the UHF and HF/VHF bands.

Helically twisted photonic crystal fibres

NASA Astrophysics Data System (ADS)

Russell, P. St. J.; Beravat, R.; Wong, G. K. L.

2017-02-01

Recent theoretical and experimental work on helically twisted photonic crystal fibres (PCFs) is reviewed. Helical Bloch theory is introduced, including a new formalism based on the tight-binding approximation. It is used to explore and explain a variety of unusual effects that appear in a range of different twisted PCFs, including fibres with a single core and fibres with N cores arranged in a ring around the fibre axis. We discuss a new kind of birefringence that causes the propagation constants of left- and right-spinning optical vortices to be non-degenerate for the same order of orbital angular momentum (OAM). Topological effects, arising from the twisted periodic `space', cause light to spiral around the fibre axis, with fascinating consequences, including the appearance of dips in the transmission spectrum and low loss guidance in coreless PCF. Discussing twisted fibres with a single off-axis core, we report that optical activity in a PCF is opposite in sign to that seen in a step-index fibre. Fabrication techniques are briefly described and emerging applications reviewed. The analytical results of helical Bloch theory are verified by an extensive series of `numerical experiments' based on finite-element solutions of Maxwell's equations in a helicoidal frame. This article is part of the themed issue 'Optical orbital angular momentum'.

Twisted gravitational waves

NASA Astrophysics Data System (ADS)

Bini, Donato; Chicone, Carmen; Mashhoon, Bahram

2018-03-01

In general relativity (GR), linearized gravitational waves propagating in empty Minkowski spacetime along a fixed spatial direction have the property that the wave front is the Euclidean plane. Beyond the linear regime, exact plane waves in GR have been studied theoretically for a long time and many exact vacuum solutions of the gravitational field equations are known that represent plane gravitational waves. These have parallel rays and uniform wave fronts. It turns out, however, that GR also admits exact solutions representing gravitational waves propagating along a fixed direction that are nonplanar. The wave front is then nonuniform and the bundle of rays is twisted. We find a class of solutions representing nonplanar unidirectional gravitational waves and study some of the properties of these twisted waves.

TWIST User Presentation

EPA Pesticide Factsheets

The Wastewater Information System Tool (TWIST) is downloadable, user-friendly management tool that will allow state and local health departments to effectively inventory and manage small wastewater treatment systems in their jurisdictions.

Twist-induced Magnetosphere Reconfiguration for Intermittent Pulsars

NASA Astrophysics Data System (ADS)

Huang, Lei; Yu, Cong; Tong, Hao

2016-08-01

We propose that the magnetosphere reconfiguration induced by magnetic twists in the closed field line region can account for the mode switching of intermittent pulsars. We carefully investigate the properties of axisymmetric force-free pulsar magnetospheres with magnetic twists in closed field line regions around the polar caps. The magnetosphere with twisted closed lines leads to enhanced spin-down rates. The enhancement in spin-down rate depends on the size of the region with twisted closed lines. Typically, it is increased by a factor of ˜2, which is consistent with the intermittent pulsars’ spin-down behavior during the “off” and “on” states. We find that there is a threshold of maximal twist angle {{Δ }}{φ }{{thres}}˜ 1. The magnetosphere is stable only if the closed line twist angle is less than {{Δ }}{φ }{{thres}}. Beyond this value, the magnetosphere becomes unstable and gets untwisted. The spin-down rate would reduce to its off-state value. The quasi-periodicity in spin-down rate change can be explained by long-term activities in the star’s crust and the untwisting induced by MHD instability. The estimated duration of on-state is about 1 week, consistent with observations. Due to the MHD instability, there exists an upper limit for the spin-down ratio (f˜ 3) between the on-state and the off-state, if the Y-point remains at the light cylinder.

Twisting microfluidics in a planetary centrifuge.

PubMed

Yasuda, Shoya; Hayakawa, Masayuki; Onoe, Hiroaki; Takinoue, Masahiro

2017-03-15

This paper reports a twisting microfluidic method utilising a centrifuge-based fluid extruding system in a planetary centrifuge which simultaneously generates an orbital rotation and an axial spin. In this method, fluid extrusion from a micro-scale capillary to an 'open-space' solution or air enables release of the fluid from the capillary-based microchannel, which physically means that there is a release of fluids from a confined low-Reynolds-number environment to an open non-low-Reynolds-number environment. As a result, the extruded fluids are separated from the axial spin of the capillary, and the difference in the angular rates of the axial spin between the capillary and the extruded fluids produces the 'twisting' of the fluid. In this study, we achieve control of the twist of highly viscous fluids, and we construct a simple physical model for the fluid twist. In addition, we demonstrate the formation of twisted hydrogel microstructures (stripe-patterned microbeads and multi-helical microfibres) with control over the stripe pattern and the helical pitch length. We believe that this method will enable the generation of more sophisticated microstructures which cannot easily be formed by usual channel-based microfluidic devices. This method can also provide advanced control of microfluids, as in the case of rapid mixing of highly viscous fluids. This method can contribute to a wide range of applications in materials science, biophysics, biomedical science, and microengineering in the future.

Multi-stage Depressed Collectors (MDC) for efficiency improvements of UHF broadcast klystrons

NASA Technical Reports Server (NTRS)

Kosmahl, H. G.

1982-01-01

The consumed primary power is reduced and the efficiency of traveling wave tubes is raised through the use of depressed collectors which passively convert potential energy into electric energy. Efficiency was kept with constant within a 3 dB range while the output power varied by 10 dB. Aspects to be considered in transferring this technology to UHF klystrons are the electron energy spectrum of the klystron and the magnitude of the injection angle required.

Association between Twist and multidrug resistance gene-associated proteins in Taxol®-resistant MCF-7 cells and a 293 cell model of Twist overexpression.

PubMed

Wang, Li; Tan, Rui-Zhi; Zhang, Zhi-Xia; Yin, Rui; Zhang, Yong-Liang; Cui, Wei-Jia; He, Tao

2018-01-01

Multidrug resistance (MDR) severely limits the effectiveness of chemotherapy. Previous studies have identified Twist as a key factor of acquired MDR in breast, gastric and prostate cancer. However, the underlying mechanisms of action of Twist in MDR remain unclear. In the present study, the expression levels of MDR-associated proteins, including lung resistance-related protein (LRP), topoisomerase IIα (TOPO IIα), MDR-associated protein (MRP) and P-glycoprotein (P-gp), and the expression of Twist in cancerous tissues and pericancerous tissues of human breast cancer, were examined. In order to simulate Taxol ® resistance in cells, a Taxol ® -resistant human mammary adenocarcinoma cell subline (MCF-7/Taxol ® ) was established by repeatedly exposing MCF-7 cells to high concentrations of Taxol ® (up to 15 µg/ml). Twist was also overexpressed in 293 cells by transfecting this cell line with pcDNA5/FRT/TO vector containing full-length hTwist cDNA to explore the dynamic association between Twist and MDR gene-associated proteins. It was identified that the expression levels of Twist, TOPO IIα, MRP and P-gp were upregulated and LRP was downregulated in human breast cancer tissues, which was consistent with the expression of these proteins in the Taxol ® -resistant MCF-7 cell model. Notably, the overexpression of Twist in 293 cells increased the resistance to Taxol ® , Trichostatin A and 5-fluorouracil, and also upregulated the expression of MRP and P-gp. Taken together, these data demonstrated that Twist may promote drug resistance in cells and cancer tissues through regulating the expression of MDR gene-associated proteins, which may assist in understanding the mechanisms of action of Twist in drug resistance.

Helically twisted photonic crystal fibres

PubMed Central

Beravat, R.; Wong, G. K. L.

2017-01-01

Recent theoretical and experimental work on helically twisted photonic crystal fibres (PCFs) is reviewed. Helical Bloch theory is introduced, including a new formalism based on the tight-binding approximation. It is used to explore and explain a variety of unusual effects that appear in a range of different twisted PCFs, including fibres with a single core and fibres with N cores arranged in a ring around the fibre axis. We discuss a new kind of birefringence that causes the propagation constants of left- and right-spinning optical vortices to be non-degenerate for the same order of orbital angular momentum (OAM). Topological effects, arising from the twisted periodic ‘space’, cause light to spiral around the fibre axis, with fascinating consequences, including the appearance of dips in the transmission spectrum and low loss guidance in coreless PCF. Discussing twisted fibres with a single off-axis core, we report that optical activity in a PCF is opposite in sign to that seen in a step-index fibre. Fabrication techniques are briefly described and emerging applications reviewed. The analytical results of helical Bloch theory are verified by an extensive series of ‘numerical experiments’ based on finite-element solutions of Maxwell's equations in a helicoidal frame. This article is part of the themed issue ‘Optical orbital angular momentum’. PMID:28069771

Structural and electron diffraction scaling of twisted graphene bilayers

NASA Astrophysics Data System (ADS)

Zhang, Kuan; Tadmor, Ellad B.

2018-03-01

Multiscale simulations are used to study the structural relaxation in twisted graphene bilayers and the associated electron diffraction patterns. The initial twist forms an incommensurate moiré pattern that relaxes to a commensurate microstructure comprised of a repeating pattern of alternating low-energy AB and BA domains surrounding a high-energy AA domain. The simulations show that the relaxation mechanism involves a localized rotation and shrinking of the AA domains that scales in two regimes with the imposed twist. For small twisting angles, the localized rotation tends to a constant; for large twist, the rotation scales linearly with it. This behavior is tied to the inverse scaling of the moiré pattern size with twist angle and is explained theoretically using a linear elasticity model. The results are validated experimentally through a simulated electron diffraction analysis of the relaxed structures. A complex electron diffraction pattern involving the appearance of weak satellite peaks is predicted for the small twist regime. This new diffraction pattern is explained using an analytical model in which the relaxation kinematics are described as an exponentially-decaying (Gaussian) rotation field centered on the AA domains. Both the angle-dependent scaling and diffraction patterns are in quantitative agreement with experimental observations. A Matlab program for extracting the Gaussian model parameters accompanies this paper.

Scanning tunneling microscopy and spectroscopy of twisted trilayer graphene

NASA Astrophysics Data System (ADS)

Zuo, Wei-Jie; Qiao, Jia-Bin; Ma, Dong-Lin; Yin, Long-Jing; Sun, Gan; Zhang, Jun-Yang; Guan, Li-Yang; He, Lin

2018-01-01

Twist, as a simple and unique degree of freedom, could lead to enormous novel quantum phenomena in bilayer graphene. A small rotation angle introduces low-energy van Hove singularities (VHSs) approaching the Fermi level, which result in unusual correlated states in the bilayer graphene. It is reasonable to expect that the twist could also affect the electronic properties of few-layer graphene dramatically. However, such an issue has remained experimentally elusive. Here, by using scanning tunneling microscopy/spectroscopy (STM/STS), we systematically studied a twisted trilayer graphene (TTG) with two different small twist angles between adjacent layers. Two sets of VHSs, originating from the two twist angles, were observed in the TTG, indicating that the TTG could be simply regarded as a combination of two different twisted bilayers of graphene. By using high-resolution STS, we observed a split of the VHSs and directly imaged the spatial symmetry breaking of electronic states around the VHSs. These results suggest that electron-electron interactions play an important role in affecting the electronic properties of graphene systems with low-energy VHSs.

[Expression and mechanism of Twist2 in glioma].

PubMed

Wang, L Z; Wang, W J; Xiong, Y F; Xu, S; Wang, S S; Tu, Y; Wang, Z Y; Yan, X L; Mei, J H; Wang, C L

2017-12-08

Objective: To investigate the significance of Twist2 in glioma and whether it is involved in the malignant transformation of glioma by epithelial-mesenchymal transition (EMT). Methods: Using immunohistochemical method detected the expression level of Twist2 in 60 cases of gliomas (including WHO grades Ⅱ, Ⅲ and Ⅳ, each for 20 cases) and 20 cases of non-tumor brain tissues. Real-time fluorescence quantitative PCR and Western blot were used to detect the expression level of Twist2 mRNA and protein in 61 cases of fresh glioma tissue (WHO grade Ⅱ 16 cases, Ⅲ 21 cases, Ⅳ 24 cases) and 12 cases of adjacent tissues, and the expression levels of E-cadherin, N-cadherin and vimentin were also investigated in fresh glioma tissue. Results: Immunohistochemistry results showed that the percentages of Twist2 expression in glioma was 90%(54/60) compared with 30%(6/20) in non-tumor brain tissues( P <0.01). The percentages of Twist2 expression were 75% (15/20), 95% (19/20), and 100% (20/20) in the WHO gradesⅡ, Ⅲ and Ⅳ gliomas, respectively. WHO grades Ⅳ and Ⅲ were significantly higher than that of WHO grade Ⅱ ( P <0.01). There was no significant difference between WHO grade Ⅳand WHO Ⅲ glioma ( P >0.05). Real-time fluorescence quantitative PCR and Western blot showed that the expression level of Twist 2 in gliomas was significantly higher than that in para-cancerous tissues ( P <0.01), and those in WHO grades Ⅳ and Ⅲ gliomas were significantly higher than that in WHO grade Ⅱ glioma ( P <0.01). There was no significant difference between WHO grade Ⅳand grade Ⅲ glioma ( P >0.05). Detection of key protein expression in EMT by Western blot displayed that the expression of E-cadherin was negatively associated with Twist2 in glioma ( r =-0.972, P <0.01). The expression of N-cadherin and vimentin was positively associated with Twist2 in glioma( r =0.971, P <0.01; r =0.968, P <0.01). Conclusions: The expression of Twist2 in human glioma is positively

Signal distortion on VHF/UHF transionospheric paths: First results from the Wideband Ionospheric Distortion Experiment

NASA Astrophysics Data System (ADS)

Cannon, Paul S.; Groves, Keith; Fraser, David J.; Donnelly, William J.; Perrier, Kathleen

2006-10-01

To the best of our knowledge, we report the first determination of ionospheric distortion, comprising the simultaneous characterization of both multipath and Doppler, on wideband, transionospheric VHF (158 MHz) and UHF (422 MHz) signals. The measurements took place as part of the test phase of the United Kingdom-United States Wideband Ionospheric Distortion Experiment during the evening (˜1000 UT) of 18 January 2005. This characterization has been achieved using the ALTAIR radar at the Ronald Reagan Ballistic Missile Defense Test Site on Kwajalein Atoll (9.395°N, 167.469°E (12.87°N, 237.16°E corrected geomagnetic)) in the Pacific, in conjunction with a low Earth orbiting, constant radar cross-section, passive satellite (calibration sphere). During the period when the two-way S4 index was above ˜0.8 on both channels, the median coherency times were 43 and 96 ms at VHF and UHF, respectively (at 1.5σ). The corresponding median coherency bandwidths were 0.8 and 2.1 MHz.

Design of miniature type parallel coupled microstrip hairpin filter in UHF range

NASA Astrophysics Data System (ADS)

Hasan, Adib Belhaj; Rahman, Maj Tarikur; Kahhar, Azizul; Trina, Tasnim; Saha, Pran Kanai

2017-12-01

A microstrip parallel coupled line bandpass filter is designed in UHF range and the filter size is reduced by microstrip hairpin structure. The FR4 substrate is used as base material of the filter. The filter is analyzed by both ADS and CST design studio in the frequency range of 500 MHz to 650 MHz. The Bandwidth is found 13.27% with a center frequency 570 MHz. Simulation from both ADS and CST shows a very good agreement of performance of the filter.

Analysis of lead twist in modern high-performance grinding methods

NASA Astrophysics Data System (ADS)

Kundrák, J.; Gyáni, K.; Felhő, C.; Markopoulos, AP; Deszpoth, I.

2016-11-01

According to quality requirements of road vehicles shafts, which bear dynamic seals, twisted-pattern micro-geometrical topography is not allowed. It is a question whether newer modern grinding methods - such as quick-point grinding and peel grinding - could provide twist- free topography. According to industrial experience, twist-free surfaces can be made, however with certain settings, same twist occurs. In this paper it is proved by detailed chip-geometrical analysis that the topography generated by the new procedures is theoretically twist-patterned because of the feeding motion of the CBN tool. The presented investigation was carried out by a single-grain wheel model and computer simulation.

Trace of the Twisted Heisenberg Category

NASA Astrophysics Data System (ADS)

Oğuz, Can Ozan; Reeks, Michael

2017-12-01

We show that the trace decategorification, or zeroth Hochschild homology, of the twisted Heisenberg category defined by Cautis and Sussan is isomorphic to a quotient of {W^-}, a subalgebra of W_{1+∞} defined by Kac, Wang, and Yan. Our result is a twisted analogue of that by Cautis, Lauda, Licata, and Sussan relating W_{1+∞} and the trace decategorification of the Heisenberg category.

Particle-in-Cell Simulations of the Twisted Magnetospheres of Magnetars. I.

NASA Astrophysics Data System (ADS)

Chen, Alexander Y.; Beloborodov, Andrei M.

2017-08-01

The magnetospheres of magnetars are believed to be filled with electron-positron plasma generated by electric discharge. We present a first numerical experiment demonstrating this process in an axisymmetric magnetosphere with a simple threshold prescription for pair creation, which is applicable to the inner magnetosphere with an ultrastrong field. The {e}+/- discharge occurs in response to the twisting of the closed magnetic field lines by a shear deformation of the magnetar surface, which launches electric currents into the magnetosphere. The simulation shows the formation of an electric “gap” with an unscreened electric field ({\\boldsymbol{E}}\\cdot {\\boldsymbol{B}}\

Reaction mechanism of the acidic hydrolysis of highly twisted amides: Rate acceleration caused by the twist of the amide bond.

PubMed

Mujika, Jon I; Formoso, Elena; Mercero, Jose M; Lopez, Xabier

2006-08-03

We present an ab initio study of the acid hydrolysis of a highly twisted amide and a planar amide analogue. The aim of these studies is to investigate the effect that the twist of the amide bond has on the reaction barriers and mechanism of acid hydrolysis. Concerted and stepwise mechanisms were investigated using density functional theory and polarizable continuum model calculations. Remarkable differences were observed between the mechanism of twisted and planar amide, due mainly to the preference for N-protonation of the former and O-protonation of the latter. In addition, we were also able to determine that the hydrolytic mechanism of the twisted amide will be pH dependent. Thus, there is a preference for a stepwise mechanism with formation of an intermediate in the acid hydrolysis, whereas the neutral hydrolysis undergoes a concerted-type mechanism. There is a nice agreement between the characterized intermediate and available X-ray data and a good agreement with the kinetically estimated rate acceleration of hydrolysis with respect to analogous undistorted amide compounds. This work, along with previous ab initio calculations, describes a complex and rich chemistry for the hydrolysis of highly twisted amides as a function of pH. The theoretical data provided will allow for a better understanding of the available kinetic data of the rate acceleration of amides upon twisting and the relation of the observed rate acceleration with intrinsic differential reactivity upon loss of amide bond resonance.

Fiber-Optic Propagation Effects in Long-Haul HF/VHF/UHF Analog Photonic Links

DTIC Science & Technology

2014-04-17

theoretical analysis of crosstalk in fiber optic wavelength division multiplexed systems is presented for the HF/VHF/UHF (1 MHz to 3 GHz) frequency...Street, Suite 1425 Arlington, VA 22203-1995 EW-271-003 6582 ONR Wavelength division multiplexing Crosstalk 05-03-2013 – 20-08-2014 TABLE OF CONTENTS...in optical fiber that can alter the phase relationship between signals in separate fibers or between signals that are multiplexed onto the same

Twisted multifilament superconductor

NASA Technical Reports Server (NTRS)

Coles, W. D. (Inventor)

1973-01-01

Masking selected portions of a ribbon and forming an intermetallic compound on the unmasked portions by a controlled diffusion reaction produces a twisted filamentary structure. The masking material prohibits the formation of superconductive material on predetermined areas of the substrate.

Using UHF proximity loggers to quantify male-female interactions: a scoping study of estrous activity in cattle.

PubMed

O'Neill, C J; Bishop-Hurley, G J; Williams, P J; Reid, D J; Swain, D L

2014-12-10

Reproductive efficiency is an important determinant of profitable cattle breeding systems and the success of assisted reproductive techniques (ART) in wildlife conservation programs. Methods of estrous detection used in intensive beef and dairy cattle systems lack accuracy and remain the single biggest issue for improvement of reproductive rates and such methods are not practical for either large-scale extensive beef cattle enterprises or free-living mammalian species. Recent developments in UHF (ultra high frequency) proximity logger telemetry devices have been used to provide a continuous pair-wise measure of associations between individual animals for both livestock and wildlife. The objective of this study was to explore the potential of using UHF telemetry to identify the reproductive cycle phenotype in terms of intensity and duration of estrus. The study was conducted using Belmont Red (interbred Africander Brahman Hereford-Shorthorn) cattle grazing irrigated pasture on Belmont Research Station, northeastern Australia. The cow-bull associations from three groups of cows each with one bull were recorded over a 7-week breeding season and the stage of estrus was identified using ultrasonography. Telemetry data from bull and cows, collected over 4 8-day logger deployments, were log transformed and analyzed by ANOVA. Both the number and duration of bull-cow affiliations were significantly (P<0.001) greater in estrous cows compared to anestrus cows. These results support the development of the UHF technology as a hands-off and noninvasive means of gathering socio-sexual information on both wildlife and livestock for reproductive management. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

Moiré edge states in twisted graphene nanoribbons

NASA Astrophysics Data System (ADS)

Fleischmann, M.; Gupta, R.; Weckbecker, D.; Landgraf, W.; Pankratov, O.; Meded, V.; Shallcross, S.

2018-05-01

The edge physics of graphene based systems is well known to be highly sensitive to the atomic structure at the boundary, with localized zero mode edge states found only on the zigzag-type termination of the lattice. Here we demonstrate that the graphene twist bilayer supports an additional class of edge states, that (i) are found for all edge geometries and thus are robust against edge roughness, (ii) occur at energies coinciding with twist induced Van Hove singularities in the bulk and (iii) possess an electron density strongly modulated by the moiré lattice. Interestingly, these "moiré edge states" exist only for certain lattice commensurations and thus the edge physics of the twist bilayer is, in dramatic contrast to that of the bulk, not uniquely determined by the twist angle.

NAEB TECHNICAL REPORT ON THE IMPACT OF AIRBORNE TELEVISION TRANSMISSION ON LAND-BASED UHF TELEVISION ASSIGNMENT PLANS.

ERIC Educational Resources Information Center

BRONSON, VERNON; AND OTHERS

OPERATIONAL EFFECTS OF AIRBORNE EDUCATIONAL TELEVISION ON ULTRAHIGH FREQUENCY (UHF) TELEVISION ASSIGNMENTS ON LAND WERE INVESTIGATED. SPECIFICALLY, THE EFFORT RELATED TO EXPANSION PLANS OF THE MIDWEST PROGRAM ON AIRBORNE TELEVISION INSTRUCTION (MPATI). PREVIOUS STUDIES BY THE NATIONAL ASSOCIATION OF EDUCATIONAL BROADCASTERS (NAEB) LED TO THE…

Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

NASA Astrophysics Data System (ADS)

Hu, F.; Das, Suprem R.; Luan, Y.; Chung, T.-F.; Chen, Y. P.; Fei, Z.

2017-12-01

We report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly due to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.

Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, F.; Das, Suprem R.; Luan, Y.

Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

DOE PAGES

Hu, F.; Das, Suprem R.; Luan, Y.; ...

2017-12-13

Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

Reversible Twisting of Primary Amides via Ground State N-C(O) Destabilization: Highly Twisted Rotationally Inverted Acyclic Amides.

PubMed

Meng, Guangrong; Shi, Shicheng; Lalancette, Roger; Szostak, Roman; Szostak, Michal

2018-01-17

Since the seminal studies by Pauling in 1930s, planarity has become the defining characteristic of the amide bond. Planarity of amides has central implications for the reactivity and chemical properties of amides of relevance to a range of chemical disciplines. While the vast majority of amides are planar, nonplanarity has a profound effect on the properties of the amide bond, with the most common method to restrict the amide bond relying on the incorporation of the amide function into a rigid cyclic ring system. In a major departure from this concept, here, we report the first class of acyclic twisted amides that can be prepared, reversibly, from common primary amides in a single, operationally trivial step. Di-tert-butoxycarbonylation of the amide nitrogen atom yields twisted amides in which the amide bond exhibits nearly perpendicular twist. Full structural characterization of a range of electronically diverse compounds from this new class of twisted amides is reported. Through reactivity studies we demonstrate unusual properties of the amide bond, wherein selective cleavage of the amide bond can be achieved by a judicious choice of the reaction conditions. Through computational studies we evaluate structural and energetic details pertaining to the amide bond deformation. The ability to selectively twist common primary amides, in a reversible manner, has important implications for the design and application of the amide bond nonplanarity in structural chemistry, biochemistry and organic synthesis.

Twisted sigma-model solitons on the quantum projective line

NASA Astrophysics Data System (ADS)

Landi, Giovanni

2018-04-01

On the configuration space of projections in a noncommutative algebra, and for an automorphism of the algebra, we use a twisted Hochschild cocycle for an action functional and a twisted cyclic cocycle for a topological term. The latter is Hochschild-cohomologous to the former and positivity in twisted Hochschild cohomology results into a lower bound for the action functional. While the equations for the critical points are rather involved, the use of the positivity and the bound by the topological term lead to self-duality equations (thus yielding twisted noncommutative sigma-model solitons, or instantons). We present explicit nontrivial solutions on the quantum projective line.

The Twist Tensor Nuclear Norm for Video Completion.

PubMed

Hu, Wenrui; Tao, Dacheng; Zhang, Wensheng; Xie, Yuan; Yang, Yehui

2017-12-01

In this paper, we propose a new low-rank tensor model based on the circulant algebra, namely, twist tensor nuclear norm (t-TNN). The twist tensor denotes a three-way tensor representation to laterally store 2-D data slices in order. On one hand, t-TNN convexly relaxes the tensor multirank of the twist tensor in the Fourier domain, which allows an efficient computation using fast Fourier transform. On the other, t-TNN is equal to the nuclear norm of block circulant matricization of the twist tensor in the original domain, which extends the traditional matrix nuclear norm in a block circulant way. We test the t-TNN model on a video completion application that aims to fill missing values and the experiment results validate its effectiveness, especially when dealing with video recorded by a nonstationary panning camera. The block circulant matricization of the twist tensor can be transformed into a circulant block representation with nuclear norm invariance. This representation, after transformation, exploits the horizontal translation relationship between the frames in a video, and endows the t-TNN model with a more powerful ability to reconstruct panning videos than the existing state-of-the-art low-rank models.

"Twisted Beam" SEE Observations of Ionospheric Heating from HAARP

NASA Astrophysics Data System (ADS)

Briczinski, S. J.; Bernhardt, P. A.; Siefring, C. L.; Han, S.-M.; Pedersen, T. R.; Scales, W. A.

2015-10-01

Nonlinear interactions of high power HF radio waves in the ionosphere provide aeronomers with a unique space-based laboratory capability. The High-Frequency Active Auroral Research Program (HAARP) in Gakona, Alaska is the world's largest heating facility, yielding effective radiated powers in the gigawatt range. New results are present from HAARP experiments using a "twisted beam" excitation mode. Analysis of twisted beam heating shows that the SEE results obtained are identical to more traditional patterns. One difference in the twisted beam mode is the heating region produced is in the shape of a ring as opposed to the more traditional "solid spot" region from a pencil beam. The ring heating pattern may be more conducive to the creation of stable artificial airglow layers because of the horizontal structure of the ring. The results of these runs include artificial layer creation and evolution as pertaining to the twisted beam pattern. The SEE measurements aid the interpretation of the twisted beam interactions in the ionosphere.

Role of left ventricular twist mechanics in cardiomyopathies, dance of the helices

PubMed Central

Kauer, Floris; Geleijnse, Marcel Leonard; van Dalen, Bastiaan Martijn

2015-01-01

Left ventricular twist is an essential part of left ventricular function. Nevertheless, knowledge is limited in “the cardiology community” as it comes to twist mechanics. Fortunately the development of speckle tracking echocardiography, allowing accurate, reproducible and rapid bedside assessment of left ventricular twist, has boosted the interest in this important mechanical aspect of left ventricular deformation. Although the fundamental physiological role of left ventricular twist is undisputable, the clinical relevance of assessment of left ventricular twist in cardiomyopathies still needs to be established. The fact remains; analysis of left ventricular twist mechanics has already provided substantial pathophysiological understanding on a comprehensive variety of cardiomyopathies. It has become clear that increased left ventricular twist in for example hypertrophic cardiomyopathy may be an early sign of subendocardial (microvascular) dysfunction. Furthermore, decreased left ventricular twist may be caused by left ventricular dilatation or an extensive myocardial scar. Finally, the detection of left ventricular rigid body rotation in noncompaction cardiomyopathy may provide an indispensible method to objectively confirm this difficult diagnosis. All this endorses the value of left ventricular twist in the field of cardiomyopathies and may further encourage the implementation of left ventricular twist parameters in the “diagnostic toolbox” for cardiomyopathies. PMID:26322187

Twisted surfaces with vanishing curvature in Galilean 3-space

NASA Astrophysics Data System (ADS)

Dede, Mustafa; Ekici, Cumali; Goemans, Wendy; Ünlütürk, Yasin

In this work, we define twisted surfaces in Galilean 3-space. In order to construct these surfaces, a planar curve is subjected to two simultaneous rotations, possibly with different rotation speeds. The existence of Euclidean rotations and isotropic rotations leads to three distinct types of twisted surfaces in Galilean 3-space. Then we classify twisted surfaces in Galilean 3-space with zero Gaussian curvature or zero mean curvature.

LS Channel Estimation and Signal Separation for UHF RFID Tag Collision Recovery on the Physical Layer.

PubMed

Duan, Hanjun; Wu, Haifeng; Zeng, Yu; Chen, Yuebin

2016-03-26

In a passive ultra-high frequency (UHF) radio-frequency identification (RFID) system, tag collision is generally resolved on a medium access control (MAC) layer. However, some of collided tag signals could be recovered on a physical (PHY) layer and, thus, enhance the identification efficiency of the RFID system. For the recovery on the PHY layer, channel estimation is a critical issue. Good channel estimation will help to recover the collided signals. Existing channel estimates work well for two collided tags. When the number of collided tags is beyond two, however, the existing estimates have more estimation errors. In this paper, we propose a novel channel estimate for the UHF RFID system. It adopts an orthogonal matrix based on the information of preambles which is known for a reader and applies a minimum-mean-square-error (MMSE) criterion to estimate channels. From the estimated channel, we could accurately separate the collided signals and recover them. By means of numerical results, we show that the proposed estimate has lower estimation errors and higher separation efficiency than the existing estimates.

Twisting perturbed parafermions

NASA Astrophysics Data System (ADS)

Belitsky, A. V.

2017-07-01

The near-collinear expansion of scattering amplitudes in maximally supersymmetric Yang-Mills theory at strong coupling is governed by the dynamics of stings propagating on the five sphere. The pentagon transitions in the operator product expansion which systematize the series get reformulated in terms of matrix elements of branch-point twist operators in the two-dimensional O(6) nonlinear sigma model. The facts that the latter is an asymptotically free field theory and that there exists no local realization of twist fields prevents one from explicit calculation of their scaling dimensions and operator product expansion coefficients. This complication is bypassed making use of the equivalence of the sigma model to the infinite-level limit of WZNW models perturbed by current-current interactions, such that one can use conformal symmetry and conformal perturbation theory for systematic calculations. Presently, to set up the formalism, we consider the O(3) sigma model which is reformulated as perturbed parafermions.

Twisted Vanes Would Enhance Fuel/Air Mixing In Turbines

NASA Technical Reports Server (NTRS)

Nguyen, H. Lee; Micklow, Gerald J.; Dogra, Anju S.

1994-01-01

Computations of flow show performance of high-shear airblast fuel injector in gas-turbine engine enhanced by use of appropriately proportioned twisted (instead of flat) dome swirl vanes. Resultant more nearly uniform fuel/air mixture burns more efficiently, emitting smaller amounts of nitrogen oxides. Twisted-vane high-shear airblast injectors also incorporated into paint sprayers, providing advantages of low pressure drop characteristic of airblast injectors in general and finer atomization of advanced twisted-blade design.

Performance of twist-coupled blades on variable speed rotors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lobitz, D.W.; Veers, P.S.; Laino, D.J.

1999-12-07

The load mitigation and energy capture characteristics of twist-coupled HAWT blades that are mounted on a variable speed rotor are investigated in this paper. These blades are designed to twist toward feather as they bend with pretwist set to achieve a desirable twist distribution at rated power. For this investigation, the ADAMS-WT software has been modified to include blade models with bending-twist coupling. Using twist-coupled and uncoupled models, the ADAMS software is exercised for steady wind environments to generate C{sub p} curves at a number of operating speeds to compare the efficiencies of the two models. The ADAMS software ismore » also used to generate the response of a twist-coupled variable speed rotor to a spectrum of stochastic wind time series. This spectrum contains time series with two mean wind speeds at two turbulence levels. Power control is achieved by imposing a reactive torque on the low speed shaft proportional to the RPM squared with the coefficient specified so that the rotor operates at peak efficiency in the linear aerodynamic range, and by limiting the maximum RPM to take advantage of the stall controlled nature of the rotor. Fatigue calculations are done for the generated load histories using a range of material exponents that represent materials from welded steel to aluminum to composites, and results are compared with the damage computed for the rotor without twist-coupling. Results indicate that significant reductions in damage are achieved across the spectrum of applied wind loading without any degradation in power production.« less

Comparison of split double and triple twists in pair figure skating.

PubMed

King, Deborah L; Smith, Sarah L; Brown, Michele R; McCrory, Jean L; Munkasy, Barry A; Scheirman, Gary I

2008-05-01

In this study, we compared the kinematic variables of the split triple twist with those of the split double twist to help coaches and scientists understand these landmark pair skating skills. High-speed video was taken during the pair short and free programmes at the 2002 Salt Lake City Winter Olympics and the 2003 International Skating Union Grand Prix Finals. Three-dimensional analyses of 14 split double twists and 15 split triple twists from eleven pairs were completed. In spite of considerable variability in the performance variables among the pairs, the main difference between the split double twists and split triple twists was an increase in rotational rate. While eight of the eleven pairs relied primarily on an increased rotational rate to complete the split triple twist, three pairs employed a combined strategy of increased rotational rate and increased flight time due predominantly to delayed or lower catches. These results were similar to observations of jumps in singles skating for which the extra rotation is typically due to an increase in rotational velocity; increases in flight time come primarily from delayed landings as opposed to additional height during flight. Combining an increase in flight time and rotational rate may be a good strategy for completing the split triple twist in pair skating.

Improving the range of UHF RFID transponders using solar energy harvesting under low light conditions

NASA Astrophysics Data System (ADS)

Ascher, A.; Lehner, M.; Eberhardt, M.; Biebl, E.

2015-11-01

The sensitivity of passive UHF RFID transponders (Radio Frequency Identification) is the key issue, which determines the maximum read range of an UHF RFID system. During this work the ability of improving the sensitivity using solar energy harvesting, especially for low light conditions, is shown. To use the additional energy harvested from the examined silicon and organic solar cells, the passive RFID system is changed into a semi-active one. This needs no changes on the reader hardware itself, only the used RFIC (Radio Frequency Integrated Circuit) of the transponder has to possess an additional input pin for an external supply voltage. The silicon and organic cells are evaluated and compared to each other regarding their low light performance. The different cells are examined in a shielded box, which is protected from the environmental lighting. Additionally, a demonstrator is shown, which makes the measurement of the extended read range with respect to the lighting conditions possible. If the cells are completely darkened, the sensitivity gain is ascertained using high capacity super caps. Due to the measurements an enhancement in range up to 70 % could be guaranteed even under low light conditions.

An active UHF RFID localization system for fawn saving

NASA Astrophysics Data System (ADS)

Eberhardt, M.; Lehner, M.; Ascher, A.; Allwang, M.; Biebl, E. M.

2015-11-01

We present a localization concept for active UHF RFID transponders which enables mowing machine drivers to detect and localize marked fawns. The whole system design and experimental results with transponders located near the ground in random orientations in a meadow area are shown. The communication flow between reader and transponders is realized as a dynamic master-slave concept. Multiple marked fawns will be localized by processing detected transponders sequentially. With an eight-channel-receiver with integrated calibration method one can estimate the direction-of-arrival by measuring the phases of the transponder signals up to a range of 50 m in all directions. For further troubleshooting array manifolds have been measured. An additional hand-held receiver with a two-channel receiver allows a guided approaching search without endangering the fawn by the mowing machine.

Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease.

PubMed

Xue, Gongda; Hemmings, Brian A

2012-02-01

The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.

Effect of twist on single-mode fiber-optic 3 × 3 couplers

NASA Astrophysics Data System (ADS)

Chen, Dandan; Ji, Minning; Peng, Lei

2018-01-01

In the fabricating process of a 3 × 3 fused tapered coupler, the three fibers are usually twisted to be close-contact. The effect of twist on 3 × 3 fused tapered couplers is investigated in this paper. It is found that though a linear 3 × 3 coupler may realize equal power splitting ratio theoretically by twisting a special angle, it is hard to be fabricated actually because the twist angle and the coupler's length must be determined in advance. While an equilateral 3 × 3 coupler can not only realize approximate equal power splitting ratio theoretically but can also be fabricated just by controlling the elongation length. The effect of twist on the equilateral 3 × 3 coupler lies in the relationship between the equal ratio error and the twist angle. The more the twist angle is, the larger the equal ratio error may be. The twist angle usually should be no larger than 90° on one coupling period length in order to keep the equal ratio error small enough. The simulation results agree well with the experimental data.

Twisted ultrathin silicon nanowires: A possible torsion electromechanical nanodevice

NASA Astrophysics Data System (ADS)

Garcia, J. C.; Justo, J. F.

2014-11-01

Nanowires have been considered for a number of applications in nanometrology. In such a context, we have explored the possibility of using ultrathin twisted nanowires as torsion nanobalances to probe forces and torques at molecular level with high precision, a nanoscale system analogous to the Coulomb's torsion balance electrometer. In order to achieve this goal, we performed a first-principles investigation on the structural and electronic properties of twisted silicon nanowires, in their pristine and hydrogenated forms. The results indicated that wires with pentagonal and hexagonal cross-sections are the thinnest stable silicon nanostructures. Additionally, all wires followed a Hooke's law behavior for small twisting deformations. Hydrogenation leads to spontaneous twisting, but with angular spring constants considerably smaller than the ones for the respective pristine forms. We observed considerable changes on the nanowire electronic properties upon twisting, which allows to envision the possibility of correlating the torsional angular deformation with the nanowire electronic transport. This could ultimately allow a direct access to measurements on interatomic forces at molecular level.

New twist on artificial muscles.

PubMed

Haines, Carter S; Li, Na; Spinks, Geoffrey M; Aliev, Ali E; Di, Jiangtao; Baughman, Ray H

2016-10-18

Lightweight artificial muscle fibers that can match the large tensile stroke of natural muscles have been elusive. In particular, low stroke, limited cycle life, and inefficient energy conversion have combined with high cost and hysteretic performance to restrict practical use. In recent years, a new class of artificial muscles, based on highly twisted fibers, has emerged that can deliver more than 2,000 J/kg of specific work during muscle contraction, compared with just 40 J/kg for natural muscle. Thermally actuated muscles made from ordinary polymer fibers can deliver long-life, hysteresis-free tensile strokes of more than 30% and torsional actuation capable of spinning a paddle at speeds of more than 100,000 rpm. In this perspective, we explore the mechanisms and potential applications of present twisted fiber muscles and the future opportunities and challenges for developing twisted muscles having improved cycle rates, efficiencies, and functionality. We also demonstrate artificial muscle sewing threads and textiles and coiled structures that exhibit nearly unlimited actuation strokes. In addition to robotics and prosthetics, future applications include smart textiles that change breathability in response to temperature and moisture and window shutters that automatically open and close to conserve energy.

New twist on artificial muscles

PubMed Central

Haines, Carter S.; Li, Na; Spinks, Geoffrey M.; Aliev, Ali E.; Di, Jiangtao; Baughman, Ray H.

2016-01-01

Lightweight artificial muscle fibers that can match the large tensile stroke of natural muscles have been elusive. In particular, low stroke, limited cycle life, and inefficient energy conversion have combined with high cost and hysteretic performance to restrict practical use. In recent years, a new class of artificial muscles, based on highly twisted fibers, has emerged that can deliver more than 2,000 J/kg of specific work during muscle contraction, compared with just 40 J/kg for natural muscle. Thermally actuated muscles made from ordinary polymer fibers can deliver long-life, hysteresis-free tensile strokes of more than 30% and torsional actuation capable of spinning a paddle at speeds of more than 100,000 rpm. In this perspective, we explore the mechanisms and potential applications of present twisted fiber muscles and the future opportunities and challenges for developing twisted muscles having improved cycle rates, efficiencies, and functionality. We also demonstrate artificial muscle sewing threads and textiles and coiled structures that exhibit nearly unlimited actuation strokes. In addition to robotics and prosthetics, future applications include smart textiles that change breathability in response to temperature and moisture and window shutters that automatically open and close to conserve energy. PMID:27671626

Analysis of gun barrel rifling twist

NASA Astrophysics Data System (ADS)

Sun, Jia; Chen, Guangsong; Qian, Linfang; Liu, Taisu

2017-05-01

Aiming at the problem of gun barrel rifling twist, the constraint relation between rifling and projectile is investigated. The constraint model of rifling and projectile is established and the geometric relation between the twist and the motion of projectile is analyzed. Based on the constraint model, according to the rotating band that is fired, the stress and the motion law of the rotating band in bore are analyzed. The effects to rotating band (double rotating band or wide driving band) caused by different rifling (rib rifling, increasing rifling and combined rifling) are also investigated. The model is demonstrated by several examples. The results of numerical examples and the constraint mode show that the uncertainty factors will be brought in the increasing rifling and combined rifling during the projectile move in the bore. According to the amplitude and the strength of the twist acting on rotating band, the steady property of rotational motion of the projectile, the rib rifling is a better choose.

Unraveling cellulose microfibrils: a twisted tale.

PubMed

Hadden, Jodi A; French, Alfred D; Woods, Robert J

2013-10-01

Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. Copyright © 2013 Wiley Periodicals, Inc.

Unraveling Cellulose Microfibrils: A Twisted Tale

PubMed Central

Hadden, Jodi A.; French, Alfred D.; Woods, Robert J.

2014-01-01

Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. PMID:23681971

Influence of pinches on magnetic reconnection in turbulent space plasmas

NASA Astrophysics Data System (ADS)

Olshevsky, Vyacheslav; Lapenta, Giovanni; Markidis, Stefano; Divin, Andrey

A generally accepted scenario of magnetic reconnection in space plasmas is the breakage of magnetic field lines in X-points. In laboratory, reconnection is widely studied in pinches, current channels embedded into twisted magnetic fields. No model of magnetic reconnection in space plasmas considers both null-points and pinches as peers. We have performed a particle-in-cell simulation of magnetic reconnection in a three-dimensional configuration where null-points are present nitially, and Z-pinches are formed during the simulation. The X-points are relatively stable, and no substantial energy dissipation is associated with them. On contrary, turbulent magnetic reconnection in the pinches causes the magnetic energy to decay at a rate of approximately 1.5 percent per ion gyro period. Current channels and twisted magnetic fields are ubiquitous in turbulent space plasmas, so pinches can be responsible for the observed high magnetic reconnection rates.

Mesoscale mechanics of twisting carbon nanotube yarns.

PubMed

Mirzaeifar, Reza; Qin, Zhao; Buehler, Markus J

2015-03-12

Fabricating continuous macroscopic carbon nanotube (CNT) yarns with mechanical properties close to individual CNTs remains a major challenge. Spinning CNT fibers and ribbons for enhancing the weak interactions between the nanotubes is a simple and efficient method for fabricating high-strength and tough continuous yarns. Here we investigate the mesoscale mechanics of twisting CNT yarns using full atomistic and coarse grained molecular dynamics simulations, considering concurrent mechanisms at multiple length-scales. To investigate the mechanical response of such a complex structure without losing insights into the molecular mechanism, we applied a multiscale strategy. The full atomistic results are used for training a coarse grained model for studying larger systems consisting of several CNTs. The mesoscopic model parameters are updated as a function of the twist angle, based on the full atomistic results, in order to incorporate the atomistic scale deformation mechanisms in larger scale simulations. By bridging across two length scales, our model is capable of accurately predicting the mechanical behavior of twisted yarns while the atomistic level deformations in individual nanotubes are integrated into the model by updating the parameters. Our results focused on studying a bundle of close packed nanotubes provide novel mechanistic insights into the spinning of CNTs. Our simulations reveal how twisting a bundle of CNTs improves the shear interaction between the nanotubes up to a certain level due to increasing the interaction surface. Furthermore, twisting the bundle weakens the intertube interactions due to excessive deformation in the cross sections of individual CNTs in the bundle.

Estimate of the fetal temperature increase due to UHF RFID exposure.

PubMed

Fiocchi, S; Markakis, I A; Liorni, I; Parazzini, M; Samaras, T; Ravazzani, P

2013-01-01

Exposure from electromagnetic (EM) devices has increased during the last decades due to the rapid development of new technologies. Among them, radiofrequency identification (RFID) applications are used in almost every aspect of everyday life, which could expose people unselectively. This scenario could pose potential risks for certain groups of general population, such as pregnant women, who are more sensitive to thermal effects produced by EM exposure. In this paper, the temperature rise at the steady state in two pregnant women models exposed to UHF RFID has been assessed. Results show that heating of tissues is far from the threshold of biological effects indicated by radiation protection guidelines.

Formation of Twisted Elephant Trunks in the Rosette Nebula

NASA Astrophysics Data System (ADS)

Carlqvist, P.; Gahm, G. F.; Kristen, H.

New observations show that dark elephant trunks in the Rosette nebula are often built up by thin filaments. In several of the trunks the filaments seem to form a twisted pattern. This pattern is hard to reconcile with current theory. We propose a new model for the formation of twisted elephant trunks in which electromagnetic forces play an important role. The model considers the behaviour of a twisted magnetic filament in a molecular cloud, where a cluster of hot stars has been recently born. As a result of stellar winds, and radiation pressure, electromagnetic forces, and inertia forces part of the filament can develop into a double helix pointing towards the stars. The double helix represents the twisted elephant trunk. A simple analogy experiment visualizes and supports the trunk model.

Wing Twist Measurements at the National Transonic Facility

NASA Technical Reports Server (NTRS)

Burner, Alpheus W.; Wahls, Richard A.; Goad, William K.

1996-01-01

A technique for measuring wing twist currently in use at the National Transonic Facility is described. The technique is based upon a single camera photogrammetric determination of two dimensional coordinates with a fixed (and known) third dimensional coordinate. The wing twist is found from a conformal transformation between wind-on and wind-off 2-D coordinates in the plane of rotation. The advantages and limitations of the technique as well as the rationale for selection of this particular technique are discussed. Examples are presented to illustrate run-to-run and test-to-test repeatability of the technique in air mode. Examples of wing twist in cryogenic nitrogen mode are also presented.

Statistical mechanics of ribbons under bending and twisting torques.

PubMed

Sinha, Supurna; Samuel, Joseph

2013-11-20

We present an analytical study of ribbons subjected to an external torque. We first describe the elastic response of a ribbon within a purely mechanical framework. We then study the role of thermal fluctuations in modifying its elastic response. We predict the moment-angle relation of bent and twisted ribbons. Such a study is expected to shed light on the role of twist in DNA looping and on bending elasticity of twisted graphene ribbons. Our quantitative predictions can be tested against future single molecule experiments.

Exact special twist method for quantum Monte Carlo simulations

NASA Astrophysics Data System (ADS)

Dagrada, Mario; Karakuzu, Seher; Vildosola, Verónica Laura; Casula, Michele; Sorella, Sandro

2016-12-01

We present a systematic investigation of the special twist method introduced by Rajagopal et al. [Phys. Rev. B 51, 10591 (1995), 10.1103/PhysRevB.51.10591] for reducing finite-size effects in correlated calculations of periodic extended systems with Coulomb interactions and Fermi statistics. We propose a procedure for finding special twist values which, at variance with previous applications of this method, reproduce the energy of the mean-field infinite-size limit solution within an adjustable (arbitrarily small) numerical error. This choice of the special twist is shown to be the most accurate single-twist solution for curing one-body finite-size effects in correlated calculations. For these reasons we dubbed our procedure "exact special twist" (EST). EST only needs a fully converged independent-particles or mean-field calculation within the primitive cell and a simple fit to find the special twist along a specific direction in the Brillouin zone. We first assess the performances of EST in a simple correlated model such as the three-dimensional electron gas. Afterwards, we test its efficiency within ab initio quantum Monte Carlo simulations of metallic elements of increasing complexity. We show that EST displays an overall good performance in reducing finite-size errors comparable to the widely used twist average technique but at a much lower computational cost since it involves the evaluation of just one wave function. We also demonstrate that the EST method shows similar performances in the calculation of correlation functions, such as the ionic forces for structural relaxation and the pair radial distribution function in liquid hydrogen. Our conclusions point to the usefulness of EST for correlated supercell calculations; our method will be particularly relevant when the physical problem under consideration requires large periodic cells.

Meteoroid Fragmentation as Revealed in Head- and Trail-Echoes Observed with the Arecibo UHF and VHF Radars

NASA Technical Reports Server (NTRS)

Mathews, J. D.; Malhorta, A.

2011-01-01

We report recent 46.8/430 MHz (VHF/UHF) radar meteor observations at Arecibo Observatory (AO) that reveal many previously unreported features in the radar meteor return - including flare-trails at both UHF and VHF - that are consistent with meteoroid fragmentation. Signature features of fragmentation include strong intra-pulse and pulse-to-pulse fading as the result of interference between or among multiple meteor head-echo returns and between head-echo and impulsive flare or "point" trail-echoes. That strong interference fading occurs implies that these scatterers exhibit well defined phase centers and are thus small compared with the wavelength. These results are consistent with and offer advances beyond a long history of optical and radar meteoroid fragmentation studies. Further, at AO, fragmenting and flare events are found to be a large fraction of the total events even though these meteoroids are likely the smallest observed by the major radars. Fragmentation is found to be a major though not dominate component of the meteors observed at other HPLA radars that are sensitive to larger meteoroids.

Twist-3 contributions to wide-angle photoproduction of pions

NASA Astrophysics Data System (ADS)

Kroll, P.; Passek-Kumerički, K.

2018-04-01

We investigate wide-angle π0 photoproduction within the handbag approach to twist-3 accuracy. In contrast to earlier work both the 2-particle as well as the 3-particle twist-3 contributions are taken into account. It is shown that both are needed for consistent results that respect gauge invariance and crossing properties. The numerical studies reveal the dominance of the twist-3 contribution. With it fair agreement with the recent CLAS measurement of the π0 cross section is obtained. We briefly comment also on wide-angle photoproduction of other pseudoscalar mesons.

Twisting integrin receptors increases endothelin-1 gene expression in endothelial cells

NASA Technical Reports Server (NTRS)

Chen, J.; Fabry, B.; Schiffrin, E. L.; Wang, N.; Ingber, D. E. (Principal Investigator)

2001-01-01

A magnetic twisting stimulator was developed based on the previously published technique of magnetic twisting cytometry. Using ligand-coated ferromagnetic microbeads, this device can apply mechanical stresses with varying amplitudes, duration, frequencies, and waveforms to specific cell surface receptors. Biochemical and biological responses of the cells to the mechanical stimulation can be assayed. Twisting integrin receptors with RGD (Arg-Gly-Asp)-containing peptide-coated beads increased endothelin-1 (ET-1) gene expression by >100%. In contrast, twisting scavenger receptors with acetylated low-density lipoprotein-coated beads or twisting HLA antigen with anti-HLA antibody-coated beads did not lead to alterations in ET-1 gene expression. In situ hybridization showed that the increase in ET-1 mRNA was localized in the cells that were stressed with the RGD-coated beads. Blocking stretch-activated ion channels with gadolinium, chelating Ca2+ with EGTA, or inhibiting tyrosine phosphorylation with genistein abolished twist-induced ET-1 mRNA elevation. Abolishing cytoskeletal tension with an inhibitor of the myosin ATPase, with an inhibitor of myosin light chain kinase, or with an actin microfilament disrupter blocked twisted-induced increases in ET-1 expression. Our results are consistent with the hypothesis that the molecular structural linkage of integrin-cytoskeleton is an important pathway for stress-induced ET-1 gene expression.

A photometric determination of twists in early-type galaxies. II

NASA Technical Reports Server (NTRS)

Williams, T. B.; Schwarzschild, M.

1979-01-01

In continuation of previous work, detailed photometric data have been obtained for two elliptical galaxies by using the Mount Lemmon 1.5-m telescope and a large SEC television camera. As before, the aim of this photometry is to gain additional information on the occurrence of twists in such galaxies; i.e., on the change of the position angle of the major axes of the isophotes from the center outward. No significant twist was found in NGC 1052. However, NGC 584 was found to have a securely observed twist of about 10 deg within 10 kpc from its center. These data strengthen previous indications that many ellipticals contain twists in their inner, bright portions.

Active-Twist Rotor Control Applications for UAVs

NASA Technical Reports Server (NTRS)

Wilbur, Matthew L.; Wilkie, W. Keats

2004-01-01

The current state-of-the-art in active-twist rotor control is discussed using representative examples from analytical and experimental studies, and the application to rotary-wing UAVs is considered. Topics include vibration and noise reduction, rotor performance improvement, active blade tracking, stability augmentation, and rotor blade de-icing. A review of the current status of piezoelectric fiber composite actuator technology, the class of piezoelectric actuators implemented in active-twist rotor systems, is included.

Aeroelastic Analysis of Helicopter Rotor Blades Incorporating Anisotropic Piezoelectric Twist Actuation

NASA Technical Reports Server (NTRS)

Wilkie, W. Keats; Belvin, W. Keith; Park, K. C.

1996-01-01

A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consists of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for dynamics simulation using numerical integration. The twist actuation responses for three conceptual fullscale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

Effect of twist on transverse impact response of ballistic fiber yarns

DOE PAGES

Song, Bo; Lu, Wei -Yang

2015-06-15

A Hopkinson bar was employed to conduct transverse impact testing of twisted Kevlar KM2 fiber yarns at the same impact speed. The speed of Euler transverse wave generated by the impact was measured utilizing a high speed digital camera. The study included fiber yarns twisted by different amounts. The Euler transverse wave speed was observed to increase with increasing amount of twist of the fiber yarn, within the range of this investigation. As a result, the higher transverse wave speeds in the more twisted fiber yarns indicate better ballistic performance in soft body armors for personal protection.

Cerclage handling for improved fracture treatment. A biomechanical study on the twisting procedure.

PubMed

Wähnert, D; Lenz, M; Schlegel, U; Perren, S; Windolf, M

2011-01-01

Twisting is clinically the most frequently applied method for tightening and maintaining cerclage fixation. The twisting procedure is controversially discussed. Several factors during twisting affect the mechanical behaviour of the cerclage. This in vitro study investigated the influence of different parameters of the twisting procedure on the fixation strength of the cerclage in an experimental setup with centripetal force application. Cortical half shells of the femoral shaft were mounted on a testing fixture. 1.0 mm, 1.25 mm and 1.5 mm stainless ste- el wire cerclages as well as a 1.0mm cable cerclage were applied to the bone. Pretension of the cerclage during the installation was measured during the locking procedure. Subsequently, cyclic testing was performed up to failure. Higher pretension could be achieved with increasing wire diameter. However, with larger wire diameter the drop of pre- tension due to the bending and cutting the twist also increased. The cable cerclage showed the highest pretension after locking. Cerclages twisted under traction revealed significantly higher initial cerclage tension. Plastically deformed twists offered higher cerclage pretension compared to twists which were deformed in the elastic region of the material. Cutting the wire within the twist caused the highest loss of cerclage tension (44% initial tension) whereas only 11 % was lost when cutting the wire ends separately. The bending direction of the twist significantly influenced the cerclage pretension. 45% pretension was lost in forward bending of the twist, 53% in perpendicular bending and 90% in backward bending. Several parameters affect the quality of a cerclage fixation. Adequate installation of cerclage wires could markedly improve the clinical outcome of cerclage.

Topological entanglement entropy with a twist.

PubMed

Brown, Benjamin J; Bartlett, Stephen D; Doherty, Andrew C; Barrett, Sean D

2013-11-27

Defects in topologically ordered models have interesting properties that are reminiscent of the anyonic excitations of the models themselves. For example, dislocations in the toric code model are known as twists and possess properties that are analogous to Ising anyons. We strengthen this analogy by using the topological entanglement entropy as a diagnostic tool to identify properties of both defects and excitations in the toric code. Specifically, we show, through explicit calculation, that the toric code model including twists and dyon excitations has the same quantum dimensions, the same total quantum dimension, and the same fusion rules as an Ising anyon model.

AKT-ions with a TWIST between EMT and MET.

PubMed

Tang, Huifang; Massi, Daniela; Hemmings, Brian A; Mandalà, Mario; Hu, Zhengqiang; Wicki, Andreas; Xue, Gongda

2016-09-20

The transcription factor Twist is an important regulator of cranial suture during embryogenesis. Closure of the neural tube is achieved via Twist-triggered cellular transition from an epithelial to mesenchymal phenotype, a process known as epithelial-mesenchymal transition (EMT), characterized by a remarkable increase in cell motility. In the absence of Twist activity, EMT and associated phenotypic changes in cell morphology and motility can also be induced, albeit moderately, by other transcription factor families, including Snail and Zeb. Aberrant EMT triggered by Twist in human mammary tumour cells was first reported to drive metastasis to the lung in a metastatic breast cancer model. Subsequent analysis of many types of carcinoma demonstrated overexpression of these unique EMT transcription factors, which statistically correlated with worse outcome, indicating their potential as biomarkers in the clinic. However, the mechanisms underlying their activation remain unclear. Interestingly, increasing evidence indicates they are selectively activated by distinct intracellular kinases, thereby acting as downstream effectors facilitating transduction of cytoplasmic signals into nucleus and reprogramming EMT and mesenchymal-epithelial transition (MET) transcription to control cell plasticity. Understanding these relationships and emerging data indicating differential phosphorylation of Twist leads to complex and even paradoxical functionalities, will be vital to unlocking their potential in clinical settings.

Conductive sub-layer of twisted-tape-induced swirl-flow heat transfer in vertical circular tubes with various twisted-tape inserts

NASA Astrophysics Data System (ADS)

Hata, K.; Fukuda, K.; Masuzaki, S.

2018-04-01

Twisted-tape-induced swirl-flow heat transfer due to exponentially increasing heat inputs with various exponential periods ( Q = Q 0 exp(t/τ), τ = 6.04 to 23.07 s) and twisted-tape-induced pressure drop was systematically measured for various mass velocities ( G = 4115 to 13,656 kg/m2 s), inlet liquid temperatures ( T in = 285.88 to 299.09 K), and inlet pressures ( P in = 847.45 to 943.29 kPa) using an experimental water loop flow. Measurements were made over a 59.2-mm effective length and three sections (upper, middle, and lower positions), within which four potential taps were spot-welded onto the outer surface of a 6-mm-inner-diameter, 69.6-mm-heated length, 0.4-mm-thickness platinum circular test tube. Type SUS304 twisted tapes with a width w = 5.6 mm, a thickness δ T = 0.6 mm, a total length l = 372 mm, and twist ratios y = 2.39 and 4.45 were employed in this study. The RANS equations (Reynolds Averaged Navier-Stokes Simulation) with a k-ɛ turbulence model for a circular tube 6 mm in diameter and 636 mm in length were numerically solved for heating of water with a heated section 6 mm in diameter and 70 mm in length using the CFD code, under the same conditions as the experimental ones and considering the temperature dependence of the thermo-physical properties concerned. The theoretical values of surface heat flux q on the circular tubes with twisted tapes with twist ratios y of 2.39 and 4.45 were found to be almost in agreement with the corresponding experimental values of heat flux q, with deviations of less than 30% for the range of temperature difference between the average heater inner surface temperature and the liquid bulk mean temperature ΔT L [ = T s,av - T L , T L = ( T in + T out )/2] considered in this study. The theoretical values of the local surface temperature T s , local average liquid temperature T f,av , and local liquid pressure drop ΔP x were found to be within almost 15% of the corresponding experimental ones. The thickness of the

Sox5 induces epithelial to mesenchymal transition by transactivation of Twist1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pei, Xin-Hong; Department of Pathology, The Basic Medical College of Zhengzhou University, Zhengzhou, Henan; Lv, Xin-Quan

2014-03-28

Highlights: • Depletion of Sox5 inhibits breast cancer proliferation, migration, and invasion. • Sox5 transactivates Twist1 expression. • Sox5 induces epithelial to mesenchymal transition through transactivation of Twist1 expression. - Abstract: The epithelial to mesenchymal transition (EMT), a highly conserved cellular program, plays an important role in normal embryogenesis and cancer metastasis. Twist1, a master regulator of embryonic morphogenesis, is overexpressed in breast cancer and contributes to metastasis by promoting EMT. In exploring the mechanism underlying the increased Twist1 in breast cancer cells, we found that the transcription factor SRY (sex-determining region Y)-box 5(Sox5) is up-regulation in breast cancer cellsmore » and depletion of Sox5 inhibits breast cancer cell proliferation, migration, and invasion. Furthermore, depletion of Sox5 in breast cancer cells caused a dramatic decrease in Twist1 and chromosome immunoprecipitation assay showed that Sox5 can bind directly to the Twist1 promoter, suggesting that Sox5 transactivates Twist1 expression. We further demonstrated that knockdown of Sox5 up-regulated epithelial phenotype cell biomarker (E-cadherin) and down-regulated mesenchymal phenotype cell biomarkers (N-cadherin, Vimentin, and Fibronectin 1), resulting in suppression of EMT. Our study suggests that Sox5 transactivates Twist1 expression and plays an important role in the regulation of breast cancer progression.« less

UHF coplanar-slot antenna for aircraft-to-satellite data communications

NASA Technical Reports Server (NTRS)

Myhre, R. W.

1979-01-01

A lightweight low drag coplanar slot antenna was developed for use on commercial jet aircraft that will provide upper hemisphere coverage in the UHF band at frequencies of 402 and 468 MHz is described. The antenna is designed to transmit meteorological data from wide body jet aircraft to ground users via synchronous meteorological data relay satellites. The low profile antenna (23.5 cm wide by 38.1 cm long slot by 1.9 cm high) is a conformal antenna utilizing the coplanar approach with the advantages of broad frequency bandwidth and improved electrical integrity over wide range of temperature. The antenna is circular polarized, has anon axis gain of near +2.5 dB, and a HPBW greater than 90 deg. Areas discussed include antenna design, radiation characteristics, flight testing, and system performance.

Extension-twist coupling of composite circular tubes with application to tilt rotor blade design

NASA Technical Reports Server (NTRS)

Nixon, Mark W.

1987-01-01

This investigation was conducted to determine if twist deformation required for the design of full-scale extension-twist-coupled tilt-rotor blades can be achieved within material design limit loads, and to demonstrate the accuracy of a coupled-beam analysis in predicting twist deformations. Two extension-twist-coupled tilt-rotor blade designs were developed based on theoretically optimum aerodynamic twist distributions. The designs indicated a twist rate requirement of between .216 and .333 deg/in. Agreement between axial tests and analytical predictions was within 10 percent at design limit loads. Agreement between the torsion tests and predictions was within 11 percent.

Photo-switchable bistable twisted nematic liquid crystal optical switch.

PubMed

Wang, Chun-Ta; Wu, Yueh-Chi; Lin, Tsung-Hsien

2013-02-25

This work demonstrates a photo-switchable bistable optical switch that is based on an azo-chiral doped liquid crystal (ACDLC). The photo-induced isomerization of the azo-chiral dopant can change the chirality of twisted nematic liquid crystal and the gap/pitch ratio of an ACDLC device, enabling switching between 0° and 180° twist states in a homogeneous aligned cell. The bistable 180° and 0° twist states of the azo-chiral doped liquid crystal between crossed polarizers correspond to the ON and OFF states of a light shutter, respectively, and they can be maintained stably for tens of hours. Rapid switching between 180° and 0° twist states can be carried out using 408 and 532 nm addressing light. Such a photo-controllable optical switch requires no specific asymmetric alignment layer or precise control of the cell gap/pitch ratio, so it is easily fabricated and has the potential for use in optical systems.

PARTIAL ERUPTION OF A FILAMENT WITH TWISTING NON-UNIFORM FIELDS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bi, Yi; Jiang, Yunchun; Yang, Jiayan

The eruption of a filament in a kinklike fashion is often regarded as a signature of kink instability. However, the kink instability threshold for the filament’s magnetic structure is not widely understood. Using Hα observations from the New Vacuum Solar Telescope, we present a partial eruptive filament. During the eruption, the filament thread appeared to split from its middle and to break out in a kinklike fashion. In this period, the remaining filament material stayed below and erupted without the kinking motion later on. The coronal magnetic field lines associated with the filament are obtained from nonlinear force-free field extrapolationsmore » using the twelve-minute-cadence vector magnetograms of the Helioseismic and Magnetic Imager (HMI) on board the Solar Dynamic Observatory. We studied the extrapolated field lines passing through the magnetic dips which are in good agreement with the observed filament. The field lines are non-uniformly twisted and appear to be composed of two twisted flux ropes winding around each other. One of them has a higher twist than the other, and the flux rope with the higher twist has its dips aligned with the kinking eruptive thread at the beginning of its eruption. Before the eruption, moreover, the flux rope with the higher twist was found to expand with an approximately constant field twist. In addition, the helicity flux maps deduced from the HMI magnetograms show that some helicity is injected into the overlying magnetic arcade, but no significant helicity is injected into the flux ropes. Accordingly, we suggest that the highly twisted flux rope became kink unstable when the instability threshold declined with the expansion of the flux rope.« less

Geometric Constraints and the Anatomical Interpretation of Twisted Plant Organ Phenotypes

PubMed Central

Weizbauer, Renate; Peters, Winfried S.; Schulz, Burkhard

2011-01-01

The study of plant mutants with twisting growth in axial organs, which normally grow straight in the wild-type, is expected to improve our understanding of the interplay among microtubules, cellulose biosynthesis, cell wall structure, and organ biomechanics that control organ growth and morphogenesis. However, geometric constraints based on symplastic growth and the consequences of these geometric constraints concerning interpretations of twisted-organ phenotypes are currently underestimated. Symplastic growth, a fundamental concept in plant developmental biology, is characterized by coordinated growth of adjacent cells based on their connectivity through cell walls. This growth behavior implies that in twisting axial organs, all cell files rotate in phase around the organ axis, as has been illustrated for the Arabidopsis spr1 and twd1 mutants in this work. Evaluating the geometry of such organs, we demonstrate that a radial gradient in cell elongation and changes in cellular growth anisotropy must occur in twisting organs out of geometric necessity alone. In-phase rotation of the different cell layers results in a decrease of length and angle toward organ axis from the outer cell layers inward. Additionally, the circumference of each cell layer increases in twisting organs, which requires compensation through radial expansion or an adjustment of cell number. Therefore, differential cell elongation and growth anisotropy cannot serve as arguments for or against specific hypotheses regarding the molecular cause of twisting growth. We suggest instead, that based on mathematical modeling, geometric constraints in twisting organs are indispensable for the explanation of the causal connection of molecular and biomechanical processes in twisting as well as normal organs. PMID:22645544

Composite material bend-twist coupling for wind turbine blade applications

NASA Astrophysics Data System (ADS)

Walsh, Justin M.

Current efforts in wind turbine blade design seek to employ bend-twist coupling of composite materials for passive power control by twisting blades to feather. Past efforts in this area of study have proved to be problematic, especially in formulation of the bend-twist coupling coefficient alpha. Kevlar/epoxy, carbon/epoxy and glass/epoxy specimens were manufactured to study bend-twist coupling, from which numerical and analytical models could be verified. Finite element analysis was implemented to evaluate fiber orientation and material property effects on coupling magnitude. An analytical/empirical model was then derived to describe numerical results and serve as a replacement for the commonly used coupling coefficient alpha. Through the results from numerical and analytical models, a foundation for aeroelastic design of wind turbines blades utilizing biased composite materials is provided.

Wear characteristics of UHMW polyethylene by twist method

NASA Astrophysics Data System (ADS)

Chișiu, G.; Popescu, A. M.; Tudor, A.; Petrescu, A. M.; Stoica, G. F.; Subhi, K. A.

2018-01-01

A wear test of the twist movement was performed as a new method to estimate the in vivo wear behavior of an acetabular cup material for total knee replacements. A series of UHMWPE samples was used to evaluate the dynamic coefficient of friction in twist movement in contact with steel. The experimental data were conducted to validate the related theoretical model developed in the present study.

Lightning flash density versus altitude and storm structure from observations with UHF- and S-band radars

NASA Technical Reports Server (NTRS)

Mazur, V.; Gerlach, J. C.; Rust, W. D.

1984-01-01

The UHF-(70.5 cm wavelength) and S-band (10 cm wavelength) radar at NASA/Wallops Island Research Facility in Virginia, U.S.A. have been used to relate lightning activity with altitude and with the reflectivity structure of thunderstorms. Two centers of lightning flash density were found; one between 6 and 8 km altitude and another between 11 and 15 km. Previously announced in STAR as N83-31206

Chirality-controlled spontaneous twisting of crystals due to thermal topochemical reaction.

PubMed

Rai, Rishika; Krishnan, Baiju P; Sureshan, Kana M

2018-03-20

Crystals that show mechanical response against various stimuli are of great interest. These stimuli induce polymorphic transitions, isomerizations, or chemical reactions in the crystal and the strain generated between the daughter and parent domains is transcribed into mechanical response. We observed that the crystals of modified dipeptide LL (N 3 -l-Ala-l-Val-NHCH 2 C≡CH) undergo spontaneous twisting to form right-handed twisted crystals not only at room temperature but also at 0 °C over time. Using various spectroscopic techniques, we have established that the twisting is due to the spontaneous topochemical azide-alkyne cycloaddition (TAAC) reaction at room temperature or lower temperatures. The rate of twisting can be increased by heating, exploiting the faster kinetics of the TAAC reaction at higher temperatures. To address the role of molecular chirality in the direction of twisting the enantiomer of dipeptide LL, N 3 -d-Ala-d-Val-NHCH 2 C≡CH (DD), was synthesized and topochemical reactivity and mechanoresponse of its crystals were studied. We have found that dipeptide DD not only underwent TAAC reaction, giving 1,4-triazole-linked pseudopolypeptides of d-amino acids, but also underwent twisting with opposite handedness (left-handed twisting), establishing the role of molecular chirality in controlling the direction of mechanoresponse. This paper reports ( i ) a mechanical response due to a thermal reaction and ( ii ) a spontaneous mechanical response in crystals and ( iii ) explains the role of molecular chirality in the handedness of the macroscopic mechanical response.

Electron density inversed by plasma lines induced by suprathermal electron in the ionospheric modification experiment

NASA Astrophysics Data System (ADS)

Wang, Xiang; Zhou, Chen

2018-05-01

Incoherent scatter radar (ISR) is the most powerful ground-based measurement facility to study the ionosphere. The plasma lines are not routinely detected by the incoherent scatter radar due to the low intensity, which falls below the measured spectral noise level of the incoherent scatter radar. The plasma lines are occasionally enhanced by suprathermal electrons through the Landau damping process and detectable to the incoherent scatter radar. In this study, by using the European Incoherent Scatter Association (EISCAT) UHF incoherent scatter radar, the experiment observation presents that the enhanced plasma lines were observed. These plasma lines were considered as manifest of the suprathermal electrons generated by the high-frequency heating wave during the ionospheric modification. The electron density profile is also obtained from the enhanced plasma lines. This study can be a promising technique for obtaining the accurate electron density during ionospheric modification experiment.

On the twists of interplanetary magnetic flux ropes observed at 1 AU

NASA Astrophysics Data System (ADS)

Wang, Yuming; Zhuang, Bin; Hu, Qiang; Liu, Rui; Shen, Chenglong; Chi, Yutian

2016-10-01

Magnetic flux ropes (MFRs) are one kind of fundamental structures in the solar/space physics and involved in various eruption phenomena. Twist, characterizing how the magnetic field lines wind around a main axis, is an intrinsic property of MFRs, closely related to the magnetic free energy and stableness. Although the effect of the twist on the behavior of MFRs had been widely studied in observations, theory, modeling, and numerical simulations, it is still unclear how much amount of twist is carried by MFRs in the solar atmosphere and in heliosphere and what role the twist played in the eruptions of MFRs. Contrasting to the solar MFRs, there are lots of in situ measurements of magnetic clouds (MCs), the large-scale MFRs in interplanetary space, providing some important information of the twist of MFRs. Thus, starting from MCs, we investigate the twist of interplanetary MFRs with the aid of a velocity-modified uniform-twist force-free flux rope model. It is found that most of MCs can be roughly fitted by the model and nearly half of them can be fitted fairly well though the derived twist is probably overestimated by a factor of 2.5. By applying the model to 115 MCs observed at 1 AU, we find that (1) the twist angles of interplanetary MFRs generally follow a trend of about 0.6l/R radians, where l/R is the aspect ratio of a MFR, with a cutoff at about 12π radians AU-1, (2) most of them are significantly larger than 2.5π radians but well bounded by 2l/R radians, (3) strongly twisted magnetic field lines probably limit the expansion and size of MFRs, and (4) the magnetic field lines in the legs wind more tightly than those in the leading part of MFRs. These results not only advance our understanding of the properties and behavior of interplanetary MFRs but also shed light on the formation and eruption of MFRs in the solar atmosphere. A discussion about the twist and stableness of solar MFRs are therefore given.

Raman spectroscopy measurement of bilayer graphene's twist angle to boron nitride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Bin; Wang, Peng; Pan, Cheng

2015-07-20

When graphene is placed on hexagonal boron nitride with a twist angle, new properties develop due to the resulting moiré superlattice. Here, we report a method using Raman spectroscopy to make rapid, non-destructive measurements of the twist angle between bilayer graphene and hexagonal boron nitride. The lattice orientation is determined by using flakes with both bilayer and monolayer regions, and using the known Raman signature for the monolayer to measure the twist angle of the entire flake. The widths of the second order Raman peaks are found to vary linearly in the superlattice period and are used to determine themore » twist angle. The results are confirmed by using transport measurements to infer the superlattice period by the charge density required to reach the secondary resistance peaks. Small twist angles are also found to produce a significant modification of the first order Raman G band peak.« less

Bend-Twist Coupled Carbon-Fiber Laminate Beams: Fundamental Behavior and Applications

NASA Astrophysics Data System (ADS)

Babuska, Pavel

Material-induced bend-twist coupling in laminated composite beams has seen applications in engineered structures for decades, ranging from airplane wings to turbine blades. Symmetric, unbalanced, carbon fiber laminates which exhibit bend-twist coupling can be difficult to characterize and exhibit unintuitive deformation states which may pose challenges to the engineer. In this thesis, bend-twist coupled beams are investigated comprehensively, by experimentation, numerical modeling, and analytical methods. Beams of varying fiber angle and amount of coupling were manufactured and physically tested in both linear and nonlinear static and dynamic settings. Analytical mass and stiffness matrices were derived for the development of a beam element to use in the stiffness matrix analysis method. Additionally, an ABAQUS finite element model was used in conjunction with the analytical methods to predict and further characterize the behavior of the beams. The three regimes, experimental, analytical, and numerical, represent a full-field characterization of bend-twist coupling in composite beams. A notable application of bend-twist coupled composites is for passively adaptive turbine blades whereby the deformation coupling can be built into the blade structure to simultaneously bend and twist, thus pitching the blade into or away from the fluid flow, changing the blade angle of attack. Passive pitch adaptation has been implemented successfully in wind turbine blades, however, for marine turbine blades, the technology is still in the development phase. Bend-twist coupling has been shown numerically to be beneficial to the tidal turbine performance, however little validation has been conducted in the experimental regime. In this thesis, passively adaptive experiment scale tidal turbine blades were designed, analyzed, manufactured, and physically tested, validating the foundational numerical work. It was shown that blade forces and root moments as well as turbine thrust and power

Twist promotes tumor metastasis in basal-like breast cancer by transcriptionally upregulating ROR1.

PubMed

Cao, Jingying; Wang, Xin; Dai, Tao; Wu, Yuanzhong; Zhang, Meifang; Cao, Renxian; Zhang, Ruhua; Wang, Gang; Jiang, Rou; Zhou, Binhua P; Shi, Jian; Kang, Tiebang

2018-01-01

Rationale: Twist is a key transcription factor for induction of epithelial-mesenchymal transition (EMT), which promotes cell migration, invasion, and cancer metastasis, confers cancer cells with stem cell-like characteristics, and provides therapeutic resistance. However, the functional roles and targeted genes of Twist in EMT and cancer progression remain elusive. Methods: The potential targeted genes of Twist were identified from the global transcriptomes of T47D/Twist cells by microarray analysis. EMT phenotype was detected by western blotting and immunofluorescence of marker proteins. The dual-luciferase reporter and chromatin immunoprecipitation assays were employed to observe the direct transcriptional induction of ROR1 by Twist. A lung metastasis model was used to study the pro-metastatic role of Twist and ROR1 by injecting MDA-MB-231 cells into tail vein of nude mice. Bio-informatics analysis was utilized to measure the metastasis-free survival of breast cancer patients. Results: Twist protein was proved to directly activate the transcription of ROR1 gene, a receptor of Wnt5a in non-canonical WNT signaling pathway. Silencing of ROR1 inhibited EMT process, cell migration, invasion, and cancer metastasis of basal-like breast cancer (BLBC) cells. Knockdown of ROR1 also ameliorated the pro-metastatic effect of Twist. Furthermore, analyses of clinical specimens indicated that high expression of both ROR1 and Twist tightly correlates with poor metastasis-free survival of breast cancer patients. Conclusion: ROR1 is a targeted gene of Twist. Twist/ROR1 signaling is critical for invasion and metastasis of BLBC cells.

A Geometric Construction of Cyclic Cocycles on Twisted Convolution Algebras

NASA Astrophysics Data System (ADS)

Angel, Eitan

2010-09-01

In this thesis we give a construction of cyclic cocycles on convolution algebras twisted by gerbes over discrete translation groupoids. In his seminal book, Connes constructs a map from the equivariant cohomology of a manifold carrying the action of a discrete group into the periodic cyclic cohomology of the associated convolution algebra. Furthermore, for proper étale groupoids, J.-L. Tu and P. Xu provide a map between the periodic cyclic cohomology of a gerbe twisted convolution algebra and twisted cohomology groups. Our focus will be the convolution algebra with a product defined by a gerbe over a discrete translation groupoid. When the action is not proper, we cannot construct an invariant connection on the gerbe; therefore to study this algebra, we instead develop simplicial notions related to ideas of J. Dupont to construct a simplicial form representing the Dixmier-Douady class of the gerbe. Then by using a JLO formula we define a morphism from a simplicial complex twisted by this simplicial Dixmier-Douady form to the mixed bicomplex of certain matrix algebras. Finally, we define a morphism from this complex to the mixed bicomplex computing the periodic cyclic cohomology of the twisted convolution algebras.

Finite element and analytical models for twisted and coiled actuator

NASA Astrophysics Data System (ADS)

Tang, Xintian; Liu, Yingxiang; Li, Kai; Chen, Weishan; Zhao, Jianguo

2018-01-01

Twisted and coiled actuator (TCA) is a class of recently discovered artificial muscle, which is usually made by twisting and coiling polymer fibers into spring-like structures. It has been widely studied since discovery due to its impressive output characteristics and bright prospects. However, its mathematical models describing the actuation in response to the temperature are still not fully developed. It is known that the large tensile stroke is resulted from the untwisting of the twisted fiber when heated. Thus, the recovered torque during untwisting is a key parameter in the mathematical model. This paper presents a simplified model for the recovered torque of TCA. Finite element method is used for evaluating the thermal stress of the twisted fiber. Based on the results of the finite element analyses, the constitutive equations of twisted fibers are simplified to develop an analytic model of the recovered torque. Finally, the model of the recovered torque is used to predict the deformation of TCA under varying temperatures and validated against experimental results. This work will enhance our understanding of the deformation mechanism of TCAs, which will pave the way for the closed-loop position control.

The Physics of Twisted Magnetic Tubes Rising in a Stratified Medium: Two-dimensional Results

NASA Astrophysics Data System (ADS)

Emonet, T.; Moreno-Insertis, F.

1998-01-01

The physics of a twisted magnetic flux tube rising in a stratified medium is studied using a numerical magnetohydrodynamic (MHD) code. The problem considered is fully compressible (has no Boussinesq approximation), includes ohmic resistivity, and is two-dimensional, i.e., there is no variation of the variables in the direction of the tube axis. We study a high-plasma β-case with a small ratio of radius to external pressure scale height. The results obtained will therefore be of relevance to understanding the transport of magnetic flux across the solar convection zone. We confirm that a sufficient twist of the field lines around the tube axis can suppress the conversion of the tube into two vortex rolls. For a tube with a relative density deficit on the order of 1/β (the classical Parker buoyancy) and a radius smaller than the pressure scale height (R2<twist necessary corresponds to an average pitch angle on the order of sin-1 [(R/Hp)1/2]. The evolution of a tube with this degree of twist is studied in detail, including the initial transient phase, the internal torsional oscillations, and the asymptotic, quasi-stationary phase. During the initial phase, the outermost, weakly magnetized layers of the tube are torn off its main body and endowed with vorticity. They yield a trailing magnetized wake with two vortex rolls. The fraction of the total magnetic flux that is brought to the wake is a function of the initial degree of twist. In the weakly twisted case, most of the initial tube is turned into vortex rolls. With a strong initial twist, the tube rises with only a small deformation and no substantial loss of magnetic flux. The formation of the wake and the loss of flux from the main body of the tube are basically complete after the initial transient phase. A sharp interface between the tube interior and the external flows is formed at the tube front and sides; this area has the characteristic features of a magnetic boundary layer. Its

Alternative approaches to plasma confinement

NASA Technical Reports Server (NTRS)

Roth, J. R.

1978-01-01

The paper discusses 20 plasma confinement schemes each representing an alternative to the tokamak fusion reactor. Attention is given to: (1) tokamak-like devices (TORMAC, Topolotron, and the Extrap concept), (2) stellarator-like devices (Torsatron and twisted-coil stellarators), (3) mirror machines (Astron and reversed-field devices, the 2XII B experiment, laser-heated solenoids, the LITE experiment, the Kaktus-Surmac concept), (4) bumpy tori (hot electron bumpy torus, toroidal minimum-B configurations), (5) electrostatically assisted confinement (electrostatically stuffed cusps and mirrors, electrostatically assisted toroidal confinement), (6) the Migma concept, and (7) wall-confined plasmas. The plasma parameters of the devices are presented and the advantages and disadvantages of each are listed.

Design of a Miniaturized Meandered Line Antenna for UHF RFID Tags

PubMed Central

Islam, Mohammad Tariqul; Rowe, Wayne S. T.; Kibria, Salehin; Jit Singh, Mandeep; Misran, Norbahiah

2016-01-01

A semi-circle looped vertically omnidirectional radiation (VOR) patterned tag antenna for UHF (919–923 MHz for Malaysia) frequency is designed to overcome the impedance mismatch issue in this paper. Two impedance matching feeding strips are used in the antenna structure to tune the input impedance of the antenna. Two dipole shaped meandered lines are used to achieve a VOR pattern. The proposed antenna is designed for 23-j224 Ω chip impedance. The antenna is suitable for ‘place and tag’ application. A small size of 77.68×35.5 mm2 is achieved for a read range performance of 8.3 meters using Malaysia regulated maximum power transfer of 2.0 W effective radiated power (ERP). PMID:27533470

Experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers

NASA Astrophysics Data System (ADS)

Yin, Long-Jing; Qiao, Jia-Bin; Zuo, Wei-Jie; Li, Wen-Tian; He, Lin

2015-08-01

Non-Abelian gauge potentials are quite relevant in subatomic physics, but they are relatively rare in a condensed matter context. Here we report the experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers by scanning tunneling microscopy and spectroscopy. At a magic twisted angle, θ ≈(1.11±0.05 ) ∘ , a pronounced sharp peak, which arises from the nondispersive flat bands at the charge neutrality point, is observed in the tunneling density of states due to the action of the non-Abelian gauge fields. Moreover, we observe confined electronic states in the twisted bilayer, as manifested by regularly spaced tunneling peaks with energy spacing δ E ≈vF/D ≈70 meV (here vF is the Fermi velocity of graphene and D is the period of the moiré patterns). This indicates that the non-Abelian gauge potentials in twisted graphene bilayers confine low-energy electrons into a triangular array of quantum dots following the modulation of the moiré patterns. Our results also directly demonstrate that the Fermi velocity in twisted bilayers can be tuned from about 106m /s to zero by simply reducing the twisted angle of about 2∘.

SAR exposure from UHF RFID reader in adult, child, pregnant woman, and fetus anatomical models.

PubMed

Fiocchi, Serena; Markakis, Ioannis A; Ravazzani, Paolo; Samaras, Theodoros

2013-09-01

The spread of radio frequency identification (RFID) devices in ubiquitous applications without their simultaneous exposure assessment could give rise to public concerns about their potential adverse health effects. Among the various RFID system categories, the ultra high frequency (UHF) RFID systems have recently started to be widely used in many applications. This study addresses a computational exposure assessment of the electromagnetic radiation generated by a realistic UHF RFID reader, quantifying the exposure levels in different exposure scenarios and subjects (two adults, four children, and two anatomical models of women 7 and 9 months pregnant). The results of the computations are presented in terms of the whole-body and peak spatial specific absorption rate (SAR) averaged over 10 g of tissue to allow comparison with the basic restrictions of the exposure guidelines. The SAR levels in the adults and children were below 0.02 and 0.8 W/kg in whole-body SAR and maximum peak SAR levels, respectively, for all tested positions of the antenna. On the contrary, exposure of pregnant women and fetuses resulted in maximum peak SAR(10 g) values close to the values suggested by the guidelines (2 W/kg) in some of the exposure scenarios with the antenna positioned in front of the abdomen and with a 100% duty cycle and 1 W radiated power. Copyright © 2013 Wiley Periodicals, Inc.

A Transformation Called "Twist"

ERIC Educational Resources Information Center

Hwang, Daniel

2010-01-01

The transformations found in secondary mathematics curriculum are typically limited to stretches and translations (e.g., ACARA, 2010). Advanced students may find the transformation, twist, to be of further interest. As most available resources are written for professional-level readers, this article is intended to be an introduction accessible to…

Twisted Quantum Lax Equations

NASA Astrophysics Data System (ADS)

Jurčo, Branislav; Schupp, Peter

We show the construction of twisted quantum Lax equations associated with quantum groups, and solve these equations using factorization properties of the corresponding quantum groups. Our construction generalizes in many respects the AKS construction for Lie groups and the construction of M. A. Semenov-Tian-Shansky for the Lie-Poisson case.

A Martian Telecommunications Network: UHF Relay Support of the Mars Exploration Rovers by the Mars Global Surveyor, Mars Odyssey, and Mars Express Orbiters

NASA Technical Reports Server (NTRS)

Edwards, Charles D., Jr.; Barbieri, A.; Brower, E.; Estabrook, P.; Gibbs, R.; Horttor, R.; Ludwinski, J.; Mase, R.; McCarthy, C.; Schmidt, R.;

TWIST1-WDR5-Hottip regulates Hoxa9 chromatin to facilitate prostate cancer metastasis

PubMed Central

Malek, Reem; Gajula, Rajendra P.; Williams, Russell D.; Nghiem, Belinda; Simons, Brian W.; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R.; True, Lawrence; An, Steven S.; DeWeese, Theodore L.; Ross, Ashley E.; Schaeffer, Edward M.; Pienta, Kenneth J.; Hurley, Paula J.; Morrissey, Colm; Tran, Phuoc T.

2017-01-01

TWIST1 is a transcription factor critical for development which can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are co-expressed in mouse prostate and then silenced post-natally. Here we report that TWIST1 and HOXA9 co-expression are re-activated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to co-enrichment of TWIST1 and WDR5 as well increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacological inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo. This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. PMID:28484075

Optimal flapping wing for maximum vertical aerodynamic force in hover: twisted or flat?

PubMed

Phan, Hoang Vu; Truong, Quang Tri; Au, Thi Kim Loan; Park, Hoon Cheol

2016-07-08

This work presents a parametric study, using the unsteady blade element theory, to investigate the role of twist in a hovering flapping wing. For the investigation, a flapping-wing system was developed to create a wing motion of large flapping amplitude. Three-dimensional kinematics of a passively twisted wing, which is capable of creating a linearly variable geometric angle of attack (AoA) along the wingspan, was measured during the flapping motion and used for the analysis. Several negative twist or wash-out configurations with different values of twist angle, which is defined as the difference in the average geometric AoAs at the wing root and the wing tip, were obtained from the measured wing kinematics through linear interpolation and extrapolation. The aerodynamic force generation and aerodynamic power consumption of these twisted wings were obtained and compared with those of flat wings. For the same aerodynamic power consumption, the vertical aerodynamic forces produced by the negatively twisted wings are approximately 10%-20% less than those produced by the flat wings. However, these twisted wings require approximately 1%-6% more power than flat wings to produce the same vertical force. In addition, the maximum-force-producing twisted wing, which was found to be the positive twist or wash-in configuration, was used for comparison with the maximum-force-producing flat wing. The results revealed that the vertical aerodynamic force and aerodynamic power consumption of the two types of wings are almost identical for the hovering condition. The power loading of the positively twisted wing is only approximately 2% higher than that of the maximum-force-producing flat wing. Thus, the flat wing with proper wing kinematics (or wing rotation) can be regarded as a simple and efficient candidate for the development of hovering flapping-wing micro air vehicle.

NASA Standard Initiator Susceptibility to UHF and S-Band Radio Frequency Power and Lightning Strikes

NASA Technical Reports Server (NTRS)

Burnham, Karen; Scully, Robert; Norgard, John

2013-01-01

The NASA Standard Initiator (NSI) is an important piece of pyrotechnic equipment used in many space applications. This presentation will outline the results of a series of tests done at UHF and S-Band frequencies to determine NSI susceptibility to Radio Frequency (RF) power. The results show significant susceptibility to pulsed RF power in the S-Band region. Additional testing with lightning pulses injected into the firing line harness, modelling the indirect effects of a lightning strike to a spacecraft, showed no vulnerability

NASA Standard Initiator Susceptibility to UHF and S-Band Radio Frequency Power and Lightning Strikes

NASA Technical Reports Server (NTRS)

Burnham, Karen; Scully, Robert C.; Norgard, John D.

2013-01-01

The NASA Standard Initiator (NSI) is an important piece of pyrotechnic equipment used in many space applications. This paper outlines the results of a series of tests done at UHF and S-Band frequencies to determine NSI susceptibility to Radio Frequency (RF) power. The results show significant susceptibility to pulsed RF power in the S-Band region. Additional testing with lightning pulses injected into the firing line harness, modelling the indirect effects of a lightning strike to a spacecraft, showed no vulnerability.

Design optimization for active twist rotor blades

NASA Astrophysics Data System (ADS)

Mok, Ji Won

This dissertation introduces the process of optimizing active twist rotor blades in the presence of embedded anisotropic piezo-composite actuators. Optimum design of active twist blades is a complex task, since it involves a rich design space with tightly coupled design variables. The study presents the development of an optimization framework for active helicopter rotor blade cross-sectional design. This optimization framework allows for exploring a rich and highly nonlinear design space in order to optimize the active twist rotor blades. Different analytical components are combined in the framework: cross-sectional analysis (UM/VABS), an automated mesh generator, a beam solver (DYMORE), a three-dimensional local strain recovery module, and a gradient based optimizer within MATLAB. Through the mathematical optimization problem, the static twist actuation performance of a blade is maximized while satisfying a series of blade constraints. These constraints are associated with locations of the center of gravity and elastic axis, blade mass per unit span, fundamental rotating blade frequencies, and the blade strength based on local three-dimensional strain fields under worst loading conditions. Through pre-processing, limitations of the proposed process have been studied. When limitations were detected, resolution strategies were proposed. These include mesh overlapping, element distortion, trailing edge tab modeling, electrode modeling and foam implementation of the mesh generator, and the initial point sensibility of the current optimization scheme. Examples demonstrate the effectiveness of this process. Optimization studies were performed on the NASA/Army/MIT ATR blade case. Even though that design was built and shown significant impact in vibration reduction, the proposed optimization process showed that the design could be improved significantly. The second example, based on a model scale of the AH-64D Apache blade, emphasized the capability of this framework to

Large ionospheric disturbances produced by the HAARP HF facility

NASA Astrophysics Data System (ADS)

Bernhardt, Paul A.; Siefring, Carl L.; Briczinski, Stanley J.; McCarrick, Mike; Michell, Robert G.

2016-07-01

The enormous transmitter power, fully programmable antenna array, and agile frequency generation of the High Frequency Active Auroral Research Program (HAARP) facility in Alaska have allowed the production of unprecedented disturbances in the ionosphere. Using both pencil beams and conical (or twisted) beam transmissions, artificial ionization clouds have been generated near the second, third, fourth, and sixth harmonics of the electron gyrofrequency. The conical beam has been used to sustain these clouds for up to 5 h as opposed to less than 30 min durations produced using pencil beams. The largest density plasma clouds have been produced at the highest harmonic transmissions. Satellite radio transmissions at 253 MHz from the National Research Laboratory TACSat4 communications experiment have been severely disturbed by propagating through artificial plasma regions. The scintillation levels for UHF waves passing through artificial ionization clouds from HAARP are typically 16 dB. This is much larger than previously reported scintillations at other HF facilities which have been limited to 3 dB or less. The goals of future HAARP experiments should be to build on these discoveries to sustain plasma densities larger than that of the background ionosphere for use as ionospheric reflectors of radio signals.

Au-coated tilted fiber Bragg grating twist sensor based on surface plasmon resonance

NASA Astrophysics Data System (ADS)

Shen, Changyu; Zhang, Yang; Zhou, Wenjun; Albert, Jacques

2014-02-01

A fiber twist sensor based on the surface plasmon resonance (SPR) effect of an Au-coated tilted fiber Bragg grating (TFBG) is proposed. The SPR response to the twist effect on an Au-coated TFBG (immersing in distilled water) is studied theoretically and experimentally. The results show that the transmission power around the wavelength of SPR changes with the twist angle. For the twist ranging from 0° to 180° in clockwise or anti-clockwise directions, the proposed sensor shows sensitivities of 0.037 dBm/° (S-polarized) and 0.039 dBm/° (P-polarized), which are almost 7.5 times higher than that of the current similar existing twist sensor.

New dualities and misleading anomaly matchings from outer-automorphism twists

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pal, Sridip; Song, Jaewon

We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

New dualities and misleading anomaly matchings from outer-automorphism twists

DOE PAGES

Pal, Sridip; Song, Jaewon

2017-03-29

We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

Fermion number of twisted kinks in the NJL2 model revisited

NASA Astrophysics Data System (ADS)

Thies, Michael

2018-03-01

As a consequence of axial current conservation, fermions cannot be bound in localized lumps in the massless Nambu-Jona-Lasinio model. In the case of twisted kinks, this manifests itself in a cancellation between the valence fermion density and the fermion density induced in the Dirac sea. To attribute the correct fermion number to these bound states requires an infrared regularization. Recently, this has been achieved by introducing a bare fermion mass, at least in the nonrelativistic regime of small twist angles and fermion numbers. Here, we propose a simpler regularization using a finite box which preserves integrability and can be applied at any twist angle. A consistent and physically plausible assignment of fermion number to all twisted kinks emerges.

Shape of the terrestrial plasma sheet in the near-Earth magnetospheric tail as imaged by the Interstellar Boundary Explorer

DOE PAGES

Dayeh, M. A.; Fuselier, S. A.; Funsten, H. O.; ...

2015-04-11

We present remote, continuous observations from the Interstellar Boundary Explorer of the terrestrial plasma sheet location back to -16 Earth radii (R E) in the magnetospheric tail using energetic neutral atom emissions. The time period studied includes two orbits near the winter and summer solstices, thus associated with large negative and positive dipole tilt, respectively. Continuous side-view images reveal a complex shape that is dominated mainly by large-scale warping due to the diurnal motion of the dipole axis. Superposed on the global warped geometry are short-time fluctuations in plasma sheet location that appear to be consistent with plasma sheet flappingmore » and possibly twisting due to changes in the interplanetary conditions. We conclude that the plasma sheet warping due to the diurnal motion dominates the average shape of the plasma sheet. Over short times, the position of the plasma sheet can be dominated by twisting and flapping.« less

Twisting failure of centrally loaded open-section columns in the elastic range

NASA Technical Reports Server (NTRS)

Kappus, Robert

1938-01-01

In the following report a complete theory of twisting failure by the energy method is developed, based on substantially the same assumptions as those employed by Wagner and Bleich. Problems treated in detail are: the stress and strain condition under St. Venant twist and in twist with axial constraint; the concept of shear center and the energy method for problems of elastic stability.

TWIST1-WDR5-Hottip Regulates Hoxa9 Chromatin to Facilitate Prostate Cancer Metastasis.

PubMed

Malek, Reem; Gajula, Rajendra P; Williams, Russell D; Nghiem, Belinda; Simons, Brian W; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R; True, Lawrence; An, Steven S; DeWeese, Theodore L; Ross, Ashley E; Schaeffer, Edward M; Pienta, Kenneth J; Hurley, Paula J; Morrissey, Colm; Tran, Phuoc T

2017-06-15

TWIST1 is a transcription factor critical for development that can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are coexpressed in mouse prostate and then silenced postnatally. Here we report that TWIST1 and HOXA9 coexpression are reactivated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to coenrichment of TWIST1 and WDR5 as well as increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter, which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacologic inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. Cancer Res; 77(12); 3181-93. ©2017 AACR . ©2017 American Association for Cancer Research.

Slug, Twist, and E-Cadherin as Immunohistochemical Biomarkers in Meningeal Tumors

PubMed Central

Nagaishi, Masaya; Nobusawa, Sumihito; Tanaka, Yuko; Ikota, Hayato; Yokoo, Hideaki; Nakazato, Yoichi

2012-01-01

The overexpression of Twist and Slug and subsequent down-regulation of E-cadherin facilitate the acquirement of invasive growth properties in cancer cells. It is unclear which of these molecules are expressed in mesenchymal tumors in the central nervous system. Here, we investigated 10 cases each of hemangiopericytoma, solitary fibrous tumor, meningothelial, fibrous, angiomatous, and atypical meningiomas, and 5 cases of anaplastic meningioma for Slug, Twist, E-cadherin, and N-cadherin immunoexpression. Nuclear Slug expression was observed in 9/10 (90%) hemangiopericytomas and 5/10 (50%) solitary fibrous tumors, but not in any meningiomas, except for 1 case. Similarly, nuclear Twist expression was more extensive in hemangiopericytomas and solitary fibrous tumors than meningiomas. In contrast to Slug and Twist, the positive expression of E-cadherin was observed in 39/45 (87%) meningiomas, but not in any hemangiopericytomas or solitary fibrous tumors (P<0.0001). The fraction of tumor cells expressing E-cadherin in meningeal tumors was negatively correlated to those of Twist (P = 0.004) and Slug (P<0.0001). The overexpression of Slug and Twist with down-regulation of E-cadherin was characteristic findings in hemangiopericytomas and solitary fibrous tumors, but not in meningiomas. The immunohistochemical profiles of the two tumor groups may be useful as diagnostic markers in cases that present a differential diagnosis challenge. PMID:23029385

Designing Polyamide Inhibitors of TWIST 1 for Prosenescence Therapy

DTIC Science & Technology

2014-09-01

Pyrrole -Imidazole Polyamides; TWIST1; KRAS; non-small cell lung cancer (NSCLC); senescence 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF... Pyrrole -Imidazole Polyamides (PIP) are a class of cell permeable programmable small-molecule heterocyclic amino acid oligomers that can be designed...The original specific aims are below: Specific Aim#1. Design and synthesize a TWIST1-inhibitory specific Pyrrole -Imidazole Polyamides (PIP

Rayleigh scattering of twisted light by hydrogenlike ions

NASA Astrophysics Data System (ADS)

Peshkov, A. A.; Volotka, A. V.; Surzhykov, A.; Fritzsche, S.

2018-02-01

The elastic Rayleigh scattering of twisted light and, in particular, the polarization (transfer) of the scattered photons have been analyzed within the framework of second-order perturbation theory and Dirac's relativistic equation. Special attention was paid hereby to the scattering on three different atomic targets: single atoms, a mesoscopic (small) target, and a macroscopic (large) target, which are all centered with regard to the beam axis. Detailed calculations of the polarization Stokes parameters were performed for C5 + ions and for twisted Bessel beams. It is shown that the polarization of scattered photons is sensitive to the size of an atomic target and to the helicity, the opening angle, and the projection of the total angular momentum of the incident Bessel beam. These computations indicate more that the Stokes parameters of the (Rayleigh) scattered twisted light may significantly differ from their behavior for an incident plane-wave radiation.

Structural and electronic transformation in low-angle twisted bilayer graphene

NASA Astrophysics Data System (ADS)

Gargiulo, Fernando; Yazyev, Oleg V.

2018-01-01

Experiments on bilayer graphene unveiled a fascinating realization of stacking disorder where triangular domains with well-defined Bernal stacking are delimited by a hexagonal network of strain solitons. Here we show by means of numerical simulations that this is a consequence of a structural transformation of the moiré pattern inherent to twisted bilayer graphene taking place at twist angles θ below a crossover angle θ\\star=1.2\\circ . The transformation is governed by the interplay between the interlayer van der Waals interaction and the in-plane strain field, and is revealed by a change in the functional form of the twist energy density. This transformation unveils an electronic regime characteristic of vanishing twist angles in which the charge density converges, though not uniformly, to that of ideal bilayer graphene with Bernal stacking. On the other hand, the stacking domain boundaries form a distinct charge density pattern that provides the STM signature of the hexagonal solitonic network.

Filters for cathodic arc plasmas

DOEpatents

Anders, Andre; MacGill, Robert A.; Bilek, Marcela M. M.; Brown, Ian G.

2002-01-01

Cathodic arc plasmas are contaminated with macroparticles. A variety of magnetic plasma filters has been used with various success in removing the macroparticles from the plasma. An open-architecture, bent solenoid filter, with additional field coils at the filter entrance and exit, improves macroparticle filtering. In particular, a double-bent filter that is twisted out of plane forms a very compact and efficient filter. The coil turns further have a flat cross-section to promote macroparticle reflection out of the filter volume. An output conditioning system formed of an expander coil, a straightener coil, and a homogenizer, may be used with the magnetic filter for expanding the filtered plasma beam to cover a larger area of the target. A cathodic arc plasma deposition system using this filter can be used for the deposition of ultrathin amorphous hard carbon (a-C) films for the magnetic storage industry.

Anisotropic piezoelectric twist actuation of helicopter rotor blades: Aeroelastic analysis and design optimization

NASA Astrophysics Data System (ADS)

Wilkie, William Keats

1997-12-01

An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain a soluti An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain amited additional piezoelectric material mass, it is shown that blade twist actuation approaches which exploit in-plane piezoelectric free-stain anisotropies are capable of producing amplitudes of oscillatory blade twisting sufficient for rotor vibration reduction applications. The second study examines the effectiveness of using embedded piezoelectric actuator laminae to alleviate vibratory loads due to retreating blade stall. A 10 to 15 percent improvement in dynamic stall limited forward flight speed, and a 5 percent improvement in stall limited rotor thrust were numerically demonstrated for the active twist rotor blade relative to a conventional blade design. The active twist blades are also demonstrated to be more susceptible than the conventional blades to dynamic stall induced vibratory loads when not operating with twist actuation. This is the result of designing the active twist blades with low torsional stiffness in order to maximize piezoelectric twist authority

Twisted bilayer graphene photoluminescence emission peaks at van Hove singularities.

PubMed

Alencar, Thonimar V; von Dreifus, Driele; Gabriela Cota Moreira, Maria; Eliel, Gomes S N; Yeh, Chao-Hui; Chiu, Po-Wen; Pimenta, Marcos A; Malard, Leandro M; Maria de Paula, Ana

2018-05-02

We report on photoluminescence emission imaging by femtosecond laser excitation on twisted bilayer graphene samples. The emission images are obtained by tuning the excitation laser energies in the near infrared region. We demonstrate an increase of the photoluminescence emission at excitation energies that depends on the bilayer twist angle. The results show a peak for the light emission when the excitation is in resonance with transitions at the van Hove singularities in the electronic density of states. We measured the photoluminescence excitation peak position and width for samples with various twist angles showing resonances in the energy range of 1.2 to 1.7 eV.

Twisted bilayer graphene photoluminescence emission peaks at van Hove singularities

NASA Astrophysics Data System (ADS)

Alencar, Thonimar V.; von Dreifus, Driele; Cota Moreira, Maria Gabriela; Eliel, Gomes S. N.; Yeh, Chao-Hui; Chiu, Po-Wen; Pimenta, Marcos A.; Malard, Leandro M.; de Paula, Ana Maria

2018-05-01

We report on photoluminescence emission imaging by femtosecond laser excitation on twisted bilayer graphene samples. The emission images are obtained by tuning the excitation laser energies in the near infrared region. We demonstrate an increase of the photoluminescence emission at excitation energies that depends on the bilayer twist angle. The results show a peak for the light emission when the excitation is in resonance with transitions at the van Hove singularities in the electronic density of states. We measured the photoluminescence excitation peak position and width for samples with various twist angles showing resonances in the energy range of 1.2 to 1.7 eV.

Probing Twisted Magnetic Field Using Microwave Observations in an M Class Solar Flare on 11 February, 2014

NASA Astrophysics Data System (ADS)

Sharykin, I. N.; Kuznetsov, A. A.; Myshyakov, I. I.

2018-02-01

This work demonstrates the possibility of magnetic-field topology investigations using microwave polarimetric observations. We study a solar flare of GOES M1.7 class that occurred on 11 February, 2014. This flare revealed a clear signature of spatial inversion of the radio-emission polarization sign. We show that the observed polarization pattern can be explained by nonthermal gyrosynchrotron emission from the twisted magnetic structure. Using observations of the Reuven Ramaty High Energy Solar Spectroscopic Imager, Nobeyama Radio Observatory, Radio Solar Telescope Network, and Solar Dynamics Observatory, we have determined the parameters of nonthermal electrons and thermal plasma and identified the magnetic structure where the flare energy release occurred. To reconstruct the coronal magnetic field, we use nonlinear force-free field (NLFFF) and potential magnetic-field approaches. Radio emission of nonthermal electrons is simulated by the GX Simulator code using the extrapolated magnetic field and the parameters of nonthermal electrons and thermal plasma inferred from the observations; the model radio maps and spectra are compared with observations. We have found that the potential-magnetic-field approach fails to explain the observed circular polarization pattern; on the other hand, the Stokes-V map is successfully explained by assuming nonthermal electrons to be distributed along the twisted magnetic structure determined by the NLFFF extrapolation approach. Thus, we show that the radio-polarization maps can be used for diagnosing the topology of the flare magnetic structures where nonthermal electrons are injected.

Twist1 Transcriptional Targets in the Developing Atrio-Ventricular Canal of the Mouse

PubMed Central

Vrljicak, Pavle; Cullum, Rebecca; Xu, Eric; Chang, Alex C. Y.; Wederell, Elizabeth D.; Bilenky, Mikhail; Jones, Steven J. M.; Marra, Marco A.; Karsan, Aly; Hoodless, Pamela A.

2012-01-01

Malformations of the cardiovascular system are the most common type of birth defect in humans, frequently affecting the formation of valves and septa. During heart valve and septa formation, cells from the atrio-ventricular canal (AVC) and outflow tract (OFT) regions of the heart undergo an epithelial-to-mesenchymal transformation (EMT) and invade the underlying extracellular matrix to give rise to endocardial cushions. Subsequent maturation of newly formed mesenchyme cells leads to thin stress-resistant leaflets. TWIST1 is a basic helix-loop-helix transcription factor expressed in newly formed mesenchyme cells of the AVC and OFT that has been shown to play roles in cell survival, cell proliferation and differentiation. However, the downstream targets of TWIST1 during heart valve formation remain unclear. To identify genes important for heart valve development downstream of TWIST1, we performed global gene expression profiling of AVC, OFT, atria and ventricles of the embryonic day 10.5 mouse heart by tag-sequencing (Tag-seq). Using this resource we identified a novel set of 939 genes, including 123 regulators of transcription, enriched in the valve forming regions of the heart. We compared these genes to a Tag-seq library from the Twist1 null developing valves revealing significant gene expression changes. These changes were consistent with a role of TWIST1 in controlling differentiation of mesenchymal cells following their transformation from endothelium in the mouse. To study the role of TWIST1 at the DNA level we performed chromatin immunoprecipitation and identified novel direct targets of TWIST1 in the developing heart valves. Our findings support a role for TWIST1 in the differentiation of AVC mesenchyme post-EMT in the mouse, and suggest that TWIST1 can exert its function by direct DNA binding to activate valve specific gene expression. PMID:22815831

Recombinant mouse periostin ameliorates coronal sutures fusion in Twist1+/- mice.

PubMed

Bai, Shanshan; Li, Dong; Xu, Liang; Duan, Huichuan; Yuan, Jie; Wei, Min

2018-04-17

Saethre-Chotzen syndrome is an autosomal dominantly inherited disorder caused by mutations in the twist family basic helix-loop-helix transcription factor 1 (TWIST1) gene. Surgical procedures are frequently required to reduce morphological and functional defects in patients with Saethre-Chotzen syndrome. Therefore, the development of noninvasive procedures to treat Saethre-Chotzen syndrome is critical. We identified that periostin, which is an extracellular matrix protein that plays an important role in both bone and connective tissues, is downregulated in craniosynostosis patients. We aimed to verify the effects of different concentrations (0, 50, 100, and 200 μg/l) of recombinant mouse periostin in Twist1 +/- mice (a mouse model of Saethre-Chotzen syndrome) coronal suture cells in vitro and in vivo. Cell proliferation, migration, and osteogenic differentiation were observed and detected. Twist1 +/- mice were also injected with recombinant mouse periostin to verify the treatment effects. Cell Counting Kit-8 results showed that recombinant mouse periostin inhibited the proliferation of suture-derived cells in a time- and concentration-dependent manner. Cell migration was also suppressed when treated with recombinant mouse periostin. Real-time quantitative PCR and Western blotting results suggested that messenger ribonucleic acid and protein expression of alkaline phosphatase, bone sialoprotein, collagen type I, and osteocalcin were all downregulated after treatment with recombinant mouse periostin. However, the expression of Wnt-3a, Wnt-1, and β-catenin were upregulated. The in vivo results demonstrated that periostin-treated Twist1 +/- mice showed patent coronal sutures in comparison with non-treated Twist1 +/- mice which have coronal craniosynostosis. Our results suggest that recombinant mouse periostin can inhibit coronal suture cell proliferation and migration and suppress osteogenic differentiation of suture-derived cells via Wnt canonical signaling, as

An aeroelastic analysis of helicopter rotor blades incorporating piezoelectric fiber composite twist actuation

NASA Technical Reports Server (NTRS)

Wilkie, W. Keats; Park, K. C.

1996-01-01

A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consist of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for numerical integration. The twist actuation responses for three conceptual full-scale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

Twist1 Suppresses Senescence Programs and Thereby Accelerates and Maintains Mutant Kras-Induced Lung Tumorigenesis

PubMed Central

Thiyagarajan, Saravanan; Das, Sandhya T.; Zabuawala, Tahera; Chen, Joy; Cho, Yoon-Jae; Luong, Richard; Tamayo, Pablo; Salih, Tarek; Aziz, Khaled; Adam, Stacey J.; Vicent, Silvestre; Nielsen, Carsten H.; Withofs, Nadia; Sweet-Cordero, Alejandro; Gambhir, Sanjiv S.; Rudin, Charles M.; Felsher, Dean W.

2012-01-01

KRAS mutant lung cancers are generally refractory to chemotherapy as well targeted agents. To date, the identification of drugs to therapeutically inhibit K-RAS have been unsuccessful, suggesting that other approaches are required. We demonstrate in both a novel transgenic mutant Kras lung cancer mouse model and in human lung tumors that the inhibition of Twist1 restores a senescence program inducing the loss of a neoplastic phenotype. The Twist1 gene encodes for a transcription factor that is essential during embryogenesis. Twist1 has been suggested to play an important role during tumor progression. However, there is no in vivo evidence that Twist1 plays a role in autochthonous tumorigenesis. Through two novel transgenic mouse models, we show that Twist1 cooperates with KrasG12D to markedly accelerate lung tumorigenesis by abrogating cellular senescence programs and promoting the progression from benign adenomas to adenocarcinomas. Moreover, the suppression of Twist1 to physiological levels is sufficient to cause Kras mutant lung tumors to undergo senescence and lose their neoplastic features. Finally, we analyzed more than 500 human tumors to demonstrate that TWIST1 is frequently overexpressed in primary human lung tumors. The suppression of TWIST1 in human lung cancer cells also induced cellular senescence. Hence, TWIST1 is a critical regulator of cellular senescence programs, and the suppression of TWIST1 in human tumors may be an effective example of pro-senescence therapy. PMID:22654667

Twist-2 matching of transverse momentum dependent distributions

NASA Astrophysics Data System (ADS)

Gutiérrez-Reyes, Daniel; Scimemi, Ignazio; Vladimirov, Alexey A.

2017-06-01

We systematically study the large-qT (or small-b) matching of transverse momentum dependent (TMD) distributions to the twist-2 integrated parton distributions. Performing operator product expansion for a generic TMD operator at the next-to-leading order (NLO) we found the complete set of TMD distributions that match twist-2. These are unpolarized, helicity, transversity, pretzelosity and linearly polarized gluon distributions. The NLO matching coefficients for these distributions are presented. The pretzelosity matching coefficient is zero at the presented order, however, it is evident that it is non-zero in the following orders. This result offers a natural explanation of the small value of pretzelosity found in phenomenological fits. We also demonstrate that the cancellation of rapidity divergences by the leading order soft factor imposes the necessary requirement on the Lorentz structure of TMD operators, which is supported only by the TMD distributions of leading dynamical twist. Additionally, this requirement puts restrictions on the γ5-definition in the dimensional regularization.

Collisionless plasma expansion into vacuum: Two new twists on an old problema)

NASA Astrophysics Data System (ADS)

Arefiev, Alexey V.; Breizman, Boris N.

2009-05-01

The paper deals with a generic problem of collisionless plasma expansion into vacuum in the regimes where the expanding plasma consists of hot electrons and cold ions. The expansion is caused by electron pressure and serves as an energy transfer mechanism from electrons to ions. This process is often described under the assumption of Maxwellian electrons, which easily fails in the absence of collisions. The paper discusses two systems with a naturally occurring non-Maxwellian distribution: an expanding laser-irradiated nanoplasma and a supersonic jet coming out of a magnetic nozzle. The presented rigorous kinetic description demonstrates how the deviation from the Maxwellian distribution fundamentally alters the process of ion acceleration during plasma expansion. This result points to the critical importance of a fully kinetic treatment in problems with collisionless plasma expansion.

Description of the plasma diagnostics package (PDP) for the OSS-1 Shuttle mission and JSC plasma chamber test in conjunction with the fast pulse electron gun (FPEG)

NASA Technical Reports Server (NTRS)

Shawhan, S. D.

1982-01-01

The objectives, equipment, and techniques for the plasma diagnostics package (PDP) carried by the OSS-1 instrument payload of the STS-4 and scheduled for the Spacelab-2 mission are described. The goals of the first flight were to examine the Orbiter-magnetoplasma interactions by measuring the electric and magnetic field strengths, the ionized particle wakes, and the generated waves. The RMS was employed to lift the unit out of the bay in order to allow characterization of the fields, EM interference, and plasma contamination within 15 m of the Orbiter. The PDP will also be used to examine plasma depletion, chemical reaction rates, waves, and energized plasma produced by firing of the Orbiter thrusters. Operation of the PDP was carried out in the NASA Space Environment Simulation Laboratory test chamber, where the PDP was used to assay the fields, fluxes, wave amplitudes, and particle energy spectra. The PDP instrumentation is also capable of detecting thermal ions, thermal electrons suprathermal particles, VHF/UHF EMI levels, and the S-band field strength.

Influence UHF radiation on the process of self-assembly and lethal effect of bacterial lipopolysaccharide

NASA Astrophysics Data System (ADS)

Brill, G. E.; Egorova, A. V.; Bugaeva, I. O.; Postnov, D. E.; Melnikov, A. G.; Ushakova, O. V.

2018-04-01

The influence of low-intensity electromagnetic radiation on the process of self-assembly, spectral-fluorescent characteristics and lethal effect of bacterial lipopolysaccharide (endotoxin) was performed. A solution of bacterial lipopolysaccharide exposed to electromagnetic waves with a frequency of 1 GHz, the power density of 0.1 μW/cm2 for 10 min. In experiments on a large group of control and irradiated mice, a comparative analysis of the estimated lethal dose of endotoxin was performed. It was proved that UHF radiation of certain parameters reduces the lethal effects of bacterial lipopolysaccharide on 26%.

Highly sensitive twist sensor based on tilted fiber Bragg grating of polarization-dependent properties

NASA Astrophysics Data System (ADS)

Lu, Yanfang; Shen, Changyu; Chen, Debao; Chu, Jinlei; Wang, Qiang; Dong, Xinyong

2014-10-01

The transmission intensity of the tilted fiber Bragg grating (TFBG) is strongly dependent on the polarization properties of the TFBG. The polarization characteristic of the cladding modes can be used for twist measuring. In this paper, a highly sensitive fiber twist sensor is proposed. The transmission intensity on the strong loss wavelength showed a quasi-sin θ changing with the twist angle ranging from 0° to 180° for S- or P-polarized input. A high sensitivity of 0.299 dB/° is achieved, which is almost 17.9 times higher than that of the current similar existing twist sensor. The twist angle can be measured precisely with the matrix.

In Silico Measurements of Twist and Bend Moduli for β-Solenoid Protein Self-Assembly Units.

PubMed

Heinz, Leonard P; Ravikumar, Krishnakumar M; Cox, Daniel L

2015-05-13

We compute potentials of mean force for bend and twist deformations via force pulling and umbrella sampling experiments for four β-solenoid proteins (BSPs) that show promise in nanotechnology applications. In all cases, we find quasi-Hooke's law behavior until the point of rupture. Bending moduli show modest anisotropy for two-sided and three-sided BSPs, and little anisotropy for a four-sided BSP. There is a slight clockwise/counterclockwise asymmetry in the twist potential of mean force, showing greater stiffness when the applied twist follows the intrinsic twist. When we extrapolate to beam theory appropriate for amyloid fibrils of the BSPs, we find bend/twist moduli which are somewhat smaller than those in the literature for other amyloid fibrils. Twist persistence lengths are on the order of a micron, and bend persistence lengths are several microns. Provided the intrinsic twist can be reversed, these results support the usage of BSPs in biomaterials applications.

Two-pseudoscalar-meson decay of {chi}{sub cJ} with twist-3 corrections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou Mingzhen; Zhou Haiqing; Department of Physics, Southeast University, Nanjing 211189

2009-11-01

The decays of {chi}{sub cJ}{yields}{pi}{sup +}{pi}{sup -}, K{sup +}K{sup -} (J=0,2) are discussed within the standard and modified hard-scattering approach when including the contributions from twist-3 distribution amplitudes and wave functions of the light pseudoscalar meson. A model for twist-2 and twist-3 distribution amplitudes and wave functions of the pion and kaon with BHL prescription are proposed as the solution to the end-point singularities. The results show that the contributions from twist-3 parts are actually not power suppressed comparing with the leading-twist contribution. After including the effects from the transverse momentum of light meson valence-quark state and Sudakov factors, themore » decay widths of the {chi}{sub cJ} into pions or kaons are comparable with the their experimental data.« less

Projection Moire Interferometry for Rotorcraft Applications: Deformation Measurements of Active Twist Rotor Blades

NASA Technical Reports Server (NTRS)

Fleming, Gary A.; Soto, Hector L.; South, Bruce W.

2002-01-01

Projection Moire Interferometry (PMI) has been used during wind tunnel tests to obtain azimuthally dependent blade bending and twist measurements for a 4-bladed Active Twist Rotor (ATR) system in simulated forward flight. The ATR concept offers a means to reduce rotor vibratory loads and noise by using piezoelectric active fiber composite actuators embedded in the blade structure to twist each blade as they rotate throughout the rotor azimuth. The twist imparted on the blades for blade control causes significant changes in blade loading, resulting in complex blade deformation consisting of coupled bending and twist. Measurement of this blade deformation is critical in understanding the overall behavior of the ATR system and the physical mechanisms causing the reduction in rotor loads and noise. PMI is a non-contacting, video-based optical measurement technique capable of obtaining spatially continuous structural deformation measurements over the entire object surface within the PMI system field-of-view. When applied to rotorcraft testing, PMI can be used to measure the azimuth-dependent blade bending and twist along the full span of the rotor blade. This paper presents the PMI technique as applied to rotorcraft testing, and provides results obtained during the ATR tests demonstrating the PMI system performance. PMI measurements acquired at select blade actuation conditions generating minimum and maximum rotor loads are provided to explore the interrelationship between rotor loads, blade bending, and twist.

Collisionless plasma expansion into vacuum: Two new twists on an old problem

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arefiev, Alexey V.; Breizman, Boris N.

The paper deals with a generic problem of collisionless plasma expansion into vacuum in the regimes where the expanding plasma consists of hot electrons and cold ions. The expansion is caused by electron pressure and serves as an energy transfer mechanism from electrons to ions. This process is often described under the assumption of Maxwellian electrons, which easily fails in the absence of collisions. The paper discusses two systems with a naturally occurring non-Maxwellian distribution: an expanding laser-irradiated nanoplasma and a supersonic jet coming out of a magnetic nozzle. The presented rigorous kinetic description demonstrates how the deviation from themore » Maxwellian distribution fundamentally alters the process of ion acceleration during plasma expansion. This result points to the critical importance of a fully kinetic treatment in problems with collisionless plasma expansion.« less

Twist Model Development and Results from the Active Aeroelastic Wing F/A-18 Aircraft

NASA Technical Reports Server (NTRS)

Lizotte, Andrew M.; Allen, Michael J.

2007-01-01

Understanding the wing twist of the active aeroelastic wing (AAW) F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption. This technique produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

Twist Model Development and Results From the Active Aeroelastic Wing F/A-18 Aircraft

NASA Technical Reports Server (NTRS)

Lizotte, Andrew; Allen, Michael J.

2005-01-01

Understanding the wing twist of the active aeroelastic wing F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption and by using neural networks. These techniques produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

Experimental Investigation of the Electronic Properties of Twisted Bilayer Graphene by STM and STS

NASA Astrophysics Data System (ADS)

Yin, Longjing; Qiao, Jiabin; Wang, Wenxiao; Zuo, Weijie; He, Lin

The electronic properties of graphene multilayers depend sensitively on their stacking order. A twisted angle is treated as a unique degree of freedom to tune the electronic properties of graphene system. Here we study electronic structures of the twisted bilayers by scanning tunneling microscopy (STM) and spectroscopy (STS). We demonstrate that the interlayer coupling strength affects both the Van Hove singularities and the Fermi velocity of twisted bilayers dramatically. This removes the discrepancy about the Fermi velocity renormalization in the twisted bilayers and provides a consistent interpretation of all current data. Moreover, we report the experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers by STM and STS. At a magic twisted angle, about 1.11°, a pronounced sharp peak is observed in the tunnelling spectra due to the action of the non-Abelian gauge fields. Because of the effective non-Abelian gauge fields, the rotation angle could transfer the charge carriers in the twisted bilayers from massless Dirac fermions into well localized electrons, or vice versa, efficiently. This provides a new route to tune the electronic properties of graphene systems, which will be essential in future graphene nanoelectronics.

Factorising the 3D topologically twisted index

NASA Astrophysics Data System (ADS)

Cabo-Bizet, Alejandro

2017-04-01

We explore the path integration — upon the contour of hermitian (non-auxliary) field configurations — of topologically twisted N=2 Chern-Simons-matter theory (TTCSM) on {S}_2 times a segment. In this way, we obtain the formula for the 3D topologically twisted index, first as a convolution of TTCSM on {S}_2 times halves of {S}_1 , second as TTCSM on {S}_2 times {S}_1 — with a puncture, — and third as TTCSM on {S}_2× {S}_1 . In contradistinction to the first two cases, in the third case, the vector multiplet auxiliary field D is constrained to be anti-hermitian.

Obstructions for twist star products

NASA Astrophysics Data System (ADS)

Bieliavsky, Pierre; Esposito, Chiara; Waldmann, Stefan; Weber, Thomas

2018-05-01

In this short note, we point out that not every star product is induced by a Drinfel'd twist by showing that not every Poisson structure is induced by a classical r-matrix. Examples include the higher genus symplectic Pretzel surfaces and the symplectic sphere S^2.

Optics of twisted nematic and supertwisted nematic liquid-crystal displays

NASA Astrophysics Data System (ADS)

Leenhouts, F.; Schadt, M.

1986-11-01

For the first time calculations of the off-state transmission of twisted nematic liquid-crystal displays (LCD's) are presented which exhibit twist angles greater than the conventional 90 °. The transmission has been calculated using a treatment introduced by Priestley. In addition, the CIE (Commission Internationale d'Eclairage) color coordinates were evaluated which, together with the brightness, determine the optical appearance of an LCD. The finite efficiency of the polarizers was taken into account. The results are compared with those obtained for conventional 90 ° twisted nematic LCD's. From the calculations follow the conditions required to obtain optimal contrast and steep electro-optical characteristics in 180 ° supertwisted LCD's designed for high information content applications.

Mechanism of Twist1-Induced Invasion in Breast Cancer Metastasis

DTIC Science & Technology

2012-01-01

Breast Cancer Metastasis PRINCIPAL INVESTIGATOR: Mark Adam Eckert CONTRACTING...2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Mechanism of Twist1-Induced Invasion in Breast Cancer Metastasis 5b. GRANT NUMBER W81XWH-09-1...an important mediator of breast cancer metastasis by driving the epithelial-mesenchymal transition. We find that Twist1 promotes metastasis by

A New Twisting Somersault: 513XD

NASA Astrophysics Data System (ADS)

Tong, William; Dullin, Holger R.

2017-12-01

We present the mathematical framework of an athlete modelled as a system of coupled rigid bodies to simulate platform and springboard diving. Euler's equations of motion are generalised to non-rigid bodies and are then used to innovate a new dive sequence that in principle can be performed by real-world athletes. We begin by assuming that shape changes are instantaneous so that the equations of motion simplify enough to be solved analytically, and then use this insight to present a new dive (513XD) consisting of 1.5 somersaults and five twists using realistic shape changes. Finally, we demonstrate the phenomenon of converting pure somersaulting motion into pure twisting motion by using a sequence of impulsive shape changes, which may have applications in other fields such as space aeronautics.

Twist1-positive epithelial cells retain adhesive and proliferative capacity throughout dissemination

PubMed Central

Shamir, Eliah R.; Coutinho, Kester; Georgess, Dan; Auer, Manfred

2016-01-01

ABSTRACT Dissemination is the process by which cells detach and migrate away from a multicellular tissue. The epithelial-to-mesenchymal transition (EMT) conceptualizes dissemination in a stepwise fashion, with downregulation of E-cadherin leading to loss of intercellular junctions, induction of motility, and then escape from the epithelium. This gain of migratory activity is proposed to be mutually exclusive with proliferation. We previously developed a dissemination assay based on inducible expression of the transcription factor Twist1 and here utilize it to characterize the timing and dynamics of intercellular adhesion, proliferation and migration during dissemination. Surprisingly, Twist1+ epithelium displayed extensive intercellular junctions, and Twist1– luminal epithelial cells could still adhere to disseminating Twist1+ cells. Although proteolysis and proliferation were both observed throughout dissemination, neither was absolutely required. Finally, Twist1+ cells exhibited a hybrid migration mode; their morphology and nuclear deformation were characteristic of amoeboid cells, whereas their dynamic protrusive activity, pericellular proteolysis and migration speeds were more typical of mesenchymal cells. Our data reveal that epithelial cells can disseminate while retaining competence to adhere and proliferate. PMID:27402962

Hover Testing of the NASA/Army/MIT Active Twist Rotor Prototype Blade

NASA Technical Reports Server (NTRS)

Wilbur, Matthew L.; Yeager, William T., Jr.; Wilkie, W. Keats; Cesnik, Carlos E. S.; Shin, Sangloon

2000-01-01

Helicopter rotor individual blade control promises to provide a mechanism for increased rotor performance and reduced rotorcraft vibrations and noise. Active material methods, such as piezoelectrically actuated trailing-edge flaps and strain-induced rotor blade twisting, provide a means of accomplishing individual blade control without the need for hydraulic power in the rotating system. Recent studies have indicated that controlled strain induced blade twisting can be attained using piezoelectric active fiber composite technology. In order to validate these findings experimentally, a cooperative effort between NASA Langley Research Center, the Army Research Laboratory, and the MIT Active Materials and Structures Laboratory has been developed. As a result of this collaboration an aeroelastically-scaled active-twist model rotor blade has been designed and fabricated for testing in the heavy gas environment of the Langley Transonic Dynamics Tunnel (TDT). The results of hover tests of the active-twist prototype blade are presented in this paper. Comparisons with applicable analytical predictions of active-twist frequency response in hovering flight are also presented.

Demonstration of an elastically coupled twist control concept for tilt rotor blade application

NASA Technical Reports Server (NTRS)

Lake, R. C.; Nixon, M. W.; Wilbur, M. L.; Singleton, J. D.; Mirick, P. H.

1994-01-01

The purpose of this Note is to present results from an analytic/experimental study that investigated the potential for passively changing blade twist through the use of extension-twist coupling. A set of composite model rotor blades was manufactured from existing blade molds for a low-twist metal helicopter rotor blade, with a view toward establishing a preliminary proof concept for extension-twist-coupled rotor blades. Data were obtained in hover for both a ballasted and unballasted blade configuration in sea-level atmospheric conditions. Test data were compared with results obtained from a geometrically nonlinear analysis of a detailed finite element model of the rotor blade developed in MSC/NASTRAN.

Gravity in twisted space

NASA Technical Reports Server (NTRS)

Farrar, Kelly A.; Melott, Adrian L.

1990-01-01

Numerical simulations with periodic boundary conditions are widely used in cosmology. These have a multiply connected topology known as a three-torus. Such nontrivial topologies for the actual universe may have arisen in the Big Bang. A two-dimensional numerical model with a twisted topology, sometimes a Klein bottle, is shown as well as the fact that local properties of the model are not dependent on topology.

Nonlinear Plasma Experiments in Geospace with Gigawatts of RF Power at HAARP

NASA Astrophysics Data System (ADS)

Sheerin, J. P.; Rayyan, N.; Watkins, B. J.; Bristow, W. A.; Bernhardt, P. A.

2014-10-01

The HAARP phased-array HF transmitter at Gakona, AK delivers up to 3.6 GW (ERP) of HF power in the range of 2.8 - 10 MHz to the ionosphere with millisecond pointing, power modulation, and frequency agility. HAARP's unique features have enabled the conduct of a number of nonlinear plasma experiments in the interaction region of overdense ionospheric plasma including stimulated electromagnetic emissions (SEE), artificial aurora, artificial ionization layers, VLF wave-particle interactions in the magnetosphere, strong Langmuir turbulence (SLT) and suprathermal electron acceleration. Diagnostics include the Modular UHF Ionospheric Radar (MUIR) sited at HAARP, the SuperDARN-Kodiak HF radar, spacecraft radio beacons, HF receivers to record stimulated electromagnetic emissions (SEE) and telescopes and cameras for optical emissions. We report on short timescale ponderomotive overshoot effects, artificial field-aligned irregularities (AFAI), the aspect angle dependence of the intensity of the plasma line, and suprathermal electrons. Applications are made to the study and control of irregularities affecting spacecraft communication and navigation systems.

Theory of twisted nonuniformly heated bars

NASA Technical Reports Server (NTRS)

Shorr, B. F.

1980-01-01

Nonlineary distributed stresses in twisted nonuniformly heated bars of arbitrary cross section are calculated taking into account various elasticity parameters. The approximate theory is shown to be sufficiently general and accurate by comparison with experimental data.

Epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia modulates proliferation, cell survival and chemosensitivity

PubMed Central

Thathia, Shabnam H.; Ferguson, Stuart; Gautrey, Hannah E.; van Otterdijk, Sanne D.; Hili, Michela; Rand, Vikki; Moorman, Anthony V.; Meyer, Stefan; Brown, Robert; Strathdee, Gordon

2012-01-01

Background Altered regulation of many transcription factors has been shown to be important in the development of leukemia. TWIST2 modulates the activity of a number of important transcription factors and is known to be a regulator of hematopoietic differentiation. Here, we investigated the significance of epigenetic regulation of TWIST2 in the control of cell growth and survival and in response to cytotoxic agents in acute lymphoblastic leukemia. Design and Methods TWIST2 promoter methylation status was assessed quantitatively, by combined bisulfite and restriction analysis (COBRA) and pyrosequencing assays, in multiple types of leukemia and TWIST2 expression was determined by quantitative reverse transcriptase polymerase chain reaction analysis. The functional role of TWIST2 in cell proliferation, survival and response to chemotherapy was assessed in transient and stable expression systems. Results We found that TWIST2 was inactivated in more than 50% of cases of childhood and adult acute lymphoblastic leukemia through promoter hypermethylation and that this epigenetic regulation was especially prevalent in RUNX1-ETV6-driven cases. Re-expression of TWIST2 in cell lines resulted in a dramatic reduction in cell growth and induction of apoptosis in the Reh cell line. Furthermore, re-expression of TWIST2 resulted in increased sensitivity to the chemotherapeutic agents etoposide, daunorubicin and dexamethasone and TWIST2 hypermethylation was almost invariably found in relapsed adult acute lymphoblastic leukemia (91% of samples hypermethylated). Conclusions This study suggests a dual role for epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia, initially through altering cell growth and survival properties and subsequently by increasing resistance to chemotherapy. PMID:22058208

A possible regulatory link between Twist 1 and PPARγ gene regulation in 3T3-L1 adipocytes.

PubMed

Ren, Rui; Chen, Zhufeng; Zhao, Xia; Sun, Tao; Zhang, Yuchao; Chen, Jie; Lu, Sumei; Ma, Wanshan

2016-11-08

Peroxisome proliferator-activated receptor γ (PPARγ) is a critical gene that regulates the function of adipocytes. Therefore, studies on the molecular regulation mechanism of PPARγ are important to understand the function of adipose tissue. Twist 1 is another important functional gene in adipose tissue, and hundreds of genes are regulated by Twist 1. The aim of this study was to investigate the regulation of Twist 1 and PPARγ expression in 3T3-L1 mature adipocytes. We induced differentiation in 3T3-L1 preadipocytes and examined alterations in Twist 1 and PPARγ expression. We used the PPARγ agonist pioglitazone and the PPARγ antagonist T0070907 to investigate the effect of PPARγ on Twist 1 expression. In addition, we utilized retroviral interference and overexpression of Twist 1 to determine the effects of Twist 1 on PPARγ expression. The expression levels of Twist 1 and PPARγ were induced during differentiation in 3T3-L1 adipocytes. Application of either a PPARγ agonist (pioglitazone) or antagonist (T0070907) influenced Twist 1 expression, with up-regulation of Twist 1 under pioglitazone (1 μM, 24 h) and down-regulation of Twist 1 under T0070907 (100 μM, 24 h) exposure. Furthermore, the retroviral interference of Twist 1 decreased the protein and mRNA expression of PPARγ, while Twist 1 overexpression had the opposite effect. There was a possible regulatory link between Twist 1 and PPARγ in 3T3-L1 mature adipocytes. This regulatory link enhanced the regulation of PPARγ and may be a functional mechanism of Twist 1 regulation of adipocyte physiology and pathology.

The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis.

PubMed

Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

2011-02-01

The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis.

The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis

PubMed Central

Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

2011-01-01

The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis. PMID:20714342

Twist effects in quantum vortices and phase defects

NASA Astrophysics Data System (ADS)

Zuccher, Simone; Ricca, Renzo L.

2018-02-01

In this paper we show that twist, defined in terms of rotation of the phase associated with quantum vortices and other physical defects effectively deprived of internal structure, is a property that has observable effects in terms of induced axial flow. For this we consider quantum vortices governed by the Gross-Pitaevskii equation (GPE) and perform a number of test cases to investigate and compare the effects of twist in two different contexts: (i) when this is artificially superimposed on an initially untwisted vortex ring; (ii) when it is naturally produced on the ring by the simultaneous presence of a central straight vortex. In the first case large amplitude perturbations quickly develop, generated by the unnatural setting of the initial condition that is not an analytical solution of the GPE. In the second case much milder perturbations emerge, signature of a genuine physical process. This scenario is confirmed by other test cases performed at higher twist values. Since the second setting corresponds to essential linking, these results provide new evidence of the influence of topology on physics.

Low-Frequency Interlayer Raman Modes to Probe Interface of Twisted Bilayer MoS 2

DOE PAGES

Huang, Shengxi; Liang, Liangbo; Ling, Xi; ...

2016-02-21

A variety of van der Waals homo- and hetero- structures assembled by stamping monolayers together present optoelectronic properties suitable for diverse applications. Understanding the details of the interlayer stacking and resulting coupling is crucial for tuning these properties. Twisted bilayer transition metal dichalcogenides offer a great platform for developing a precise understanding of the structure/property relationship. Here, we study the low-frequency interlayer shear and breathing Raman modes (<50 cm-1) in twisted bilayer MoS 2 by Raman spectroscopy and first-principles modeling. Twisting introduces both rotational and translational shifts and significantly alters the interlayer stacking and coupling, leading to notable frequency andmore » intensity changes of low-frequency modes. The frequency variation can be up to 8 cm-1 and the intensity can vary by a factor of ~5 for twisting near 0 and 60 , where the stacking is a mixture of multiple high-symmetry stacking patterns and is thus especially sensitive to twisting. Moreover, for twisting angles between 20 and 40 , the interlayer coupling is nearly constant since the stacking results in mismatched lattices over the entire sample. It follows that the Raman signature is relatively uniform. Interestingly, unlike the breathing mode, the shear mode is extremely sensitive to twisting: it disappears between 20 and 40 as its frequency drops to almost zero due to the stacking-induced mismatch. Note that for some samples, multiple breathing mode peaks appear, indicating non-uniform coupling across the interface. In contrast to the low-frequency interlayer modes, high-frequency intralayer Raman modes are much less sensitive to interlayer stacking and coupling, showing negligible changes upon twisting. Our research demonstrates the effectiveness of low-frequency Raman modes for probing the interfacial coupling and environment of twisted bilayer MoS2, and potentially other two-dimensional materials and

Long range ultra-high frequency (UHF) radio frequency identification (RFID) antenna design

NASA Astrophysics Data System (ADS)

Reynolds, Nathan D.

There is an ever-increasing demand for radio frequency identification (RFID) tags that are passive, long range, and mountable on multiple surfaces. Currently, RFID technology is utilized in numerous applications such as supply chain management, access control, and public transportation. With the combination of sensory systems in recent years, the applications of RFID technology have been extended beyond tracking and identifying. This extension includes applications such as environmental monitoring and healthcare applications. The available sensory systems usually operate in the medium or high frequency bands and have a low read range. However, the range limitations of these systems are being overcome by the development of RFID sensors focused on utilizing tags in the ultra-high frequency (UHF) band. Generally, RFID tags have to be mounted to the object that is being identified. Often the objects requiring identification are metallic. The inherent properties of metallic objects have substantial effects on nearby electromagnetic radiation; therefore, the operation of the tag antenna is affected when mounted on a metallic surface. This outlines one of the most challenging problems for RFID systems today: the optimization of tag antenna performance in a complex environment. In this research, a novel UHF RFID tag antenna, which has a low profile, long range, and is mountable on metallic surfaces, is designed analytically and simulated using a 3-D electromagnetic simulator, ANSYS HFSS. A microstrip patch antenna is selected as the antenna structure, as patch antennas are low profile and suitable for mounting on metallic surfaces. Matching and theoretical models of the microstrip patch antenna are investigated. Once matching and theory of a microstrip patch antenna is thoroughly understood, a unique design technique using electromagnetic band gap (EBG) structures is explored. This research shows that the utilization of an EBG structure in the patch antenna design yields

Work Function Variations in Twisted Graphene Layers

DOE PAGES

Robinson, Jeremy T.; Culbertson, James; Berg, Morgann; ...

2018-01-31

By combining optical imaging, Raman spectroscopy, kelvin probe force microscopy (KFPM), and photoemission electron microscopy (PEEM), we show that graphene’s layer orientation, as well as layer thickness, measurably changes the surface potential (Φ). Detailed mapping of variable-thickness, rotationally-faulted graphene films allows us to correlate Φ with specific morphological features. Using KPFM and PEEM we measure ΔΦ up to 39 mV for layers with different twist angles, while ΔΦ ranges from 36–129 mV for different layer thicknesses. The surface potential between different twist angles or layer thicknesses is measured at the KPFM instrument resolution of ≤ 200 nm. The PEEM measuredmore » work function of 4.4 eV for graphene is consistent with doping levels on the order of 10 12cm -2. Here, we find that Φ scales linearly with Raman G-peak wavenumber shift (slope = 22.2 mV/cm -1) for all layers and twist angles, which is consistent with doping-dependent changes to graphene’s Fermi energy in the ‘high’ doping limit. Our results here emphasize that layer orientation is equally important as layer thickness when designing multilayer two-dimensional systems where surface potential is considered.« less

Work Function Variations in Twisted Graphene Layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, Jeremy T.; Culbertson, James; Berg, Morgann

By combining optical imaging, Raman spectroscopy, kelvin probe force microscopy (KFPM), and photoemission electron microscopy (PEEM), we show that graphene’s layer orientation, as well as layer thickness, measurably changes the surface potential (Φ). Detailed mapping of variable-thickness, rotationally-faulted graphene films allows us to correlate Φ with specific morphological features. Using KPFM and PEEM we measure ΔΦ up to 39 mV for layers with different twist angles, while ΔΦ ranges from 36–129 mV for different layer thicknesses. The surface potential between different twist angles or layer thicknesses is measured at the KPFM instrument resolution of ≤ 200 nm. The PEEM measuredmore » work function of 4.4 eV for graphene is consistent with doping levels on the order of 10 12cm -2. Here, we find that Φ scales linearly with Raman G-peak wavenumber shift (slope = 22.2 mV/cm -1) for all layers and twist angles, which is consistent with doping-dependent changes to graphene’s Fermi energy in the ‘high’ doping limit. Our results here emphasize that layer orientation is equally important as layer thickness when designing multilayer two-dimensional systems where surface potential is considered.« less

Inner Surface Chirality of Single-Handed Twisted Carbonaceous Tubular Nanoribbons.

PubMed

Liu, Dan; Li, Baozong; Guo, Yongmin; Li, Yi; Yang, Yonggang

2015-11-01

Single-handed twisted 4,4'-biphenylene-bridged polybissilsesquioxane tubular nanoribbons and single-layered nanoribbons were prepared by tuning the water/ethanol volume ratio in the reaction mixture at pH = 11.6 through a supramolecular templating approach. The single-layered nanoribbons were formed by shrinking tubular nanoribbons after the removal of the templates. In addition, solvent-induced handedness inversion was achieved. The handedness of the polybissilsesquioxanes could be controlled by changing the ethanol/water volume ratio in the reaction mixture. After carbonization at 900 °C for 4.0 h and removal of silica, single-handed twisted carbonaceous tubular nanoribbons and single-layered nanoribbons with micropores in the walls were obtained. X-ray diffraction and Raman spectroscopy analyses indicated that the carbon is predominantly amorphous. The circular dichroism spectra show that the twisted tubular nanoribbons exhibit optical activity, while the twisted single-layered nanoribbons do not. The results shown here indicate that chirality is transferred from the organic self-assemblies to the inner surfaces of the 4,4'-biphenylene-bridged polybissilsesquioxane tubular nanoribbons and subsequently to those of the carbonaceous tubular nanoribbons. © 2015 Wiley Periodicals, Inc.

Shifting Plasma

NASA Image and Video Library

2017-05-09

Strands of plasma at the sun edge shifted and twisted back and forth over a 22-hour period, May 2-3, 2017. In this close-up from NASA Solar Dynamics Observatory, the strands are being manipulated by strong magnetic forces associated with active region. This kind of activity is not at all uncommon, but best viewed in profile. The images were taken in a wavelength of extreme ultraviolet light. To give a sense of scale, the strands hover above the sun more than several times the size of Earth. Movies are available at https://photojournal.jpl.nasa.gov/catalog/PIA21632

Nanorobotic System iTRo for Controllable 1D Micro/nano Material Twisting Test.

PubMed

Lu, Haojian; Shang, Wanfeng; Wei, Xueyong; Yang, Zhan; Fukuda, Toshio; Shen, Yajing

2017-06-08

In-situ micro/nano characterization is an indispensable methodology for material research. However, the precise in-situ SEM twisting of 1D material with large range is still challenge for current techniques, mainly due to the testing device's large size and the misalignment between specimen and the rotation axis. Herein, we propose an in-situ twist test robot (iTRo) to address the above challenges and realize the precise in-situ SEM twisting test for the first time. Firstly, we developed the iTRo and designed a series of control strategies, including assembly error initialization, triple-image alignment (TIA) method for rotation axis alignment, deformation-based contact detection (DCD) method for sample assembly, and switch control for robots cooperation. After that, we chose three typical 1D material, i.e., magnetic microwire Fe 74 B 13 Si 11 C 2 , glass fiber, and human hair, for twisting test and characterized their properties. The results showed that our approach is able to align the sample to the twisting axis accurately, and it can provide large twisting range, heavy load and high controllability. This work fills the blank of current in-situ mechanical characterization methodologies, which is expected to give significant impact in the fundamental nanomaterial research and practical micro/nano characterization.

Design and simulation of the micromixer with chaotic advection in twisted microchannels.

PubMed

Jen, Chun-Ping; Wu, Chung-Yi; Lin, Yu-Cheng; Wu, Ching-Yi

2003-05-01

Chaotic mixers with twisted microchannels were designed and simulated numerically in the present study. The phenomenon whereby a simple Eulerian velocity field may generate a chaotic response in the distribution of a Lagrangian marker is termed chaotic advection. Dynamic system theory indicates that chaotic particle motion can occur when a velocity field is either two-dimensional and time-dependent, or three-dimensional. In the present study, micromixers with three-dimensional structures of the twisted microchannel were designed in order to induce chaotic mixing. In addition to the basic T-mixer, three types of micromixers with inclined, oblique and wavelike microchannels were investigated. In the design of each twisted microchannel, the angle of the channels' bottoms alternates in each subsection. When the fluids enter the twisted microchannels, the flow sways around the varying structures within the microchannels. The designs of the twisted microchannels provide a third degree of freedom to the flow field in the microchannel. Therefore, chaotic regimes that lead to chaotic mixing may arise. The numerical results indicate that mixing occurs in the main channel and progressively larger mixing lengths are required as the Peclet number increased. The swaying of the flow in the twisted microchannel causes chaotic advection. Among the four micromixer designs, the micromixer with the inclined channel most improved mixing. Furthermore, using the inclined mixer with six subsections yielded optimum performance, decreasing the mixing length by up to 31% from that of the basic T-mixer.

SET8 promotes epithelial–mesenchymal transition and confers TWIST dual transcriptional activities

PubMed Central

Yang, Fen; Sun, Luyang; Li, Qian; Han, Xiao; Lei, Liandi; Zhang, Hua; Shang, Yongfeng

2012-01-01

SET8 is implicated in transcriptional regulation, heterochromatin formation, genomic stability, cell-cycle progression, and development. As such, it is predicted that SET8 might be involved in the development and progression of tumour. However, whether and how SET8 might be implicated in tumourigenesis is currently unknown. Here, we report that SET8 is physically associated with TWIST, a master regulator of epithelial–mesenchymal transition (EMT). We demonstrated that SET8 and TWIST are functionally interdependent in promoting EMT and enhancing the invasive potential of breast cancer cells in vitro and in vivo. We showed that SET8 acts as a dual epigenetic modifier on the promoters of the TWIST target genes E-cadherin and N-cadherin via its H4K20 monomethylation activity. Significantly, in breast carcinoma samples, SET8 expression is positively correlated with metastasis and the expression of TWIST and N-cadherin and negatively correlated with E-cadherin. Together, our experiments revealed a novel role for SET8 in tumour invasion and metastasis and provide a molecular mechanism underlying TWIST-promoted EMT, suggesting SET8 as a potential target for intervention of the metastasis of breast cancer. PMID:21983900

Effect of Magnetic Twist on Nonlinear Transverse Kink Oscillations of Line-tied Magnetic Flux Tubes

NASA Astrophysics Data System (ADS)

Terradas, J.; Magyar, N.; Van Doorsselaere, T.

2018-01-01

Magnetic twist is thought to play an important role in many structures of the solar atmosphere. One of the effects of twist is to modify the properties of the eigenmodes of magnetic tubes. In the linear regime standing kink solutions are characterized by a change in polarization of the transverse displacement along the twisted tube. In the nonlinear regime, magnetic twist affects the development of shear instabilities that appear at the tube boundary when it is oscillating laterally. These Kelvin–Helmholtz instabilities (KHI) are produced either by the jump in the azimuthal component of the velocity at the edge of the sharp boundary between the internal and external part of the tube or by the continuous small length scales produced by phase mixing when there is a smooth inhomogeneous layer. In this work the effect of twist is consistently investigated by solving the time-dependent problem including the process of energy transfer to the inhomogeneous layer. It is found that twist always delays the appearance of the shear instability, but for tubes with thin inhomogeneous layers the effect is relatively small for moderate values of twist. On the contrary, for tubes with thick layers, the effect of twist is much stronger. This can have some important implications regarding observations of transverse kink modes and the KHI itself.

Universality, twisted fans, and the Ising model. [Renormalization, two-loop calculations, scale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dash, J.W.; Harrington, S.J.

1975-06-24

Critical exponents are evaluated for the Ising model using universality in the form of ''twisted fans'' previously introduced in Reggeon field theory. The universality is with respect to scales induced through renormalization. Exact twists are obtained at ..beta.. = 0 in one loop for D = 2,3 with ..nu.. = 0.75 and 0.60 respectively. In two loops one obtains ..nu.. approximately 1.32 and 0.68. No twists are obtained for eta, however. The results for the standard two loop calculations are also presented as functions of a scale.

Feed system design and experimental results in the uhf model study for the proposed Urbana phased array

NASA Technical Reports Server (NTRS)

Loane, J. T.; Bowhill, S. A.; Mayes, P. E.

1982-01-01

The effects of atmospheric turbulence and the basis for the coherent scatter radar techniques are discussed. The reasons are given for upgrading the Radar system to a larger steerable array. Phase array theory pertinent to the system design is reviewed, along with approximations for maximum directive gain and blind angles due to mutual coupling. The methods and construction techniques employed in the UHF model study are explained. The antenna range is described, with a block diagram for the mode of operation used.

Space Station UCS antenna pattern computation and measurement. [UHF Communication Subsystem

NASA Technical Reports Server (NTRS)

Hwu, Shian U.; Lu, Ba P.; Johnson, Larry A.; Fournet, Jon S.; Panneton, Robert J.; Ngo, John D.; Eggers, Donald S.; Arndt, G. D.

1993-01-01

The purpose of this paper is to analyze the interference to the Space Station Ultrahigh Frequency (UHF) Communication Subsystem (UCS) antenna radiation pattern due to its environment - Space Station. A hybrid Computational Electromagnetics (CEM) technique was applied in this study. The antenna was modeled using the Method of Moments (MOM) and the radiation patterns were computed using the Uniform Geometrical Theory of Diffraction (GTD) in which the effects of the reflected and diffracted fields from surfaces, edges, and vertices of the Space Station structures were included. In order to validate the CEM techniques, and to provide confidence in the computer-generated results, a comparison with experimental measurements was made for a 1/15 scale Space Station mockup. Based on the results accomplished, good agreement on experimental and computed results was obtained. The computed results using the CEM techniques for the Space Station UCS antenna pattern predictions have been validated.

An analysis of rotor blade twist variables associated with different Euler sequences and pretwist treatments

NASA Technical Reports Server (NTRS)

Alkire, K.

1984-01-01

A nonlinear analysis which is necessary to adequately model elastic helicopter rotor blades experiencing moderately large deformations was examined. The analysis must be based on an appropriate description of the blade's deformation geometry including elastic bending and twist. Built-in pretwist angles complicate the deformation process ant its definition. Relationships between the twist variables associated with different rotation sequences and corresponding forms of the transformation matrix are lasted. Relationships between the twist variables associated with first, the pretwist combined with the deformation twist are included. Many of the corresponding forms of the transformation matrix for the two cases are listed. It is shown that twist variables connected with the combined twist treatment are related to those where the pretwist is applied initially. A method to determine the relationships and some results are outlined. A procedure to evaluate the transformation matrix that eliminates the Eulerlike sequence altogether is demonstrated. The resulting form of the transformation matrix is unaffected by rotation sequence or pretwist treatment.

Direct Observation of Twisted Surface skyrmions in Bulk Crystals

NASA Astrophysics Data System (ADS)

Zhang, S. L.; van der Laan, G.; Wang, W. W.; Haghighirad, A. A.; Hesjedal, T.

2018-06-01

Magnetic skyrmions in noncentrosymmetric helimagnets with Dn symmetry are Bloch-type magnetization swirls with a helicity angle of ±9 0 ° . At the surface of helimagnetic thin films below a critical thickness, a twisted skyrmion state with an arbitrary helicity angle has been proposed; however, its direct experimental observation has remained elusive. Here, we show that circularly polarized resonant elastic x-ray scattering is able to unambiguously measure the helicity angle of surface skyrmions, providing direct experimental evidence that a twisted skyrmion surface state also exists in bulk systems. The exact surface helicity angles of twisted skyrmions for both left- and right-handed chiral bulk Cu2 OSeO3 , in the single as well as in the multidomain skyrmion lattice state, are determined, revealing their detailed internal structure. Our findings suggest that a skyrmion surface reconstruction is a universal phenomenon, stemming from the breaking of translational symmetry at the interface.

Approximate spin projection of three-component UHF wavefunctions - The states of the pentachlorocyclopentadienyl cation and the croconate dianion, C5O5/2-/

NASA Technical Reports Server (NTRS)

Phillips, D. H.; Schug, J. C.

1974-01-01

The approximate spin projection method of Amos et al. is extended to handle UHF wave functions having three significant components of differing multiplicity. An expression is given for the energy after single annihilation which differs from that of Amos and Hall. The new expression reproduces the results obtained from a previous exact calculation for which the weights and energies of the components are known. The extended approximate projection method is applied to the pi-electron UHF wave functions for the ground states of the pentachlorocyclopentadienyl cation and the croconate dianion, C5O5(2-). The results indicate a triplet ground state for the former and a singlet ground state for the latter, in agreement with experimental ESR susceptibility measurements for these molecular ions. C5C15(-) cannont be treated by restricted Hartree-Fock theory, due to its open-shell ground state. Incorrect results are obtained for the croconate dianion, if restricted Hartree-Fock theory and singly excited configuration interactions are utilized.

Twisted, multifilament Nb3Sn superconductive ribbon

NASA Technical Reports Server (NTRS)

Coles, W. D.

1972-01-01

An experimental study of superconductor stabilization has resulted in the successful application of the concepts of filamentary structure and conductor twist to Nb3Sn ribbon. The Nb3Sn is formed in parallel, helical paths, which are continuous around the ribbon. Short lengths (12-18cm) of 1.27 cm wide superconductive ribbon were produced. The filamentary and twist characteristics are incorporated in the ribbon by means of an inert mask formed on the ribbon surface early in the fabrication process. Diffusion reaction of the niobium and tin is prevented at the filament boundaries. Described are the conductor methods of fabrication, and test results obtained. The technology required to adapt the processes for the production of long lengths of ribbon is available.

Elastic continuum theory: towards understanding of the twist-bend nematic phases.

PubMed

Barbero, G; Evangelista, L R; Rosseto, M P; Zola, R S; Lelidis, I

2015-09-01

The twist-bend nematic phase, N_{TB}, may be viewed as a heliconical molecular arrangement in which the director n precesses uniformly about an extra director field, t. It corresponds to a nematic ground state exhibiting nanoscale periodic modulation. To demonstrate the stability of this phase from the elastic point of view, a natural extension of the Frank elastic energy density is proposed. The elastic energy density is built in terms of the elements of symmetry of the new phase in which intervene the components of these director fields together with the usual Cartesian tensors. It is shown that the ground state corresponds to a deformed state for which K_{22}>K_{33}. In the framework of the model, the phase transition between the usual and the twist-bend nematic phase is of second order with a finite wave vector. The model does not require a negative K_{33} in agreement with recent experimental data that yield K_{33}>0. A threshold is predicted for the molecular twist power below which no transition to a twist-bend nematic may occur.

High performance twisted and coiled soft actuator with spandex fiber for artificial muscles

NASA Astrophysics Data System (ADS)

Yang, Sang Yul; Cho, Kyeong Ho; Kim, Youngeun; Song, Min-Geun; Jung, Ho Sang; Yoo, Ji Wang; Moon, Hyungpil; Koo, Ja Choon; Nam, Jae-do; Ryeol Choi, Hyouk

2017-10-01

This paper reports the twisted and coiled soft actuator (abbreviated with STCA) with spandex fiber. The STCA exhibits higher actuation strain at lower temperature than the previous nylon twisted and coiled soft actuators (abbreviated with NTCAs). While NTCAs are fabricated using a twist-insertion process until coils are formed, a new method is developed to fabricate the STCA using the ultra-stretch of spandex, whereby the STCA is twisted again after the coil has been formed. A 6-gear-twist-insertion device that increases the stability and the fabrication speed is developed to fabricate the STCA. The superior performance exhibited by the STCA is due to the 14% contraction strain of the bare spandex (bare nylon: 4%) and the low spring constant of 0.0115 N mm-1. The maximum tensile actuation strain of STCA was 45% at 130 °C, and the maximum specific work was 1.523 kJ kg-1 at 130 °C. STCA could repeatedly actuate 100 times with a strain change of less than 0.4%.

Using a LIDAR Vegetation Model to Predict UHF SAR Attenuation in Coniferous Forests

PubMed Central

Swanson, Alan; Huang, Shengli; Crabtree, Robert

2009-01-01

Attenuation of radar signals by vegetation can be a problem for target detection and GPS reception, and is an important parameter in models describing vegetation backscatter. Here we first present a model describing the 3D distribution of stem and foliage structure based on small footprint scanning LIDAR data. Secondly we present a model that uses ray-tracing methodology to record detailed interactions between simulated radar beams and vegetation components. These interactions are combined over the SAR aperture and used to predict two-way attenuation of the SAR signal. Accuracy of the model is demonstrated using UHF SAR observations of large trihedral corner reflectors in coniferous forest stands. Our study showed that the model explains between 66% and 81% of the variability in observed attenuation. PMID:22573972

Metastasis-associated in colon cancer-1 promotes vasculogenic mimicry in gastric cancer by upregulating TWIST1/2

PubMed Central

Wang, Lin; Lin, Li; Chen, Xi; Sun, Li; Liao, Yulin; Huang, Na; Liao, Wangjun

2015-01-01

Vasculogenic mimicry (VM) is a blood supply modality that is strongly associated with the epithelial-mesenchymal transition (EMT), TWIST1 activation and tumor progression. We previously reported that metastasis-associated in colon cancer-1 (MACC1) induced the EMT and was associated with a poor prognosis of patients with gastric cancer (GC), but it remains unknown whether MACC1 promotes VM and regulates the TWIST signaling pathway in GC. In this study, we investigated MACC1 expression and VM by immunohistochemistry in 88 patients with stage IV GC, and also investigated the role of TWIST1 and TWIST2 in MACC1-induced VM by using nude mice with GC xenografts and GC cell lines. We found that the VM density was significantly increased in the tumors of patients who died of GC and was positively correlated with MACC1 immunoreactivity (p < 0.05). The 3-year survival rate was only 8.6% in patients whose tumors showed double positive staining for MACC1 and VM, whereas it was 41.7% in patients whose tumors were negative for both MACC1 and VM. Moreover, nuclear expression of MACC1, TWIST1, and TWIST2 was upregulated in GC tissues compared with matched adjacent non-tumorous tissues (p < 0.05). Overexpression of MACC1 increased TWIST1/2 expression and induced typical VM in the GC xenografts of nude mice and in GC cell lines. MACC1 enhanced TWIST1/2 promoter activity and facilitated VM, while silencing of TWIST1 or TWIST2 inhibited VM. Hepatocyte growth factor (HGF) increased the nuclear translocation of MACC1, TWIST1, and TWIST2, while a c-Met inhibitor reduced these effects. These findings indicate that MACC1 promotes VM in GC by regulating the HGF/c-Met-TWIST1/2 signaling pathway, which means that MACC1 and this pathway are potential new therapeutic targets for GC. PMID:25895023

Insulin-like growth factor-I induces CLU expression through Twist1 to promote prostate cancer growth.

PubMed

Takeuchi, Ario; Shiota, Masaki; Beraldi, Eliana; Thaper, Daksh; Takahara, Kiyoshi; Ibuki, Naokazu; Pollak, Michael; Cox, Michael E; Naito, Seiji; Gleave, Martin E; Zoubeidi, Amina

2014-03-25

Clusterin (CLU) is cytoprotective molecular chaperone that is highly expressed in castrate-resistant prostate cancer (CRPC). CRPC is also characterized by increased insulin-like growth factor (IGF)-I responsiveness which induces prostate cancer survival and CLU expression. However, how IGF-I induces CLU expression and whether CLU is required for IGF-mediated growth signaling remain unknown. Here we show that IGF-I induced CLU via STAT3-Twist1 signaling pathway. In response to IGF-I, STAT3 was phosphorylated, translocated to the nucleus and bound to the Twist1 promoter to activate Twist1 transcription. In turn, Twist1 bound to E-boxes on the CLU promoter and activated CLU transcription. Inversely, we demonstrated that knocking down Twist1 abrogated IGF-I induced CLU expression, indicating that Twist1 mediated IGF-I-induced CLU expression. When PTEN knockout mice were crossed with lit/lit mice, the resultant IGF-I deficiency suppressed Twist1 as well as CLU gene expression in mouse prostate glands. Moreover, both Twist1 and CLU knockdown suppressed prostate cancer growth accelerated by IGF-I, suggesting the relevance of this signaling not only in an in vitro, but also in an in vivo. Collectively, this study indicates that IGF-I induces CLU expression through sequential activation of STAT3 and Twist1, and suggests that this signaling cascade plays a critical role in prostate cancer pathogenesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Wrinkles, loops, and topological defects in twisted ribbons

NASA Astrophysics Data System (ADS)

Chopin, Julien

Nature abounds with elastic ribbon like shapes including double-stranded semiflexible polymers, graphene and metal oxide nanoribbons which are examples of elongated elastic structures with a strongly anisotropic cross-section. Due to this specific geometry, it is far from trivial to anticipate if a ribbon should be considered as a flat flexible filament or a narrow thin plate. We thus perform an experiment in which a thin elastic ribbon is loaded using a twisting and traction device coupled with a micro X-ray computed tomography machine allowing a full 3D shape reconstruction. A wealth of morphological behaviors can be observed including wrinkled helicoids, curled and looped configurations, and faceted ribbons. In this talk, I will show that most morphologies can be understood using a far-from-threshold approach and simple scaling arguments. Further, we find that the various shapes can be organized in a phase diagram using the twist, the tension, and the geometry of the ribbon as control parameters. Finally, I will discuss the spontaneous formation of topological defects with negatively-signed Gaussian charge at large twist and small but finite stretch.

Fiber-Optic Sensors for Measurements of Torsion, Twist and Rotation: A Review.

PubMed

Budinski, Vedran; Donlagic, Denis

2017-02-23

Optical measurement of mechanical parameters is gaining significant commercial interest in different industry sectors. Torsion, twist and rotation are among the very frequently measured mechanical parameters. Recently, twist/torsion/rotation sensors have become a topic of intense fiber-optic sensor research. Various sensing concepts have been reported. Many of those have different properties and performances, and many of them still need to be proven in out-of-the laboratory use. This paper provides an overview of basic approaches and a review of current state-of-the-art in fiber optic sensors for measurements of torsion, twist and/or rotation.Invited Paper.

Define the Twist ATX LPAR1 Signaling Axis in Promoting Obesity Associated Triple Negative Breast Cancer

DTIC Science & Technology

2017-05-01

developed CRISPR technology to examine if Twist enhances ATX and LPAR1 expression. Specifically, we performed lentiviral transduction of Twist...targeting gRNA into breast cancer cells MDA-MB-578 and SUM-1315, and selected single cell colony with Twist knockout. We chose CRISPR -gRNA over the...shRNA system which was originally proposed, as CRISPR provides higher specificity and fewer off-target effects. To verify knockout of Twist, we first

Design of a New Built-in UHF Multi-Frequency Antenna Sensor for Partial Discharge Detection in High-Voltage Switchgears.

PubMed

Zhang, Xiaoxing; Cheng, Zheng; Gui, Yingang

2016-07-26

In this study a new built-in ultrahigh frequency (UHF) antenna sensor was designed and applied in a high-voltage switchgear for partial discharge (PD) detection. The casing of the switchgear was initially used as the ground plane of the antenna sensor, which integrated the sensor into the high-voltage switchgear. The Koch snowflake patch was adopted as the radiation patch of the antenna to overcome the disadvantages of common microstrip antennas, and the feed position and the dielectric layer thickness were simulated in detail. Simulation results show that the antenna sensor possessed four resonant points with good impedance matching from 300 MHz to 1000 MHz, and it also presented good multi-frequency performance in the entire working frequency band. PD detection experiments were conducted in the high-voltage switchgear, and the fabricated antenna sensor was effectively built into the high-voltage switchgear. In order to reflect the advantages of the built-in antenna sensor, another external UHF antenna sensor was used as a comparison to simultaneously detect PD. Experimental results demonstrated that the built-in antenna sensor possessed high detection sensitivity and strong anti-interference capacity, which ensured the practicability of the design. In addition, it had more high-voltage switchgear PD detection advantages than the external sensor.

Design of a New Built-in UHF Multi-Frequency Antenna Sensor for Partial Discharge Detection in High-Voltage Switchgears

PubMed Central

Zhang, Xiaoxing; Cheng, Zheng; Gui, Yingang

2016-01-01

In this study a new built-in ultrahigh frequency (UHF) antenna sensor was designed and applied in a high-voltage switchgear for partial discharge (PD) detection. The casing of the switchgear was initially used as the ground plane of the antenna sensor, which integrated the sensor into the high-voltage switchgear. The Koch snowflake patch was adopted as the radiation patch of the antenna to overcome the disadvantages of common microstrip antennas, and the feed position and the dielectric layer thickness were simulated in detail. Simulation results show that the antenna sensor possessed four resonant points with good impedance matching from 300 MHz to 1000 MHz, and it also presented good multi-frequency performance in the entire working frequency band. PD detection experiments were conducted in the high-voltage switchgear, and the fabricated antenna sensor was effectively built into the high-voltage switchgear. In order to reflect the advantages of the built-in antenna sensor, another external UHF antenna sensor was used as a comparison to simultaneously detect PD. Experimental results demonstrated that the built-in antenna sensor possessed high detection sensitivity and strong anti-interference capacity, which ensured the practicability of the design. In addition, it had more high-voltage switchgear PD detection advantages than the external sensor. PMID:27472331

Modeling and development of a twisting wing using inductively heated shape memory alloy actuators

NASA Astrophysics Data System (ADS)

Saunders, Robert N.; Hartl, Darren J.; Boyd, James G.; Lagoudas, Dimitris C.

2015-04-01

Wing twisting has been shown to improve aircraft flight performance. The potential benefits of a twisting wing are often outweighed by the mass of the system required to twist the wing. Shape memory alloy (SMA) actuators repeatedly demonstrate abilities and properties that are ideal for aerospace actuation systems. Recent advances have shown an SMA torsional actuator that can be manufactured and trained with the ability to generate large twisting deformations under substantial loading. The primary disadvantage of implementing large SMA actuators has been their slow actuation time compared to conventional actuators. However, inductive heating of an SMA actuator allows it to generate a full actuation cycle in just seconds rather than minutes while still . The aim of this work is to demonstrate an experimental wing being twisted to approximately 10 degrees by using an inductively heated SMA torsional actuator. This study also considers a 3-D electromagnetic thermo-mechanical model of the SMA-wing system and compare these results to experiments to demonstrate modeling capabilities.

Polarization-dependent diffraction in all-dielectric, twisted-band structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kardaś, Tomasz M.; Jagodnicka, Anna; Wasylczyk, Piotr, E-mail: pwasylcz@fuw.edu.pl

2015-11-23

We propose a concept for light polarization management: polarization-dependent diffraction in all-dielectric microstructures. Numerical simulations of light propagation show that with an appropriately configured array of twisted bands, such structures may exhibit zero birefringence and at the same time diffract two circular polarizations with different efficiencies. Non-birefringent structures as thin as 3 μm have a significant difference in diffraction efficiency for left- and right-hand circular polarizations. We identify the structural parameters of such twisted-band matrices for optimum performance as circular polarizers.

A low-volume, low-mass, low-power UHF proximity micro-transceiver for Mars Exploration

NASA Technical Reports Server (NTRS)

Kuhn, William; Lay, Norman; Grigorian, Edwin

2005-01-01

UHF half-duplex micro-transceiver measuring 1 cubic centimeter, weighing less than 10 grams, and operating at 40 mW on receive and 50mW, 300mW, or 3W on transmit is described. The micro-transceiver is being designed for future Mars exploration missions, but can be adapted for other proximity links. It supports transmission rates up to 256 ksps and higher in BPSK or QPSK format for data return and receives command/control instructions at up to 8 ksps. In addition to its low mass/power features, temperature compensated circuit and system design and radiation tolerance allow operation outside of large shielded enclosures, further reducing the mass and complexity of exploration vehicles.

Controlling coupled bending-twisting vibrations of anisotropic composite wing

NASA Astrophysics Data System (ADS)

Ryabov, Victor; Yartsev, Boris

2018-05-01

The paper discusses the possibility to control coupled bending-twisting vibrations of anisotropic composite wing by means of the monoclinic structures in the reinforcement of the plating. Decomposing the potential straining energy and kinetic energy of natural vibration modes into interacting and non-interacting parts, it became possible to introduce the two coefficients that integrally consider the effect of geometry and reinforcement structure upon the dynamic response parameters of the wing. The first of these coefficients describes the elastic coupling of the natural vibration modes, the second coefficient describes the inertial one. The paper describes the numerical studies showing how the orientation of considerably anisotropic CRP layers in the plating affects natural frequencies, loss factors, coefficients of elastic and inertial coupling for several lower tones of natural bending-twisting vibrations of the wing. Besides, for each vibration mode, partial values of the above mentioned dynamic response parameters were determined by means of the relationships for orthotropic structures where instead of "free" shearing modulus in the reinforcement plant, "pure" shearing modulus is used. Joint analysis of the obtained results has shown that each pair of bending-twisting vibration modes has its orientation angle ranges of the reinforcing layers where the inertial coupling caused by asymmetry of the cross-section profile with respect to the main axes of inertia decreases, down to the complete extinction, due to the generation of the elastic coupling in the plating material. These ranges are characterized by the two main features: 1) the difference in the natural frequencies of the investigated pair of bending-twisting vibration modes is the minimum and 2) natural frequencies of bending-twisting vibrations belong to a stretch restricted by corresponding partial natural frequencies of the investigated pair of vibration modes. This result is of practical importance

Terahertz conductivity of twisted bilayer graphene

NASA Astrophysics Data System (ADS)

Chia, Elbert E. M.; Zou, Xingquan; Shang, Jingzhi; Leaw, Jianing; Luo, Zhiqiang; Luo, Liyan; Cheong, Siew Ann; Su, Haibin; Zhu, Jian-Xin; Castro Neto, A. H.; Yu, Ting

2013-03-01

Using terahertz time-domain spectroscopy, the real part of optical conductivity [σ1 (ω) ] of twisted bilayer graphene was obtained at different temperatures (10 - 300 K) in the frequency range 0.3 - 3 THz. On top of a Drude-like response, we see a strong and narrow peak in σ1 (ω) at ~2.7 THz. We analyze the overall Drude-like response using a disorder-dependent (unitary scattering) model, then attribute the peak at 2.7 THz to an enhanced density of states at that energy, that is caused by the presence of van Hove singularities arising from a commensurate twisting of the two graphene layers. Singapore MOE AcRF Tier 2 (ARC 23/08), NRF-CRP (NRF-CRP4-2008-04), NNSA of the U.S. DOE at LANL (DE-AC52-06NA25396), LANL LDRD Program, NRF-CRP (R-144-000-295-281), DOE DE-FG02-08ER46512, ONR MURI N00014-09-1-1063.

Development of an active twist rotor blade with distributed actuation and orthotropic material

NASA Astrophysics Data System (ADS)

Wierach, Peter; Riemenschneider, Johannes; Keye, Stefan

2005-05-01

Individual blade control (IBC) as well as higher harmonic control (HHC) for helicopter rotors promises to be a method to increase flight performance and to reduce vibration and noise. For those controls, an additional twist actuation of the rotor blade is needed. The developed concept comprises the implementation of distributed piezoelectric actuation into the rotor blade skin. In order to maximize the twist within given constraints, as torsional rigidity and given actuator design, the concept takes advantage of an orthotropic rotor blade skin. That way, a combination of shear actuation with orthotropic coupling generates more twist than each one of these effects alone. Previous approaches with distributed actuation used actuators operating in +/-45° direction with quasi-isotropic composites. A FE-Model of the blade was developed and validated using a simplified demonstrator. The objective of this study was to identify the effects of various geometric and material parameters to optimize the active twist performance of the blades. The whole development was embedded in an iterative process followed by an objective assessment. For this purpose a detailed structural model on the basis of the BO105 model rotor blade was developed, to predict the performance with respect to rotor dynamics, stability, aerodynamics and acoustics. Rotor dynamic simulations provided an initial overview of the active twist rotor performance. In comparison to the BO105 baseline rotor a noise reduction of 3 dB was predicted for an active twist of 0.8° at the blade tip. Additionally, a power reduction of 2.3% at 87m/s based on a 2.5 to BO105 was computed. A demonstrator blade with a rotor radius of 2m has been designed and manufactured. This blade will be tested to prove, that the calculated maximum twist can also be achieved under centrifugal loads.

Coexistence of twisted and untwisted crystals: An impurity/structural order model with implications for agate patterns

USGS Publications Warehouse

Comer, J.; Ortoleva, P.

2007-01-01

Coexistence of twisted and untwisted crystals is explained via a model that accounts for the coupling of the entropic and energetic effects of impurities and a supra-lattice-scale structural order parameter. It is shown that twisted impure crystals can be in equilibrium with untwisted purer ones. The model explains how coexistence can occur in agates and other systems under hydrostatic stress. The model implies that untwisted crystals grown under one set of conditions could undergo a phase separation that, when accompanied by an imposed compositional gradient, leads to commonly observed, alternating bands of twisted and untwisted crystals and, when occurring in the absence of an external gradient, mossy patterns of crystal texture can emerge. This phenomenon is not related to anisotropic applied stress. Rather coexistence is a consequence of a compositional segregation/twist phase transition. Since twist coexistence is a compositional equilibrium, it arises from the exchange between bulk phases; hence, the detailed nature of the atomic structure within an interface between twisted and untwisted zones is not relevant. The approach places crystal-twist phenomena within the theory of order/disorder phase transitions.

Thymoquinone inhibits cancer metastasis by downregulating TWIST1 expression to reduce epithelial to mesenchymal transition.

PubMed

Khan, Md Asaduzzaman; Tania, Mousumi; Wei, Chunli; Mei, Zhiqiang; Fu, Shelly; Cheng, Jingliang; Xu, Jianming; Fu, Junjiang

2015-08-14

Proteins that promote epithelial to mesenchymal transition (EMT) are associated with cancer metastasis. Inhibition of EMT regulators may be a promising approach in cancer therapy. In this study, Thymoquinone (TQ) was used to treat cancer cell lines to investigate its effects on EMT-regulatory proteins and cancer metastasis. We show that TQ inhibited cancer cell growth, migration and invasion in a dose-dependent manner. At the molecular level, TQ treatment decreased the transcriptional activity of the TWIST1 promoter and the mRNA expression of TWIST1, an EMT-promoting transcription factor. Accordingly, TQ treatment also decreased the expression of TWIST1-upregulated genes such as N-Cadherin and increased the expression of TWIST1-repressed genes such as E-Cadherin, resulting in a reduction of cell migration and invasion. TQ treatment also inhibited the growth and metastasis of cancer cell-derived xenograft tumors in mice but partially attenuated the migration and invasion in TWIST1-overexpressed cell lines. Furthermore, we found that TQ treatment enhanced the promoter DNA methylation of the TWIST1 gene in BT 549 cells. Together, these results demonstrate that TQ treatment inhibits TWIST1 promoter activity and decreases its expression, leading to the inhibition of cancer cell migration, invasion and metastasis. These findings suggest TQ as a potential small molecular inhibitor of cancer growth and metastasis.

Thymoquinone inhibits cancer metastasis by downregulating TWIST1 expression to reduce epithelial to mesenchymal transition

PubMed Central

Khan, Md. Asaduzzaman; Tania, Mousumi; Wei, Chunli; Mei, Zhiqiang; Fu, Shelly; Cheng, Jingliang; Xu, Jianming; Fu, Junjiang

2015-01-01

Proteins that promote epithelial to mesenchymal transition (EMT) are associated with cancer metastasis. Inhibition of EMT regulators may be a promising approach in cancer therapy. In this study, Thymoquinone (TQ) was used to treat cancer cell lines to investigate its effects on EMT-regulatory proteins and cancer metastasis. We show that TQ inhibited cancer cell growth, migration and invasion in a dose-dependent manner. At the molecular level, TQ treatment decreased the transcriptional activity of the TWIST1 promoter and the mRNA expression of TWIST1, an EMT-promoting transcription factor. Accordingly, TQ treatment also decreased the expression of TWIST1-upregulated genes such as N-Cadherin and increased the expression of TWIST1-repressed genes such as E-Cadherin, resulting in a reduction of cell migration and invasion. TQ treatment also inhibited the growth and metastasis of cancer cell-derived xenograft tumors in mice but partially attenuated the migration and invasion in TWIST1-overexpressed cell lines. Furthermore, we found that TQ treatment enhanced the promoter DNA methylation of the TWIST1 gene in BT 549 cells. Together, these results demonstrate that TQ treatment inhibits TWIST1 promoter activity and decreases its expression, leading to the inhibition of cancer cell migration, invasion and metastasis. These findings suggest TQ as a potential small molecular inhibitor of cancer growth and metastasis. PMID:26023736

Design and analysis of variable-twist tiltrotor blades using shape memory alloy hybrid composites

NASA Astrophysics Data System (ADS)

Park, Jae-Sang; Kim, Seong-Hwan; Jung, Sung Nam; Lee, Myeong-Kyu

2011-01-01

The tiltrotor blade, or proprotor, acts as a rotor in the helicopter mode and as a propeller in the airplane mode. For a better performance, the proprotor should have different built-in twist distributions along the blade span, suitable for each operational mode. This paper proposes a new variable-twist proprotor concept that can adjust the built-in twist distribution for given flight modes. For a variable-twist control, the present proprotor adopts shape memory alloy hybrid composites (SMAHC) containing shape memory alloy (SMA) wires embedded in the composite matrix. The proprotor of the Korea Aerospace Research Institute (KARI) Smart Unmanned Aerial Vehicle (SUAV), which is based on the tiltrotor concept, is used as a baseline proprotor model. The cross-sectional properties of the variable-twist proprotor are designed to maintain the cross-sectional properties of the original proprotor as closely as possible. However, the torsion stiffness is significantly reduced to accommodate the variable-twist control. A nonlinear flexible multibody dynamic analysis is employed to investigate the dynamic characteristics of the proprotor such as natural frequency and damping in the whirl flutter mode, the blade structural loads in a transition flight and the rotor performance in hover. The numerical results show that the present proprotor is designed to have a strong similarity to the baseline proprotor in dynamic and load characteristics. It is demonstrated that the present proprotor concept could be used to improve the hover performance adaptively when the variable-twist control using the SMAHC is applied appropriately.

Reproducibility of Echocardiograph-Derived Multilevel Left Ventricular Apical Twist Mechanics.

PubMed

Stewart, Glenn M; Yamada, Akira; Kavanagh, Justin J; Haseler, Luke J; Chan, Jonathan; Sabapathy, Surendran

2016-02-01

Left ventricular (LV) twist mechanics are routinely assessed via echocardiography in clinical and research trials investigating the function of obliquely oriented myocardial fibers. However, echocardiograph-derived measures of LV twist may be compromised by nonstandardized acquisition of the apical image. This study examined the reproducibility of echocardiograph-derived parameters of apical twist mechanics at multiple levels of the apical myocardium. Two sets of 2D LV parasternal short-axis images were obtained in 30 healthy subjects (24 men; 19-57 year) via echocardiography. Images were acquired immediately distal to the papillary muscles (apical image 1), immediately above the point of LV cavity obliteration at end systole (apical image 3), and midway between apical image 1 and apical image 3 (apical image 2). Repeat scans were performed within 1 hour, and twist mechanics (rotation and rotation rate) were calculated via frame-by-frame tracking of natural acoustic echocardiographic markers (speckle tracking). The magnitude of apical rotation increased progressively toward the apex (apical image 1: 4.2 ± 2.1°, apical image 2: 7.2 ± 3.9°, apical image 3: 11.8 ± 4.6°). apical images 1, 2, and 3 each had moderate to good correlations between repeat scans (ICC: 0.531-0.856). When apical images 1, 2, and 3 were averaged, rotation was 7.7 ± 2.7° and between-scan correlation was excellent (ICC: 0.910). Similar results were observed for systolic and diastolic rotation rates. Averaging multiple standardized apical images, tending progressively toward the apex, generated the most reproducible rotation indices and may be optimal for the assessment of LV twist mechanics across therapeutic, interventional, and research studies; however, care should be taken given the influence of acquisition level on the magnitude of apical rotation. © 2015, Wiley Periodicals, Inc.

Dualities and Topological Field Theories from Twisted Geometries

NASA Astrophysics Data System (ADS)

Markov, Ruza

I will present three studies of string theory on twisted geometries. In the first calculation included in this dissertation we use gauge/gravity duality to study the Coulomb branch of an unusual type of nonlocal field theory, called Puff Field Theory. On the gravity side, this theory is given in terms of D3-branes in type IIB string theory with a geometric twist. While the field theory description, available in the IR limit, is a deformation of Yang-Mills gauge theory by an order seven operator which we here compute. In the rest of this dissertation we explore N = 4 super Yang-Mills (SYM) theory compactied on a circle with S-duality and R-symmetry twists that preserve N = 6 supersymmetry in 2 + 1D. It was shown that abelian theory on a flat manifold gives Chern-Simons theory in the low-energy limit and here we are interested in the non-abelian counterpart. To that end, we introduce external static supersymmetric quark and anti-quark sources into the theory and calculate the Witten Index of the resulting Hilbert space of ground states on a two-torus. Using these results we compute the action of simple Wilson loops on the Hilbert space of ground states without sources. In some cases we find disagreement between our results for the Wilson loop eigenvalues and previous conjectures about a connection with Chern-Simons theory. The last result discussed in this dissertation demonstrates a connection between gravitational Chern-Simons theory and N = 4 four-dimensional SYM theory compactified on a circle twisted by S-duality where the remaining three-manifold is not flat starting with the explicit geometric realization of S-duality in terms of (2, 0) theory.

Left ventricular twisting mechanics and exercise in healthy individuals: a systematic review

PubMed Central

Drury, C Taylor; Bredin, Shannon SD; Phillips, Aaron A; Warburton, Darren ER

2012-01-01

The aim of this study was to review systematically the effects of exercise on left ventricular (LV) twisting mechanics in healthy individuals. Literature searches were conducted in electronic databases for articles reporting measures of LV twisting mechanics in healthy individuals before and during/after exercise. Upon review, 18 articles were analyzed. Studies were separated by exercise type into the following four categories to allow for detailed comparisons: submaximal, prolonged endurance, maximal, and chronic endurance. Despite an overall methodological quality of low to moderate and within-group variations in exercise intensity, duration, and subject characteristics, important trends in the literature emerged. Most important, the coupling of LV systolic twisting and diastolic untwisting was present in all exercise types, as both were either improved or impaired concomitantly, highlighting the linkage between systole and diastole provided through LV twist. In addition, trends regarding the effects of age, training status, and cardiac loading also became apparent within different exercise types. Furthermore, a potential dose-response relationship between exercise duration and the degree of impairment to LV twisting mechanics was found. Although some disagreement existed in results, the observed trends provide important directions for future research. Future investigations should be of higher methodological quality and should include consistent exercise protocols and subject populations in order to minimize the variability between investigations. PMID:24198592

Gate induced monolayer behavior in twisted bilayer black phosphorus

NASA Astrophysics Data System (ADS)

Sevik, Cem; Wallbank, John R.; Gülseren, Oğuz; Peeters, François M.; Çakır, Deniz

2017-09-01

Optical and electronic properties of black phosphorus strongly depend on the number of layers and type of stacking. Using first-principles calculations within the framework of density functional theory, we investigate the electronic properties of bilayer black phosphorus with an interlayer twist angle of 90°. These calculations are complemented with a simple k\\centerdot p model which is able to capture most of the low energy features and is valid for arbitrary twist angles. The electronic spectrum of 90° twisted bilayer black phosphorus is found to be x-y isotropic in contrast to the monolayer. However x-y anisotropy, and a partial return to monolayer-like behavior, particularly in the valence band, can be induced by an external out-of-plane electric field. Moreover, the preferred hole effective mass can be rotated by 90° simply by changing the direction of the applied electric field. In particular, a + 0.4 (-0.4) V {{{\\mathringA}}-1} out-of-plane electric field results in a  ˜60% increase in the hole effective mass along the \\mathbf{y} (\\mathbf{x} ) axis and enhances the m\\mathbf{y}\\ast/m\\mathbf{x}\\ast (m\\mathbf{x}\\ast/m\\mathbf{y}\\ast ) ratio as much as by a factor of 40. Our DFT and k\\centerdot p simulations clearly indicate that the twist angle in combination with an appropriate gate voltage is a novel way to tune the electronic and optical properties of bilayer phosphorus and it gives us a new degree of freedom to engineer the properties of black phosphorus based devices.

DC conductivity of twisted bilayer graphene: Angle-dependent transport properties and effects of disorder

NASA Astrophysics Data System (ADS)

Andelković, M.; Covaci, L.; Peeters, F. M.

2018-03-01

The in-plane dc conductivity of twisted bilayer graphene is calculated using an expansion of the real-space Kubo-Bastin conductivity in terms of Chebyshev polynomials. We investigate within a tight-binding approach the transport properties as a function of rotation angle, applied perpendicular electric field, and vacancy disorder. We find that for high-angle twists, the two layers are effectively decoupled, and the minimum conductivity at the Dirac point corresponds to double the value observed in monolayer graphene. This remains valid even in the presence of vacancies, hinting that chiral symmetry is still preserved. On the contrary, for low twist angles, the conductivity at the Dirac point depends on the twist angle and is not protected in the presence of disorder. Furthermore, for low angles and in the presence of an applied electric field, we find that the chiral boundary states emerging between AB and BA regions contribute to the dc conductivity, despite the appearance of localized states in the AA regions. The results agree qualitatively with recent transport experiments in low-angle twisted bilayer graphene.

Twists and turns in the body: an imaging spectrum.

PubMed

Luk, Shiobhon Y; Fung, K H

2010-10-01

Life is full of twists and turns. These surprises can sometimes be wonderfully invigorating. Twists and turns can also occur in the body, however, sometimes with dangerous consequences. Torsion and volvulus are important causes of acute abdominal pain. The clinical symptoms and signs associated with torsion and volvulus are often non-specific and are difficult to diagnose clinically. Clinicians frequently rely on imaging methods to make the diagnosis. Prompt and accurate diagnosis is important to avoid the life-threatening complications of torsion and volvulus. Therefore, it is helpful to be familiar with the features of torsion and volvulus.

Robustifying twist-and-turn entanglement with interaction-based readout

NASA Astrophysics Data System (ADS)

Mirkhalaf, Safoura S.; Nolan, Samuel P.; Haine, Simon A.

2018-05-01

The use of multiparticle entangled states has the potential to drastically increase the sensitivity of atom interferometers and atomic clocks. The twist-and-turn (TNT) Hamiltonian can create multiparticle entanglement much more rapidly than the ubiquitous one-axis twisting Hamiltonian in the same spin system. In this paper, we consider the effects of detection noise—a key limitation in current experiments—on the metrological usefulness of nonclassical states generated under TNT dynamics. We also consider a variety of interaction-based readouts to maximize their performance. Interestingly, the optimum interaction-based readout is not the obvious case of perfect time reversal.

Families of vector-like deformations of relativistic quantum phase spaces, twists and symmetries

NASA Astrophysics Data System (ADS)

Meljanac, Daniel; Meljanac, Stjepan; Pikutić, Danijel

2017-12-01

Families of vector-like deformed relativistic quantum phase spaces and corresponding realizations are analyzed. A method for a general construction of the star product is presented. The corresponding twist, expressed in terms of phase space coordinates, in the Hopf algebroid sense is presented. General linear realizations are considered and corresponding twists, in terms of momenta and Poincaré-Weyl generators or gl(n) generators are constructed and R-matrix is discussed. A classification of linear realizations leading to vector-like deformed phase spaces is given. There are three types of spaces: (i) commutative spaces, (ii) κ -Minkowski spaces and (iii) κ -Snyder spaces. The corresponding star products are (i) associative and commutative (but non-local), (ii) associative and non-commutative and (iii) non-associative and non-commutative, respectively. Twisted symmetry algebras are considered. Transposed twists and left-right dual algebras are presented. Finally, some physical applications are discussed.

Twisted versus braided magnetic flux ropes in coronal geometry. II. Comparative behaviour

NASA Astrophysics Data System (ADS)

Prior, C.; Yeates, A. R.

2016-06-01

Aims: Sigmoidal structures in the solar corona are commonly associated with magnetic flux ropes whose magnetic field lines are twisted about a mutual axis. Their dynamical evolution is well studied, with sufficient twisting leading to large-scale rotation (writhing) and vertical expansion, possibly leading to ejection. Here, we investigate the behaviour of flux ropes whose field lines have more complex entangled/braided configurations. Our hypothesis is that this internal structure will inhibit the large-scale morphological changes. Additionally, we investigate the influence of the background field within which the rope is embedded. Methods: A technique for generating tubular magnetic fields with arbitrary axial geometry and internal structure, introduced in part I of this study, provides the initial conditions for resistive-MHD simulations. The tubular fields are embedded in a linear force-free background, and we consider various internal structures for the tubular field, including both twisted and braided topologies. These embedded flux ropes are then evolved using a 3D MHD code. Results: Firstly, in a background where twisted flux ropes evolve through the expected non-linear writhing and vertical expansion, we find that flux ropes with sufficiently braided/entangled interiors show no such large-scale changes. Secondly, embedding a twisted flux rope in a background field with a sigmoidal inversion line leads to eventual reversal of the large-scale rotation. Thirdly, in some cases a braided flux rope splits due to reconnection into two twisted flux ropes of opposing chirality - a phenomenon previously observed in cylindrical configurations. Conclusions: Sufficiently complex entanglement of the magnetic field lines within a flux rope can suppress large-scale morphological changes of its axis, with magnetic energy reduced instead through reconnection and expansion. The structure of the background magnetic field can significantly affect the changing morphology of a

Chiral tunneling in a twisted graphene bilayer.

PubMed

He, Wen-Yu; Chu, Zhao-Dong; He, Lin

2013-08-09

The perfect transmission in a graphene monolayer and the perfect reflection in a Bernal graphene bilayer for electrons incident in the normal direction of a potential barrier are viewed as two incarnations of the Klein paradox. Here we show a new and unique incarnation of the Klein paradox. Owing to the different chiralities of the quasiparticles involved, the chiral fermions in a twisted graphene bilayer show an adjustable probability of chiral tunneling for normal incidence: they can be changed from perfect tunneling to partial or perfect reflection, or vice versa, by controlling either the height of the barrier or the incident energy. As well as addressing basic physics about how the chiral fermions with different chiralities tunnel through a barrier, our results provide a facile route to tune the electronic properties of the twisted graphene bilayer.

Effect of the cross sectional aspect ratio on the flow past a twisted cylinder

NASA Astrophysics Data System (ADS)

Jung, Jae Hwan; Yoon, Hyun Sik

2013-11-01

The cross-flow around twisted cylinders of cross sectional aspect ratio (A/B) from 1 to 2.25 is investigated at a subcritical Reynolds number (Re) of 3000 using large eddy simulation (LES). The flow past a corresponding smooth and wavy cylinder is also calculated for comparison and validation against experimental data. The effect of twisted surface assessed in terms of the mean drag and root-mean-square (RMS) value of fluctuating lift. The shear layer of the twisted cylinder covering the recirculation region is more elongated than those of the smooth and the wavy cylinder. Successively, vortex shedding of the twisted cylinder is considerably suppressed, compared with those of the smooth and the wavy cylinder. The maximum drag reduction of up to 13% compared with a smooth cylinder is obtained at a certain cross sectional aspect ratio. The fluctuating lift coefficient of the twisted cylinder is also significantly suppressed. We found that the cross sectional cross sectional aspect ratio (A/B) plays an essential role in determining the vortical structures behind the twisted cylinder which has a significant effect on the reduction of the fluctuating lift and suppression of flow-induced vibration. This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIP) through GCRC-SOP (No. 2011-0030013).

TiO2/water Nanofluid Heat Transfer in Heat Exchanger Equipped with Double Twisted-Tape Inserts

NASA Astrophysics Data System (ADS)

Eiamsa-ard, S.; Ketrain, R.; Chuwattanakul, V.

2018-05-01

Nowadays, heat transfer enhancement plays an important role in improving efficiency of heat transfer and thermal systems for numerous areas such as heat recovery processes, chemical reactors, air-conditioning/refrigeration system, food engineering, solar air/water heater, cooling of high power electronics etc. The present work presents the experimental results of the heat transfer enhancement of TiO2/water nanofluid in a heat exchanger tube fitted with double twisted tapes. The study covered twist ratios of twisted tapes (y/w) of 1.5, 2.0, and 2.5) while the concentration of the nanofluid was kept constant at 0.05% by volume. Observations show that heat transfer, friction loss and thermal performance increase as twist ratio (y/w) decreases. The use of the nanofluid in the tube equipped with the double twisted-tapes with the smallest twist ratio (y/w = 1.5) results in the increases of heat transfer rates and friction factor up to 224.8% and 8.98 times, respectively as compared to those of water. In addition, the experimental results performed that double twisted tapes induced dual swirling-flows which played an important role in improving fluid mixing and heat transfer enhancement. It is also observed that the TiO2/water nanofluid was responsible for low pressure loss behaviors.

Large-N solution of the heterotic CP(N-1) model with twisted masses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolokhov, Pavel A.; Department of Physics and Astronomy, University of Victoria, Victoria, BC, V8P 1A1; Shifman, Mikhail

2010-07-15

We address a number of unanswered questions in the N=(0,2)-deformed CP(N-1) model with twisted masses. In particular, we complete the program of solving the CP(N-1) model with twisted masses in the large-N limit. In A. Gorsky, M. Shifman, and A. Yung, Phys. Rev. D 73, 065011 (2006), a nonsupersymmetric version of the model with the Z{sub N} symmetric twisted masses was analyzed in the framework of Witten's method. In M. Shifman and A. Yung, Phys. Rev. D 77, 125017 (2008), this analysis was extended: the large-N solution of the heterotic N=(0,2) CP(N-1) model with no twisted masses was found. Heremore » we solve this model with the twisted masses switched on. Dynamical scenarios at large and small m are studied (m is the twisted-mass scale). We found three distinct phases and two phase transitions on the m plane. Two phases with the spontaneously broken Z{sub N} symmetry are separated by a phase with unbroken Z{sub N}. This latter phase is characterized by a unique vacuum and confinement of all U(1) charged fields (''quarks''). In the broken phases (one of them is at strong coupling) there are N degenerate vacua and no confinement, similarly to the situation in the N=(2,2) model. Supersymmetry is spontaneously broken everywhere except a circle |m|={Lambda} in the Z{sub N}-unbroken phase. Related issues are considered. In particular, we discuss the mirror representation for the heterotic model in a certain limiting case.« less

Design of Restoration Method Based on Compressed Sensing and TwIST Algorithm

NASA Astrophysics Data System (ADS)

Zhang, Fei; Piao, Yan

2018-04-01

In order to improve the subjective and objective quality of degraded images at low sampling rates effectively,save storage space and reduce computational complexity at the same time, this paper proposes a joint restoration algorithm of compressed sensing and two step iterative threshold shrinkage (TwIST). The algorithm applies the TwIST algorithm which used in image restoration to the compressed sensing theory. Then, a small amount of sparse high-frequency information is obtained in frequency domain. The TwIST algorithm based on compressed sensing theory is used to accurately reconstruct the high frequency image. The experimental results show that the proposed algorithm achieves better subjective visual effects and objective quality of degraded images while accurately restoring degraded images.

Joint research effort on vibrations of twisted plates, phase 1: Final results

NASA Technical Reports Server (NTRS)

Kielb, R. E.; Leissa, A. W.; Macbain, J. C.; Carney, K. S.

1985-01-01

The complete theoretical and experimental results of the first phase of a joint government/industry/university research study on the vibration characteristics of twisted cantilever plates are given. The study is conducted to generate an experimental data base and to compare many different theoretical methods with each other and with the experimental results. Plates with aspect ratios, thickness ratios, and twist angles representative of current gas turbine engine blading are investigated. The theoretical results are generated by numerous finite element, shell, and beam analysis methods. The experimental results are obtained by precision matching a set of twisted plates and testing them at two laboratories. The second and final phase of the study will concern the effects of rotation.

A comparison of the UHF Follow-On and MILSTAR satellite communication systems

NASA Astrophysics Data System (ADS)

Perkins, Clifton E., Jr.

1991-09-01

The author compares the UHF Follow-On and MILSTAR satellite communication systems. The comparison uses an analytical hierarchy process. Although the two systems have been tasked with different missions, a comparison of cost, capability, and orbit is conducted. UFO provides many of the same capabilities as MILSTAR, but on a smaller scale. Since UFO is also a new space system acquisition, it is used to compare dollars spent to field a viable communication system. A review of frequency bands, losses, and problems is conducted to establish the relationship. Cost data is provided to establish the major difference in the systems. While MILSTAR does possess more total capability than UFO, it is 10 times more costly. Additionally, UFO is a satellite that will evolve with new technology while MILSTAR is built to full capability immediately. In the author's opinion, the incremental performance of MILSTAR does not justify its incremental cost.

Methods and apparatus for twist bend coupled (TCB) wind turbine blades

DOEpatents

Moroz, Emilian Mieczyslaw; LeMieux, David Lawrence; Pierce, Kirk Gee

2006-10-10

A method for controlling a wind turbine having twist bend coupled rotor blades on a rotor mechanically coupled to a generator includes determining a speed of a rotor blade tip of the wind turbine, measuring a current twist distribution and current blade loading, and adjusting a torque of a generator to change the speed of the rotor blade tip to thereby increase an energy capture power coefficient of the wind turbine.

High-order orbital angular momentum mode generator based on twisted photonic crystal fiber.

PubMed

Fu, Cailing; Liu, Shen; Wang, Ying; Bai, Zhiyong; He, Jun; Liao, Changrui; Zhang, Yan; Zhang, Feng; Yu, Bin; Gao, Shecheng; Li, Zhaohui; Wang, Yiping

2018-04-15

High-order orbital angular momentum (OAM) modes, namely, OAM +5 and OAM +6 , were generated and demonstrated experimentally by twisting a solid-core hexagonal photonic crystal fiber (PCF) during hydrogen-oxygen flame heating. Leaky orbital resonances in the cladding depend strongly on the twist rate and length of the helical PCF. Moreover, the generated high-order OAM mode could be a polarized mode. The secret of the successful observation of high-order modes is that leaky orbital resonances in the twisted PCF cladding have a high coupling efficiency of more than -20  dB.

Fiber-Optic Sensors for Measurements of Torsion, Twist and Rotation: A Review †

PubMed Central

Budinski, Vedran; Donlagic, Denis

2017-01-01

Optical measurement of mechanical parameters is gaining significant commercial interest in different industry sectors. Torsion, twist and rotation are among the very frequently measured mechanical parameters. Recently, twist/torsion/rotation sensors have become a topic of intense fiber-optic sensor research. Various sensing concepts have been reported. Many of those have different properties and performances, and many of them still need to be proven in out-of-the laboratory use. This paper provides an overview of basic approaches and a review of current state-of-the-art in fiber optic sensors for measurements of torsion, twist and/or rotation. PMID:28241510

Sunspot rotation. II. Effects of varying the field strength and twist of an emerging flux tube

NASA Astrophysics Data System (ADS)

Sturrock, Z.; Hood, A. W.

2016-09-01

Context. Observations of flux emergence indicate that rotational velocities may develop within sunspots. However, the dependence of this rotation on sub-photospheric field strength and twist remains largely unknown. Aims: We investigate the effects of varying the initial field strength and twist of an emerging sub-photospheric magnetic flux tube on the rotation of the sunspots at the photosphere. Methods: We consider a simple model of a stratified domain with a sub-photospheric interior layer and three overlying atmospheric layers. A twisted arched flux tube is inserted in the interior and is allowed to rise into the atmosphere. To achieve this, the magnetohydrodynamic equations are solved using the Lagrangian-remap code, Lare3d. We perform a parameter study by independently varying the sub-photospheric magnetic field strength and twist. Results: Altering the initial magnetic field strength and twist of the flux tube significantly affects the tube's evolution and the rotational motions that develop at the photosphere. The rotation angle, vorticity, and current show a direct dependence on the initial field strength. We find that an increase in field strength increases the angle through which the fieldlines rotate, the length of the fieldlines extending into the atmosphere, and the magnetic energy transported to the atmosphere. This also affects the amount of residual twist in the interior. The length of the fieldlines is crucial as we predict the twist per unit length equilibrates to a lower value on longer fieldlines. No such direct dependence is found when we modify the twist of the magnetic field owing to the complex effect this has on the tension force acting on the tube. However, there is still a clear ordering in quantities such as the rotation angle, helicity, and free energy with higher initial twist cases being related to sunspots that rotate more rapidly, transporting more helicity and magnetic energy to the atmosphere.

New twisted intermetallic compound superconductor: A concept

NASA Technical Reports Server (NTRS)

Coles, W. D.; Brown, G. V.; Laurence, J. C.

1972-01-01

Method for processing Nb3Sn and other intermetallic compound superconductors produces a twisted, stabilized wire or tube which can be used to wind electromagnetics, armatures, rotors, and field windings for motors and generators as well as other magnetic devices.

Analysis of a Caenorhabditis elegans Twist homolog identifies conserved and divergent aspects of mesodermal patterning

PubMed Central

Harfe, Brian D.; Gomes, Ana Vaz; Kenyon, Cynthia; Liu, Jun; Krause, Michael; Fire, Andrew

1998-01-01

Mesodermal development is a multistep process in which cells become increasingly specialized to form specific tissue types. In Drosophila and mammals, proper segregation and patterning of the mesoderm involves the bHLH factor Twist. We investigated the activity of a Twist-related factor, CeTwist, during Caenorhabditis elegans mesoderm development. Embryonic mesoderm in C. elegans derives from a number of distinct founder cells that are specified during the early lineages; in contrast, a single blast cell (M) is responsible for all nongonadal mesoderm formation during postembryonic development. Using immunofluorescence and reporter fusions, we determined the activity pattern of the gene encoding CeTwist. No activity was observed during specification of mesodermal lineages in the early embryo; instead, the gene was active within the M lineage and in a number of mesodermal cells with nonstriated muscle fates. A role for CeTwist in postembryonic mesodermal cell fate specification was indicated by ectopic expression and genetic interference assays. These experiments showed that CeTwist was responsible for activating two target genes normally expressed in specific subsets of nonstriated muscles derived from the M lineage. In vitro and in vivo assays suggested that CeTwist cooperates with the C. elegans E/Daughterless homolog in directly activating these targets. The two target genes that we have studied, ceh-24 and egl-15, encode an NK-2 class homeodomain and an FGF receptor (FGFR) homolog, respectively. Twist activates FGFR and NK-homeodomain target genes during mesodermal patterning of Drosophila and similar target interactions have been proposed to modulate mesenchymal growth during closure of the vertebrate skull. These results suggest the possibility that a conserved pathway may be used for diverse functions in mesodermal specification. PMID:9716413

An empirically-based model for the lift coefficients of twisted airfoils with leading-edge tubercles

NASA Astrophysics Data System (ADS)

Ni, Zao; Su, Tsung-chow; Dhanak, Manhar

2018-04-01

Experimental data for untwisted airfoils are utilized to propose a model for predicting the lift coefficients of twisted airfoils with leading-edge tubercles. The effectiveness of the empirical model is verified through comparison with results of a corresponding computational fluid-dynamic (CFD) study. The CFD study is carried out for both twisted and untwisted airfoils with tubercles, the latter shown to compare well with available experimental data. Lift coefficients of twisted airfoils predicted from the proposed empirically-based model match well with the corresponding coefficients determined using the verified CFD study. Flow details obtained from the latter provide better insight into the underlying mechanism and behavior at stall of twisted airfoils with leading edge tubercles.

Defects in crystalline packings of twisted filament bundles. I. Continuum theory of disclinations.

PubMed

Grason, Gregory M

2012-03-01

We develop the theory of the coupling between in-plane order and out-of-plane geometry in twisted, two-dimensionally ordered filament bundles based on the nonlinear continuum elasticity theory of columnar materials. We show that twisted textures of filament backbones necessarily introduce stresses into the cross-sectional packing of bundles and that these stresses are formally equivalent to the geometrically induced stresses generated in thin elastic sheets that are forced to adopt spherical curvature. As in the case of crystalline order on curved membranes, geometrically induced stresses couple elastically to the presence of topological defects in the in-plane order. We derive the effective theory of multiple disclination defects in the cross section of bundle with a fixed twist and show that above a critical degree of twist, one or more fivefold disclinations is favored in the elastic energy ground state. We study the structure and energetics of multidisclination packings based on models of equilibrium and nonequilibrium cross-sectional order.

Design and analysis of adaptive Super-Twisting sliding mode control for a microgyroscope.

PubMed

Feng, Zhilin; Fei, Juntao

2018-01-01

This paper proposes a novel adaptive Super-Twisting sliding mode control for a microgyroscope under unknown model uncertainties and external disturbances. In order to improve the convergence rate of reaching the sliding surface and the accuracy of regulating and trajectory tracking, a high order Super-Twisting sliding mode control strategy is employed, which not only can combine the advantages of the traditional sliding mode control with the Super-Twisting sliding mode control, but also guarantee that the designed control system can reach the sliding surface and equilibrium point in a shorter finite time from any initial state and avoid chattering problems. In consideration of unknown parameters of micro gyroscope system, an adaptive algorithm based on Lyapunov stability theory is designed to estimate the unknown parameters and angular velocity of microgyroscope. Finally, the effectiveness of the proposed scheme is demonstrated by simulation results. The comparative study between adaptive Super-Twisting sliding mode control and conventional sliding mode control demonstrate the superiority of the proposed method.

Symmetries and Invariants of Twisted Quantum Algebras and Associated Poisson Algebras

NASA Astrophysics Data System (ADS)

Molev, A. I.; Ragoucy, E.

We construct an action of the braid group BN on the twisted quantized enveloping algebra U q'( {o}N) where the elements of BN act as automorphisms. In the classical limit q → 1, we recover the action of BN on the polynomial functions on the space of upper triangular matrices with ones on the diagonal. The action preserves the Poisson bracket on the space of polynomials which was introduced by Nelson and Regge in their study of quantum gravity and rediscovered in the mathematical literature. Furthermore, we construct a Poisson bracket on the space of polynomials associated with another twisted quantized enveloping algebra U q'( {sp}2n). We use the Casimir elements of both twisted quantized enveloping algebras to reproduce and construct some well-known and new polynomial invariants of the corresponding Poisson algebras.

A Twist on Facial Selectivity of Hydride Reductions of Cyclic Ketones: Twist-Boat Conformers in Cyclohexanone, Piperidone, and Tropinone Reactions

PubMed Central

2015-01-01

The role of twist-boat conformers of cyclohexanones in hydride reductions was explored. The hydride reductions of a cis-2,6-disubstituted N-acylpiperidone, an N-acyltropinone, and tert-butylcyclohexanone by lithium aluminum hydride and by a bulky borohydride reagent were investigated computationally and compared to experiment. Our results indicate that in certain cases, factors such as substrate conformation, nucleophile bulkiness, and remote steric features can affect stereoselectivity in ways that are difficult to predict by the general Felkin–Anh model. In particular, we have calculated that a twist-boat conformation is relevant to the reactivity and facial selectivity of hydride reduction of cis-2,6-disubstituted N-acylpiperidones with a small hydride reagent (LiAlH4) but not with a bulky hydride (lithium triisopropylborohydride). PMID:25372509

How the embryonic brain tube twists

NASA Astrophysics Data System (ADS)

Chen, Zi; Guo, Qiaohang; Forsch, Nickolas; Taber, Larry

2014-03-01

During early development, the tubular brain of the chick embryo undergoes a combination of progressive ventral bending and rightward torsion. This deformation is one of the major organ-level symmetry-breaking events in development. Available evidence suggests that bending is caused by differential growth, but the mechanism for torsion remains poorly understood. Since the heart almost always loops in the same direction that the brain twists, researchers have speculated that heart looping affects the direction of brain torsion. However, direct evidence is virtually nonexistent, nor is the mechanical origin of such torsion understood. In our study, experimental perturbations show that the bending and torsional deformations in the brain are coupled and that the vitelline membrane applies an external load necessary for torsion to occur. In addition, the asymmetry of the looping heart gives rise to the chirality of the twisted brain. A computational model is used to interpret these findings. Our work clarifies the mechanical origins of brain torsion and the associated left-right asymmetry, reminiscent of D'Arcy Thompson's view of biological form as ``diagram of forces''.

Visualization of Flows in Packed Beds of Twisted Tapes

NASA Technical Reports Server (NTRS)

Hendricks, R. C.; Braun, M. J.; Peloso, D.; Athavale, M. M.; Mullen, R. L.

2002-01-01

A videotape presentation of the flow field in a packed bed of 48 twisted tapes which can be simulated by very thin virtual cylinders has been assembled. The indices of refraction of the oil and the Lucite twisted tapes were closely matched, and the flow was seeded with magnesium oxide particles. Planar laser light projected the flow field in two dimensions both along and transverse to the flow axis. The flow field was three dimensional and complex to describe, yet the most prominent finding was flow threads. It appeared that axial flow spiraled along either within the confines of a virtual cylindrical boundary or within the exterior region, between the tangency points, of the virtual cylinders. Random packing and bed voids created vortices and disrupted the laminar flow but minimized the entrance effects. The flow-pressure drops in the packed bed fell below the Ergun model for porous-media flows. Single-twisted-tape results of Smithberg and Landis (1964) were used to guide the analysis. In appendix A the results of several investigators are scaled to the Ergun model. Further investigations including different geometric configurations, computational fluid dynamic (CFD) gridding, and analysis are required.

Ultra-compact UHF Band-pass Filter Designed by Archimedes Spiral Capacitor and Shorted-loaded Stubs

NASA Astrophysics Data System (ADS)

Peng, Lin; Jiang, Xing

2015-01-01

UHF microstrip band-pass filters (BPFs) that much smaller than the referred BPFs are proposed in this communication. For the designing purpose of compactness, archimedes spiral capacitor and ground-loaded stubs are utilized to enhance capacitances and inductance of a filter. Two compact BPFs denoted as BPF 1 and BPF 2 are designed by applying these techniques. The size of BPF 1 and BPF 2 are 0.062 λg × 0.056 λg and 0.047 λg × 0.043 λg, respectively, where λg are guided wavelengths of the centre frequencies of the corresponding filters. The proposed filters were constructed and measured, and the measured results are in good agreement with the simulated ones.

Recurrent Mutations in the Basic Domain of TWIST2 Cause Ablepharon Macrostomia and Barber-Say Syndromes.

PubMed

Marchegiani, Shannon; Davis, Taylor; Tessadori, Federico; van Haaften, Gijs; Brancati, Francesco; Hoischen, Alexander; Huang, Haigen; Valkanas, Elise; Pusey, Barbara; Schanze, Denny; Venselaar, Hanka; Vulto-van Silfhout, Anneke T; Wolfe, Lynne A; Tifft, Cynthia J; Zerfas, Patricia M; Zambruno, Giovanna; Kariminejad, Ariana; Sabbagh-Kermani, Farahnaz; Lee, Janice; Tsokos, Maria G; Lee, Chyi-Chia R; Ferraz, Victor; da Silva, Eduarda Morgana; Stevens, Cathy A; Roche, Nathalie; Bartsch, Oliver; Farndon, Peter; Bermejo-Sanchez, Eva; Brooks, Brian P; Maduro, Valerie; Dallapiccola, Bruno; Ramos, Feliciano J; Chung, Hon-Yin Brian; Le Caignec, Cédric; Martins, Fabiana; Jacyk, Witold K; Mazzanti, Laura; Brunner, Han G; Bakkers, Jeroen; Lin, Shuo; Malicdan, May Christine V; Boerkoel, Cornelius F; Gahl, William A; de Vries, Bert B A; van Haelst, Mieke M; Zenker, Martin; Markello, Thomas C

2015-07-02

Ablepharon macrostomia syndrome (AMS) and Barber-Say syndrome (BSS) are rare congenital ectodermal dysplasias characterized by similar clinical features. To establish the genetic basis of AMS and BSS, we performed extensive clinical phenotyping, whole exome and candidate gene sequencing, and functional validations. We identified a recurrent de novo mutation in TWIST2 in seven independent AMS-affected families, as well as another recurrent de novo mutation affecting the same amino acid in ten independent BSS-affected families. Moreover, a genotype-phenotype correlation was observed, because the two syndromes differed based solely upon the nature of the substituting amino acid: a lysine at TWIST2 residue 75 resulted in AMS, whereas a glutamine or alanine yielded BSS. TWIST2 encodes a basic helix-loop-helix transcription factor that regulates the development of mesenchymal tissues. All identified mutations fell in the basic domain of TWIST2 and altered the DNA-binding pattern of Flag-TWIST2 in HeLa cells. Comparison of wild-type and mutant TWIST2 expressed in zebrafish identified abnormal developmental phenotypes and widespread transcriptome changes. Our results suggest that autosomal-dominant TWIST2 mutations cause AMS or BSS by inducing protean effects on the transcription factor's DNA binding. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

TWISTED RIBBON FUEL ELEMENT

DOEpatents

Breden, C.R.; Schultz, A.B.

1961-06-01

A reactor core formed of bundles of parallel fuel elements in the form of ribbons is patented. The fuel ribbons are twisted about their axes so as to have contact with one another at regions spaced lengthwise of the ribbons and to be out of contact with one another at locations between these spaced regions. The contact between the ribbons is sufficient to allow them to be held together in a stable bundle in a containing tube without intermediate support, while permitting enough space between the ribbon for coolant flowing.

How is the relationship between TWIST-1 and BCR-ABL1 gene expressions in chronic myeloid leukaemia patients?

PubMed

Heidari, Nazanin; Vosoughi, Tina; Mohammadi Asl, Javad; Saki Malehi, Amal; Saki, Najmaldin

2018-01-12

The activation and increased expression of BCR-ABL1 lead to malignant chronic myelogenous leukaemia (CML) cells, as well as the resistance to antitumour agents and apoptosis inducers. Moreover, TWIST-1 protein is a prognostic factor of leukemogenesis, and its level is raised in CML patients with cytogenetic resistance to imatinib. So, there is a likely relationship between BCR-ABL1 and TWIST-1 genes. The aim of the study was to assess the relationship between TWIST-1 and BCR-ABL1 expressions. Peripheral blood samples were obtained from 44 CML patients under treatment and also from ten healthy subjects as normal controls. The expression of TWIST-1 and BCR-ABL1 genes was measured using real-time PCR, and ABL1 was used as the reference gene. The gene expression was evaluated by REST software. The expression levels of TWIST-1 and BCR-ABL1 genes in CML patients was changed 40.23 ± 177.75-fold and 6 ± 18-fold, respectively. No significant relationship was observed between the expressions of TWIST-1 and BCR-ABL1 genes. All patients with TWIST-1 expression levels ≥100-fold had failure of response to treatment. The probability of the relationship between BCR-ABL1 and TWIST-1 is still debatable, and the average of TWIST-1 expression has been higher in patients without response to treatment. Definitive conclusion needs further investigations.

Heat Transfer Enhancement of Laminar Nanofluids Flow in a Circular Tube Fitted with Parabolic-Cut Twisted Tape Inserts

PubMed Central

Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

2014-01-01

Numerical investigation has been carried out on heat transfer and friction factor characteristics of copper-water nanofluid flow in a constant heat-fluxed tube with the existence of new configuration of vortex generator using Computational Fluid Dynamics (CFD) simulation. Two types of swirl flow generator: Classical twisted tape (CTT) and Parabolic-cut twisted tape (PCT) with a different twist ratio (y = 2.93, 3.91 and 4.89) and different cut depth (w = 0.5, 1.0 and 1.5 cm) with 2% and 4% volume concentration of CuO nanofluid were used for simulation. The effect of different parameters such as flow Reynolds number, twist ratio, cut depth and nanofluid were considered. The results show that the enhancement of heat transfer rate and the friction factor induced by the Classical (CTT) and Parabolic-cut (PCT) inserts increases with twist ratio and cut depth decreases. The results also revealed that the heat transfer enhancement increases with an increase in the volume fraction of the CuO nanoparticle. Furthermore, the twisted tape with twist ratio (y = 2.93) and cut depth w = 0.5 cm offered 10% enhancement of the average Nusselt number with significant increases in friction factor than those of Classical twisted tape. PMID:24605055

Radiative capture of cold neutrons by protons and deuteron photodisintegration with twisted beams

NASA Astrophysics Data System (ADS)

Afanasev, Andrei; Serbo, Valeriy G.; Solyanik, Maria

2018-05-01

We consider two basic nuclear reactions: capture of neutrons by protons, n + p → γ + d, and its time-reversed counterpart, photodisintegration of the deuteron, γ + d → n + p. In both of these cases we assume that the incoming beam of neutrons or photons is ‘twisted’ by having an azimuthal phase dependence, i.e., it carries an additional angular momentum along its direction of propagation. Taking a low-energy limit of these reactions, we derive relations between corresponding transition amplitudes and cross sections with plane-wave beams and twisted beams. Implications for experiments with twisted cold neutrons and twisted photon beams are discussed.

Mechanical strain energy shuttle for aircraft morphing via wing twist or structural deformation

NASA Astrophysics Data System (ADS)

Clingman, Dan J.; Ruggeri, Robert T.

2004-07-01

Direct structural deformation to achieve aerodynamic benefit is difficult because large actuators must supply energy for structural strain and aerodynamic loads. This ppaer presents a mechanism that allows most of the energy required to twist or deform a wing to be stored in descrete springs. When this device is used, only sufficient energy is provided to control the position of the wing. This concept allows lightweight actuators to perform wing twisting and other structural distortions, and it reduces the onboard mass of the wing-twist system. The energy shuttle can be used with any actuator and it has been adapted for used with shape memory alloy, piezoelectric, and electromagnetic actuators.

Multiport Circular Polarized RFID-Tag Antenna for UHF Sensor Applications.

PubMed

Zaid, Jamal; Abdulhadi, Abdulhadi; Kesavan, Arun; Belaizi, Yassin; Denidni, Tayeb A

2017-07-05

A circular polarized patch antenna for UHF RFID tag-based sensor applications is presented, with the circular polarization (CP) generated by a new antenna shape, an asymmetric stars shaped slotted microstrip patch antenna (CP-ASSSMP). Four stars etched on the patch allow the antenna's size to be reduced by close to 20%. The proposed antenna is matched with two RFID chips via inductive-loop matching. The first chip is connected to a resistive sensor and acts as a sensor node, and the second is used as a reference node. The proposed antenna is used for two targets, serving as both reference and sensor simultaneously, thereby eliminating the need for a second antenna. Its reader can read the RFID chips at any orientation of the tag due to the CP. The measured reading range is about 25 m with mismatch polarization. The operating frequency band is 902-929 MHz for the two ports, which is covered by the US RFID band, and the axial-ratio bandwidth is about 7 MHz. In addition, the reader can also detect temperature, based on the minimum difference in the power required by the reference and sensor.

Multiport Circular Polarized RFID-Tag Antenna for UHF Sensor Applications

PubMed Central

Zaid, Jamal; Abdulhadi, Abdulhadi; Kesavan, Arun; Belaizi, Yassin; Denidni, Tayeb A.

2017-01-01

A circular polarized patch antenna for UHF RFID tag-based sensor applications is presented, with the circular polarization (CP) generated by a new antenna shape, an asymmetric stars shaped slotted microstrip patch antenna (CP-ASSSMP). Four stars etched on the patch allow the antenna’s size to be reduced by close to 20%. The proposed antenna is matched with two RFID chips via inductive-loop matching. The first chip is connected to a resistive sensor and acts as a sensor node, and the second is used as a reference node. The proposed antenna is used for two targets, serving as both reference and sensor simultaneously, thereby eliminating the need for a second antenna. Its reader can read the RFID chips at any orientation of the tag due to the CP. The measured reading range is about 25 m with mismatch polarization. The operating frequency band is 902–929 MHz for the two ports, which is covered by the US RFID band, and the axial-ratio bandwidth is about 7 MHz. In addition, the reader can also detect temperature, based on the minimum difference in the power required by the reference and sensor. PMID:28678178

Mesoporous Silica Nanoparticle Delivery of Chemically Modified siRNA Against TWIST1 Leads to Reduced Tumor Burden

PubMed Central

Finlay, James; Roberts, Cai M.; Dong, Juyao; Zink, Jeffrey I.; Tamanoi, Fuyuhiko; Glackin, Carlotta A.

2015-01-01

Growth and progression of solid tumors depends on the integration of multiple pro-growth and survival signals, including the induction of angiogenesis. TWIST1 is a transcription factor whose reactivation in tumors leads to epithelial to mesenchymal transition (EMT), including increased cancer cell stemness, survival, and invasiveness. Additionally, TWIST1 drives angiogenesis via activation of IL-8 and CCL2, independent of VEGF signaling. In this work, results suggest that chemically modified siRNA against TWIST1 reverses EMT both in vitro and in vivo. siRNA delivery with a polyethyleneimine-coated mesoporous silica nanoparticle (MSN) led to reduction of TWIST1 target genes and migratory potential in vitro. In mice bearing xenograft tumors, weekly intravenous injections of the siRNA-nanoparticle complexes resulted in decreased tumor burden together with a loss of CCL2 suggesting a possible anti-angiogenic response. Therapeutic use of TWIST1 siRNA delivered via MSNs has the potential to inhibit tumor growth and progression in many solid tumor types. Chemically modified siRNA against TWIST1 was complexed to cation-coated mesoporous silica nanoparticles and tested in vitro and in vivo. In cell culture experiments, siRNA reduced expression of TWIST1 and its target genes, and reduced cell migration. In mice, injections of the siRNA-nanoparticle complex led to reduced tumor weight. Data suggest that diminished tumor burden was the result of reduced CCL2 expression and angiogenesis following TWIST1 knockdown. PMID:26115637

Spectroscopic and Ab Initio Determination of the Ring-Twisting Potential Energy Function for 1,3-Cyclohexadiene

NASA Astrophysics Data System (ADS)

Autrey, Daniel; Choo, Jaebum; Laane, Jaan

2000-10-01

The ring-twisting vibration of 1,3-cyclohexadiene has been studied using Raman and infrared spectroscopy of the molecule in the vapor phase. The Raman spectrum shows five ring-twisting transitions in the 150 - 200 cm-1 region. The far-infrared spectrum shows only two transitions for this vibration, which is infrared forbidden in the C_2v (planar) approximation. Three ring-twisting combination bands were also observed off a fundamental vibration at 926.1 cm-1. A coordinate dependent kinetic energy expansion for the ring-twisting motion was calculated, and this was used to determine the ring-twisting potential function. Ab initio calculations were performed using Moller-Plesset perturbation theory (MP2) using different basis sets. The barrier to planarity of 1150 cm-1 was determined from the spectroscopic data. The various ab initio calculations gave barriers to planarity in the 1197 - 1593 cm-1 range.

STS-3/OSS-1 Plasma Diagnostics Package (PDP) measurements of the temperature pressure and plasma

NASA Technical Reports Server (NTRS)

Shawhan, S. D.; Murphy, G.

1983-01-01

Designed to withstand the thermal extremes of the STS-3 mission through the use of heaters and thermal blankets, the plasma diagnostics package sat on the release/engagement mechanism on the OSS-1 payload pallet without a coldplate and was attached to the RMS for two extended periods. Plots show temperature versus mission elapsed time for two temperature sensors. Pressure in the range of 10 to the -3 power torr and 10 to the -7 power torr, measured 3 inches from the skin of the package is plotted against GMT during the mission. The most distinctive feature of the pressure profile is the modulation at the obit period. It was found that pressure peaks when the atmospheric gas is rammed into the cargo bay. Electric and magnetic noise spectra and time variability due to orbiter systems, UHF and S-band transmitter field strengths, and measurements of the ion spectra obtained both in the cargo bay and during experiments are plotted.

Emerging role of Twist1 in fibrotic diseases.

PubMed

Ning, Xiaoxuan; Zhang, Kun; Wu, Qingfeng; Liu, Minna; Sun, Shiren

2018-03-01

Epithelial-mesenchymal transition (EMT) is a pathological process that occurs in a variety of diseases, including organ fibrosis. Twist1, a basic helix-loop-helix transcription factor, is involved in EMT and plays significant roles in various fibrotic diseases. Suppression of the EMT process represents a promising approach for the treatment of fibrotic diseases. In this review, we discuss the roles and the underlying molecular mechanisms of Twist1 in fibrotic diseases, including those affecting kidney, lung, skin, oral submucosa and other tissues. We aim at providing new insight into the pathogenesis of various fibrotic diseases and facilitating the development of novel diagnostic and therapeutic methods for their treatment. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Numerical investigation of heat transfer and friction factor characteristics in a circular tube fitted with V-cut twisted tape inserts.

PubMed

Salman, Sami D; Kadhum, Abdul Amir H; Takriff, Mohd S; Mohamad, Abu Bakar

2013-01-01

Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration.

Numerical Investigation of Heat Transfer and Friction Factor Characteristics in a Circular Tube Fitted with V-Cut Twisted Tape Inserts

PubMed Central

Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

2013-01-01

Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration. PMID:24078795

Rotor Hover Performance and Flowfield Measurements with Untwisted and Highly-Twisted Blades

NASA Technical Reports Server (NTRS)

Ramasamy, Manikandan; Gold, Nili P.; Bhagwat, Mahendra J.

2010-01-01

The flowfield and performance characteristics of highly-twisted blades were analyzed at various thrust conditions to improve the fundamental understanding relating the wake effects on rotor performance. Similar measurements made using untwisted blades served as the baseline case. Twisted blades are known to give better hover performance than untwisted blades at high thrust coefficients typical of those found in full-scale rotors. However, the present experiments were conducted at sufficiently low thrust (beginning from zero thrust), where the untwisted blades showed identical, if not better, performance when compared with the highly-twisted blades. The flowfield measurements showed some key wake differences between the two rotors, as well. These observations when combined with simple blade element momentum theory (also called annular disk momentum theory) helped further the understanding of rotor performance characteristics.

Analysis of Snail1 function and regulation by Twist1 in palatal fusion.

PubMed

Yu, Wenli; Zhang, Yanping; Ruest, L Bruno; Svoboda, Kathy K H

2013-01-01

Palatal fusion is a tightly controlled process which comprises multiple cellular events, including cell movement and differentiation. Midline epithelial seam (MES) degradation is essential to palatal fusion. In this study, we analyzed the function of Snail1 during the degradation of the MES. We also analyzed the mechanism regulating the expression of the Snail1 gene in palatal shelves. Palatal explants treated with Snail1 siRNA did not degrade the MES and E-cadherin was not repressed leading to failure of palatal fusion. Transforming growth factor beta 3 (Tgfβ3) regulated Snail1 mRNA, as Snail1 expression decreased in response to Tgfβ3 neutralizing antibody and a PI-3 kinase (PI3K) inhibitor. Twist1, in collaboration with E2A factors, regulated the expression of Snail1. Twist1/E47 dimers bond to the Snail1 promoter to activate expression. Without E47, Twist1 repressed Snail1 expression. These results support the hypothesis that Tgfβ3 may signal through Twist1 and then Snail1 to downregulate E-cadherin expression during palatal fusion.

The association between left ventricular twisting motion and mechanical dyssynchrony: a three-dimensional speckle tracking study.

PubMed

Fujiwara, Shohei; Komamura, Kazuo; Nakabo, Ayumi; Masaki, Mitsuru; Fukui, Miho; Sugahara, Masataka; Itohara, Kanako; Soyama, Yuko; Goda, Akiko; Hirotani, Shinichi; Mano, Toshiaki; Masuyama, Tohru

2016-02-01

Left ventricular (LV) dyssynchrony is a causal factor in LV dysfunction and thought to be associated with LV twisting motion. We tested whether three-dimensional speckle tracking (3DT) can be used to evaluate the relationship between LV twisting motion and dyssynchrony. We examined 25 patients with sick sinus syndrome who had received dual chamber pacemakers. The acute effects of ventricular pacing on LV wall motion after the switch from atrial to ventricular pacing were assessed. LV twisting motion and dyssynchrony during each pacing mode were measured using 3DT. LV dyssynchrony was calculated from the time to the minimum peak systolic area strain of 16 LV imaging segments. Ventricular pacing increased LV dyssynchrony and decreased twist and torsion. A significant correlation was observed between changes in LV dyssynchrony and changes in torsion (r = -0.65, p < 0.01). Evaluation of LV twisting motion can potentially be used for diagnosing LV dyssynchrony.

Electric currents induced by twisted light in Quantum Rings.

PubMed

Quinteiro, G F; Berakdar, J

2009-10-26

We theoretically investigate the generation of electric currents in quantum rings resulting from the optical excitation with twisted light. Our model describes the kinetics of electrons in a two-band model of a semiconductor-based mesoscopic quantum ring coupled to light having orbital angular momentum (twisted light). We find the analytical solution, which exhibits a "circular" photon-drag effect and an induced magnetization, suggesting that this system is the circular analog of that of a bulk semiconductor excited by plane waves. For realistic values of the electric field and material parameters, the computed electric current can be as large as microA; from an applied perspective, this opens new possibilities to the optical control of the magnetization in semiconductors.

Electric-field effects in the twist-bend nematic phase

NASA Astrophysics Data System (ADS)

Meyer, Claire; Dozov, Ivan; Davidson, Patrick; Luckhurst, Geoffrey R.; Dokli, Irena; Knezevic, Anamarija; Lesac, Andreja

2018-02-01

In the recently discovered Twist-Bend Nematic (NTB) phase, the nematic director is spontaneously distorted and twisted along a conical helix with an extremely short pitch, 10 nm. We have investigated the behavior of the NTB phase subject to an electric-field. We show that, due to the periodic NTB structure, the electro-optic effects are not nematic-like but are close analogs to those in the smectic and cholesteric phases. In particular, we have studied the fast (sub-microsecond) flexoelectrically-induced rotation of the optic axis, which is similar to the electroclinic effect in the SmA* phase and the flexoelectric response of short-pitch cholesterics. We discuss the possible applications of the fast NTB electro-optic effects.

Reducing Bolt Preload Variation with Angle-of-Twist Bolt Loading

NASA Technical Reports Server (NTRS)

Thompson, Bryce; Nayate, Pramod; Smith, Doug; McCool, Alex (Technical Monitor)

2001-01-01

Critical high-pressure sealing joints on the Space Shuttle reusable solid rocket motor require precise control of bolt preload to ensure proper joint function. As the reusable solid rocket motor experiences rapid internal pressurization, correct bolt preloads maintain the sealing capability and structural integrity of the hardware. The angle-of-twist process provides the right combination of preload accuracy, reliability, process control, and assembly-friendly design. It improves significantly over previous methods. The sophisticated angle-of-twist process controls have yielded answers to all discrepancies encountered while the simplicity of the root process has assured joint preload reliability.

Pauli energy spectrum for twist-deformed spacetime

NASA Astrophysics Data System (ADS)

Daszkiewicz, Marcin

2018-04-01

In this paper, we define the Pauli Hamiltonian function for the twist-deformed N-enlarged Newton-Hooke spacetime provided by M. Daszkiewicz [Mod. Phys. Lett. A 27, 1250083 (2012)]. Further, we derive its energy spectrum, i.e. we find the corresponding eigenvalues as well as the proper eigenfunctions.

Artificial blood-flow controlling effects of inhomogeneity of twisted magnetic fields

NASA Astrophysics Data System (ADS)

Nakagawa, Hidenori; Ohuchi, Mikio

2017-06-01

We developed a blood-flow controlling system using magnetic therapy for some types of nervous diseases. In our research, we utilized overlapped extremely low frequency (ELF) fields for the most effective blood-flow for the system. Results showed the possibility that the inhomogeneous region obtained by overlapping the fields at 50 Hz, namely, a desirably twisted field revealed a significant difference in induced electromotive forces at the insertion points of electrodes. In addition, ELF exposures with a high inhomogeneity of the twisted field at 50 Hz out of phase were more effective in generating an induced electromotive difference by approximately 31%, as contrasted with the difference generated by the exposure in phase. We expect that the increase of the inhomogeneity of the twisted field around a blood vessel can produce the most effective electromotive difference in the blood, and also moderately affect the excitable cells relating to the autonomic nervous system for an outstanding blood-flow control in vivo.

Experimental and theoretical study of the in- fiber twist sensor based on quasi-fan Solc structure filter.

PubMed

Sun, Chunran; Wang, Muguang; Jian, Shuisheng

2017-08-21

In this paper, a novel quasi-fan Solc structure filter based on elliptical-core spun fiber for twist sensing has been experimentally investigated and theoretically analyzed. The discrete model of spun fiber has been built to analyze the transmission characteristics of proposed sensor. Both experimental and simulated results indicate that the extinction ratio of the comb spectrum based on quasi-fan Solc birefringent fiber filter varies with twist angle and agrees well with each other. Based on the intensity modulation, the proposed twist sensor exhibits a high sensitivity of 0.02219 dB/(°/m). Moreover, thanks to the invariability of the fiber birefringence and the state of polarization of the input light, the proposed twist sensor has a very low temperature and strain sensitivity, which can avoid the cross-sensitivity problem existing in most twist sensors.

Using 4th order Runge-Kutta method for solving a twisted Skyrme string equation

NASA Astrophysics Data System (ADS)

Hadi, Miftachul; Anderson, Malcolm; Husein, Andri

2016-03-01

We study numerical solution, especially using 4th order Runge-Kutta method, for solving a twisted Skyrme string equation. We find numerically that the value of minimum energy per unit length of vortex solution for a twisted Skyrmion string is 20.37 × 1060 eV/m.

A zero torsional stiffness twist morphing blade as a wind turbine load alleviation device

NASA Astrophysics Data System (ADS)

Lachenal, X.; Daynes, S.; Weaver, P. M.

2013-06-01

This paper presents the design, analysis and realization of a zero stiffness twist morphing wind turbine blade. The morphing blade is designed to actively twist as a means of alleviating the gust loads which reduce the fatigue life of wind turbine blades. The morphing structure exploits an elastic strain energy balance within the blade to enable large twisting deformations with modest actuation requirements. While twist is introduced using the warping of the blade skin, internal pre-stressed members ensure that a constant strain energy balance is achieved throughout the deformation, resulting in a zero torsional stiffness structure. The torsional stability of the morphing blade is characterized by analysing the elastic strain energy in the device. Analytical models of the skin, the pre-stressed components and the complete blade are compared to their respective finite element models as well as experimental results. The load alleviation potential of the adaptive structure is quantified using a two-dimensional steady flow aerodynamic model which is experimentally validated with wind tunnel measurements.

A plant tendril mimic soft actuator with phototunable bending and chiral twisting motion modes

NASA Astrophysics Data System (ADS)

Wang, Meng; Lin, Bao-Ping; Yang, Hong

2016-12-01

In nature, plant tendrils can produce two fundamental motion modes, bending and chiral twisting (helical curling) distortions, under the stimuli of sunlight, humidity, wetting or other atmospheric conditions. To date, many artificial plant-like mechanical machines have been developed. Although some previously reported materials could realize bending or chiral twisting through tailoring the samples into various ribbons along different orientations, each single ribbon could execute only one deformation mode. The challenging task is how to endow one individual plant tendril mimic material with two different, fully tunable and reversible motion modes (bending and chiral twisting). Here we show a dual-layer, dual-composition polysiloxane-based liquid crystal soft actuator strategy to synthesize a plant tendril mimic material capable of performing two different three-dimensional reversible transformations (bending versus chiral twisting) through modulation of the wavelength band of light stimuli (ultraviolet versus near-infrared). This material has broad application prospects in biomimetic control devices.

A plant tendril mimic soft actuator with phototunable bending and chiral twisting motion modes.

PubMed

Wang, Meng; Lin, Bao-Ping; Yang, Hong

2016-12-22

In nature, plant tendrils can produce two fundamental motion modes, bending and chiral twisting (helical curling) distortions, under the stimuli of sunlight, humidity, wetting or other atmospheric conditions. To date, many artificial plant-like mechanical machines have been developed. Although some previously reported materials could realize bending or chiral twisting through tailoring the samples into various ribbons along different orientations, each single ribbon could execute only one deformation mode. The challenging task is how to endow one individual plant tendril mimic material with two different, fully tunable and reversible motion modes (bending and chiral twisting). Here we show a dual-layer, dual-composition polysiloxane-based liquid crystal soft actuator strategy to synthesize a plant tendril mimic material capable of performing two different three-dimensional reversible transformations (bending versus chiral twisting) through modulation of the wavelength band of light stimuli (ultraviolet versus near-infrared). This material has broad application prospects in biomimetic control devices.

Observing the release of twist by magnetic reconnection in a solar filament eruption

PubMed Central

Xue, Zhike; Yan, Xiaoli; Cheng, Xin; Yang, Liheng; Su, Yingna; Kliem, Bernhard; Zhang, Jun; Liu, Zhong; Bi, Yi; Xiang, Yongyuan; Yang, Kai; Zhao, Li

2016-01-01

Magnetic reconnection is a fundamental process of topology change and energy release, taking place in plasmas on the Sun, in space, in astrophysical objects and in the laboratory. However, observational evidence has been relatively rare and typically only partial. Here we present evidence of fast reconnection in a solar filament eruption using high-resolution H-alpha images from the New Vacuum Solar Telescope, supplemented by extreme ultraviolet observations. The reconnection is seen to occur between a set of ambient chromospheric fibrils and the filament itself. This allows for the relaxation of magnetic tension in the filament by an untwisting motion, demonstrating a flux rope structure. The topology change and untwisting are also found through nonlinear force-free field modelling of the active region in combination with magnetohydrodynamic simulation. These results demonstrate a new role for reconnection in solar eruptions: the release of magnetic twist. PMID:27306479

Unwinding motion of a twisted active region filament

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, X. L.; Xue, Z. K.; Kong, D. F.

To better understand the structures of active region filaments and the eruption process, we study an active region filament eruption in active region NOAA 11082 in detail on 2010 June 22. Before the filament eruption, the opposite unidirectional material flows appeared in succession along the spine of the filament. The rising of the filament triggered two B-class flares at the upper part of the filament. As the bright material was injected into the filament from the sites of the flares, the filament exhibited a rapid uplift accompanying the counterclockwise rotation of the filament body. From the expansion of the filament,more » we can see that the filament consisted of twisted magnetic field lines. The total twist of the filament is at least 5π obtained by using a time slice method. According to the morphology change during the filament eruption, it is found that the active region filament was a twisted flux rope and its unwinding motion was like a solar tornado. We also find that there was a continuous magnetic helicity injection before and during the filament eruption. It is confirmed that magnetic helicity can be transferred from the photosphere to the filament. Using the extrapolated potential fields, the average decay index of the background magnetic fields over the filament is 0.91. Consequently, these findings imply that the mechanism of solar filament eruption could be due to the kink instability and magnetic helicity accumulation.« less

Conformal twists, Yang–Baxter σ-models & holographic noncommutativity

NASA Astrophysics Data System (ADS)

Araujo, Thiago; Bakhmatov, Ilya; Colgáin, Eoin Ó.; Sakamoto, Jun-ichi; Sheikh-Jabbari, Mohammad M.; Yoshida, Kentaroh

2018-06-01

Expanding upon earlier results (Araujo et al 2017 Phys. Rev. D 95 105006), we present a compendium of σ-models associated with integrable deformations of AdS5 generated by solutions to homogenous classical Yang–Baxter equation. Each example we study from four viewpoints: conformal (Drinfeld) twists, closed string gravity backgrounds, open string parameters and proposed dual noncommutative (NC) gauge theory. Irrespective of whether the deformed background is a solution to supergravity or generalized supergravity, we show that the open string metric associated with each gravity background is undeformed AdS5 with constant open string coupling and the NC structure Θ is directly related to the conformal twist. One novel feature is that Θ exhibits ‘holographic noncommutativity’: while it may exhibit non-trivial dependence on the holographic direction, its value everywhere in the bulk is uniquely determined by its value at the boundary, thus facilitating introduction of a dual NC gauge theory. We show that the divergence of the NC structure Θ is directly related to the unimodularity of the twist. We discuss the implementation of an outer automorphism of the conformal algebra as a coordinate transformation in the AdS bulk and discuss its implications for Yang–Baxter σ-models and self-T-duality based on fermionic T-duality. Finally, we comment on implications of our results for the integrability of associated open strings and planar integrability of dual NC gauge theories.

Time-varying wing-twist improves aerodynamic efficiency of forward flight in butterflies.

PubMed

Zheng, Lingxiao; Hedrick, Tyson L; Mittal, Rajat

2013-01-01

Insect wings can undergo significant chordwise (camber) as well as spanwise (twist) deformation during flapping flight but the effect of these deformations is not well understood. The shape and size of butterfly wings leads to particularly large wing deformations, making them an ideal test case for investigation of these effects. Here we use computational models derived from experiments on free-flying butterflies to understand the effect of time-varying twist and camber on the aerodynamic performance of these insects. High-speed videogrammetry is used to capture the wing kinematics, including deformation, of a Painted Lady butterfly (Vanessa cardui) in untethered, forward flight. These experimental results are then analyzed computationally using a high-fidelity, three-dimensional, unsteady Navier-Stokes flow solver. For comparison to this case, a set of non-deforming, flat-plate wing (FPW) models of wing motion are synthesized and subjected to the same analysis along with a wing model that matches the time-varying wing-twist observed for the butterfly, but has no deformation in camber. The simulations show that the observed butterfly wing (OBW) outperforms all the flat-plate wings in terms of usable force production as well as the ratio of lift to power by at least 29% and 46%, respectively. This increase in efficiency of lift production is at least three-fold greater than reported for other insects. Interestingly, we also find that the twist-only-wing (TOW) model recovers much of the performance of the OBW, demonstrating that wing-twist, and not camber is key to forward flight in these insects. The implications of this on the design of flapping wing micro-aerial vehicles are discussed.

Time-Varying Wing-Twist Improves Aerodynamic Efficiency of Forward Flight in Butterflies

PubMed Central

Zheng, Lingxiao; Hedrick, Tyson L.; Mittal, Rajat

2013-01-01

Insect wings can undergo significant chordwise (camber) as well as spanwise (twist) deformation during flapping flight but the effect of these deformations is not well understood. The shape and size of butterfly wings leads to particularly large wing deformations, making them an ideal test case for investigation of these effects. Here we use computational models derived from experiments on free-flying butterflies to understand the effect of time-varying twist and camber on the aerodynamic performance of these insects. High-speed videogrammetry is used to capture the wing kinematics, including deformation, of a Painted Lady butterfly (Vanessa cardui) in untethered, forward flight. These experimental results are then analyzed computationally using a high-fidelity, three-dimensional, unsteady Navier-Stokes flow solver. For comparison to this case, a set of non-deforming, flat-plate wing (FPW) models of wing motion are synthesized and subjected to the same analysis along with a wing model that matches the time-varying wing-twist observed for the butterfly, but has no deformation in camber. The simulations show that the observed butterfly wing (OBW) outperforms all the flat-plate wings in terms of usable force production as well as the ratio of lift to power by at least 29% and 46%, respectively. This increase in efficiency of lift production is at least three-fold greater than reported for other insects. Interestingly, we also find that the twist-only-wing (TOW) model recovers much of the performance of the OBW, demonstrating that wing-twist, and not camber is key to forward flight in these insects. The implications of this on the design of flapping wing micro-aerial vehicles are discussed. PMID:23341923

The Effect of a Twisted Magnetic Field on the Phase Mixing of the Kink Magnetohydrodynamic Waves in Coronal Loops

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ebrahimi, Zanyar; Karami, Kayoomars; Soler, Roberto, E-mail: z.ebrahimi@uok.ac.ir

There is observational evidence for the existence of a twisted magnetic field in the solar corona. This inspires us to investigate the effect of a twisted magnetic field on the evolution of magnetohydrodynamic (MHD) kink waves in coronal loops. With this aim, we solve the incompressible linearized MHD equations in a magnetically twisted nonuniform coronal flux tube in the limit of long wavelengths. Our results show that a twisted magnetic field can enhance or diminish the rate of phase mixing of the Alfvén continuum modes and the decay rate of the global kink oscillation depending on the twist model andmore » the sign of the longitudinal ( k{sub z} ) and azimuthal ( m ) wavenumbers. Also, our results confirm that in the presence of a twisted magnetic field, when the sign of one of the two wavenumbers m and k {sub z} is changed, the symmetry with respect to the propagation direction is broken. Even a small amount of twist can have an important impact on the process of energy cascading to small scales.« less

Cosmic acceleration from M theory on twisted spaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neupane, Ishwaree P.; Wiltshire, David L.

2005-10-15

In a recent paper [I. P. Neupane and D. L. Wiltshire, Phys. Lett. B 619, 201 (2005).] we have found a new class of accelerating cosmologies arising from a time-dependent compactification of classical supergravity on product spaces that include one or more geometric twists along with nontrivial curved internal spaces. With such effects, a scalar potential can have a local minimum with positive vacuum energy. The existence of such a minimum generically predicts a period of accelerated expansion in the four-dimensional Einstein conformal frame. Here we extend our knowledge of these cosmological solutions by presenting new examples and discuss themore » properties of the solutions in a more general setting. We also relate the known (asymptotic) solutions for multiscalar fields with exponential potentials to the accelerating solutions arising from simple (or twisted) product spaces for internal manifolds.« less

Females have greater left ventricular twist mechanics than males during acute reductions to preload.

PubMed

Williams, Alexandra M; Shave, Rob E; Stembridge, Mike; Eves, Neil D

2016-07-01

Compared to males, females have smaller left ventricular (LV) dimensions and volumes, higher ejection fractions (EF), and higher LV longitudinal and circumferential strain. LV twist mechanics determine ventricular function and are preload-dependent. Therefore, the sex differences in LV structure and myocardial function may result in different mechanics when preload is altered. This study investigated sex differences in LV mechanics during acute challenges to preload. With the use of conventional and speckle-tracking echocardiography, LV structure and function were assessed in 20 males (24 ± 6.2 yr) and 20 females (23 ± 3.1 yr) at baseline and during progressive levels of lower body negative pressure (LBNP). Fourteen participants (8 males, 6 females) were also assessed following a rapid infusion of saline. LV end-diastolic volume, end-systolic volume, stroke volume (SV), and EF were reduced in both groups during LBNP (P < 0.001). While males had greater absolute volumes (P < 0.001), there were no sex differences in allometrically scaled volumes at any stage. Sex differences were not detected at baseline in basal rotation, apical rotation, or twist. Apical rotation and twist increased in both groups (P < 0.001) with LBNP. At -60 mmHg, females had greater apical rotation (P = 0.009), twist (P = 0.008), and torsion (P = 0.002) and faster untwisting velocity (P = 0.02) than males. There were no differences in mechanics following saline infusion. Females have larger LV twist and a faster untwisting velocity than males during large reductions to preload, supporting that females have a greater reliance on LV twist mechanics to maintain SV during severe reductions to preload. Copyright © 2016 the American Physiological Society.

RESONANT ABSORPTION OF AXISYMMETRIC MODES IN TWISTED MAGNETIC FLUX TUBES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giagkiozis, I.; Verth, G.; Goossens, M.

2016-06-01

It has been shown recently that magnetic twist and axisymmetric MHD modes are ubiquitous in the solar atmosphere, and therefore the study of resonant absorption for these modes has become a pressing issue because it can have important consequences for heating magnetic flux tubes in the solar atmosphere and the observed damping. In this investigation, for the first time, we calculate the damping rate for axisymmetric MHD waves in weakly twisted magnetic flux tubes. Our aim is to investigate the impact of resonant damping of these modes for solar atmospheric conditions. This analytical study is based on an idealized configurationmore » of a straight magnetic flux tube with a weak magnetic twist inside as well as outside the tube. By implementing the conservation laws derived by Sakurai et al. and the analytic solutions for weakly twisted flux tubes obtained recently by Giagkiozis et al. we derive a dispersion relation for resonantly damped axisymmetric modes in the spectrum of the Alfvén continuum. We also obtain an insightful analytical expression for the damping rate in the long wavelength limit. Furthermore, it is shown that both the longitudinal magnetic field and the density, which are allowed to vary continuously in the inhomogeneous layer, have a significant impact on the damping time. Given the conditions in the solar atmosphere, resonantly damped axisymmetric modes are highly likely to be ubiquitous and play an important role in energy dissipation. We also suggest that, given the character of these waves, it is likely that they have already been observed in the guise of Alfvén waves.« less

Twist-writhe partitioning in a coarse-grained DNA minicircle model

NASA Astrophysics Data System (ADS)

Sayar, Mehmet; Avşaroǧlu, Barış; Kabakçıoǧlu, Alkan

2010-04-01

Here we present a systematic study of supercoil formation in DNA minicircles under varying linking number by using molecular-dynamics simulations of a two-bead coarse-grained model. Our model is designed with the purpose of simulating long chains without sacrificing the characteristic structural properties of the DNA molecule, such as its helicity, backbone directionality, and the presence of major and minor grooves. The model parameters are extracted directly from full-atomistic simulations of DNA oligomers via Boltzmann inversion; therefore, our results can be interpreted as an extrapolation of those simulations to presently inaccessible chain lengths and simulation times. Using this model, we measure the twist/writhe partitioning in DNA minicircles, in particular its dependence on the chain length and excess linking number. We observe an asymmetric supercoiling transition consistent with experiments. Our results suggest that the fraction of the linking number absorbed as twist and writhe is nontrivially dependent on chain length and excess linking number. Beyond the supercoiling transition, chains of the order of one persistence length carry equal amounts of twist and writhe. For longer chains, an increasing fraction of the linking number is absorbed by the writhe.

To investigate the relation between pore size and twist angle in enhanced thermoelectric efficient porous armchair graphene nanoribbons

NASA Astrophysics Data System (ADS)

Kaur, Sukhdeep; Randhawa, Deep Kamal Kaur; Bindra Narang, Sukhleen

2018-05-01

Based on Non-Equilibrium Green’s function method, we demonstrate that the twisted deformation is an efficient method to improve the figure of merit ZT of porous armchair graphene nanoribbons AGNRs. The peak value of ZT can be obtained for a certain tunable twist angle. Further analysis shows that the tunable twist angle exhibits an inverse relationship with the pore size laying forth the designers a choice for the larger twists to be replaced by smaller ones simply by increasing the size of the pore. Ballistic transport regime and semi-empirical method using Huckel basis set is used to obtain the electrical properties while the Tersoff potential is employed for the phononic system. These interesting findings indicate that the twisted porous AGNRs can be utilized as designing materials for potential thermoelectric applications.

Far-Infrared and Raman Spectra and The Ring-Twisting Potential Energy Function of 1,3-Cyclohexadiene

NASA Astrophysics Data System (ADS)

Autrey, Daniel; Choo, Jaebum; Laane, Jaan

2001-10-01

The nu19 (A2) ring-twisting vibration of 1,3-cyclohexadiene has been analyzed from the vapor-phase Raman and infrared spectra. The Raman spectrum shows nine ring-twisting transitions in the 116 - 199 cm-1 region. The far-infrared spectrum confirms five of these transitions, despite the fact that the vibration is infrared forbidden in the C2v (planar) approximation. Other Raman and infrared combination bands verify the assignments and provide information on the vibrational coupling. A coordinate dependent kinetic energy expansion for the ring-twisting motion was calculated, and this was used to determine the ring-twisting potential function, which has a barrier to planarity of 1132 cm-1 and energy minima corresponding to twisting angles of 9.1º and 30.1º. Ab initio calculations were also carried out using Moller-Plesset perturbation theory (MP2) with a large number of different basis sets. The various ab initio calculations gave barriers to planarity in the 1197 - 1593 cm-1 range and calculated vibrational frequencies in excellent agreement with the experimental values.

UHF Radar observations at HAARP with HF pump frequencies near electron gyro-harmonics and associated ionospheric effects

NASA Astrophysics Data System (ADS)

Watkins, Brenton; Fallen, Christopher; Secan, James

Results for HF modification experiments at the HAARP facility in Alaska are presented for experiments with the HF pump frequency near third and fourth electron gyro-harmonics. A UHF diagnostic radar with range resolution of 600 m was used to determine time-dependent altitudes of scattering from plasma turbulence during heating experiments. Experiments were conducted with multiple HF frequencies stepped by 20 kHz above and below the gyro-harmonic values. During times of HF heating the HAARP facility has sufficient power to enhance large-scale ionospheric densities in the lower ionosphere (about 150-200 km altitude) and also in the topside ionosphere (above about 350 km). In the lower ionosphere, time-dependent decreases of the altitude of radar scatter result from electron density enhancements. The effects are substantially different even for relatively small frequency steps of 20 kHz. In all cases the time-varying altitude decrease of radar scatter stops about 5-10 km below the gyro-harmonic altitude that is frequency dependent; we infer that electron density enhancements stop at this altitude where the radar signals stop decreasing with altitude. Experiments with corresponding total electron content (TEC) data show that for HF interaction altitudes above about 170 km there is substantial topside electron density increases due to upward electron thermal conduction. For lower altitudes of HF interaction the majority of the thermal energy is transferred to the neutral gas and no significant topside density increases are observed. By selecting an appropriate HF frequency a little greater than the gyro-harmonic value we have demonstrated that the ionospheric response to HF heating is a self-oscillating mode where the HF interaction altitude moves up and down with a period of several minutes. If the interaction region is above about 170 km this also produces a continuously enhanced topside electron density and upward plasma flux. Experiments using an FM scan with the HF

Twisting and Writhing with George Ellery Hale

NASA Astrophysics Data System (ADS)

Canfield, Richard C.

2013-06-01

Early in his productive career in astronomy, George Ellery Hale developed innovative solar instrumentation that allowed him to make narrow-band images. Among the solar phenomena he discovered were sunspot vortices, which he attributed to storms akin to cyclones in our own atmosphere. Using the concept of magnetic helicity, physicists and mathematicians describe the topology of magnetic fields, including twisting and writhing. Our contemporary understanding of Hale's vortices as a consequence of large-scale twist in sunspot magnetic fields hinges on a key property of helicity: conservation. I will describe the critical role that this property plays, when applied to twist and writhe, in a fundamental aspect of global solar magnetism: the hemispheric and solar cycle dependences of active region electric currents with respect to magnetic fields. With the advent of unbroken sequences of high-resolution magnetic images, such as those presently available from the Helioseismic and Magnetic Imager on Solar Dynamics Observatory, the flux of magnetic helicity through the photosphere can be observed quantitatively. As magnetic flux tubes buoy up through the convection zone, buffeted and shredded by turbulence, they break up into fragments by repeated random bifurcation. We track these rising flux fragments in the photosphere, and calculate the flux of energy and magnetic helicity there. Using a quantitative model of coronal currents, we also track connections between these fragments to calculate the energy and magnetic helicity stored at topological interfaces that are in some ways analogous to the storage of stress at faults in the Earth's crust. Comparison of these values to solar flares and interplanetary coronal mass ejections implies that this is the primary storage mechanism for energy and magnetic helicity released in those phenomena, and suggests a useful tool for quantitative prediction of geomagnetic storms.

Symmetries and Boundary Conditions with a Twist

NASA Astrophysics Data System (ADS)

Zawadzki, Krissia; D'Amico, Irene; Oliveira, Luiz N.

2017-10-01

Interest in finite-size systems has risen in the last decades, due to the focus on nanotechnological applications and because they are convenient for numerical treatment that can subsequently be extrapolated to infinite lattices. Independently of the envisioned application, special attention must be given to boundary condition, which may or may not preserve the symmetry of the infinite lattice. Here, we present a detailed study of the compatibility between boundary conditions and conservation laws. The conflict between open boundary conditions and momentum conservation is well understood, but we examine other symmetries, as well: we discuss gauge invariance, inversion, spin, and particle-hole symmetry and their compatibility with open, periodic, and twisted boundary conditions. In the interest of clarity, we develop the reasoning in the framework of the one-dimensional half-filled Hubbard model, whose Hamiltonian displays a variety of symmetries. Our discussion includes analytical and numerical results. Our analytical survey shows that, as a rule, boundary conditions break one or more symmetries of the infinite-lattice Hamiltonian. The exception is twisted boundary condition with the special torsion Θ = πL/2, where L is the lattice size. Our numerical results for the ground-state energy at half-filling and the energy gap for L = 2-7 show how the breaking of symmetry affects the convergence to the L → ∞ limit. We compare the computed energies and gaps with the exact results for the infinite lattice drawn from the Bethe-Ansatz solution. The deviations are boundary-condition dependent. The special torsion yields more rapid convergence than open or periodic boundary conditions. For sizes as small as L = 7, the numerical results for twisted condition are very close to the L → ∞ limit. We also discuss the ground-state electronic density and magnetization at half filling under the three boundary conditions.

Sweep-twist adaptive rotor blade : final project report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashwill, Thomas D.

2010-02-01

Knight & Carver was contracted by Sandia National Laboratories to develop a Sweep Twist Adaptive Rotor (STAR) blade that reduced operating loads, thereby allowing a larger, more productive rotor. The blade design used outer blade sweep to create twist coupling without angled fiber. Knight & Carver successfully designed, fabricated, tested and evaluated STAR prototype blades. Through laboratory and field tests, Knight & Carver showed the STAR blade met the engineering design criteria and economic goals for the program. A STAR prototype was successfully tested in Tehachapi during 2008 and a large data set was collected to support engineering and commercialmore » development of the technology. This report documents the methodology used to develop the STAR blade design and reviews the approach used for laboratory and field testing. The effort demonstrated that STAR technology can provide significantly greater energy capture without higher operating loads on the turbine.« less

Somatic twist: a model for the evolution of decussation.

PubMed

Kinsbourne, Marcel

2013-09-01

In the chordate and vertebrate central nervous system, sensory and motor nerve tracts cross from one side to the other as they connect the brain with sensory receptors and motor neurons. These "decussations," crossings in the form of an X, relate each side of the brain to the opposite side of the body. The protochordates derive from an invertebrate ancestor, but no such contralateral arrangement occurs in any invertebrate phylum. No adaptive benefit of decussation has been established. What might explain the evolution of decussation? A brief review of relevant features of comparative morphology of invertebrates, chordates and vertebrates leads to an explanatory model of decussation. A "somatic twist model" of invertebrate-vertebrate transition accounts for decussations as byproducts of a more momentous change; the relocation of the neuraxis from the ventral to the dorsal aspect of the body. Evidence is presented that this inversion proceeded by means of a twisting of the body 180 degrees on its axis just behind its anterior pole. This rotation aligned the neuraxis with the dorsal head ganglia and brain and by twisting the nerve tracts it brought decussation in its wake. Decussation evolved as a byproduct of a genetically determined partial inversion of the body plan, which resulted in a 180 degree rotation posterior to the brain and oropharynx.

New collinear twist-3 analysis of transverse SSA: Toward a resolution for the sign-mismatch problem

DOE PAGES

Kanazawa, Koichi; Pitonyak, Daniel; Koike, Yuji; ...

2014-10-19

We present a new collinear twist-3 analysis of the transverse SSA A N at RHIC. We use the TMD Sivers/Collins function to fix some of the relevant collinear twist-3 functions and perform a fit of the RHIC data with other parameterized twist-3 functions. This allows us to keep the consistency among descriptions in pp collision, SIDIS, and e +e – annihilation and thus could provide a unified description of the spin asymmetries in the low- and high-P T processes. In conclusion, by taking into account the twist-3 fragmentation contribution, we show for the first time this contribution could be themore » main source of A N in pp ↑ → hX and its inclusion could provide a solution for the sign-mismatch problem.« less

Scaling effects in resonant coupling phenomena between fundamental and cladding modes in twisted microstructured optical fibers.

PubMed

Napiorkowski, Maciej; Urbanczyk, Waclaw

2018-04-30

We show that in twisted microstructured optical fibers (MOFs) the coupling between the core and cladding modes can be obtained for helix pitch much greater than previously considered. We provide an analytical model describing scaling properties of the twisted MOFs, which relates coupling conditions to dimensionless ratios between the wavelength, the lattice pitch and the helix pitch of the twisted fiber. Furthermore, we verify our model using a rigorous numerical method based on the transformation optics formalism and study its limitations. The obtained results show that for appropriately designed twisted MOFs, distinct, high loss resonance peaks can be obtained in a broad wavelength range already for the fiber with 9 mm helix pitch, thus allowing for fabrication of coupling based devices using a less demanding method involving preform spinning.

Knockdown of TWIST1 enhances arsenic trioxide- and ionizing radiation-induced cell death in lung cancer cells by promoting mitochondrial dysfunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seo, Sung-Keum; Kim, Jae-Hee; Choi, Ha-Na

Highlights: • Knockdown of TWIST1 enhanced ATO- and IR-induced cell death in NSCLCs. • Intracellular ROS levels were increased in cells treated with TWIST1 siRNA. • TWIST1 siRNA induced MMP loss and mitochondrial fragmentation. • TWIST1 siRNA upregulated the fission-related proteins FIS1 and DRP1. - Abstract: TWIST1 is implicated in the process of epithelial mesenchymal transition, metastasis, stemness, and drug resistance in cancer cells, and therefore is a potential target for cancer therapy. In the present study, we found that knockdown of TWIST1 by small interfering RNA (siRNA) enhanced arsenic trioxide (ATO)- and ionizing radiation (IR)-induced cell death in non-small-cellmore » lung cancer cells. Interestingly, intracellular reactive oxygen species levels were increased in cells treated with TWIST1 siRNA and further increased by co-treatment with ATO or IR. Pretreatment of lung cancer cells with the antioxidant N-acetyl-cysteine markedly suppressed the cell death induced by combined treatment with TWIST1 siRNA and ATO or IR. Moreover, treatment of cells with TWIST1 siRNA induced mitochondrial membrane depolarization and significantly increased mitochondrial fragmentation (fission) and upregulated the fission-related proteins FIS1 and DRP1. Collectively, our results demonstrate that siRNA-mediated TWIST1 knockdown induces mitochondrial dysfunction and enhances IR- and ATO-induced cell death in lung cancer cells.« less

On the small angle twist sub-grain boundaries in Ti3AlC2.

PubMed

Zhang, Hui; Zhang, Chao; Hu, Tao; Zhan, Xun; Wang, Xiaohui; Zhou, Yanchun

2016-04-01

Tilt-dominated grain boundaries have been investigated in depth in the deformation of MAX phases. In stark contrast, another important type of grain boundaries, twist grain boundaries, have long been overlooked. Here, we report on the observation of small angle twist sub-grain boundaries in a typical MAX phase Ti3AlC2 compressed at 1200 °C, which comprise hexagonal screw dislocation networks formed by basal dislocation reactions. By first-principles investigations on atomic-scale deformation and general stacking fault energy landscapes, it is unequivocally demonstrated that the twist sub-grain boundaries are most likely located between Al and Ti4f (Ti located at the 4f Wyckoff sites of P63/mmc) layers, with breaking of the weakly bonded Al-Ti4f. The twist angle increases with the increase of deformation and is estimated to be around 0.5° for a deformation of 26%. This work may shed light on sub-grain boundaries of MAX phases, and provide fundamental information for future atomic-scale simulations.

Effect of Intrinsic Twist on Length of Crystalline and Disordered Regions in Cellulose Microfibrils

NASA Astrophysics Data System (ADS)

Nili, Abdolmadjid; Shklyaev, Oleg; Zhao, Zhen; Zhong, Linghao; Crespi, Vincent

2013-03-01

Cellulose is the most abundant biological material in the world. It provides mechanical reinforcement for plant cell wall, and could potentially serve as renewable energy source for biofuel. Native cellulose forms a non-centrosymmetric chiral crystal due to lack of roto-inversion symmetry of constituent glucose chains. Chirality of cellulose crystal could result in an overall twist. Competition between unwinding torsional/extensional and twisting energy terms leads to twist induced frustration along fibril's axis. The accumulated frustration could be the origin of periodic disordered regions observed in cellulose microfibrils. These regions could play significant role in properties of cellulose bundles and ribbons as well as biological implications on plant cell walls. We propose a mechanical model based on Frenkel-Kontorova mechanism to investigate effects of radius dependent twist on crystalline size in cellulose microfibrils. Parameters of the model are adjusted according to all-atom molecular simulations. This work is supported by the US Department of Energy, Office of Basic Energy Sciences as part of The Center for LignoCellulose Structure and Formation, an Energy Frontier Research Center

The TWIST1 oncogene is a direct target of hypoxia-inducible factor-2alpha.

PubMed

Gort, E H; van Haaften, G; Verlaan, I; Groot, A J; Plasterk, R H A; Shvarts, A; Suijkerbuijk, K P M; van Laar, T; van der Wall, E; Raman, V; van Diest, P J; Tijsterman, M; Vooijs, M

2008-03-06

Hypoxia-inducible factors (HIFs) are highly conserved transcription factors that play a crucial role in oxygen homeostasis. Intratumoral hypoxia and genetic alterations lead to HIF activity, which is a hallmark of solid cancer and is associated with poor clinical outcome. HIF activity is regulated by an evolutionary conserved mechanism involving oxygen-dependent HIFalpha protein degradation. To identify novel components of the HIF pathway, we performed a genome-wide RNA interference screen in Caenorhabditis elegans, to suppress HIF-dependent phenotypes, like egg-laying defects and hypoxia survival. In addition to hif-1 (HIFalpha) and aha-1 (HIFbeta), we identified hlh-8, gska-3 and spe-8. The hlh-8 gene is homologous to the human oncogene TWIST1. We show that TWIST1 expression in human cancer cells is enhanced by hypoxia in a HIF-2alpha-dependent manner. Furthermore, intronic hypoxia response elements of TWIST1 are regulated by HIF-2alpha, but not HIF-1alpha. These results identify TWIST1 as a direct target gene of HIF-2alpha, which may provide insight into the acquired metastatic capacity of hypoxic tumors.

Shape memory alloy TiNi actuators for twist control of smart wing designs

NASA Astrophysics Data System (ADS)

Jardine, A. Peter; Kudva, Jayanth N.; Martin, Christopher A.; Appa, Kari

1996-05-01

On high performance military aircraft, small changes in both wing twist and wing camber have the potential to provide substantial payoffs in terms of additional lift and enhanced maneuverability. To achieve the required wing shape, actuators made of smart materials are currently being studied under an ARPA/WL contract for a subscale model of a fighter aircraft. The use of the shape memory alloy TiNi for wing twist actuation was investigated using shape memory effect (SME) torque tube actuator configurations. The actuator configurations were sized to fit inside a 16% scale model of an aircraft wing and the torque's supplied to the wing were similarly calculated from full-scale requirements. The actuator systems were tested in a conventional laboratory setting. Design and calibration of the actuators for wing twist are discussed.

The Effect of Non-Harmonic Active Twist Actuation on BVI Noise

NASA Technical Reports Server (NTRS)

Fogarty, David E.; Wilbur, Matthew L.; Sekula, Martin K.

2011-01-01

The results of a computational study examining the effects of non-harmonic active-twist control on blade-vortex interaction (BVI) noise for the Apache Active Twist Rotor are presented. Rotor aeroelastic behavior was modeled using the Comprehensive Analytical Model of Rotorcraft Aerodynamics and Dynamics code and the rotor noise was predicted using the acoustics code PSU-WOPWOP. The application of non-harmonic active-twist inputs to the main rotor blade system comprised three parameters: azimuthal location to start actuation, azimuthal duration of actuation, and magnitude of actuation. The acoustic analysis was conducted for a single low-speed flight condition of advance ratio mu=0.14 and shaft angle-of-attack, a(sub s)=+6deg. BVI noise levels were predicted on a flat plane of observers located 1.1 rotor diameters beneath the rotor. The results indicate significant reductions of up to 10dB in BVI noise using a starting azimuthal location for actuation of 90?, an azimuthal duration of actuation of 90deg, and an actuation magnitude of +1.5 ft-lb.

Quercetin Suppresses Twist to Induce Apoptosis in MCF-7 Breast Cancer Cells

PubMed Central

Ranganathan, Santhalakshmi; Halagowder, Devaraj; Sivasithambaram, Niranjali Devaraj

2015-01-01

Quercetin is a dietary flavonoid which exerts anti-oxidant, anti-inflammatory and anti-cancer properties. In this study, we investigated the anti-proliferative effect of quercetin in two breast cancer cell lines (MCF-7 and MDA-MB-231), which differed in hormone receptor. IC50 value (37μM) of quercetin showed significant cytotoxicity in MCF-7 cells, which was not observed in MDA-MB-231 cells even at 100μM of quercetin treatment. To study the response of cancer cells to quercetin, with respect to different hormone receptors, both the cell lines were treated with a fixed concentration (40μM) of quercetin. MCF-7 cells on quercetin treatment showed more apoptotic cells with G1 phase arrest. In addition, quercetin effectively suppressed the expression of CyclinD1, p21, Twist and phospho p38MAPK, which was not observed in MDA-MB-231 cells. To analyse the molecular mechanism of quercetin in exerting an apoptotic effect in MCF-7 cells, Twist was over-expressed and the molecular changes were observed after quercetin administration. Quercetin effectively regulated the expression of Twist, in turn p16 and p21 which induced apoptosis in MCF-7 cells. In conclusion, quercetin induces apoptosis in breast cancer cells through suppression of Twist via p38MAPK pathway. PMID:26491966

A UHF RFID system with on-chip-antenna tag for short range communication

NASA Astrophysics Data System (ADS)

Qi, Peng; Chun, Zhang; Xijin, Zhao; Zhihua, Wang

2015-05-01

A UHF RF identification system based on the 0.18 μm CMOS process has been developed for short range and harsh size requirement applications, which is composed of a fully integrated tag and a special reader. The whole tag chip with the antenna takes up an area of 0.36 mm2, which is smaller than other reported tags with an on-chip antenna (OCA) using the standard CMOS process. A self-defined protocol is proposed to reduce the power consumption, and minimize the size of the tag. The specialized SOC reader system consists of the RF transceiver, digital baseband, MCU and host interface. Its power consumption is about 500 mW. Measurement results show that the system's reading range is 2 mm with 20 dBm reader output power. With an inductive antenna printed on a paper substrate around the OCA tag, the reading range can be extended from several centimeters to meters, depending on the shape and size of the inductive antenna.

Evidence of Twisted Flux-Tube Emergence in Active Regions

NASA Astrophysics Data System (ADS)

Poisson, M.; Mandrini, C. H.; Démoulin, P.; López Fuentes, M.

2015-03-01

Elongated magnetic polarities are observed during the emergence phase of bipolar active regions (ARs). These extended features, called magnetic tongues, are interpreted as a consequence of the azimuthal component of the magnetic flux in the toroidal flux-tubes that form ARs. We develop a new systematic and user-independent method to identify AR tongues. Our method is based on determining and analyzing the evolution of the AR main polarity inversion line (PIL). The effect of the tongues is quantified by measuring the acute angle [ τ] between the orientation of the PIL and the direction orthogonal to the AR main bipolar axis. We apply a simple model to simulate the emergence of a bipolar AR. This model lets us interpret the effect of magnetic tongues on parameters that characterize ARs ( e.g. the PIL inclination and the tilt angles, and their evolution). In this idealized kinematic emergence model, τ is a monotonically increasing function of the twist and has the same sign as the magnetic helicity. We systematically apply our procedure to a set of bipolar ARs (41 ARs) that were observed emerging in line-of-sight magnetograms over eight years. For most of the cases studied, the tongues only have a small influence on the AR tilt angle since tongues have a much lower magnetic flux than the more concentrated main polarities. From the observed evolution of τ, corrected for the temporal evolution of the tilt angle and its final value when the AR is fully emerged, we estimate the average number of turns in the subphotospherically emerging flux-rope. These values for the 41 observed ARs are below unity, except for one. This indicates that subphotospheric flux-ropes typically have a low amount of twist, i.e. highly twisted flux-tubes are rare. Our results demonstrate that the evolution of the PIL is a robust indicator of the presence of tongues and constrains the amount of twist in emerging flux-tubes.

Twisted Pair Of Insulated Wires Senses Moisture

NASA Technical Reports Server (NTRS)

Laue, Eric G.; Stephens, James B.

1989-01-01

Sensitivity of electronic moisture sensor to low levels of moisture increased by new electrode configuration. Moisture-sensing circuit described in "Low-Cost Humidity Sensor" (NPO-16544). New twisted pair of wires takes place of flat-plate capacitor in circuit. Configuration allows for thermal expansion and contraction of polymer while maintaining nearly constant area of contact between polymer and wires.

A Novel Displacement and Tilt Detection Method Using Passive UHF RFID Technology.

PubMed

Lai, Xiaozheng; Cai, Zhirong; Xie, Zeming; Zhu, Hailong

2018-05-21

The displacement and tilt angle of an object are useful information for wireless monitoring applications. In this paper, a low-cost detection method based on passive radio frequency identification (RFID) technology is proposed. This method uses a standard ultrahigh-frequency (UHF) RFID reader to measure the phase variation of the tag response and detect the displacement and tilt angle of RFID tags attached to the targeted object. An accurate displacement result can be detected by the RFID system with a linearly polarized (LP) reader antenna. Based on the displacement results, an accurate tilt angle can also be detected by the RFID system with a circularly polarized (CP) reader antenna, which has been proved to have a linear relationship with the phase parameter of the tag’s backscattered wave. As far as accuracy is concerned, the mean absolute error (MAE) of displacement is less than 2 mm and the MAE of the tilt angle is less than 2.5° for an RFID system with 500 mm working range.

Selectively enhanced photocurrent generation in twisted bilayer graphene with van Hove singularity

PubMed Central

Yin, Jianbo; Wang, Huan; Peng, Han; Tan, Zhenjun; Liao, Lei; Lin, Li; Sun, Xiao; Koh, Ai Leen; Chen, Yulin; Peng, Hailin; Liu, Zhongfan

2016-01-01

Graphene with ultra-high carrier mobility and ultra-short photoresponse time has shown remarkable potential in ultrafast photodetection. However, the broad and weak optical absorption (∼2.3%) of monolayer graphene hinders its practical application in photodetectors with high responsivity and selectivity. Here we demonstrate that twisted bilayer graphene, a stack of two graphene monolayers with an interlayer twist angle, exhibits a strong light–matter interaction and selectively enhanced photocurrent generation. Such enhancement is attributed to the emergence of unique twist-angle-dependent van Hove singularities, which are directly revealed by spatially resolved angle-resolved photoemission spectroscopy. When the energy interval between the van Hove singularities of the conduction and valance bands matches the energy of incident photons, the photocurrent generated can be significantly enhanced (up to ∼80 times with the integration of plasmonic structures in our devices). These results provide valuable insight for designing graphene photodetectors with enhanced sensitivity for variable wavelength. PMID:26948537

Twist drill craniostomy with closed drainage for chronic subdural haematoma in the elderly: an effective method.

PubMed

Ramnarayan, R; Arulmurugan, B; Wilson, Paul M; Nayar, Rani

2008-09-01

Chronic subdural haematoma is a disease of the elderly and surgery in these patients carries a much higher risk. The common surgical procedures for chronic subdural haematoma include twist drill craniostomy, burr hole evacuation or craniotomy. The aim of this study was to analyse the results of twist drill craniostomy with drainage in elderly patients with chronic subdural haematoma. Forty-two elderly patients (>65 years) with radiologically proven chronic subdural haematoma were analysed. All the patients underwent twist drill craniostomy and continuous drainage of the haematoma under local anaesthesia and total intravenous anaesthesia (TIVA). There were 24 males and 18 females. Headache and cognitive decline was seen in 50% and weakness of limbs in 60% of patients. CT scan was done in all cases. All patients underwent twist drill 2-3 cm in front of the parietal eminence under local anaesthesia. The drain was left for 24-72 h depending on the drainage. At 1 week, 88% of patients had a good outcome. Twist drill craniostomy with drainage under local anaesthesia is a safe and effective procedure for chronic subdural haematoma in the elderly and could be used as the first and only option in these people.

Strain, curvature, and twist measurements in digital holographic interferometry using pseudo-Wigner-Ville distribution based method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rajshekhar, G.; Gorthi, Sai Siva; Rastogi, Pramod

2009-09-15

Measurement of strain, curvature, and twist of a deformed object play an important role in deformation analysis. Strain depends on the first order displacement derivative, whereas curvature and twist are determined by second order displacement derivatives. This paper proposes a pseudo-Wigner-Ville distribution based method for measurement of strain, curvature, and twist in digital holographic interferometry where the object deformation or displacement is encoded as interference phase. In the proposed method, the phase derivative is estimated by peak detection of pseudo-Wigner-Ville distribution evaluated along each row/column of the reconstructed interference field. A complex exponential signal with unit amplitude and the phasemore » derivative estimate as the argument is then generated and the pseudo-Wigner-Ville distribution along each row/column of this signal is evaluated. The curvature is estimated by using peak tracking strategy for the new distribution. For estimation of twist, the pseudo-Wigner-Ville distribution is evaluated along each column/row (i.e., in alternate direction with respect to the previous one) for the generated complex exponential signal and the corresponding peak detection gives the twist estimate.« less

Loss of Twist1 in the Mesenchymal Compartment Promotes Increased Fibrosis in Experimental Lung Injury by Enhanced Expression of CXCL12

PubMed Central

Tan, Jiangning; Tedrow, John R.; Nouraie, Mehdi; Dutta, Justin A.; Miller, David T.; Li, Xiaoyun; Yu, Shibing; Chu, Yanxia; Juan-Guardela, Brenda; Kaminski, Naftali; Ramani, Kritika; Biswas, Partha S.; Zhang, Yingze

2017-01-01

Idiopathic pulmonary fibrosis (IPF) is a disease characterized by the accumulation of apoptosis-resistant fibroblasts in the lung. We have previously shown that high expression of the transcription factor Twist1 may explain this prosurvival phenotype in vitro. However, this observation has never been tested in vivo. We found that loss of Twist1 in COL1A2+ cells led to increased fibrosis characterized by very significant accumulation of T cells and bone marrow–derived matrix-producing cells. We found that Twist1-null cells expressed high levels of the T cell chemoattractant CXCL12. In vitro, we found that the loss of Twist1 in IPF lung fibroblasts increased expression of CXCL12 downstream of increased expression of the noncanonical NF-κB transcription factor RelB. Finally, blockade of CXCL12 with AMD3100 attenuated the exaggerated fibrosis observed in Twist1-null mice. Transcriptomic analysis of 134 IPF patients revealed that low expression of Twist1 was characterized by enrichment of T cell pathways. In conclusion, loss of Twist1 in collagen-producing cells led to increased bleomycin-induced pulmonary fibrosis, which is mediated by increased expression of CXCL12. Twist1 expression is associated with dysregulation of T cells in IPF patients. Twist1 may shape the IPF phenotype and regulate inflammation in fibrotic lung injury. PMID:28179498

Active experiments in geospace plasmas with gigawatts of RF power at HAARP

NASA Astrophysics Data System (ADS)

Sheerin, James

2016-07-01

The ionosphere provides a relatively quiescent plasma target, stable on timescales of minutes, for a whole host of active plasma experiments. The largest HF transmitter built to date is the HAARP phased-array HF transmitter near Gakona, Alaska which can deliver up to 3.6 Gigawatts (ERP) of CW RF power in the range of 2.8 - 10 MHz to the ionosphere with millisecond pointing, power modulation, and frequency agility. With an ionospheric background thermal energy in the range of only 0.1 eV, this amount of power gives access to the highest regimes of the nonlinearity (RF intensity to thermal pressure) ratio. HAARP's unique features have enabled the conduct of a number of nonlinear plasma experiments in the inter¬action region of overdense ionospheric plasma including generation of artificial aurorae, artificial ionization layers, VLF wave-particle interactions in the magnetosphere, parametric instabilities, stimulated electromagnetic emissions (SEE), strong Langmuir turbulence (SLT) and suprathermal electron acceleration. Diagnostics include the Modular UHF Ionospheric Radar (MUIR) sited at HAARP, the SuperDARN-Kodiak HF radar, spacecraft radio beacons, HF receivers to record stimulated electromagnetic emissions (SEE) and optics for optical emissions. We report on short timescale ponderomotive overshoot effects, artificial field-aligned irregularities (AFAI), the aspect angle dependence of the intensity of the HF-enhanced plasma line, and production of suprathermal electrons. Applications are made to the controlled study of fundamental nonlinear plasma processes of relevance to laboratory plasmas, ionospheric irregularities affecting spacecraft communication and navigation systems, artificial ionization mirrors, wave-particle interactions in the magnetosphere, active global magnetospheric experiments, and many more.

The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise

PubMed Central

Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J.

2016-01-01

Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, V˙O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32–69% of V˙O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results. PMID:27100099

The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise.

PubMed

Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J

2016-01-01

Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, [Formula: see text]O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32-69% of [Formula: see text]O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results.

Twist seal for high-pressure vessels such as space shuttle rocket motors

NASA Technical Reports Server (NTRS)

von Pragenau, George L. (Inventor)

1989-01-01

Seals for sealing clevis and flange joints (14) of a solid rocket booster motor, and more particularly to a seal (30) which is twisted upon application of expansion forces to an edge seal (36). This twisting motion initially causes a leading edge seal (44) to be urged into sealing engagement with a surface (48) of an adjacent member (20) and thereafter, increasing fluid pressure on a pressurized side (64) of a seal (30) drives a broad sealing region (46) into sealing engagement with a surface (48).

TWIST and p-Akt immunoexpression in normal oral epithelium oral dysplasia and in oral squamous cell carcinoma

PubMed Central

Yamamoto, Fernanda-Paula; Corrêa Pontes, Flávia-Sirotheau; Cury, Sérgio-Elias; Fonseca, Felipe-Paiva; Rebelo-Pontes, Hélder; Pinto-Júnior, Décio-dos Santos

2012-01-01

Objectives: The aim of this study was to evaluate the immunoexpression of TWIST and p-Akt proteins in oral leukoplakia (OL) and oral squamous cell carcinoma (OSCC), correlating their expressions with the histological features of the lesions. Study design: Immunohistochemical studies were carried out on 10 normal oral epithelium, 30 OL and 20 OSCC formalin-fixed, paraffin-embedded tissue samples. Immunoperoxidase reactions for TWIST and p-Akt proteins were applied on the specimens and the positivity of the reactions was calculated for 1000 epithelial cells. Results: Kruskal-Wallis and Dunn’s post tests revealed a significant difference in TWIST and p-Akt immunoexpression among normal oral mucosa, OL and OSCC. In addition, a significant positive correlation was found between TWIST and p-Akt expressions according to the Pearson’s correlation test. Conclusions: The results obtained in the current study suggest that TWIST and p-Akt may participate of the multi-step process of oral carcinogenesis since its early stages. Key words: Oral cancer, oral leukoplakia, dysplasia, immunohistochemistry. PMID:21743395

Integral Twist Actuation of Helicopter Rotor Blades for Vibration Reduction

NASA Technical Reports Server (NTRS)

Shin, SangJoon; Cesnik, Carlos E. S.

2001-01-01

Active integral twist control for vibration reduction of helicopter rotors during forward flight is investigated. The twist deformation is obtained using embedded anisotropic piezocomposite actuators. An analytical framework is developed to examine integrally-twisted blades and their aeroelastic response during different flight conditions: frequency domain analysis for hover, and time domain analysis for forward flight. Both stem from the same three-dimensional electroelastic beam formulation with geometrical-exactness, and axe coupled with a finite-state dynamic inflow aerodynamics model. A prototype Active Twist Rotor blade was designed with this framework using Active Fiber Composites as the actuator. The ATR prototype blade was successfully tested under non-rotating conditions. Hover testing was conducted to evaluate structural integrity and dynamic response. In both conditions, a very good correlation was obtained against the analysis. Finally, a four-bladed ATR system is built and tested to demonstrate its concept in forward flight. This experiment was conducted at NASA Langley Tansonic Dynamics Tunnel and represents the first-of-a-kind Mach-scaled fully-active-twist rotor system to undergo forward flight test. In parallel, the impact upon the fixed- and rotating-system loads is estimated by the analysis. While discrepancies are found in the amplitude of the loads under actuation, the predicted trend of load variation with respect to its control phase correlates well. It was also shown, both experimentally and numerically, that the ATR blade design has the potential for hub vibratory load reduction of up to 90% using individual blade control actuation. Using the numerical framework, system identification is performed to estimate the harmonic transfer functions. The linear time-periodic system can be represented by a linear time-invariant system under the three modes of blade actuation: collective, longitudinal cyclic, and lateral cyclic. A vibration

The influence of adrenergic stimulation on sex differences in left ventricular twist mechanics.

PubMed

Williams, Alexandra M; Shave, Rob E; Cheyne, William S; Eves, Neil D

2017-06-15

Sex differences in left ventricular (LV) mechanics occur during acute physiological challenges; however, it is unknown whether sex differences in LV mechanics are fundamentally regulated by differences in adrenergic control. Using two-dimensional echocardiography and speckle tracking analysis, this study compared LV mechanics in males and females matched for LV length during post-exercise ischaemia (PEI) and β 1 -adrenergic receptor blockade. Our data demonstrate that while basal rotation was increased in males, LV twist was not significantly different between the sexes during PEI. In contrast, during β 1 -adrenergic receptor blockade, LV apical rotation, twist and untwisting velocity were reduced in males compared to females. Significant relationships were observed between LV twist and LV internal diameter and sphericity index in females, but not males. These findings suggest that LV twist mechanics may be more sensitive to alterations in adrenergic stimulation in males, but more highly influenced by ventricular structure and geometry in females. Sex differences in left ventricular (LV) mechanics exist at rest and during acute physiological stress. Differences in cardiac autonomic and adrenergic control may contribute to sex differences in LV mechanics and LV haemodynamics. Accordingly, this study aimed to investigate sex differences in LV mechanics with altered adrenergic stimulation achieved through post-handgrip-exercise ischaemia (PEI) and β 1 -adrenergic receptor (AR) blockade. Twenty males (23 ± 5 years) and 20 females (22 ± 3 years) were specifically matched for LV length (males: 8.5 ± 0.5 cm, females: 8.2 ± 0.6 cm, P = 0.163), and two-dimensional speckle-tracking echocardiography was used to assess LV structure and function at baseline, during PEI and following administration of 5 mg bisoprolol (β 1 -AR antagonist). During PEI, LV end-diastolic volume and stroke volume were increased in both groups (P < 0.001), as was end

Structures of Highly Twisted Amides Relevant to Amide N-C Cross-Coupling: Evidence for Ground-State Amide Destabilization.

PubMed

Pace, Vittorio; Holzer, Wolfgang; Meng, Guangrong; Shi, Shicheng; Lalancette, Roger; Szostak, Roman; Szostak, Michal

2016-10-04

Herein, we show that acyclic amides that have recently enabled a series of elusive transition-metal-catalyzed N-C activation/cross-coupling reactions are highly twisted around the N-C(O) axis by a new destabilization mechanism of the amide bond. A unique effect of the N-glutarimide substituent, leading to uniformly high twist (ca. 90°) irrespective of the steric effect at the carbon side of the amide bond has been found. This represents the first example of a twisted amide that does not bear significant steric hindrance at the α-carbon atom. The (15) N NMR data show linear correlations between electron density at nitrogen and amide bond twist. This study strongly supports the concept of amide bond ground-state twist as a blueprint for activation of amides toward N-C bond cleavage. The new mechanism offers considerable opportunities for organic synthesis and biological processes involving non-planar amide bonds. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Twisted-Light-Ion Interaction: The Role of Longitudinal Fields

NASA Astrophysics Data System (ADS)

Quinteiro, G. F.; Schmidt-Kaler, Ferdinand; Schmiegelow, Christian T.

2017-12-01

The propagation of light beams is well described using the paraxial approximation, where field components along the propagation direction are usually neglected. For strongly inhomogeneous or shaped light fields, however, this approximation may fail, leading to intriguing variations of the light-matter interaction. This is the case of twisted light having opposite orbital and spin angular momenta. We compare experimental data for the excitation of a quadrupole transition in a single trapped 40Ca+ ion from Schmiegelow et al. [Nat. Commun. 7, 12998 (2016), 10.1038/ncomms12998] with a complete model where longitudinal components of the electric field are taken into account. Our model matches the experimental data and excludes by 11 standard deviations the approximation of a complete transverse field. This demonstrates the relevance of all field components for the interaction of twisted light with matter.

Aminopeptidase A initiates tumorigenesis and enhances tumor cell stemness via TWIST1 upregulation in colorectal cancer

PubMed Central

Chuang, Hui-Yu; Jiang, Jeng-Kae; Yang, Muh-Hwa; Wang, Hsei-Wei; Li, Ming-Chun; Tsai, Chan-Yen; Jhang, Yau-Yun; Huang, Jason C.

2017-01-01

Metastasis accounts for the high mortality rate associated with colorectal cancer (CRC), but metastasis regulators are not fully understood. To identify a novel gene involved in tumor metastasis, we used oligonucleotide microarrays, transcriptome distance analyses, and machine learning algorithms to determine links between primary and metastatic colorectal cancers. Aminopeptidase A (APA; also known as ENPEP) was selected as our focus because its relationship with colorectal cancer requires clarification. Higher APA mRNA levels were observed in patients in advanced stages of cancer, suggesting a correlation between ENPEP and degree of malignancy. Our data also indicate that APA overexpression in CRC cells induced cell migration, invasion, anchorage-independent capability, and mesenchyme-like characteristics (e.g., EMT markers). We also observed TWIST induction in APA-overexpressing SW480 cells and TWIST down-regulation in HT29 cells knocked down with APA. Both APA silencing and impaired APA activity were found to reduce migratory capacity, cancer anchorage, stemness properties, and drug resistance in vitro and in vivo. We therefore suggest that APA enzymatic activity affects tumor initiation and cancer malignancy in a TWIST-dependent manner. Results from RT-qPCR and the immunohistochemical staining of specimens taken from CRC patients indicate a significant correlation between APA and TWIST. According to data from SurvExpress analyses of TWIST1 and APA mRNA expression profiles, high APA and TWIST expression are positively correlated with poor CRC prognosis. APA may act as a prognostic factor and/or therapeutic target for CRC metastasis and recurrence. PMID:28177885

Magnetothermodynamics: measurements of the thermodynamic properties in a relaxed magnetohydrodynamic plasma

NASA Astrophysics Data System (ADS)

Kaur, M.; Barbano, L. J.; Suen-Lewis, E. M.; Shrock, J. E.; Light, A. D.; Schaffner, D. A.; Brown, M. B.; Woodruff, S.; Meyer, T.

2018-02-01

We have explored the thermodynamics of compressed magnetized plasmas in laboratory experiments and we call these studies `magnetothermodynamics'. The experiments are carried out in the Swarthmore Spheromak eXperiment device. In this device, a magnetized plasma source is located at one end and at the other end, a closed conducting can is installed. We generate parcels of magnetized plasma and observe their compression against the end wall of the conducting cylinder. The plasma parameters such as plasma density, temperature and magnetic field are measured during compression using HeNe laser interferometry, ion Doppler spectroscopy and a linear probe array, respectively. To identify the instances of ion heating during compression, a PV diagram is constructed using measured density, temperature and a proxy for the volume of the magnetized plasma. Different equations of state are analysed to evaluate the adiabatic nature of the compressed plasma. A three-dimensional resistive magnetohydrodynamic code (NIMROD) is employed to simulate the twisted Taylor states and shows stagnation against the end wall of the closed conducting can. The simulation results are consistent to what we observe in our experiments.

Understanding the Twist Distribution Inside Magnetic Flux Ropes by Anatomizing an Interplanetary Magnetic Cloud

NASA Astrophysics Data System (ADS)

Wang, Yuming; Shen, Chenglong; Liu, Rui; Liu, Jiajia; Guo, Jingnan; Li, Xiaolei; Xu, Mengjiao; Hu, Qiang; Zhang, Tielong

2018-05-01

Magnetic flux rope (MFR) is the core structure of the greatest eruptions, that is, the coronal mass ejections (CMEs), on the Sun, and magnetic clouds are posteruption MFRs in interplanetary space. There is a strong debate about whether or not a MFR exists prior to a CME and how the MFR forms/grows through magnetic reconnection during the eruption. Here we report a rare event, in which a magnetic cloud was observed sequentially by four spacecraft near Mercury, Venus, Earth, and Mars, respectively. With the aids of a uniform-twist flux rope model and a newly developed method that can recover a shock-compressed structure, we find that the axial magnetic flux and helicity of the magnetic cloud decreased when it propagated outward but the twist increased. Our analysis suggests that the "pancaking" effect and "erosion" effect may jointly cause such variations. The significance of the pancaking effect is difficult to be estimated, but the signature of the erosion can be found as the imbalance of the azimuthal flux of the cloud. The latter implies that the magnetic cloud was eroded significantly leaving its inner core exposed to the solar wind at far distance. The increase of the twist together with the presence of the erosion effect suggests that the posteruption MFR may have a high-twist core enveloped by a less-twisted outer shell. These results pose a great challenge to the current understanding on the solar eruptions as well as the formation and instability of MFRs.

Stretchable, Twisted Conductive Microtubules for Wearable Computing, Robotics, Electronics, and Healthcare.

PubMed

Do, Thanh Nho; Visell, Yon

2017-05-11

Stretchable and flexible multifunctional electronic components, including sensors and actuators, have received increasing attention in robotics, electronics, wearable, and healthcare applications. Despite advances, it has remained challenging to design analogs of many electronic components to be highly stretchable, to be efficient to fabricate, and to provide control over electronic performance. Here, we describe highly elastic sensors and interconnects formed from thin, twisted conductive microtubules. These devices consist of twisted assemblies of thin, highly stretchable (>400%) elastomer tubules filled with liquid conductor (eutectic gallium indium, EGaIn), and fabricated using a simple roller coating process. As we demonstrate, these devices can operate as multimodal sensors for strain, rotation, contact force, or contact location. We also show that, through twisting, it is possible to control their mechanical performance and electronic sensitivity. In extensive experiments, we have evaluated the capabilities of these devices, and have prototyped an array of applications in several domains of stretchable and wearable electronics. These devices provide a novel, low cost solution for high performance stretchable electronics with broad applications in industry, healthcare, and consumer electronics, to emerging product categories of high potential economic and societal significance.

Electronic structure and optical properties of twisted bilayer graphene calculated via time evolution of states in real space

NASA Astrophysics Data System (ADS)

Le, H. Anh; Do, V. Nam

2018-03-01

We investigate the electronic and optical properties of twisted bilayer graphene with arbitrary twist angles θ . Our results are based on a method of evolving in time quantum states in lattice space. We propose an efficient scheme of sampling lattice nodes that helps to reduce significantly computational cost, particularly for tiny twist angles. We demonstrate the continuous variation of the density of states and the optical conductivity with respect to the twist angle. It indicates that the commensurability between the two graphene layers does not play an essential role in governing the electronic and optical properties. We point out that, for the twist angles roughly in the range 0 .1∘<θ <3∘ , the density of states in the vicinity of the Fermi energy exhibits the typical W shape with a small peak locating at the Fermi energy. This peak is formed as the merging of two van Hove peaks and reflects the appearance of states strongly localized in the AA-like region of moiré zones. When decreasing the twist angle to zero, the W shape is gradually transformed to the U shape, which is seen as the behavior of the density of states in the limit of θ →0∘ .

Eruption of a plasma blob, associated M-class flare, and large-scale extreme-ultraviolet wave observed by SDO

NASA Astrophysics Data System (ADS)

Kumar, P.; Manoharan, P. K.

2013-05-01

We present a multiwavelength study of the formation and ejection of a plasma blob and associated extreme ultraviolet (EUV) waves in active region (AR) NOAA 11176, observed by SDO/AIA and STEREO on 25 March 2011. The EUV images observed with the AIA instrument clearly show the formation and ejection of a plasma blob from the lower atmosphere of the Sun at ~9 min prior to the onset of the M1.0 flare. This onset of the M-class flare happened at the site of the blob formation, while the blob was rising in a parabolic path with an average speed of ~300 km s. The blob also showed twisting and de-twisting motion in the lower corona, and the blob speed varied from ~10-540 km s. The faster and slower EUV wavefronts were observed in front of the plasma blob during its impulsive acceleration phase. The faster EUV wave propagated with a speed of ~785 to 1020 km s, whereas the slower wavefront speed varied in between ~245 and 465 km s. The timing and speed of the faster wave match the shock speed estimated from the drift rate of the associated type II radio burst. The faster wave experiences a reflection by the nearby AR NOAA 11177. In addition, secondary waves were observed (only in the 171 Å channel), when the primary fast wave and plasma blob impacted the funnel-shaped coronal loops. The Helioseismic Magnetic Imager (HMI) magnetograms revealed the continuous emergence of new magnetic flux along with shear flows at the site of the blob formation. It is inferred that the emergence of twisted magnetic fields in the form of arch-filaments/"anemone-type" loops is the likely cause for the plasma blob formation and associated eruption along with the triggering of M-class flare. Furthermore, the faster EUV wave formed ahead of the blob shows the signature of fast-mode MHD wave, whereas the slower wave seems to be generated by the field line compression by the plasma blob. The secondary wave trains originated from the funnel-shaped loops are probably the fast magnetoacoustic waves

Development of an Active Twist Rotor for Wind: Tunnel Testing (NLPN97-310

NASA Technical Reports Server (NTRS)

Cesnik, Carlos E. S.; Shin, SangJoon; Hagood, Nesbitt W., IV

1998-01-01

The development of the Active Twist Rotor prototype blade for hub vibration and noise reduction studies is presented in this report. Details of the modeling, design, and manufacturing are explored. The rotor blade is integrally twisted by direct strain actuation. This is accomplished by distributing embedded piezoelectric fiber composites along the span of the blade. The development of the analysis framework for this type of active blade is presented. The requirements for the prototype blade, along with the final design results are also presented. A detail discussion on the manufacturing aspects of the prototype blade is described. Experimental structural characteristics of the prototype blade compare well with design goals, and preliminary bench actuation tests show lower performance than originally predicted. Electrical difficulties with the actuators are also discussed. The presented prototype blade is leading to a complete fully articulated four-blade active twist rotor system for future wind tunnel tests.

Mechanical behaviors of multi-filament twist superconducting strand under tensile and cyclic loading

NASA Astrophysics Data System (ADS)

Wang, Xu; Li, Yingxu; Gao, Yuanwen

2016-01-01

The superconducting strand, serving as the basic unit cell of the cable-in-conduit-conductors (CICCs), is a typical multi-filament twist composite which is always subjected to a cyclic loading under the operating condition. Meanwhile, the superconducting material Nb3Sn in the strand is sensitive to strain frequently relating to the performance degradation of the superconductivity. Therefore, a comprehensive study on the mechanical behavior of the strand helps understanding the superconducting performance of the strained Nb3Sn strands. To address this issue, taking the LMI (internal tin) strand as an example, a three-dimensional structural finite element model, named as the Multi-filament twist model, of the strand with the real configuration of the LMI strand is built to study the influences of the plasticity of the component materials, the twist of the filament bundle, the initial thermal residual stress and the breakage and its evolution of the filaments on the mechanical behaviors of the strand. The effective properties of superconducting filament bundle with random filament breakage and its evolution versus strain are obtained based on the damage theory of fiber-reinforced composite materials proposed by Curtin and Zhou. From the calculation results of this model, we find that the occurrence of the hysteresis loop in the cyclic loading curve is determined by the reverse yielding of the elastic-plastic materials in the strand. Both the initial thermal residual stress in the strand and the pitch length of the filaments have significant impacts on the axial and hysteretic behaviors of the strand. The damage of the filaments also affects the axial mechanical behavior of the strand remarkably at large axial strain. The critical current of the strand is calculated by the scaling law with the results of the Multi-filament twist model. The predicted results of the Multi-filament twist model show an acceptable agreement with the experiment.

Control of twisted and coiled polymer actuator with anti-windup compensator

NASA Astrophysics Data System (ADS)

Suzuki, Motoya; Kamamichi, Norihiro

2018-07-01

A twisted and coiled polymer actuator (TCPA) is a novel soft actuator. It is fabricated by twisting nylon thread or fishing line. It can be thermally activated and has remarkable properties such as high power/mass ratio and large deformation. By applying conductive nylon fibers to the actuator, it can be electrically driven by Joule heating. However, if a controller of the actuator is designed without considering an input saturation, the control performance may be descended by windup phenomena. In this paper, to solve this problem, a feedback control with an anti-windup compensator is applied. The validity of the applied method is investigated through numerical simulations and experiments.

Investigating the Role of Twist1 in Diabetes Pathogenesis

DTIC Science & Technology

Several genes associated with diabetes have been identified in genome wide association studies, but their genetic validation as causative factors...of insulin. Loss-of-function genetic experiments demonstrated that Twist1 deletion against fatty pancreas formation driven by obesity, thereby

Twisting cracks in Bouligand structures.

PubMed

Suksangpanya, Nobphadon; Yaraghi, Nicholas A; Kisailus, David; Zavattieri, Pablo

2017-12-01

The Bouligand structure, which is found in many biological materials, is a hierarchical architecture that features uniaxial fiber layers assembled periodically into a helicoidal pattern. Many studies have highlighted the high damage-resistant performance of natural and biomimetic Bouligand structures. One particular species that utilizes the Bouligand structure to achieve outstanding mechanical performance is the smashing Mantis Shrimp, Odontodactylus Scyllarus (or stomatopod). The mantis shrimp generates high speed, high acceleration blows using its raptorial appendage to defeat highly armored preys. The load-bearing part of this appendage, the dactyl club, contains an interior region [16] that consists of a Bouligand structure. This region is capable of developing a significant amount of nested twisting microcracks without exhibiting catastrophic failure. The development and propagation of these microcracks are a source of energy dissipation and stress relaxation that ultimately contributes to the remarkable damage tolerance properties of the dactyl club. We develop a theoretical model to provide additional insights into the local stress intensity factors at the crack front of twisting cracks formed within the Bouligand structure. Our results reveal that changes in the local fracture mode at the crack front leads to a reduction of the local strain energy release rate, hence, increasing the necessary applied energy release rate to propagate the crack, which is quantified by the local toughening factor. Ancillary 3D simulations of the asymptotic crack front field were carried out using a J-integral to validate the theoretical values of the energy release rate and the local stress intensity factors. Copyright © 2017 Elsevier Ltd. All rights reserved.

STS-3/OSS-1 Plasma Diagnostics Package (PDP) measurements of Orbiter transmitter and subsystem electromagnetic interference

NASA Technical Reports Server (NTRS)

Shawhan, S. D.; Murphy, G.

1983-01-01

The plasma diagnostics package receiver system is described to identify the various antennas and to characterize the complement of receivers which cover the frequency range of 30 Hz to 800 Hz and S-band at 2200 + or - 300 MHz. Sample results are presented to show the variability of electromagnetic effects associated with the orbiter and the time variability of these effects. The electric field and magnetic field maximum and minimum field strength spectra observed during the mission at the pallet location are plotted. Values are also derived for the maximum UHF transmitter and S-band transmitter field strengths. Calibration data to convert from the survey plots to actual narrowband and broadband field strengths are listed.

Needleless electrospinning with twisted wire spinneret

NASA Astrophysics Data System (ADS)

Holopainen, Jani; Penttinen, Toni; Santala, Eero; Ritala, Mikko

2015-01-01

A needleless electrospinning setup named ‘Needleless Twisted Wire Electrospinning’ was developed. The polymer solution is electrospun from the surface of a twisted wire set to a high voltage and collected on a cylindrical collector around the wire. Multiple Taylor cones are simultaneously self-formed on the downward flowing solution. The system is robust and simple with no moving parts aside from the syringe pump used to transport the solution to the top of the wire. The structure and process parameters of the setup and the results on the preparation of polyvinyl pyrrolidone (PVP), hydroxyapatite (HA) and bioglass fibers with the setup are presented. PVP fiber sheets with areas of 40 × 120 cm2 and masses up to 1.15 g were prepared. High production rates of 5.23 g h-1 and 1.40 g h-1 were achieved for PVP and HA respectively. The major limiting factor of the setup is drying of the polymer solution on the wire during the electrospinning process which will eventually force to interrupt the process for cleaning of the wire. Possible solutions to this problem and other ways to develop the setup are discussed. The presented system provides a simple way to increase the production rate and area of fiber sheet as compared with the conventional needle electrospinning.

Adaptive twisting sliding mode algorithm for hypersonic reentry vehicle attitude control based on finite-time observer.

PubMed

Guo, Zongyi; Chang, Jing; Guo, Jianguo; Zhou, Jun

2018-06-01

This paper focuses on the adaptive twisting sliding mode control for the Hypersonic Reentry Vehicles (HRVs) attitude tracking issue. The HRV attitude tracking model is transformed into the error dynamics in matched structure, whereas an unmeasurable state is redefined by lumping the existing unmatched disturbance with the angular rate. Hence, an adaptive finite-time observer is used to estimate the unknown state. Then, an adaptive twisting algorithm is proposed for systems subject to disturbances with unknown bounds. The stability of the proposed observer-based adaptive twisting approach is guaranteed, and the case of noisy measurement is analyzed. Also, the developed control law avoids the aggressive chattering phenomenon of the existing adaptive twisting approaches because the adaptive gains decrease close to the disturbance once the trajectories reach the sliding surface. Finally, numerical simulations on the attitude control of the HRV are conducted to verify the effectiveness and benefit of the proposed approach. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

Twisting singular solutions of Betheʼs equations

NASA Astrophysics Data System (ADS)

Nepomechie, Rafael I.; Wang, Chunguang

2014-12-01

The Bethe equations for the periodic XXX and XXZ spin chains admit singular solutions, for which the corresponding eigenvalues and eigenvectors are ill-defined. We use a twist regularization to derive conditions for such singular solutions to be physical, in which case they correspond to genuine eigenvalues and eigenvectors of the Hamiltonian.

An investigation of methods for updating ionospheric scintillation models using topside in-situ plasma density measurements

NASA Astrophysics Data System (ADS)

Secan, James A.

1991-05-01

Modern military communication, navigation, and surveillance systems depend on reliable, noise-free transionospheric radio-frequency channels. They can be severely impacted by small-scale electron-density irregularities in the ionosphere, which cause both phase and amplitude scintillation. Basic tools used in planning and mitigation schemes are climatological in nature and thus may greatly over- and under-estimate the effects of scintillation in a given scenario. This report summarizes the results of the first year of a three-year investigation into the methods for updating ionospheric scintillation models using observations of ionospheric plasma-density irregularities measured by DMSP Scintillation Meter (SM) sensor. Results are reported from the analysis of data from a campaign conducted in January 1990 near Tromso, Norway, in which near coincident in-situ plasma-density and transionospheric scintillation measurements were made. Estimates for the level of intensity and phase scintillation on a transionospheric UHF radio link in the early-evening auroral zone were calculated from DMSP SM data and compared to the levels actually observed.

High-resolution inchworm linear motor based on electrostatic twisting microactuators

NASA Astrophysics Data System (ADS)

Kim, Sang-Ho; Hwang, Il-Han; Jo, Kyoung-Woo; Yoon, Eui-Sung; Lee, Jong-Hyun

2005-09-01

A new inchworm micromotor using new electrostatic in-plane twisting microactuators has been designed, fabricated and characterized for nano-resolution manipulators. The proposed twisting mechanism was implemented employing a pair of differential electrostatic actuators with a high stiffness in the driving direction for stable positioning. The electromechanically coupled motion of the voltage-displacement relation was analyzed using a finite element method (FEM), confirming that the twisting actuator makes a tiny step movement efficiently. The proposed actuator was fabricated on a silicon-on-insulator (SOI) wafer with the device footprint of 2.2 × 2.8 mm2, and its nano-stepping characteristics were measured by an optical interferometer consisting of an integrated micromirror and optical fiber. The fabricated inchworm motor showed a minimum step displacement of 5.2 ± 3.8 nm (2σ) and 4.1 ± 2.9 nm (2σ) for cyclic motion in the +y- and the -y-directions, respectively, with the gripping voltage of 15 V and differential voltage of 1 V. As a result, the proposed inchworm micromotor could operate with a stroke of 3 µm and a bi-directional step displacement of less than 10 nm. The step displacement is the smallest value of in-plane-type micromotors so far, and its magnitude was controllable up to 120 nm/cycle by changing the differential voltage.

Report on twisted nematic and supertwisted nematic device characterization program

NASA Technical Reports Server (NTRS)

1995-01-01

In this study we measured the optical characteristics of normally white twisted nematic (NWTN) and super twisted nematic (STN ) cells. Though no dynamic computer model was available, the static observations were compared with computer simulated behavior. The measurements were taken as a function of both viewing angle and applied voltage and included in the static case not only luminance but also contrast ratio and chromaticity . We employed the computer model Twist Cell Optics, developed at Kent State in conjunction with this study, and whose optical modeling foundation, Iike the ViDEOS program, is the 4 x 4 matrix method of Berreman. In order to resolve discrepancies between the experimental and modeled data the optical parameters of the individual cell components, where not known, were determined using refractometry, profilometry, and various forms of ellipsometry. The resulting agreement between experiment and model is quite good due primarily to a better understanding of the structure and optics of dichroic sheet polarizers. A description of the model and test cells employed are given in section 2. Section 3 contains the experimental data gathered and section 4 gives examples of the fit between model and experiment. Also included with this report are a pair of papers which resulted from the research and which detail the polarizer properties and some of the cell characterization methods.

Measurements of the canonical helicity evolution of a gyrating kinked plasma column

NASA Astrophysics Data System (ADS)

von der Linden, Jens; Sears, Jason; Intrator, Thomas; You, Setthivoine

2017-10-01

Conversions between kinetic and magnetic energy occur over a wide range of plasma scales as exhibited in astrophysical and solar dynamos, and reconnection in the solar corona and laboratory experiments. Canonical flux tubes present the distinct advantage of reconciling all plasma regimes - e.g. kinetic, two-fluid, and MHD - with the topological concept of helicity: twists, writhes, and linkages. This poster presents the first visualization and analysis of the 3D dynamics of canonical flux tubes and their relative helicity evolution from experimental measurements. Ion and electron canonical flux tubes are visualized from Mach, triple, and Ḃ probe measurements at over 10,000 spatial locations of a gyrating kinked plasma column. The flux tubes co-gyrate with the peak density and electron temperature in and out of a measurement volume. The electron and ion canonical flux tubes twist with opposite handedness and the ion flux tube writhes around the electron flux tube. The relative cross helicity between the magnetic and ion flow vorticity flux tubes dominates the relative ion canonical helicity and is anticorrelated with the relative magnetic helicity. The 3D nature of the kink and a reverse eddy current affect the helicity evolution. This work is supported by DOE Grant DE-SC0010340 and the DOE Office of Science Graduate Student Research Program and prepared in part by LLNL under Contract DE-AC52-07NA27344. LLNL-ABS-734669.

Coplanar UHF RFID tag antenna with U-shaped inductively coupled feed for metallic applications

PubMed Central

Ismail, Alyani; Raja Abdullah, Raja Syamsul Azmir; Saeedi, Tale

2017-01-01

In this paper, we present a novel compact, coplanar, tag antenna design for metallic objects. Electrically small antenna has designed for a UHF RFID (860–960 MHz) based on a proximity-coupled feed through. Furthermore, two symmetrical Via-loaded coplanar grounds fed by a U-shaped inductively coupled feed through an embedded transmission line. This configuration results in an antenna with dimensions of 31 × 19.5 × 3.065 mm3 at 915 MHz, and the total gain for the antenna is 0.12 dBi. The Via-loaded coplanar and U-shaped inductively coupled feeds allow the antenna to provide flexible tuning in terms of antenna impedance. In addition, a figure of merit is applied for the proposed tag antenna, and the results are presented. The read range is measured to be 4.2 m, which is very close to simulated values. This antenna measurement shows very good agreement with simulations. PMID:28570706

Coplanar UHF RFID tag antenna with U-shaped inductively coupled feed for metallic applications.

PubMed

Salman, Karrar Naji; Ismail, Alyani; Raja Abdullah, Raja Syamsul Azmir; Saeedi, Tale

2017-01-01

In this paper, we present a novel compact, coplanar, tag antenna design for metallic objects. Electrically small antenna has designed for a UHF RFID (860-960 MHz) based on a proximity-coupled feed through. Furthermore, two symmetrical Via-loaded coplanar grounds fed by a U-shaped inductively coupled feed through an embedded transmission line. This configuration results in an antenna with dimensions of 31 × 19.5 × 3.065 mm3 at 915 MHz, and the total gain for the antenna is 0.12 dBi. The Via-loaded coplanar and U-shaped inductively coupled feeds allow the antenna to provide flexible tuning in terms of antenna impedance. In addition, a figure of merit is applied for the proposed tag antenna, and the results are presented. The read range is measured to be 4.2 m, which is very close to simulated values. This antenna measurement shows very good agreement with simulations.

Interaction between left ventricular twist mechanics and arterial haemodynamics during localised, non-metabolic hyperaemia with and without blood flow restriction.

PubMed

van Mil, Anke C C M; Pearson, James; Drane, Aimee L; Cockcroft, John R; McDonnell, Barry J; Stöhr, Eric J

2016-04-01

What is the central question of this study? Left ventricular (LV) twist is reduced when afterload is increased, but the meaning of this specific heart muscle response and its impact on cardiac output are not well understood. What is the main finding and its importance? This study shows that LV twist responds even when arterial haemodynamics are altered only locally, and without apparent change in metabolic (i.e. heat-induced) demand. The concurrent decline in cardiac output and LV twist during partial arterial occlusion despite the increased peripheral demand caused by heat stress suggests that LV twist may be involved in the protective sensing of heart muscle stress that can override the provision of the required cardiac output. Whether left ventricular (LV) twist and untwisting rate (LV twist mechanics) respond to localised, peripheral, non-metabolic changes in arterial haemodynamics within an individual's normal afterload range is presently unknown. Furthermore, previous studies indicate that LV twist mechanics may override the provision of cardiac output, but this hypothesis has not been examined purposefully. Therefore, we acutely altered local peripheral arterial haemodynamics in 11 healthy humans (women/men n = 3/8; age 26 ± 5 years) by bilateral arm heating (BAH). Ultrasonography was used to examine arterial haemodynamics, LV twist mechanics and the twist-to-shortening ratio (TSR). To determine the arterial function-dependent contribution of LV twist mechanics to cardiac output, partial blood flow restriction to the arms was applied during BAH (BAHBFR ). Bilateral arm heating increased arm skin temperatures [change (Δ) +6.4 ± 0.9°C, P < 0.0001] but not core temperature (Δ -0.0 ± 0.1°C, P > 0.05), concomitant to increases in brachial artery blood flow (Δ 212 ± 77 ml, P < 0.0001), cardiac output (Δ 495 ± 487 l min(-1) , P < 0.05), LV twist (Δ 3.0 ± 3.5 deg, P < 0.05) and TSR (Δ 3.3 ± 1.3, P < 0.05) but

Energy harvesting from coupled bending-twisting oscillations in carbon-fibre reinforced polymer laminates

NASA Astrophysics Data System (ADS)

Xie, Mengying; Zhang, Yan; Kraśny, Marcin J.; Rhead, Andrew; Bowen, Chris; Arafa, Mustafa

2018-07-01

The energy harvesting capability of resonant harvesting structures, such as piezoelectric cantilever beams, can be improved by utilizing coupled oscillations that generate favourable strain mode distributions. In this work, we present the first demonstration of the use of a laminated carbon fibre reinforced polymer to create cantilever beams that undergo coupled bending-twisting oscillations for energy harvesting applications. Piezoelectric layers that operate in bending and shear mode are attached to the bend-twist coupled beam surface at locations of maximum bending and torsional strains in the first mode of vibration to fully exploit the strain distribution along the beam. Modelling of this new bend-twist harvesting system is presented, which compares favourably with experimental results. It is demonstrated that the variety of bend and torsional modes of the harvesters can be utilized to create a harvester that operates over a wider range of frequencies and such multi-modal device architectures provides a unique approach to tune the frequency response of resonant harvesting systems.

Denjoy minimal sets and Birkhoff periodic orbits for non-exact monotone twist maps

NASA Astrophysics Data System (ADS)

Qin, Wen-Xin; Wang, Ya-Nan

2018-06-01

A non-exact monotone twist map φbarF is a composition of an exact monotone twist map φ bar with a generating function H and a vertical translation VF with VF ((x , y)) = (x , y - F). We show in this paper that for each ω ∈ R, there exists a critical value Fd (ω) ≥ 0 depending on H and ω such that for 0 ≤ F ≤Fd (ω), the non-exact twist map φbarF has an invariant Denjoy minimal set with irrational rotation number ω lying on a Lipschitz graph, or Birkhoff (p , q)-periodic orbits for rational ω = p / q. Like the Aubry-Mather theory, we also construct heteroclinic orbits connecting Birkhoff periodic orbits, and show that quasi-periodic orbits in these Denjoy minimal sets can be approximated by periodic orbits. In particular, we demonstrate that at the critical value F =Fd (ω), the Denjoy minimal set is not uniformly hyperbolic and can be approximated by smooth curves.

Twisted Savonius turbine based marine current energy conversion system

NASA Astrophysics Data System (ADS)

Hassan, Md. Imtiaj

The Ocean Network Seafloor Instrumentation (ONSFI) Project is a multidisciplinary research and development project that aims to design, fabricate and validate a proof-of-concept seafloor array of wireless marine sensors for use in monitoring seabed processes. The sensor pods, known as Seaformatics, will be powered by ocean bottom currents and will be able to communicate with each other and to the Internet through surface master units to facilitate observation of the ocean floor from the shore. This thesis explores the use of the twisted Savonius turbine as a means of converting the kinetic energy of the free flowing water into electrical energy for the pods. This will eliminate the need for battery replacement. A physical model of the turbine was constructed and tested in the Water Flume at the Marine Institute of Memorial University and in the Wind Tunnel in the Engineering Building at Memorial University. A mathematical model of the turbine was constructed in SolidWorks. This was tested in the Computational Fluid Dynamics or CFD software FLOW-3D. Experimental results were compared with CFD results and the agreement was reasonable. A twisted Savonius turbine emulator was developed to test a dc-dc boost converter. A low cost microcontroller based MPPT algorithm was developed to obtain maximum power from the turbine. Overall the thesis shows that the twisted Savonius turbine can provide the power needed by the sensor pods. It also shows that CFD is a viable way to study the performance of the Savonius type of turbine.

Application of Out-of-Plane Warping to Control Rotor Blade Twist

NASA Technical Reports Server (NTRS)

VanWeddingen, Yannick; Bauchau, Olivier; Kottapalli, Sesi; Ozbay, Serkan; Mehrotra, Yogesh

2012-01-01

The goal of this ongoing study is to develop and demonstrate the feasibility of a blade actuation system to dynamically change the twist, and/or the camber, of an airfoil section and, consequently, alter the in-flight aerodynamic loading on the blade for efficient flight control. The required analytical and finite element tools are under development to enable an accurate and comprehensive aeroelastic assessment of the current Full-Blade Warping and 3D Warping Actuated Trailing Edge Flap concepts. The feasibility of the current concepts for swashplateless rotors and higher harmonic blade control is also being investigated. In particular, the aim is to complete the following objectives, some of which have been completed (as noted below) and others that are currently ongoing: i) Develop a Vlasov finite element model and validate against the ABAQUS shell models (completed). ii) Implement the 3D warping actuation concept within the comprehensive analysis code DYMORE. iii) Perform preliminary aeroelastic simulations of blades using DYMORE with 3D warping actuation: a) Investigate the blade behavior under 1 per/rev actuation. Determine whether sufficient twist can be generated and sustained to achieve primary blade control. b) Investigate the behavior of a trailing edge flap configuration under higher harmonic excitations. Determine how much twist can be obtained at the harmonics 2-5 per/rev. iv) Determine actuator specifications such as the power required, load and displacements, and identify the stress and strain distributions in the actuated blades. In general, the completion of Item ii) above will give an additional research capability in rotorcraft dynamics analyses, i.e., the capability to calculate the rotor blade twist due to warping, something that is not currently available in any of the existing comprehensive rotorcraft analyses.

6. DETAIL OF GUSSET WITH CURVE ANGLE IRON AND TWISTED ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

6. DETAIL OF GUSSET WITH CURVE ANGLE IRON AND TWISTED STRIPS, FORMING SUN RAY PATTERN. LATTICE RAILING AT LOWER RIGHT. - River Road Bridge, Spanning Spring Creek in Spring Creek Township, Hallton, Elk County, PA

14. DETAIL OF GUSSET WITH CURVE ANGLE IRON AND TWISTED ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

14. DETAIL OF GUSSET WITH CURVE ANGLE IRON AND TWISTED STRIPS, FORMING SUN RAY PATTERN. LATTICE RAILING AT LOWER RIGHT. - River Road Bridge, Spanning Spring Creek in Spring Creek Township, Hallton, Elk County, PA

Angular momentum transport with twisted exciton wave packets

NASA Astrophysics Data System (ADS)

Zang, Xiaoning; Lusk, Mark T.

2017-10-01

A chain of cofacial molecules with CN or CN h symmetry supports excitonic states with a screwlike structure. These can be quantified with the combination of an axial wave number and an azimuthal winding number. Combinations of these states can be used to construct excitonic wave packets that spiral down the chain with well-determined linear and angular momenta. These twisted exciton wave packets can be created and annihilated using laser pulses, and their angular momentum can be optically modified during transit. This allows for the creation of optoexcitonic circuits in which information, encoded in the angular momentum of light, is converted into excitonic wave packets that can be manipulated, transported, and then reemitted. A tight-binding paradigm is used to demonstrate the key ideas. The approach is then extended to quantify the evolution of twisted exciton wave packets in a many-body, multilevel time-domain density functional theory setting. In both settings, numerical methods are developed that allow the site-to-site transfer of angular momentum to be quantified.

The Twisted Nose: What to Do When It's Not Straight.

PubMed

Gonzalez, Joseph R; Winkler, Andrew A

2018-06-01

Septorhinoplasty is among the most common facial plastic and reconstructive surgeries and its complexities are reflected in a relatively high revision rate. The patient with a postoperative twisted nose presents an additional challenge and requires that the surgeon display empathy and possess a deep knowledge of the aesthetic and functional intricacies of the nose. Correction of the twisted nose should be approached in a systematic fashion with unique considerations for each "third" of the nose. While there are many options in the overall surgical armamentarium, each surgeon will find specific techniques that are most efficacious and reproducible for their individual practice. This article discusses select surgical "pearls" and techniques that can aid the surgeon in their own surgical decision-making. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Wheel Unloading of Rail Vehicles Due to Track Twist

DOT National Transportation Integrated Search

1986-02-01

An analysis is presented describing the effect that track twist has on the loads carried by the wheels of a rail car. Wheel unloading is determined as a function of the difference in crosslevel between the truck centers of the car. The different vehi...

Orbit characteristics of the tristatic EISCAT UHF meteors

NASA Astrophysics Data System (ADS)

Szasz, C.; Kero, J.; Meisel, D. D.; Pellinen-Wannberg, A.; Wannberg, G.; Westman, A.

2008-07-01

The tristatic EISCAT 930-MHz UHF system is used to determine the absolute geocentric velocities of meteors detected with all three receivers simultaneously at 96 km, the height of the common radar volume. The data used in this study were taken between 2002 and 2005, during four 24-h runs at summer/winter solstice and vernal/autumnal equinox to observe the largest seasonal difference. The observed velocities of 410 tristatic meteors are integrated back through the Earth atmosphere to find their atmospheric entry velocities using an ablation model. Orbit calculations are performed by taking zenith attraction, Earth rotation as well as obliquity of the ecliptic into account. The results are presented in the form of different orbital characteristics. None of the observed meteors appears to be of extrasolar or asteroidal origin; comets, particularly short-period (<200 yr) ones, may be the dominant source for the particles observed. About 40 per cent of the radiants can be associated with the north apex sporadic meteor source and 58 per cent of the orbits are retrograde. There is evidence of resonance gaps at semimajor axis values corresponding to commensurabilities with Jupiter, which may be the first convincing evidence of Jupiter's gravitational influence on the population of small sporadic meteoroids surveyed by radar. The geocentric velocity distribution is bimodal with a prograde population centred around 38 kms-1 and a retrograde population peaking at 59 kms-1. The EISCAT radar system is located close to the Arctic Circle, which means that the North Ecliptic Pole (NEP) is near zenith once every 24 h, i.e. during each observational period. In this particular geometry, the local horizon coincides with the ecliptic plane. The meteoroid influx should therefore be directly comparable throughout the year.

WISDOM : an UHF GPR on the Exomars Mission

NASA Astrophysics Data System (ADS)

Corbel, C.; Hamram, S.; Ney, R.; Plettemeier, D.; Dolon, F.; Jeangeot, A.; Ciarletti, V.; Berthelier, J.

2006-12-01

This paper describes the main technical features of WISDOM (Water Ice and Subsurface Deposit Observations on Mars) Ground Penetrating Radar. This radar has been selected on the PASTEUR payload of the ESA ExoMars rover. The launch is scheduled in 2011. The main objective of this mission is to acquire and analyze samples of the shallow subsurface and search for traces of extinct or extant life. The WISDOM GPR aims at providing observations of the structure and layering of the upper layers of the subsurface in order to retrieve geological information that are of prime interest to select optimal sites to drill. It will also localize buried obstacles (rocks, boulders, ?)in the underground that will make the delicate drilling operations safer. WISDOM will operate in the UHF range from 500 MHz to 3 GHz and probe the first few meters of the subsurface with a high resolution (a few centimeters). The large bandwidth requirement (2.5 GHz) led us to select a gated step frequency technique for WISDOM. The Step Frequency technique is based on the analysis of the system in the frequency domain. The phase and amplitude of the reflected signal are measured at about 200 different frequencies effectively measuring the transfer function of the sub-surface between the transmitter and receiver antenna. The impulse response and eventually the distance of the reflecting structures can be obtained by performing an inverse Fourier transform of the measured transfer function. The broad band antennas have been designed in order to have a wide radiation pattern into the sub-surface and to avoid the direct coupling and allow co and cross polar measurements. To decrease the direct signal between the transmitter and the receiver or strong reflections from the surface, hardware range gating is implemented. The performances of the instrument operated in well characterized conditions will be presented

The topological basis expression of four-qubit XXZ spin chain with twist boundary condition

NASA Astrophysics Data System (ADS)

Du, Guijiao; Xue, Kang; Zhou, Chengcheng; Sun, Chunfang; Wang, Gangcheng

2013-07-01

We investigate the XXZ model's characteristic with the twisted boundary condition and the topological basis expression. Owing to twist boundary condition, the ground state energy will changing back and forth between E_{13} and E_{15} by modulate the parameter φ . By using TLA generators, the XXZ model's Hamiltonian can be constructed. All the eigenstates can be expressed by topological basis, and the whole of eigenstates' entanglement are maximally entangle states (Q(|φ _i> )=1).

Experimental Analysis of the Thermo-Hydraulic Performance on a Cylindrical Parabolic Concentrating Solar Water Heater with Twisted Tape Inserts in an Absorber Tube

NASA Astrophysics Data System (ADS)

Kumar, Birendra; Nayak, Rajen Kumar; Singh, S. N.

2018-05-01

A twisted tape inserted in an absorber tube may be an excellent option to enhance the performance of a cylindrical parabolic concentrating solar collector (CPC). The present work is an experimental study of the flow and heat transfer with and without twisted tape inserts in the absorber tube of a CPC. Results are presented for mass flow rates of water, ṁ=0.0198-0.0525 kg/s, twist ratio, y=5-10 and Reynolds number, Re=2577.46-6785.55. In the present study, we found that the outlet water temperature, collector efficiency and Nusselt number (Nu) are higher in the twisted tapes as compared to those without the twisted tape inserts in the absorber tube of the CPC. For fixed mass flow rate of water ṁ, the To and η increased with the decrease in twist ratio, y, and is higher in lower twist ratio, y=5, of the twisted tapes. The whole experiment was performed at the Indian Institute of Technology (ISM) in Dhanbad, India during the months of March-April 2017. Based on the experimental data, the correlations for the Nu and friction factor were also developed.

Formation and stability of twisted ribbons in mixtures of rod-like fd-virus and non-adsorbing polymer

NASA Astrophysics Data System (ADS)

Dogic, Z.; Didonna, B.; Bryning, M.; Lubensky, T. C.; Yodh, A. G.; Janmey, P. A.

2003-03-01

We are investigating the behavior of mixtures of monodisperse fd-virus rods and non-adsorbing polymer. We observe the formation of isolated smectic disks. The single smectic disk is of a monolayer of aligned rods while its thickness equal to the length of a single rod. As disks coalesce they undergo shape transformations from flat structures to elongated twisted ribbons. A theoretical model is formulated wherein the chirality of the molecule favors the formation of the elongated ribbon structure while the line tension favors formation of untwisted disks. To check the validity of the theoretical model line tension and twist constants are experimentally measured. The line tension is deduced from thermal fluctuations of the interface. The twist constant is determined by unwinding the twisted ribbons using optical tweezers. This work is partially supported by NSF grants DMR-0203378, the PENN MRSEC, DMR-0079909, and NASA grant NAG8-2172.

Evidence of quasi-partonic higher-twist effects in deep inelastic scattering at HERA at moderate Q^2

NASA Astrophysics Data System (ADS)

Motyka, Leszek; Sadzikowski, Mariusz; Słomiński, Wojciech; Wichmann, Katarzyna

2018-01-01

The combined HERA data for the inclusive deep inelastic scattering (DIS) cross sections for the momentum transfer Q^2 > 1 GeV^2 are fitted within the Dokshitzer-Gribov-Lipatov-Altarelli-Parisi (DGLAP) framework at next-to-leading order (NLO) and next-to-next-to-leading order (NNLO) accuracy, complemented by a QCD-inspired parameterisation of twist 4 corrections. A modified form of the input parton density functions is also included, motivated by parton saturation mechanism at small Bjorken x and at a low scale. These modifications lead to a significant improvement of the data description in the region of low Q^2. For the whole data sample, the new benchmark NNLO DGLAP fit yields χ ^2/d.o.f. ˜eq 1.19 to be compared to 1.46 resulting from the standard NNLO DGLAP fit. We discuss the results in the context of the parton saturation picture and describe the impact of the higher-twist corrections on the derived parton density functions. The resulting description of the longitudinal proton structure function FL is consistent with the HERA data. Our estimates of higher-twist contributions to the proton structure functions are comparable to the leading-twist contributions at low Q^2 ˜eq 2 GeV^2 and x ˜eq 10^{-5}. The x-dependence of the twist 4 corrections obtained from the best fit is consistent with the leading twist 4 quasi-partonic operators, corresponding to an exchange of four interacting gluons in the t-channel.

High mode magnetohydrodynamic waves propagation in a twisted rotating jet emerging from a filament eruption

NASA Astrophysics Data System (ADS)

Zhelyazkov, Ivan; Chandra, Ramesh

2018-05-01

We study the conditions under which high mode magnetohydrodynamic (MHD) waves propagating on a rotating jet emerging from the filament eruption on 2013 April 10-11 can became unstable against the Kelvin-Helmholtz instability (KHI). The evolution of jet indicates the blob like structure at its boundary which could be one of the observable features of the KHI development. We model the jet as a twisted rotating axially moving magnetic flux tube and explore the propagation characteristics of the running MHD modes on the basis of dispersion relations derived in the framework of the ideal magnetohydrodynamics. It is established that unstable MHD waves with wavelengths in the range of 12-15 Mm and instability developing times from 1.5 to 2.6 min can be detected at the excitation of high mode MHD waves. The magnitude of the azimuthal mode number m crucially depends upon the twist of the internal magnetic field. It is found that at slightly twisted magnetic flux tube the appropriate azimuthal mode number is m = 16 while in the case of a moderately twisted flux tube it is equal to 18.

The effect of twisted-tape width on heat transfer and pressure drop for fully developed laminar flow

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakroun, W.M.; Al-Fahed, S.F.

1996-07-01

A series of experiments was conducted to study the effect of twisted-tape width on the heat transfer and pressure drop with laminar flow in tubes. Data for three twisted-tape wavelengths, each with five different widths, have been collected with constant wall temperature boundary condition. Correlations for the friction factor and Nusselt number are also available. The correlations predict the experimental data to within 10 to 15 percent for the heat transfer and friction factor, respectively. The presence of the twisted tape has caused the friction factor to increase by a factor of 3 to 7 depending on Reynolds number andmore » the twisted-tape geometry. Heat transfer results have shown an increase of 1.5 to 3 times that of plain tubes depending on the flow conditions and the twisted-tape geometry. The width shows no effect on friction factor and heat transfer in the low range of Reynolds number but has a more pronounced effect on heat transfer at the higher range of Reynolds number. It is recommended to use loose-fit tapes for low Reynolds number flows instead of tight-fit in the design of heat exchangers because they are easier to install and remove for cleaning purposes.« less

Stability of Medium-Bridged Twisted Amides in Aqueous Solutions

PubMed Central

Szostak, Michal; Yao, Lei; Aubé, Jeffrey

2012-01-01

“Twisted” amides containing non-standard dihedral angles are typically hypersensitive to hydrolysis, a feature that has stringently limited their utility in water. We have synthesized a series of bridged lactams that contain a twisted amide linkage but which exhibit enhanced stability in aqueous environments. Many of these compounds were extracted unchanged from aqueous mixtures ranging from the strongly basic to the strongly acidic. NMR experiments showed that tricyclic lactams undergo reversible hydrolysis at extreme pH ranges, but that a number of compounds in this structure class are indefinitely stable under physiologically relevant pH conditions; one bicyclic example was additionally water-soluble. We examined the effect of structure on the reversibility of amide bond hydrolysis, which we attributed to the transannular nature of the amino acid analogs. These data suggest that medium-bridged lactams of these types should provide useful platforms for studying the behavior of twisted amides in aqueous systems. PMID:19178141

THE EFFECT OF A TWISTED MAGNETIC FIELD ON THE PERIOD RATIO P{sub 1}/P{sub 2} OF NONAXISYMMETRIC MAGNETOHYDRODYNAMIC WAVES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karami, K.; Bahari, K., E-mail: KKarami@uok.ac.ir, E-mail: K.Bahari@razi.ac.ir

2012-10-01

We consider nonaxisymmetric magnetohydrodynamic (MHD) modes in a zero-beta cylindrical compressible thin magnetic flux tube modeled as a twisted core surrounded by a magnetically twisted annulus, with both embedded in a straight ambient external field. The dispersion relation is derived and solved analytically and numerically to obtain the frequencies of the nonaxisymmetric MHD waves. The main result is that the twisted magnetic annulus does affect the period ratio P{sub 1}/P{sub 2} of the kink modes. For the kink modes, the magnetic twist in the annulus region can achieve deviations from P{sub 1}/P{sub 2} = 2 of the same order ofmore » magnitude as in the observations. Furthermore, the effect of the internal twist on the fluting modes is investigated.« less

Evidence for higher twist effects in fast π- production by antineutrinos in neon

NASA Astrophysics Data System (ADS)

Fitch, P. J.; Kasper, P.; Cooper-Sarkar, A. M.; Aderholz, M.; Armenise, N.; Azemoon, T.; Bertrand, D.; Berggren, M.; Bullock, F. W.; Calicchio, M.; Clayton, E. F.; Coghen, T.; Erriquez, O.; Gerbier, G.; Guy, J.; Hulth, P. O.; Iaselli, G.; Jones, G. T.; Lagraa, M.; Marage, P.; Middleton, R. P.; Miller, D.; Mobayyen, M. M.; Neveu, M.; O'Neale, S. W.; Parker, M. A.; Sansum, R. A.; Simopoulou, E.; Varvell, K.; Vallée, C.; Vayaki, A.; Venus, W.; Wachsmuth, H.; Wittek, W.; Wells, J.; Zevgolatakos, E.

1986-03-01

Evidence for a significant higher twist contribution to high z π- production in antineutrino scattering is presented. In events with W>3 GeV and Q 2>1 GeV2 in our data, it accounts for (51 ±8)% of all π- with z above 0.5. It is consistent with the z- Q 2 correlations of Berger's higher twist prediction. The data are inconclusive concerning the predicted y-z correlation and p T dependence. The z - Q 2 correlation is not adequately described by the Lund Monte-Carlo.

Advanced Twisted Pair Cables for Distributed Local Area Networks in Intelligent Structure Systems

NASA Astrophysics Data System (ADS)

Semenov, Andrey

2018-03-01

The possibility of a significant increase in the length of cable communication channels of local area networks of automation and engineering support systems of buildings in the case of their implementation on balanced twisted pair cables is shown. Assuming a direct connection scheme and an effective speed of 100 Mbit/s, analytical relationships are obtained for the calculation of the maximum communication distance. The necessity of using in the linear part of such systems of twisted pair cables with U/UTP structure and interference parameters at the level of category 5e is grounded.

Detailed pressure distribution measurements obtained on several configurations of an aspect-ratio-7 variable twist wing

NASA Technical Reports Server (NTRS)

Holbrook, G. T.; Dunham, D. M.

1985-01-01

Detailed pressure distribution measurements were made for 11 twist configurations of a unique, multisegmented wing model having an aspect ratio of 7 and a taper ratio of 1. These configurations encompassed span loads ranging from that of an untwisted wing to simple flapped wings both with and without upper-surface spoilers attached. For each of the wing twist configurations, electronic scanning pressure transducers were used to obtain 580 surface pressure measurements over the wing in about 0.1 sec. Integrated pressure distribution measurements compared favorably with force-balance measurements of lift on the model when the model centerbody lift was included. Complete plots and tabulations of the pressure distribution data for each wing twist configuration are provided.

Further Examination of the Vibratory Loads Reduction Results from the NASA/ARMY/MIT Active Twist Rotor Test

NASA Technical Reports Server (NTRS)

Wilbur, Matthew L.; Yeager, William T., Jr.; Sekula, Martin K.

2002-01-01

The vibration reduction capabilities of a model rotor system utilizing controlled, strain-induced blade twisting are examined. The model rotor blades, which utilize piezoelectric active fiber composite actuators, were tested in the NASA Langley Transonic Dynamics Tunnel using open-loop control to determine the effect of active-twist on rotor vibratory loads. The results of this testing have been encouraging, and have demonstrated that active-twist rotor designs offer the potential for significant load reductions in future helicopter rotor systems. Active twist control was found to use less than 1% of the power necessary to operate the rotor system and had a pronounced effect on both rotating- and fixed-system loads, offering reductions in individual harmonic loads of up to 100%. A review of the vibration reduction results obtained is presented, which includes a limited set of comparisons with results generated using the second-generation version of the Comprehensive Analytical Model of Rotorcraft Aerodynamics and Dynamics (CAMRAD II) rotorcraft comprehensive analysis.

Management Options for Twisted Gastric Tube after Laparoscopic Sleeve Gastrectomy.

PubMed

Abd Ellatif, Mohamed E; Abbas, Ashraf; El Nakeeb, Ayman; Magdy, Alaa; Salama, Asaad F; Bashah, Moataz M; Dawoud, Ibrahim; Gamal, Maged Ali; Sargsyan, Davit

2017-09-01

This study aims to determine the incidence, etiology, and management options for symptomatic gastric obstruction caused by axially twisted sleeve gastrectomy. In this retrospective study, we reviewed medical charts of all morbidly obese patients who underwent laparoscopic sleeve gastrectomy. Patients who developed gastric obstruction symptoms and were diagnosed with twisted sleeve gastrectomy were identified and included in this study. From October 2005 to December 2015, there are 3634 morbidly obese patients who underwent laparoscopic sleeve gastrectomy (LSG). Eighty-six (2.3%) patients developed symptoms of gastric obstruction. Forty-five (1.23%) patients were included in this study. The mean time of presentation was 59.8 days after surgery. Upper GI contrast study was done routinely, and it was positive for axial twist in 37 (82%) patients. Abdominal CT with oral and IV contrast was done in eight (18%) when swallow study was equivocal. Endoscopic treatment was successful in 43 patients (95.5%). Sixteen patients were successfully managed by endoscopic stenting, and 29 patients had balloon dilation. The average numbers of dilation sessions were 1.7. Out of these 29 patients, 18 responded well to a single session of dilatation and did not require any further dilatation sessions. Two patients who failed to respond to three subsequent sessions of balloon dilation underwent laparoscopic adhesiolysis and gastropexy. Endoscopic stenting is an effective tool in management of axial rotation of sleeved stomach. Balloon dilation can also be effective in selected cases. Few cases might require laparoscopic adhesiolysis and gastropexy.

Leading twist nuclear shadowing phenomena in hard processes with nuclei

DOE PAGES

L. Franfurt; Guzey, V.; Strikman, M.

2012-01-08

We present and discuss the theory and phenomenology of the leading twist theory of nuclear shadowing which is based on the combination of the generalization of Gribov-Glauber theory, QCD factorization theorems, and HERA QCD analysis of diffraction in lepton-proton deep inelastic scattering (DIS). We apply this technique for the analysis of a wide range of hard processes with nuclei-inclusive DIS on deuterons, medium-range and heavy nuclei, coherent and incoherent diffractive DIS with nuclei, and hard diffraction in proton-nucleus scattering - and make predictions for the effect of nuclear shadowing in the corresponding sea quark and gluon parton distributions. We alsomore » analyze the role of the leading twist nuclear shadowing in generalized parton distributions in nuclei and certain characteristics of final states in nuclear DIS. We discuss the limits of applicability of the leading twist approximation for small x scattering off nuclei and the onset of the black disk regime and methods of detecting it. It will be possible to check many of our predictions in the near future in the studies of the ultraperipheral collisions at the Large Hadron Collider (LHC). Further checks will be possible in pA collisions at the LHC and forward hadron production at Relativistic Heavy Ion Collider (RHIC). As a result, detailed tests will be possible at an Electon-Ion Collider (EIC) in USA and at the Large Hadron-Electron Collider (LHeC) at CERN.« less

Homologous and cannibalistic coronal mass ejections from twisted magnetic flux rope simulations

NASA Astrophysics Data System (ADS)

Chatterjee, Piyali; Fan, Yuhong

We present results from magnetohydrodynamic simulations of the development of homologous sequence of coronal mass ejections (CMEs) and demonstrate their so-called cannibalistic behavior. These CMEs originate from the repeated formations and partial eruptions of kink unstable flux ropes as a result of continued emergence of a twisted flux rope across the lower boundary into a pre-existing coronal potential arcade field. Our simulation shows that a CME erupting into the open magnetic field created by a preceding CME has a higher speed. The second of the three successive CMEs in one of the simulations is cannibalistic, catching up and merging with the first into a single fast CME before exiting the domain. All the CMEs including the leading merged CME, attained speeds of about 1000 km s-1 as they exit the domain. The reformation of a twisted flux rope after each CME eruption during the sustained flux emergence can naturally explain the X-ray observations of repeated reformations of sigmoids and "sigmoid-under-cusp" configurations at a low-coronal source of homologous CMEs. We also investigate the initiation mechanism and ejecta topology of these energetic CMEs as a function of the twist parameter of the flux rope.

Raman Excitation Profile of the G-band Enhancement in Twisted Bilayer Graphene

NASA Astrophysics Data System (ADS)

Eliel, G. S. N.; Ribeiro, H. B.; Sato, K.; Saito, R.; Lu, Chun-Chieh; Chiu, Po-Wen; Fantini, C.; Righi, A.; Pimenta, M. A.

2017-12-01

A resonant Raman study of twisted bilayer graphene (TBG) samples with different twisting angles using many different laser lines in the visible range is presented. The samples were fabricated by CVD technique and transferred to Si/SiO2 substrates. The Raman excitation profiles of the huge enhancement of the G-band intensity for a group of different TBG flakes were obtained experimentally, and the analysis of the profiles using a theoretical expression for the Raman intensities allowed us to obtain the energies of the van Hove singularities generated by the Moiré patterns and the lifetimes of the excited state of the Raman process. Our results exhibit a good agreement between experimental and calculated energies for van Hove singularities and show that the lifetime of photoexcited carrier does not depend significantly on the twisting angle in the range intermediate angles ( 𝜃 between 10∘ and 15∘). We observed that the width of the resonance window (Γ ≈ 250 meV) is much larger than the REP of the Raman modes of carbon nanotubes, which are also enhanced by resonances with van Hove singularities.

ARE TORNADO-LIKE MAGNETIC STRUCTURES ABLE TO SUPPORT SOLAR PROMINENCE PLASMA?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luna, M.; Moreno-Insertis, F.; Priest, E.

Recent high-resolution and high-cadence observations have surprisingly suggested that prominence barbs exhibit apparent rotating motions suggestive of a tornado-like structure. Additional evidence has been provided by Doppler measurements. The observations reveal opposite velocities for both hot and cool plasma on the two sides of a prominence barb. This motion is persistent for several hours and has been interpreted in terms of rotational motion of prominence feet. Several authors suggest that such barb motions are rotating helical structures around a vertical axis similar to tornadoes on Earth. One of the difficulties of such a proposal is how to support cool prominencemore » plasma in almost-vertical structures against gravity. In this work we model analytically a tornado-like structure and try to determine possible mechanisms to support the prominence plasma. We have found that the Lorentz force can indeed support the barb plasma provided the magnetic structure is sufficiently twisted and/or significant poloidal flows are present.« less

Mechanical characteristics and comparisons of cerclage wires: introduction of the double-wrap and loop/twist tying methods.

PubMed

Roe, S C

1997-01-01

Evaluate the mechanical properties of twist, loop, double loop, double-wrap and loop/twist cerclage. The initial tension generated by 18 cerclage of each type was determined using a materials testing machine after tying around a testing jig. Six wires from each type were distracted and the initial stiffness and yield load were determined. Yield behavior was further investigated in six wires of each type by determining the load required to reduce cerclage tension below 30 Newton (N) following and incremental (50 N) stepwise load and unload regimen. The amount of collapse of the simulated bone fragments that resulted in the reduction of initial tension to 30 N was measured for the final six wires of each group. Data were analyzed by analysis of variance and a multiple comparison test. Twist type cerclage generated less tension than loop-type cerclage. The yield load of these two types was similar. Double-loop and double-wrap cerclage generated superior tension and resisted a greater load before loosening. Loop/twist cerclage had an intermediate initial tension but had the greatest resistance to loading. In the collapse test, the greater the initial tension, the more collapse could occur before the wire was loose. For all types of cerclage wire fixation, a reduction of diameter of the testing jig of more than 1% caused loosening. Double-loop and double-wrap cerclage provide greater compression of fragments and resist loads associated with weight-bearing better than the twist and loop methods. Loop/twist cerclage may have advantages because of their superior resistance to loading. All cerclage will loosen if fracture fragments collapse.

Development and evaluation of TWIST Dixon for dynamic contrast-enhanced (DCE) MRI with improved acquisition efficiency and fat suppression.

PubMed

Le, Yuan; Kroeker, Randall; Kipfer, Hal D; Lin, Chen

2012-08-01

To develop a new pulse sequence called time-resolved angiography with stochastic trajectories (TWIST) Dixon for dynamic contrast enhanced magnetic resonance imaging (DCE-MRI). The method combines dual-echo Dixon to generate separated water and fat images with a k-space view-sharing scheme developed for 3D TWIST. The performance of TWIST Dixon was compared with a volume interpolated breathhold examination (VIBE) sequence paired with spectrally selective adiabatic inversion Recovery (SPAIR) and quick fat-sat (QFS) fat-suppression techniques at 3.0T using quantitative measurements of fat-suppression accuracy and signal-to-noise ratio (SNR) efficiency, as well as qualitative breast image evaluations. The water fraction of a uniform phantom was calculated from the following images: 0.66 ± 0.03 for TWIST Dixon; 0.56 ± 0.23 for VIBE-SPAIR, and 0.53 ± 0.14 for VIBE-QFS, while the reference value is 0.70 measured by spectroscopy. For phantoms with contrast (Gd-BOPTA) concentration ranging from 0-6 mM, TWIST Dixon also provides consistently higher SNR efficiency (3.2-18.9) compared with VIBE-SPAIR (2.8-16.8) and VIBE-QFS (2.4-12.5). Breast images acquired with TWIST Dixon at 3.0T show more robust and uniform fat suppression and superior overall image quality compared with VIBE-SPAIR. The results from phantom and volunteer evaluation suggest that TWIST Dixon outperforms conventional methods in almost every aspect and it is a promising method for DCE-MRI and contrast-enhanced perfusion MRI, especially at higher field strength where fat suppression is challenging. Copyright © 2012 Wiley Periodicals, Inc.

Would You Rather (WYR), with a Sexual Health Twist!

ERIC Educational Resources Information Center

Rosen, Brittany; McNeill, Elisa Beth; Wilson, Kelly

2014-01-01

Would You Rather (WYR), with a Sexual Health Twist! teaching technique uses two youth games, "Would you rather…" and Twister®, to actively engage students in developing decision-making skills regarding human sexuality. Utilizing the "Would you rather" choices, the teacher provides a short scenario with two difficult choices.…

Tyrosine kinase receptor c-ros-oncogene 1 inhibition alleviates aberrant bone formation of TWIST-1 haploinsufficient calvarial cells from Saethre-Chotzen syndrome patients.

PubMed

Camp, Esther; Anderson, Peter J; Zannettino, Andrew C W; Glackin, Carlotta A; Gronthos, Stan

2018-09-01

Saethre-Chotzen syndrome (SCS), associated with TWIST-1 mutations, is characterized by premature fusion of cranial sutures. TWIST-1 haploinsufficiency, leads to alterations in suture mesenchyme cellular gene expression patterns, resulting in aberrant osteogenesis and craniosynostosis. We analyzed the expression of the TWIST-1 target, Tyrosine kinase receptor c-ros-oncogene 1 (C-ROS-1) in TWIST-1 haploinsufficient calvarial cells derived from SCS patients and calvaria of Twist-1 del/+ mutant mice and found it to be highly expressed when compared to TWIST-1 wild-type controls. Knock-down of C-ROS-1 expression in TWIST-1 haploinsufficient calvarial cells derived from SCS patients was associated with decreased capacity for osteogenic differentiation in vitro. Furthermore, treatment of human SCS calvarial cells with the tyrosine kinase chemical inhibitor, Crizotinib, resulted in reduced C-ROS-1 activity and the osteogenic potential of human SCS calvarial cells with minor effects on cell viability or proliferation. Cultured human SCS calvarial cells treated with Crizotinib exhibited a dose-dependent decrease in alkaline phosphatase activity and mineral deposition, with an associated decrease in expression levels of Runt-related transcription factor 2 and OSTEOPONTIN, with reduced PI3K/Akt signalling in vitro. Furthermore, Crizotinib treatment resulted in reduced BMP-2 mediated bone formation potential of whole Twist-1 del/+ mutant mouse calvaria organotypic cultures. Collectively, these results suggest that C-ROS-1 promotes osteogenic differentiation of TWIST-1 haploinsufficient calvarial osteogenic progenitor cells. Furthermore, the aberrant osteogenic potential of these cells is inhibited by the reduction of C-ROS-1. Therefore, targeting C-ROS-1 with a pharmacological agent, such as Crizotinib, may serve as a novel therapeutic strategy to alleviate craniosynostosis associated with aberrant TWIST-1 function. © 2018 Wiley Periodicals, Inc.

A unified formulation of dichroic signals using the Borrmann effect and twisted photon beams.

PubMed

Collins, Stephen P; Lovesey, Stephen W

2018-05-21

Dichroic X-ray signals derived from the Borrmann effect and a twisted photon beam with topological charge l = 1 are formulated with an effective wavevector. The unification applies for non-magnetic and magnetic materials. Electronic degrees of freedom associated with an ion are encapsulated in multipoles previously used to interpret conventional dichroism and Bragg diffraction enhanced by an atomic resonance. A dichroic signal exploiting the Borrmann effect with a linearly polarized beam presents charge-like multipoles that include a hexadecapole. A difference between dichroic signals obtained with a twisted beam carrying spin polarization (circular polarization) and opposite winding numbers presents charge-like atomic multipoles, whereas a twisted beam carrying linear polarization alone presents magnetic (time-odd) multipoles. Charge-like multipoles include a quadrupole, and magnetic multipoles include a dipole and an octupole. We discuss the practicalities and relative merits of spectroscopy exploiting the two remarkably closely-related processes. Signals using beams with topological charges l ≥ 2 present additional atomic multipoles.

Reconstruction of Twist Torque in Main Parachute Risers

NASA Technical Reports Server (NTRS)

Day, Joshua D.

2015-01-01

The reconstruction of twist torque in the Main Parachute Risers of the Capsule Parachute Assembly System (CPAS) has been successfully used to validate CPAS Model Memo conservative twist torque equations. Reconstruction of basic, one degree of freedom drop tests was used to create a functional process for the evaluation of more complex, rigid body simulation. The roll, pitch, and yaw of the body, the fly-out angles of the parachutes, and the relative location of the parachutes to the body are inputs to the torque simulation. The data collected by the Inertial Measurement Unit (IMU) was used to calculate the true torque. The simulation then used photogrammetric and IMU data as inputs into the Model Memo equations. The results were then compared to the true torque results to validate the Model Memo equations. The Model Memo parameters were based off of steel risers and the parameters will need to be re-evaluated for different materials. Photogrammetric data was found to be more accurate than the inertial data in accounting for the relative rotation between payload and cluster. The Model Memo equations were generally a good match and when not matching were generally conservative.

Time-dependent density functional theory with twist-averaged boundary conditions

NASA Astrophysics Data System (ADS)

Schuetrumpf, B.; Nazarewicz, W.; Reinhard, P.-G.

2016-05-01

Background: Time-dependent density functional theory is widely used to describe excitations of many-fermion systems. In its many applications, three-dimensional (3D) coordinate-space representation is used, and infinite-domain calculations are limited to a finite volume represented by a spatial box. For finite quantum systems (atoms, molecules, nuclei, hadrons), the commonly used periodic or reflecting boundary conditions introduce spurious quantization of the continuum states and artificial reflections from boundary; hence, an incorrect treatment of evaporated particles. Purpose: The finite-volume artifacts for finite systems can be practically cured by invoking an absorbing potential in a certain boundary region sufficiently far from the described system. However, such absorption cannot be applied in the calculations of infinite matter (crystal electrons, quantum fluids, neutron star crust), which suffer from unphysical effects stemming from a finite computational box used. Here, twist-averaged boundary conditions (TABC) have been used successfully to diminish the finite-volume effects. In this work, we extend TABC to time-dependent modes. Method: We use the 3D time-dependent density functional framework with the Skyrme energy density functional. The practical calculations are carried out for small- and large-amplitude electric dipole and quadrupole oscillations of 16O. We apply and compare three kinds of boundary conditions: periodic, absorbing, and twist-averaged. Results: Calculations employing absorbing boundary conditions (ABC) and TABC are superior to those based on periodic boundary conditions. For low-energy excitations, TABC and ABC variants yield very similar results. With only four twist phases per spatial direction in TABC, one obtains an excellent reduction of spurious fluctuations. In the nonlinear regime, one has to deal with evaporated particles. In TABC, the floating nucleon gas remains in the box; the amount of nucleons in the gas is found to be

Fast-switching chiral nematic liquid-crystal mode with polymer-sustained twisted vertical alignment.

PubMed

Chang, Kai-Han; Joshi, Vinay; Chien, Liang-Chy

2017-04-01

We demonstrate a fast-switching liquid-crystal mode with polymer-sustained twisted vertical alignment. By optimizing the polymerization condition, a polymer microstructure with controlled orientation is produced. The polymer microstructure not only synergistically suppresses the optical bounce during field-induced homeotropic-twist transition but also shortens the response time significantly. Theoretical analyses validate that the ground state free energy density is modified by the aligning field of the polymer microstructure, which affects the driving voltage of the device. The outcomes of this paper will enable the development of fast-switching and achromatic electro-optical and photonic devices.

Fast-switching chiral nematic liquid-crystal mode with polymer-sustained twisted vertical alignment

NASA Astrophysics Data System (ADS)

Chang, Kai-Han; Joshi, Vinay; Chien, Liang-Chy

2017-04-01

We demonstrate a fast-switching liquid-crystal mode with polymer-sustained twisted vertical alignment. By optimizing the polymerization condition, a polymer microstructure with controlled orientation is produced. The polymer microstructure not only synergistically suppresses the optical bounce during field-induced homeotropic-twist transition but also shortens the response time significantly. Theoretical analyses validate that the ground state free energy density is modified by the aligning field of the polymer microstructure, which affects the driving voltage of the device. The outcomes of this paper will enable the development of fast-switching and achromatic electro-optical and photonic devices.

Light polarization management via reflection from arrays of sub-wavelength metallic twisted bands

NASA Astrophysics Data System (ADS)

Nawrot, M.; Haberko, J.; Zinkiewicz, Ł.; Wasylczyk, P.

2017-12-01

With constant progress of nano- and microfabrication technologies, photolithography in particular, a number of sub-wavelength metallic structures have been demonstrated that can be used to manipulate light polarization. Numerical simulations of light propagation hint that helical twisted bands can have interesting polarization properties. We use three-dimensional two-photon photolithography (direct laser writing) to fabricate a few-micrometer-thick arrays of twisted bands and coat them uniformly with metal. We demonstrate that circular polarization can be generated from linear polarization upon reflection from such structures over a broad range of frequencies in the mid infrared.

The Twisting of Thin-walled, Stiffened Circular Cylinders

NASA Technical Reports Server (NTRS)

Schapitz, E

1938-01-01

On the basis of the present investigation of the twisting of thin-walled, stiffened cylinders the following conclusions can be reached: 1) there is as yet no generally applicable formula for the buckling moment of the skin; 2) the mathematical treatment of the condition of the shell after buckling of the skin is based on the tension-field theory, wherein the strain condition is considered homogenous.

Twisted MoSe 2 bilayers with variable local stacking and interlayer coupling revealed by low-frequency Raman spectroscopy

DOE PAGES

Puretzky, Alexander A.; Liang, Liangbo; Li, Xufan; ...

2016-01-14

Unique twisted bilayers of MoSe 2 with multiple stacking orientations and interlayer couplings in the narrow range of twist angles, 60 ± 3°, are revealed by low-frequency Raman spectroscopy and theoretical analysis. The slight deviation from 60 allows the concomitant presence of patches featuring all three high-symmetry stacking configurations (2H or AA', AB', A'B) in one unique bilayer system. In this case, the periodic arrangement of the patches and their size strongly depend on the twist angle. Ab initio modeling predicts significant changes in frequencies and intensities of low-frequency modes versus stacking and twist angle. Experimentally, the variable stacking andmore » coupling across the interface is revealed by the appearance of two breathing modes corresponding to the mixture of the high-symmetry stacking configurations and unaligned regions of monolayers. Only one breathing mode is observed outside the narrow range of twist angles. This indicates a stacking transition to unaligned monolayers with mismatched atom registry without the in-plane restoring force required to generate a shear mode. As a result, the variable interlayer coupling and spacing in transition metal dichalcogenide bilayers revealed in this study may provide a new platform for optoelectronic applications of these materials.« less

Twisted MoSe 2 bilayers with variable local stacking and interlayer coupling revealed by low-frequency Raman spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Puretzky, Alexander A.; Liang, Liangbo; Li, Xufan

Unique twisted bilayers of MoSe 2 with multiple stacking orientations and interlayer couplings in the narrow range of twist angles, 60 ± 3°, are revealed by low-frequency Raman spectroscopy and theoretical analysis. The slight deviation from 60 allows the concomitant presence of patches featuring all three high-symmetry stacking configurations (2H or AA', AB', A'B) in one unique bilayer system. In this case, the periodic arrangement of the patches and their size strongly depend on the twist angle. Ab initio modeling predicts significant changes in frequencies and intensities of low-frequency modes versus stacking and twist angle. Experimentally, the variable stacking andmore » coupling across the interface is revealed by the appearance of two breathing modes corresponding to the mixture of the high-symmetry stacking configurations and unaligned regions of monolayers. Only one breathing mode is observed outside the narrow range of twist angles. This indicates a stacking transition to unaligned monolayers with mismatched atom registry without the in-plane restoring force required to generate a shear mode. As a result, the variable interlayer coupling and spacing in transition metal dichalcogenide bilayers revealed in this study may provide a new platform for optoelectronic applications of these materials.« less

ADAM12 induction by Twist1 promotes tumor invasion and metastasis via regulation of invadopodia and focal adhesions

PubMed Central

Eckert, Mark A.; Santiago-Medina, Miguel; Lwin, Thinzar M.; Kim, Jihoon; Courtneidge, Sara A.

2017-01-01

ABSTRACT The Twist1 transcription factor promotes tumor invasion and metastasis by inducing epithelial–mesenchymal transition (EMT) and invadopodia-mediated extracellular matrix (ECM) degradation. The critical transcription targets of Twist1 for mediating these events remain to be uncovered. Here, we report that Twist1 strongly induces expression of a disintegrin and metalloproteinase 12 (ADAM12). We observed that the expression levels of Twist1 mRNA and ADAM12 mRNA are tightly correlated in human breast tumors. Knocking down ADAM12 blocked cell invasion in a 3D mammary organoid culture. Suppression of ADAM12 also inhibited Twist1-induced tumor invasion and metastasis in human breast tumor xenografts, without affecting primary tumor formation. Mechanistically, knockdown of ADAM12 in breast cancer cells significantly reduced invadopodia formation and matrix degradation, and simultaneously increased overall cell adhesion to the ECM. Live-imaging analysis showed that knockdown of ADAM12 significantly inhibited focal adhesion turnover. Mechanistically, both the disintegrin and metalloproteinase domains of ADAM12 are required for its function at invadopodia, whereas the metalloproteinase domain is dispensable for its function at focal adhesions. Taken together, these data suggest that ADAM12 plays a crucial role in tumor invasion and metastasis by regulating both invadopodia and focal adhesions. PMID:28468988

Splitting of Van Hove singularities in slightly twisted bilayer graphene

NASA Astrophysics Data System (ADS)

Li, Si-Yu; Liu, Ke-Qin; Yin, Long-Jing; Wang, Wen-Xiao; Yan, Wei; Yang, Xu-Qin; Yang, Jun-Kai; Liu, Haiwen; Jiang, Hua; He, Lin

2017-10-01

A variety of new and interesting electronic properties have been predicted in graphene monolayer doped to Van Hove singularities (VHSs) of its density of state. However, tuning the Fermi energy to reach a VHS of graphene by either gating or chemical doping is prohibitively difficult, owing to their large energy distance (˜3 eV). This difficulty can be easily overcome in twisted bilayer graphene (TBG). By introducing a small twist angle between two adjacent graphene sheets, we are able to generate two low-energy VHSs arbitrarily approaching the Fermi energy. Here, we report experimental studies of electronic properties around the VHSs of a slightly TBG through scanning tunneling microscopy measurements. The split of the VHSs is observed and the spatial symmetry breaking of electronic states around the VHSs is directly visualized. These exotic results provide motivation for further theoretical and experimental studies of graphene systems around the VHSs.

Colliding Magnetic Flux Ropes and Quasi-Separatrix Layers in a Laboratory Plasma

NASA Astrophysics Data System (ADS)

Lawrence, Eric Eugene

An experimental study of the dynamics of colliding magnetic flux ropes and the magnetic reconnection that occurs during these collisions is presented. A magnetic flux rope is a bundle of twisted magnetic field lines that is ubiquitous in space and solar plasmas. The flux ropes are created in the Large Plasma Device (LAPD) using two heated lanthanum hexaboride (LaB6) cathodes that inject currents into the background plasma. The currents are initially parallel to the background magnetic field. The azimuthal field of each current together with the background axial field create helical twisted flux ropes. It is found that the flux ropes rotate in time (corkscrew) and collide with each other. During a collision, antiparallel magnetic fields can undergo magnetic reconnection. When these collisions occur, we observe current layers flowing in the opposite direction of the injected current, a signatuare of reconnection. Analysis of the three-dimensional magnetic field lines shows the existence of quasi-separatrix layers (QSLs). These are regions in the magnetic configuration where there are large spatial gradients in the connectivity of field line footpoints in the boundary surfaces. QSLs are thought to be favorable sites for magnetic reconnection. It is shown that the location and shape of the QSL is similar to what is seen in simulations of merging flux ropes. Furthermore, the field line structure of the QSL is similar to that of a twisted hyperbolic flux tube (HFT). An HFT is a type of QSL that has been shown to be a preferred site for current sheet formation in simulations of interacting coronal loops. The HFT in this experiment is found to be generally near the reverse current layers, although the agreement is not perfect. Looking at the time evolution of the QSL, we find that the QSL cross-sectional area grows and contracts at the same time that the flux ropes collide and that the reverse current layers appear. Analysis of the field line motion shows that, during

An in Vitro Twist Fatigue Test of Fabric Stent-Grafts Supported by Z-Stents vs. Ringed Stents.

PubMed

Lin, Jing; Guidoin, Robert; Du, Jia; Wang, Lu; Douglas, Graeham; Zhu, Danjie; Nutley, Mark; Perron, Lygia; Zhang, Ze; Douville, Yvan

2016-02-16

Whereas buckling can cause type III endoleaks, long-term twisting of a stent-graft was investigated here as a mechanism leading to type V endoleak or endotension. Two experimental device designs supported with Z-stents having strut angles of 35° or 45° were compared to a ringed control under accelerated twisting. Damage to each device was assessed and compared after different durations of twisting, with focus on damage that may allow leakage. Stent-grafts with 35° Z-stents had the most severe distortion and damage to the graft fabric. The 45° Z-stents caused less fabric damage. However, consistent stretching was still seen around the holes for sutures, which attach the stents to the graft fabric. Larger holes may become channels for fluid percolation through the wall. The ringed stent-graft had the least damage observed. Stent apexes with sharp angles appear to be responsible for major damage to the fabrics. Device manufacturers should consider stent apex angle when designing stent-grafts, and ensure their devices are resistant to twisting.

An in Vitro Twist Fatigue Test of Fabric Stent-Grafts Supported by Z-Stents vs. Ringed Stents

PubMed Central

Lin, Jing; Guidoin, Robert; Du, Jia; Wang, Lu; Douglas, Graeham; Zhu, Danjie; Nutley, Mark; Perron, Lygia; Zhang, Ze; Douville, Yvan

2016-01-01

Whereas buckling can cause type III endoleaks, long-term twisting of a stent-graft was investigated here as a mechanism leading to type V endoleak or endotension. Two experimental device designs supported with Z-stents having strut angles of 35° or 45° were compared to a ringed control under accelerated twisting. Damage to each device was assessed and compared after different durations of twisting, with focus on damage that may allow leakage. Stent-grafts with 35° Z-stents had the most severe distortion and damage to the graft fabric. The 45° Z-stents caused less fabric damage. However, consistent stretching was still seen around the holes for sutures, which attach the stents to the graft fabric. Larger holes may become channels for fluid percolation through the wall. The ringed stent-graft had the least damage observed. Stent apexes with sharp angles appear to be responsible for major damage to the fabrics. Device manufacturers should consider stent apex angle when designing stent-grafts, and ensure their devices are resistant to twisting. PMID:28787913

Heater-induced altitude descent of the EISCAT UHF ion line enhancements: Observations and modelling

NASA Astrophysics Data System (ADS)

Ashrafi, M.; Kosch, M. J.; Honary, F.

2006-01-01

On 12 November 2001, artificial optical annuli were produced using the EISCAT high-frequency (HF) ionospheric heating facility. This unusual phenomenon was induced using O-mode transmissions at 5.423 MHz with 550 MW effective isotropic radiated power and the pump beam dipped 9° south of the zenith. The pump frequency corresponds to the fourth electron gyroharmonic frequency at 215 km altitude. The EISCAT UHF radar observed a persistent pump-induced enhancement in the ion line backscatter power near the HF reflection altitude. The optical and radar signatures of HF pumping started at ˜230 km and descended to ˜220 km within ˜60 s. This effect has been modelled using the solution to differential equations describing pump-induced electron temperature and density perturbations. The decrease in altitude of the ion line by ˜10 km and changes in electron density have been modelled. The results show that a maximum electron temperature enhancement of up to ˜5700 K can be achieved on average, which is not sufficient to explain the observed optical emissions.

Perversions with a twist

NASA Astrophysics Data System (ADS)

Silva, Pedro E. S.; Trigueiros, Joao L.; Trindade, Ana C.; Simoes, Ricardo; Dias, Ricardo G.; Godinho, Maria Helena; de Abreu, Fernao Vistulo

2016-03-01

Perversions connecting two helices with symmetric handedness are a common occurrence in nature, for example in tendrils. These defects can be found in our day life decorating ribbon gifts or when plants use tendrils to attach to a support. Perversions arise when clamped elastic filaments coil into a helical shape but have to conserve zero overall twist. We investigate whether other types of perversions exist and if they display different properties. Here we show mathematically and experimentally that a continuous range of different perversions can exist and present different geometries. Experimentally, different perversions were generated using micro electrospun fibres. Our experimental results also confirm that these perversions behave differently upon release and adopt different final configurations. These results also demonstrate that it is possible to control on demand the formation and shape of microfilaments, in particular, of electrospun fibres by using ultraviolet light.

Effects of dielectric inhomogeneity on electrostatic twist rigidity of a helical biomolecule in Debye-Hückel regime

NASA Astrophysics Data System (ADS)

Rezaie-Dereshgi, Amir; Mohammad-Rafiee, Farshid

2018-04-01

The electrostatic interactions play a crucial role in biological systems. Here we consider an impermeable dielectric molecule in the solvent with a different dielectric constant. The electrostatic free energy in the problem is studied in the Debye-Hückel regime using the analytical Green function that is calculated in the paper. Using this electrostatic free energy, we study the electrostatic contribution to the twist rigidity of a double stranded helical molecule such as a DNA and an actin filament. The dependence of the electrostatic twist rigidity of the molecule to the dielectric inhomogeneity, structural parameters, and the salt concentration is studied. It is shown that, depending on the parameters, the electrostatic twist rigidity could be positive or negative.

Bedside Treatment of Chronic Subdural Hematoma: Using Radiographic Characteristics to Revisit the Twist Drill.

PubMed

Garber, Sarah; McCaffrey, Jamie; Quigley, Edward P; MacDonald, Joel D

2016-05-01

Conventional treatment strategies for the management of symptomatic chronic subdural hematoma (cSDH) in the elderly include observation, operative burr holes or craniotomy, and bedside twist drill drainage. The decision on which technique to use should be determined by weighing the comorbidities and symptoms of the patient with the potential risks and benefits. The goal of this study was to identify radiographic characteristics on computed tomography scan that might be used to guide surgical decision making in terms of operative versus bedside removal of cSDH. We retrospectively reviewed clinical and radiographic features in patients who underwent bedside twist drill evacuation of a cSDH and those for a cohort of patients who underwent operative intervention via burr holes. We did not identify any clinical features or preoperative imaging characteristics to suggest an advantage of one procedure over the other. Additionally, complete radiographic resolution of cSDH on postoperative imaging is not required to relieve patient symptoms. Although bedside twist drill evacuation may avoid operating room costs and anesthetic complications in an elderly patient population and allow earlier resumption of anticoagulation treatment if necessary, there is also a risk of morbidity if uncontrolled bleeding is encountered or the patient is unable to tolerate the bedside procedure. However, bedside twist drill craniostomy is a reasonable and effective option for the treatment of subacute/chronic SDH in patients who may not be optimal surgical candidates. Georg Thieme Verlag KG Stuttgart · New York.

Expectation values of twist fields and universal entanglement saturation of the free massive boson

NASA Astrophysics Data System (ADS)

Blondeau-Fournier, Olivier; Doyon, Benjamin

2017-07-01

The evaluation of vacuum expectation values (VEVs) in massive integrable quantum field theory (QFT) is a nontrivial renormalization-group ‘connection problem’—relating large and short distance asymptotics—and is in general unsolved. This is particularly relevant in the context of entanglement entropy, where VEVs of branch-point twist fields give universal saturation predictions. We propose a new method to compute VEVs of twist fields associated to continuous symmetries in QFT. The method is based on a differential equation in the continuous symmetry parameter, and gives VEVs as infinite form-factor series which truncate at two-particle level in free QFT. We verify the method by studying U(1) twist fields in free models, which are simply related to the branch-point twist fields. We provide the first exact formulae for the VEVs of such fields in the massive uncompactified free boson model, checking against an independent calculation based on angular quantization. We show that logarithmic terms, overlooked in the original work of Callan and Wilczek (1994 Phys. Lett. B 333 55-61), appear both in the massless and in the massive situations. This implies that, in agreement with numerical form-factor observations by Bianchini and Castro-Alvaredo (2016 Nucl. Phys. B 913 879-911), the standard power-law short-distance behavior is corrected by a logarithmic factor. We discuss how this gives universal formulae for the saturation of entanglement entropy of a single interval in near-critical harmonic chains, including loglog corrections.

Kelvin-Helmholtz instability in a twisting solar polar coronal hole jet observed by SDO/AIA

NASA Astrophysics Data System (ADS)

Zhelyazkov, I.; Zaqarashvili, T. V.; Ofman, L.; Chandra, R.

2018-01-01

We investigate the conditions under which the fluting (m = 2), m = 3 , and m = 12 magnetohydrodynamic (MHD) modes in a uniformly twisted flux tube moving along its axis become unstable in order to model the Kelvin-Helmholtz (KH) instability in a twisting solar coronal hole jet near the northern pole of the Sun. We employed the dispersion relations of MHD modes derived from the linearized MHD equations. We assumed real wavenumbers and complex angular wave frequencies, namely complex wave phse velocities. The dispersion relations were solved numerically at fixed input parameters (taken from observational data) and varying degrees of torsion of the internal magnetic field. It is shown that the stability of the modes depends upon five parameters: the density contrast between the flux tube and its environment, the ratio of the external and internal axial magnetic fields, the twist of the magnetic field lines inside the tube, the ratio of transverse and axial jet's velocities, and the value of the Alfvén Mach number (the ratio of the tube axial velocity to Alfvén speed inside the flux tube). Using a twisting jet of 2010 August 21 by SDO/AIA and other observations of coronal jets we set the parameters of our theoretical model and have obtained that in a twisted magnetic flux tube of radius of 9.8 Mm, at a density contrast of 0.474 and fixed Alfvén Mach number of ≅ 0.76 , for the three MHD modes there exist instability windows whose width crucially depends upon the internal magnetic field twist. It is found that for the considered modes an azimuthal magnetic field of 1.3 - 1.4 G (computed at the tube boundary) makes the width of the instability windows equal to zero, that is, it suppress the KH instability onset. On the other hand, the times for developing KH instability of the m = 12 MHD mode at instability wavelengths between 15 and 12 Mm turn out to be in the range of 1.9 - 4.7 min that is in agreement with the growth rates estimated from the temporal evolution of

Performance Evaluation of UHF RFID Technologies for Real-Time Bus Recognition in the Taipei Bus Station

PubMed Central

Own, Chung-Ming; Lee, Da-Sheng; Wang, Ti-Ho; Wang, De-Jun; Ting, Yu-Lun

2013-01-01

Transport stations such as airports, ports, and railways have adopted blocked-type pathway management to process and control travel systems in a one-directional manner. However, this excludes highway transportation where large buses have great variability and mobility; thus, an instant influx of numerous buses increases risks and complicates station management. Focusing on Taipei Bus Station, this study employed RFID technology to develop a system platform integrated with modern information technology that has numerous characteristics. This modern information technology comprised the following systems: ultra-high frequency (UHF) radio-frequency identification (RFID), ultrasound and license number identification, and backstage graphic controls. In conclusion, the system enabled management, bus companies, and passengers to experience the national bus station's new generation technology, which provides diverse information and synchronization functions. Furthermore, this technology reached a new milestone in the energy-saving and efficiency-increasing performance of Taiwan's buses. PMID:23778192

Self-consistent perturbation theory for two dimensional twisted bilayers

NASA Astrophysics Data System (ADS)

Shirodkar, Sharmila N.; Tritsaris, Georgios A.; Kaxiras, Efthimios

Theoretical modeling and ab-initio simulations of two dimensional heterostructures with arbitrary angles of rotation between layers involve unrealistically large and expensive calculations. To overcome this shortcoming, we develop a methodology for weakly interacting heterostructures that treats the effect of one layer on the other as perturbation, and restricts the calculations to their primitive cells. Thus, avoiding computationally expensive supercells. We start by approximating the interaction potential between the twisted bilayers to that of a hypothetical configuration (viz. ideally stacked untwisted layers), which produces band structures in reasonable agreement with full-scale ab-initio calculations for commensurate and twisted bilayers of graphene (Gr) and Gr/hexagonal boron nitride (h-BN) heterostructures. We then self-consistently calculate the charge density and hence, interaction potential of the heterostructures. In this work, we test our model for bilayers of various combinations of Gr, h-BN and transition metal dichalcogenides, and discuss the advantages and shortcomings of the self-consistently calculated interaction potential. Department of Physics, Harvard University, Cambridge, Massachusetts 02138, USA.

NGC 5626: a massive fast rotator with a twist

NASA Astrophysics Data System (ADS)

Viaene, S.; Sarzi, M.; Baes, M.; Puerari, I.

2018-02-01

We present a kinematic analysis of the dust-lane elliptical NGC 5626 based on MUSE observations. These data allow us to robustly classify this galaxy as a fast rotator and to infer a virial mass of 1011.7 M⊙, making it one of the most massive fast rotators known. In addition, the depth and extent of the MUSE data reveal a strong kinematic twist in the stellar velocity field (by up to 45° beyond 1.5Re). A comparison with the ATLAS3D sample underlines the rareness of this system, although we show that such a large-scale kinematic twist could have been missed by the ATLAS3D data due to the limited spatial sampling of this survey (typically extending to 0.6Re for massive early-type galaxies). MUSE thus has the potential to unveil more examples of this type of galaxies. We discuss the environment and possible formation history of NGC 5626 and finally argue how a merger between the Milky Way and Andromeda could produce a galaxy of the same class as NGC 5626.

Alternating twist structures formed by electroconvection in the nematic phase of an achiral bent-core molecule.

PubMed

Tanaka, Shingo; Dhara, Surajit; Sadashiva, B K; Shimbo, Yoshio; Takanishi, Yoichi; Araoka, Fumito; Ishikawa, Ken; Takezoe, Hideo

2008-04-01

We report an unusual electroconvection in the nematic phase of a bent-core liquid crystal. In a voltage-frequency diagram, two frequency regions exhibiting prewavy stripe patterns were found, as reported by Wiant We found that these stripes never show extinction dark when cells were rotated under crossed polarizers. Based on the color interchange in between neighboring stripes by the rotation of the cells or an analyzer, twisted molecular orientation is suggested; i.e., the directors are alternately twisted from the top to the bottom surfaces with a pretilt angle in adjacent stripes, which is an analogue of the twisted (splayed) structure observed in surface-stabilized ferroelectric liquid crystal cells. The transmittance spectra calculated using the 4x4 matrix method from the model structure are consistent with the experimental observation.

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

Twist phase-induced characteristics changes of a radially polarized Gaussian Schell-Model beam in a uniaxial crystal orthogonal to the optical axis

NASA Astrophysics Data System (ADS)

Cao, Pengfei; Fu, Wenyu

2017-10-01

Based on the extended Huygens-Fresnel integral formula and unified theory of coherence and polarization, we obtained the cross-spectral density matrix elements for a radially polarized partially coherent twist (RPPCT) beam in a uniaxial crystal. Moreover, compared with free space, we explore numerically the evolution properties of a RPPCT beam in a uniaxial crystal. The calculation results show that the evolution properties of a RPPCT beam in crystals are substantially different from its properties in free space. These properties in crystals are mainly determined by the twist factor and the ratio of extraordinary index to ordinary refractive index. In a uniaxial crystal, the distribution of the intensity of a RPPCT beam all exhibits non-circular symmetry, and these distributions change with twist factor and the ratio of extraordinary index to ordinary refractive index. The twist factor affects their rotation orientation angles, and the ratio of extraordinary index to ordinary refractive index impacts their twisted levels. This novel characteristics can be used for free-space optical communications, particle manipulation and nonlinear optics, where partially coherent beam with controlled profile and twist factor are required.

Three-Dimensional Rotation, Twist and Torsion Analyses Using Real-Time 3D Speckle Tracking Imaging: Feasibility, Reproducibility, and Normal Ranges in Pediatric Population.

PubMed

Zhang, Li; Zhang, Jing; Han, Wei; Gao, Jun; He, Lin; Yang, Yali; Yin, Ping; Xie, Mingxing; Ge, Shuping

2016-01-01

The specific aim of this study was to evaluate the feasibility, reproducibility and maturational changes of LV rotation, twist and torsion variables by real-time 3D speckle-tracking echocardiography (RT3DSTE) in children. A prospective study was conducted in 347 consecutive healthy subjects (181 males/156 females, mean age 7.12 ± 5.3 years, and range from birth to 18-years) using RT 3D echocardiography (3DE). The LV rotation, twist and torsion measurements were made off-line using TomTec software. Manual landmark selection and endocardial border editing were performed in 3 planes (apical "2"-, "4"-, and "3"- chamber views) and semi-automated tracking yielded LV rotation, twist and torsion measurements. LV rotation, twist and torsion analysis by RT 3DSTE were feasible in 307 out of 347 subjects (88.5%). There was no correlation between rotation or twist and age, height, weight, BSA or heart rate, respectively. However, there was statistically significant, but very modest correlation between LV torsion and age (R2 = 0.036, P< 0.001). The normal ranges were defined for rotation and twist in this cohort, and for torsion for each age group. The intra-observer and inter-observer variabilities for apical and basal rotation, twist and torsion ranged from 7.3% ± 3.8% to 12.3% ± 8.8% and from 8.8% ± 4.6% to 15.7% ± 10.1%, respectively. We conclude that analysis of LV rotation, twist and torsion by this new RT3D STE is feasible and reproducible in pediatric population. There is no maturational change in rotation and twist, but torsion decreases with age in this cohort. Further refinement is warranted to validate the utility of this new methodology in more sensitive and quantitative evaluation of congenital and acquired heart diseases in children.

Electromagnetic torque tweezers: a versatile approach for measurement of single-molecule twist and torque.

PubMed

Janssen, Xander J A; Lipfert, Jan; Jager, Tessa; Daudey, Renier; Beekman, Jaap; Dekker, Nynke H

2012-07-11

The well-established single-molecule force-spectroscopy techniques have recently been complemented by methods that can measure torque and twist directly, notably magnetic torque tweezers and the optical torque wrench. A limitation of the current torque measurement schemes is the intrinsic coupling between the force and torque degrees of freedom. Here we present electromagnetic torque tweezers (eMTT) that combine permanent and electromagnets to enable independent control of the force and torsional trap stiffness for sensitive measurements of single molecule torque and twist. Using the eMTT, we demonstrate sensitive torque measurements on tethered DNA molecules from simple tracking of the beads' (x,y)-position, obviating the need for any angular tracking algorithms or markers. Employing the eMTT for high-resolution torque measurements, we experimentally confirm the theoretically predicted torque overshoot at the DNA buckling transition in high salt conditions. We envision that the flexibility and control afforded by the eMTT will enable a range of new torque and twist measurement schemes from single-molecules to living cells.

Vertical velocity and turbulence aspects during Mistral events as observed by UHF wind profilers