Sample records for underdoped high tc

  1. Possible effect of oxygen content on the under-doped characteristics of the La2- xSrxCuO4+ δ compound

    NASA Astrophysics Data System (ADS)

    Zhang, Huanbo; Sato, Hiroshi; Liedl, Gerald L.

    1994-12-01

    The effect of oxygen non-stoichiometry on the superconducting characteristics of the La2- xSrxCuO4+ δ compound in the underdoped region ( x<0.16) is reassessed. Although superconductivity in the La2- xSrxCuO4+ δ compound can be unambiguously attributed to the holes in the CuO 2 sheet in the structure, the hole content (ϱ sh) cannot be regarded as equal to the Sr content, x, as was frequently assumed. The parabolic relation between Tc and x for La2- xSrxCuO4+ δ is shown to not fully represent the intrinsic relation between Tc and hole content for the p-type high- Tc cuprates, but to be related to the variation of oxygen non-stoichiometry in the under-doped region. It is demonstrated that the intrinsic relation of Tc vs. ϱ sh can be derived from the parabolic Tc- x relation in the under-doped region of this system, and vice versa, provided that the variation of oxygen content with x is properly taken into account.

  2. Charge Order and Superconductivity in Underdoped YBa2 Cu3 O7 -δ under Pressure

    NASA Astrophysics Data System (ADS)

    Putzke, Carsten; Ayres, Jake; Buhot, Jonathan; Licciardello, Salvatore; Hussey, Nigel E.; Friedemann, Sven; Carrington, Antony

    2018-03-01

    In underdoped cuprates, an incommensurate charge density wave (CDW) order is known to coexist with superconductivity. A dip in Tc at the hole doping level where the CDW is strongest (np≃0.12 ) suggests that CDW order may suppress superconductivity. We investigate the interplay of charge order with superconductivity in underdoped YBa2 Cu3 O7 -δ by measuring the temperature dependence of the Hall coefficient RH(T ) at high magnetic field and at high hydrostatic pressure. We find that, although pressure increases Tc by up to 10 K at 2.6 GPa, it has very little effect on RH(T ). This suggests that pressure, at these levels, only weakly affects the CDW and that the increase in Tc with pressure cannot be attributed to a suppression of the CDW. We argue, therefore, that the dip in Tc at np≃0.12 at ambient pressure is probably not caused by the CDW formation.

  3. The robustness of high-Tc superconductivity in underdoped YBa2Cu3O6+x investigated in under strong magnetic fields

    NASA Astrophysics Data System (ADS)

    Harrison, Neil; Hsu, Y.-T.; Hartstein, M.; Chan, M.; Porras, J.; Loew, T.; Le Tacon, M.; Lonzarich, G.; Keimer, B.; Flux, V.; Sebastian, S.

    A central unresolved mystery in high-Tc superconductivity is whether the pairing amplitude is small in the underdoped regime and relates to the superfluid density or whether it is large and relate to the intrinsic energy scales of the Mott insulating parent state. The magnetic field provides a sensitive probe of the pairing amplitude. However, experimental probes of the extent of the vortex state in temperature and magnetic field have thus far been indirect and hence subject to debate. Here we report measurements over a broad range of temperature and magnetic fields which we use to probe the extent of the vortex region in underdoped YBa2Cu3O6+x. and its interplay with quantum oscillations. N.H. acknowledges UU DOE BES Support for ''Science of 100 Tesla''.

  4. Unified electronic phase diagram for hole-doped high- Tc cuprates

    NASA Astrophysics Data System (ADS)

    Honma, T.; Hor, P. H.

    2008-05-01

    We have analyzed various characteristic temperatures and energies of hole-doped high- Tc cuprates as a function of a dimensionless hole-doping concentration (pu) . Entirely based on the experimental grounds, we construct a unified electronic phase diagram (UEPD), where three characteristic temperatures ( T∗ ’s) and their corresponding energies ( E∗ ’s) converge as pu increases in the underdoped regime. T∗ ’s and E∗ ’s merge together with the Tc curve and 3.5kBTc curve at pu˜1.1 in the overdoped regime, respectively. They finally go to zero at pu˜1.3 . The UEPD follows an asymmetric half-dome-shaped Tc curve, in which Tc appears at pu˜0.4 , reaches a maximum at pu˜1 , and rapidly goes to zero at pu˜1.3 . The asymmetric half-dome-shaped Tc curve is at odds with the well-known symmetric superconducting dome for La2-xSrxCuO4 (SrD-La214), in which two characteristic temperatures and energies converge as pu increases and merge together at pu˜1.6 , where Tc goes to zero. The UEPD clearly shows that pseudogap phase precedes and coexists with high temperature superconductivity in the underdoped and overdoped regimes, respectively. It is also clearly seen that the upper limit of high- Tc cuprate physics ends at a hole concentration that equals to 1.3 times the optimal doping concentration for almost all high- Tc cuprate materials and 1.6 times the optimal doping concentration for the SrD-La214. Our analysis strongly suggests that pseudogap is a precursor of high- Tc superconductivity, the observed quantum critical point inside the superconducting dome may be related to the end point of UEPD, and the normal state of the underdoped and overdoped high temperature superconductors cannot be regarded as a conventional Fermi liquid phase.

  5. Synthesis and superconductivity of highly underdoped HgBa2CuO4+δ

    NASA Astrophysics Data System (ADS)

    Edwards, P. P.; Gameson, I.; Fletcher, A.; Peacock, G. B.

    1998-05-01

    The highest transition temperature superconductors are found within the complex homologous series HgBa2Can-1CunO2n+2+δ (n=1-7), with the third member, HgBa2Ca2Cu3O8+δ possessing the record-high transition temperature (Tc) of 135 K at room pressure. The first member of this family, HgBa2CuO4+δ having a Tc of up to 97 K, displays the highest transition temperature for any analogous compounds with a single copper-layer. The chemical reaction for the formation of this material is intrinsically complex due to the natural high volatility of mercury-bearing compounds; chemical synthesis has been postulated to proceed via a solid-vapour reaction. With this in mind, we have developed a mixed solid/vapour phase synthesis for HgBa2CuO4+δ using what one might term a `remote' source of mercury, in this case elemental Hg itself. Interestingly, because of the zero oxidation state of elemental mercury in the reagent mixture, the synthesis reaction proceeds under reducing conditions. By this route, a highly underdoped state (Tc<=35 K) of the superconducting phase HgBa2CuO4+δ is readily obtained. This level of underdoping is extremely difficult to achieve by more conventional synthetic routes. We comment on the unusually high oxygen affinity of the resulting underdoped compound, in relation to other cuprate superconductors, and the implied mobility of oxygen defects within the crystal structure.

  6. The rate of quasiparticle recombination probes the onset of coherence in cuprate superconductors.

    PubMed

    Hinton, J P; Thewalt, E; Alpichshev, Z; Mahmood, F; Koralek, J D; Chan, M K; Veit, M J; Dorow, C J; Barišić, N; Kemper, A F; Bonn, D A; Hardy, W N; Liang, Ruixing; Gedik, N; Greven, M; Lanzara, A; Orenstein, J

    2016-04-13

    In the underdoped copper-oxides, high-temperature superconductivity condenses from a nonconventional metallic "pseudogap" phase that exhibits a variety of non-Fermi liquid properties. Recently, it has become clear that a charge density wave (CDW) phase exists within the pseudogap regime. This CDW coexists and competes with superconductivity (SC) below the transition temperature Tc, suggesting that these two orders are intimately related. Here we show that the condensation of the superfluid from this unconventional precursor is reflected in deviations from the predictions of BSC theory regarding the recombination rate of quasiparticles. We report a detailed investigation of the quasiparticle (QP) recombination lifetime, τqp, as a function of temperature and magnetic field in underdoped HgBa2CuO(4+δ) (Hg-1201) and YBa2Cu3O(6+x) (YBCO) single crystals by ultrafast time-resolved reflectivity. We find that τqp(T) exhibits a local maximum in a small temperature window near Tc that is prominent in underdoped samples with coexisting charge order and vanishes with application of a small magnetic field. We explain this unusual, non-BCS behavior by positing that Tc marks a transition from phase-fluctuating SC/CDW composite order above to a SC/CDW condensate below. Our results suggest that the superfluid in underdoped cuprates is a condensate of coherently-mixed particle-particle and particle-hole pairs.

  7. The rate of quasiparticle recombination probes the onset of coherence in cuprate superconductors

    PubMed Central

    Hinton, J. P.; Thewalt, E.; Alpichshev, Z.; Mahmood, F.; Koralek, J. D.; Chan, M. K.; Veit, M. J.; Dorow, C. J.; Barišić, N.; Kemper, A. F.; Bonn, D. A.; Hardy, W. N.; Liang, Ruixing; Gedik, N.; Greven, M.; Lanzara, A.; Orenstein, J.

    2016-01-01

    In the underdoped copper-oxides, high-temperature superconductivity condenses from a nonconventional metallic ”pseudogap” phase that exhibits a variety of non-Fermi liquid properties. Recently, it has become clear that a charge density wave (CDW) phase exists within the pseudogap regime. This CDW coexists and competes with superconductivity (SC) below the transition temperature Tc, suggesting that these two orders are intimately related. Here we show that the condensation of the superfluid from this unconventional precursor is reflected in deviations from the predictions of BSC theory regarding the recombination rate of quasiparticles. We report a detailed investigation of the quasiparticle (QP) recombination lifetime, τqp, as a function of temperature and magnetic field in underdoped HgBa2CuO4+δ (Hg-1201) and YBa2Cu3O6+x (YBCO) single crystals by ultrafast time-resolved reflectivity. We find that τqp(T ) exhibits a local maximum in a small temperature window near Tc that is prominent in underdoped samples with coexisting charge order and vanishes with application of a small magnetic field. We explain this unusual, non-BCS behavior by positing that Tc marks a transition from phase-fluctuating SC/CDW composite order above to a SC/CDW condensate below. Our results suggest that the superfluid in underdoped cuprates is a condensate of coherently-mixed particle-particle and particle-hole pairs. PMID:27071712

  8. Separation of charge-order and magnetic QCPs in heavy fermions and high Tc cuprates

    NASA Astrophysics Data System (ADS)

    Harrison, Neil

    2010-03-01

    The Fermi surface topology of high temperature superconductors inferred from magnetic quantum oscillation measurements provides clues for the origin of unconventional pairing thus previously not accessed by other spectroscopy techniques. While the overdoped regime of the high Tc phase diagram has a large Fermi surface consistent with bandstructure calculations, the underdoped regime of YBa2Cu2O6+x is found to be composed of small pockets. There is considerable debate as to whether the small observed ``pocket'' is hole-like or electron-like- whether the Fermi surface is best described by a t-J model or a conventional band folding picture- whether or not a Fermi liquid description applies- or- whether bilayer coupling splits the degeneracy of the observed pockets. We (myself and collaborators) have now collected an extensive body of experimental data that brings this debate to rest, but raises new questions about the nature of itinerant magnetism in underdoped high Tc cuprates. Quantum oscillation measurements are performed on multiple samples in magnetic fields extending to 85 T, temperatures between 30 mK (dilution fridge in dc fields to 45 T) and 18 K, over a range of hole dopings and with samples rotated in-situ about multiple axes with respect to the magnetic field. We perform a topographical map of the Fermi surface, enabling the in-plane shape of one of the pockets to be determined- imposing stringent constraints on the origin of the Fermi surface. While quantum oscillations measurements are consistent with a topological Fermi surface change associated with magnetism near optimal doping, they also point to a secondary instability deep within the underdoped regime beneath a high Tc superconducting sub-dome. An steep upturn in the quasiparticle effective mass is observed on underdoping, suggestive of a quantum critical point near x= 0.46 separating the metallic regime (composed of small pockets) from a more underdoped insulating charge-ordered regime (earlier reported in neutron scattering measurements). Our findings suggest the importance of two critical instabilities affecting the Fermi surface beneath the high Tc superconducting dome(s). While one of these has been proposed to provide the likely origin of unconventional pairing in the cuprates, the other can be an important factor in boosting transition temperatures. [4pt] This work is supported by the DoE BES grant ``Science in 100 T''. The author would like to thank collaborators S. E. Sebastian, C. H. Mielke, P. A. Goddard, M. M. Altarawneh, R. Liang, D. A. Bonn, W. N. Hardy and G. G. Lonzarich, and supporting staff at the National High Magnetic Field Laboratory (NHMFL). Quantum oscillation experiments are performed at the NHMFL, which is funded by the NSF with support from the DoE and State of Florida.

  9. Doping-evolution of the superconducting gap in single crystals of (Ca 1-x La x ) 10 (Pt 3 As 8 )(Fe 2 As 2 ) 5 superconductor from London penetration depth measurements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cho, K.; Tanatar, M. A.; Ni, N.

    2014-09-19

    The doping-evolution of the superconducting gap structure in iron-based superconductor (Ca 1-xLax)10(Pt3As8)(Fe2As2)5(x = 0.04, 0.06, 0.09, 0.11, and 0.18) was probed by high-resolution measurements of the London penetration depth, λ(T). The samples spanned compositions from underdoped to slightly overdoped with superconducting critical temperatures, Tc, from 12.7 K (x = 0.04) through (optimal) 23.3 K (x = 0.11) to 21.9 K (x = 0.18). The low-temperature variation (up to 0.3 Tc ) of λ(T) was analysed using a power-law function, Δλ = ATn. For compositions close to the optimal doping, (x = 0.09, 0.11, and 0.18), characterized by Tc > 20K,more » Δλ(T) shows a tendency to saturation, indicative of a full gap on the Fermi surface. Fitting over the lowest temperature range (T < 0.1 Tc) gives n = 2.6. This value is well outside the range 1 ≤ n ≤ 2 expected for the line-nodal superconductor. The exponent n decreased to n ~ 2 in the two most underdoped compositions x = 0.04 (Tc = 12.7 K) and 0.06 (Tc = 18.2 K), implying the development of a notable gap anisotropy revealed by the enhanced influence of pair-breaking scattering. This decrease is accompanied by a significant increase of the total variation of the penetration depth Δλ in a fixed temperature interval (e.g., Tmin - 0.3Tc). Both the decrease of the exponent and the increase of the absolute value of Δλ in the underdoped regime are similar to the observations in other charge-doped iron-based superconductors, such as doped BaFe2As2 and NaFeAs, suggesting a universal behavior in iron-based superconductors.« less

  10. Quantum oscillation signatures of spin-orbit interactions controlling the residual nodal bilayer-splitting in underdoped high-Tc cuprates

    NASA Astrophysics Data System (ADS)

    Harrison, Neil; Shekhter, Arkady

    2015-03-01

    We investigate the origin of the small residual nodal bilayer-splitting in the underdoped high-Tc superconductor YBa2Cu3O6+x using the results of recently published angle-resolved quantum oscillation data [Sebastian et al., Nature 511, 61 (2014)]. A crucial clue to the origin of the residual bilayer-splitting is found to be provided by the anomalously small Zeeman-splitting of some of the observed cyclotron orbits. We show that such an anomalously Zeeman-splitting (or small effective g-factor) for a subset of orbits can be explained by spin-orbit interactions, which become significant in the nodal regions as a result of the vanishing bilayer coupling. The primary effect of spin-orbit interactions is to cause quasiparticles traversing the nodal region of the Brillouin zone to undergo a spin flip. We suggest that the Rashba-like spin-orbit interactions, naturally present in bilayer systems, have the right symmetry and magnitude to give rise to a network of coupled orbits consistent with experimental observations in underdoped YBa2Cu3O6+x. This work is supported by the DOEm BES proposal LANLF100, while the magnet lab is supported by the NSF and Florida State.

  11. Entropy of vortex cores near the superconductor-insulator transition in an underdoped cuprate.

    PubMed

    Capan, C; Behnia, K; Hinderer, J; Jansen, A G M; Lang, W; Marcenat, C; Marin, C; Flouquet, J

    2002-02-04

    We present a study of Nernst effect in underdoped La(2-x)Sr(x)CuO4 in magnetic fields as high as 28 T. At high fields, a sizable Nernst signal was found to persist in the presence of a field-induced nonmetallic resistivity. By simultaneously measuring resistivity and the Nernst coefficient, we extract the entropy of vortex cores in the vicinity of this field-induced superconductor-insulator transition. Moreover, the temperature dependence of the thermoelectric Hall angle provides strong constraints on the possible origins of the finite Nernst signal above T(c), as recently discovered by Xu et al. [Nature (London) 406, 486 (2000)].

  12. On the important role of the anti-Jahn-Teller effect in underdoped cuprate superconductors

    NASA Astrophysics Data System (ADS)

    Kamimura, Hiroshi; Matsuno, Shunichi; Mizokawa, Takashi; Sasaoka, Kenji; Shiraishi, Kenji; Ushio, Hideki

    2013-04-01

    In this paper it is shown that the "anti-Jahn-Teller effect" plays an essential role in giving rise to a small Fermi surface of Fermi pockets above Tc and d-wave superconductivity below Tc in underdoped cuprates. In the first part of the present paper, we review the latest developments of the model proposed by Kamimura and Suwa, which bears important characteristics born from the interplay of Jahn-Teller Physics and Mott Physics. It is shown that the feature of Fermi surfaces in underdoped LSCO is the Fermi pockets in the nodal region constructed by doped holes under the coexistence of a metallic state and of the local antiferromagnetic order. In the antinodal region in the momentum space, there are no Fermi surfaces. Then it is discussed that the phonon-involved mechanism based on the Kamimura-Suwa model leads to the d-wave superconductivity. In particular, it is shown that the origin of strong electron-phonon interactions in cuprates is due to the anti-Jahn-Teller effect. In the second part a recent theoretical result on the energy distribution curves (EDCs) of angle-resolved photoemission spectroscopy (ARPES) below Tc is discussed. It is shown that the feature of ARPES profiles of underdoped cuprates consists of a coherent peak in the nodal region and the real transitions of photoexcited electrons from occupied states below the Fermi level to a free-electron state above the vacuum level in the antinodal region, where the latter transitions form a broad hump. From this feature, the origin of the two distinct gaps observed by ARPES is elucidated without introducing the concept of the pseudogap. Finally, a remark is made on the phase diagram of underdoped cuprates.

  13. Correlation between superfluid density and T(C) of underdoped YBa2Cu3O6+x near the superconductor-insulator transition.

    PubMed

    Zuev, Yuri; Kim, Mun Seog; Lemberger, Thomas R

    2005-09-23

    We report measurements of the ab-plane superfluid density n(s) (magnetic penetration depth lambda) of heavily underdoped films of YBa2Cu3O6+x, with T(C)'s from 6 to 50 K. We find the characteristic length for vortex unbinding transition equal to the film thickness, suggesting strongly coupled CuO2 layers. At the lowest dopings, T(C) is as much as 5 times larger than the upper limit set by the 2D Kosterlitz-Thouless-Berezinskii transition temperature calculated for individual CuO2 bilayers. Our main finding is that T(C) is not proportional to n(s)(0); instead, we find T(C) proportional to ns(1/2.3+/-0.4). This conflicts with a popular point of view that quasi-2D thermal phase fluctuations determine the transition temperature.

  14. Towards a complete Fermi surface in underdoped high Tc superconductors

    NASA Astrophysics Data System (ADS)

    Harrison, Neil

    The discovery of magnetic quantum oscillations in underdoped high Tc superconductors raised many questions, and initiated a quest to understand the origin of the Fermi surface the like of which had not been seen since the very first discovery of quantum oscillations in elemental bismuth. While studies of the Fermi surface of materials are today mostly assisted by computer codes for calculating the electronic band structure, this was not the case in the underdoped high Tc materials. The Fermi surface was shown to reconstructed into small pockets, yet there was no hint of a viable order parameter. Crucial clues to understanding the origin of the Fermi surface were provided by the small value of the observed Fermi surface cross-section, the negative Hall coefficient and the small electronic heat capacity at high magnetic fields. We also know that the magnetic fields were likely to be too weak to destroy the pseudogap and that vortex pinning effects could be seen to persist to high magnetic fields at low temperatures. I will show that the Fermi surface that appears to fit best with the experimental observations is a small electron pocket formed by connecting the nodal `Fermi arcs' seen in photoemission experiments, corresponding to a density-wave state with two different orthogonal ordering vectors. The existence of such order has subsequently been detected by x-ray scattering experiments, thereby strengthening the case for charge ordering being responsible for reconstructing the Fermi surface. I will discuss new efforts to understand the relationship between the charge ordering and the pseudogap state, discussing the fate of the quasiparticles in the antinodal region and the dimensionality of the Fermi surface. The author acknowledges contributions from Suchitra Sebastian, Brad Ramshaw, Mun Chan, Yu-Te Hsu, Mate Hartstein, Gil Lonzarich, Beng Tan, Arkady Shekhter, Fedor Balakirev, Ross McDonald, Jon Betts, Moaz Altarawneh, Zengwei Zhu, Chuck Mielke, James Day, Doug Bonn, Ruixing Liang, Walter Hardy. Supported by BES ``Science of 100 tesla'' program.

  15. Doping evolution of the second magnetization peak and magnetic relaxation in (B a1 -xKx ) F e2A s2 single crystals

    NASA Astrophysics Data System (ADS)

    Liu, Yong; Zhou, Lin; Sun, Kewei; Straszheim, Warren E.; Tanatar, Makariy A.; Prozorov, Ruslan; Lograsso, Thomas A.

    2018-02-01

    We present a thorough study of doping dependent magnetic hysteresis and relaxation characteristics in single crystals of (B a1 -xKx ) F e2A s2 (0.18 ≤x ≤1 ). The critical current density Jc reaches maximum in the underdoped sample x =0.26 and then decreases in the optimally doped and overdoped samples. Meanwhile, the magnetic relaxation rate S rapidly increases and the flux creep activation barrier U0 sharply decreases in the overdoped sample x =0.70 . These results suggest that vortex pinning is very strong in the underdoped regime, but it is greatly reduced in the optimally doped and overdoped regime. Transmission electron microscope (TEM) measurements reveal the existence of dislocations and inclusions in all three studied samples x =0.38 , 0.46, and 0.65. An investigation of the paramagnetic Meissner effect (PME) suggests that spatial variations in Tc become small in the samples x =0.43 and 0.46, slightly above the optimal doping levels. Our results support that two types of pinning sources dominate the (B a1 -xKx ) F e2A s2 crystals: (i) strong δl pinning, which results from the fluctuations in the mean free path l and δ Tc pinning from the spatial variations in Tc in the underdoped regime, and (ii) weak δ Tc pinning in the optimally doped and overdoped regime.

  16. Universal optimal hole-doping concentration in single-layer high-temperature cuprate superconductors

    NASA Astrophysics Data System (ADS)

    Honma, T.; Hor, P. H.

    2006-09-01

    We argue that in cuprate physics there are two types, hole content per CuO2 plane (Ppl) and the corresponding hole content per unit volume (P3D), of hole-doping concentrations for addressing physical properties that are two dimensional (2D) and three dimensional (3D) in nature, respectively. We find that the superconducting transition temperature (Tc) varies systematically with P3D as a superconducting 'dome' with a universal optimal hole-doping concentration of P3Dopt = 1.6 × 1021 cm-3 for single-layer high-temperature superconductors. We suggest that P3Dopt determines the upper bound of the electronic energy of underdoped single-layer high-Tc cuprates.

  17. Quasiparticle properties at microwave frequencies in the underdoped YBa2Cu3O7-δ thin films

    NASA Astrophysics Data System (ADS)

    Hsing, Lai

    2004-03-01

    Microstrip ring resonators with quality factor (Q) over 10^4 at temperature 5 K were fabricated using the double-side YBa_2Cu_3O_7-δ (YBCO) films deposited on LaAlO3 (LAO) substrates. By placing a narrow gap in the ring resonator, the original fundamental resonating mode (3.61 GHz) splits into two modes (1.80 GHz and 5.33 GHz) with distinct resonating frequencies. The samples allow us to determine the temperature and the frequency dependences of penetration depth and microwave conductivity for various underdoped-cuprates by using Drude formula and the modified two-fluid model. The natures of the order parameter of high-Tc superconductivity in the underdoped cases are shown to be of d-wave type in an exact manner. In particular, the Fermi-liquid correction factor α ^2 and the vertex correction factor β from the model, proposed by Wen and Lee, can be estimated that α ^2 is doping independent in the underdoped regime and β decreases as oxygen content is decreasing in our experiment data. All these results are independent of frequencies as well. The results reveal that the interaction between quasiparticles is insensitive dependence of the impurity concentrations due to oxygen deficiency on the CuO chain and the impurity potential for forward scattering approaches the same as back scattering with more oxygen deficiency.

  18. Twenty years of talking past each other: The theory of high Tc

    NASA Astrophysics Data System (ADS)

    Anderson, Philip W.

    2007-09-01

    In 1988, the outline of an essentially correct theory of the high Tc cuprates was published by two groups, Zhang et al. in Zurich and Kotliar et al. in the US, based on earlier suggestions. The rather startling experimental predictions: that the gap would be real d-wave with nodes; that the gap would greatly increase with underdoping; that Tc would exhibit a dome terminating linearly around x = 30%; were so bizarre that these papers gathered little attention from others, including myself and at least 8 other Nobel prize-winners, and as they came to be substantiated one by one nobody much noticed that fact until the method was revived a dozen years later by Paramekanti et al. and Sorella et al. I will discuss some recent achievements and generalizations of these methods.

  19. Metal-insulator quantum critical point beneath the high Tc superconducting dome.

    PubMed

    Sebastian, Suchitra E; Harrison, N; Altarawneh, M M; Mielke, C H; Liang, Ruixing; Bonn, D A; Hardy, W N; Lonzarich, G G

    2010-04-06

    An enduring question in correlated systems concerns whether superconductivity is favored at a quantum critical point (QCP) characterized by a divergent quasiparticle effective mass. Despite such a scenario being widely postulated in high T(c) cuprates and invoked to explain non-Fermi liquid transport signatures, experimental evidence is lacking for a critical divergence under the superconducting dome. We use ultrastrong magnetic fields to measure quantum oscillations in underdoped YBa(2)Cu(3)O(6+x), revealing a dramatic doping-dependent upturn in quasiparticle effective mass at a critical metal-insulator transition beneath the superconducting dome. Given the location of this QCP under a plateau in T(c) in addition to a postulated QCP at optimal doping, we discuss the intriguing possibility of two intersecting superconducting subdomes, each centered at a critical Fermi surface instability.

  20. Quantum oscillations and nodal pockets from Fermi surface reconstruction in the underdoped cuprates

    NASA Astrophysics Data System (ADS)

    Harrison, Neil

    2012-02-01

    Fermiology in the underdoped high Tc cuprates presents us with unique challenges, requiring experimentalists to look deeper into the data than is normally required for clues. Recent measurements of an oscillatory chemical potential affecting the oscillations at high magnetic fields provide a strong indication of a single type of carrier pocket. When considered in conjunction with photoemission and specific heat measurements, a Fermi surface comprised almost entirely of nodal pockets is suggested. The mystery of the Fermi surface is deepened, however, by a near doping-independent Fermi surface cross-sectional area and negative Hall and Seebeck coefficients. We explore ways in which these findings can be reconciled, taking an important hint from the diverging effective mass yielded by quantum oscillations at low dopings. The author wishes to thank Suchitra Sebastian, Moaz Atarawneh, Doug Bonn, Walter Hardy, Ruixing Liang, Charles Mielke and Gilbert Lonzarich who have contributed to this work. The work is supported by the NSF through the NHMFL and by the DOE project ``Science at 100 tesla.''

  1. The pseudogap and the unusual excitations in the optical conductivity of Bi2Sr2CaCu2O8+δ material

    NASA Astrophysics Data System (ADS)

    Bhuiyan, E. H.; Azzouz, M.

    2017-12-01

    We studied the optical conductivity of Bi2Sr2CaCu2O8+δ material as a function of temperature and doping within the Rotating Antiferromagnetism Theory (RAFT). The optical conductivity of the material is studied from underdoped to overdoped regime for a wide range of temperatures. We mainly focused on the pseudogap state and unusual excitations in the optical conductivity. The former is realized in the underdoped to optimally doped regimes below a characteristic temperature T*, a temperature that can appreciably exceed the superconducting transition temperature TC. The latter is appeared in the optical conductivity spectra below the TC and we studied it by varying temperature. The pseudogap response is explored by changing the doping level and by varying the temperature from above to below T*. The results obtained from theories are compared with available experimental data and found a good agreement with those experimental results.

  2. Designing heterostructures with higher-temperature superconductivity

    NASA Astrophysics Data System (ADS)

    Le Hur, Karyn; Chung, Chung-Hou; Paul, I.

    2011-07-01

    We propose to increase the superconducting transition temperature Tc of strongly correlated materials by designing heterostructures which exhibit a high pairing energy as a result of magnetic fluctuations. More precisely, applying an effective theory of the doped Mott insulator, we envisage a bilayer Hubbard system where both layers exhibit intrinsic intralayer (intraband) d-wave superconducting correlations. Introducing a finite asymmetry between the hole densities of the two layers such that one layer becomes slightly more underdoped and the other more overdoped, we show a visible enhancement of Tc compared to the optimally doped isolated layer. Using the bonding and antibonding band basis, we show that the mechanism behind this enhancement of Tc is the interband pairing correlation mediated by the hole asymmetry which strives to decrease the paramagnetic nodal contribution to the superfluid stiffness. For two identical layers, Tc remains comparable to that of the isolated layer until moderate values of the interlayer single-particle tunneling term. These heterostructures shed new light on fundamental questions related to superconductivity.

  3. Annealing Effects on the Normal-State Resistive Properties of Underdoped Cuprates

    NASA Astrophysics Data System (ADS)

    Vovk, R. V.; Khadzhai, G. Ya.; Nazyrov, Z. F.; Kamchatnaya, S. N.; Feher, A.; Dobrovolskiy, O. V.

    2018-05-01

    The influence of room-temperature annealing on the parameters of the basal-plane electrical resistance of underdoped YBa_2Cu_3O_{7-δ } and HoBa_2Cu_3O_{7-δ } single crystals in the normal and superconducting states is investigated. The form of the derivatives dρ (T)/dT makes it possible to determine the onset temperature of the fluctuation conductivity and indicates a nonuniform distribution of the labile oxygen. Annealing has been revealed to lead to a monotonic decrease in the oxygen deficiency, that primarily manifests itself as a decrease in the residual resistance, an increase of T_c, and a decrease in the Debye temperature.

  4. A universal order underlying the pseudogap regime of the underdoped high Tc cuprates

    NASA Astrophysics Data System (ADS)

    Harrison, Neil

    2014-03-01

    A major achievement in condensed matter physics in the last quarter century has been a step towards the understanding of the unconventional d-wave superconducting state in the copper-oxide materials. Surprisingly, the normal state out of which the superconducting state emerges remains a mystery at low charge carrier densities, i.e., in the underdoped regime. This regime is of particular interest because it is characterised by an unusual momentum dependent energy pseudogap in the excitation spectrum that has defied explanation and is key to a full understanding of the unconventional d-wave superconducting state. I will present new quantum oscillation experimental results within the pseudogap regime of the high Tc superconductors YBa2Cu3O6+x and YBa2Cu4O8 which now extend up to the optimally-doped regime. These data reveal the evolution of the Fermi surface approaching the putative quantum critical point under the superconducting dome. A comprehensive angle-resolved study of the Fermi surface enables us to unambiguously identify a specific form of order that accounts for the observed quantum oscillations as well as other spectroscopic, transport and thermodynamic probes within the pseudogap regime. The author would like to thank B. Ramshaw, S. Sebastian, F. Balakirev, C. Mielke, M. Altarawneh, P. Goddard, S. Sabok, B. Babrowski, D. Bonn, W. Hardy, R. Liang and G. Lonzarich. This work was supported by the DOE BES ``Science of 100 tesla'' project and by the NSF and Florida State.

  5. Atomic substitution in selected high-temperature superconductors: Elucidating the nature of Raman spectra excitations

    NASA Astrophysics Data System (ADS)

    Hewitt, Kevin Cecil

    2000-10-01

    In this thesis, the effects of atomic substitution on the vibrational and electronic excitations found in the Raman spectra of selected high-temperature superconductors (HTS) are studied. In particular, atomic and isotopic substitution methods have been used to determine the character of features observed in the Raman spectra of Bi2Sr2Ca n-1CunO2 n+4+delta (n = 1 - Bi2201, n = 2 - Bi2212) and YBa2Cu3O7-delta (Y123). In Bi2201, Pb substitution for Bi (and Sr) has led to the reduction and eventual removal of the structural modulation, characteristic of all members of the Bi-family of HTS. The high quality single crystals and our sensitive triple spectrometer enabled identification of a pair of low frequency modes. The modes are determined to arise from shear and compressional rigid-layer vibrations. The normal state of underdoped cuprates is characterized by a pseudogap of unknown origin. In crystals of underdoped Bi2212 a spectral peak found at 590 cm-1, previously attributed to the pairing of quasiparticles (above Tc) and hence to the formation of a normal state pseudogap, has been found to soften by 3.8% with oxygen isotope exchange. In addition, the feature is absent in fully oxygenated and yttrium underdoped crystals. In this study, the first of its kind on underdoped and isotope substituted Bi2212, the feature has been assigned to stretching vibrations of oxygen in the a-b plane. Bi2212 crystals with varying hole concentrations (0.07 < p < 0.23) were studied to investigate the effects of doping on the symmetry and magnitude of the superconducting gap. Electronic Raman scattering experiments that sample the diagonal (B 2g) and principal axes (B1 g) of the BZ have led us to conclude that the superconducting gap possesses dx2-y2 symmetry, in the underdoped and overdoped regimes. It is found that the magnitude of the superconducting gap (Delta(k)) is sensitive to changes in p. Studies of the pair-breaking peak found in the B1g spectra allow us to conclude that the magnitude of the maximum gap (Deltamax) decreases monotonically with increasing hole doping, for p > 0.13. The pair-breaking effects in Bi2212 have also been compared to the doping dependence of Delta(k) in the widely studied compound Y123. (Abstract shortened by UMI.)

  6. What is strange about high-temperature superconductivity in cuprates?

    NASA Astrophysics Data System (ADS)

    Božović, I.; He, X.; Wu, J.; Bollinger, A. T.

    2017-10-01

    Cuprate superconductors exhibit many features, but the ultimate question is why the critical temperature (Tc) is so high. The fundamental dichotomy is between the weak-pairing, Bardeen-Cooper-Schrieffer (BCS) scenario, and Bose-Einstein condensation (BEC) of strongly-bound pairs. While for underdoped cuprates it is hotly debated which of these pictures is appropriate, it is commonly believed that on the overdoped side strongly-correlated fermion physics evolves smoothly into the conventional BCS behavior. Here, we test this dogma by studying the dependence of key superconducting parameters on doping, temperature, and external fields, in thousands of cuprate samples. The findings do not conform to BCS predictions anywhere in the phase diagram.

  7. Pseudogap temperature T* of cuprate superconductors from the Nernst effect

    NASA Astrophysics Data System (ADS)

    Cyr-Choinière, O.; Daou, R.; Laliberté, F.; Collignon, C.; Badoux, S.; LeBoeuf, D.; Chang, J.; Ramshaw, B. J.; Bonn, D. A.; Hardy, W. N.; Liang, R.; Yan, J.-Q.; Cheng, J.-G.; Zhou, J.-S.; Goodenough, J. B.; Pyon, S.; Takayama, T.; Takagi, H.; Doiron-Leyraud, N.; Taillefer, Louis

    2018-02-01

    We use the Nernst effect to delineate the boundary of the pseudogap phase in the temperature-doping phase diagram of hole-doped cuprate superconductors. New data for the Nernst coefficient ν (T ) of YBa2Cu3Oy (YBCO), La1.8 -xEu0.2SrxCuO4 (Eu-LSCO), and La1.6 -xNd0.4SrxCuO4 (Nd-LSCO) are presented and compared with previously published data on YBCO, Eu-LSCO, Nd-LSCO, and La2 -xSrxCuO4 (LSCO). The temperature Tν at which ν /T deviates from its high-temperature linear behavior is found to coincide with the temperature at which the resistivity ρ (T ) deviates from its linear-T dependence, which we take as the definition of the pseudogap temperature T★—in agreement with the temperature at which the antinodal spectral gap detected in angle-resolved photoemission spectroscopy (ARPES) opens. We track T★ as a function of doping and find that it decreases linearly vs p in all four materials, having the same value in the three LSCO-based cuprates, irrespective of their different crystal structures. At low p ,T★ is higher than the onset temperature of the various orders observed in underdoped cuprates, suggesting that these orders are secondary instabilities of the pseudogap phase. A linear extrapolation of T★(p ) to p =0 yields T★(p →0 ) ≃TN (0), the Néel temperature for the onset of antiferromagnetic order at p =0 , suggesting that there is a link between pseudogap and antiferromagnetism. With increasing p ,T★(p ) extrapolates linearly to zero at p ≃pc 2 , the critical doping below which superconductivity emerges at high doping, suggesting that the conditions which favor pseudogap formation also favor pairing. We also use the Nernst effect to investigate how far superconducting fluctuations extend above the critical temperature Tc, as a function of doping, and find that a narrow fluctuation regime tracks Tc, and not T★. This confirms that the pseudogap phase is not a form of precursor superconductivity, and fluctuations in the phase of the superconducting order parameter are not what causes Tc to fall on the underdoped side of the Tc dome.

  8. Evidence for three-dimensional XY critical properties in underdoped YBa2Cu3O7-δ

    NASA Astrophysics Data System (ADS)

    Schneider, T.

    2007-05-01

    We perform a detailed analysis of the reversible magnetization data of Salem-Sugui and Babíc of underdoped and optimally doped YBa2Cu3O7-δ single crystals. Near the zero field transition temperature we observe extended consistency with the properties of the three-dimensional XY universality class, even though the attained critical regime is limited by an inhomogeneity induced finite size effect. Nevertheless, as Tc falls from 93.5to41.5K , the critical amplitude of the in-plane correlation length ξab0 , the anisotropy γ=ξab0/ξc0 and the critical amplitude of the in-plane penetration depth λab0 increase substantially, while the critical amplitude of the c -axis correlation length ξc0 does not change much. As a consequence, the correlation volume Vcorr- increases and the critical amplitude of the specific heat singularity A- decreases dramatically, while the rise of λab0 reflects the behavior of the zero temperature counterpart. Conversely, although ξab0 and λab0 increase with reduced Tc , the ratio λab0/ξab0- , corresponding to the Ginzburg-Landau parameter κab , decreases substantially and YBa2Cu3O7-δ crosses over from an extreme to a weak type-II superconductor.

  9. The effect of charge transfer fluctuation on superconductivity in high temperature superconductors

    NASA Astrophysics Data System (ADS)

    Liu, Yihsuan; Wu, Huan-Kuang; Lee, Ting-Kuo

    H i g h - Tc Cuprates have been studied quite often as an effective one band t - J model that neglects charge fluctuation between oxygen 2p6 band and copper 3d10 band, and Zhang-Rice singlet is just a hole in the model. However, recent Scanning Tunneling Spectra(STS) measurement on underdoped Cuprate shows that charge transfer gap is only of order 12 eV. This small gap necessitates a re-examination of the charge transfer fluctuation. Here we modify the t-J model by including charge transfer fluctuation allowing the formation of doubly occupied sites. For certain parameters it is similar with the t-J-U model. This model is studied via variational Monte Carlo method(VMC). Our result shows that this model can give a unified behavior of superconducting dome with different long rang hopping parameters. The anti-correlation between charge transfer gap and pairing is also confirmed. More interestingly the charge fluctuation is found to affect pairing order parameter in different ways in underdoped and overdoped regions. This work is partially supported by Taiwan Ministry of Science and Technology with Grant. MOST 105-2112-M-001-008 and calculation was supported by a National Center of High Performance Computing in Taiwan.

  10. The electronic structure of the high-TC cuprates within the hidden rotating order

    NASA Astrophysics Data System (ADS)

    Azzouz, M.; Ramakko, B. W.; Presenza-Pitman, G.

    2010-09-01

    The doping dependence of the Fermi surface and energy distribution curves of the high-TC cuprate materials La2 - xSrxCuO4 and Bi2Sr2CaCu2O8 + δ are analyzed within the rotating antiferromagnetism theory. Using three different quantities; the k-dependent occupation probability, the spectral function, and the chemical potential (energy spectra), the Fermi surface is calculated and compared to experimental data for La2 - xSrxCuO4. The Fermi surface we calculate evolves from hole-like pockets in the underdoped regime to large electron-like contours in the overdoped regime. This is in agreement with recent findings by Sebastian et al for the α-pocket of Y Ba2Cu3O6 + x (2010 Phys. Rev. B 81 214524). In addition, the full width at half maximum of the energy distribution curves is found to behave linearly with their peak position in agreement with experiment for Bi2Sr2CaCu2O8 + δ. The effect of scattering on both the Fermi surface and energy distribution curves is examined.

  11. dc Resistivity of Quantum Critical, Charge Density Wave States from Gauge-Gravity Duality

    NASA Astrophysics Data System (ADS)

    Amoretti, Andrea; Areán, Daniel; Goutéraux, Blaise; Musso, Daniele

    2018-04-01

    In contrast to metals with weak disorder, the resistivity of weakly pinned charge density waves (CDWs) is not controlled by irrelevant processes relaxing momentum. Instead, the leading contribution is governed by incoherent, diffusive processes which do not drag momentum and can be evaluated in the clean limit. We compute analytically the dc resistivity for a family of holographic charge density wave quantum critical phases and discuss its temperature scaling. Depending on the critical exponents, the ground state can be conducting or insulating. We connect our results to dc electrical transport in underdoped cuprate high Tc superconductors. We conclude by speculating on the possible relevance of unstable, semilocally critical CDW states to the strange metallic region.

  12. dc Resistivity of Quantum Critical, Charge Density Wave States from Gauge-Gravity Duality.

    PubMed

    Amoretti, Andrea; Areán, Daniel; Goutéraux, Blaise; Musso, Daniele

    2018-04-27

    In contrast to metals with weak disorder, the resistivity of weakly pinned charge density waves (CDWs) is not controlled by irrelevant processes relaxing momentum. Instead, the leading contribution is governed by incoherent, diffusive processes which do not drag momentum and can be evaluated in the clean limit. We compute analytically the dc resistivity for a family of holographic charge density wave quantum critical phases and discuss its temperature scaling. Depending on the critical exponents, the ground state can be conducting or insulating. We connect our results to dc electrical transport in underdoped cuprate high T_{c} superconductors. We conclude by speculating on the possible relevance of unstable, semilocally critical CDW states to the strange metallic region.

  13. Broken rotational symmetry on the Fermi surface of a high-Tc superconductor

    DOE PAGES

    Ramshaw, B. J.; Harrison, N.; Sebastian, S. E.; ...

    2017-02-13

    Broken fourfold rotational (C 4) symmetry is observed in the experimental properties of several classes of unconventional superconductors. It has been proposed that this symmetry breaking is important for superconducting pairing in these materials, but in the high-T c cuprates this broken symmetry has never been observed on the Fermi surface. Here we report a pronounced anisotropy in the angle dependence of the interlayer magnetoresistance of the underdoped high transition temperature (high-T c) superconductor YBa 2Cu 3O 6.58, directly revealing broken C 4 symmetry on the Fermi surface. Moreover, we demonstrate that this Fermi surface has C 2 symmetry ofmore » the type produced by a uniaxial or anisotropic density-wave phase. This establishes the central role of C 4 symmetry breaking in the Fermi surface reconstruction of YBa 2Cu 3O 6+δ , and suggests a striking degree of universality among unconventional superconductors.« less

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beales, T.P.; Parberry, J.M.

    (Bi{sub 0.33}Cd{sub 0.67})Sr{sub 2}YCu{sub 2}O{sub 7{minus}{delta}} can be synthesized single phase by XRD, between 800 and 950 C. It has a tetragonal structure, space group P4/mmm, and lattice parameters a = 3.802 {angstrom} and c = 11.96 {angstrom}. The Cd site can be fully replaced with an appropriate M{sup 11} ion and the Y site can be chemically substituted up to 100% by lanthanide ions with ionic radii falling between those of Nd and Gd, with a measurable shift in a and c axis lattice parameters. As synthesized, (Bi{sub 0.33}Cd{sub 0.67})Sr{sub 2}YCu{sub 2}O{sub 7{minus}{delta}} is semiconducting and paramagnetic down tomore » 4 K. Superconductivity can be induced by a post-synthesis annealing in high pressure oxygen to give {Tc} = 40 K. Thermopower measurements show that the material is underdoped with S{sub 290K} = 50 {mu}VK{sup {minus}1}. Introduction of extra charge carriers to raise {Tc} by doping Ca on the Y site is not chemically possible with the synthesis techniques used.« less

  15. Quasiparticle recombination dynamics in the model cuprate superconductor HgBa2CuO4+δ

    NASA Astrophysics Data System (ADS)

    Hinton, J. P.; Thewalt, E.; Koralek, J. D.; Orenstein, J.; Barisic, N.; Xhao, X.; Chan, M.; Dorow, C.; Veit, M.; Ji, L.; Greven, M.

    2014-03-01

    The cuprate family of high temperature superconductors is characterized by a variety of electronic phases which emerge when charge carriers are added to the antiferromagnetic parent compound. The structural simplicity of the single layer cuprate system HgBa2CuO4+δ (Hg1201) is advantageous for experimentally detecting subtle features of these phases. In this work, we investigate the recombination dynamics of photo-excited quasiparticles in Hg1201 as a function of doping, temperature, and magnetic field using pump-probe optical reflectivity. We observe two distinct onset temperatures above TC in the underdoped part of the phase diagram, corresponding to T* and T** as observed in transport and neutron scattering experiments. We also measure a suppression of the recombination rate near TC which peaks at 8% hole concentration. We associate this suppression with coherence effects. Lastly, we observe a complex, non-monotonic temperature dependence in the dynamics around optimal doping, providing evidence for reentrant phase transitions near the apex of the superconducting dome. Work supported by DOE-BES

  16. Effects of electron irradiation on resistivity and London penetration depth of Ba1-xKxFe2As2 (x <= 0.34) iron-pnictide superconductor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cho, K; Konczykowski, M; Murphy, Jason

    2014-09-01

    Irradiation with 2.5 MeV electrons at doses up to 5.2×1019 electrons/cm2 was used to introduce pointlike defects in single crystals of Ba1-xKxFe2As2 with x=0.19 (Tc=14K),0.26 (Tc=32K), 0.32 (Tc=37K), and 0.34 (Tc=39K) to study the superconducting gap structure by probing the effect of nonmagnetic scattering on electrical resistivity ρ(T) and London penetration depth λ(T). For all compositions, the irradiation suppressed the superconducting transition temperature Tc and increased resistivity. The low-temperature behavior of λ(T) is best described by the power-law function, Δλ(T)=A(T/Tc)n. While substantial suppression of Tc supports s± pairing, in samples close to the optimal doping, x=0.26, 0.32, and 0.34, themore » exponent n remained high (n≥3), indicating almost exponential attenuation and thus a robust full superconducting gap. For the x=0.19 composition, which exhibits coexistence of superconductivity and long-range magnetism, the suppression of Tc was much more rapid, and the exponent n decreased toward the s± dirty limit of n=2. In this sample, the irradiation also suppressed the temperature of structural/magnetic transition Tsm from 103 to 98 K, consistent with the itinerant nature of the long-range magnetic order. Our results suggest that underdoped compositions, especially in the coexisting regime, are most susceptible to nonmagnetic scattering and imply that in multiband Ba1-xKxFe2As2 superconductors, the ratio of the interband to intraband pairing strength, as well as the related gap anisotropy, increases upon the departure from the optimal doping.« less

  17. Stripe order in the underdoped region of the two-dimensional Hubbard model

    NASA Astrophysics Data System (ADS)

    Zheng, Bo-Xiao; Chung, Chia-Min; Corboz, Philippe; Ehlers, Georg; Qin, Ming-Pu; Noack, Reinhard M.; Shi, Hao; White, Steven R.; Zhang, Shiwei; Chan, Garnet Kin-Lic

    2017-12-01

    Competing inhomogeneous orders are a central feature of correlated electron materials, including the high-temperature superconductors. The two-dimensional Hubbard model serves as the canonical microscopic physical model for such systems. Multiple orders have been proposed in the underdoped part of the phase diagram, which corresponds to a regime of maximum numerical difficulty. By combining the latest numerical methods in exhaustive simulations, we uncover the ordering in the underdoped ground state. We find a stripe order that has a highly compressible wavelength on an energy scale of a few kelvin, with wavelength fluctuations coupled to pairing order. The favored filled stripe order is different from that seen in real materials. Our results demonstrate the power of modern numerical methods to solve microscopic models, even in challenging settings.

  18. STM/STS study on electronic superstructures in the superconducting state of high-Tc cuprate Bi2Sr2CaCu2O8+δ

    NASA Astrophysics Data System (ADS)

    Mizuta, S.; Kurosawa, T.; Takeyama, K.; Momono, N.; Ishii, Y.; Yoshida, H.; Oda, M.; Ido, M.

    2018-03-01

    We report STM/STS measurements at 8 K in underdoped Bi2Sr2CaCu2O8+δ crystals (T c = 76 K and hole-doping level p ∼ 0.12) whose energy spectra around the Fermi level are characterized by a two-gap structure consisting of spatially inhomogeneous pseudogap (PG) and comparatively homogeneous superconducting gap (SCG). Two electronic superstructures, checkerboard modulation (CBM) and Cu-O-Cu bond-centered modulation (BCM), are observed with mapping spectral weights at low energies within the SCG and the ratio of spectral weights at ±ΔPG (PG energy), respectively. On the basis of the present findings, we suggest that the lower-energy scale CBM is an intrinsic property of Cu-O planes and can coexist with the BCM whose characteristic energy is ∼ΔPG in identical regions in real space.

  19. Strongly suppressed proximity effect and ferromagnetism in topological insulator/ferromagnet/superconductor thin film trilayers of Bi2Se3/SrRuO3/underdoped YBa2Cu3O x : a possible new platform for Majorana nano-electronics

    NASA Astrophysics Data System (ADS)

    Koren, Gad

    2018-07-01

    We report properties of a topological insulator–ferromagnet–superconductor trilayers comprised of thin films of 20 nm thick {Bi}}2{Se}}3 on 10 nm SrRuO3 on 30 nm {YBa}}2{Cu}}3{{{O}}}x. As deposited trilayers are underdoped and have a superconductive transition with {{T}}{{c}} onset at 75 K, zero resistance at 65 K, {{T}}Cueri} at 150 K and {{T}}* of about 200 K. Further reannealing under vacuum yields the 60 K phase of {YBa}}2{Cu}}3{{{O}}}x which still has zero resistance below about 40 K. Only when 10 × 100 microbridges were patterned in the trilayer, some of the bridges showed resistive behavior all the way down to low temperatures. Magnetoresistance versus temperature of the superconductive ones showed the typical peak due to flux flow against pinning below {{T}}{{c}}, while the resistive ones showed only the broad leading edge of such a peak. All this indicates clearly weak-link superconductivity in the resistive bridges between superconductive {YBa}}2{Cu}}3{{{O}}}x grains via the topological and ferromagnetic cap layers. Comparing our results to those of a reference trilayer (RTL) with the topological {Bi}}2{Se}}3 layer substituted by a non-superconducting highly overdoped {La}}1.65{Sr}}0.35{CuO}}4, indicates that the superconductive proximity effect as well as ferromagnetism in the topological trilayer are actually strongly suppressed compared to the non-topological RTL. This strong suppression could originate in lattice and Fermi levels mismatch as well as in short coherence length and unfavorable effects of strong spin–orbit coupling in {Bi}}2{Se}}3 on the d-wave pairing of {YBa}}2{Cu}}3{{{O}}}x. Proximity induced edge currents in the SRO/YBCO layer could lead to Majorana bound states, a possible signature of which is observed in the present study as zero bias conductance peaks.

  20. Calorimetric determination of the magnetic phase diagram of underdoped ortho II YBa2Cu3O6.54 single crystals

    PubMed Central

    Marcenat, C.; Demuer, A.; Beauvois, K.; Michon, B.; Grockowiak, A.; Liang, R.; Hardy, W.; Bonn, D. A.; Klein, T.

    2015-01-01

    The recent discovery of a charge order in underdoped YBa2Cu3Oy raised the question of the interplay between superconductivity and this competing phase. Understanding the normal state of high-temperature superconductors is now an essential step towards the description of the pairing mechanism in those materials and determining the upper critical field is therefore of fundamental importance. We present here a calorimetric determination of the field–temperature phase diagram in underdoped YBa2Cu3Oy single crystals. We show that the specific heat saturates in high magnetic fields. This saturation is consistent with a normal state without any significant superconducting contribution and a total Sommerfeld coefficient γN∼6.5±1.5 mJ mol−1 K−2 putting strong constraints on the theoretical models for the Fermi surface reconstruction. PMID:26294047

  1. Superconductor to Mott insulator transition in YBa2Cu3O7/LaCaMnO3 heterostructures.

    PubMed

    Gray, B A; Middey, S; Conti, G; Gray, A X; Kuo, C-T; Kaiser, A M; Ueda, S; Kobayashi, K; Meyers, D; Kareev, M; Tung, I C; Liu, Jian; Fadley, C S; Chakhalian, J; Freeland, J W

    2016-09-15

    The superconductor-to-insulator transition (SIT) induced by means such as external magnetic fields, disorder or spatial confinement is a vivid illustration of a quantum phase transition dramatically affecting the superconducting order parameter. In pursuit of a new realization of the SIT by interfacial charge transfer, we developed extremely thin superlattices composed of high Tc superconductor YBa2Cu3O7 (YBCO) and colossal magnetoresistance ferromagnet La0.67Ca0.33MnO3 (LCMO). By using linearly polarized resonant X-ray absorption spectroscopy and magnetic circular dichroism, combined with hard X-ray photoelectron spectroscopy, we derived a complete picture of the interfacial carrier doping in cuprate and manganite atomic layers, leading to the transition from superconducting to an unusual Mott insulating state emerging with the increase of LCMO layer thickness. In addition, contrary to the common perception that only transition metal ions may respond to the charge transfer process, we found that charge is also actively compensated by rare-earth and alkaline-earth metal ions of the interface. Such deterministic control of Tc by pure electronic doping without any hindering effects of chemical substitution is another promising route to disentangle the role of disorder on the pseudo-gap and charge density wave phases of underdoped cuprates.

  2. Competing Quantum Orderings in Cuprate Superconductors:

    NASA Astrophysics Data System (ADS)

    Martin, I.; Ortiz, G.; Balatsky, A. V.; Bishop, A. R.

    We present a minimal model for cuprate superconductors. At the unrestricted mean-field level, the model produces homogeneous superconductivity at large doping, striped superconductivity in the underdoped regime and various antiferromagnetic phases at low doping and for high temperatures. On the underdoped side, the superconductor is intrinsically inhomogeneous and global phase coherence is achieved through Josephson-like coupling of the superconducting stripes. The model is applied to calculate experimentally measurable ARPES spectra.

  3. Fluctuation conductivity of oxygen underdoped YBa2Cu3O7-δ single crystals

    NASA Astrophysics Data System (ADS)

    Vovk, R. V.; Khadzhai, G. Ya.; Goulatis, I. L.; Chroneos, A.

    2014-03-01

    The electrical resistance in the range of ТC-300 K in the layer planes of YВа2Сu3О7-δ single crystals with a range of oxygen deficiency (providing a range of TC from 78 to 92 K) was investigated. The experimental data is approximated by an expression that accounts for the scattering of electrons on phonons, as well as on defects and the fluctuation conductivity in a 3-D model of the Aslamazov-Larkin theory. According to this approximation, depending upon the oxygen deficiency, the Debye temperature varies from 245 to 400 K, coherence length ξС(0)≈0.5 Å.

  4. Doping dependence of the anisotropic quasiparticle interference in NaFe(1-x)Co(x)As iron-based superconductors.

    PubMed

    Cai, Peng; Ruan, Wei; Zhou, Xiaodong; Ye, Cun; Wang, Aifeng; Chen, Xianhui; Lee, Dung-Hai; Wang, Yayu

    2014-03-28

    We use scanning tunneling microscopy to investigate the doping dependence of quasiparticle interference (QPI) in NaFe1-xCoxAs iron-based superconductors. The goal is to study the relation between nematic fluctuations and Cooper pairing. In the parent and underdoped compounds, where fourfold rotational symmetry is broken macroscopically, the QPI patterns reveal strong rotational anisotropy. At optimal doping, however, the QPI patterns are always fourfold symmetric. We argue this implies small nematic susceptibility and, hence, insignificant nematic fluctuation in optimally doped iron pnictides. Since TC is the highest this suggests nematic fluctuation is not a prerequistite for strong Cooper pairing.

  5. Isotope shift of the 590-cm-1 Raman feature in underdoped Bi2Sr2CaCu2O8+δ

    NASA Astrophysics Data System (ADS)

    Hewitt, K. C.; Wang, N. L.; Irwin, J. C.; Pooke, D. M.; Pantoja, A. E.; Trodahl, H. J.

    1999-10-01

    Raman-scattering studies have been performed on underdoped Bi2Sr2CaCu2O8+δ. In single crystals underdoped by oxygen removal, a 590-cm-1 peak is observed in the B1g spectrum. The feature is observed to soften in frequency by 3.8% with isotopic exchange of 16O by 18O. In contrast, the 590-cm-1 peak is not observed in crystals underdoped by Y substitution which suggests that it is a vibrational mode activated by oxygen deficency. We have also found that underdoping leads to a depletion of low-energy spectral weight from regions of the Fermi surface located near the Brillouin-zone axes.

  6. The 590 cm-1 B_1g feature in underdoped Bi_2Sr_2CaCu_2O_8+δ

    NASA Astrophysics Data System (ADS)

    Hewitt, Kevin C.; Wang, N. L.; Irwin, J. C.; Pooke, D. M.; Pantoja, A. E.; Trodahl, H. J.

    1999-05-01

    Raman scattering studies have been performed on underdoped Bi_2Sr_2CaCu_2O_8+δ. In single crystals underdoped by oxygen removal, a 590 cm-1 peak is observed in the B_1g spectrum. The feature is observed to soften in frequency by 3.8% with isotopic exchange of ^16O by ^18O. In contrast, the 590 cm-1 peak is not observed in crystals underdoped by Y substitution which suggests that it corresponds to a disorder induced vibrational mode. We have also found that underdoping leads to a depletion of low energy spectral weight from regions of the Fermi surface located near the Brillouin zone axes.

  7. High field charge order across the phase diagram of YBa2Cu3Oy

    NASA Astrophysics Data System (ADS)

    Laliberté, Francis; Frachet, Mehdi; Benhabib, Siham; Borgnic, Benjamin; Loew, Toshinao; Porras, Juan; Le Tacon, Mathieu; Keimer, Bernhard; Wiedmann, Steffen; Proust, Cyril; LeBoeuf, David

    2018-03-01

    In hole-doped cuprates there is now compelling evidence that inside the pseudogap phase, charge order breaks translational symmetry. In YBa2Cu3Oy charge order emerges in two steps: a 2D order found at zero field and at high temperature inside the pseudogap phase, and a 3D order that is superimposed below the superconducting transition Tc when superconductivity is weakened by a magnetic field. Several issues still need to be addressed such as the effect of disorder, the relationship between those charge orders and their respective impact on the Fermi surface. Here, we report high magnetic field sound velocity measurements of the 3D charge order in underdoped YBa2Cu3Oy in a large doping range. We found that the 3D charge order exists over the same doping range as its 2D counterpart, indicating an intimate connection between the two distinct orders. Moreover, our data suggest that 3D charge order has only a limited impact on low-lying electronic states of YBa2Cu3Oy.

  8. Competing quantum orderings in cuprate superconductors: A minimal model

    NASA Astrophysics Data System (ADS)

    Martin, I.; Ortiz, G.; Balatsky, A. V.; Bishop, A. R.

    2001-02-01

    We present a minimal model for cuprate superconductors. At the unrestricted mean-field level, the model produces homogeneous superconductivity at large doping, striped superconductivity in the underdoped regime and various antiferromagnetic phases at low doping and for high temperatures. On the underdoped side, the superconductor is intrinsically inhomogeneous and global phase coherence is achieved through Josephson-like coupling of the superconducting stripes. The model is applied to calculate experimentally measurable ARPES spectra.

  9. Anisotropy of the penetration depth in La2-xSrxCuO4 in underdoped and overdoped regions

    NASA Astrophysics Data System (ADS)

    Zaleski, A. J.; Klamut, J.

    1999-12-01

    We present the results of measurements of the penetration depth anisotropy in pulverized, ceramic La2-xSrxCuO4. The measurements were carried out for x = 0.08, 0.1, 0.125, 0.15 and 0.2. The powdered samples, immersed in wax, were magnetically oriented in a static magnetic field of 10 T. The penetration depth in the a-b plane, icons/Journals/Common/lambda" ALT="lambda" ALIGN="TOP"/>ab, and perpendicular to it, icons/Journals/Common/lambda" ALT="lambda" ALIGN="TOP"/>icons/Journals/Common/perp" ALT="perp" ALIGN="MIDDLE"/>, were derived from alternating-current susceptibility measurements. For underdoped samples they both vary linearly with temperature (for the low-temperature region), while for the samples from the overdoped region the measured points can be fitted by an exponential function. These results support Uemura's picture (Uemura Y J 1997 Physica C 282-287 194) of crossover from Bose-Einstein condensation to a Bardeen-Cooper-Schrieffer mechanism of superconductivity. The penetration depth values extrapolated to T = 0 may be described by a quadratic function of the strontium concentration (for both icons/Journals/Common/lambda" ALT="lambda" ALIGN="TOP"/>ab and icons/Journals/Common/lambda" ALT="lambda" ALIGN="TOP"/>icons/Journals/Common/perp" ALT="perp" ALIGN="MIDDLE"/>). The anisotropy of the penetration depth as a function of the substitution shows a similar dependence to the critical temperature Tc(x).

  10. The overdoped region of the high Tc superconducting Bi2212 revisited

    NASA Astrophysics Data System (ADS)

    Zaki, N.; Yang, H.-B.; Rameau, J. D.; Johnson, P. D.; Claus, H.; Hinks, D. G.

    High-resolution angle-resolved photoemission (ARPES) is used to probe the temperature dependence of the gaps observed in the antinodal region of the Fermi surface (FS) in overdoped Bi2212. In particular we study samples with doping levels greater than 0.19, the latter having previously been determined to be the doping level associated with a Fermi surface reconstruction. Careful simulation of the measured ARPES spectra indicates that any gap observed in this region of the FS at these doping levels is a reflection of the range of superconducting gaps associated with inhomogeneities observed in STM studies of the same systems. With this observation we are able to reexamine the phase diagram associated with the Bi2212 system and discuss the origin of the pseudogap associated with the underdoped region. This work is supported in part by the Center for Emergent Superconductivity (CES), an EFRC funded by the U.S. DOE. The work is also supported in part by the U.S. DOE under Contract No. DE-AC02- 98CH10886 at BNL and Contract No. DE-AC02-06CH11357 at ANL.

  11. Superconductivity, pairing symmetry, and disorder in the doped topological insulator Sn1 -xInxTe for x ≥0.10

    NASA Astrophysics Data System (ADS)

    Smylie, M. P.; Claus, H.; Kwok, W.-K.; Louden, E. R.; Eskildsen, M. R.; Sefat, A. S.; Zhong, R. D.; Schneeloch, J.; Gu, G. D.; Bokari, E.; Niraula, P. M.; Kayani, A.; Dewhurst, C. D.; Snezhko, A.; Welp, U.

    2018-01-01

    The temperature dependence of the London penetration depth Δ λ (T ) in the superconducting doped topological crystalline insulator Sn1 -xInxTe was measured down to 450 mK for two different doping levels, x ≈0.45 (optimally doped) and x ≈0.10 (underdoped), bookending the range of cubic phase in the compound. The results indicate no deviation from fully gapped BCS-like behavior, eliminating several candidate unconventional gap structures. Critical field values below 1 K and other superconducting parameters are also presented. The introduction of disorder by repeated particle irradiation with 5 MeV protons does not enhance Tc, indicating that ferroelectric interactions do not compete with superconductivity.

  12. Competing Quantum Orderings in Cuprate Superconductors: A Minimal Model

    NASA Astrophysics Data System (ADS)

    Martin, Ivar; Ortiz, Gerardo; Balatsky, A. V.; Bishop, A. R.

    2001-03-01

    We present a minimal model for cuprate superconductors. At the unrestricted mean-field level, the model produces homogeneous superconductivity at large doping, striped superconductivity in the underdoped regime and various antiferromagnetic phases at low doping and for high temperatures. On the underdoped side, the superconductor is intrinsically inhomogeneous and global phase coherence is achieved through Josephson-like coupling of the superconducting stripes. The model is applied to calculate experimentally measurable ARPES spectra, and local density of states measurable by STM.

  13. Nernst effect in electron-doped Pr2-xCexCuO4

    NASA Astrophysics Data System (ADS)

    Balci, Hamza; Hill, C. P.; Qazilbash, M. M.; Greene, R. L.

    2003-08-01

    The Nernst effect of Pr2-xCexCuO4 (x=0.13, 0.15, and 0.17) has been measured on thin film samples between 5 120 K and 0 14 T. In comparison to recent measurements on hole-doped cuprates that showed an anomalously large Nernst effect above the resistive Tc and Hc2 [Z. A. Xu et al., Nature (London) 406, 486 (2000); Yayu Wang et al., Phys. Rev. B 64, 224519 (2001); Yayu Wang et al., Phys. Rev. Lett. 88, 257003 (2002); C. Caplan et al., ibid 88, 056601 (2002)], we find a normal Nernst effect above Tc and Hc2 for all dopings. The lack of an anomalous Nernst effect in the electron-doped compounds supports the models that explain this effect in terms of amplitude and phase fluctuations in the hole-doped cuprates. In addition, the Hc2(T) determined from the Nernst effect shows a conventional behavior for all dopings. The energy gap determined from Hc2(0) decreases as the system goes from underdoping to overdoping in agreement with the recent tunneling experiments.

  14. Superconductor to Mott insulator transition in YBa 2Cu 3O 7/LaCaMnO 3 heterostructures

    DOE PAGES

    Gray, B. A.; Middey, S.; Conti, G.; ...

    2016-09-15

    The superconductor-to-insulator transition (SIT) induced by means such as external magnetic fields, disorder or spatial confinement is a vivid illustration of a quantum phase transition dramatically affecting the superconducting order parameter. In this paper, in pursuit of a new realization of the SIT by interfacial charge transfer, we developed extremely thin superlattices composed of high Tc superconductor YBa 2Cu 3O 7 (YBCO) and colossal magnetoresistance ferromagnet La 0.67Ca 0.33MnO 3 (LCMO). By using linearly polarized resonant X-ray absorption spectroscopy and magnetic circular dichroism, combined with hard X-ray photoelectron spectroscopy, we derived a complete picture of the interfacial carrier doping inmore » cuprate and manganite atomic layers, leading to the transition from superconducting to an unusual Mott insulating state emerging with the increase of LCMO layer thickness. In addition, contrary to the common perception that only transition metal ions may respond to the charge transfer process, we found that charge is also actively compensated by rare-earth and alkaline-earth metal ions of the interface. Finally, such deterministic control of Tc by pure electronic doping without any hindering effects of chemical substitution is another promising route to disentangle the role of disorder on the pseudo-gap and charge density wave phases of underdoped cuprates.« less

  15. “Nodal Gap” induced by the incommensurate diagonal spin density modulation in underdoped high- T c superconductors

    DOE PAGES

    Zhou, Tao; Gao, Yi; Zhu, Jian -Xin

    2015-03-07

    Recenmore » tly it was revealed that the whole Fermi surface is fully gapped for several families of underdoped cuprates. The existence of the finite energy gap along the d -wave nodal lines (nodal gap) contrasts the common understanding of the d -wave pairing symmetry, which challenges the present theories for the high- T c superconductors. Here we propose that the incommensurate diagonal spin-density-wave order can account for the above experimental observation. The Fermi surface and the local density of states are also studied. Our results are in good agreement with many important experiments in high- T c superconductors.« less

  16. Fragile charge order in the nonsuperconducting ground state of the underdoped high-temperature superconductors.

    PubMed

    Tan, B S; Harrison, N; Zhu, Z; Balakirev, F; Ramshaw, B J; Srivastava, A; Sabok-Sayr, S A; Sabok, S A; Dabrowski, B; Lonzarich, G G; Sebastian, Suchitra E

    2015-08-04

    The normal state in the hole underdoped copper oxide superconductors has proven to be a source of mystery for decades. The measurement of a small Fermi surface by quantum oscillations on suppression of superconductivity by high applied magnetic fields, together with complementary spectroscopic measurements in the hole underdoped copper oxide superconductors, point to a nodal electron pocket from charge order in YBa2Cu3(6+δ). Here, we report quantum oscillation measurements in the closely related stoichiometric material YBa2Cu4O8, which reveals similar Fermi surface properties to YBa2Cu3(6+δ), despite the nonobservation of charge order signatures in the same spectroscopic techniques, such as X-ray diffraction, that revealed signatures of charge order in YBa2Cu3(6+δ). Fermi surface reconstruction in YBa2Cu4O8 is suggested to occur from magnetic field enhancement of charge order that is rendered fragile in zero magnetic fields because of its potential unconventional nature and/or its occurrence as a subsidiary to more robust underlying electronic correlations.

  17. Anomalous electron doping independent two-dimensional superconductivity

    NASA Astrophysics Data System (ADS)

    Zhou, Wei; Xing, Xiangzhuo; Zhao, Haijun; Feng, Jiajia; Pan, Yongqiang; Zhou, Nan; Zhang, Yufeng; Qian, Bin; Shi, Zhixiang

    2017-07-01

    Transition metal (Co and Ni) co-doping effects are investigated on an underdoped Ca0.94La0.06Fe2As2 compound. It is discovered that electron doping from substituting Fe with transition metal (TM = Co, Ni) can trigger high-{T}{{c}} superconductivity around 35 K, which emerges abruptly before the total suppression of the innate spin-density-wave/anti-ferromagnetism (SDW/AFM) state. Remarkably, the critical temperature for the high-{T}{{c}} superconductivity remains constant against a wide range of TM doping levels. And the net electron doping density dependence of the superconducting {T}{{c}} based on the rigid band model can be nicely scaled into a single curve for Co and Ni substitutions, in stark contrast to the case of Ba(Fe1-x TM x )2As2. This carrier density independent superconductivity and the unusual scaling behavior are presumably resulted from the interface superconductivity based on the similarity with the interface superconductivity in a La2-x Sr x CuO4-La2CuO4 bilayer. Evidence of the two-dimensional character of the superfluid by angle-resolved magneto-resistance measurements can further strengthen the interface nature of the high-{T}{{c}} superconductivity.

  18. A minimal model of striped superconductors

    NASA Astrophysics Data System (ADS)

    Martin, I.; Ortiz, G.; Balatsky, A. V.; Bishop, A. R.

    2001-12-01

    We present a minimal model of high-temperature superconductors that simultaneously supports antiferromagnetic stripes and d-wave superconductivity. At the unrestricted mean-field level, the various phases of the cuprates, including weak and strong pseudogap phases, and two different types of superconductivity in the underdoped and the overdoped regimes, find a natural interpretation. We argue that on the underdoped side, the superconductor is intrinsically inhomogeneous and global phase coherence is achieved through Josephson-like coupling of the superconducting stripes. On the overdoped side, the state is overall homogeneous and the superconductivity is of a classical BCS type.

  19. Superconductivity, Pairing Symmetry, and Disorder in the Doped Topological Insulator Sn 1-xIn xTe for x >= 0.10.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smylie, M. P.; Claus, H.; Kwok, W. -K.

    The temperature dependence of the London penetration depth Delta lambda(T) in the superconducting doped topological crystalline insulator Sn1-xInxTe was measured down to 450 mK for two different doping levels, x approximate to 0.45 (optimally doped) and x approximate to 0.10 (underdoped), bookending the range of cubic phase in the compound. The results indicate no deviation from fully gapped BCS-like behavior, eliminating several candidate unconventional gap structures. Critical field values below 1 K and other superconducting parameters are also presented. The introduction of disorder by repeated particle irradiation with 5 MeV protons does not enhance T-c, indicating that ferroelectric interactions domore » not compete with superconductivity.« less

  20. Robust s± pairing in CaK (Fe1-xNix) 4As4 (x =0 and 0.05) from the response to electron irradiation

    NASA Astrophysics Data System (ADS)

    Teknowijoyo, S.; Cho, K.; Kończykowski, M.; Timmons, E. I.; Tanatar, M. A.; Meier, W. R.; Xu, M.; Bud'ko, S. L.; Canfield, P. C.; Prozorov, R.

    2018-04-01

    Controlled pointlike disorder introduced by 2.5-MeV electron irradiation was used to probe the superconducting state of single crystals of CaK (Fe1-xNix) 4As4 superconductor at x =0 and 0.05 doping levels. Both compositions show an increase of the residual resistivity and a decrease of the superconducting transition temperature, Tc, at the rate of d Tc/d ρ (Tc) ≈0.19 K/(μ Ω cm ) for x =0 and 0.38 K/(μ Ω cm ) for x =0.05 , respectively. In the Ni-doped compound (x =0.05 ), the coexisting spin-vortex crystal (SVC) magnetic phase is suppressed at the rate of d TN/d ρ (TN) ≈ 0.16 K/(μ Ω cm ). The low-temperature variation of London penetration depth is well approximated by the power-law function, Δ λ (T ) =A Tn , with n ≈2.5 for x =0 and n ≈1.9 for x =0.05 in the pristine state. Detailed analysis of λ (T ) and Tc evolution with disorder is consistent with two effective nodeless energy gaps in the density of states due to robust s± pairing. Overall the behavior of CaK (Fe1-xNix) 4As4 at x =0 is similar to a slightly overdoped Ba1 -yKyFe2As2 at y ≈ 0.5, and at x =0.05 to an underdoped composition at y ≈ 0.2.

  1. Optimum inhomogeneity of local lattice distortions in La2CuO4+y

    PubMed Central

    Poccia, Nicola; Ricci, Alessandro; Campi, Gaetano; Fratini, Michela; Puri, Alessandro; Gioacchino, Daniele Di; Marcelli, Augusto; Reynolds, Michael; Burghammer, Manfred; Saini, Naurang Lal; Aeppli, Gabriel; Bianconi, Antonio

    2012-01-01

    Electronic functionalities in materials from silicon to transition metal oxides are, to a large extent, controlled by defects and their relative arrangement. Outstanding examples are the oxides of copper, where defect order is correlated with their high superconducting transition temperatures. The oxygen defect order can be highly inhomogeneous, even in optimal superconducting samples, which raises the question of the nature of the sample regions where the order does not exist but which nonetheless form the “glue” binding the ordered regions together. Here we use scanning X-ray microdiffraction (with a beam 300 nm in diameter) to show that for La2CuO4+y, the glue regions contain incommensurate modulated local lattice distortions, whose spatial extent is most pronounced for the best superconducting samples. For an underdoped single crystal with mobile oxygen interstitials in the spacer La2O2+y layers intercalated between the CuO2 layers, the incommensurate modulated local lattice distortions form droplets anticorrelated with the ordered oxygen interstitials, and whose spatial extent is most pronounced for the best superconducting samples. In this simplest of high temperature superconductors, there are therefore not one, but two networks of ordered defects which can be tuned to achieve optimal superconductivity. For a given stoichiometry, the highest transition temperature is obtained when both the ordered oxygen and lattice defects form fractal patterns, as opposed to appearing in isolated spots. We speculate that the relationship between material complexity and superconducting transition temperature Tc is actually underpinned by a fundamental relation between Tc and the distribution of ordered defect networks supported by the materials. PMID:22961255

  2. Valency and spin states of substituent cations in Bi2.15Sr1.85CaCu2O8+δ

    NASA Astrophysics Data System (ADS)

    Benseman, T. M.; Cooper, J. R.; Zentile, C. L.; Lemberger, L.; Balakrishnan, G.

    2011-10-01

    We studied the valency and spin behavior of M = Mn, Fe, Co, Li, and Al in the high-temperature superconducting compound Bi2.15Sr1.85Ca(Cu1-zMz)2O8+δ (Bi-2212) for small values of z. Mn, Fe, and Co retain their magnetic moments, and our thermopower and magnetic susceptibility data imply ionization states Mn3+, Fe2+, and Co2+, while Li and Al are accommodated in the charge reservoir layers. Single-crystal studies show that the susceptibility of Co2+ ions in Bi-2212 is strongly anisotropic, with a weak anisotropy detected for Mn3+ and none for Fe2+. Fits to a pseudogap formula for a pure Bi-2212 crystal suggest that the spin susceptibility of the host compound is more anisotropic than previously realized. Data in the superconducting state allow us to compare the pair-breaking properties of the different impurities. Several aspects of the data, including the stronger suppression of the superconducting transition temperature Tc by Co compared with Fe for underdoped and optimally doped samples, show that the d-level structure of the magnetic ions and multiorbital effects are important. We also find that the temperatures of the magnetization crossing points are equal to the low-field Tc values to within 1% or 2%. This agrees with a 2D thermodynamic fluctuation argument given by Junod

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chaix, L.; Ghiringhelli, G.; Peng, Y. Y.

    Experimental evidence on high-Tc cuprates reveals ubiquitous charge density wave (CDW) modulations, which coexist with superconductivity. Although the CDW had been predicted by theory, important questions remain about the extent to which the CDW influences lattice and charge degrees of freedom and its characteristics as functions of doping and temperature. These questions are intimately connected to the origin of the CDW and its relation to the mysterious cuprate pseudogap. Here, we use ultrahigh resolution resonant inelastic x-ray scattering (RIXS) to reveal new CDW character in underdoped Bi2Sr2CaCu2O8+{\\delta} (Bi2212). At low temperature, we observe dispersive excitations from an incommensurate CDW thatmore » induces anomalously enhanced phonon intensity, unseen using other techniques. Near the pseudogap temperature T*, the CDW persists, but the associated excitations significantly weaken and the CDW wavevector shifts, becoming nearly commensurate with a periodicity of four lattice constants. The dispersive CDW excitations, phonon anomaly, and temperature dependent commensuration provide a comprehensive momentum space picture of complex CDW behavior and point to a closer relationship with the pseudogap state.« less

  4. Doping - dependent anisotropy of the superconducting gap in underdoped pnictide superconductors

    NASA Astrophysics Data System (ADS)

    Prozorov, Ruslan

    2012-02-01

    The in-plane London penetration depth, δλ(T), was studied in single crystals of Ba1-xKxFe2As2 (``Ba122") and Ca10(Pt3As8)[(Fe1-xPtx)2As2]5 (``10-3-8"). Whereas in Ba122 magnetism and superconductivity coexist in the underdoped regime, the 10-3-8 compound exhibits a clear separation of two order parameters. By comparing the results obtained in these two systems, we could study general features of the superconducting gap structure as function of doping in the underdoped regime. Similar to all other pnictides, the low-temperature variation of London penetration depth exhibits a power-law behavior, δλ(T)= AT^n, in both systems. Moving towards the underdoped edge of the superconducting dome, the exponent n decreases well below scattering - limited value of n=2 and, at the same time, the pre-factor A increases. Both trends indicate an increasing anisotropy of the superconducting gap in more underdoped compounds. These and previous results suggest that the development of the superconducting gap anisotropy towards the underdoped edge of the superconducting dome is an intrinsic property of iron pnictides, similar to the known tendency on the overdoped side where magnetism and superconductivity do not interfere.[4pt] In collboration with M.A. Tanatar, H. Kim, The Ames Laboratory; Bing Shen, Hai-Hu Wen, Nanjing University; and N. Ni, R.J. Cava, Princeton University.

  5. The t J model for the oxide high-Tc superconductors

    NASA Astrophysics Data System (ADS)

    Ogata, Masao; Fukuyama, Hidetoshi

    2008-03-01

    A theoretical review is given on high temperature superconductivity in copper oxides (cuprates) by focusing on the hole doping cases based on the view that it is realized in carrier doped Mott insulators, as noted by Anderson in the initial stage. From the detailed knowledge of electronic states deduced from experiments that showed the undoped parent case is Mott insulators (charge transfer type insulators, to be precise) and that the hole doping is mainly on oxygen sites, the t-J model, as derived by Zhang and Rice, is shown to be a canonical model for hole doped cuprates and values of various parameters of the model have been assessed. Results of many different numerical methods so far obtained for this t-J model, especially the variational Monte Carlo method, have clearly indicated the stability of the \\rmd_{x^2-y^2} -wave superconductivity at absolute zero for the parameter region of actual experimental interest and the particular doping dependences of the condensation energy of superconductivity reflecting particular features of doped Mott insulators. For finite temperatures, on the other hand, the field theoretical slave-boson approximation based on the spin (spinons) and charge (holons) separations and the gauge fields as a glue combining them predicts qualitatively particular features of the existence of characteristic crossover temperatures of the spin singlet of the resonating valence bond (RVB) state, TRVB and the onset of Bose condensation of holons, TB, triggering coherent motion of electrons as convoluted particles of spinons and holons. The considerations based on the gauge field indicate that the onset temperature of superconductivity, Tc, is the lower one of these two, i.e. either TB (overdoped cases) or TRVB (underdoped cases), respectively. These characteristic features of the 'phase diagram' at finite temperatures are in overall agreement with various experimental observations, especially with the existence of spin-gap or pseudo-gap phases. In more detailed examinations of the underdoped region, the antiferromagnetic long-range order and superconductivity show a very intricate relationship at low temperatures depending on the system; they coexist as clarified in the inner layer of Hg-1245 but spin glass states intervene between them in La2-xSrxCuO4 (LSCO). It is argued that these differences can be attributed to the different degrees of disorder. Actually, theories based on the t-J model have also predicted the coexistence of antiferromagnetism and superconductivity in the ground state of clean systems. On the other hand, interesting experimental findings of large Nernst effect and 'Fermi arc' in LSCO and impurity effects in YBCO have prompted the necessity of theoretical investigations of electronic states of lightly doped Mott insulators in the presence of strong disorder.

  6. The rate of quasiparticle recombination probes the onset of coherence in cuprate superconductors

    DOE PAGES

    Hinton, J. P.; Thewalt, E.; Alpichshev, Z.; ...

    2016-04-13

    In the underdoped copper-oxides, high-temperature superconductivity condenses from a nonconventional metallic ”pseudogap” phase that exhibits a variety of non-Fermi liquid properties. Recently, it has become clear that a charge density wave (CDW) phase exists within the pseudogap regime. This CDW coexists and competes with superconductivity (SC) below the transition temperature T c, suggesting that these two orders are intimately related. Here we show that the condensation of the superfluid from this unconventional precursor is reflected in deviations from the predictions of BSC theory regarding the recombination rate of quasiparticles. We report a detailed investigation of the quasiparticle (QP) recombination lifetime,more » τ qp, as a function of temperature and magnetic field in underdoped HgBa 2CuO 4+δ (Hg-1201) and YBa 2Cu 3O 6+x (YBCO) single crystals by ultrafast time-resolved reflectivity. We find that τ qp(T) exhibits a local maximum in a small temperature window near T c that is prominent in underdoped samples with coexisting charge order and vanishes with application of a small magnetic field. We explain this unusual, non-BCS behavior by positing that T c marks a transition from phase-fluctuating SC/CDW composite order above to a SC/CDW condensate below. Lastly, our results suggest that the superfluid in underdoped cuprates is a condensate of coherently-mixed particle-particle and particle-hole pairs.« less

  7. Ong construction for the reconstructed Fermi surface of underdoped cuprates

    NASA Astrophysics Data System (ADS)

    Robinson, P.; Hussey, N. E.

    2015-12-01

    Using the Ong construction for a two-dimensional metal, we show that the sign change in the Hall coefficient RH of underdoped hole-doped cuprates at low temperature is consistent with the emergence of biaxial charge order recently proposed to explain the observation of low-frequency quantum oscillations. The sharp evolution of RH with temperature, however, can only be reconciled by incorporating a highly anisotropic quasiparticle scattering rate. The magnitude and form of the scattering rate extracted from the fitting imply that those quasiparticles at the vertices of the reconstructed pocket(s) approach the boundary of incoherence at the onset of charge order.

  8. The microscopic structure of charge density waves in underdoped YBa 2Cu 3O 6.54 revealed by x-ray diffraction

    DOE PAGES

    E. M. Forgan; Huecker, M.; Blackburn, E.; ...

    2015-12-09

    Charge density wave (CDW) order appears throughout the underdoped high-temperature cuprate superconductors, but the underlying symmetry breaking and the origin of the CDW remain unclear. We use X-ray diffraction to determine the microscopic structure of the CDWs in an archetypical cuprate YBa 2Cu 3O 6.54 at its superconducting transition temperature ~60 K. We find that the CDWs in this material break the mirror symmetry of the CuO 2 bilayers. The ionic displacements in the CDWs have two components, which are perpendicular and parallel to the CuO 2 planes, and are out of phase with each other. The planar oxygen atomsmore » have the largest displacements, perpendicular to the CuO 2 planes. Our results allow many electronic properties of the underdoped cuprates to be understood. For example, the CDWs will lead to local variations in the electronic structure, giving an explicit explanation of density-wave states with broken symmetry observed in scanning tunnelling microscopy and soft X-ray measurements.« less

  9. The microscopic structure of charge density waves in underdoped YBa2Cu3O6.54 revealed by X-ray diffraction

    NASA Astrophysics Data System (ADS)

    Forgan, E. M.; Blackburn, E.; Holmes, A. T.; Briffa, A. K. R.; Chang, J.; Bouchenoire, L.; Brown, S. D.; Liang, Ruixing; Bonn, D.; Hardy, W. N.; Christensen, N. B.; Zimmermann, M. V.; Hücker, M.; Hayden, S. M.

    2015-12-01

    Charge density wave (CDW) order appears throughout the underdoped high-temperature cuprate superconductors, but the underlying symmetry breaking and the origin of the CDW remain unclear. We use X-ray diffraction to determine the microscopic structure of the CDWs in an archetypical cuprate YBa2Cu3O6.54 at its superconducting transition temperature ~60 K. We find that the CDWs in this material break the mirror symmetry of the CuO2 bilayers. The ionic displacements in the CDWs have two components, which are perpendicular and parallel to the CuO2 planes, and are out of phase with each other. The planar oxygen atoms have the largest displacements, perpendicular to the CuO2 planes. Our results allow many electronic properties of the underdoped cuprates to be understood. For instance, the CDWs will lead to local variations in the electronic structure, giving an explicit explanation of density-wave states with broken symmetry observed in scanning tunnelling microscopy and soft X-ray measurements.

  10. Pseudogap in normal underdoped phase of Bi2212: LDA + DMFT + Σk

    NASA Astrophysics Data System (ADS)

    Nekrasov, I. A.; Kuchinskii, E. Z.; Pchelkina, Z. V.; Sadovskii, M. V.

    2007-09-01

    Pseudogap phenomena are observed for normal underdoped phase of different high- Tc cuprates. Among others Bi 2Sr 2CaCu 2O 8- δ (Bi2212) compound is one of the most studied experimentally [A. Damascelli, Z. Hussain, Z.-X. Shen, Rev. Mod. Phys. 75 (2003) 473; J.C. Campuzano, M.R. Norman, M. Randeria, in: K.H. Bennemann, J.B. Ketterson (Eds.), Physics of Superconductors, vol. 2, Springer, Berlin, 2004, p. 167; J. Fink et al., cond-mat/0512307; X.J. Zhou et al., cond-mat/0604284]. To describe pseudogap regime in Bi2212, we employ novel generalized DMFT + Σk approach [E.Z. Kuchinskii, I.A. Nekrasov, M.V. Sadovskii, JETP Lett. 82 (2005) 198; M.V. Sadovskii et al., Phys. Rev. B 72 (2005) 155105, and these proceedings, doi:10.1016/j.physc.2007.03.367]. This approach gives possibility to preserve conventional dynamical mean-field theory (DMFT) equations [A. Georges et al., Rev. Mod. Phys. 68 (1996) 13] and include an additional (momentum dependent) self-energy Σk. In the present case, Σk describes non-local dynamical correlations induced by short-ranged collective Heisenberg-like antiferromagnetic spin fluctuations [M.V. Sadovskii, Physics-Uspekhi 44 (2001) 515, cond-mat/0408489]. The effective single impurity problem in the DMFT + Σk is solved by numerical renormalization group (NRG) [R. Bulla, A.C. Hewson, Th. Pruschke, J. Phys. Cond. Mat. 10 (1998) 8365; R. Bulla, Phys. Rev. Lett. 83 (1999) 136]. To take into account material specific properties of two neighboring CuO 2 layers of Bi2212 we employ local density approximation (LDA) to calculate necessary model parameters, e.g. the values of intra- and interlayer hopping integrals between Cu-sites. Onsite Coulomb interaction U for x2- y2 orbital was calculated in constrained LDA method [O. Gunnarsson et al., Phys. Rev. B 39 (1989) 1708]. The value of pseudogap potential Δ was obtained within DMFT(NRG) [E.Z. Kuchinskii, I.A. Nekrasov, M.V. Sadovskii, JETP Lett. 82 (2005) 198; M.V. Sadovskii et al., Phys. Rev. B 72 (2005) 155105, and these proceedings, doi:10.1016/j.physc.2007.03.367]. Here, we report theoretical LDA + DMFT + Σk quasiparticle bands dispersion, Fermi surface (FS) and angular resolved photoemission (ARPES) spectra accounting for pseudogap and bilayer splitting effects for normal underdoped Bi2212 ( δ = 0.15). We show that LDA-calculated value of bilayer splitting (BS) is too small to describe experimentally observed peak-dip-hump structure. Fermi surface in presence of the pseudogap fluctuations is almost insensitive to the BS value. Results obtained are in good agreement with recent ARPES experiments.

  11. Cuprate phase diagram and the influence of nanoscale inhomogeneities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zaki, N.; Yang, H. -B.; Rameau, J. D.

    2017-11-01

    The phase diagram associated with high-Tc superconductors is complicated by an array of different ground states. The parent material represents an antiferromagnetic insulator but with doping superconductivity becomes possible with transition temperatures previously thought unattainable. The underdoped region of the phase diagram is dominated by the so-called pseudogap phenomena, whereby in the normal state the system mimics superconductivity in its spectral response but does not show the complete loss of resistivity associated with the superconducting state. An understanding of this regime presents one of the great challenges for the field. In the present study we revisit the structure of themore » phase diagram as determined in photoemission studies. By careful analysis of the role of nanoscale inhomogeneities in the overdoped region, we are able to more carefully separate out the gaps due to the pseudogap phenomena from the gaps due to the superconducting transition. Within a mean-field description, we are thus able to link the magnitude of the doping-dependent pseudogap directly to the Heisenberg exchange interaction term, J Sigma s(i)s(j), contained in the t - J model. This approach provides a clear indication that the pseudogap is associated with spin singlet formation.« less

  12. Cuprate phase diagram and the influence of nanoscale inhomogeneities

    NASA Astrophysics Data System (ADS)

    Zaki, N.; Yang, H.-B.; Rameau, J. D.; Johnson, P. D.; Claus, H.; Hinks, D. G.

    2017-11-01

    The phase diagram associated with high-Tc superconductors is complicated by an array of different ground states. The parent material represents an antiferromagnetic insulator but with doping superconductivity becomes possible with transition temperatures previously thought unattainable. The underdoped region of the phase diagram is dominated by the so-called pseudogap phenomena, whereby in the normal state the system mimics superconductivity in its spectral response but does not show the complete loss of resistivity associated with the superconducting state. An understanding of this regime presents one of the great challenges for the field. In the present study we revisit the structure of the phase diagram as determined in photoemission studies. By careful analysis of the role of nanoscale inhomogeneities in the overdoped region, we are able to more carefully separate out the gaps due to the pseudogap phenomena from the gaps due to the superconducting transition. Within a mean-field description, we are thus able to link the magnitude of the doping-dependent pseudogap directly to the Heisenberg exchange interaction term, J ∑sisj , contained in the t -J model. This approach provides a clear indication that the pseudogap is associated with spin singlet formation.

  13. Dispersive charge density wave excitations in Bi2Sr2CaCu2O8+δ

    DOE PAGES

    Chaix, L.; Ghiringhelli, G.; Peng, Y. Y.; ...

    2017-06-12

    Experimental evidence on high-Tc cuprates reveals ubiquitous charge density wave (CDW) modulations, which coexist with superconductivity. Although the CDW had been predicted by theory, important questions remain about the extent to which the CDW influences lattice and charge degrees of freedom and its characteristics as functions of doping and temperature. These questions are intimately connected to the origin of the CDW and its relation to the mysterious cuprate pseudogap. Here, we use ultrahigh resolution resonant inelastic x-ray scattering (RIXS) to reveal new CDW character in underdoped Bi2Sr2CaCu2O8+{\\delta} (Bi2212). At low temperature, we observe dispersive excitations from an incommensurate CDW thatmore » induces anomalously enhanced phonon intensity, unseen using other techniques. Near the pseudogap temperature T*, the CDW persists, but the associated excitations significantly weaken and the CDW wavevector shifts, becoming nearly commensurate with a periodicity of four lattice constants. The dispersive CDW excitations, phonon anomaly, and temperature dependent commensuration provide a comprehensive momentum space picture of complex CDW behavior and point to a closer relationship with the pseudogap state.« less

  14. Field-induced thermal metal-to-insulator transition in underdoped La(2-x)Sr(x)CuO(4+delta).

    PubMed

    Hawthorn, D G; Hill, R W; Proust, C; Ronning, F; Sutherland, Mike; Boaknin, Etienne; Lupien, C; Tanatar, M A; Paglione, Johnpierre; Wakimoto, S; Zhang, H; Taillefer, Louis; Kimura, T; Nohara, M; Takagi, H; Hussey, N E

    2003-05-16

    The transport of heat and charge in cuprates was measured in single crystals of La(2-x)Sr(x)CuO(4+delta) (LSCO) across the doping phase diagram at low temperatures. In underdoped LSCO, the thermal conductivity is found to decrease with increasing magnetic field in the T-->0 limit, in striking contrast to the increase observed in all superconductors, including cuprates at higher doping. In heavily underdoped LSCO, where superconductivity can be entirely suppressed with an applied magnetic field, we show that a novel thermal metal-to-insulator transition takes place upon going from the superconducting state to the field-induced normal state.

  15. Neutron-scattering evidence for a periodically modulated superconducting phase in the underdoped cuprate La 1.905Ba 0.095CuO 4

    DOE PAGES

    Xu, Zhijun; Stock, C.; Chi, Songxue; ...

    2014-10-01

    The role of antiferromagnetic spin correlations in high-temperature superconductors remains a matter of debate. We present inelastic neutron-scattering evidence that gapless spin fluctuations coexist with superconductivity in La 1.905Ba 0.095CuO 4. Furthermore, we observe that both the low-energy magnetic spectral weight and the spin incommensurability are enhanced with the onset of superconducting correlations. We propose that the coexistence occurs through intertwining of spatial modulations of the pair wave function and the antiferromagnetic correlations. This proposal is also directly relevant to sufficiently underdoped La 2-xSr xCuO 4 and YBa 2Cu 3O 6+x.

  16. NMR study of nematic spin fluctuations in a detwinned single crystal of underdoped Ba ( Fe 1 ₋ x Co x ) 2 As 2

    DOE PAGES

    Kissikov, T.; Dioguardi, A. P.; Timmons, E. I.; ...

    2016-10-11

    Here, we report the experimental details of how mechanical detwinning can be implemented in tandem with high-sensitivity nuclear magnetic resonance measurements and use this setup to measure the in-plane anisotropy of the spin-lattice relaxation rate in underdoped Ba(Fe 1–xCo x) 2As 2 with x = 0.048. The anisotropy reaches a maximum of 30% at TN, and the recovery data reveal that the glassy behavior of the spin fluctuations present in the twinned state persist in the fully detwinned crystal. A theoretical model is presented to describe the spin-lattice relaxation rate in terms of anisotropic nematic spin fluctuations.

  17. Rapid enhancement of nodal quasiparticle mass with heavily underdoping in Bi2212

    NASA Astrophysics Data System (ADS)

    Anzai, Hiroaki; Arita, Masashi; Namatame, Hirofumi; Taniguchi, Masaki; Ishikado, Motoyuki; Fujita, Kazuhiro; Ishida, Shigeyuki; Uchida, Shin-ichi; Ino, Akihiro

    2018-05-01

    We report substantial advance of our low-energy angle-resolved photoemission study of nodal quasiparticles in Bi2Sr2CaCu2O8+δ. The new data cover the samples from underdoped down to heavily underdoped levels. We also present the nodal Fermi velocities that determined by using an excitation-photon energy of hν = 7.0 eV over a wide doping range. The consistency between the results with hν = 8.1 and 7.0 eV allows us to rule out the effect of photoemission matrix elements. In comparison with the data previously reported, the nodal effective mass increases by a factor of ∼ 1.5 in going from optimally doped to heavily underdoped levels. We find a rapid enhancement of the nodal quasiparticle mass at low doping levels near the superconductor-to-insulator transition. The effective coupling spectrum, λ (ω) , is extracted directly from the energy derivatives of the quasiparticle dispersion and scattering rate, as a causal function of the mass enhancement factor. A steplike increase in Reλ (ω) around ∼ 65 meV is demonstrated clearly by the Kramers-Kronig transform of Imλ (ω) . To extract the low-energy renormalization effect, we calculated a simple model for the electron-boson interaction. This model reveals that the contribution of the renormalization at | ω | ≤ 15 meV to the quasiparticle mass is larger than that around 65 meV in underdoped samples.

  18. Thermodynamics of the magnetic-field-induced "normal" state in an underdoped high Tc superconductor

    NASA Astrophysics Data System (ADS)

    Riggs, Scott Chandler

    High magnetic fields are used to kill superconductivity and probe what happens to system when it cannot reach the ideal ground state, i.e. what is the normal-state ground state? Early work in High-Tc, where the application of magnetic field destroyed the zero resistance state and recovered a resistivity value that connected continuously with the zero field curve, lead people to believe this magnetic-field-induced-state had fully driven the system normal, revealing the true underlying ground state, without any vestige of superconductivity. Many experiments done in this region of phase space have results interpreted as coming from the low energy ground state excitations. With the emergence of ultra-clean crystals in a unique family of hole doped high-Tc superconductors, YBa2Cu3O 7-delta, YBCO, a new and highly unexpected phenomena of quantum oscillations were discovered, and they followed the standard Liftshitz-Kosevich (LK) theory for a normal metal. The results suddenly made the problem of high-T c appear to be analogous to superconductivity in the organics, which is brought about by a wave-vector nesting and Fermi surface reconstruction. The only problem, it appeared, that needed to be reconciled was with Angle Resolved Photo-Emission Spectroscopy (ARPES) and Scanning Tunneling Microscopy (STM) data that claimed to see no such Fermi surface, instead only "arcs", a set of disconnected segments in the Brillouin zone which quasiparticle peaks are observed at the Fermi energy, which in a mean field description does not allow for a continuous Fermi surface contour. These two discrepancies led to the "arc vs pocket" debate, which is still unresolved. The other kink in the quantum oscillation armor is that, to this date, quantum oscillations in the hole-doped cuprates have only been seen in YBCO, the only cuprate structure to have CuO chains, which conduct and are located in between two CuO2 superconducting planes in the unit cell. In an attempt to reconcile the "arc vs pocket" debate we measure specific heat on an ultra-clean de-twinned single crystal of underdoped YBCO 6.56 with a Tc = 60 K, up to fields twice irreversibility field, define as the onset of the resistive transition. The zero temperature extrapolation of the electronic contribution to the specific heat, gamma, is the total quasiparticle density of states. For a two-dimensional system with parabolic energy bands, gamma is simply the sum of each pocket multiplied by its effective mass. Therefore, by determining gamma at high fields and using previously determined values for the effective mass from quantum oscillation transport measurements we can simply play a counting game to determine the number of pockets in the Fermi surface. Furthermore, at low fields the response to the specific heat as a function of magnetic field in a d-wave superconductor is known to have a (H) dependence, and we can look for deviations from this (H) , which are expected to happen when the system is no longer in a superconducting state. Results from our specific heat experiment shed new light on the true nature of the magnetic field induced "normal" state, and should force reinterpretation of many experimental findings. The specific heat measurements foremost show a smooth evolution of gamma from low to high magnetic fields which follows a Ac (H) dependence, with the prefactor, Ac giving the correct magnitude for the anisotropy of the d-wave superconducting gap. This means with the application of magnetic fields strong enough to restore the resistive state, the superconducting gap still exits. Additionally, we see quantum oscillations that follow conventional LK formalism and can determine an effective mass uniquely, where no fitting parameters are required. Interestingly, these oscillations fit on top of the (H) finding. How can the (H) and quantum oscillation whose phenomena arise from very different physics be reconciled? Looking at our own zero field gamma value of 1.85 mJ mol-1 K-2, which is intrinsic for YBCO, allows the pocket counting game to begin. Coupling bandstructure calculations, angle dependent quantum oscillation measurements, which determine the shape of the pocket, with the zero field gamma value leads to the simplest interpretation; quantum oscillatory phenomena is a manifestation of the CuO chain and BaO insulating layer orbital hybridization band and is likely not relevant to high temperature superconductivity.

  19. Linear dichroism and the nature of charge order in underdoped cuprates

    DOE PAGES

    Norman, M. R.

    2015-04-21

    Recent experiments have addressed the nature of the charge order seen in underdoped cuprates. In this paper, I show that x-ray absorption and linear dichroism are excellent probes of such order. Ab initio calculations reveal that a d-wave charge density wave order involving the oxygen ions is a much better description of the data than alternate models.

  20. Oxygen isotope effect in disordered underdoped and overdoped La 2-xSr xCu 1-yZn yO 4 superconductors

    NASA Astrophysics Data System (ADS)

    Naqib, S. H.; Islam, R. S.

    2011-04-01

    The effect of oxygen isotopic substitution on the superconducting transition temperature has been studied for heavily underdoped and overdoped La 2-xSr xCu 1-yZn yO 4 compounds with different Zn contents in the CuO 2 plane. The effect of Zn on the isotope coefficient, α, was significantly more pronounced in the case of the underdoped ( x = 0.09) compounds compared to the overdoped ( x = 0.22) ones. The variation of α with disorder content can be described quite well within a model based solely on Cooper pair-breaking in the case of the underdoped compounds. This model fails to describe the behavior of α( y) for the overdoped samples, even though Zn still suppresses T c very effectively at this hole (Sr) content, indicating that the Zn induced pair-breaking is still very much at play. We discuss the implications of these findings in details by considering the Zn induced magnetism, stripe correlations, and possible changes in the superconducting order parameter as hole content in the CuO 2 plane, p (≡ x), is varied.

  1. Superconductor-to-insulator transition and transport properties of underdoped YBa2Cu3O(y) crystals.

    PubMed

    Semba, K; Matsuda, A

    2001-01-15

    The carrier-concentration-driven superconductor-to-insulator (SI) transition as well as transport properties in underdoped YBa2Cu3O(y) twinned crystals is studied. The SI transition takes place at y approximately 6.3, carrier concentration n(SI)H approximately 3x10(20) cm(-3), anisotropy rho(c)/rho(ab) approximately 10(3), and the threshold resistivity rho(SI)ab approximately 0.8 mOmega cm which corresponds to a critical sheet resistance h/4e2 approximately 6.5 kOmega per CuO2 bilayer. The evolution of a carrier, nH infiniti y - 6.2, is clearly observed in the underdoped region. The resistivity and Hall coefficient abruptly acquire strong temperature dependence at y approximately 6.5 indicating a radical change in the electronic state.

  2. Spin susceptibility of charge-ordered YBa2Cu3Oy across the upper critical field

    NASA Astrophysics Data System (ADS)

    Zhou, Rui; Hirata, Michihiro; Wu, Tao; Vinograd, Igor; Mayaffre, Hadrien; Krämer, Steffen; Reyes, Arneil P.; Kuhns, Philip L.; Liang, Ruixing; Hardy, W. N.; Bonn, D. A.; Julien, Marc-Henri

    2017-12-01

    The value of the upper critical field Hc2, a fundamental characteristic of the superconducting state, has been subject to strong controversy in high-Tc copper oxides. Since the issue has been tackled almost exclusively by macroscopic techniques so far, there is a clear need for local-probe measurements. Here, we use 17O NMR to measure the spin susceptibility χspin of the CuO2 planes at low temperature in charge-ordered YBa2Cu3Oy. We find that χspin increases (most likely linearly) with magnetic field H and saturates above field values ranging from 20 T to 40 T. This result is consistent with the lowest Hc2 values claimed previously and with the interpretation that the charge density wave (CDW) reduces Hc2 in underdoped YBa2Cu3Oy. Furthermore, the absence of marked deviation in χspin(H) at the onset of long-range CDW order indicates that this Hc2 reduction and the Fermi-surface reconstruction are primarily rooted in the short-range CDW order already present in zero field, not in the field-induced long-range CDW order. Above Hc2, the relatively low values of T= 2 K show that the pseudogap is a ground-state property, independent of the superconducting gap.

  3. Compensated electron and hole pockets in an underdoped high- Tc superconductor

    NASA Astrophysics Data System (ADS)

    Sebastian, Suchitra E.; Harrison, N.; Goddard, P. A.; Altarawneh, M. M.; Mielke, C. H.; Liang, Ruixing; Bonn, D. A.; Hardy, W. N.; Andersen, O. K.; Lonzarich, G. G.

    2010-06-01

    We report quantum oscillations in the underdoped high-temperature superconductor YBa2Cu3O6+x over a wide range in magnetic field 28≤μ0H≤85T corresponding to ≈12 oscillations, enabling the Fermi surface topology to be mapped to high resolution. As earlier reported by Sebastian [Nature (London) 454, 200 (2008)10.1038/nature07095], we find a Fermi surface comprising multiple pockets, as revealed by the additional distinct quantum oscillation frequencies and harmonics reported in this work. We find the originally reported broad low-frequency Fourier peak at ≈535T to be clearly resolved into three separate peaks at ≈460 , ≈532 , and ≈602T , in reasonable agreement with the reported frequencies of Audouard [Phys. Rev. Lett. 103, 157003 (2009)10.1103/PhysRevLett.103.157003]. However, our increased resolution and angle-resolved measurements identify these frequencies to originate from two similarly sized pockets with greatly contrasting degrees of interlayer corrugation. The spectrally dominant frequency originates from a pocket (denoted α ) that is almost ideally two-dimensional in form (exhibiting negligible interlayer corrugation). In contrast, the newly resolved weaker adjacent spectral features originate from a deeply corrugated pocket (denoted γ ). On comparison with band structure, the d -wave symmetry of the interlayer dispersion locates the minimally corrugated α pocket at the “nodal” point knodal=(π/2,π/2) , and the significantly corrugated γ pocket at the “antinodal” point kantinodal=(π,0) within the Brillouin zone. The differently corrugated pockets at different locations indicate creation by translational symmetry breaking—a spin-density wave has been suggested from the suppression of Zeeman splitting for the spectrally dominant pocket. In a broken-translational symmetry scenario, symmetry points to the nodal (α) pocket corresponding to holes, with the weaker antinodal (γ) pocket corresponding to electrons—likely responsible for the negative Hall coefficient reported by LeBoeuf [Nature (London) 450, 533 (2007)10.1038/nature06332]. Given the similarity in α and γ pocket volumes, their opposite carrier type and the previous report of a diverging effective mass in Sebastian [Proc. Nat. Am. Soc. 107, 6175 (2010)10.1073/pnas.0913711107], we discuss the possibility of a secondary Fermi surface instability at low dopings of the excitonic insulator type, associated with the metal-insulator quantum critical point. Its potential involvement in the enhancement of superconducting transition temperatures is also discussed.

  4. In-plane electronic anisotropy of underdoped '122' Fe-arsenide superconductors revealed by measurements of detwinned single crystals

    NASA Astrophysics Data System (ADS)

    Fisher, I. R.; Degiorgi, L.; Shen, Z. X.

    2011-12-01

    The parent phases of the Fe-arsenide superconductors harbor an antiferromagnetic ground state. Significantly, the Néel transition is either preceded or accompanied by a structural transition that breaks the four-fold symmetry of the high-temperature lattice. Borrowing language from the field of soft condensed matter physics, this broken discrete rotational symmetry is widely referred to as an Ising nematic phase transition. Understanding the origin of this effect is a key component of a complete theoretical description of the occurrence of superconductivity in this family of compounds, motivating both theoretical and experimental investigation of the nematic transition and the associated in-plane anisotropy. Here we review recent experimental progress in determining the intrinsic in-plane electronic anisotropy as revealed by resistivity, reflectivity and angle-resolved photoemission spectroscopy measurements of detwinned single crystals of underdoped Fe-arsenide superconductors in the '122' family of compounds.

  5. On local pairs vs. BCS: Quo vadis high-T c superconductivity

    DOE PAGES

    Pavuna, D.; Dubuis, G.; Bollinger, A. T.; ...

    2016-07-28

    Since the discovery of high-temperature superconductivity in cuprates, proposals have been made that pairing may be local, in particular in underdoped samples. Furthermore, we briefly review evidence for local pairs from our experiments on thin films of La 2–xSr xCuO 4, synthesized by atomic layer-by-layer molecular beam epitaxy (ALL-MBE).

  6. Evidence for a small hole pocket in the Fermi surface of underdoped YBa2Cu3Oy

    PubMed Central

    Doiron-Leyraud, N.; Badoux, S.; René de Cotret, S.; Lepault, S.; LeBoeuf, D.; Laliberté, F.; Hassinger, E.; Ramshaw, B. J.; Bonn, D. A.; Hardy, W. N.; Liang, R.; Park, J.-H..; Vignolles, D.; Vignolle, B.; Taillefer, L.; Proust, C.

    2015-01-01

    In underdoped cuprate superconductors, the Fermi surface undergoes a reconstruction that produces a small electron pocket, but whether there is another, as yet, undetected portion to the Fermi surface is unknown. Establishing the complete topology of the Fermi surface is key to identifying the mechanism responsible for its reconstruction. Here we report evidence for a second Fermi pocket in underdoped YBa2Cu3Oy, detected as a small quantum oscillation frequency in the thermoelectric response and in the c-axis resistance. The field-angle dependence of the frequency shows that it is a distinct Fermi surface, and the normal-state thermopower requires it to be a hole pocket. A Fermi surface consisting of one electron pocket and two hole pockets with the measured areas and masses is consistent with a Fermi-surface reconstruction by the charge–density–wave order observed in YBa2Cu3Oy, provided other parts of the reconstructed Fermi surface are removed by a separate mechanism, possibly the pseudogap. PMID:25616011

  7. Temperature dependence of superfluid density in YBa 2Cu 3O 7- δ and Y 0.7Ca 0.3Ba 2Cu 3O 7- δ thin films: A doping dependence study of the linear slope

    NASA Astrophysics Data System (ADS)

    Lai, L. S.; Juang, J. Y.; Wu, K. H.; Uen, T. M.; Gou, Y. S.

    2005-11-01

    By using a microstrip ring resonator to measure the temperature dependence of the in-plane magnetic penetration depth λ(T) in YBa2Cu3O7-δ (YBCO) and Y0.7Ca0.3Ba2Cu3O7-δ (Ca-YBCO) epitaxially grown thin films, the linear temperature dependence of the superfluid density ρs/m∗ ≡ 1/λ2(T) was observed from the under- to the overdoped regime at the temperatures below T/Tc ≈ 0.3 . For the underdoped regime of YBCO and Ca-YBCO thin films, the magnitude of the slope d(1/λ2(T))/dT is insensitive to doping, and it can be treated in the framework of projected d-density-wave model. Combining these slope values with the thermal conductivity measurements, the Fermi-liquid correction factor α2 from the Fermi-liquid model, suggested by Wen and Lee, was revealed here with various doping levels.

  8. Doping-dependent anisotropic superconducting gap in Na1-δ(Fe1-xCox)As from London penetration depth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cho, Kyuil; Tanatar, Makariy A.; Spyrison, Nicholas

    2012-07-30

    The London penetration depth was measured in single crystals of self-doped Na1-δFeAs (from under doping to optimal doping, Tc from 14 to 27 K) and electron-doped Na(Fe1-xCox)As with x ranging from undoped, x=0, to overdoped, x=0.1. In all samples, the low-temperature variation of the penetration depth exhibits a power-law dependence, Δλ(T)=ATn, with the exponent that varies in a domelike fashion from n˜1.1 in the underdoped, reaching a maximum of n˜1.9 in the optimally doped, and decreasing again to n˜1.3 on the overdoped side. While the anisotropy of the gap structure follows a universal domelike evolution, the exponent at optimal doping,more » n˜1.9, is lower than in other charge-doped Fe-based superconductors (FeSCs). The full-temperature range superfluid density, ρs(T)=λ(0)/λ(T)2, at optimal doping is also distinctly different from other charge-doped FeSCs but is similar to isovalently substituted BaFe2(As1-xPx)2, believed to be a nodal pnictide at optimal doping. These results suggest that the superconducting gap in Na(Fe1-xCox)As is highly anisotropic even at optimal doping.« less

  9. Phase diagram of the underdoped cuprates at high magnetic field

    NASA Astrophysics Data System (ADS)

    Chakraborty, Debmalya; Morice, Corentin; Pépin, Catherine

    2018-06-01

    The experimentally measured phase diagram of cuprate superconductors in the temperature-applied magnetic field plane illuminates key issues in understanding the physics of these materials. At low temperature, the superconducting state gives way to a long-range charge order with increasing magnetic field; both the orders coexist in a small intermediate region. The charge order transition is strikingly insensitive to temperature and quickly reaches a transition temperature close to the zero-field superconducting Tc. We argue that such a transition along with the presence of the coexisting phase is difficult to obtain in a weak coupling competing orders formalism. We demonstrate that for some range of parameters there is an enlarged symmetry of the strongly coupled charge and superconducting orders in the system depending on their relative masses and the coupling strength of the two orders. We establish that this sharp switch from the superconducting phase to the charge order phase can be understood in the framework of a composite SU(2) order parameter comprising the charge and superconducting orders. Finally, we illustrate that there is a possibility of the coexisting phase of the competing charge and superconducting orders only when the SU(2) symmetry between them is weakly broken due to biquadratic terms in the free energy. The relation of this sharp transition to the proximity to the pseudogap quantum critical doping is also discussed.

  10. Spin susceptibility of charge-ordered YBa2Cu3Oy across the upper critical field

    PubMed Central

    Zhou, Rui; Hirata, Michihiro; Wu, Tao; Vinograd, Igor; Mayaffre, Hadrien; Krämer, Steffen; Reyes, Arneil P.; Kuhns, Philip L.; Liang, Ruixing; Hardy, W. N.; Bonn, D. A.; Julien, Marc-Henri

    2017-01-01

    The value of the upper critical field Hc2, a fundamental characteristic of the superconducting state, has been subject to strong controversy in high-Tc copper oxides. Since the issue has been tackled almost exclusively by macroscopic techniques so far, there is a clear need for local-probe measurements. Here, we use 17O NMR to measure the spin susceptibility χspin of the CuO2 planes at low temperature in charge-ordered YBa2Cu3Oy. We find that χspin increases (most likely linearly) with magnetic field H and saturates above field values ranging from 20 T to 40 T. This result is consistent with the lowest Hc2 values claimed previously and with the interpretation that the charge density wave (CDW) reduces Hc2 in underdoped YBa2Cu3Oy. Furthermore, the absence of marked deviation in χspin(H) at the onset of long-range CDW order indicates that this Hc2 reduction and the Fermi-surface reconstruction are primarily rooted in the short-range CDW order already present in zero field, not in the field-induced long-range CDW order. Above Hc2, the relatively low values of χspin at T= 2 K show that the pseudogap is a ground-state property, independent of the superconducting gap. PMID:29183974

  11. Ground state of underdoped cuprates in vicinity of superconductor-to-insulator transition

    DOE PAGES

    Wu, Jie; Bollinger, Anthony T.; Sun, Yujie; ...

    2016-08-15

    When an insulating underdoped cuprate is doped beyond a critical concentration (x c), high-temperature superconductivity emerges. We have synthesized a series of La 2–xSr xCuO 4 (LSCO) samples using the combinatorial spread technique that allows us to traverse the superconductor-to-insulator transition (SIT) in extremely fine doping steps, Δx≈0.00008. We have measured the Hall resistivity (ρ H) as a function of temperature down to 300 mK in magnetic fields up to 9 T. At very low temperatures, ρ H shows an erratic behavior, jumps and fluctuations exceeding 100%, hysteresis, and memory effects, indicating that the insulating ground state is a charge-clustermore » glass (CCG). Furthermore, based on the phase diagram depicted in our experiment, we propose a unified picture to account for the anomalous electric transport in the vicinity of the SIT, suggesting that the CCG is in fact a disordered and glassy version of the charge density wave.« less

  12. Electronic disorder and magnetic-field-induced superconductivity enhancement in Fe1+y(Te1-xSex)

    NASA Astrophysics Data System (ADS)

    Hu, Jin; Liu, Tijiang; Qian, Bin; Mao, Zhiqiang

    2012-02-01

    The iron chalcogenide Fe1+y(Te1-xSex) superconductor system exhibits a unique electronic and magnetic phase diagram distinct from those seen in iron pnictides: bulk superconductivity does not appear immediately following the suppression of long-range (π,0) AFM order. Instead, an intermediate phase with weak charge carrier localization appears between AFM order and bulk superconductivity (Liu et al., Nat. Mater. 9, 719 (2010)). In this talk, we report our recent studies on the relationship between the normal state and superconducting properties in Fe1+y(Te1-xSex). We show that the superconducting volume fraction VSC and normal state metallicity significantly increase while the normal state Sommerfeld coefficient γ and Hall coefficient RH drop drastically with increasing Se content in the underdoped superconducting region. Additionally, VSC is surprisingly enhanced by magnetic field in heavily underdoped superconducting samples. The implications of these results will be discussed. Our analyses suggest that the suppression of superconductivity in the underdoped region is associated with electronic disorder caused by incoherent magnetic scattering arising from (π,0) magnetic fluctuations.

  13. Anomalous thermal diffusivity in underdoped YBa2Cu3O6+x

    PubMed Central

    Levenson-Falk, Eli M.; Ramshaw, B. J.; Bonn, D. A.; Liang, Ruixing; Hardy, W. N.; Hartnoll, Sean A.; Kapitulnik, Aharon

    2017-01-01

    The thermal diffusivity in the ab plane of underdoped YBCO crystals is measured by means of a local optical technique in the temperature range of 25–300 K. The phase delay between a point heat source and a set of detection points around it allows for high-resolution measurement of the thermal diffusivity and its in-plane anisotropy. Although the magnitude of the diffusivity may suggest that it originates from phonons, its anisotropy is comparable with reported values of the electrical resistivity anisotropy. Furthermore, the anisotropy drops sharply below the charge order transition, again similar to the electrical resistivity anisotropy. Both of these observations suggest that the thermal diffusivity has pronounced electronic as well as phononic character. At the same time, the small electrical and thermal conductivities at high temperatures imply that neither well-defined electron nor phonon quasiparticles are present in this material. We interpret our results through a strongly interacting incoherent electron–phonon “soup” picture characterized by a diffusion constant D∼vB2τ, where vB is the soup velocity, and scattering of both electrons and phonons saturates a quantum thermal relaxation time τ∼ℏ/kBT. PMID:28484003

  14. Evolution of superconducting gap and metallic ground state in cuprates from transport

    NASA Astrophysics Data System (ADS)

    Taillefer, Louis

    2006-03-01

    We report on fundamental characteristics of the ground state of cuprates in the limit of T=0, for both normal and superconducting states, obtained from transport measurements on high-quality single crystals of YBCO and Tl-2201, as a function of hole concentration. The superconducting gap is extracted from thermal conductivity; it is found to scale with the superconducting transition temperature throughout the overdoped regime, with a gap-to-Tc ratio of 5 [1]. The normal state is accessed by suppressing superconductivity with magnetic fields up to 60 T and is characterized by the limiting behavior of its electrical resistivity; while carrier localization is observed in YBCO at low temperature for carrier concentrations p below 0.1 hole/planar Cu, at p=0.1 and above the material remains highly metallic down to T=0 [2]. This shows that the non-superconducting state of underdoped cuprates, deep in the pseudogap phase, is remarkably similar to that of strongly overdoped cuprates, e.g. at p=0.3. We compare these results with similar measurements on other cuprates and discuss their implication for our understanding of the cuprate phase diagram. [1] In collaboration with: D.G. Hawthorn, S.Y. Li, M. Sutherland, E. Boaknin, R.W. Hill, C. Proust, F. Ronning, M. Tanatar, J. Paglione, D. Peets, R. Liang, D.A. Bonn, W.N. Hardy, and N.N. Kolesnikov. [2] In collaboration with: C. Proust, M. Sutherland, N. Doiron- Leyraud, S.Y. Li, R. Liang, D.A. Bonn, W.N. Hardy, N.E. Hussey, S. Adachi, S. Tajima, J. Levallois, and M. Narbone.

  15. Disentangling superconducting and magnetic orders in NaFe1 -xNixAs using muon spin rotation

    NASA Astrophysics Data System (ADS)

    Cheung, Sky C.; Guguchia, Zurab; Frandsen, Benjamin A.; Gong, Zizhou; Yamakawa, Kohtaro; Almeida, Dalson E.; Onuorah, Ifeanyi J.; Bonfá, Pietro; Miranda, Eduardo; Wang, Weiyi; Tam, David W.; Song, Yu; Cao, Chongde; Cai, Yipeng; Hallas, Alannah M.; Wilson, Murray N.; Munsie, Timothy J. S.; Luke, Graeme; Chen, Bijuan; Dai, Guangyang; Jin, Changqing; Guo, Shengli; Ning, Fanlong; Fernandes, Rafael M.; De Renzi, Roberto; Dai, Pengcheng; Uemura, Yasutomo J.

    2018-06-01

    Muon spin rotation and relaxation studies have been performed on a "111" family of iron-based superconductors, NaFe1 -xNixAs , using single crystalline samples with Ni concentrations x =0 , 0.4, 0.6, 1.0, 1.3, and 1.5%. Static magnetic order was characterized by obtaining the temperature and doping dependences of the local ordered magnetic moment size and the volume fraction of the magnetically ordered regions. For x =0 and 0.4%, a transition to a nearly-homogeneous long range magnetically ordered state is observed, while for x ≳0.4 % magnetic order becomes more disordered and is completely suppressed for x =1.5 % . The magnetic volume fraction continuously decreases with increasing x . Development of superconductivity in the full volume is inferred from Meissner shielding results for x ≳0.4 % . The combination of magnetic and superconducting volumes implies that a spatially-overlapping coexistence of magnetism and superconductivity spans a large region of the T -x phase diagram for NaFe1 -xNixAs . A strong reduction of both the ordered moment size and the volume fraction is observed below the superconducting TC for x =0.6 , 1.0, and 1.3%, in contrast to other iron pnictides in which one of these two parameters exhibits a reduction below TC, but not both. The suppression of magnetic order is further enhanced with increased Ni doping, leading to a reentrant nonmagnetic state below TC for x =1.3 % . The reentrant behavior indicates an interplay between antiferromagnetism and superconductivity involving competition for the same electrons. These observations are consistent with the sign-changing s± superconducting state, which is expected to appear on the verge of microscopic coexistence and phase separation with magnetism. We also present a universal linear relationship between the local ordered moment size and the antiferromagnetic ordering temperature TN across a variety of iron-based superconductors. We argue that this linear relationship is consistent with an itinerant-electron approach, in which Fermi surface nesting drives antiferromagnetic ordering. In studies of superconducting properties, we find that the T =0 limit of superfluid density follows the linear trend observed in underdoped cuprates when plotted against TC. This paper also includes a detailed theoretical prediction of the muon stopping sites and provides comparisons with experimental results.

  16. The physics of inhomogeneous striped superconductors

    NASA Astrophysics Data System (ADS)

    Martin, I.; Ortiz, G.; Eroles, J.; Balatsky, A. V.; Bishop, A. R.

    2001-05-01

    We present a minimal model of a doped Mott insulator that simultaneously supports antiferromagnetic stripes and d-wave superconductivity. At the unrestricted mean-field level, the various phases of the cuprates, including weak and strong pseudogap phases, and two different types of superconductivity in the underdoped and the overdoped regimes, find a natural interpretation. We argue that on the underdoped side, the superconductor is intrinsically inhomogeneous — striped nanoscale coexistence of superconductivity and magnetism — and global phase coherence is achieved through Josephson-like coupling of the superconducting stripes. On the overdoped side, the state is overall homogeneous and the superconductivity is of the classical BCS type.

  17. Superconductivity, pseudo-gap, and stripe correlations in high-Tc cuprates

    NASA Astrophysics Data System (ADS)

    Zhang, Zailan; Denis, Sylvain; Lebert, Blair W.; Bertran, Francois; Le Fèvre, Patrick; Taleb-Ibrahimi, Amina; Castellan, John-Paul; Bolloc'h, David Le; Jacques, Vincent L. R.; Sidis, Yvan; Baptiste, Benoît; Decorse, Claudia; Berthet, Patrick; Perfetti, Luca; d'Astuto, Matteo

    2018-05-01

    Under-doped La-214 cuprates show a charge- and spin-modulation known as "stripes" [1]. These stripe modulations are (quasi)-static close to 1/8 hole doping where superconductivity is suppressed. The pseudo-gap phase of other cuprate compounds recently also revealed charge modulation, but interpreted rather as a charge density wave (CDW) [2-4], that possibly competes with superconductivity. In this context, to better understand the interplay between the stripe phase and the superconductivity, we use angle-resolved photoemission spectroscopy to study the electronic band structure and gap in La-214 cuprates near 1/8 doping (La2-x-yNdySrxCuO4 (x = 0.12; y = 0.0 & 0.4)) and compare with the previous results in the same system [5] and La1.86Ba0.14CuO4 [6]. Our data shows a loss of spectral intensity towards the end of the Fermi arcs, that is possibly due to a strong renormalisation, as already pointed out elsewhere [6], with a noisy but still measurable gap. On the nodal direction no gap is observed within our statistics, but a sizeable decrease in intensity with temperature. Moreover, we do not see any shadow band, but our Fermi surface can be well modelled with a single electron band calculation in the tight binding approximation, even very close to the 1/8 doping La2-x-yNdySrxCuO4 with and without Nd substitution.

  18. No evidence for orbital loop currents in charge-ordered YBa2Cu3O6 +x from polarized neutron diffraction

    NASA Astrophysics Data System (ADS)

    Croft, T. P.; Blackburn, E.; Kulda, J.; Liang, Ruixing; Bonn, D. A.; Hardy, W. N.; Hayden, S. M.

    2017-12-01

    It has been proposed that the pseudogap state of underdoped cuprate superconductors may be due to a transition to a phase which has circulating currents within each unit cell. Here, we use polarized neutron diffraction to search for the corresponding orbital moments in two samples of underdoped YBa2Cu3O6 +x with doping levels p =0.104 and 0.123. In contrast to some other reports using polarized neutrons, but in agreement with nuclear magnetic resonance and muon spin rotation measurements, we find no evidence for the appearance of magnetic order below 300 K. Thus, our experiment suggests that such order is not an intrinsic property of high-quality cuprate superconductor single crystals. Our results provide an upper bound for a possible orbital loop moment which depends on the pattern of currents within the unit cell. For example, for the CC-θI I pattern proposed by Varma, we find that the ordered moment per current loop is less than 0.013 μB for p =0.104 .

  19. STM/STS studies for interplane disorder effects on the electronic states of the Cu-O plane in Bi2201

    NASA Astrophysics Data System (ADS)

    Kurosawa, T.; Hatta, G.; Miyazaki, H.; Yamaji, J.; Yoshikawa, K.; Nakagawa, Y.; Shibata, Y.; Yoshida, H.; Oda, M.; Ido, M.; Takeyama, K.; Momono, N.

    2015-08-01

    STM/STS experiments have been performed in Bi2Sr1.7R0.3CuO6+δ (R-Bi2201) systems with R = La and Eu, which are of a nearly optimal doping level po but have different Tc values, 35 K and 20 K, respectively, to examine interplane disorder effects on the superconducting (SC) gap and the pseudogap (PG) that is accompanied by a checkerboard-type charge order (CCO). We report that as interplane disorders are strengthened by replacing La with Eu in optimal Bi2201, the antinodal PG size Δ∗ increases from ˜ 30meV to ˜ 60meV, which is comparable to the value for an underdoping level p/po ˜ 0.5 in La-Bi2201. On the other hand, the period of CCO in optimal Eu-Bi2201 is the same as in optimal La-Bi2201, about five times lattice constant ˜ 5a along the Cu-O bond directions; it remains unchanged even if the PG develops markedly to the same degree as for p/po ˜ 0.5 in La-Bi2201, whose period is ˜ 4a.

  20. Enhanced coherent oscillations in the superconducting state of underdoped YB a 2 C u 3 O 6 + x induced via ultrafast terahertz excitation

    DOE PAGES

    Dakovski, Georgi L.; Lee, Wei -Sheng; Hawthorn, David G.; ...

    2015-06-24

    We utilize intense, single-cycle terahertz pulses to induce collective excitations in the charge-density-wave-ordered underdoped cuprate YBa 2Cu 3O 6+x. These excitations manifest themselves as pronounced coherent oscillations of the optical reflectivity in the transient state, accompanied by minimal incoherent quasiparticle relaxation dynamics. The oscillations occur at frequencies consistent with soft phonon energies associated with the charge-density-wave, but vanish above the superconducting transition temperature rather than that at the charge-density-wave transition. These results indicate an intimate relationship of the terahertz excitation with the underlying charge-density-wave and the superconducting condensate itself.

  1. Number of holes contained within the Fermi surface volume in underdoped high-temperature superconductors

    DOE PAGES

    Harrison, Neil

    2016-08-16

    Here, we provide a potential solution to the longstanding problem relating Fermi surface reconstruction to the number of holes contained within the Fermi surface volume in underdoped high T c superconductors. On considering uniaxial and biaxial charge-density wave order, we show that there exists a relationship between the ordering wave vector, the hole doping, and the cross-sectional area of the reconstructed Fermi surface whose precise form depends on the volume of the starting Fermi surface. We consider a “large” starting Fermi surface comprising 1+p hole carriers, as predicted by band structure calculations, and a “small” starting Fermi surface comprising pmore » hole carriers, as proposed in models in which the Coulomb repulsion remains the dominant energy. Using the reconstructed Fermi surface cross-sectional area obtained in quantum oscillation experiments in YBa 2Cu 3O 6+x and HgBa 2CuO 4+x and the established methods for estimating the chemical hole doping, we find the ordering vectors obtained from x-ray scattering measurements to show a close correspondence with those expected for the small starting Fermi surface. We therefore show the quantum oscillation frequency and charge-density wave vectors provide accurate estimates for the number of holes contributing to the Fermi surface volume in the pseudogap regime.« less

  2. Number of holes contained within the Fermi surface volume in underdoped high-temperature superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harrison, Neil

    Here, we provide a potential solution to the longstanding problem relating Fermi surface reconstruction to the number of holes contained within the Fermi surface volume in underdoped high T c superconductors. On considering uniaxial and biaxial charge-density wave order, we show that there exists a relationship between the ordering wave vector, the hole doping, and the cross-sectional area of the reconstructed Fermi surface whose precise form depends on the volume of the starting Fermi surface. We consider a “large” starting Fermi surface comprising 1+p hole carriers, as predicted by band structure calculations, and a “small” starting Fermi surface comprising pmore » hole carriers, as proposed in models in which the Coulomb repulsion remains the dominant energy. Using the reconstructed Fermi surface cross-sectional area obtained in quantum oscillation experiments in YBa 2Cu 3O 6+x and HgBa 2CuO 4+x and the established methods for estimating the chemical hole doping, we find the ordering vectors obtained from x-ray scattering measurements to show a close correspondence with those expected for the small starting Fermi surface. We therefore show the quantum oscillation frequency and charge-density wave vectors provide accurate estimates for the number of holes contributing to the Fermi surface volume in the pseudogap regime.« less

  3. Pair-density waves, charge-density waves, and vortices in high-Tc cuprates

    NASA Astrophysics Data System (ADS)

    Dai, Zhehao; Zhang, Ya-Hui; Senthil, T.; Lee, Patrick A.

    2018-05-01

    A recent scanning tunneling microscopy (STM) experiment reports the observation of a charge-density wave (CDW) with a period of approximately 8a in the halo region surrounding the vortex core, in striking contrast to the approximately 4a period CDWs that are commonly observed in the cuprates. Inspired by this work, we study a model where a bidirectional pair-density wave (PDW) with period 8 is at play. This further divides into two classes: (1) where the PDW is a competing state of the d -wave superconductor and can exist only near the vortex core where the d -wave order is suppressed and (2) where the PDW is the primary order, the so-called "mother state" that persists with strong phase fluctuations to high temperature and high magnetic field and lies behind the pseudogap phenomenology. We study the charge-density wave structures near the vortex core in these models. We emphasize the importance of the phase winding of the d -wave order parameter. The PDW can be pinned by the vortex core due to this winding and become static. Furthermore, the period-8 CDW inherits the properties of this winding, which gives rise to a special feature of the Fourier transform peak, namely, it is split in certain directions. There is also a line of zeros in the inverse Fourier transform of filtered data. We propose that these are key experimental signatures that can distinguish between the PDW-driven scenario from the more mundane option that the period-8 CDW is primary. We discuss the pro's and con's of the options considered above. Finally, we attempt to place the STM experiment in the broader context of pseudogap physics of underdoped cuprates and relate this observation to the unusual properties of x-ray scattering data on CDW carried out to very high magnetic field.

  4. Ultrafast dynamics of quasiparticles and coherent acoustic phonons in slightly underdoped (BaK)Fe2As2

    PubMed Central

    Lin, Kung-Hsuan; Wang, Kuan-Jen; Chang, Chung-Chieh; Wen, Yu-Chieh; Lv, Bing; Chu, Ching-Wu; Wu, Maw-Kuen

    2016-01-01

    We have utilized ultrafast optical spectroscopy to study carrier dynamics in slightly underdoped (BaK)Fe2As2 crystals without magnetic transition. The photoelastic signals due to coherent acoustic phonons have been quantitatively investigated. According to our temperature-dependent results, we found that the relaxation component of superconducting quasiparticles persisted from the superconducting state up to at least 70 K in the normal state. Our findings suggest that the pseudogaplike feature in the normal state is possibly the precursor of superconductivity. We also highlight that the pseudogap feature of K-doped BaFe2As2 is different from that of other iron-based superconductors, including Co-doped or P-doped BaFe2As2. PMID:27180873

  5. Electronic specific heat and low-energy quasiparticle excitations in the superconducting state of La2-xSrxCuO4 single crystals

    NASA Astrophysics Data System (ADS)

    Wen, Hai-Hu; Liu, Zhi-Yong; Zhou, Fang; Xiong, Jiwu; Ti, Wenxing; Xiang, Tao; Komiya, Seiki; Sun, Xuefeng; Ando, Yoichi

    2004-12-01

    Low-temperature specific heat has been measured and extensively analyzed on a series of La2-xSrxCuO4 single crystals from underdoped to overdoped regime. From these data the quasiparticle density of state in the mixed state is derived and compared to the predicted scaling law Cvol/TH=f(T/H) of d -wave superconductivity. It is found that the scaling law can be nicely followed by the optimally doped sample (x=0.15) in quite a wide region of (T/H⩽8K/T) . However, the region for this scaling becomes smaller and smaller toward more underdoped region: a clear trend can be seen for samples from x=0.15to0.069 . Therefore, generally speaking, the scaling quality becomes worse on the underdoped samples in terms of scalable region of T/H . This feature in the underdoped region is explained as due to the low-energy excitations from a second order (for example, antiferromagnetic correlation, d -density wave, spin-density wave, or charge-density wave order) that may coexist or compete with superconductivity. Surprisingly, deviations from the d -wave scaling law have also been found for the overdoped sample (x=0.22) , while the scaling law is reconciled for the overdoped sample, when the core size effect is taken into account. An important discovery of present work is that the zero-temperature data follow the Volovik’s relation Δγ(T=0)=AH quite well for all samples investigated here; although the applicability of the d -wave scaling law to the data at finite temperatures varies with doped-hole concentration. We also present the doping dependence of some parameters, such as the residual linear term γ0 , the α value, etc. It is suggested that the residual linear term (γ0T) of the electronic specific heat observed in all cuprate superconductors is probably due to the inhomogeneity, either chemical or electronic in origin. The field-induced reduction of the specific heat in the mixed state is also reported. Finally, implications on the electronic phase diagram are suggested.

  6. Doping evolution of the second magnetization peak and magnetic relaxation in ( B a 1 - x K x ) F e 2 A s 2 single crystals

    DOE PAGES

    Liu, Yong; Zhou, Lin; Sun, Kewei; ...

    2018-02-16

    Here, we present a thorough study of doping dependent magnetic hysteresis and relaxation characteristics in single crystals of (Ba 1-xK x) Fe 2As 2 (0.18 ≤ x ≤ 1). The critical current density J c reaches maximum in the underdoped sample x = 0.26 and then decreases in the optimally doped and overdoped samples. Meanwhile, the magnetic relaxation rate S rapidly increases and the flux creep activation barrier U 0 sharply decreases in the overdoped sample x = 0.70. These results suggest that vortex pinning is very strong in the underdoped regime, but it is greatly reduced in the optimallymore » doped and overdoped regime. Transmission electron microscope (TEM) measurements reveal the existence of dislocations and inclusions in all three studied samples x = 0.38, 0.46, and 0.65. An investigation of the paramagnetic Meissner effect (PME) suggests that spatial variations in T c become small in the samples x = 0.43 and 0.46, slightly above the optimal doping levels. Our results support that two types of pinning sources dominate the (Ba 1-xK x) Fe 2As 2 crystals: (i) strong δl pinning, which results from the fluctuations in the mean free path l and δT c pinning from the spatial variations in T c in the underdoped regime, and (ii) weak δT c pinning in the optimally doped and overdoped regime.« less

  7. Doping evolution of the second magnetization peak and magnetic relaxation in ( B a 1 - x K x ) F e 2 A s 2 single crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yong; Zhou, Lin; Sun, Kewei

    Here, we present a thorough study of doping dependent magnetic hysteresis and relaxation characteristics in single crystals of (Ba 1-xK x) Fe 2As 2 (0.18 ≤ x ≤ 1). The critical current density J c reaches maximum in the underdoped sample x = 0.26 and then decreases in the optimally doped and overdoped samples. Meanwhile, the magnetic relaxation rate S rapidly increases and the flux creep activation barrier U 0 sharply decreases in the overdoped sample x = 0.70. These results suggest that vortex pinning is very strong in the underdoped regime, but it is greatly reduced in the optimallymore » doped and overdoped regime. Transmission electron microscope (TEM) measurements reveal the existence of dislocations and inclusions in all three studied samples x = 0.38, 0.46, and 0.65. An investigation of the paramagnetic Meissner effect (PME) suggests that spatial variations in T c become small in the samples x = 0.43 and 0.46, slightly above the optimal doping levels. Our results support that two types of pinning sources dominate the (Ba 1-xK x) Fe 2As 2 crystals: (i) strong δl pinning, which results from the fluctuations in the mean free path l and δT c pinning from the spatial variations in T c in the underdoped regime, and (ii) weak δT c pinning in the optimally doped and overdoped regime.« less

  8. Optical probes of symmetry breaking in magnetic and superconducting BaFe2(As1-xPx)2

    NASA Astrophysics Data System (ADS)

    Orenstein, Joseph

    The discovery of iron pnictide superconductors has opened promising new directions in the effort to fully understand the phenomenon of high-Tc, with a focus on the connections between superconductivity, magnetism, and electronic nematicity. The BaFe2(As1-xPx)2 (P:Ba122) system in particular has received attention because isovalent substitution of As for P generates less disorder than doping on the Fe site. The phase diagram of P:Ba122 is characterized by a line of simultaneous antiferromagnetic (AF) and tetragonal-to-orthorhombic transitions, Ts (x) , that penetrates the superconducting dome at x =0.28, just below optimal doping (xopt = 0.30). In this work, we use spatially-resolved optical polarimetry and photomodulated reflectance to detect linear birefringence and therefore breaking of 4-fold rotational (C4) symmetry. In underdoped (x<0.28) samples, birefringence appears at T>Tsand grows continuously with decreasing T . The birefringence is unidirectional in a large (300 μm x300 μm) field of view, suggesting that C4 breaking in this range of T is caused by residual strain that couples to a diverging nematic susceptibility. Birefringence maps just below Ts (x) show the appearance of domains, indicating the onset of spontaneous symmetry breaking to an AF ground state. Surprisingly, in samples with x>0.28, in which the low T phase is superconducting/ tetragonal rather than AF/orthorhombic, C4 breaking is observed as well, with an abrupt onset and domain formation at 55 K. We tentatively associate these features with a transition to an AF phase induced by residual strain, as previously proposed [H.-H. Kuo et al. Phys. Rev. B86, 134507 (2012)] to account for structure in resistivity vs. T. Time-resolved photomodulation allow us to follow the amplitude of the AF order with time following pulsed photoexcitation. Below Tc the AF order at first weakens , but then strengthens in response to the photoinduced weakening of superconductivity. This complex time evolution is accounted for quantitatively by a model based on the coexistence and competition of AF and superconducting order. We gratefully acknowledge support by the U.S. Department of Energy, Office of Science, Materials Sciences and Engineering Division, and the Gordon and Betty Moore Foundation's EPiQS Initiative through Grant GBMF4537.

  9. Electronic Phase Separation in the Slightly Underdoped Iron Pnictide Superconductor Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, J. T.; Inosov, D. S.; Sun, G. L.

    2009-03-20

    Here we present a combined study of the slightly underdoped novel pnictide superconductor Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} by means of x-ray powder diffraction, neutron scattering, muon-spin rotation ({mu}SR), and magnetic force microscopy (MFM). Static antiferromagnetic order sets in below T{sub m}{approx_equal}70 K as inferred from the neutron scattering and zero-field-{mu}SR data. Transverse-field {mu}SR below T{sub c} shows a coexistence of magnetically ordered and nonmagnetic states, which is also confirmed by MFM imaging. We explain such coexistence by electronic phase separation into antiferromagnetic and superconducting- or normal-state regions on a lateral scale of several tens of nanometers. Our findings indicatemore » that such mesoscopic phase separation can be considered an intrinsic property of some iron pnictide superconductors.« less

  10. Nematicity in stripe ordered cuprates probed via resonant x-ray scattering

    DOE PAGES

    Achkar, A. J.; Zwiebler, M.; McMahon, Christopher; ...

    2016-02-05

    We found that in underdoped cuprate superconductors, a rich competition occurs between superconductivity and charge density wave (CDW) order. Whether rotational symmetry-breaking (nematicity) occurs intrinsically and generically or as a consequence of other orders is under debate. Here, we employ resonant x-ray scattering in stripe-ordered superconductors (La,M) 2CuO 4 to probe the relationship between electronic nematicity of the Cu 3d orbitals, structure of the (La,M) 2O 2 layers, and CDW order. We find distinct temperature dependences for the structure of the (La,M) 2O 2 layers and the electronic nematicity of the CuO 2 planes, with only the latter being enhancedmore » by the onset of CDW order. Our results identify electronic nematicity as an order parameter that is distinct from a purely structural order parameter in underdoped striped cuprates.« less

  11. Weak phase stiffness and nature of the quantum critical point in underdoped cuprates

    DOE PAGES

    Yildirim, Yucel; Ku, Wei

    2015-11-02

    We demonstrate that the zero-temperature superconducting phase diagram of underdoped cuprates can be quantitatively understood in the strong binding limit, using only the experimental spectral function of the “normal” pseudogap phase without any free parameter. In the prototypical (La 1–xSr x) 2CuO 4, a kinetics-driven d-wave superconductivity is obtained above the critical doping δ c ~ 5.2%, below which complete loss of superfluidity results from local quantum fluctuation involving local p-wave pairs. Near the critical doping, an enormous mass enhancement of the local pairs is found responsible for the observed rapid decrease of phase stiffness. Lastly, a striking mass divergencemore » is predicted at δ c that dictates the occurrence of the observed quantum critical point and the abrupt suppression of the Nernst effects in the nearby region.« less

  12. Magnetic phase diagram of underdoped YBa 2 Cu 3 O y inferred from torque magnetization and thermal conductivity

    DOE PAGES

    Yu, Fan; Hirschberger, Max; Loew, Toshinao; ...

    2016-10-24

    We obtain the magnetic phase diagram in the underdoped cuprate YBa2Cu3Oy using torque magnetometry at temperatures 0.3–70 K and magnetic fields up to 45 T. At low fields, vortices (quantized flux tubes) form a vortex solid that is strongly pinned to the lattice. At large fields, melting of the solid to a vortex liquid produces nonzero dissipation. However, the vortex liquid persists to fields above 41 T. We have also mapped out the “transition” fields at which the charge-density–wave state (observed in X-ray diffraction experiments) becomes stable. Our results show that, in intense fields, superconductivity adjusts to coexist with themore » charge-density wave, but the Cooper pairs, which define the superconducting fluid, survive to fields well above 41 T.« less

  13. Nematicity in stripe ordered cuprates probed via resonant x-ray scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Achkar, A. J.; Zwiebler, M.; McMahon, Christopher

    We found that in underdoped cuprate superconductors, a rich competition occurs between superconductivity and charge density wave (CDW) order. Whether rotational symmetry-breaking (nematicity) occurs intrinsically and generically or as a consequence of other orders is under debate. Here, we employ resonant x-ray scattering in stripe-ordered superconductors (La,M) 2CuO 4 to probe the relationship between electronic nematicity of the Cu 3d orbitals, structure of the (La,M) 2O 2 layers, and CDW order. We find distinct temperature dependences for the structure of the (La,M) 2O 2 layers and the electronic nematicity of the CuO 2 planes, with only the latter being enhancedmore » by the onset of CDW order. Our results identify electronic nematicity as an order parameter that is distinct from a purely structural order parameter in underdoped striped cuprates.« less

  14. Thermodynamic signature of a magnetic-field-driven phase transition within the superconducting state of an underdoped cuprate

    NASA Astrophysics Data System (ADS)

    Kemper, J. B.; Vafek, O.; Betts, J. B.; Balakirev, F. F.; Hardy, W. N.; Liang, Ruixing; Bonn, D. A.; Boebinger, G. S.

    2016-01-01

    More than a quarter century after the discovery of the high-temperature superconductor (HTS) YBa2Cu3O6+δ (YBCO; ref. ), studies continue to uncover complexity in its phase diagram. In addition to HTS and the pseudogap, there is growing evidence for multiple phases with boundaries which are functions of temperature (T), doping (p) and magnetic field. Here we report the low-temperature electronic specific heat (Celec) of YBa2Cu3O6.43 and YBa2Cu3O6.47 (p = 0.076 and 0.084) up to a magnetic field (H) of 34.5 T, a poorly understood region of the underdoped H-T-p phase space. We observe two regimes in the low-temperature limit: below a characteristic magnetic field H' ~ 12-15 T, Celec/T obeys an expected H1/2 behaviour; however, near H' there is a sharp inflection followed by a linear-in-H behaviour. H' rests deep within the superconducting phase and, thus, the linear-in-H behaviour is observed in the zero-resistance regime. In the limit of zero temperature, Celec/T is proportional to the zero-energy electronic density of states. At one of our dopings, the inflection is sharp only at lowest temperatures, and we thus conclude that this inflection is evidence of a magnetic-field-driven quantum phase transition.

  15. Normal state transport studies of Bi2Sr2 Ca n-1CunOy thin films at different doping levels and manifestation of the pseudogap

    NASA Astrophysics Data System (ADS)

    Raffy, H.

    2002-03-01

    We have studied the evolution of the transport properties of Bi2Sr2 Ca n-1CunOy (n=1, 2) epitaxial thin films as function of doping p. For each phase, this was done on a single film by changing the oxygen content going from a maximally overdoped to a strongly underdoped non superconducting state(Z. Konstantinovic, Z.Z. Li and H. Raffy, Physica C 351, 163 (2001)). The behaviour of the resistance versus T and of the Hall effect will be described in the different regions of the phase diagram. In the underdoped region the pseudogap manifests itself on R(T) by a more rapid decrease or a reduction of the scattering rate below a temperature T*, representing an energy /temperature scale. It is observed that the resistivity curves can be scaled to a universal curve as a function of T/T*. Magnetoresistance measurements performed up to 20 Teslas do not show any significant change of this curve or of T*. The Hall constant RH(T) shows similar temperature dependence for both phases, with a broad maximum around 100K. The cotangent of the Hall angle can be described, above a temperature T0 (p), by a law of the form a+bT^m with 1.65

  16. Mechanisms for Superconductivity in Cuprates compared with results from the Generalized MacMillan-Rowell Analysis of High Resolution Laser- ARPES

    NASA Astrophysics Data System (ADS)

    Varma, Chandra; Choi, Han-Yong; Zhang, Wentao; Zhou, Xingjiang

    2012-02-01

    The spectra of fluctuations and their coupling to fermions has been deduced from extensive high resolution laser ARPES in several BISCCO samples and quantitatively analyzed. We ask the question whether some of the theories for superconductivity in Cuprates are consistent or inconsistent with the frequency and the momentum dependence of the deductions. We find that any fluctuation spectra, for example that of Antiferromagnetic Fluctuations, whose frequency dependence depends significantly on momentum dependence are excluded. We consider the quantum-critical spectra of the loop-current order observed in under-doped cuprates and its coupling to fermions and find it consistent with the data.

  17. Progressive slowing down of spin fluctuations in underdoped LaFeAsO1-xFx

    NASA Astrophysics Data System (ADS)

    Hammerath, F.; Gräfe, U.; Kühne, T.; Kühne, H.; Kuhns, P. L.; Reyes, A. P.; Lang, G.; Wurmehl, S.; Büchner, B.; Carretta, P.; Grafe, H.-J.

    2013-09-01

    The evolution of low-energy spin dynamics in the iron-based superconductor LaFeAsO1-xFx was studied over a broad doping, temperature, and magnetic field range (x= 0-0.15, T≤ 480 K, μ0H≤ 30 T) by means of 75As nuclear magnetic resonance. An enhanced spin-lattice relaxation rate divided by temperature (T1T)-1 in underdoped superconducting samples (x= 0.045, 0.05, and 0.075) suggests the presence of antiferromagnetic spin fluctuations, which are strongly reduced in optimally doped (x=0.10) and completely absent in overdoped (x=0.15) samples. In contrast to previous analysis, Curie-Weiss fits are shown to be insufficient to describe the data over the whole temperature range. Instead, a Bloembergen-Purcell-Pound (BPP) model is used to describe the occurrence of a peak in (T1T)-1 clearly above the superconducting transition, reflecting a progressive slowing down of the spin fluctuations down to the superconducting phase transition.

  18. Pressure tuning of structure, superconductivity, and novel magnetic order in the Ce-underdoped electron-doped cuprate T ' - Pr 1.3 - x La 0.7 Ce x CuO 4 ( x = 0.1 )

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guguchia, Z.; Adachi, T.; Shermadini, Z.

    High-pressure neutron powder diffraction, muon-spin rotation, and magnetization studies of the structural, magnetic, and the superconducting properties of the Ce-underdoped superconducting (SC) electron-doped cuprate system with the Nd 2 CuO 4 (the so-called T ' ) structure T ' - Pr 1.3 - x La 0.7 Ce x CuO 4 with x = 0.1 are reported. A strong reduction of the in-plane and out-of-plane lattice constants is observed under pressure. However, no indication of any pressure-induced phase transition from T ' to the K 2 NiF 4 (the so-called T) structure is observed up to the maximum applied pressure ofmore » p = 11 GPa. Large and nonlinear increase of the short-range magnetic order temperature T so in T ' - Pr 1.3 - x La 0.7 Ce x CuO 4 ( x = 0.1 ) was observed under pressure. Simultaneous pressure causes a nonlinear decrease of the SC transition temperature T c . All these experiments establish the short-range magnetic order as an intrinsic and competing phase in SC T ' - Pr 1.3 - x La 0.7 Ce x CuO 4 ( x = 0.1 ). The observed pressure effects may be interpreted in terms of the improved nesting conditions through the reduction of the in-plane and out-of-plane lattice constants upon hydrostatic pressure.« less

  19. Dependence of the critical temperature in overdoped copper oxides on superfluid density

    DOE PAGES

    Božović, I.; He, X.; Wu, J.; ...

    2016-08-17

    The physics of underdoped copper-oxide superconductors, including the pseudogap, spin and charge ordering, and their relation to superconductivity 1-3, is intensely debated. The overdoped side is perceived as simpler, with strongly-correlated fermion physics evolving smoothly into the conventional Bardeen-Cooper-Schrieffer (BCS) behavior. Pioneering studies on a few overdoped samples 4-11 indicated that the superfluid density was much smaller than expected, but this was attributed to pair-breaking, disorder, and phase separation. Here, we test this conjecture by studying how the magnetic penetration depth λ and the phase stiffness ρs depend on temperature and doping, scanning densely the entire overdoped side of themore » La 2-xSr xCuO 4 (LSCO) phase diagram. We have measured the absolute values of λ and ρs to the accuracy of ±1% in thousands of cuprate samples; the large statistics reveals clear trends and intrinsic properties. The films are quite homogeneous; variations in the critical temperature (T c) within a film are very small (< 1 K). At every doping, ρs(T) decreases linearly with temperature. The T c(ρ s0) dependence is linear but with an offset, (T c - T 0) ∝ ρs0 where T0 ≈ 7 K, except very close to the origin where Tc ∝ √ρ s0. This scaling law defies the standard BCS description, posing a challenge to theory.« less

  20. Pressure and high-Tc superconductivity in sulfur hydrides.

    PubMed

    Gor'kov, Lev P; Kresin, Vladimir Z

    2016-05-11

    The paper discusses fundamentals of record-TC superconductivity discovered under high pressure in sulfur hydride. The rapid increase of TC with pressure in the vicinity of Pcr ≈ 123GPa is interpreted as the fingerprint of a first-order structural transition. Based on the cubic symmetry of the high-TC phase, it is argued that the lower-TC phase has a different periodicity, possibly related to an instability with a commensurate structural vector. In addition to the acoustic branches, the phonon spectrum of H3S contains hydrogen modes with much higher frequencies. Because of the complex spectrum, usual methods of calculating TC are here inapplicable. A modified approach is formulated and shown to provide realistic values for TC and to determine the relative contributions of optical and acoustic branches. The isotope effect (change of TC upon Deuterium for Hydrogen substitution) originates from high frequency phonons and differs in the two phases. The decrease of TC following its maximum in the high-TC phase is a sign of intermixing with pairing at hole-like pockets which arise in the energy spectrum of the cubic phase at the structural transition. On-pockets pairing leads to the appearance of a second gap and is remarkable for its non-adiabatic regime: hydrogen mode frequencies are comparable to the Fermi energy.

  1. Identification of Trypanosoma cruzi discrete typing units (DTUs) through the implementation of a high-resolution melting (HRM) genotyping assay.

    PubMed

    Higuera, Sonia L; Guhl, Felipe; Ramírez, Juan David

    2013-04-20

    Chagas disease, caused by Trypanosoma cruzi, is a geographically widespread anthropozoonosis that is considered a major public health problem in Latin America. Because this parasite presents high genetic variability, a nomenclature has been adopted to classify the parasite into six discrete typing units (DTUs): TcI, TcII, TcIII, TcIV, TcV, and TcVI, which present different eco-epidemiological, clinical, and geographic associations. Currently, the available genotyping methods present a series of drawbacks that implies the need for developing new methods for characterizing T. cruzi DTU's. The aim of this work was to genotype reference populations from T. cruzi by means of a High-Resolution Melting (HRM) genotyping assay. Amplification of the mini-exon gene allowed the genotyping of three distinct groups: TcI, TcII- TcIV- TcV, and TcIII-TcVI, while amplification of the 24sα gene generated non-overlapping melting temperature ranges for each DTU that were used to identify the groups in the six existing DTUs of Trypanosoma cruzi. The proposed genotyping assay allowed discrimination of the six genetic groups by obtaining specific melting curves for each DTU. The application of this technique is proposed because of its specificity, sensitivity, high performance, and low cost compared with other previously described characterization methods.

  2. Simple methodology to directly genotype Trypanosoma cruzi discrete typing units in single and mixed infections from human blood samples.

    PubMed

    Bontempi, Iván A; Bizai, María L; Ortiz, Sylvia; Manattini, Silvia; Fabbro, Diana; Solari, Aldo; Diez, Cristina

    2016-09-01

    Different DNA markers to genotype Trypanosoma cruzi are now available. However, due to the low quantity of parasites present in biological samples, DNA markers with high copy number like kinetoplast minicircles are needed. The aim of this study was to complete a DNA assay called minicircle lineage specific-PCR (MLS-PCR) previously developed to genotype the T. cruzi DTUs TcV and TcVI, in order to genotype DTUs TcI and TcII and to improve TcVI detection. We screened kinetoplast minicircle hypervariable sequences from cloned PCR products from reference strains belonging to the mentioned DTUs using specific kDNA probes. With the four highly specific sequences selected, we designed primers to be used in the MLS-PCR to directly genotype T. cruzi from biological samples. High specificity and sensitivity were obtained when we evaluated the new approach for TcI, TcII, TcV and TcVI genotyping in twenty two T. cruzi reference strains. Afterward, we compared it with hybridization tests using specific kDNA probes in 32 blood samples from chronic chagasic patients from North Eastern Argentina. With both tests we were able to genotype 94% of the samples and the concordance between them was very good (kappa=0.855). The most frequent T. cruzi DTUs detected were TcV and TcVI, followed by TcII and much lower TcI. A unique T. cruzi DTU was detected in 18 samples meantime more than one in the remaining; being TcV and TcVI the most frequent association. A high percentage of mixed detections were obtained with both assays and its impact was discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Denitrifying sulfide removal process on high-tetracycline wastewater.

    PubMed

    Liu, Chunshuang; Xu, Jian; Lee, Duu-Jong; Yu, Daoyong; Liu, Lihong

    2016-04-01

    Antibiotics wastewater from tetracycline (TC) production unit can have high levels of chemical oxygen demand, ammonium and sulfate and up to a few hundreds of milligrams per liter of TC. Denitrifying sulfide removal (DSR) process is set up for simultaneously removal of sulfur, carbon and nitrogen from waters. The DSR process was for the first time studied for treating TC wastewaters. The TC stress has no adverse effects on removal rates of nitrate and acetate; however, it moderately deteriorated sulfide removal rates and S(0) accumulation rates when the concentration is higher than 100mgL(-1) TC. The Thauera sp., and Pseudomonas sp. present the heterotrophs and Sulfurovum sp. presented the autotroph for the present DSR reactions. The high tolerance of TC stress by the tested consortium was explained by the excess production of extracellular polymeric substances at high TC concentration, which can bind with TC for minimizing its inhibition effects. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  5. James C. McGroddy Prize Lecutre: Iron-Based Superconductors: Discovery and Progress

    NASA Astrophysics Data System (ADS)

    Hosono, Hideo

    2015-03-01

    The largest breakthrough in the history is the discovery of high Tc Cuprates by G.Bednorz and A.Muller in 1986 and the maximum Tc exceeded 77K, boiling temperature of liquid nitrogen in 1987. However, no new superconductors with high Tc had been reported since then except MgB2 (Tc =39K) discovered by J.Akimitsu in 2001.We found LaFePO superconductor with Tc =3K in 2006 and LaFeAsO1-xFx with Tc =26K (42K at under high pressure of 5GPa) in early 2008. The latter discovery rekindled the extensive superconductivity research globally, and more than 10,000 papers have been published to now. This excitement originates from disprovement of a widely accepted belief that iron with a large magnetic moment is harmful for emergence of superconductivity and relatively high Tc. Extensive research on iron-based superconductors pushed up the maximal Tc to 56K, which is next to high Tc cuprates and has led to the discovery of more than 50 new iron-based superconducting materials to date. Seen are so many advances in elucidation of superconducting properties and pairing mechanism. In this talk, I introduce a tale to the discovery and show the current status by reviewing progresses in materials, properties, mechanism and the application covering the recent hot topics. Emphases are placed on the unique characteristics arising from multi-orbital nature which totally differs from high Tc cuprates.

  6. Use of Tc-99m-galactosyl-neoglycoalbumin (Tc-NGA) to determine hepatic blood flow

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stadalnik, R.C.; Vera, D.R.; Woodle, E.S.

    1984-01-01

    Tc-NGA is a new liver radiopharmaceutical which binds to a hepatocyte-specific membrane receptor. Three characteristics of Tc-NGA can be exploited in the measurement of hepatic blood flow (HBF): 1) ability to alter the affinity of Tc-NGA for its receptor by changing the galactose: albumin ratio; 2) ability to achieve a high specific activity with Tc-99m labeling; and 3) ability to administer a high molar dose of Tc-NGA without physiologic side effects. In addition, kinetic modeling of Tc-NGA dynamic data can provide estimates of hepatic receptor concentration. In experimental studies in young pigs, HBF was determined using two techniques: 1) kineticmore » modeling of dynamic data using moderate affinity, low specific activity Tc-NGA (Group A, n=12); and 2) clearance (CL) technique using high affinity, high specific activity Tc-NGA (Group B, n=4). In both groups, HBF was determined simultaneously by continuous infusion of indocyanine green (CI-ICG) with hepatic vein sampling. Regression analysis of HBF measurements obtained with the Tc-NGA kinetic modeling technique and the CI-ICG technique (Group A) revealed good correlation between the two techniques (r=0.802, p=0.02). Similarly, HBF determination by the clearance technique (Group B) provided highly accurate measurements when compared to the CI-ICG technique. Hepatic blood flow measurements by the clearance technique (CL-NGA) fell within one standard deviation of the error associated with each CI-ICG HBF measurement (all CI-ICG standard deviations were less than 10%).« less

  7. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  8. Effect of Structural Relaxation on the In-Plane Electrical Resistance of Oxygen-Underdoped ReBaCuO (Re = Y, Ho) Single Crystals

    NASA Astrophysics Data System (ADS)

    Vovk, Ruslan V.; Vovk, Nikolaj R.; Dobrovolskiy, Oleksandr V.

    2014-05-01

    The effect of jumpwise temperature variation and room-temperature storing on the basal-plane electrical resistivity of underdoped ReBaCuO (Re = Y, Ho) single crystals is investigated. Reducing the oxygen content has been revealed to lead to the phase segregation accompanied by both, labile component diffusion and structural relaxation in the sample volume. Room-temperature storing of single crystals with different oxygen hypostoichiometries leads to a substantial widening of the rectilinear segment in in conjunction with a narrowing of the temperature range of existence of the pseudogap state. It is established that the excess conductivity obeys an exponential law in a broad temperature range, while the pseudogap's temperature dependence is described satisfactory in the framework of the BCS-BEC crossover theory. Substituting yttrium with holmium essentially effects the charge distribution and the effective interaction in CuO planes, thereby stimulating disordering processes in the oxygen subsystem. This is accompanied by a notable shift of the temperature zones corresponding to transitions of the metal-insulator type and to the regime of manifestation of the pseudogap anomaly.

  9. Techniques for Connecting Superconducting Thin Films

    NASA Technical Reports Server (NTRS)

    Mester, John; Gwo, Dz-Hung

    2006-01-01

    Several improved techniques for connecting superconducting thin films on substrates have been developed. The techniques afford some versatility for tailoring the electronic and mechanical characteristics of junctions between superconductors in experimental electronic devices. The techniques are particularly useful for making superconducting or alternatively normally conductive junctions (e.g., Josephson junctions) between patterned superconducting thin films in order to exploit electron quantum-tunneling effects. The techniques are applicable to both low-Tc and high-Tc superconductors (where Tc represents the superconducting- transition temperature of a given material), offering different advantages for each. Most low-Tc superconductors are metallic, and heretofore, connections among them have been made by spot welding. Most high-Tc superconductors are nonmetallic and cannot be spot welded. These techniques offer alternatives to spot welding of most low-Tc superconductors and additional solutions to problems of connecting most high-Tc superconductors.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Neeway, James J.; Asmussen, R. Matthew; Lawter, Amanda R.

    Many efforts have focused on the sequestration and immobilization of 99Tc because the radionuclide is highly mobile in oxidizing environments and presents serious health risks due to its radiotoxicity and long half-life (t1/2 = 213 000 a). One of the more common methods for Tc removal from solution and immobilization in solids is based on reducing Tc from highly soluble Tc(VII) to sparingly soluble Tc(IV). In order to remove solution Tc through this reduction process, the Tc-sequestering solid must contain a reducing agent and, ideally, the Tc-sequestering material would function in a large range of chemical environments. For long-term stability,more » the reduced Tc would preferentially be incorporated into the resulting mineral structure instead of simply being sorbed onto the mineral surface. Here, we report results obtained from batch sorption experiments performed in anoxic and oxic conditions with two sulfide-containing potassium metal sulfide (KMS) materials, known as KMS-2 and KMS-2-SS. In deionized water in anoxic conditions after 15 d of contact, KMS-2 is capable of removing ~45% of Tc and KMS-2-SS is capable of removing ~90% of Tc. The improved performance of KMS-2-SS compared to KMS-2 in deionized water in anoxic conditions appears to be linked both to a higher pH resulting from the batch sorption experiments performed with KMS-2-SS and a higher overall purity of KMS-2-SS. Both materials perform even better in highly caustic (pH~13.5), high ionic strength (8.0 M) simulated Hanford low-activity waste solutions, removing more than 90% Tc after 15 d of contact in anoxic conditions. Post-reaction solids analysis indicate that Tc(VII) is reduced to Tc(IV) and that Tc(IV) is bonded to S atoms in the resulting KMS-2 structure in a Tc2S7 form. In contrast to previous ion exchange experiments with other KMS materials, the batch sorption experiments examining Tc removal cause the initially crystalline KMS materials to lose much of their initial long-range order.« less

  11. Natural and emergent Trypanosoma cruzi I genotypes revealed by mitochondrial (Cytb) and nuclear (SSU rDNA) genetic markers.

    PubMed

    Ramírez, Juan David; Duque, María Clara; Montilla, Marleny; Cucunubá, Zulma; Guhl, Felipe

    2012-12-01

    Chagas disease is a tropical and systemic disease caused by the parasite Trypanosoma cruzi. This parasite has been divided into six Discrete Typing Units (DTU's) due to its high genetic diversity. T. cruzi I (TcI) is the most prevalent DTU in Colombia and recently associated to cardiomyopathies. The aim of this study was to unravel the genetic variability among a set of 70 cell-single TcI clones from different geographical regions and hosts using the sequences of Cytb and SSU rDNA. The results showed two genotypes associated to transmission cycles of Chagas disease in Colombia and supports the previous descriptions using SL-IR. Phylogenetic networks were developed detecting recombination events within TcI. We also tested the phylogenetic relationships beneath TcI clones and TcIII/TcIV sequences observing the high relatedness of TcI clones from sylvatic cycle with TcIII/TcIV. We corroborate the high genetic diversity displayed by TcI, the plausible recombination within this DTU supporting the previous model of genetic exchange proposed in T. cruzi populations. We conclude inquiring the need to pursue new studies to elucidate the genetic structure of TcI across Chagas disease endemic countries. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Vertical distributions of (99)Tc and the (99)Tc/(137)Cs activity ratio in the coastal water off Aomori, Japan.

    PubMed

    Nakanishi, Takahiro; Zheng, Jian; Aono, Tatsuo; Yamada, Masatoshi; Kusakabe, Masashi

    2011-08-01

    Using a sector-field ICP-MS the vertical distributions of the (99)Tc concentration and (99)Tc/(137)Cs activity ratio were measured in the coastal waters off Aomori Prefecture, Japan, where a spent-nuclear-fuel reprocessing plant has begun test operation. The (99)Tc concentrations in surface water ranged from 1.8 to 2.4 mBq/m(3), no greater than the estimated background level. Relatively high (99)Tc/(137)Cs activity ratios (10-12 × 10(-4)) would be caused by the inflow of the high-(99)Tc/(137)Cs water mass from the Japan Sea. There is no observable contamination from the reprocessing plant in the investigated area. The (99)Tc concentration and the (99)Tc/(137)Cs activity ratio in water column showed gradual decreases with depth. Our results implied that (99)Tc behaves in a more conservative manner than (137)Cs in marine environments. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. Mixed-state Hall effect of high-T(c) superconductors

    NASA Astrophysics Data System (ADS)

    Kang, Byeongwon

    In this dissertation, we presented the study on the mixed-state Hall effect of high-Tc superconductors (HTSs). In order to understand the mechanisms of the puzzling phenomena in the mixed-state Hall effect of HTSs, the Hall sign anomaly and scaling behavior, Hall measurements are conducted in several HTS thin films. We investigate the mechanism of the sign reversal of the Hall resistivity in Tl-2201 films when the electronic band structure is varied through the underdoped, optimally doped, and overdoped regions. It is found that the Hall sign reversals are an intrinsic property of HTSs and determined by electronic band structure. Although pinning is not found to be the mechanism behind sign reversals, pinning can suppress the appearance of the Hall sign reversal. Therefore, it is concluded that two (or more) sign reversals are a generic behavior of HTSs. From a systematic study of the vortex phase diagram, we discover several new features of the vortex liquid. In the presence of pinning, the vortex-liquid phase can be divided into two regions, a glassy liquid (GL) where vortices remain correlated as manifested in non-Ohmic resistivity, and a regular liquid (RL) where resistivity becomes Ohmic as vortices become uncorrelated. The field dependence of the Hall angle is found to be linear in the RL and nonlinear in the GL. Generally the decoupling line (Hk- T), which is defined as a boundary between the GL and the RL, is lower than the depinning line (Hd-T). As pinning increases the Hk-T may approach the Hd-T, thus vortices are decoupled and depinned nearly simultaneously. For a weak pinning system, on the other hand, the Hk-T and the Hd-T are well separated so that single vortices remain pinned in the region Hk ≤ H ≥ Hd. The behavior of s xy is also investigated in the GL and the RL. In the GL s xy is observed to strongly depend on pinning due to the inter-vortex correlation whereas in the RL s xy is independent of pinning since the pinning effect is scaled out.

  14. Reductive Sequestration Of Pertechnetate (99TcO4–) By Nano Zerovalent Iron (nZVI) Transformed By Abiotic Sulfide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fan, Dimin; Anitori, Roberto; Tebo, Bradley M.

    2013-04-24

    Under anoxic conditions, soluble 99TcO4– can be reduced to less soluble TcO2•nH2O, but the oxide is highly susceptible to reoxidation. Here we investigate an alternative strategy for remediation of Tc-contaminated groundwater whereby sequestration as Tc sulfide is favored by sulfidic conditions stimulated by nano zero-valent iron (nZVI). nZVI was pre-exposed to increasing concentrations of sulfide in simulated Hanford groundwater for 24 hrs to mimic the stages of aquifer sulfate reduction and onset of biotic sulfidogenesis. Solid-phase characterizations of the sulfidated nZVI confirmed the formation of nanocrystalline FeS phases, but higher S/Fe ratios (>0.112) did not result in the formation ofmore » significantly more FeS. The kinetics of Tc sequestration by these materials showed faster Tc removal rates with increasing S/Fe between S/Fe = 0–0.056, but decreasing Tc removal rates with S/Fe > 0.224. The more favorable Tc removal kinetics at low S/Fe could be due to a higher affinity of TcO4– for FeS (over iron oxides), and electron microscopy confirmed that the majority of the Tc was associated with FeS phases. The inhibition of Tc removal at high S/Fe appears to have been caused by excess HS–. X-ray absorption spectroscopy revealed that as S/Fe increased, Tc speciation shifted from TcO2•nH2O to TcS2. The most substantial change of Tc speciation occurred at low S/Fe, coinciding with the rapid increase of Tc removal rate. This agreement further confirms the importance of FeS in Tc sequestration.« less

  15. Size, Shape and Impurity Effects on Superconducting critical temperature.

    NASA Astrophysics Data System (ADS)

    Umeda, Masaki; Kato, Masaru; Sato, Osamu

    Bulk superconductors have their own critical temperatures Tc. However, for a nano-structured superconductor, Tc depends on size and shape of the superconductor. Nishizaki showed that the high pressure torsion on bulks of Nb makes Tc higher, because the torsion makes many nano-sized fine grains in the bulks. However the high pressure torsion on bulks of V makes Tc lower, and Nishizaki discussed that the decrease of Tc is caused by impurities in the bulks of V. We studied size, shape, and impurity effects on Tc, by solving the Gor'kov equations, using the finite element method. We found that smaller and narrower superconductors show higher Tc. We found how size and shape affects Tc by studying spacial order parameter distributions and quasi-particle eigen-energies. Also we studied the impurity effects on Tc, and found that Tc decreases with increase of scattering rate by impurities. This work was supported in part of KAKENHI Grant Number JP26400367 and JP16K05460, and program for leading graduate schools of ministry of education, culture, sports, science and technology-Japan.

  16. Electronic Phase Separation in Iron Selenide (Li,Fe)OHFeSe Superconductor System

    NASA Astrophysics Data System (ADS)

    Mao, Yiyuan; Li, Jun; Huan, Yulong; Yuan, Jie; Li, Zi-an; Chai, Ke; Ma, Mingwei; Ni, Shunli; Tian, Jinpeng; Liu, Shaobo; Zhou, Huaxue; Zhou, Fang; Li, Jianqi; Zhang, Guangming; Jin, Kui; Dong, Xiaoli; Zhao, Zhongxian

    2018-05-01

    The phenomenon of phase separation into antiferromagnetic (AFM) and superconducting (SC) or normal-state regions has great implication for the origin of high-temperature (high-Tc) superconductivity. However, the occurrence of an intrinsic antiferromagnetism above the Tc of (Li, Fe)OHFeSe superconductor is questioned. Here we report a systematic study on a series of (Li, Fe)OHFeSe single crystal samples with Tc up to ~41 K. We observe an evident drop in the static magnetization at Tafm ~125 K, in some of the SC (Tc < ~38 K, cell parameter c < ~9.27 {\\AA}) and non-SC samples. We verify that this AFM signal is intrinsic to (Li, Fe)OHFeSe. Thus, our observations indicate mesoscopic-to-macroscopic coexistence of an AFM state with the normal (below Tafm) or SC (below Tc) state in (Li, Fe)OHFeSe. We explain such coexistence by electronic phase separation, similar to that in high-Tc cuprates and iron arsenides. However, such an AFM signal can be absent in some other samples of (Li, Fe)OHFeSe, particularly it is never observed in the SC samples of Tc > ~38 K, owing to a spatial scale of the phase separation too small for the macroscopic magnetic probe. For this case, we propose a microscopic electronic phase separation. It is suggested that the microscopic static phase separation reaches vanishing point in high-Tc (Li, Fe)OHFeSe, by the occurrence of two-dimensional AFM spin fluctuations below nearly the same temperature as Tafm reported previously for a (Li, Fe)OHFeSe (Tc ~42 K) single crystal. A complete phase diagram is thus established. Our study provides key information of the underlying physics for high-Tc superconductivity.

  17. Thermal Expansion Behavior in TcO2. Toward Breaking the Tc-Tc Bond.

    PubMed

    Reynolds, Emily; Zhang, Zhaoming; Avdeev, Maxim; Thorogood, Gordon J; Poineau, Frederic; Czerwinski, Kenneth R; Kimpton, Justin A; Kennedy, Brendan J

    2017-08-07

    The structure of TcO 2 between 25 and 1000 °C has been determined in situ using X-ray powder diffraction methods and is found to remain monoclinic in space group P2 1 /c. Thermal expansion in TcO 2 is highly anisotropic, with negative thermal expansion of the b axis observed above 700 °C. This is the result of an anomalous expansion along the a axis that is a consequence of weakening of the Tc-Tc bonds.

  18. The relationships between precipitation, convective cloud and tropical cyclone intensity change

    NASA Astrophysics Data System (ADS)

    Ruan, Z.; Wu, Q.

    2017-12-01

    Using 16 years precipitation, brightness temperature (IR BT) data and tropical cyclone (TC) information, this study explores the relationship between precipitation, convective cloud and tropical cyclone (TC) intensity change in the Western North Pacific Ocean. It is found that TC intensity has positive relation with TC precipitation. TC precipitation increases with increased TC intensity. Based on the different phase of diurnal cycle, convective TC clouds were divided into very cold deep convective clouds (IR BTs<208K) and cold high clouds (208K

  19. The protein family TcTASV-C is a novel Trypanosoma cruzi virulence factor secreted in extracellular vesicles by trypomastigotes and highly expressed in bloodstream forms.

    PubMed

    Caeiro, Lucas D; Alba-Soto, Catalina D; Rizzi, Mariana; Solana, María Elisa; Rodriguez, Giselle; Chidichimo, Agustina M; Rodriguez, Matías E; Sánchez, Daniel O; Levy, Gabriela V; Tekiel, Valeria

    2018-05-01

    TcTASV-C is a protein family of about 15 members that is expressed only in the trypomastigote stage of Trypanosoma cruzi. We have previously shown that TcTASV-C is located at the parasite surface and secreted to the medium. Here we report that the expression of different TcTASV-C genes occurs simultaneously at the trypomastigote stage and while some secreted and parasite-associated products are found in both fractions, others are different. Secreted TcTASV-C are mainly shedded through trypomastigote extracellular vesicles, of which they are an abundant constituent, despite its scarce expression on culture-derived trypomastigotes. In contrast, TcTASV-C is highly expressed in bloodstream trypomastigotes; its upregulation in bloodstream parasites was observed in different T. cruzi strains and was specific for TcTASV-C, suggesting that some host-molecules trigger TcTASV-C expression. TcTASV-C is also strongly secreted by bloodstream parasites. A DNA prime-protein boost immunization scheme with TcTASV-C was only partially effective to control the infection in mice challenged with a highly virulent T. cruzi strain. Vaccination triggered a strong humoral response that delayed the appearance of bloodstream trypomastigotes at the early phase of the infection. Linear epitopes recognized by vaccinated mice were mapped within the TcTASV-C family motif, suggesting that blockade of secreted TcTASV-C impacts on the settlement of infection. Furthermore, although experimental and naturally T. cruzi-infected hosts did not react with antigens from extracellular vesicles, vaccinated and challenged mice recognized not only TcTASV-C but also other vesicle-antigens. We hypothesize that TcTASV-C is involved in the establishment of the initial T. cruzi infection in the mammalian host. Altogether, these results point towards TcTASV-C as a novel secreted virulence factor of T. cruzi trypomastigotes.

  20. The function of Sn(II)-apatite as a Tc immobilizing agent

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Asmussen, R. Matthew; Neeway, James J.; Lawter, Amanda R.

    2016-11-01

    Technetium-99 is a radioactive contaminant of high concern at many nuclear waste storage sites. At the U.S. Department of Energy Hanford Site, 99Tc is a component of low-activity waste (LAW) fractions of the nuclear tank waste, which are highly caustic, high ionic strength and have high concentrations of chromate. Removal of 99Tc from LAW streams would greatly benefit the site remediation process. In this study, we investigated the removal of 99Tc(VII), as pertechnetate, from deionized water (DIW) and a LAW simulant using two solid sorbents, tin (II) apatite (Sn-A) and SnCl2 through batch sorption testing and solid phase characterization. Sn-Amore » showed higher levels of removal of Tc from both DIW and LAW simulant compared with the SnCl2. Scanning electron microscopy/energy dispersive X-ray spectroscopy (SEM/XEDS) and X-ray adsorption spectroscopy (XAS) of Sn-A following batch experiments in DIW showed that TcO4- is reduced to Tc(IV) on the Sn-A surface with no incorporation into the lattice structure of Sn-A. The performance of Sn-A in the LAW simulant was lowered due to a combined effect of the high alkalinity, which lead to an increased dissolution of Sn from the Sn-A, and a preference for the reduction of Cr(VI) over Tc(VII).« less

  1. Spatiotemporal Co-existence of Female Thyroid and Breast Cancers in Hangzhou, China

    NASA Astrophysics Data System (ADS)

    Fei, Xufeng; Christakos, George; Lou, Zhaohan; Ren, Yanjun; Liu, Qingmin; Wu, Jiaping

    2016-06-01

    Thyroid and breast cancers (TC, BC) are common female malignant tumors worldwide. Studies suggest that TC patients have a higher BC risk, and vice versa. However, it has not been investigated quantitatively if there is an association between the space-time TC and BC incidence distributions at the population level. This work aims to answer this question. 5358 TC and 8784 BC (female) cases were diagnosed in Hangzhou (China, 2008-2012). Pearson and Spearman rank correlation coefficients of the TC and BC incidences were high, and their patterns were geographically similar. The spatiotemporal co-existence of TC and BC distributions was investigated using the integrative disease predictability (IDP) criterion: if TC-BC association is part of the disease mapping knowledge bases, it should yield improved space-time incidence predictions. Improved TC (BC) incidence predictions were generated when integrating both TC and BC data than when using only TC (BC) data. IDP consistently demonstrated the spatiotemporal co-existence of TC and BC distributions throughout Hangzhou (2008-2012), which means that when the population experiences high incidences of one kind of cancer attention should be paid to the other kind of cancer too. The strength of TC-BC association was measured by the IDP coefficients and incidence prediction accuracy.

  2. Spatiotemporal Co-existence of Female Thyroid and Breast Cancers in Hangzhou, China

    PubMed Central

    Fei, Xufeng; Christakos, George; Lou, Zhaohan; Ren, Yanjun; Liu, Qingmin; Wu, Jiaping

    2016-01-01

    Thyroid and breast cancers (TC, BC) are common female malignant tumors worldwide. Studies suggest that TC patients have a higher BC risk, and vice versa. However, it has not been investigated quantitatively if there is an association between the space-time TC and BC incidence distributions at the population level. This work aims to answer this question. 5358 TC and 8784 BC (female) cases were diagnosed in Hangzhou (China, 2008–2012). Pearson and Spearman rank correlation coefficients of the TC and BC incidences were high, and their patterns were geographically similar. The spatiotemporal co-existence of TC and BC distributions was investigated using the integrative disease predictability (IDP) criterion: if TC-BC association is part of the disease mapping knowledge bases, it should yield improved space-time incidence predictions. Improved TC (BC) incidence predictions were generated when integrating both TC and BC data than when using only TC (BC) data. IDP consistently demonstrated the spatiotemporal co-existence of TC and BC distributions throughout Hangzhou (2008–2012), which means that when the population experiences high incidences of one kind of cancer attention should be paid to the other kind of cancer too. The strength of TC-BC association was measured by the IDP coefficients and incidence prediction accuracy. PMID:27341638

  3. Microscopic model for the isotope effect in the high-Tc oxides

    NASA Astrophysics Data System (ADS)

    Kresin, V. Z.; Wolf, S. A.

    1994-02-01

    An unconventional microscopic mechanism relating Tc and the isotope substitution for the doped superconductors such as the high-Tc oxides is proposed. Strong nonadiabaticity, when it is impossible, strictly speaking, to separate fully the nuclear and electronic degrees of freedom, leads to a peculiar dependence of the carrier concentration n on the ionic mass M. This case corresponds, for example, to the isotopic substitution of the axial oxygen in YBa2Cu3O7-x. Because of the dependence of Tc on n, this leads to the dependence of Tc on M, that is to the isotope effect. The minimum value of the isotope coefficient corresponds to Tc=Tmaxc.

  4. Colloquium: High pressure and road to room temperature superconductivity

    NASA Astrophysics Data System (ADS)

    Gor'kov, Lev P.; Kresin, Vladimir Z.

    2018-01-01

    This Colloquium is concerned with the superconducting state of new high-Tc compounds containing hydrogen ions (hydrides). Recently superconductivity with the record-setting transition temperature of Tc=203 K was reported for sulfur hydrides under high pressure. In general, high pressure serves as a path finding tool toward novel structures, including those with very high Tc . The field has a rich and interesting history. Currently, it is broadly recognized that superconductivity in sulfur hydrides owes its origin to the phonon mechanism. However, the picture differs from the conventional one in important ways. The phonon spectrum in sulfur hydride is both broad and has a complex structure. Superconductivity arises mainly due to strong coupling to the high-frequency optical modes, although the acoustic phonons also make a noticeable contribution. A new approach is described, which generalizes the standard treatment of the phonon mechanism and makes it possible to obtain an analytical expression for Tc in this phase. It turns out that, unlike in the conventional case, the value of the isotope coefficient (for the deuterium-hydrogen substitution) varies with the pressure and reflects the impact of the optical modes. The phase diagram, that is the pressure dependence of Tc , is rather peculiar. A crucial feature is that increasing pressure results in a series of structural transitions, including the one which yields the superconducting phase with the record Tc of 203 K. In a narrow region near P ≈150 GPa the critical temperature rises sharply from Tc≈120 to ≈200 K . It seems that the sharp structural transition, which produces the high-Tc phase, is a first-order phase transition caused by interaction between the order parameter and lattice deformations. A remarkable feature of the electronic spectrum in the high-Tc phase is the appearance of small pockets at the Fermi level. Their presence leads to a two-gap spectrum, which can, in principle, be observed with the future use of tunneling spectroscopy. This feature leads to nonmonotonic and strongly asymmetric pressure dependence of Tc . Other hydrides, e.g., CaH6 and MgH6 , can be expected to display even higher values of Tc up to room temperature. The fundamental challenge lies in the creation of a structure capable of displaying high Tc at ambient pressure.

  5. Synthesis, Characterization, and Initial Biological Evaluation of [99m Tc]Tc-Tricarbonyl-labeled DPA-α-MSH Peptide Derivatives for Potential Melanoma Imaging.

    PubMed

    Gao, Feng; Sihver, Wiebke; Bergmann, Ralf; Belter, Birgit; Bolzati, Cristina; Salvarese, Nicola; Steinbach, Jörg; Pietzsch, Jens; Pietzsch, Hans-Jürgen

    2018-06-06

    α-Melanocyte stimulating hormone (α-MSH) derivatives target the melanocortin-1 receptor (MC1R) specifically and selectively. In this study, the α-MSH-derived peptide NAP-NS1 (Nle-Asp-His-d-Phe-Arg-Trp-Gly-NH 2 ) with and without linkers was conjugated with 5-(bis(pyridin-2-ylmethyl)amino)pentanoic acid (DPA-COOH) and labeled with [ 99m Tc]Tc-tricarbonyl by two methods. With the one-pot method the labeling was faster than with the two-pot method, while obtaining similarly high yields. Negligible trans-chelation and high stability in physiological solutions was determined for the [ 99m Tc]Tc-tricarbonyl-peptide conjugates. Coupling an ethylene glycol (EG)-based linker increased the hydrophilicity. The peptide derivatives displayed high binding affinity in murine B16F10 melanoma cells as well as in human MeWo and TXM13 melanoma cell homogenates. Preliminary in vivo studies with one of the [ 99m Tc]Tc-tricarbonyl-peptide conjugates showed good stability in blood and both renal and hepatobiliary excretion. Biodistribution was performed on healthy rats to gain initial insight into the potential relevance of the 99m Tc-labeled peptides for in vivo imaging. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Technetium Reduction and Permanent Sequestration by Abiotic and Biotic Formation of Low-Solubility Sulfide Mineral Phases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tratnyek, Paul G.; Tebo, Bradley M.; Fan, Dimin

    One way to minimize the mobility of the Tc VII oxyanion pertechnetate (TcO 4 -) is to effect reduction under sulfidogenic conditions (generated abiotically by Fe 0 or biotically) to form TcS x, which is significantly slower to oxidize than Tc IVO 2. In sediment systems, TcS x and other precipitates may oxidize more slowly due to oxygen diffusion limitations to these low permeability precipitate zones. In addition, the TcO 4 - reduction rate may be more rapid in the presence of sediment because of additional reductive surface phases. This project aims to provide a fundamental understanding of the feasibilitymore » of immobilization of TcO 4 - as TcS x in the vadose zone or groundwater by application nano zero-valent iron (nZVI), and sulfide or sulfate. Biotic batch experiments have used the sulfate-reducing bacterium (SRB) Desulfotomaculum reducens. The iron sulfide mineral mackinawite was generated under these conditions, while vivianite was formed in nZVI only controls. The sulfide/bacteria-containing system consistently reduced aqueous pertechnetate rapidly (> 95% in the first hour), a rate similar to that for the sulfide-free, nZVI only system. Reduced Tc (aged for 3 months) generated in both SRB/nZVI systems was highly resistant to reoxidation. In reduced samples, Tc was found associated with solid phases containing Fe and S (D. reducens/nZVI) or Fe (nZVI only). Experiments using D. reducens without nZVI provided some additional insights. Firstly, stationary phase cultures were able to slowly reduce pertechnetate. Secondly, addition of pertechnetate at the beginning of cell growth (lag phase) resulted in a faster rate of Tc reduction, possibly indicating a direct (e.g. enzymatic) role for D. reducens in Tc reduction. Abiotic batch experiments were conducted with Na 2S as the sulfide source. Pertechnetate reduction was rapid in the presence of sulfide and nZVI, although the rate was suppressed at the higher S/Fe ratios tested. This suppression appeared to be due to the formation of Tc-containing colloids. As with the biotic experiments, pertechnetate reduced under sulfidic conditions was highly resistant to reoxidation. The microscopic morphology of abiotically-transformed nZVI particles varied significantly with those in the biotic experiment, although mackinawite was formed in both systems (as indicated by μXRD and Mössbauer spectroscopy). Preliminary XAS analysis pointed to a mixture of Tc-O and Tc-S binding in the abiotic sulfide/nZVI system, while the major reduced solids under non-sulfidic conditions were TcO 2•nH 2O. The presence of sediment and advective flow to the TcO 4 -/nZVI/sulfide system results in additional processes occurring. Although the natural Hanford sediment used has sufficient available ferrous iron to slowly reduce TcO 4 -, under anaerobic conditions, that rate is orders of magnitude slower than reduction by nZVI/sulfide. Batch and 1-D column experiments showed that the TcO 4 - reduction rate increased with the sediment surface area (with the same nZVI mass). As in batch systems, column studies showed that the presence of sulfide with TcO 4 - at low (2-5 mM) concentrations increased the TcO 4 - reduction rate and high (10-30 mM) sulfide decreased the rate. This change is attributed to the formation of sulfide precipitates on the nZVI and sediment surfaces. Injection of low and high sulfide (i.e. pretreatment) prior to TcO 4 -/sulfide injection also greatly decreased the TcO 4 - reduction rate, likely decreasing the generation of ferrous iron from the nZVI. Although the high sulfide systems have slower Tc reduction rates, 190 times more Tc mass precipitated than in the low sulfide systems and the highest fraction of Tc mass remained immobilized.« less

  7. Will Outer Tropical Cyclone Size Change due to Anthropogenic Warming?

    NASA Astrophysics Data System (ADS)

    Schenkel, B. A.; Lin, N.; Chavas, D. R.; Vecchi, G. A.; Knutson, T. R.; Oppenheimer, M.

    2017-12-01

    Prior research has shown significant interbasin and intrabasin variability in outer tropical cyclone (TC) size. Moreover, outer TC size has even been shown to vary substantially over the lifetime of the majority of TCs. However, the factors responsible for both setting initial outer TC size and determining its evolution throughout the TC lifetime remain uncertain. Given these gaps in our physical understanding, there remains uncertainty in how outer TC size will change, if at all, due to anthropogenic warming. The present study seeks to quantify whether outer TC size will change significantly in response to anthropogenic warming using data from a high-resolution global climate model and a regional hurricane model. Similar to prior work, the outer TC size metric used in this study is the radius in which the azimuthal-mean surface azimuthal wind equals 8 m/s. The initial results from the high-resolution global climate model data suggest that the distribution of outer TC size shifts significantly towards larger values in each global TC basin during future climates, as revealed by 1) statistically significant increase of the median outer TC size by 5-10% (p<0.05) according to a 1,000-sample bootstrap resampling approach with replacement and 2) statistically significant differences between distributions of outer TC size from current and future climate simulations as shown using two-sample Kolmogorov Smirnov testing (p<<0.01). Additional analysis of the high-resolution global climate model data reveals that outer TC size does not uniformly increase within each basin in future climates, but rather shows substantial locational dependence. Future work will incorporate the regional mesoscale hurricane model data to help focus on identifying the source of the spatial variability in outer TC size increases within each basin during future climates and, more importantly, why outer TC size changes in response to anthropogenic warming.

  8. Nematic-driven anisotropic electronic properties of underdoped detwinned Ba(Fe1-xCox)2As2 revealed by optical spectroscopy

    NASA Astrophysics Data System (ADS)

    Degiorgi, L.

    2015-03-01

    We collect optical reflectivity data as a function of temperature across the structural tetragonal-to-orthorhombic phase transition at Ts on Ba(Fe1-xCox)2As2 for x = 0, 2.5% and 4.5%, with uniaxial and in-situ tunable applied pressure in order to detwin the sample and to exert on it an external symmetry breaking field. At T =Ts . Moreover, the optical anisotropy gets progressively depleted with increasing Co-content in the underdoped regime, consistent with the doping dependence of the orthorhombicity but contrary to the non-monotonic behavior observed for the dc anisotropy. Our findings bear testimony for an important anisotropy of the electronic structure and thus underscore an electronic polarization upon (pressure) inducing and entering the nematic phase. Work in collaboration with: A. Dusza, C. Mirri, S. Bastelberger, A. Lucarelli (ETH Zurich) and J.H. Chu, H.H. Kuo, I.R. Fisher (Stanford University).

  9. Anomalous Thermal Diffusivity in Bad Metals

    NASA Astrophysics Data System (ADS)

    Zhang, Jiecheng; Levenson-Falk, Eli M.; Ramshaw, Brad J.; Bonn, Douglas A.; Liang, Ruixing; Hardy, Walter N.; Hartnoll, Sean A.; Kapitulnik, Aharon

    Local measurements of thermal diffusivity are used to analyze the transport of heat in the bad metallic regime of several strongly correlated materials. In underdoped YBCO systems, we use the in-plane anisotropy to analyze transport in this system. Specifically, we find that the diffusivity anisotropy is comparable to reported values of the electrical resistivity anisotropy and drops sharply below the charge order transition, suggesting that both anisotropies have the same origin. We interpret our results through a strong electron-phonon scattering picture and find that both electronic and phononic contributions to the diffusivity exhibit a saturated scattering time of ℏ /kB T . Our results suggest that neither well-defined electron nor phonon quasiparticles are present in underdoped YBCO systems, and thermal transport exhibits a collective behavior of a ''soup'' of strongly coupled electrons and phonons which moves at a velocity that is smaller than the Fermi velocity, but larger than the speed of sound. We generalize this treatment to measurements of other bad metals and discuss its implications. Work supported by the Gordon and Betty Moore Foundation through the EPiQS Initiative, Grant GBMF4529, and by a Department of Energy Early Career Award (SAH).

  10. Characterization of Non-pertechnetate Species Relevant to the Hanford Tank Waste

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chatterjee, Sayandev; Andersen, Amity; Du, Yingge

    Among radioactive constituents present in the tank waste stored at the U.S. DOE Hanford Site, technetium-99 (Tc), which is generated from the fission of 235U and 239Pu in high yields, presents a unique challenge in that it has a long half-life ( = 292 keV; T1/2 = 2.11105 y) and exists predominately in soluble forms in the liquid supernatant and salt cake fractions of the waste. In the strongly alkaline environments prevalent in most of the tank waste, its dominant chemical form is pertechnetate (TcO 4 -, oxidation state +7). However, attempts to remove Tc from the Hanford tank wastemore » using ion-exchange processes specific to TcO 4 - only met with limited success, particularly when processing tank waste samples containing elevated concentrations of organic complexants. This suggests that a significant fraction of the soluble Tc can be present as low-valent Tc (oxidation state < +7) (non-pertechnetate). The chemical identities of these non-pertechnetate species are poorly understood. Previous analysis of the SY-101 and SY-103 tank waste samples provided strong evidence that non-pertechnetate can be comprised of [fac-Tc(CO) 3] + complexes containing Tc in oxidation state +1 (Lukens et al. 2004). During the last three years, our team has expanded this work and demonstrated that high-ionic-strength solutions typifying tank waste supernatants promote oxidative stability of the [fac-Tc(CO) 3] + species (Rapko et al. 2013a; 2013b; Levitskaia et al. 2014; Chatterjee et al. 2015). Obtained results also suggest possible stabilization of Tc(VI) and potentially Tc(IV) oxidation states in the high-ionic-strength alkaline matrices particularly in the presence of organic chelators, so that Tc(IV, VI) can serve as important redox intermediates facilitating the reduction of Tc(VII) to Tc(I). Designing strategies for effective Tc management, including separation and immobilization, necessitates understanding the molecular structure of the non-pertechnetate species and their identification in the actual tank waste samples, which would facilitate development of new treatment technologies effective for dissimilar Tc species. The key FY 2016 results are summarized below.« less

  11. Reconciliation of local and long-range tilt correlations in underdoped La 2-xBa xCuO 4(0 ≤ x ≤ 0.155)

    DOE PAGES

    Bozin, Emil S.; Zhong, Ruidan; Knox, Kevin R.; ...

    2015-02-26

    A long standing puzzle regarding the disparity of local and long range CuO₆ octahedral tilt correlations in the underdoped regime of La₂₋ xBa xCuO₄ is addressed by utilizing complementary neutron powder diffraction and inelastic neutron scattering (INS) approaches. Long-range and static CuO₆ tilt order with orthogonally inequivalent Cu-O bonds in the CuO₂ planes in the low temperature tetragonal (LTT) phase is succeeded on warming through the low-temperature transition by one with orthogonally equivalent bonds in the low temperature orthorhombic (LTO) phase. In contrast, the signatures of LTT-type tilts in the instantaneous local atomic structure persist on heating throughout the LTOmore » crystallographic phase on the nanoscale, although becoming weaker as temperature increases. Analysis of the INS spectra for the x = 1/8 composition reveals the dynamic nature of the LTT-like tilt fluctuations within the LTO phase and their 3D character. The doping dependence of relevant structural parameters indicates that the magnitude of the Cu-O bond anisotropy has a maximum at x = 1/8 doping where bulk superconductivity is most strongly suppressed, suggesting that the structural anisotropy might be influenced by electron-phonon coupling and the particular stability of the stripe-ordered phase at this composition. The bond-length modulation that pins stripe order is found to be remarkably subtle, with no anomalous bond length disorder at low temperature, placing an upper limit on any in-plane Cu-O bondlength anisotropy. The results further reveal that although appreciable octahedral tilts persist through the high-temperature transition and into the high temperature tetragonal (HTT) phase, there is no significant preference between different tilt directions in the HTT regime. As a result, this study also exemplifies the importance of a systematic approach using complementary techniques when investigating systems exhibiting a large degree of complexity and subtle structural responses.« less

  12. Multilocus sequence typing (MLST) for lineage assignment and high resolution diversity studies in Trypanosoma cruzi.

    PubMed

    Yeo, Matthew; Mauricio, Isabel L; Messenger, Louisa A; Lewis, Michael D; Llewellyn, Martin S; Acosta, Nidia; Bhattacharyya, Tapan; Diosque, Patricio; Carrasco, Hernan J; Miles, Michael A

    2011-06-01

    Multilocus sequence typing (MLST) is a powerful and highly discriminatory method for analysing pathogen population structure and epidemiology. Trypanosoma cruzi, the protozoan agent of American trypanosomiasis (Chagas disease), has remarkable genetic and ecological diversity. A standardised MLST protocol that is suitable for assignment of T. cruzi isolates to genetic lineage and for higher resolution diversity studies has not been developed. We have sequenced and diplotyped nine single copy housekeeping genes and assessed their value as part of a systematic MLST scheme for T. cruzi. A minimum panel of four MLST targets (Met-III, RB19, TcGPXII, and DHFR-TS) was shown to provide unambiguous assignment of isolates to the six known T. cruzi lineages (Discrete Typing Units, DTUs TcI-TcVI). In addition, we recommend six MLST targets (Met-II, Met-III, RB19, TcMPX, DHFR-TS, and TR) for more in depth diversity studies on the basis that diploid sequence typing (DST) with this expanded panel distinguished 38 out of 39 reference isolates. Phylogenetic analysis implies a subdivision between North and South American TcIV isolates. Single Nucleotide Polymorphism (SNP) data revealed high levels of heterozygosity among DTUs TcI, TcIII, TcIV and, for three targets, putative corresponding homozygous and heterozygous loci within DTUs TcI and TcIII. Furthermore, individual gene trees gave incongruent topologies at inter- and intra-DTU levels, inconsistent with a model of strict clonality. We demonstrate the value of systematic MLST diplotyping for describing inter-DTU relationships and for higher resolution diversity studies of T. cruzi, including presence of recombination events. The high levels of heterozygosity will facilitate future population genetics analysis based on MLST haplotypes.

  13. Spectroscopic Properties of Tc(I) Tricarbonyl Species Relevant to the Hanford Tank Waste

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Levitskaia, Tatiana G.; Andersen, Amity; Chatterjee, Sayandev

    2015-12-04

    Technetium-99 (Tc) exists predominately in soluble forms in the liquid supernatant and salt cake fractions of the nuclear tank waste stored at the U.S. DOE Hanford Site. In the strongly alkaline environments prevalent in the tank waste, its dominant chemical form is pertechnetate (TcO4-, oxidation state +7). However, attempts to remove Tc from the Hanford tank waste using ion-exchange processes specific to TcO 4 - only met with limited success, particularly processing tank waste samples containing elevated concentrations of organic complexants. This suggests that a significant fraction of the soluble Tc can be present as non-pertechnetate low-valent Tc (oxidation statemore » < +7) (non-pertechnetate). The chemical identities of these non-pertechnetate species are poorly understood. Previous analysis of the SY-101 and SY-103 tank waste samples provided strong evidence that non-pertechnetate can be comprised of [Tc(CO) 3] + complexes containing Tc in oxidation state +1 (Lukens et al. 2004). During the last two years, our team has expanded this work and demonstrated that high-ionic-strength solutions typifying tank waste supernatants promote oxidative stability of the [Tc(CO) 3] + species (Rapko et al. 2013; Levitskaia et al. 2014). It also was observed that high-ionic-strength alkaline matrices stabilize Tc(VI) and potentially Tc(IV) oxidation states, particularly in presence organic chelators, suggesting that the relevant Tc compounds can serve as important redox intermediates facilitating the reduction of Tc(VII) to Tc(I). Designing strategies for effective Tc processing, including separation and immobilization, necessitates understanding the molecular structure of these non-pertechnetate species and their identification in the actual tank waste samples. To-date, only limited information exists regarding the nature and characterization of the Tc(I), Tc(IV), and Tc(VI) species. One objective of this project is to identify the form of non-pertechnetate in the Hanford waste. To do this, we are developing a spectral library of reference non-pertechnetate compounds that can be compared against actual waste samples. The emphasis of the fiscal year 2015 work was Tc(I) tricarbonyl [Tc(CO) 3] + compounds. The key findings are summarized below.« less

  14. (99m)Tc-amitrole as a novel selective imaging probe for solid tumor: In silico and preclinical pharmacological study.

    PubMed

    Essa, B M; Sakr, T M; Khedr, Mohammed A; El-Essawy, F A; El-Mohty, A A

    2015-08-30

    Lactoperoxidase (LPO) inhibitors are very selective for solid tumor due to their high binding affinity to the LPO enzyme. A computational study was used to select top-ranked LPO inhibitor (alone and in complex with (99m)Tc) with high in silico affinity. The novel prepared (99m)Tc-amitrole complex demonstrated both in silico and in vivo high affinity toward solid tumors.(99m)Tc-amitrole was radio-synthesized with a high radiochemical yield (89.7±3.25). It showed in vitro stability for up to 6h. Its preclinical evaluation in solid tumor-bearing mice showed high retention and biological accumulation in solid tumor cells with a high Target/Non-Target (T/NT) ratio equal to 4.9 at 60min post-injection. The data described previously could recommend (99m)Tc-amitrole as potential targeting scintigraphic probe for solid tumor imaging. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Endogenous steroid hormone levels in early pregnancy and risk of testicular cancer in the offspring: a nested case-referent study.

    PubMed

    Holl, Katsiaryna; Lundin, Eva; Surcel, Heljä-Marja; Grankvist, Kjell; Koskela, Pentti; Dillner, Joakim; Hallmans, Göran; Wadell, Göran; Olafsdottir, Gudridur H; Ogmundsdottir, Helga M; Pukkala, Eero; Lehtinen, Matti; Stattin, Pär; Lukanova, Annekatrin

    2009-06-15

    According to the leading hypothesis on testicular cancer (TC) etiology exposure to a specific pattern of steroid hormones in utero, in particular, to high levels of estrogens and low levels of androgens is the major determinant of TC risk in the offspring. We performed a case-referent study nested within Finnish, Swedish and Icelandic maternity cohorts exploiting early pregnancy serum samples to evaluate the role of maternal endogenous steroid hormones with regard to the risk of TC. TC cases and referents were aged between 0 and 25 years. For each case-index mother pair, three or four matched referent-referent mother pairs were identified using national population registries. First trimester or early second trimester sera were retrieved from the index mothers of 73 TC cases and 286 matched referent mothers, and were tested for dehydroepiandrosterone sulfate (DHEAS), androstenedione, testosterone, estradiol, estrone, and sex hormone binding globulin (SHBG). Offspring of mothers with high DHEAS levels had a significantly decreased risk of TC (OR for highest vs. lowest DHEAS quartile, 0.18 (95% CI 0.06-0.58). In contrast, offspring of mothers with high androstenedione levels had an increased risk of TC (OR 4.1; 95% CI 1.2-12.0). High maternal total estradiol level also tended to be associated with an increased risk of TC in the offspring (OR 32; 95% CI 0.98-1,090). We report the first direct evidence that interplay of maternal steroid hormones in the early pregnancy is important in the etiology of TC in the offspring. Copyright 2008 UICC.

  16. Spectroscopic Characterization of Aqua [ fac-Tc(CO)3]+ Complexes at High Ionic Strength.

    PubMed

    Chatterjee, Sayandev; Hall, Gabriel B; Engelhard, Mark H; Du, Yingge; Washton, Nancy M; Lukens, Wayne W; Lee, Sungsik; Pearce, Carolyn I; Levitskaia, Tatiana G

    2018-06-18

    Understanding fundamental Tc chemistry is important to both the remediation of nuclear waste and the reprocessing of nuclear fuel; however, current knowledge of the electronic structure and spectral signatures of low-valent Tc compounds significantly lags behind the remainder of the d-block elements. In particular, identification and treatment of Tc speciation in legacy nuclear waste is challenging due to the lack of reference data especially for Tc compounds in the less common oxidation states (I-VI). In an effort to establish a spectroscopic library corresponding to the relevant conditions of extremely high ionic strength typical for the legacy nuclear waste, compounds with the general formula of [ fac-Tc(CO) 3 (OH 2 ) 3- n (OH) n ] 1- n (where n = 0-3) were examined by a range of spectroscopic techniques including 99 Tc/ 13 C NMR, IR, XPS, and XAS. In the series of monomeric aqua species, stepwise hydrolysis results in the increase of the Tc metal center electron density and corresponding progressive decrease of the Tc-C bond distances, Tc electron binding energies, and carbonyl stretching frequencies in the order [ fac-Tc(CO) 3 (OH 2 ) 3 ] + > [ fac-Tc(CO) 3 (OH 2 ) 2 (OH)] > [ fac-Tc(CO) 3 (OH 2 )(OH) 2 ] - . These results correlate with established trends of the 99 Tc upfield chemical shift and carbonyl 13 C downfield chemical shift. The lone exception is [ fac-Tc(CO) 3 (OH)] 4 which exhibits a comparatively low electron density at the metal center attributed to the μ 3 -bridging nature of the - OH ligands causing less σ-donation and no π-donation. This work also reports the first observations of these compounds by XPS and [ fac-Tc(CO) 3 Cl 3 ] 2- by XAS. The unique and distinguishable spectral features of the aqua [ fac-Tc(CO) 3 ] + complexes lay the foundation for their identification in the complex aqueous matrixes.

  17. Understanding the in vivo uptake kinetics of a phosphatidylethanolamine-binding agent 99mTc-Duramycin

    PubMed Central

    Audi, Said; Li, Zhixin; Capacete, Joseph; Liu, Yu; Fang, Wei; Shu, Laura G.; Zhao, Ming

    2013-01-01

    Introduction 99mTc-Duramycin is a peptide-based molecular probe that binds specifically to phosphatidylethanolamine (PE). The goal was to characterize the kinetics of molecular interactions between 99mTc-Duramycin and the target tissue. Methods High level of accessible PE is induced in cardiac tissues by myocardial ischemia (30 min) and reperfusion (120 min) in Sprague Dawley rats. Target binding and biodistribution of 99mTc-duramycin was captured using SPECT/CT. To quantify the binding kinetics, the presence of radioactivity in ischemic versus normal cardiac tissues was measured by gamma counting at 3, 10, 20, 60 and 180 min after injection. A partially inactivated form of 99mTc-Duramycin was analyzed in the same fashion. A compartment model was developed to quantify the uptake kinetics of 99mTc-Duramycin in normal and ischemic myocardial tissue. Results 99mTc-duramycin binds avidly to the damaged tissue with a high target-to-background radio. Compartment modeling shows that accessibility of binding sites in myocardial tissue to 99mTc-Duramycin is not a limiting factor and the rate constant of target binding in the target tissue is at 2.2 ml/nmol/min/g. The number of available binding sites for 99mTc-Duramycin in ischemic myocardium was estimated at 0.14 nmol/g. Covalent modification of D15 resulted in a 9 fold reduction in binding affinity. Conclusion 99mTc-Duramycin accumulates avidly in target tissues in a PE-dependent fashion. Model results reflect an efficient uptake mechanism, consistent with the low molecular weight of the radiopharmaceutical and the relatively high density of available binding sites. These data help better define the imaging utilities of 99mTc-Duramycin as a novel PE-binding agent. PMID:22534031

  18. Attachment of Free Filament Thermocouples for Temperature Measurements on CMC

    NASA Technical Reports Server (NTRS)

    Lei, Jih-Fen; Cuy, Michael D.; Wnuk, Stephen P.

    1997-01-01

    Ceramic Matrix Composites (CMC) are being developed for use as enabling materials for advanced aeropropulsion engine and high speed civil transport applications. The characterization and testing of these advanced materials in hostile, high-temperature environments require accurate measurement of the material temperatures. Commonly used wire Thermo-Couples (TC) can not be attached to this ceramic based material via conventional spot-welding techniques. Attachment of wire TC's with commercially available ceramic cements fail to provide sufficient adhesion at high temperatures. While advanced thin film TC technology provides minimally intrusive surface temperature measurement and has good adhesion on the CMC, its fabrication requires sophisticated and expensive facilities and is very time consuming. In addition, the durability of lead wire attachments to both thin film TC's and the substrate materials requires further improvement. This paper presents a newly developed attachment technique for installation of free filament wire TC's with a unique convoluted design on ceramic based materials such as CMC's. Three CMC's (SiC/SiC CMC and alumina/alumina CMC) instrumented with type IC, R or S wire TC's were tested in a Mach 0.3 burner rig. The CMC temperatures measured from these wire TC's were compared to that from the facility pyrometer and thin film TC's. There was no sign of TC delamination even after several hours exposure to 1200 C. The test results proved that this new technique can successfully attach wire TC's on CMC's and provide temperature data in hostile environments. The sensor fabrication process is less expensive and requires very little time compared to that of the thin film TC's. The same installation technique/process can also be applied to attach lead wires for thin film sensor systems.

  19. Novel 99mTc(III)-azide complexes [99mTc(N3)(CDO)(CDOH)2B-R] (CDOH2=cyclohexanedione dioxime) as potential radiotracers for heart imaging.

    PubMed

    Liu, Min; Zheng, Yumin; Avcibasi, Ugur; Liu, Shuang

    2016-11-01

    In this study, novel 99m Tc(III)-azide complexes [ 99m Tc(N 3 )(CDO)(CDOH) 2 B-R] ( 99m Tc-ISboroxime-N 3 : R=IS; 99m Tc-MPboroxime-N 3 : R=MP; 99m Tc-PAboroxime-N 3 : R=PA; 99m Tc-PYboroxime-N 3 : R=PY; and 99m Tc-Uboroxime-N 3 : R=5U) were evaluated as heart imaging agents. Complexes [ 99m Tc(N 3 )(CDO)(CDOH) 2 B-R] (R=IS, MP, PA, PY and 5U) were prepared by ligand exchange between NaN 3 and [ 99m TcCl(CDO)(CDOH) 2 B-R]. Biodistribution and imaging studies were carried out in Sprague-Dawley rats. Image quantification was performed to compare their initial heart uptake and myocardial retention. 99m Tc-ISboroxime-N 3 , 99m Tc-PYboroxime-N 3 and 99m Tc-Uboroxime-N 3 were prepared with high RCP (93-98%) while the RCP of 99m Tc-MPboroxime-N 3 and 99m Tc-PAboroxime-N 3 was 80-85%. The myocardial retention curves of 99m Tc-ISboroxime-N 3 , 99m Tc-PYboroxime-N 3 and 99m Tc-Uboroxime-N 3 were best fitted to the bi-exponential decay function. The half-time of the fast component was 1.6±0.4min for 99m Tc-ISboroxime-N 3 , 0.7±0.1min for 99m Tc-PYboroxime-N 3 and 0.9±0.4min for 99m Tc-Uboroxime-N 3 . The 2-min heart uptake from biodistribution studies followed the ranking order of 99m Tc-ISboroxime-N 3 (3.60±0.68%ID/g)> 99m Tc-PYboroxime-N 3 (2.35±0.37%ID/g)≫ 99m Tc-Uboroxime-N 3 (1.29±0.06%ID/g). 99m Tc-ISboroxime-N 3 had the highest 2-min heart uptake among 99m Tc radiotracers revaluated in SD rats. High quality SPECT images were obtained with the right and left ventricular walls being clearly delineated. The best image acquisition window was 0-5min for 99m Tc-ISboroxime-N 3 . Both azide coligand and boronate caps had significant impact on the heart uptake and myocardial retention of complexes [ 99m Tc(N 3 )(CDO)(CDOH) 2 B-R]. Among the radiotracers evaluated in SD rats, 99m Tc-ISboroxime-N 3 has the highest initial heart uptake with the heart retention comparable to that of 99m Tc-Teboroxime. 99m Tc-ISboroxime-N 3 is a promising alternative to 99m Tc-Teboroxime for SPECT MPI. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Technetium Incorporation in Glass for the Hanford Tank Waste Treatment and Immobilization Plant

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kruger, Albert A.; Kim, Dong Sang

    2015-01-14

    A priority of the United States Department of Energy (U.S. DOE) is to dispose of nuclear wastes accumulated in 177 underground tanks at the Hanford Nuclear Reservation in eastern Washington State. These nuclear wastes date from the Manhattan Project of World War II and from plutonium production during the Cold War. The DOE plans to separate high-level radioactive wastes from low activity wastes and to treat each of the waste streams by vitrification (immobilization of the nuclides in glass) for disposal. The immobilized low-activity waste will be disposed of here at Hanford and the immobilized high-level waste at the nationalmore » geologic repository. Included in the inventory of highly radioactive wastes is large volumes of 99Tc (~9 × 10E2 TBq or ~2.5 × 104 Ci or ~1500 kg). A problem facing safe disposal of Tc-bearing wastes is the processing of waste feed into in a chemically durable waste form. Technetium incorporates poorly into silicate glass in traditional glass melting. It readily evaporates during melting of glass feeds and out of the molten glass, leading to a spectrum of high-to-low retention (ca. 20 to 80%) in the cooled glass product. DOE-ORP currently has a program at Pacific Northwest National Laboratory (PNNL), in the Department of Materials Science and Engineering at Rutgers University and in the School of Mechanical and Materials Engineering at Washington State University that seeks to understand aspects of Tc retention by means of studying Tc partitioning, molten salt formation, volatilization pathways, and cold cap chemistry. Another problem involves the stability of Tc in glass in both the national geologic repository and on-site disposal after it has been immobilized. The major environmental concern with 99Tc is its high mobility in addition to a long half-life (2.1×105 yrs). The pertechnetate ion (TcO4-) is highly soluble in water and does not adsorb well onto the surface of minerals and so migrates nearly at the same velocity as groundwater. Long-term corrosion of glass waste forms is an area of current interest to the DOE, but attention to the release of Tc from glass has been little explored. It is expected that the release of Tc from glass should be highly dependent on the local glass structure as well as the chemistry of the surrounding environment, including groundwater pH. Though the speciation of Tc in glass has been previously studied, and the Tc species present in waste glass have been previously reported, environmental Tc release mechanisms are poorly understood. The recent advances in Tc chemistry that have given rise to an understanding of incorporation in the glass giving rise to significantly higher single-pass retention during vitrification are presented. Additionally, possible changes to the baseline flowsheet that allow for relatively minor volumes of Tc reporting to secondary waste treatment will be discussed.« less

  1. Determination of technetium-99 in environmental samples: a review.

    PubMed

    Shi, Keliang; Hou, Xiaolin; Roos, Per; Wu, Wangsuo

    2012-01-04

    Due to the lack of a stable technetium isotope, and the high mobility and long half-life, (99)Tc is considered to be one of the most important radionuclides in safety assessment of environmental radioactivity as well as nuclear waste management. (99)Tc is also an important tracer for oceanographic research due to the high technetium solubility in seawater as TcO(4)(-). A number of analytical methods, using chemical separation combined with radiometric and mass spectrometric measurement techniques, have been developed over the past decades for determination of (99)Tc in different environmental samples. This article summarizes and compares recently reported chemical separation procedures and measurement methods for determination of (99)Tc. Due to the extremely low concentration of (99)Tc in environmental samples, the sample preparation, pre-concentration, chemical separation and purification for removal of the interferences for detection of (99)Tc are the most important issues governing the accurate determination of (99)Tc. These aspects are discussed in detail in this article. Meanwhile, the different measurement techniques for (99)Tc are also compared with respect to advantages and drawbacks. Novel automated analytical methods for rapid determination of (99)Tc using solid extraction or ion exchange chromatography for separation of (99)Tc, employing flow injection or sequential injection approaches are also discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. SHMUTZ & PROTON-DIAMANT H + Irradiated/Written-Hyper/Super-conductivity(HC/SC) Precognizance/Early Experiments Connections: Wet-Graphite Room-Tc & Actualized MgB2 High-Tc: Connection to Mechanical Bulk-Moduli/Hardness: Diamond Hydrocarbon-Filaments, Disorder, Nano-Powders:C,Bi,TiB2,TiC

    NASA Astrophysics Data System (ADS)

    Wunderman, Irwin; Siegel, Edward Carl-Ludwig; Lewis, Thomas; Young, Frederic; Smith, Adolph; Dresschhoff-Zeller, Gieselle

    2013-03-01

    SHMUTZ: ``wet-graphite''Scheike-....[Adv.Mtls.(7/16/12)]hyper/super-SCHMUTZ-conductor(S!!!) = ``wet''(?)-``graphite''(?) = ``graphene''(?) = water(?) = hydrogen(?) =ultra-heavy proton-bands(???) = ...(???) claimed room/high-Tc/high-Jc superconductOR ``p''-``wave''/ BAND(!!!) superconductIVITY and actualized/ instantiated MgB2 high-Tc superconductors and their BCS- superconductivity: Tc Siegel[ICMAO(77);JMMM 7,190(78)] connection to SiegelJ.Nonxline-Sol.40,453(80)] disorder/amorphous-superconductivity in nano-powders mechanical bulk/shear(?)-moduli/hardness: proton-irradiated diamond, powders TiB2, TiC,{Siegel[Semis. & Insuls.5:39,47, 62 (79)])-...``VS''/concommitance with Siegel[Phys.Stat.Sol.(a)11,45(72)]-Dempsey [Phil.Mag. 8,86,285(63)]-Overhauser-(Little!!!)-Seitz-Smith-Zeller-Dreschoff-Antonoff-Young-...proton-``irradiated''/ implanted/ thermalized-in-(optimal: BOTH heat-capacity/heat-sink & insulator/maximal dielectric-constant) diamond: ``VS'' ``hambergite-borate-mineral transformable to Overhauser optimal-high-Tc-LiBD2 in Overhauser-(NW-periodic-table)-Land: CO2/CH4-ETERNAL-sequestration by-product: WATER!!!: physics lessons from

  3. Angle-resolved photoemission with circularly polarized light in the nodal mirror plane of underdoped Bi 2Sr 2CaCu 2O 8+ δ superconductor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Junfeng; Mion, Thomas R.; Gao, Shang

    2016-10-31

    Unraveling the nature of pseudogap phase in high-temperature superconductors holds the key to understanding their superconducting mechanisms and potentially broadening their applications via enhancement of their superconducting transition temperatures. Angle-resolved photoemission spectroscopy (ARPES) experiments using circularly polarized light have been proposed to detect possible symmetry breaking state in the pseudogap phase of cuprates. Here, the presence (absence) of an electronic order which breaks mirror symmetry of the crystal would in principle induce a finite (zero) circular dichroism in photoemission. Different orders breaking reflection symmetries about different mirror planes can also be distinguished by the momentum dependence of the measured circularmore » dichroism.« less

  4. Destroying coherence in high-temperature superconductors with current flow

    DOE PAGES

    Kaminski, A.; Rosenkranz, S.; Norman, M. R.; ...

    2016-09-13

    Here, the loss of single-particle coherence going from the superconducting state to the normal state in underdoped cuprates is a dramatic effect that has yet to be understood. Here, we address this issue by performing angle resolved photoemission spectroscopy measurements in the presence of a transport current. We find that the loss of coherence is associated with the development of an onset in the resistance, in that well before the midpoint of the transition is reached, the sharp peaks in the angle resolved photoemission spectra are completely suppressed. Since the resistance onset is a signature of phase fluctuations, this impliesmore » that the loss of single-particle coherence is connected with the loss of long-range phase coherence.« less

  5. Angle and frequency dependence of self-energy from spin fluctuation mediated d-wave pairing for high temperature superconductors.

    PubMed

    Hong, Seung Hwan; Choi, Han-Yong

    2013-09-11

    We investigated the characteristics of spin fluctuation mediated superconductivity employing the Eliashberg formalism. The effective interaction between electrons was modeled in terms of the spin susceptibility measured by inelastic neutron scattering experiments on single crystal La(2-x)Sr(x)CuO4 superconductors. The diagonal self-energy and off-diagonal self-energy were calculated by solving the coupled Eliashberg equation self-consistently for the chosen spin susceptibility and tight-binding dispersion of electrons. The full momentum and frequency dependence of the self-energy is presented for optimally doped, overdoped, and underdoped LSCO cuprates in a superconductive state. These results may be compared with the experimentally deduced self-energy from ARPES experiments.

  6. Evaluation of New Tc-99m-Labeled Arg-X-Asp-Conjugated Alpha-Melanocyte Stimulating Hormone Peptides for Melanoma Imaging

    PubMed Central

    Flook, Adam M.; Yang, Jianquan; Miao, Yubin

    2013-01-01

    The purpose of this study was to examine the melanoma targeting and imaging properties of two new 99mTc-labeled Arg-X-Asp-conjugated alpha-melanocyte stimulating hormone (α-MSH) peptides. RTD-Lys-(Arg11)CCMSH {c[Asp-Arg-Thr-Asp-DTyr]-Lys-Cys-Cys-Glu-His-DPhe-Arg-Trp-Cys-Arg-Pro-Val-NH2} and RVD-Lys-(Arg11)CCMSH peptides were synthesized and their melanocortin-1 (MC1) receptor binding affinities were determined in B16/F1 melanoma cells. The biodistribution and melanoma imaging properties of 99mTc-RTD-Lys-(Arg11)CCMSH and 99mTc-RVD-Lys-(Arg11)CCMSH were determined in B16/F1 melanoma-bearing C57 mice. The IC50 values of RTD-Lys-(Arg11)CCMSH and RVD-Lys-(Arg11)CCMSH were 0.7 ± 0.07 and 1.0 ± 0.3 nM in B16/F1 melanoma cells. Both 99mTc-RTD-Lys-(Arg11)CCMSH and 99mTc-RVD-Lys-(Arg11)CCMSH displayed high melanoma uptake. 99mTc-RTD-Lys-(Arg11)CCMSH exhibited the peak tumor uptake of 18.77 ± 5.13% ID/g at 2 h post-injection, whereas 99mTc-RVD-Lys-(Arg11)CCMSH reached the peak tumor uptake of 19.63 ± 4.68% ID/g at 4 h post-injection. Both 99mTc-RTD-Lys-(Arg11)CCMSH and 99mTc-RVD-Lys-(Arg11)CCMSH showed low accumulation in normal organs (<1.7% ID/g) except for the kidneys at 2 h post-injection. The renal uptake of 99mTc-RTD-Lys-(Arg11)CCMSH and 99mTc-RVD-Lys-(Arg11)CCMSH was 135.14 ± 23.62 and 94.01 ± 18.31% ID/g at 2 h post-injection, respectively. The melanoma lesions were clearly visualized by SPECT/CT using either 99mTc-RTD-Lys-(Arg11)CCMSH or 99mTc-RVD-Lys-(Arg11)CCMSH as an imaging probe at 2 h post-injection. Overall, the introduction of Thr or Val residue retained high melanoma uptake of 99mTc-RTD-Lys-(Arg11)CCMSH and 99mTc-RVD-Lys-(Arg11)CCMSH. However, high renal uptake of 99mTc-RTD-Lys-(Arg11)CCMSH and 99mTc-RVD-Lys-(Arg11)CCMSH need to be reduced to facilitate their future applications. PMID:23885640

  7. Evaluation of new Tc-99m-labeled Arg-X-Asp-conjugated α-melanocyte stimulating hormone peptides for melanoma imaging.

    PubMed

    Flook, Adam M; Yang, Jianquan; Miao, Yubin

    2013-09-03

    The purpose of this study was to examine the melanoma targeting and imaging properties of two new (99m)Tc-labeled Arg-X-Asp-conjugated α-melanocyte stimulating hormone (α-MSH) peptides. RTD-Lys-(Arg(11))CCMSH {c[Asp-Arg-Thr-Asp-DTyr]-Lys-Cys-Cys-Glu-His-DPhe-Arg-Trp-Cys-Arg-Pro-Val-NH2} and RVD-Lys-(Arg(11))CCMSH peptides were synthesized, and their melanocortin-1 (MC1) receptor binding affinities were determined in B16/F1 melanoma cells. The biodistribution and melanoma imaging properties of (99m)Tc-RTD-Lys-(Arg(11))CCMSH and (99m)Tc-RVD-Lys-(Arg(11))CCMSH were determined in B16/F1 melanoma-bearing C57 mice. The IC50 values of RTD-Lys-(Arg(11))CCMSH and RVD-Lys-(Arg(11))CCMSH were 0.7 ± 0.07 and 1.0 ± 0.3 nM in B16/F1 melanoma cells. Both (99m)Tc-RTD-Lys-(Arg(11))CCMSH and (99m)Tc-RVD-Lys-(Arg(11))CCMSH displayed high melanoma uptake. (99m)Tc-RTD-Lys-(Arg(11))CCMSH exhibited the highest tumor uptake of 18.77 ± 5.13% ID/g at 2 h postinjection, whereas (99m)Tc-RVD-Lys-(Arg(11))CCMSH reached the highest tumor uptake of 19.63 ± 4.68% ID/g at 4 h postinjection. Both (99m)Tc-RTD-Lys-(Arg(11))CCMSH and (99m)Tc-RVD-Lys-(Arg(11))CCMSH showed low accumulation in normal organs (<1.7% ID/g) except for the kidneys at 2 h postinjection. The renal uptake of (99m)Tc-RTD-Lys-(Arg(11))CCMSH and (99m)Tc-RVD-Lys-(Arg(11))CCMSH was 135.14 ± 23.62 and 94.01 ± 18.31% ID/g at 2 h postinjection, respectively. The melanoma lesions were clearly visualized by single-photon emission computed tomography (SPECT)/CT using either (99m)Tc-RTD-Lys-(Arg(11))CCMSH or (99m)Tc-RVD-Lys-(Arg(11))CCMSH as an imaging probe at 2 h postinjection. Overall, the introduction of Thr or Val residue retained high melanoma uptake of (99m)Tc-RTD-Lys-(Arg(11))CCMSH and (99m)Tc-RVD-Lys-(Arg(11))CCMSH. However, high renal uptake of (99m)Tc-RTD-Lys-(Arg(11))CCMSH and (99m)Tc-RVD-Lys-(Arg(11))CCMSH need to be reduced to facilitate their future applications.

  8. Assessment of triglyceride and cholesterol in overweight people based on multiple linear regression and artificial intelligence model.

    PubMed

    Ma, Jing; Yu, Jiong; Hao, Guangshu; Wang, Dan; Sun, Yanni; Lu, Jianxin; Cao, Hongcui; Lin, Feiyan

    2017-02-20

    The prevalence of high hyperlipemia is increasing around the world. Our aims are to analyze the relationship of triglyceride (TG) and cholesterol (TC) with indexes of liver function and kidney function, and to develop a prediction model of TG, TC in overweight people. A total of 302 adult healthy subjects and 273 overweight subjects were enrolled in this study. The levels of fasting indexes of TG (fs-TG), TC (fs-TC), blood glucose, liver function, and kidney function were measured and analyzed by correlation analysis and multiple linear regression (MRL). The back propagation artificial neural network (BP-ANN) was applied to develop prediction models of fs-TG and fs-TC. The results showed there was significant difference in biochemical indexes between healthy people and overweight people. The correlation analysis showed fs-TG was related to weight, height, blood glucose, and indexes of liver and kidney function; while fs-TC was correlated with age, indexes of liver function (P < 0.01). The MRL analysis indicated regression equations of fs-TG and fs-TC both had statistic significant (P < 0.01) when included independent indexes. The BP-ANN model of fs-TG reached training goal at 59 epoch, while fs-TC model achieved high prediction accuracy after training 1000 epoch. In conclusions, there was high relationship of fs-TG and fs-TC with weight, height, age, blood glucose, indexes of liver function and kidney function. Based on related variables, the indexes of fs-TG and fs-TC can be predicted by BP-ANN models in overweight people.

  9. Malleable Curie Temperatures of Natural Titanomagnetites: Occurrences, Modes, and Mechanisms

    NASA Astrophysics Data System (ADS)

    Jackson, Mike; Bowles, Julie

    2018-02-01

    Intermediate-composition titanomagnetites have Curie temperatures (Tc) that depend not only on composition but also on thermal history, with increases of 100°C or more in Tc produced by moderate-temperature (300-400°C) annealing in the laboratory or in slow natural cooling and comparable decreases produced by more rapid cooling ("quenching") from higher temperatures. New samples spanning a range of titanomagnetite compositions exhibit reversible changes in Tc comparable to those previously documented for pyroclastic samples from Mt. St. Helens and Novarupta. Additional high- and low-temperature measurements help to shed light on the nanoscale mechanisms responsible for the observed changes in Tc. High-T hysteresis measurements exhibit a peak in high-field slope khf(T) at the Curie temperature, and the peak magnitude decreases as Tc increases with annealing. Sharp changes in low-T magnetic behavior are also strongly affected by prior annealing or quenching, suggesting that these treatments affect the intrasite cation distributions. We have examined the effects of oxidation state and nonstoichiometry on the magnitude of Tc changes produced by quenching/annealing in different atmospheres. Treatments in air generally cause large changes (ΔTc > 100°). In an inert atmosphere, the changes are similar in many samples but strongly diminished in others. When the samples are embedded in a reducing material, ΔTc becomes insignificant. These results strongly suggest that cation vacancies play an essential role in the cation rearrangements responsible for the observed changes in Tc. Some form of octahedral-site chemical clustering or short-range ordering appears to be the best way to explain the large observed changes in Tc.

  10. Climatic controls on hurricane patterns: a 1200-y near-annual record from Lighthouse Reef, Belize

    NASA Astrophysics Data System (ADS)

    Denommee, K. C.; Bentley, S. J.; Droxler, A. W.

    2014-01-01

    Tropical cyclones (TCs) are powerful agents of destruction, and understanding climatic controls on TC patterns is of great importance. Over timescales of seasons to several decades, relationships among TC track, frequency, intensity and basin-scale climate changes are well documented by instrumental records. Over centuries to millennia, climate-shift influence on TC regimes remains poorly constrained. To better understand these relationships, records from multiple locations of TC strikes spanning millennia with high temporal resolution are required, but such records are rare. Here we report on a highly detailed sedimentary proxy record of paleo-TC strikes from the Blue Hole of Lighthouse Reef, Belize. Our findings provide an important addition to other high-resolution records, which collectively demonstrate that shifts between active and inactive TC regimes have occurred contemporaneously with shifts hemispheric-scale oceanic and atmospheric circulation patterns such as MDR SSTs and NAO mode, rather than with changes in local climate phenomena as has previously been suggested.

  11. Synthesis, 99m Tc-labeling, and preliminary biological evaluation of DTPA-melphalan conjugates.

    PubMed

    Wang, Jianjun; Yang, Wenjiang; Xue, Jinquan; Zhang, Yanhua; Liu, Yu

    2017-12-01

    Melphalan (MFL) is a typical nitrogen mustard for the treatment of many types of cancer. For the purpose to develop novel 99m Tc-labeled tumor imaging agents with SPECT, MFL was directly labeled by 99m Tc using diethylene triamine pentacetate acid (DTPA) as bifunctional chelating agent. The novel ligands were successfully synthesized by conjugation of DTPA to MFL to get monosubstituted DTPA-MFL and bis-substituted DTPA-2MFL. Radiolabeling was performed in high yield to get 99m Tc-DTPA-MFL and 99m Tc-DTPA-2MFL, respectively, which were hydrophilic and stable at room temperature. The high initial tumor uptake with retention, good tumor/muscle ratios, and satisfactory scintigraphic images suggested the potential of 99m Tc-DTPA-MFL and 99m Tc-DTPA-2MFL for tumor imaging. However, the slow normal tissue clearance would be a great obstacle. Further modification on the linker and/or 99m Tc-chelate to improve the tumor targeting efficacy and in vivo kinetic profiles is currently in progress. Copyright © 2017 John Wiley & Sons, Ltd.

  12. Trypanosoma cruzi IIc: Phylogenetic and Phylogeographic Insights from Sequence and Microsatellite Analysis and Potential Impact on Emergent Chagas Disease

    PubMed Central

    Llewellyn, Martin S.; Lewis, Michael D.; Acosta, Nidia; Yeo, Matthew; Carrasco, Hernan J.; Segovia, Maikell; Vargas, Jorge; Torrico, Faustino; Miles, Michael A.; Gaunt, Michael W.

    2009-01-01

    Trypanosoma cruzi, the etiological agent of Chagas disease, is highly genetically diverse. Numerous lines of evidence point to the existence of six stable genetic lineages or DTUs: TcI, TcIIa, TcIIb, TcIIc, TcIId, and TcIIe. Molecular dating suggests that T. cruzi is likely to have been an endemic infection of neotropical mammalian fauna for many millions of years. Here we have applied a panel of 49 polymorphic microsatellite markers developed from the online T. cruzi genome to document genetic diversity among 53 isolates belonging to TcIIc, a lineage so far recorded almost exclusively in silvatic transmission cycles but increasingly a potential source of human infection. These data are complemented by parallel analysis of sequence variation in a fragment of the glucose-6-phosphate isomerase gene. New isolates confirm that TcIIc is associated with terrestrial transmission cycles and armadillo reservoir hosts, and demonstrate that TcIIc is far more widespread than previously thought, with a distribution at least from Western Venezuela to the Argentine Chaco. We show that TcIIc is truly a discrete T. cruzi lineage, that it could have an ancient origin and that diversity occurs within the terrestrial niche independently of the host species. We also show that spatial structure among TcIIc isolates from its principal host, the armadillo Dasypus novemcinctus, is greater than that among TcI from Didelphis spp. opossums and link this observation to differences in ecology of their respective niches. Homozygosity in TcIIc populations and some linkage indices indicate the possibility of recombination but cannot yet be effectively discriminated from a high genome-wide frequency of gene conversion. Finally, we suggest that the derived TcIIc population genetic data have a vital role in determining the origin of the epidemiologically important hybrid lineages TcIId and TcIIe. PMID:19721699

  13. Rejection of Tetracycline and Oxytetracycline in Water by a Nanofiltration Membrane

    NASA Astrophysics Data System (ADS)

    Li, Weiying; Sun, Xiuli; Wang, Qing; Xu, Jingjing; Lu, Junyu

    2010-11-01

    The removal of tetracycline (TC) and oxytetracycline (OTC) by a nanofiltration (NF) membrane was studied using synthetic solutions. The effects of operation parameters (recovery and flux), feed concentration and salinity on the rejection of tetracyclines and their adsorption on membranes were investigated. TC was observed to show a high adsorptive affinity for the membrane. Almost 80% of TC and 70% of OTC were adsorbed on the membrane surface after stirring for 2000 min and over 50% of them had been adsorbed just 120 min after stir. High removal efficiencies (>90%) were observed for TC and OTC with NF membrane. Rejection ratio of OTC by NF was slightly higher than that of TC.

  14. North Atlantic Tropical Cyclones: historical simulations and future changes with the new high-resolution Arpege AGCM.

    NASA Astrophysics Data System (ADS)

    Pilon, R.; Chauvin, F.; Palany, P.; Belmadani, A.

    2017-12-01

    A new version of the variable high-resolution Meteo-France Arpege atmospheric general circulation model (AGCM) has been developed for tropical cyclones (TC) studies, with a focus on the North Atlantic basin, where the model horizontal resolution is 15 km. Ensemble historical AMIP (Atmospheric Model Intercomparison Project)-type simulations (1965-2014) and future projections (2020-2080) under the IPCC (Intergovernmental Panel on Climate Change) representative concentration pathway (RCP) 8.5 scenario have been produced. TC-like vortices tracking algorithm is used to investigate TC activity and variability. TC frequency, genesis, geographical distribution and intensity are examined. Historical simulations are compared to best-track and reanalysis datasets. Model TC frequency is generally realistic but tends to be too high during the rst decade of the historical simulations. Biases appear to originate from both the tracking algorithm and model climatology. Nevertheless, the model is able to simulate extremely well intense TCs corresponding to category 5 hurricanes in the North Atlantic, where grid resolution is highest. Interaction between developing TCs and vertical wind shear is shown to be contributing factor for TC variability. Future changes in TC activity and properties are also discussed.

  15. Rugged Low-Resistance Contacts To High-Tc Superconductors

    NASA Technical Reports Server (NTRS)

    Caton, Randall; Selim, Raouf; Byvik, Charles E.; Buoncristiani, A. Martin

    1992-01-01

    Newly developed technique involving use of gold makes possible to fabricate low-resistance contacts with rugged connections to high-Tc superconductors. Gold diffused into specimen of superconducting material by melting gold beads onto surface of specimen, making strong mechanical contacts. Shear strength of gold bead contacts greater than epoxy or silver paste. Practical use in high-current-carrying applications of new high-Tc materials, including superconducting magnets, long-wavelength sensors, electrical ground planes at low temperatures, and efficient transmission of power.

  16. Therapeutic efficacy of an antibiotic-loaded nanosheet in a murine burn-wound infection model.

    PubMed

    Saito, Akihiro; Miyazaki, Hiromi; Fujie, Toshinori; Ohtsubo, Shinya; Kinoshita, Manabu; Saitoh, Daizoh; Takeoka, Shinji

    2012-08-01

    Polymeric ultra-thin films (nanosheets) possess unique properties that make them suitable materials for various biomedical applications. In our previous study, we assessed the use of an antibiotic (tetracycline, TC)-loaded nanosheet (or "TC-nanosheet") for the treatment of gastrointestinal tissue defects. The nanosheet consisted of three functional layers: layer-by-layer nanosheet as a stable platform, TC as an antimicrobial agent with autofluorescence for tracing, and a poly(vinyl acetate) nanosheet to act as a protecting layer. The TC-nanosheet has high flexibility, adhesive strength and transparency. Here, we evaluated the effectiveness of the TC-nanosheet in preventing full thickness burn-wound infections. In an in vivo study, murine dorsal skin was injured by full-thickness burns and then infected with Pseudomonas aeruginosa (P. aeruginosa), a common bacterium causing burn-associated infections. The wound site was treated either with a TC-nanosheet, TC-unloaded nanosheet or left untreated. Wound management was facilitated by the high transparency of the TC-nanosheet. The TC-nanosheet significantly improved burn-wound infection by P. aeruginosa in mice. Indeed, all mice treated with the TC-nanosheet survived, whereas the other treatment groups displayed increased rates of mortality due to bacterial infection. According to histological analyses and viable bacterial counting in the liver (bacterial translocation), the TC-nanosheets were able to prevent not only the local inflammation but also systemic inflammation. We conclude that the TC-nanosheet can act as an effective treatment for full-thickness burn-wound infection. Hence, the TC-nanosheet is a promising therapeutic tool for burn-wound management in severely burn-injured patients. Copyright © 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  17. Technetium glucose complexes as potential cancer imaging agents.

    PubMed

    Dapueto, Rosina; Aguiar, Rodrigo B; Moreno, María; Machado, Camila M L; Marques, Fabio L N; Gambini, Juan P; Chammas, Roger; Cabral, Pablo; Porcal, Williams

    2015-10-01

    GLUT's (facilitative glucose transporters) over-expression in tumor cells has allowed the detection of several cancer types, using a glucose analogue ((18)F-FDG) with PET images, worldwide. New glucose analogs radiolabeled with (99m)Tc could be a less-expensive and more accessible alternative for diagnosis using SPECT imaging. d-Glucose ((99m)Tc-IDAG) and 2-d-deoxyglucose ((99m)Tc-AADG) organometallic complexes were proposed and studied as potential (18)F-FDG surrogates. The glucose complexes were prepared and evaluated as potential cancer imaging agents, in a melanoma tumor model. Iminodiacetic acid (IDA) and aminoacetate (AA) moieties were chosen as chelating system for radiolabeling with (99m)Tc. Tumor uptake of the formed complexes was evaluated in B16 murine cell line in vitro and in vivo in melanoma bearing C57BL/6 mice. In vitro and in vivo studies were conducted with (18)F-FDG in order to compare the uptake of (99m)Tc-glucose complexes in the tumor model. IDAG and AADG compounds were synthesized and radiolabeled with (99m)TcO4(-) to obtain the (99m)Tc-IDAG and (99m)Tc-AADG complexes in high yield and stability. In vitro cell studies showed maximum uptake at 60 min for complexes, (99m)Tc-IDAG and (99m)Tc-AADG, with 6% and 2%, respectively. Biodistribution studies showed high tumor uptake one hour post-injection, reaching tumor-to-muscle ratios of 12.1 ± 3.73 and 2.88 ± 1.40 for (99m)Tc-IDAG and (99m)Tc-AADG, respectively. SPECT and micro-SPECT-CT images acquired after the injection of (99m)Tc-IDAG showed accumulation in tumor sites, suggesting that this glucose complex would be a promising candidate for cancer imaging. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Interpreting Multiple Logistic Regression Coefficients in Prospective Observational Studies

    DTIC Science & Technology

    1982-11-01

    TG HDL -C Males T-C 50-80 MRW pɘ.05 pɘ.10 1HDL-C = high density lipoprotein cholesterol MRW...consider a more complete analy- sis, attempting to uncover the relationship between CHD and TG controlling for covariables such a high density ...for T-C can be re- duced, when among older individuals, elevated T-C may increase the capacity to carry cholesterol in the high density lipoprotein

  19. Tropical Cyclone Activity in the High-Resolution Community Earth System Model and the Impact of Ocean Coupling

    NASA Astrophysics Data System (ADS)

    Li, Hui; Sriver, Ryan L.

    2018-01-01

    High-resolution Atmosphere General Circulation Models (AGCMs) are capable of directly simulating realistic tropical cyclone (TC) statistics, providing a promising approach for TC-climate studies. Active air-sea coupling in a coupled model framework is essential to capturing TC-ocean interactions, which can influence TC-climate connections on interannual to decadal time scales. Here we investigate how the choices of ocean coupling can affect the directly simulated TCs using high-resolution configurations of the Community Earth System Model (CESM). We performed a suite of high-resolution, multidecadal, global-scale CESM simulations in which the atmosphere (˜0.25° grid spacing) is configured with three different levels of ocean coupling: prescribed climatological sea surface temperature (SST) (ATM), mixed layer ocean (SLAB), and dynamic ocean (CPL). We find that different levels of ocean coupling can influence simulated TC frequency, geographical distributions, and storm intensity. ATM simulates more storms and higher overall storm intensity than the coupled simulations. It also simulates higher TC track density over the eastern Pacific and the North Atlantic, while TC tracks are relatively sparse within CPL and SLAB for these regions. Storm intensification and the maximum wind speed are sensitive to the representations of local surface flux feedbacks in different coupling configurations. Key differences in storm number and distribution can be attributed to variations in the modeled large-scale climate mean state and variability that arise from the combined effect of intrinsic model biases and air-sea interactions. Results help to improve our understanding about the representation of TCs in high-resolution coupled Earth system models, with important implications for TC-climate applications.

  20. High serum total cholesterol is associated with suicide mortality in Japanese women.

    PubMed

    Svensson, T; Inoue, M; Sawada, N; Charvat, H; Mimura, M; Tsugane, S

    2017-09-01

    To investigate the association between serum total cholesterol (TC) and suicide using a large general population cohort with long follow-up times. Analyses included 16 341 men and 28 905 women aged 40-69 from the Japan Public Health Center-based Prospective Study followed from 1990 to 2012. TC levels were defined per clinical guidelines: low (<4.66 mmol/l [180 mg/dl]), normal (4.66-5.70 mmol/l [180-220 mg/dl]), and high (≥5.70 mmol/l [220 mg/dl]). Cox proportional hazards regression models were used to determine hazard ratios (HR) and confidence intervals (CI) for suicide according to TC level. Mean follow-up time was 19 years for men and 20 years for women. There were 185 suicides (men: 107; women: 78) during follow-up. Compared to women with normal TC, women with high TC had a significantly increased risk of suicide (HR = 1.90, 95% CI, 1.13-3.19). Incremental increases (0.26 mmol/l [10 mg/dl]) of low-density lipoprotein (HR = 1.11, 95% CI, 1.02-1.21) and non-high-density lipoprotein cholesterol (HR = 1.09, 95% CI, 1.01-1.18) were also associated with increased risk of suicide in women. There was no association between TC levels, or lipid fractions, and suicide in men. High TC levels may be associated with an increased risk of suicide in women. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Design and Evaluation of New Tc-99m-Labeled Lactam Bridge-Cyclized Alpha-MSH Peptides for Melanoma Imaging

    PubMed Central

    Guo, Haixun; Gallazzi, Fabio; Miao, Yubin

    2013-01-01

    The purpose of this study was to examine the melanoma targeting and imaging properties of new 99mTc-labeled lactam bridge-cyclized alpha-melanocyte stimulating hormone (α-MSH) peptides using bifunctional chelating agents. MAG3-GGNle-CycMSHhex, AcCG3-GGNle-CycMSHhex and HYNIC-GGNle-CycMSHhex peptides were synthesized and their melanocortin-1 (MC1) receptor binding affinities were determined in B16/F1 melanoma cells. The biodistribution of 99mTc-MAG3-GGNle-CycMSHhex, 99mTc-AcCG3-GGNle-CycMSHhex, 99mTc(CO)3-HYNIC-GGNle-CycMSHhex and 99mTc(EDDA)-HYNIC-GGNle-CycMSHhex were determined in B16/F1 melanoma-bearing C57 mice at 2 h post-injection to select a lead peptide for further evaluation. The melanoma targeting and imaging properties of 99mTc(EDDA)-HYNIC-GGNle-CycMSHhex were further examined because of its high melanoma uptake and fast urinary clearance. The IC50 values of MAG3-GGNle-CycMSHhex, AcCG3-GGNle-CycMSHhex and HYNIC-GGNle-CycMSHhex were 1.0 ± 0.05, 1.2 ± 0.19 and 0.6 ± 0.04 nM in B16/F1 melanoma cells, respectively. Among these four 99mTc-peptides, 99mTc(EDDA)-HYNIC-GGNle-CycMSHhex exhibited the highest melanoma uptake (14.14 ± 4.90% ID/g) and fastest urinary clearance (91.26 ± 1.96% ID) at 2 h post-injection. 99mTc(EDDA)-HYNIC-GGNle-CycMSHhex showed high tumor to normal organ uptake ratios except for the kidneys. The tumor/kidney uptake ratios of 99mTc(EDDA)-HYNIC-GGNle-CycMSHhex were 2.50 and 3.55 at 4 and 24 h post-injection. The melanoma lesions were clearly visualized by SPECT/CT using 99mTc(EDDA)-HYNIC-GGNle-CycMSHhex as an imaging probe at 2 h post-injection. Overall, high melanoma uptake coupled with fast urinary clearance of 99mTc(EDDA)-HYNIC-GGNle-CycMSHhex highlighted its potential for metastatic melanoma detection in the future. PMID:23418722

  2. The drought response of Theobroma cacao (cacao) and the regulation of genes involved in polyamine biosynthesis by drought and other stresses.

    PubMed

    Bae, Hanhong; Kim, Soo-Hyung; Kim, Moon S; Sicher, Richard C; Lary, David; Strem, Mary D; Natarajan, Savithiry; Bailey, Bryan A

    2008-02-01

    Drought can negatively impact pod production despite the fact that cacao production usually occurs in tropical areas having high rainfall. Polyamines (PAs) have been associated with the response of plants to drought in addition to their roles in responses to many other stresses. The constitutive and drought inducible expression patterns of genes encoding enzymes involved in PA biosynthesis were determined: an ornithine decarboxylase (TcODC), an arginine decarboxylase (TcADC), an S-adenosylmethionine decarboxylase (TcSAMDC), a spermidine synthase (TcSPDS), and a spermine synthase (TcSPMS). Expression analysis using quantitative real-time reverse transcription-PCR (QPCR) results showed that the PA biosynthesis genes were expressed in all plant tissues examined. Constitutive expression of PA biosynthesis genes was generally highest in mature leaves and open flowers. Expression of TcODC, TcADC, and TcSAMDC was induced with the onset of drought and correlated with changes in stomatal conductance, photosynthesis, photosystem II efficiency, leaf water potential and altered emission of blue-green fluorescence from cacao leaves. Induction of TcSAMDC in leaves was most closely correlated with changes in water potential. The earliest measured responses to drought were enhanced expression of TcADC and TcSAMDC in roots along with decreases in stomatal conductance, photosynthesis, and photosystem II efficiency. Elevated levels of putrescine, spermidine, and spermine were detected in cacao leaves 13days after the onset of drought. Expression of all five PA associated transcripts was enhanced (1.5-3-fold) in response to treatment with abscisic acid. TcODC and TcADC, were also responsive to mechanical wounding, infection by Phytophthora megakarya (a causal agent of black pod disease in cacao), the necrosis- and ethylene-inducing protein (Nep1) of Fusarium oxysporum, and flower abscission. TcSAMDC expression was responsive to all stresses except flower abscission. TcODC, although constitutively expressed at much lower levels than TcADC, TcSAMDC, TcSPDS, and TcSPMS, was highly inducible by the fungal protein Nep1 (135-fold) and the cacao pathogen Phytophthora megakarya (671-fold). The full length cDNA for ODC was cloned and characterized. Among the genes studied, TcODC, TcADC, and TcSAMDC were most sensitive to induction by drought in addition to other abiotic and biotic stresses. TcODC, TcADC, and TcSAMDC may share signal transduction pathways and/or the stress induced signal induction pathways may converge at these three genes leading to similar although not identical patterns of expression. It is possible altering PA levels in cacao will result in enhanced tolerance to multiple stresses including drought and disease as has been demonstrated in other crops.

  3. Conventional superconductivity at 203 kelvin at high pressures in the sulfur hydride system.

    PubMed

    Drozdov, A P; Eremets, M I; Troyan, I A; Ksenofontov, V; Shylin, S I

    2015-09-03

    A superconductor is a material that can conduct electricity without resistance below a superconducting transition temperature, Tc. The highest Tc that has been achieved to date is in the copper oxide system: 133 kelvin at ambient pressure and 164 kelvin at high pressures. As the nature of superconductivity in these materials is still not fully understood (they are not conventional superconductors), the prospects for achieving still higher transition temperatures by this route are not clear. In contrast, the Bardeen-Cooper-Schrieffer theory of conventional superconductivity gives a guide for achieving high Tc with no theoretical upper bound--all that is needed is a favourable combination of high-frequency phonons, strong electron-phonon coupling, and a high density of states. These conditions can in principle be fulfilled for metallic hydrogen and covalent compounds dominated by hydrogen, as hydrogen atoms provide the necessary high-frequency phonon modes as well as the strong electron-phonon coupling. Numerous calculations support this idea and have predicted transition temperatures in the range 50-235 kelvin for many hydrides, but only a moderate Tc of 17 kelvin has been observed experimentally. Here we investigate sulfur hydride, where a Tc of 80 kelvin has been predicted. We find that this system transforms to a metal at a pressure of approximately 90 gigapascals. On cooling, we see signatures of superconductivity: a sharp drop of the resistivity to zero and a decrease of the transition temperature with magnetic field, with magnetic susceptibility measurements confirming a Tc of 203 kelvin. Moreover, a pronounced isotope shift of Tc in sulfur deuteride is suggestive of an electron-phonon mechanism of superconductivity that is consistent with the Bardeen-Cooper-Schrieffer scenario. We argue that the phase responsible for high-Tc superconductivity in this system is likely to be H3S, formed from H2S by decomposition under pressure. These findings raise hope for the prospects for achieving room-temperature superconductivity in other hydrogen-based materials.

  4. Out-of-Plane Disorder Effects on the Energy Gaps and Electronic Charge Order in Bi2Sr1.7R0.3CuO6+δ (R = La and Eu)

    NASA Astrophysics Data System (ADS)

    Kurosawa, Tohru; Takeyama, Kohsaku; Baar, Stefan; Shibata, Yuto; Kataoka, Moeko; Mizuta, Shusei; Yoshida, Hiroshi; Momono, Naoki; Oda, Migaku; Ido, Masayuki

    2016-04-01

    We performed STM/STS experiments at 8 K in Bi2Sr1.7R0.3CuO6+δ (R-Bi2201) systems that had optimal (OP) hole-doping levels (˜0.17) but different Tc values, 35 K for R = La and 20 K for R = Eu, and examined out-of-plane disorder effects on the superconducting (SC) gap (SCG) and the pseudogap (PG) which is associated with the so-called "checkerboard charge order" (CCO). As out-of-plane disorders are strengthened by replacing La with Eu in OP R-Bi2201, the antinodal PG size ΔPG increases from ˜30 to ˜60 meV, the nodal SCG size ΔSC seems to decrease from ˜7 to ˜4 meV, and the pairing gap amplitude Δ0 or d-wave gap size at the antinodes is almost unchanged (Δ0 ˜ 15 meV). These gap sizes for OP doping in Eu-Bi2201 are comparable to those for an underdoping level of ˜0.1 in La-Bi2201. Although out-of-plane disorders strongly affect the electronic system of the Cu-O plane, they have no effect on the period of the CCO, which is five times the lattice constant (5a) along the Cu-O bond directions for OP doping and 4a for p ˜ 0.1. We suggest that the concentration of holes doped into the Cu-O plane may be an essential factor for determining the period of the CCO.

  5. Effects of Dopant on Depoling Temperature in Modified BiScO3 - PbTiO3

    NASA Technical Reports Server (NTRS)

    Kowalski, Benjamin; Sehirlioglu, Alp

    2014-01-01

    In recent years there has been a renewed interest for high temperature piezoelectrics for both terrestrial and aerospace applications. These applications are limited in part by the operating temperature, which is usually taken as one half of the Curie temperature (Tc), and is 200C for one of the most widely used commercial piezoelectrics, Pb(Zr,Ti)O3 (PZT). In an effort to increase Tc, subsequent research into high temperature Bi(BB)O3 PbTiO3 piezoelectrics led to the discovery of the morphotropic phase boundary (MPB) in the high-Tc BiScO3 PbTiO3 (BS-PT) system with a Tc of 460C and a d33 of 460 pmV. The Tc marks the ferroelectric to paraelectric phase transformation and while, in general, a phase transformation leads to thermal depoling in piezoelectrics with low or moderate Tcs, for high Tc piezoelectrics thermally assisted dipole rotation can lead to randomization of domains at temperatures below Tc. It becomes necessary to determine the depoling temperature (Td) which dictates the actual working temperature range. By doping for Sc and Ti the Td can be shifted while maintaining similar electromechanical properties as a function of temperature. The effect of this B-site doping on depoling temperature has been explored through the characterization of microstructure and weakhigh field measurements.

  6. Development of Tyrosine-Based Radiotracer 99mTc-N4-Tyrosine for Breast Cancer Imaging

    PubMed Central

    Kong, Fan-Lin; Ali, Mohammad S.; Rollo, Alex; Smith, Daniel L.; Zhang, Yinhan; Yu, Dong-Fang; Yang, David J.

    2012-01-01

    The purpose of this study was to develop an efficient way to synthesize 99mTc-O-[3-(1,4,8,11-tetraazabicyclohexadecane)-propyl]-tyrosine (99mTc-N4-Tyrosine), a novel amino acid-based radiotracer, and evaluate its potential in breast cancer gamma imaging. Precursor N4-Tyrosine was synthesized using a 5-step procedure, and its total synthesis yield was 38%. It was successfully labeled with 99mTc with high radiochemical purity (>95%). Cellular uptake of 99mTc-N4-Tyrosine was much higher than that of 99mTc-N4 and the clinical gold standard 18F-2-deoxy-2-fluoro-glucose (18F-FDG) in rat breast tumor cells in vitro. Tissue uptake and dosimetry estimation in normal rats revealed that 99mTc-N4-Tyrosine could be safely administered to humans. Evaluation in breast tumor-bearing rats showed that although 99mTc-N4-Tyrosine appeared to be inferior to 18F-FDG in distinguishing breast tumor tissue from chemical-induced inflammatory tissue, it had high tumor-to-muscle uptake ratios and could detect breast tumors clearly by planar scintigraphic imaging. 99mTc-N4-Tyrosine could thus be a useful radiotracer for use in breast tumor diagnostic imaging. PMID:22496612

  7. Radiopharmaceutical considerations for using Tc-99m MAA in lung transplant patients.

    PubMed

    Ponto, James A

    2010-01-01

    To elucidate radiopharmaceutical considerations for using technetium Tc-99m albumin aggregated (Tc-99m MAA) in lung transplant patients and to establish an appropriate routine dose and preparation procedure. Tertiary care academic hospital during May 2007 to May 2009. Nuclear pharmacist working in nuclear medicine department. Radiopharmaceutical considerations deemed important for the use of Tc-99m MAA in lung transplant patients included radioactivity dose, particulate dose, rate of the radiolabeling reaction (preparation time), and final radiochemical purity. Evaluation of our initial 12-month experience, published literature, and professional practice guidelines provided the basis for establishing an appropriate dose and preparation procedure of Tc-99m MAA for use in lung transplant patients. Radiochemical purity at typical incubation times and image quality in subsequent lung transplant patients imaged during the next 12 months. Based on considerations of radioactivity dose, particulate dose, rate of the radiolabeling reaction (preparation time), and final radiochemical purity, a routine dose consisting of 3 mCi (111 MBq) and 100,000 particles of Tc-99m MAA for planar perfusion lung imaging of adult lung transplant patients was established as reasonable and appropriate. MAA kits were prepared with a more reasonable amount of Tc-99m and yielded high radiochemical purity values in typical incubation times. Images have continued to be of high diagnostic quality. Tc-99m MAA used for lung transplant imaging can be readily prepared with high radiochemical purity to provide a dose of 3 mCi (111 GBq)/100,000 particles, which provides images of high diagnostic quality.

  8. Thermoelectric anisotropy in the iron-based superconductor Ba (Fe1-xCox) 2As2

    NASA Astrophysics Data System (ADS)

    Matusiak, Marcin; Rogacki, Krzysztof; Wolf, Thomas

    2018-06-01

    We report on the in-plane anisotropy of the Seebeck and Nernst coefficients as well as of the electrical resistivity determined for a series of strain-detwinned single crystals of Ba (Fe1-xC ox) 2A s2 . Two underdoped samples (x =0.024 , 0.045) exhibiting a transition from the tetragonal paramagnetic phase to the orthorhombic spin density wave (SDW) phase (at Ttr=100 and 60 K, respectively) show an onset of Nernst anisotropy at temperatures above 200 K, which is significantly higher than Ttr. In the optimally doped sample (x =0.06 ) the transport properties also appear to be in-plane anisotropic below T ≈120 K, despite the fact that this particular composition does not show any evidence of long-range magnetic order. However, the anisotropy observed in the optimally doped crystal is rather small, and for the Seebeck and Nernst coefficients the difference between values measured along and across the uniaxial strain has an opposite sign to those observed for underdoped crystals with x =0.024 and 0.045. For these two samples, the insensitivity of the Nernst anisotropy to the SDW transition suggests that the origin of nematicity might be something other than magnetic.

  9. New Gastrin Releasing Peptide Receptor-Directed [99mTc]Demobesin 1 Mimics: Synthesis and Comparative Evaluation.

    PubMed

    Nock, Berthold A; Charalambidis, David; Sallegger, Werner; Waser, Beatrice; Mansi, Rosalba; Nicolas, Guillaume P; Ketani, Eleni; Nikolopoulou, Anastasia; Fani, Melpomeni; Reubi, Jean-Claude; Maina, Theodosia

    2018-04-12

    We have previously reported on the gastrin releasing peptide receptor (GRPR) antagonist [ 99m Tc]1, ([ 99m Tc]demobesin 1, 99m Tc-[N 4 '-diglycolate-dPhe 6 ,Leu-NHEt 13 ]BBN(6-13)). [ 99m Tc]1 has shown superior biological profile compared to analogous agonist-based 99m Tc-radioligands. We herein present a small library of [ 99m Tc]1 mimics generated after structural modifications in (a) the linker ([ 99m Tc]2, [ 99m Tc]3, [ 99m Tc]4), (b) the peptide chain ([ 99m Tc]5, [ 99m Tc]6), and (c) the C-terminus ([ 99m Tc]7 or [ 99m Tc]8). The effects of above modifications on the biological properties of analogs were studied in PC-3 cells and tumor-bearing SCID mice. All analogs showed subnanomolar affinity for the human GRPR, while most receptor-affine 4 and 8 behaved as potent GRPR antagonists in a functional internalization assay. In mice bearing PC-3 tumors, [ 99m Tc]1-[ 99m Tc]6 exhibited GRPR-specific tumor uptake, rapidly clearing from normal tissues. [ 99m Tc]4 displayed the highest tumor uptake (28.8 ± 4.1%ID/g at 1 h pi), which remained high even after 24 h pi (16.3 ± 1.8%ID/g), well surpassing that of [ 99m Tc]1 (5.4 ± 0.7%ID/g at 24 h pi).

  10. A solvent-extraction module for cyclotron production of high-purity technetium-99m.

    PubMed

    Martini, Petra; Boschi, Alessandra; Cicoria, Gianfranco; Uccelli, Licia; Pasquali, Micòl; Duatti, Adriano; Pupillo, Gaia; Marengo, Mario; Loriggiola, Massimo; Esposito, Juan

    2016-12-01

    The design and fabrication of a fully-automated, remotely controlled module for the extraction and purification of technetium-99m (Tc-99m), produced by proton bombardment of enriched Mo-100 molybdenum metallic targets in a low-energy medical cyclotron, is here described. After dissolution of the irradiated solid target in hydrogen peroxide, Tc-99m was obtained under the chemical form of 99m TcO 4 - , in high radionuclidic and radiochemical purity, by solvent extraction with methyl ethyl ketone (MEK). The extraction process was accomplished inside a glass column-shaped vial especially designed to allow for an easy automation of the whole procedure. Recovery yields were always >90% of the loaded activity. The final pertechnetate saline solution Na 99m TcO 4 , purified using the automated module here described, is within the Pharmacopoeia quality control parameters and is therefore a valid alternative to generator-produced 99m Tc. The resulting automated module is cost-effective and easily replicable for in-house production of high-purity Tc-99m by cyclotrons. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. High Tc screen-printed YBa2Cu3O(7-x) films - Effect of the substrate material

    NASA Astrophysics Data System (ADS)

    Bansal, Narottam P.; Simons, Rainee N.; Farrell, D. E.

    1988-08-01

    Thick films of YBa2Cu3O(7-x) have been deposited on highly polished alumina, magnesia spinel, nickel aluminum titanate (Ni-Al-Ti), and barium tetratitanate (Ba-Ti) substrates by the screen printing technique. Properties of the films were found to be highly sensitive to the choice of the substrate material. The film on Ba-Ti turned green after firing, due to a reaction with the substrate and were insulating. A film on Ni-Al-Ti had a Tc (onset) of about 95 K and lost 90 percent of its resistance by about 75 K. However, even at 4 K it was not fully superconducting, possibly due to a reaction between the film and the substrate and interdiffusion of the reaction products. The film on alumina had Tc (onset) of about 96 K, Tc (zero) of about 66 K, and Delta Tc of about 10 K. The best film was obtained on spinel and had Tc (onset) of about 94 K, zero resistance at 81 K, and a transition width of about 7 K.

  12. High Tc screen-printed YBa2Cu3O(7-x) films - Effect of the substrate material

    NASA Technical Reports Server (NTRS)

    Bansal, Narottam P.; Simons, Rainee N.; Farrell, D. E.

    1988-01-01

    Thick films of YBa2Cu3O(7-x) have been deposited on highly polished alumina, magnesia spinel, nickel aluminum titanate (Ni-Al-Ti), and barium tetratitanate (Ba-Ti) substrates by the screen printing technique. Properties of the films were found to be highly sensitive to the choice of the substrate material. The film on Ba-Ti turned green after firing, due to a reaction with the substrate and were insulating. A film on Ni-Al-Ti had a Tc (onset) of about 95 K and lost 90 percent of its resistance by about 75 K. However, even at 4 K it was not fully superconducting, possibly due to a reaction between the film and the substrate and interdiffusion of the reaction products. The film on alumina had Tc (onset) of about 96 K, Tc (zero) of about 66 K, and Delta Tc of about 10 K. The best film was obtained on spinel and had Tc (onset) of about 94 K, zero resistance at 81 K, and a transition width of about 7 K.

  13. Understanding the in vivo uptake kinetics of a phosphatidylethanolamine-binding agent (99m)Tc-Duramycin.

    PubMed

    Audi, Said; Li, Zhixin; Capacete, Joseph; Liu, Yu; Fang, Wei; Shu, Laura G; Zhao, Ming

    2012-08-01

    (99m)Tc-Duramycin is a peptide-based molecular probe that binds specifically to phosphatidylethanolamine (PE). The goal was to characterize the kinetics of molecular interactions between (99m)Tc-Duramycin and the target tissue. High level of accessible PE is induced in cardiac tissues by myocardial ischemia (30 min) and reperfusion (120 min) in Sprague-Dawley rats. Target binding and biodistribution of (99m)Tc-duramycin were captured using SPECT/CT. To quantify the binding kinetics, the presence of radioactivity in ischemic versus normal cardiac tissues was measured by gamma counting at 3, 10, 20, 60 and 180 min after injection. A partially inactivated form of (99m)Tc-Duramycin was analyzed in the same fashion. A compartment model was developed to quantify the uptake kinetics of (99m)Tc-Duramycin in normal and ischemic myocardial tissue. (99m)Tc-duramycin binds avidly to the damaged tissue with a high target-to-background radio. Compartment modeling shows that accessibility of binding sites in myocardial tissue to (99m)Tc-Duramycin is not a limiting factor and the rate constant of target binding in the target tissue is at 2.2 ml/nmol/min/g. The number of available binding sites for (99m)Tc-Duramycin in ischemic myocardium was estimated at 0.14 nmol/g. Covalent modification of D15 resulted in a 9-fold reduction in binding affinity. (99m)Tc-Duramycin accumulates avidly in target tissues in a PE-dependent fashion. Model results reflect an efficient uptake mechanism, consistent with the low molecular weight of the radiopharmaceutical and the relatively high density of available binding sites. These data help better define the imaging utilities of (99m)Tc-Duramycin as a novel PE-binding agent. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Performance characteristics of the ARCHITECT Active-B12 (Holotranscobalamin) assay.

    PubMed

    Merrigan, Stephen D; Owen, William E; Straseski, Joely A

    2015-01-01

    Vitamin B12 (cobalamin) is a necessary cofactor in methionine and succinyl-CoA metabolism. Studies estimate the deficiency prevalence as high as 30% in the elderly population. Ten to thirty percent of circulating cobalamin is bound to transcobalamin (holotranscobalamin, holoTC) which can readily enter cells and is therefore considered the bioactive form. The objective of our study was to evaluate the analytical performance of a high-throughput, automated holoTC assay (ARCHITECT i2000(SR) Active-B12 (Holotranscobalamin)) and compare it to other available methods. Manufacturer-specified limits of blank (LoB), detection (LoD), and quantitation (LoQ), imprecision, interference, and linearity were evaluated for the ARCHITECT HoloTC assay. Residual de-identified serum samples were used to compare the ARCHITECT HoloTC assay with the automated AxSYM Active-B12 (Holotranscobalamin) assay (Abbott Diagnostics) and the manual Active-B12 (Holotranscobalamin) Enzyme Immunoassay (EIA) (Axis-Shield Diagnostics, Dundee, Scotland, UK). Manufacturer's claims of LoB, LoD, LoQ, imprecision, interference, and linearity to the highest point tested (113.4 pmol/L) were verified for the ARCHITECT HoloTC assay. Method comparison of the ARCHITECT HoloTC to the AxSYM HoloTC produced the following Deming regression statistics: (ARCHITECT(HoloTc)) = 0.941 (AxSYM(HoloTC)) + 1.2 pmol/L, S(y/x) = 6.4, r = 0.947 (n = 98). Comparison to the Active-B12 EIA produced: (ARCHITECT(HoloTC)) = 1.105 (EIA(Active-B12)) - 6.8 pmol/L, S(y/x) = 11.0, r = 0.950 (n = 221). This assay performed acceptably for LoB, LoD, LoQ, imprecision, interference, linearity and method comparison to the predicate device (AxSYM). An additional comparison to a manual Active-B12 EIA method performed similarly, with minor exceptions. This study determined that the ARCHITECT HoloTC assay is suitable for routine clinical use, which provides a high-throughput alternative for automated testing of this emerging marker of cobalamin deficiency.

  15. Development and Pharmacological Evaluation of New Bone-Targeted (99m)Tc-Radiolabeled Bisphosphonates.

    PubMed

    Makris, George; Tseligka, Eirini D; Pirmettis, Ioannis; Papadopoulos, Minas S; Vizirianakis, Ioannis S; Papagiannopoulou, Dionysia

    2016-07-05

    A novel bisphosphonate, 1-(3-aminopropylamino)ethane-1,1-diyldiphosphonic acid (3), was coupled to the tridentate chelators di-2-picolylamine, 2-picolylamine-N-acetic acid, iminodiacetic acid, 3-((2-aminoethyl)thio)-3-(1H-imidazol-4-yl)propanoic acid, and 2-((2-carboxyethyl)thio)-3-(1H-imidazol-4-yl)propanoic acid to form ligands 6, 9, 11, 15, and 19, respectively. Organometallic complexes of the general formula [Re/(99m)Tc(CO)3(κ(3)-L)] were synthesized, where L denotes ligand 6, 9, 11, 15, or 19. The rhenium complexes were prepared at the macroscopic level and characterized by spectroscopic methods. The technetium-99m organometallic complexes were synthesized in high yield and were identified by comparative reversed-phase HPLC with their Re analogues. The (99m)Tc tracers were stable in vitro and exhibited binding to hydroxyapatite. In biodistribution studies, all of the (99m)Tc complexes exhibited high bone uptake superior to that of 25, which is the directly (99m)Tc-labeled bisphosphonate 3, and comparable to that of (99m)Tc-methylene diphosphonate ((99m)Tc-MDP). The tracers [(99m)Tc(CO)3(6)] (26), [(99m)Tc(CO)3(9)] (27), [(99m)Tc(CO)3(11)] (28), and [(99m)Tc(CO)3(15)] (29) exhibited higher bone/blood ratios than (99m)Tc-MDP. 26 had the highest bone uptake at 1 h p.i. The new bisphosphonates showed no substantial growth inhibitory capacity in PC-3, Saos-2, and MCF-7 established cancer cell lines at low concentrations. Incubation of 26 with the same cancer cell lines indicated a rapid and saturated uptake. The promising properties of 26-29 indicate their potential for use as bone-imaging agents.

  16. Psychogenic fever: how psychological stress affects body temperature in the clinical population

    PubMed Central

    Oka, Takakazu

    2015-01-01

    Psychogenic fever is a stress-related, psychosomatic disease especially seen in young women. Some patients develop extremely high core body temperature (Tc) (up to 41°C) when they are exposed to emotional events, whereas others show persistent low-grade high Tc (37–38°C) during situations of chronic stress. The mechanism for psychogenic fever is not yet fully understood. However, clinical case reports demonstrate that psychogenic fever is not attenuated by antipyretic drugs, but by psychotropic drugs that display anxiolytic and sedative properties, or by resolving patients' difficulties via natural means or psychotherapy. Animal studies have demonstrated that psychological stress increases Tc via mechanisms distinct from infectious fever (which requires proinflammatory mediators) and that the sympathetic nervous system, particularly β3-adrenoceptor-mediated non-shivering thermogenesis in brown adipose tissue, plays an important role in the development of psychological stress-induced hyperthermia. Acute psychological stress induces a transient, monophasic increase in Tc. In contrast, repeated stress induces anticipatory hyperthermia, reduces diurnal changes in Tc, or slightly increases Tc throughout the day. Chronically stressed animals also display an enhanced hyperthermic response to a novel stress, while past fearful experiences induce conditioned hyperthermia to the fear context. The high Tc that psychogenic fever patients develop may be a complex of these diverse kinds of hyperthermic responses. PMID:27227051

  17. Enhanced critical current density in the pressure-induced magnetic state of the high-temperature superconductor FeSe

    PubMed Central

    Jung, Soon-Gil; Kang, Ji-Hoon; Park, Eunsung; Lee, Sangyun; Lin, Jiunn-Yuan; Chareev, Dmitriy A.; Vasiliev, Alexander N.; Park, Tuson

    2015-01-01

    We investigate the relation of the critical current density (Jc) and the remarkably increased superconducting transition temperature (Tc) for the FeSe single crystals under pressures up to 2.43 GPa, where the Tc is increased by ~8 K/GPa. The critical current density corresponding to the free flux flow is monotonically enhanced by pressure which is due to the increase in Tc, whereas the depinning critical current density at which the vortex starts to move is more influenced by the pressure-induced magnetic state compared to the increase of Tc. Unlike other high-Tc superconductors, FeSe is not magnetic, but superconducting at ambient pressure. Above a critical pressure where magnetic state is induced and coexists with superconductivity, the depinning Jc abruptly increases even though the increase of the zero-resistivity Tc is negligible, directly indicating that the flux pinning property compared to the Tc enhancement is a more crucial factor for an achievement of a large Jc. In addition, the sharp increase in Jc in the coexisting superconducting phase of FeSe demonstrates that vortices can be effectively trapped by the competing antiferromagnetic order, even though its antagonistic nature against superconductivity is well documented. These results provide new guidance toward technological applications of high-temperature superconductors. PMID:26548444

  18. Psychogenic fever: how psychological stress affects body temperature in the clinical population.

    PubMed

    Oka, Takakazu

    2015-01-01

    Psychogenic fever is a stress-related, psychosomatic disease especially seen in young women. Some patients develop extremely high core body temperature (Tc) (up to 41°C) when they are exposed to emotional events, whereas others show persistent low-grade high Tc (37-38°C) during situations of chronic stress. The mechanism for psychogenic fever is not yet fully understood. However, clinical case reports demonstrate that psychogenic fever is not attenuated by antipyretic drugs, but by psychotropic drugs that display anxiolytic and sedative properties, or by resolving patients' difficulties via natural means or psychotherapy. Animal studies have demonstrated that psychological stress increases Tc via mechanisms distinct from infectious fever (which requires proinflammatory mediators) and that the sympathetic nervous system, particularly β3-adrenoceptor-mediated non-shivering thermogenesis in brown adipose tissue, plays an important role in the development of psychological stress-induced hyperthermia. Acute psychological stress induces a transient, monophasic increase in Tc. In contrast, repeated stress induces anticipatory hyperthermia, reduces diurnal changes in Tc, or slightly increases Tc throughout the day. Chronically stressed animals also display an enhanced hyperthermic response to a novel stress, while past fearful experiences induce conditioned hyperthermia to the fear context. The high Tc that psychogenic fever patients develop may be a complex of these diverse kinds of hyperthermic responses.

  19. High-affinity copper transport and Snq2 export permease of saccharomyces cerevisiae modulate cytotoxicity of PR-10 from Theobroma cacao.

    PubMed

    Pungartnik, Cristina; da Silva, Aline Clara; de Melo, Sarah Alves; Gramacho, Karina Peres; de Mattos Cascardo, Júlio Cézar; Brendel, Martin; Micheli, Fabienne; da Silva Gesteira, Abelmon

    2009-01-01

    A pathogenesis-related (PR) protein from Theobroma cacao (TcPR-10) was identified from a cacao-Moniliophthora perniciosa interaction cDNA library. Nucleotide and amino acid sequences showed homology with other PR-10 proteins having P loop motif and Betv1 domain. Recombinant TcPR-10 showed in vitro and in vivo ribonuclease activity, and antifungal activity against the basidiomycete cacao pathogen M. perniciosa and the yeast Saccharomyces cerevisiae. Fluorescein isothiocyanate-labeled TcPR-10 was internalized by M. perniciosa hyphae and S. cerevisiae cells and inhibited growth of both fungi. Energy and temperature-dependent internalization of the TcPR-10 suggested an active importation into the fungal cells. Chronical exposure to TcPR-10 of 29 yeast mutants with single gene defects in DNA repair, general membrane transport, metal transport, and antioxidant defenses was tested. Two yeast mutants were hyperresistant compared with their respective isogenic wild type: ctr3Delta mutant, lacking the high-affinity plasma membrane copper transporter and mac1Delta, the copper-sensing transcription factor involved in regulation of high-affinity copper transport. Acute exposure of exponentially growing yeast cells revealed that TcPR-10 resistance is also enhanced in the Snq2 export permease-lacking mutant which has reduced intracellular presence of TcPR-10.

  20. Lipoprotein profiles and serum peroxide levels of aged women consuming palmolein or oleic acid-rich sunflower oil diets.

    PubMed

    Cuesta, C; Ródenas, S; Merinero, M C; Rodríguez-Gil, S; Sánchez-Muniz, F J

    1998-09-01

    To investigate the hypercholesterolemic effects of a dietary exchange between 16:0 and 18:1 while 18:2 was at relatively lower level (approximately 4%) in aged women with initially high total serum cholesterol (TC) and low density lipoprotein cholesterol (LDL-C) values and with high intakes of dietary cholesterol. Subjects were assigned to two consecutive 28 d periods. In the first period all subjects followed an oleic acid-rich diet in the form of oleic acid-rich sunflower oil. This was followed by a second period rich in palmitic acid in the form of palmolein. Nutrient intakes, serum lipids, lipoproteins, antioxidant vitamins, peroxides and LDL-peroxides were measured at two dietary periods. Instituto de Nutrición y Bromatología (CSIC), Departamento de Nutrición y Bromatología I (Nutrición) and Sección Departamental de Quimica Analítica, Universidad Complutense, Madrid, Spain. The palmolein period led to an increase in TC (P < 0.001; 17.7%) and serum apolipoprotein (Apo) B levels (P < 0.001; 18.0%). LDL-C and LDL-Apo B concentrations were higher (P < 0.001, 4.33+/-0.94 mmol/L and P < 0.01, 1.08+/-0.20 g/L, respectively) following this period than following the oleic acid-rich sunflower oil diet (3.56+/-0.85 mmol/L, 0.93+/-0.16g/L, respectively). No significant differences were observed in the TC/high density lipoprotein cholesterol (TC/HDL-C) ratio between the two dietary periods. Serum and LDL-peroxides were lower (P < 0.01, 49.5%, and P < 0.001, 69.0%, respectively) after the palmolein diet than after the oleic acid-rich sunflower oil diet. The palmolein diet significantly increased TC, LDL-C, Apo B, VLDL-ApoB, LDL-ApoB in women with TC > or = 6.21 mmol/L or with TC < 6.21 mmol/L, but the increase in Apo B, LDL-C and LDL-Apo B was greater among the women with high TC. The palmolein diet increased HDL-C in women with high or with low TC but this rise was on the borderline of statistical significance (P = 0.06) only in normocholesterolemics. Serum and LDL-peroxides tended to be higher in women with TC > 6.21 mmol/L than in women with TC < 6.21 mmol/L, but palmolein decreased serum and LDL-peroxide in hypercholesterolemics more than in the normocholesterolemics, resulting in serum and LDL-peroxide levels which theoretically are more adequate. Though palmolein increased LDL-C concentrations, it better protected LDL particles, mainly in women with high TC, against peroxidation than did oleic acid-rich sunflower oil.

  1. Theoretical Modeling of (99)Tc NMR Chemical Shifts.

    PubMed

    Hall, Gabriel B; Andersen, Amity; Washton, Nancy M; Chatterjee, Sayandev; Levitskaia, Tatiana G

    2016-09-06

    Technetium-99 (Tc) displays a rich chemistry due to its wide range of accessible oxidation states (from -I to +VII) and ability to form coordination compounds. Determination of Tc speciation in complex mixtures is a major challenge, and (99)Tc nuclear magnetic resonance (NMR) spectroscopy is widely used to probe chemical environments of Tc in odd oxidation states. However, interpretation of (99)Tc NMR data is hindered by the lack of reference compounds. Density functional theory (DFT) calculations can help to fill this gap, but to date few computational studies have focused on (99)Tc NMR of compounds and complexes. This work evaluates the effectiveness of both pure generalized gradient approximation and their corresponding hybrid functionals, both with and without the inclusion of scalar relativistic effects, to model the (99)Tc NMR spectra of Tc(I) carbonyl compounds. With the exception of BLYP, which performed exceptionally well overall, hybrid functionals with inclusion of scalar relativistic effects are found to be necessary to accurately calculate (99)Tc NMR spectra. The computational method developed was used to tentatively assign an experimentally observed (99)Tc NMR peak at -1204 ppm to fac-Tc(CO)3(OH)3(2-). This study examines the effectiveness of DFT computations for interpretation of the (99)Tc NMR spectra of Tc(I) coordination compounds in high salt alkaline solutions.

  2. Superconductivity-localization interplay and fluctuation magnetoresistance in epitaxial BaPb1 -xBixO3 thin films

    NASA Astrophysics Data System (ADS)

    Harris, D. T.; Campbell, N.; Uecker, R.; Brützam, M.; Schlom, D. G.; Levchenko, A.; Rzchowski, M. S.; Eom, C.-B.

    2018-04-01

    BaPb1 -xBixO3 is a superconductor, with transition temperature Tc=11 K, whose parent compound BaBiO3 possesses a charge ordering phase and perovskite crystal structure reminiscent of the cuprates. The lack of magnetism simplifies the BaPb1 -xBixO3 phase diagram, making this system an ideal platform for contrasting high-Tc systems with isotropic superconductors. Here we use high-quality epitaxial thin films and magnetotransport to demonstrate superconducting fluctuations that extend well beyond Tc. For the thickest films (thickness above ˜100 nm ) this region extends to ˜27 K , well above the bulk Tc and remarkably close to the higher Tc of Ba1 -xKxBiO3 (Tc=31 K). We drive the system through a superconductor-insulator transition by decreasing thickness and find the observed Tc correlates strongly with disorder. This material manifests strong fluctuations across a wide range of thicknesses, temperatures, and disorder presenting new opportunities for understanding the precursor of superconductivity near the 2D-3D dimensionality crossover.

  3. Polaron theory of high- Tc superconductors

    NASA Astrophysics Data System (ADS)

    Alexandrov, A. S.

    1989-05-01

    It is shown that the ordinary electron-phonon interaction can produce a high Tc as a result of the polaron narrowing of the band, which is not considered by the traditional theory of strong-coupling superconductors based on Migdal-Eliashberg equations, which are violated even in the range of moderate values λ ⪖1. Numerous experimental data are discussed which seem to favour a phonon-mediated attraction, polaron mass enhancement, narrow band and nonadiabatic motion of carriers and charged Bose-like excitations in high Tc metallic oxides.

  4. The Current Experimental Status of the High Tc Problem

    NASA Astrophysics Data System (ADS)

    Greene, Richard

    Over 50,000 experimental papers have been published since 1987 on the copper oxide (cuprate) high Tc superconductors. In this talk, I will attempt to summarize the experimental properties that we presently understand and those that we don't yet understand. I will not speculate on the ``unknown unknowns'', although some examples of these have appeared during the past 30 years of research. I may also present a few slides about the status of iron-based superconductors, the other major class of unconventional high Tc materials.

  5. Inverse correlation between quasiparticle mass and Tc in a cuprate high-Tc superconductor

    PubMed Central

    Putzke, Carsten; Malone, Liam; Badoux, Sven; Vignolle, Baptiste; Vignolles, David; Tabis, Wojciech; Walmsley, Philip; Bird, Matthew; Hussey, Nigel E.; Proust, Cyril; Carrington, Antony

    2016-01-01

    Close to a zero-temperature transition between ordered and disordered electronic phases, quantum fluctuations can lead to a strong enhancement of electron mass and to the emergence of competing phases such as superconductivity. A correlation between the existence of such a quantum phase transition and superconductivity is quite well established in some heavy fermion and iron-based superconductors, and there have been suggestions that high-temperature superconductivity in copper-oxide materials (cuprates) may also be driven by the same mechanism. Close to optimal doping, where the superconducting transition temperature Tc is maximal in cuprates, two different phases are known to compete with superconductivity: a poorly understood pseudogap phase and a charge-ordered phase. Recent experiments have shown a strong increase in quasiparticle mass m* in the cuprate YBa2Cu3O7-δ as optimal doping is approached, suggesting that quantum fluctuations of the charge-ordered phase may be responsible for the high-Tc superconductivity. We have tested the robustness of this correlation between m* and Tc by performing quantum oscillation studies on the stoichiometric compound YBa2Cu4O8 under hydrostatic pressure. In contrast to the results for YBa2Cu3O7-δ, we find that in YBa2Cu4O8, the mass decreases as Tc increases under pressure. This inverse correlation between m* and Tc suggests that quantum fluctuations of the charge order enhance m* but do not enhance Tc. PMID:27034989

  6. Cold SQUIDs and hot samples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, T.S.C.

    1997-05-01

    Low transition temperature (low-{Tc}) and high-{Tc} Superconducting QUantum Interference Devices (SQUIDs) have been used to perform high-resolution magnetic measurements on samples whose temperatures are much higher than the operating temperatures of the devices. Part 1 of this work focuses on measurements of the rigidity of flux vortices in high-{Tc} superconductors using two low-{Tc} SQUIDs, one on either side of a thermally-insulated sample. The correlation between the signals of the SQUIDs is a direct measure of the extent of correlation between the movements of opposite ends of vortices. These measurements were conducted under the previously-unexplored experimental conditions of nominally-zero applied magneticmore » field, such that vortex-vortex interactions were unimportant, and with zero external current. At specific temperatures, the authors observed highly-correlated noise sources, suggesting that the vortices moved as rigid rods. At other temperatures, the noise was mostly uncorrelated, suggesting that the relevant vortices were pinned at more than one point along their length. Part 2 describes the design, construction, performance, and applications of a scanning high-{Tc} SQUID microscope optimized for imaging room-temperature objects with very high spatial resolution and magnetic source sensitivity.« less

  7. Magnetic Quantum Oscillations in YBa2Cu3O6.61 and YBa2Cu3O6.69 in Fields of Up to 85 T: Patching the Hole in the Roof of the Superconducting Dome

    NASA Astrophysics Data System (ADS)

    Singleton, John; de La Cruz, Clarina; McDonald, R. D.; Li, Shiliang; Altarawneh, Moaz; Goddard, Paul; Franke, Isabel; Rickel, Dwight; Mielke, C. H.; Yao, Xin; Dai, Pengcheng

    2010-02-01

    We measure magnetic quantum oscillations in the underdoped cuprates YBa2Cu3O6+x with x=0.61, 0.69, using fields of up to 85 T. The quantum-oscillation frequencies and effective masses obtained suggest that the Fermi energy in the cuprates has a maximum at hole doping p≈0.11-0.12. On either side, the effective mass may diverge, possibly due to phase transitions associated with the T=0 limit of the metal-insulator crossover (low-p side), and the postulated topological transition from small to large Fermi surface close to optimal doping (high p side).

  8. Imaging of Cerebral Amyloid Angiopathy with Bivalent 99mTc-Hydroxamamide Complexes

    NASA Astrophysics Data System (ADS)

    Iikuni, Shimpei; Ono, Masahiro; Watanabe, Hiroyuki; Matsumura, Kenji; Yoshimura, Masashi; Kimura, Hiroyuki; Ishibashi-Ueda, Hatsue; Okamoto, Yoko; Ihara, Masafumi; Saji, Hideo

    2016-05-01

    Cerebral amyloid angiopathy (CAA), characterized by the deposition of amyloid aggregates in the walls of cerebral vasculature, is a major factor in intracerebral hemorrhage and vascular cognitive impairment and is also associated closely with Alzheimer’s disease (AD). We previously reported 99mTc-hydroxamamide (99mTc-Ham) complexes with a bivalent amyloid ligand showing high binding affinity for β-amyloid peptide (Aβ(1-42)) aggregates present frequently in the form in AD. In this article, we applied them to CAA-specific imaging probes, and evaluated their utility for CAA-specific imaging. In vitro inhibition assay using Aβ(1-40) aggregates deposited mainly in CAA and a brain uptake study were performed for 99mTc-Ham complexes, and all 99mTc-Ham complexes with an amyloid ligand showed binding affinity for Aβ(1-40) aggregates and very low brain uptake. In vitro autoradiography of human CAA brain sections and ex vivo autoradiography of Tg2576 mice were carried out for bivalent 99mTc-Ham complexes ([99mTc]SB2A and [99mTc]BT2B), and they displayed excellent labeling of Aβ depositions in human CAA brain sections and high affinity and selectivity to CAA in transgenic mice. These results may offer new possibilities for the development of clinically useful CAA-specific imaging probes based on the 99mTc-Ham complex.

  9. Imaging of Cerebral Amyloid Angiopathy with Bivalent (99m)Tc-Hydroxamamide Complexes.

    PubMed

    Iikuni, Shimpei; Ono, Masahiro; Watanabe, Hiroyuki; Matsumura, Kenji; Yoshimura, Masashi; Kimura, Hiroyuki; Ishibashi-Ueda, Hatsue; Okamoto, Yoko; Ihara, Masafumi; Saji, Hideo

    2016-05-16

    Cerebral amyloid angiopathy (CAA), characterized by the deposition of amyloid aggregates in the walls of cerebral vasculature, is a major factor in intracerebral hemorrhage and vascular cognitive impairment and is also associated closely with Alzheimer's disease (AD). We previously reported (99m)Tc-hydroxamamide ((99m)Tc-Ham) complexes with a bivalent amyloid ligand showing high binding affinity for β-amyloid peptide (Aβ(1-42)) aggregates present frequently in the form in AD. In this article, we applied them to CAA-specific imaging probes, and evaluated their utility for CAA-specific imaging. In vitro inhibition assay using Aβ(1-40) aggregates deposited mainly in CAA and a brain uptake study were performed for (99m)Tc-Ham complexes, and all (99m)Tc-Ham complexes with an amyloid ligand showed binding affinity for Aβ(1-40) aggregates and very low brain uptake. In vitro autoradiography of human CAA brain sections and ex vivo autoradiography of Tg2576 mice were carried out for bivalent (99m)Tc-Ham complexes ([(99m)Tc]SB2A and [(99m)Tc]BT2B), and they displayed excellent labeling of Aβ depositions in human CAA brain sections and high affinity and selectivity to CAA in transgenic mice. These results may offer new possibilities for the development of clinically useful CAA-specific imaging probes based on the (99m)Tc-Ham complex.

  10. Total cholesterol and neuropsychiatric symptoms in Alzheimer's disease: the impact of total cholesterol level and gender.

    PubMed

    Hall, James R; Wiechmann, April R; Johnson, Leigh A; Edwards, Melissa; Barber, Robert C; Cunningham, Rebecca; Singh, Meharvan; O'Bryant, Sid E

    2014-01-01

    Neuropsychiatric symptoms (NPS) in Alzheimer's disease (AD) are a major factor in nursing home placement and a primary cause of stress for caregivers. Elevated cholesterol has been linked to psychiatric disorders and has been shown to be a risk factor for AD and to impact disease progression. The present study investigated the relationship between cholesterol and NPS in AD. Data on cholesterol and NPS from 220 individuals (144 females, 76 males) with mild-to-moderate AD from the Texas Alzheimer's Research and Care Consortium (TARCC) cohort were analyzed. The total number of NPS and symptoms of hyperactivity, psychosis, affect and apathy were evaluated. Groups based on total cholesterol (TC; ≥200 vs. <200 mg/dl) were compared with regard to NPS. The impact of gender was also assessed. Individuals with high TC had lower MMSE scores as well as significantly more NPS and more symptoms of psychosis. When stratified by gender, males with high TC had significantly more NPS than females with high TC or than males or females with low TC. The role of elevated cholesterol in the occurrence of NPS in AD appears to be gender and symptom specific. A cross-validation of these findings will have implications for possible treatment interventions, especially for males with high TC.

  11. High-Precision Monte Carlo Simulation of the Ising Models on the Penrose Lattice and the Dual Penrose Lattice

    NASA Astrophysics Data System (ADS)

    Komura, Yukihiro; Okabe, Yutaka

    2016-04-01

    We study the Ising models on the Penrose lattice and the dual Penrose lattice by means of the high-precision Monte Carlo simulation. Simulating systems up to the total system size N = 20633239, we estimate the critical temperatures on those lattices with high accuracy. For high-speed calculation, we use the generalized method of the single-GPU-based computation for the Swendsen-Wang multi-cluster algorithm of Monte Carlo simulation. As a result, we estimate the critical temperature on the Penrose lattice as Tc/J = 2.39781 ± 0.00005 and that of the dual Penrose lattice as Tc*/J = 2.14987 ± 0.00005. Moreover, we definitely confirm the duality relation between the critical temperatures on the dual pair of quasilattices with a high degree of accuracy, sinh (2J/Tc)sinh (2J/Tc*) = 1.00000 ± 0.00004.

  12. Fabrication of superconducting nanowires from ultrathin MgB2 films via focused ion beam milling

    NASA Astrophysics Data System (ADS)

    Zhang, Chen; Wang, Da; Liu, Zheng-Hao; Zhang, Yan; Ma, Ping; Feng, Qing-Rong; Wang, Yue; Gan, Zi-Zhao

    2015-02-01

    High quality superconducting nanowires were fabricated from ultrathin MgB2 films by a focused ion beam milling technique. The precursor MgB2 films in 10 nm thick were grown on MgO substrates by using a hybrid physical-chemical vapor deposition method. The nanowires, in widths of about 300-600 nm and lengths of 1 or 10 μm, showed high superconducting critical temperatures (Tc's) above 34 K and narrow superconducting transition widths (ΔTc's) of 1-3 K. The superconducting critical current density Jc of the nanowires was above 5 × 107 A/cm2 at 20 K. The high Tc, narrow ΔTc, and high Jc of the nanowires offered the possibility of making MgB2-based nano-devices such as hot-electron bolometers and superconducting nanowire single-photon detectors with high operating temperatures at 15-20 K.

  13. 99mTc-labeling of HYNIC-conjugated cyclic RGDfK dimer and tetramer using EDDA as coligand.

    PubMed

    Wang, Jianjun; Kim, Young-Seung; Liu, Shuang

    2008-03-01

    In this study, EDDA (ethylenediamine- N, N'-diacetic acid) was used as the coligand for 99mTc-labeling of cyclic RGDfK conjugates: HYNIC-dimer (HYNIC = 6-hydrazinonicotinamide; dimer = E[c(RGDfK)]2) and HYNIC-tetramer (tetramer = E{E[c(RGDfK)]2}2). First, HYNIC-dimer was allowed to react with 99mTcO4 (-) in the presence of excess tricine and stannous chloride to form the intermediate complex [99mTc(HYNIC-dimer)(tricine)2], which was then allowed to react with EDDA to afford [99mTc(HYNIC-dimer)(EDDA)] with high yield (>90%) and high specific activity ( approximately 8.0 Ci/micromol). Under the same radiolabeling conditions, the yield for [99mTc(HYNIC-tetramer)(EDDA)] was always <65%. The results from a mixed-ligand experiment show that there is only one EDDA bonding to the 99mTc-HYNIC core in [99mTc(HYNIC-dimer)(EDDA)]. The athymic nude mice bearing subcutaneous U87MG human glioma xenografts were used to evaluate the impact of EDDA coligand on the biodistribution characteristics and excretion kinetics of the 99mTc-labeled HYNIC-dimer and HYNIC-tetramer. Surprisingly, [99mTc(HYNIC-dimer)(EDDA)] and [99mTc(HYNIC-tetramer)(EDDA)] had almost identical tumor uptake over the 2 h period. The use of EDDA as coligand to replace tricine/TPPTS (TPPTS = trisodium triphenylphosphine-3,3',3''-trisulfonate) did not significantly change the uptake of the 99mTc-labeled HYNIC-dimer in noncancerous organs, such as the liver, kidneys, and lungs; but it did result in a significantly lower kidney uptake for the 99mTc-labeled HYNIC-tetramer due to faster renal excretion. It was also found that the radiotracer tumor uptake decreases in a linear fashion as the tumor size increases. The smaller the tumors are, the higher the tumor uptake is regardless of the identity of radiotracer.

  14. Design and evaluation of new Tc-99m-labeled lactam bridge-cyclized alpha-MSH peptides for melanoma imaging.

    PubMed

    Guo, Haixun; Gallazzi, Fabio; Miao, Yubin

    2013-04-01

    The purpose of this study was to examine the melanoma targeting and imaging properties of new (99m)Tc-labeled lactam bridge-cyclized alpha-melanocyte stimulating hormone (α-MSH) peptides using bifunctional chelating agents. MAG3-GGNle-CycMSH(hex), AcCG3-GGNle-CycMSH(hex), and HYNIC-GGNle-CycMSH(hex) peptides were synthesized, and their melanocortin-1 (MC1) receptor binding affinities were determined in B16/F1 melanoma cells. The biodistribution of (99m)Tc-MAG3-GGNle-CycMSH(hex), (99m)Tc-AcCG3-GGNle-CycMSH(hex), (99m)Tc(CO)3-HYNIC-GGNle-CycMSH(hex), and (99m)Tc(EDDA)-HYNIC-GGNle-CycMSH(hex) were determined in B16/F1 melanoma-bearing C57 mice at 2 h postinjection to select a lead peptide for further evaluation. The melanoma targeting and imaging properties of (99m)Tc(EDDA)-HYNIC-GGNle-CycMSH(hex) were further examined because of its high melanoma uptake and fast urinary clearance. The IC50 values of MAG3-GGNle-CycMSH(hex), AcCG3-GGNle-CycMSH(hex), and HYNIC-GGNle-CycMSH(hex) were 1.0 ± 0.05, 1.2 ± 0.19, and 0.6 ± 0.04 nM in B16/F1 melanoma cells, respectively. Among these four (99m)Tc-peptides, (99m)Tc(EDDA)-HYNIC-GGNle-CycMSH(hex) exhibited the highest melanoma uptake (14.14 ± 4.90% ID/g) and fastest urinary clearance (91.26 ± 1.96% ID) at 2 h postinjection. (99m)Tc(EDDA)-HYNIC-GGNle-CycMSH(hex) showed high tumor to normal organ uptake ratios except for the kidneys. The tumor/kidney uptake ratios of (99m)Tc(EDDA)-HYNIC-GGNle-CycMSH(hex) were 2.50 and 3.55 at 4 and 24 h postinjection. The melanoma lesions were clearly visualized by SPECT/CT using (99m)Tc(EDDA)-HYNIC-GGNle-CycMSH(hex) as an imaging probe at 2 h postinjection. Overall, high melanoma uptake coupled with fast urinary clearance of (99m)Tc(EDDA)-HYNIC-GGNle-CycMSH(hex) highlighted its potential for metastatic melanoma detection in the future.

  15. Disappearance of nodal gap across the insulator-superconductor transition in a copper-oxide superconductor.

    PubMed

    Peng, Yingying; Meng, Jianqiao; Mou, Daixiang; He, Junfeng; Zhao, Lin; Wu, Yue; Liu, Guodong; Dong, Xiaoli; He, Shaolong; Zhang, Jun; Wang, Xiaoyang; Peng, Qinjun; Wang, Zhimin; Zhang, Shenjin; Yang, Feng; Chen, Chuangtian; Xu, Zuyan; Lee, T K; Zhou, X J

    2013-01-01

    The parent compound of the copper-oxide high-temperature superconductors is a Mott insulator. Superconductivity is realized by doping an appropriate amount of charge carriers. How a Mott insulator transforms into a superconductor is crucial in understanding the unusual physical properties of high-temperature superconductors and the superconductivity mechanism. Here we report high-resolution angle-resolved photoemission measurement on heavily underdoped Bi₂Sr₂-xLaxCuO(₆+δ) system. The electronic structure of the lightly doped samples exhibit a number of characteristics: existence of an energy gap along the nodal direction, d-wave-like anisotropic energy gap along the underlying Fermi surface, and coexistence of a coherence peak and a broad hump in the photoemission spectra. Our results reveal a clear insulator-superconductor transition at a critical doping level of ~0.10 where the nodal energy gap approaches zero, the three-dimensional antiferromagnetic order disappears, and superconductivity starts to emerge. These observations clearly signal a close connection between the nodal gap, antiferromagnetism and superconductivity.

  16. Incorporating technetium in minerals and other solids: A review

    NASA Astrophysics Data System (ADS)

    Luksic, Steven A.; Riley, Brian J.; Schweiger, Michael; Hrma, Pavel

    2015-11-01

    Technetium (Tc) can be incorporated into a number of different solids including spinel, sodalite, rutile, tin dioxide, pyrochlore, perovskite, goethite, layered double hydroxides, cements, and alloys. Synthetic routes are possible for each of these phases, ranging from high-temperature ceramic sintering to ball-milling of constituent oxides. However, in practice, Tc has only been incorporated into solid materials by a limited number of the possible syntheses. A review of the diverse ways in which Tc-immobilizing materials can be made shows the wide range of options available. Special consideration is given to hypothetical application to the Hanford Tank Waste and Vitrification Plant, such as adding a Tc-bearing mineral to waste glass melter feed. A full survey of solid Tc waste forms, the common synthesis routes to those waste forms, and their potential for application to vitrification processes are presented. The use of tin dioxide or ferrite spinel precursors to reduce Tc(VII) out of solution and into a durable form are shown to be of especially high potential.

  17. Role of Yersinia pestis Toxin Complex Family Proteins in Resistance to Phagocytosis by Polymorphonuclear Leukocytes

    PubMed Central

    Carmody, Aaron B.; Jarrett, Clayton O.; Hinnebusch, B. Joseph

    2013-01-01

    Yersinia pestis carries homologues of the toxin complex (Tc) family proteins, which were first identified in other Gram-negative bacteria as having potent insecticidal activity. The Y. pestis Tc proteins are neither toxic to fleas nor essential for survival of the bacterium in the flea, even though tc gene expression is highly upregulated and much more of the Tc proteins YitA and YipA are produced in the flea than when Y. pestis is grown in vitro. We show that Tc+ and Tc− Y. pestis strains are transmitted equivalently from coinfected fleas, further demonstrating that the Tc proteins have no discernible role, either positive or negative, in transmission by the flea vector. Tc proteins did, however, confer Y. pestis with increased resistance to killing by polymorphonuclear leukocytes (PMNs). Resistance to killing was not the result of decreased PMN viability or increased intracellular survival but instead correlated with a Tc protein-dependent resistance to phagocytosis that was independent of the type III secretion system (T3SS). Correspondingly, we did not detect T3SS-dependent secretion of the native Tc proteins YitA and YipA or the translocation of YitA– or YipA–β-lactamase fusion proteins into CHO-K1 (CHO) cells or human PMNs. Thus, although highly produced by Y. pestis within the flea and related to insecticidal toxins, the Tc proteins do not affect interaction with the flea or transmission. Rather, the Y. pestis Tc proteins inhibit phagocytosis by mouse PMNs, independent of the T3SS, and may be important for subverting the mammalian innate immune response immediately following transmission from the flea. PMID:23959716

  18. Total coliform and E. coli in public water systems using undisinfected ground water in the United States.

    PubMed

    Messner, Michael J; Berger, Philip; Javier, Julie

    2017-06-01

    Public water systems (PWSs) in the United States generate total coliform (TC) and Escherichia coli (EC) monitoring data, as required by the Total Coliform Rule (TCR). We analyzed data generated in 2011 by approximately 38,000 small (serving fewer than 4101 individuals) undisinfected public water systems (PWSs). We used statistical modeling to characterize a distribution of TC detection probabilities for each of nine groupings of PWSs based on system type (community, non-transient non-community, and transient non-community) and population served (less than 101, 101-1000 and 1001-4100 people). We found that among PWS types sampled in 2011, on average, undisinfected transient PWSs test positive for TC 4.3% of the time as compared with 3% for undisinfected non-transient PWSs and 2.5% for undisinfected community PWSs. Within each type of PWS, the smaller systems have higher median TC detection than the larger systems. All TC-positive samples were assayed for EC. Among TC-positive samples from small undisinfected PWSs, EC is detected in about 5% of samples, regardless of PWS type or size. We evaluated the upper tail of the TC detection probability distributions and found that significant percentages of some system types have high TC detection probabilities. For example, assuming the systems providing data are nationally-representative, then 5.0% of the ∼50,000 small undisinfected transient PWSs in the U.S. have TC detection probabilities of 20% or more. Communities with such high TC detection probabilities may have elevated risk of acute gastrointestinal (AGI) illness - perhaps as great or greater than the attributable risk to drinking water (6-22%) calculated for 14 Wisconsin community PWSs with much lower TC detection probabilities (about 2.3%, Borchardt et al., 2012). Published by Elsevier GmbH.

  19. Development of Tc(IV)-Incorporated Fe Minerals to Enhance 99Tc Retention in Glass Waste Form

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui

    Iron minerals have been considered to be good hosts for Tc immobilization because the Tc(IV) ion substitutes for Fe(III) in the crystal structure of the Fe oxide due to similarities in (1) cation size [Tc(IV) = 78.5 pm ; Fe(III) = 69 or 78.5 pm], (2) metal-oxygen interatomic distance (Tc—O = 0.199 nm, Fe—O = 0.203 nm), (3) number of coordinating oxygen atoms (both 6-fold coordinated), and (4) the redox potential (Eh=ca. +20 mV at pH = 7) for a redox couple between Tc(VII)/Tc(IV) and Fe(III)/Fe(II). Magnetite, maghemite, and trevorite are iron oxide minerals and all belong to spinel mineralmore » group. Laboratory testing shows that Tc can be removed from aqueous waste solutions by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation with iron oxide minerals during recrystallization of Fe(OH)2(s) used as an initial solid precursor. X-ray absorption near edge structure (XANES) spectroscopy confirmed that Tc was in the +4 oxidation state in final Tc-Fe minerals. The Tc-incorporated Fe minerals were also tested for Tc retention in glass melts at different temperatures between 600 – 1,000 oC in a furnace. After being cooled in air, the solid glass specimens collected at different temperatures were analyzed for Tc oxidation state using XANES and Tc retention using liquid scintillation counting (LSC). Even though Tc(IV) started to reoxidize at 600 oC, Tc retention in the final glass specimen prepared with Tc-incorporated Fe mineral even at high temperatures was at least two times higher than glass prepared with KTcO4 salt. Higher Tc retention in glass is considered to result from limited and delayed Tc volatilization process due to Fe mineral encapsulation for Tc. Therefore, the results showing the presence of Tc(IV) in the Fe mineral structure indicate strong possibility to enhance Tc retention in borosilicate glass as well as to reduce the remediation costs at the Hanford Site.« less

  20. Triclosan-immobilized polyamide thin film composite membranes with enhanced biofouling resistance

    NASA Astrophysics Data System (ADS)

    Park, Sang-Hee; Hwang, Seon Oh; Kim, Taek-Seung; Cho, Arah; Kwon, Soon Jin; Kim, Kyoung Taek; Park, Hee-Deung; Lee, Jung-Hyun

    2018-06-01

    We report on a strategy to improve biofouling resistance of a polyamide (PA) thin-film composite (TFC) reverse osmosis (RO) membrane via chemically immobilizing triclosan (TC), known as a common organic biocide, on its surface. To facilitate covalent attachment of TC on the membrane surface, TC was functionalized with amine moiety to prepare aminopropyl TC. Then, the TC-immobilized TFC (TFC-TC) membranes were fabricated through a one-step amide formation reaction between amine groups of aminopropyl TC and acyl chloride groups present on the PA membrane surface, which was confirmed by high-resolution XPS. Strong stability of the immobilized TC was also confirmed by a hydraulic washing test. Although the TFC-TC membrane showed slightly reduced separation performance compared to the pristine control, it still maintained a satisfactory RO performance level. Importantly, the TFC-TC membrane exhibited excellent antibacterial activity against both gram negative (E. coli and P. aeruginosa) and gram positive (S. aureus) bacteria along with greatly enhanced resistance to biofilm formation. Our immobilization approach offers a robust and relatively benign strategy to control biofouling of functional surfaces, films and membranes.

  1. Impeding 99Tc(IV) mobility in novel waste forms

    DOE PAGES

    Lee, Mal-Soon; Um, Wooyong; Wang, Guohui; ...

    2016-06-30

    Technetium ( 99Tc) is a long-lived radioactive fission product whose mobility in the subsurface is largely governed by its oxidation state1. Immobilization of Tc in mineral substrates is crucial for radioactive waste management and environmental remediation. Tc(IV) incorporation in spinels2, 3 has been proposed as a novel method to increase Tc retention in glass waste forms. However, experiments with Tc-magnetite under high temperature and oxic conditions showed re-oxidation of Tc(IV) to volatile pertechnetate Tc(VII)O4-.4, 5 Here we address this problem with large-scale ab initio molecular dynamics simulations and propose that elevated temperatures, 1st row transition metal dopants can significantly enhancemore » Tc retention in the order Co > Zn > Ni. Experiments with doped spinels at T=700 ºC provided quantitative confirmation of increased Tc retention in the same order predicted by theory. This work highlights the power of modern state-of-the-art simulations to provide essential insights and generate bottom-up design criteria of complex oxide materials at elevated temperatures.« less

  2. Systematic XAS study on the reduction and uptake of Tc by magnetite and mackinawite.

    PubMed

    Yalçıntaş, Ezgi; Scheinost, Andreas C; Gaona, Xavier; Altmaier, Marcus

    2016-11-28

    The mechanisms for the reduction and uptake of Tc by magnetite (Fe 3 O 4 ) and mackinawite (FeS) are investigated using X-ray absorption spectroscopy (XANES and EXAFS), in combination with thermodynamic calculations of the Tc/Fe systems and accurate characterization of the solution properties (pH m , pe, [Tc]). Batch sorption experiments were performed under strictly anoxic conditions using freshly prepared magnetite and mackinawite in 0.1 M NaCl solutions with varying initial Tc(vii) concentrations (2 × 10 -5 and 2 × 10 -4 M) and Tc loadings (400-900 ppm). XANES confirms the complete reduction of Tc(vii) to Tc(iv) in all investigated systems, as predicted from experimental (pH m + pe) measurements and thermodynamic calculations. Two Tc endmember species are identified by EXAFS in the magnetite system, Tc substituting for Fe in the magnetite structure and Tc-Tc dimers sorbed to the magnetite {111} faces through a triple bond. The sorption endmember is favoured at higher [Tc], whereas incorporation prevails at low [Tc] and less alkaline pH conditions. The key role of pH in the uptake mechanism is interpreted in terms of magnetite solubility, with higher [Fe] and greater recrystallization rates occurring at lower pH values. A TcS x -like phase is predominant in all investigated mackinawite systems, although the contribution of up to 20% of TcO 2 ·xH 2 O(s) (likely as surface precipitate) is observed for the highest investigated loadings (900 ppm). These results provide key inputs for an accurate mechanistic interpretation of the Tc uptake by magnetite and mackinawite, so far controversially discussed in the literature, and represent a highly relevant contribution to the investigation of Tc retention processes in the context of nuclear waste disposal.

  3. In Vitro-Generated Tc17 Cells Present a Memory Phenotype and Serve As a Reservoir of Tc1 Cells In Vivo

    PubMed Central

    Flores-Santibáñez, Felipe; Cuadra, Bárbara; Fernández, Dominique; Rosemblatt, Mariana V.; Núñez, Sarah; Cruz, Pablo; Gálvez-Cancino, Felipe; Cárdenas, J. César; Lladser, Alvaro; Rosemblatt, Mario; Bono, María Rosa; Sauma, Daniela

    2018-01-01

    Memory CD8+ T cells are ideal candidates for cancer immunotherapy because they can mediate long-term protection against tumors. However, the therapeutic potential of different in vitro-generated CD8+ T cell effector subsets to persist and become memory cells has not been fully characterized. Type 1 CD8+ T (Tc1) cells produce interferon-γ and are endowed with high cytotoxic capacity, whereas IL-17-producing CD8+ T (Tc17) cells are less cytotoxic but display enhanced self-renewal capacity. We sought to evaluate the functional properties of in vitro-generated Tc17 cells and elucidate their potential to become long lasting memory cells. Our results show that in vitro-generated Tc17 cells display a greater in vivo persistence and expansion in response to secondary antigen stimulation compared to Tc1 cells. When transferred into recipient mice, Tc17 cells persist in secondary lymphoid organs, present a recirculation behavior consistent with central memory T cells, and can shift to a Tc1 phenotype. Accordingly, Tc17 cells are endowed with a higher mitochondrial spare respiratory capacity than Tc1 cells and express higher levels of memory-related molecules than Tc1 cells. Together, these results demonstrate that in vitro-generated Tc17 cells acquire a central memory program and provide a lasting reservoir of Tc1 cells in vivo, thus supporting the use of Tc17 lymphocytes in the design of novel and more effective therapies. PMID:29472932

  4. High Tc superconducting films from metallo-organic precursors

    NASA Astrophysics Data System (ADS)

    Davison, W. W.; Shyu, S. G.; Buchanan, R. C.

    High Tc superconducting films of heavy metal soaps (derived from carboxylic acid precursors) have been prepared on Si and other substrates. The precursors were synthesized and mixed in appropriate molar ratios to form the high Tc compound YBa2Cu3O(7-x), using a high boiling point common solvent base. The precursor solution was deposited by a spin casting technique on the substrates. Film thicknesses of 0.1-1.0 micron were achieved after heat treatment at 550-850 C at not longer than 4 hours. Films were analyzed as to orientation, appropriate phase, interfacial reaction, and superconducting properties.

  5. Recovery and Determination of Adsorbed Technetium on Savannah River Site Charcoal Stack Samples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lahoda, Kristy G.; Engelmann, Mark D.; Farmer, Orville T.

    2008-03-01

    Experimental results are provided for the sample analyses for technetium (Tc) in charcoal samples placed in-line with a Savannah River Site (SRS) processing stack effluent stream as a part of an environmental surveillance program. The method for Tc removal from charcoal was based on that originally developed with high purity charcoal. Presented is the process that allowed for the quantitative analysis of 99Tc in SRS charcoal stack samples with and without 97Tc as a tracer. The results obtained with the method using the 97Tc tracer quantitatively confirm the results obtained with no tracer added. All samples contain 99Tc at themore » pg g-1 level.« less

  6. Study on Thermal Deformation Behavior of TC4 – ELI Titanium Alloy

    NASA Astrophysics Data System (ADS)

    Song, Y.; Zhang, F. S.; Huang, T.; Song, K. X.

    2018-05-01

    The TC4-ELI titanium alloy was subjected to hot compression deformation test by the Gleeble-1500D thermal simulation test machine. The thermal deformation behavior of the TC4-ELI titanium alloy was studied under the condition of 850°C-1050°C, 0.001s-1-10s-1 strain rate and 50% deformation. The constitutive equation of TC4-ELI titanium alloy was established based on the hyperbolic sine model of Arrhenius equation. The results show that the flow stress of TC4-ELI titanium alloy decreases with the increase of temperature at high temperature. The calculated heat activation energy of TC4-ELI titanium alloy is 300367.5807J / mol.

  7. Bimetallic Porous Iron (pFe) Materials for Remediation/Removal of Tc from Aqueous Systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, D.

    Remediation of Tc remains an unresolved challenge at SRS and other DOE sites. The objective of this project was to develop novel bimetallic porous iron (pFe) materials for Tc removal from aqueous systems. We showed that the pFe is much more effective in removing TcO 4 - (×30) and ReO 4 - (×8) from artificial groundwater than granular iron. Tc K-edge XANES spectroscopy indicated that Tc speciation on the pFe was 18% adsorbed TcO 4 -, 28% Tc(IV) in Tc dioxide and 54% Tc(IV) into the structure of Fe hydroxide. A variety of catalytic metal nanoparticles (i.e., Ni, Cu, Zn,more » Ag, Sn and Pd) were successfully deposited on the pFe using scalable chemical reduction methods. The Zn-pFe was outstanding among the six bimetallic pFe materials, with a capacity increase of >100% for TcO 4 - removal and of 50% for ReO 4 - removal, compared to the pFe. These results provide a highly applicable platform for solving critical DOE and industrial needs related to nuclear environmental stewardship and nuclear power production.« less

  8. Thermochemical Wastewater Valorization via Enhanced Microbial Toxicity Tolerance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beckham, Gregg T; Thelhawadigedara, Lahiru Niroshan Jayakody; Johnson, Christopher W

    Thermochemical (TC) biomass conversion processes such as pyrolysis and liquefaction generate considerable amounts of wastewater, which often contains highly toxic compounds that are incredibly challenging to convert via standard wastewater treatment approaches such as anaerobic digestion. These streams represent a cost for TC biorefineries, and a potential valorization opportunity, if effective conversion methods are developed. The primary challenge hindering microbial conversion of TC wastewater is toxicity. In this study, we employ a robust bacterium, Pseudomonas putida, with TC wastewater streams to demonstrate that aldehydes are the most inhibitory compounds in these streams. Proteomics, transcriptomics, and fluorescence-based immunoassays of P. putidamore » grown in a representative wastewater stream indicate that stress results from protein damage, which we hypothesize is a primary toxicity mechanism. Constitutive overexpression of the chaperone genes, groEL, groES, and clpB, in a genome-reduced P. putida strain improves the tolerance towards multiple TC wastewater samples up to 200-fold. Moreover, the concentration ranges of TC wastewater are industrially relevant for further bioprocess development for all wastewater streams examined here, representing different TC process configurations. Furthermore, we demonstrate proof-of-concept polyhydroxyalkanoate production from the usable carbon in an exemplary TC wastewater stream. Overall, this study demonstrates that protein quality control machinery and repair mechanisms can enable substantial gains in microbial tolerance to highly toxic substrates, including heterogeneous waste streams. When coupled to other metabolic engineering advances such as expanded substrate utilization and enhanced product accumulation, this study generally enables new strategies for biological conversion of highly-toxic, organic-rich wastewater via engineered aerobic monocultures or designer consortia.« less

  9. Fabrication Of High-Tc Superconducting Integrated Circuits

    NASA Technical Reports Server (NTRS)

    Bhasin, Kul B.; Warner, Joseph D.

    1992-01-01

    Microwave ring resonator fabricated to demonstrate process for fabrication of passive integrated circuits containing high-transition-temperature superconductors. Superconductors increase efficiencies of communication systems, particularly microwave communication systems, by reducing ohmic losses and dispersion of signals. Used to reduce sizes and masses and increase aiming accuracies and tracking speeds of millimeter-wavelength, electronically steerable antennas. High-Tc superconductors preferable for such applications because they operate at higher temperatures than low-Tc superconductors do, therefore, refrigeration systems needed to maintain superconductivity designed smaller and lighter and to consume less power.

  10. High Tc superconducting bolometric and nonbolometric infrared (IR) detectors

    NASA Technical Reports Server (NTRS)

    Lakeou, Samuel

    1994-01-01

    The original workplan for the first year of the project includes the following: establishment of a pilot superconductivity application laboratory at UDC to support the research component of the project; research on the source of electrical noise in High Tc superconducting films in order to optimize the film microstructure and lower the NEP; and lay the foundation of an academic support for exposing UDC students to the theory and application of High Tc superconductivity. Attached to this status report are abstracts and the course description for Introduction to Applications of Superconductivity.

  11. Evaluation of (99m)Tc-HYNIC-TMTP1 as a tumor-homing imaging agent targeting metastasis with SPECT.

    PubMed

    Li, Fei; Cheng, Teng; Dong, Qingjian; Wei, Rui; Zhang, Zhenzhong; Luo, Danfeng; Ma, Xiangyi; Wang, Shixuan; Gao, Qinglei; Ma, Ding; Zhu, Xiaohua; Xi, Ling

    2015-03-01

    TMTP1 (NVVRQ) is a novel tumor-homing peptide, which specifically targets tumor metastases, even at the early stage of occult metastasis foci. Fusing TMTP1 to therapeutic peptides or proteins can increase its anti-cancer efficacy both in vivo and in vitro. Here, we labeled TMTP1 with (99m)Tc to evaluate its targeting properties in an ovarian cancer xenograft tumor mouse model and a gastric cancer xenograft mouse model. The invasion ability of SKOV3 and highly metastatic SKOV3.ip cell lines were performed by the Transwell Invasion Assays, and then Rhodamine-TMTP1 was used to detect its affinity to these two cells. Using the co-ligand ethylenediamine-N, N'-diacetic acid (EDDA) and the bifunctional chelator 6-hydrazinonicotinic acid (HYNIC), the TMTP1 peptide was labeled with (99m)Tc. A cell-binding assay was performed by incubating cancer cells with (99m)Tc-HYNIC-TMTP1 with or without an excess dose of cold HYNIC-TMTP1. To evaluate the probe in vivo, nude mice bearing SKOV3, SKOV3.ip and MNK-45 tumor cells were established and subjected to SPECT imaging after injection with (99m)Tc-HYNIC-TMTP1. Ex vivo γ-counting of dissected tissues from the mice was used to evaluate its biodistribution. (99m)Tc-HYNIC-TMTP1 was successfully synthesized. The radiotracer also exhibited high hydrophilicity and excellent stability in vitro and in vivo. It has strong affinity to highly metastatic cancer cell lines but not to poorly metastatic cell lines. After mice were injected with (99m)Tc-HYNIC-TMTP1, non-invasive SPECT imaging detected SKOV3.ip and MNK-45 xenograft tumors but not SKOV3 xenograft tumors. This result can be inhibited by excess HYNIC-TMTP1. The uptake of (99m)Tc-HYNIC-TMTP1 in SKOV3.ip xenograft tumors was 0.182±0.017% ID/g at 2h p.i. with high renal uptake (74.32±15.05% ID/g at 2h p.i.). (99m)Tc-HYNIC-TMTP1 biodistribution and SPECT imaging demonstrated its ability to target highly metastatic tumors. Therefore, metastasis can be non-invasively investigated by SPECT imaging using (99m)Tc-HYNIC-TMTP1. Meanwhile, this radiotracer has some shortages in the low % ID/g of tumors and high accumulation in the kidney. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Anomalous thermal diffusivity in underdoped YBa2Cu3O6+x

    NASA Astrophysics Data System (ADS)

    Zhang, Jiecheng; Levenson-Falk, Eli M.; Ramshaw, B. J.; Bonn, D. A.; Liang, Ruixing; Hardy, W. N.; Hartnoll, Sean A.; Kapitulnik, Aharon

    2017-05-01

    The thermal diffusivity in the abab plane of underdoped YBCO crystals is measured by means of a local optical technique in the temperature range of 25-300 K. The phase delay between a point heat source and a set of detection points around it allows for high-resolution measurement of the thermal diffusivity and its in-plane anisotropy. Although the magnitude of the diffusivity may suggest that it originates from phonons, its anisotropy is comparable with reported values of the electrical resistivity anisotropy. Furthermore, the anisotropy drops sharply below the charge order transition, again similar to the electrical resistivity anisotropy. Both of these observations suggest that the thermal diffusivity has pronounced electronic as well as phononic character. At the same time, the small electrical and thermal conductivities at high temperatures imply that neither well-defined electron nor phonon quasiparticles are present in this material. We interpret our results through a strongly interacting incoherent electron-phonon “soup” picture characterized by a diffusion constant D˜vB2τD˜vB2τ, where vBvB is the soup velocity, and scattering of both electrons and phonons saturates a quantum thermal relaxation time τ˜/kBTτ˜ℏ/kBT.

  13. Modulation of low-latitude west wind on abnormal track and intensity of tropical cyclone Nargis (2008) in the Bay of Bengal

    NASA Astrophysics Data System (ADS)

    Li, Wei-Wei; Wang, Chunzai; Wang, Dongxiao; Yang, Lei; Deng, Yi

    2012-03-01

    Tropical cyclone (TC) Nargis (2008) made landfall in Myanmar on 02 May 2008, bringing a storm surge, major flooding, and resulting in a significant death toll. TC Nargis (2008) displayed abnormal features, including rare eastward motion in its late stage, rapid intensification before landing. Using reanalysis data and a numerical model, we investigated how a low-latitude westerly wind modulated TC Nargis' (2008) track and provided favorable atmospheric conditions for its rapid intensification. More importantly, we found a possible counterbalance effect of flows from the two hemispheres on the TC track in the Bay of Bengal. Our analysis indicates that a strong westerly wind burst across the Bay of Bengal, resulting in TC Nargis' (2008) eastward movement after its recurvature. This sudden enhancement of westerly wind was mainly due to the rapidly intensified mid-level cross-equatorial flow. Our results show that a high-pressure system in the Southern Hemisphere induced this strong, mid-level, cross-equatorial flow. During the rapid intensification period of TC Nargis (2008), this strong and broad westerly wind also transported a large amount of water vapor to TC Nargis (2008). Sufficient water vapor gave rise to continuously high and increased mid-level relative humidity, which was favorable to TC Nargis' (2008) intensification. Condensation of water vapor increased the energy supply, which eventuated the intensification of TC Nargis (2008) to a category 4 on the Saffir-Simpson scale.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weaver, Jamie; Soderquist, Chuck; Gassman, Paul

    The local chemistry of technetium-99 ( 99Tc) in oxide glasses is important for understanding the incorporation and long-term release of Tc from nuclear waste glasses, both those for legacy defense wastes and fuel reprocessing wastes. Tc preferably forms Tc(VII), Tc(IV), or Tc(0) in glass, depending on the level of reduction of the melt. Tc(VII) in oxide glasses is normally assumed to be isolated pertechnetate TcO 4 -anions surrounded by alkali, but can occasionally precipitate as alkali pertechnetate salts such as KTcO 4and NaTcO 4when Tc concentration is high. In these cases, Tc(VII) is 4-coordinated by oxygen. A reinvestigation of themore » chemistry of alkali-technetium-oxides formed under oxidizing conditions and at temperatures used to prepare nuclear waste glasses showed that higher coordinated alkali Tc(VII) oxide species had been reported, including those with the TcO 5 -and TcO 6 -anions. The chemistry of alkali Tc(VII) and other alkali-Tc-oxides is reviewed, along with relevant synthesis conditions. Additionally, we report attempts to make 5- and 6-coordinate pertechnetate compounds of K, Na, and Li, i.e. TcO 5 -and TcO 6 -. It was found that higher coordinated species are very sensitive to water, and easily decompose into their respective pertechnetates. It was difficult to obtain pure compounds, but mixtures of the pertechnetate and other phase(s) were frequently found, as evidenced by x-ray absorption spectroscopy (XAS), neutron diffraction (ND), and Raman spectroscopy. Low temperature electron paramagnetic resonance (EPR) measurements showed the possibility of Tc(IV) and Tc(VI) in Na 3TcO 5and Na 5TcO 6compounds. It was hypothesized that the smaller counter cation would result in more stable pertechnetates. To confirm the synthesis method, LiReO 4and Li 5ReO 6were prepared, and their Raman spectra match those in the literature. Subsequently, the Tc versions LiTcO 4and Li 5TcO 6were synthesized and characterized by ND, Raman spectroscopy, XANES, and EXAFS. The Li 5TcO 6was a marginally stable compound that appears to have the same structure as that known for Li 5ReO 6. Implications of the experimental work on stability of alkali technetate compounds and possible role in the volatilization of Tc are discussed.« less

  15. Potential high-Tc superconducting lanthanum and yttrium hydrides at high pressure

    PubMed Central

    Liu, Hanyu; Naumov, Ivan I.; Hoffmann, Roald; Ashcroft, N. W.; Hemley, Russell J.

    2017-01-01

    A systematic structure search in the La–H and Y–H systems under pressure reveals some hydrogen-rich structures with intriguing electronic properties. For example, LaH10 is found to adopt a sodalite-like face-centered cubic (fcc) structure, stable above 200 GPa, and LaH8 a C2/m space group structure. Phonon calculations indicate both are dynamically stable; electron phonon calculations coupled to Bardeen–Cooper–Schrieffer (BCS) arguments indicate they might be high-Tc superconductors. In particular, the superconducting transition temperature Tc calculated for LaH10 is 274–286 K at 210 GPa. Similar calculations for the Y–H system predict stability of the sodalite-like fcc YH10 and a Tc above room temperature, reaching 305–326 K at 250 GPa. The study suggests that dense hydrides consisting of these and related hydrogen polyhedral networks may represent new classes of potential very high-temperature superconductors. PMID:28630301

  16. Telecom 2-B and 2-C (TC2B and TC2C)

    NASA Technical Reports Server (NTRS)

    Dulac, J.; Alvarez, H.

    1991-01-01

    The DSN (Deep Space Network) mission support requirements for Telecom 2-B and 2-C (TC2B and TC2C) are summarized. These Telecom missions will provide high-speed data link applications, telephone, and television service between France and overseas territories as a follow-on to TC2A. Mission objectives are outlined and the DSN support requirements are defined through the presentation of tables and narratives describing the spacecraft flight profile; DSN support coverage; frequency assignments; support parameters for telemetry, command and support systems; and tracking support responsibility.

  17. The multiple and complex and changeable scenarios of the Trypanosoma cruzi transmission cycle in the sylvatic environment.

    PubMed

    Jansen, Ana Maria; Xavier, Samanta C C; Roque, André Luiz R

    2015-11-01

    In this study, we report and discuss the results generated from over 20 years of studies of the Trypanosoma cruzi sylvatic transmission cycle. Our results have uncovered new aspects and reviewed old concepts on issues including reservoirs, true generalist species, association of mammalian species with distinct discrete typing units - DTUs, distribution of T. cruzi genotypes in the wild, mixed infections, and T. cruzi transmission ecology. Using parasitological and serological tests, we examined T. cruzi infection in 7,285 mammalian specimens from nine mammalian orders dispersed all over the Brazilian biomes. The obtained T. cruzi isolates were characterized by mini-exon gene sequence polymorphism and PCR RFLP to identify DTUs. Infection by T. cruzi was detected by serological methods in 20% of the examined animals and isolated from 41% of those infected, corresponding to 8% of all the examined mammals. Each mammal taxon responded uniquely to T. cruzi infection. Didelphis spp. are able to maintain high and long-lasting parasitemias (positive hemocultures) caused by TcI but maintain and rapidly control parasitemias caused by TcII to almost undetectable levels. In contrast, the tamarin species Leontopithecus rosalia and L. chrysomelas maintain long-lasting and high parasitemias caused by TcII similarly to Philander sp. The coati Nasua nasua maintains high parasitemias by both parental T. cruzi DTUs TcI or TcII and by TcII/TcIV (formerly Z3) at detectable levels. Wild and domestic canidae seem to display only a short period of reservoir competence. T. cruzi infection was demonstrated in the wild canid species Cerdocyon thous and Chrysocyon brachyurus, and positive hemoculture was obtained in one hyper carnivore species (Leopardus pardalis), demonstrating that T. cruzi transmission is deeply immersed in the trophic net. T. cruzi DTU distribution in nature did not exhibit any association with a particular biome or habitat. TcI predominates throughout (58% of the T. cruzi isolates); however, in spite of being significantly less frequent (17%), TcII is also widely distributed. Concomitant DTU infection occurred in 16% of infected mammals of all biomes and included arboreal and terrestrial species, as well as bats. TcI/TcII concomitant infection was the most common and widely dispersed, with mixed TcI/TcII infections especially common in coatis and in Didelphimorphia. The second most common pattern of concomitant infection was TcI/TcIV, observed in Chiroptera, Didelphimorphia and Primates. Taken together, our results demonstrate the complexity of T. cruzi reservoir system and its transmission strategies, indicating that there is considerably more to be learned regarding ecology of T. cruzi. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Hierarchically porous and heteroatom doped carbon derived from tobacco rods for supercapacitors

    NASA Astrophysics Data System (ADS)

    Zhao, Yong-Qing; Lu, Min; Tao, Peng-Yu; Zhang, Yun-Jie; Gong, Xiao-Ting; Yang, Zhi; Zhang, Guo-Qing; Li, Hu-Lin

    2016-03-01

    A novel tobacco rods-derived carbon (TC) has been prepared by hydrothermal carbonization and potassium hydroxide activation strategy for supercapacitors application. The physicochemical properties of TC are investigated by X-ray diffraction, Raman spectra, Scanning electron microscopy, Nitrogen adsorption-desorption isotherms, X-ray photoelectron spectroscopy, and four-probe tests. Results show TC derived from different tobacco rods possesses similar properties, such as amorphous state, high specific surface area, hierarchical porous structure, numerous heteroatom groups, and good electrical conductivity. The electrochemical characteristics of TC are examined via cyclic voltammetry, galvanostatic charge-discharge, and electrochemical impedance spectroscopy measurements. In a three-electrode system, TC exhibits high capacitance with 286.6 F g-1 at 0.5 A g-1, excellent rate performance with 212.1 F g-1 even at 30 A g-1, and outstanding cyclic stability with 96% capacitance retention after 10,000 cycles at 5 A g-1. Furthermore, TC supercapacitor devices can deliver an energy density of 31.3 Wh kg-1 at 0.5 A g-1 and power density of 11.8 kW kg-1 at 15 A g-1. Therefore, this novel concept of tobacco use, namely tobacco rods from cigarette (the harmful) to high-performance carbon for supercapacitors (the beneficial), is an extremely promising strategy for developing high-performance carbon from renewable sources, and supporting the tobacco control.

  19. Quantitative analysis of relationships between irradiation parameters and the reproducibility of cyclotron-produced (99m)Tc yields.

    PubMed

    Tanguay, J; Hou, X; Buckley, K; Schaffer, P; Bénard, F; Ruth, T J; Celler, A

    2015-05-21

    Cyclotron production of (99m)Tc through the (100)Mo(p,2n) (99m)Tc reaction channel is actively being investigated as an alternative to reactor-based (99)Mo generation by nuclear fission of (235)U. An exciting aspect of this approach is that it can be implemented using currently-existing cyclotron infrastructure to supplement, or potentially replace, conventional (99m)Tc production methods that are based on aging and increasingly unreliable nuclear reactors. Successful implementation will require consistent production of large quantities of high-radionuclidic-purity (99m)Tc. However, variations in proton beam currents and the thickness and isotopic composition of enriched (100)Mo targets, in addition to other irradiation parameters, may degrade reproducibility of both radionuclidic purity and absolute (99m)Tc yields. The purpose of this article is to present a method for quantifying relationships between random variations in production parameters, including (100)Mo target thicknesses and proton beam currents, and reproducibility of absolute (99m)Tc yields (defined as the end of bombardment (EOB) (99m)Tc activity). Using the concepts of linear error propagation and the theory of stochastic point processes, we derive a mathematical expression that quantifies the influence of variations in various irradiation parameters on yield reproducibility, quantified in terms of the coefficient of variation of the EOB (99m)Tc activity. The utility of the developed formalism is demonstrated with an example. We show that achieving less than 20% variability in (99m)Tc yields will require highly-reproducible target thicknesses and proton currents. These results are related to the service rate which is defined as the percentage of (99m)Tc production runs that meet the minimum daily requirement of one (or many) nuclear medicine departments. For example, we show that achieving service rates of 84.0%, 97.5% and 99.9% with 20% variations in target thicknesses requires producing on average 1.2, 1.5 and 1.9 times the minimum daily activity requirement. The irradiation parameters that would be required to achieve these service rates are described. We believe the developed formalism will aid in the development of quality-control criteria required to ensure consistent supply of large quantities of high-radionuclidic-purity cyclotron-produced (99m)Tc.

  20. Quantitative analysis of relationships between irradiation parameters and the reproducibility of cyclotron-produced 99mTc yields

    NASA Astrophysics Data System (ADS)

    Tanguay, J.; Hou, X.; Buckley, K.; Schaffer, P.; Bénard, F.; Ruth, T. J.; Celler, A.

    2015-05-01

    Cyclotron production of 99mTc through the 100Mo(p,2n) 99mTc reaction channel is actively being investigated as an alternative to reactor-based 99Mo generation by nuclear fission of 235U. An exciting aspect of this approach is that it can be implemented using currently-existing cyclotron infrastructure to supplement, or potentially replace, conventional 99mTc production methods that are based on aging and increasingly unreliable nuclear reactors. Successful implementation will require consistent production of large quantities of high-radionuclidic-purity 99mTc. However, variations in proton beam currents and the thickness and isotopic composition of enriched 100Mo targets, in addition to other irradiation parameters, may degrade reproducibility of both radionuclidic purity and absolute 99mTc yields. The purpose of this article is to present a method for quantifying relationships between random variations in production parameters, including 100Mo target thicknesses and proton beam currents, and reproducibility of absolute 99mTc yields (defined as the end of bombardment (EOB) 99mTc activity). Using the concepts of linear error propagation and the theory of stochastic point processes, we derive a mathematical expression that quantifies the influence of variations in various irradiation parameters on yield reproducibility, quantified in terms of the coefficient of variation of the EOB 99mTc activity. The utility of the developed formalism is demonstrated with an example. We show that achieving less than 20% variability in 99mTc yields will require highly-reproducible target thicknesses and proton currents. These results are related to the service rate which is defined as the percentage of 99mTc production runs that meet the minimum daily requirement of one (or many) nuclear medicine departments. For example, we show that achieving service rates of 84.0%, 97.5% and 99.9% with 20% variations in target thicknesses requires producing on average 1.2, 1.5 and 1.9 times the minimum daily activity requirement. The irradiation parameters that would be required to achieve these service rates are described. We believe the developed formalism will aid in the development of quality-control criteria required to ensure consistent supply of large quantities of high-radionuclidic-purity cyclotron-produced 99mTc.

  1. Experimental Evidence of Biological Interactions among Different Isolates of Trypanosoma cruzi from the Chaco Region

    PubMed Central

    Ragone, Paula G.; Pérez Brandán, Cecilia; Monje Rumi, Mercedes; Tomasini, Nicolás; Lauthier, Juan J.; Cimino, Rubén O.; Uncos, Alejandro; Ramos, Federico; Alberti D´Amato, Anahí M.; Basombrío, Miguel A.; Diosque, Patricio

    2015-01-01

    Many infectious diseases arise from co-infections or re-infections with more than one genotype of the same pathogen. These mixed infections could alter host fitness, the severity of symptoms, success in pathogen transmission and the epidemiology of the disease. Trypanosoma cruzi, the etiological agent of Chagas disease, exhibits a high biological variability often correlated with its genetic diversity. Here, we developed an experimental approach in order to evaluate biological interaction between three T. cruzi isolates belonging to different Discrete Typing Units (DTUs TcIII, TcV and TcVI). These isolates were obtained from a restricted geographical area in the Chaco Region. Different mixed infections involving combinations of two isolates (TcIII + TcV, TcIII + TcVI and TcV + TcVI) were studied in a mouse model. The parameters evaluated were number of parasites circulating in peripheral blood, histopathology and genetic characterization of each DTU in different tissues by DNA hybridization probes. We found a predominance of TcVI isolate in blood and tissues respect to TcIII and TcV; and a decrease of the inflammatory response in heart when the damage of mice infected with TcVI and TcIII + TcVI mixture were compared. In addition, simultaneous presence of two isolates in the same tissue was not detected. Our results show that biological interactions between isolates with different biological behaviors lead to changes in their biological properties. The occurrence of interactions among different genotypes of T. cruzi observed in our mouse model suggests that these phenomena could also occur in natural cycles in the Chaco Region. PMID:25789617

  2. Predominance of hybrid discrete typing units of Trypanosoma cruzi in domestic Triatoma infestans from the Bolivian Gran Chaco region.

    PubMed

    Perez, Esdenka; Monje, Marcelo; Chang, Boris; Buitrago, Rosio; Parrado, Rudy; Barnabé, Christian; Noireau, François; Brenière, Simone Frédérique

    2013-01-01

    In the Gran Chaco region the reinfestation by Triatoma infestans remains a major problem for control of Chagas disease. Trypanosoma cruzi the agent of the illness presents a broad genetic intraspecific variability which is poorly documented in the Bolivian Gran Chaco. This work presents the identification of the discrete typing units (DTUs) currently recognized for T. cruzi in T. infestans populations collected before and after residual insecticide spraying in four villages in this region. Before spraying, of 84 samples, the frequencies of the DTUs identified by using the multiplex PCR based on the non transcribed spacer of the mini-exon gene (MMPCR) were 0.21 for TcI, 0.70 for TcII/TcV/TcVI, and 0.17 for TcIII/TcIV and no significant difference was observed after spraying (76 samples). Moreover 13% of the total sample corresponds to T. infestans specimens with mixed infection of DTUs of which three were TcII/TcV/TcVI with TcIII/TcIV. The partial sequences of T. cruzi Gpi gene obtained from 14 PCR products agree the MMPCR DTU identification and allowed to precise the occurrence of TcIII, TcII and hybrid TcV/TcVI stocks which were not discriminated by the MMPCR. Given the high prevalence of hybrid stocks, the authors ask whether the recombination event at the origin of hybrids would have taken place in the Gran Chaco where the putative parents are also present. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Polymorphism influences singlet fission rates in tetracene thin films

    DOE PAGES

    Arias, Dylan H.; Ryerson, Joseph L.; Cook, Jasper D.; ...

    2015-11-06

    Here, we report the effect of crystal structure and crystallite grain size on singlet fission (SF) in polycrystalline tetracene, one of the most widely studied SF and organic semiconductor materials. SF has been comprehensively studied in one polymoprh (Tc I), but not in the other, less stable polymorph (Tc II). Using carefully controlled thermal evaporation deposition conditions and high sensitivity ultrafast transient absorption spectroscopy, we found that for large crystallite size samples, SF in nearly pure Tc II films is significantly faster than SF in Tc I films. We also discovered that crystallite size has a minimal impact on themore » SF rate in Tc II films, but a significant influence in Tc I films. Large crystallites exhibit SF times of 125 ps and 22 ps in Tc I and Tc II, respectively, whereas small crystallites have SF times of 31 ps and 33 ps. Our results demonstrate first, that attention must be paid to polymorphism in obtaining a self-consistent rate picture for SF in tetracene and second, that control of polymorphism can play a significant role towards achieving a mechanistic understanding of SF in polycrystalline systems. In this latter context we show that conventional theory based on non-covalent tetracene couplings is insufficient, thus highlighting the need for models that capture the delocalized and highly mobile nature of excited states in elucidating the full photophysical picture.« less

  4. Patient Perceptions of Telephone vs. In-Person BRCA1/BRCA2 Genetic Counseling

    PubMed Central

    Peshkin, Beth N.; Kelly, Scott; Nusbaum, Rachel H.; Similuk, Morgan; DeMarco, Tiffani A.; Hooker, Gillian W.; Valdimarsdottir, Heiddis B.; Forman, Andrea D.; Joines, Jessica Rispoli; Davis, Claire; McCormick, Shelley R.; McKinnon, Wendy; Graves, Kristi D.; Isaacs, Claudine; Garber, Judy; Wood, Marie; Jandorf, Lina; Schwartz, Marc D.

    2015-01-01

    Telephone genetic counseling (TC) for hereditary breast/ovarian cancer risk has been associated with positive outcomes in high risk women. However, little is known about how patients perceive TC. As part of a randomized trial of TC versus usual care (UC; in-person genetic counseling), we compared high risk women’s perceptions of: (1) overall satisfaction with genetic counseling; (2) convenience; (3) attentiveness during the session; (4) counselor effectiveness in providing support; and (5) counselor ability to recognize emotional responses during the session. Among the 554 participants (TC, N=272; UC, N=282), delivery mode was not associated with self-reported satisfaction. However, TC participants found counseling significantly more convenient than UC participants (OR = 4.78, 95% CI = 3.32, 6.89) while also perceiving lower levels of support (OR=0.56, 95% CI=0.40–0.80) and emotional recognition (OR = 0.53, 95% CI = 0.37–0.76). In exploratory analyses, we found that non-Hispanic white participants reported higher counselor support in UC than in TC (69.4% vs. 52.8%; OR = 3.06, 95% CI = 1.39–6.74), while minority women perceived less support in UC vs. TC (58.3% vs. 38.7%; OR = 0.80, 95% CI = 0.39–1.65). We discuss potential research and practice implications of these findings which may further improve the effectiveness and utilization of TC. PMID:26455498

  5. Transparent conductive coatings

    NASA Technical Reports Server (NTRS)

    Ashok, S.

    1983-01-01

    Thin film transparent conductors are discussed. Materials with electrical conductivity and optical transparency are highly desirable in many optoelectronic applications including photovoltaics. Certain binary oxide semiconductors such as tin oxide (SnO2) and indium oxide (In2O3) offer much better performance tradeoff in optoelectronics as well as better mechanical and chemical stability than thin semitransparent films. These thin-film transparent conductors (TC) are essentially wide-bandgap degenerate semiconductors - invariably n-type - and hence are transparent to sub-bandgap (visible) radiation while affording high electrical conductivity due to the large free electron concentration. The principal performance characteristics of TC's are, of course, electrical conductivity and optical transmission. The TC's have a refractive index of around 2.0 and hence act as very efficient antireflection coatings. For using TC's in surface barrier solar cells, the photovoltaic barrier is of utmost importance and so the work function or electron affinity of the TC is also a very important material parameter. Fabrication processes are discussed.

  6. Doping-induced change of optical properties in underdoped cuprate superconductors

    NASA Astrophysics Data System (ADS)

    Liu, H. L.; Quijada, M. A.; Zibold, A. M.; Yoon, Y.-D.; Tanner, D. B.; Cao, G.; Crow, J. E.; Berger, H.; Margaritondo, G.; Forró, L.; O, Beom-Hoan; Markert, J. T.; Kelly, R. J.; Onellion, M.

    1999-01-01

    We report on the ab-plane optical reflectance measurements of single crystals of Y-doped 0953-8984/11/1/020/img15 and Pr-doped 0953-8984/11/1/020/img16 over a wide frequency range from 80 to 0953-8984/11/1/020/img17 (10 meV-5 eV) and at temperatures between 20 and 300 K. Y and Pr doping both decrease the hole concentration in the 0953-8984/11/1/020/img18 planes. This has allowed us to investigate the evolution of ab-plane charge dynamics at doping levels ranging from heavily underdoped to nearly optimally doped. Our results of the low-frequency optical conductivity and spectral weight do not show any features associated with the normal-state pseudogap. Instead, one-component analysis for the optical conductivity shows the low-frequency depression in the scattering rate at 0953-8984/11/1/020/img19, signalling entry into the pseudogap state. Alternatively, no clear indications of the normal-state pseudogap are detected in the temperature-dependent zero-frequency free-carrier scattering rate by using two-component analysis. In the superconducting state, there is also no convincing evidence of superconducting gap absorption in all spectra. We find that there is a `universal correlation' between the numbers of carriers and the transition temperature. This correlation holds whether one considers the number of carriers in the superfluid or the total number of carriers.

  7. Electrical and thermal transport properties of the electron-doped cuprate Sm2-x Ce x CuO4-y system

    NASA Astrophysics Data System (ADS)

    Scanderbeg, D. J.; Taylor, B. J.; Baumbach, R. E.; Paglione, J.; Maple, M. B.

    2016-12-01

    Electrical and thermal transport measurements were performed on thin films of the electron-doped superconductor Sm2-x Ce x CuO4-y (x  =  0.13  -  0.19) in order to study the evolving nature of the charge carriers from the under-doped to over-doped regime. A temperature versus cerium content (T  -  x) phase diagram has been constructed from the electrical transport measurements, yielding a superconducting region similar to that found for other electron-doped superconductors. Thermopower measurements show a dramatic change from the underdoped region (x  <  0.15) to the overdoped region (x  >  0.15). Application of the Fisher-Fisher-Huse (FFH) vortex glass scaling model to the magnetoresistance data was found to be insufficient to describe the data in the region of the vortex-solid to vortex-liquid transition. It was found instead that the modified vortex glass scaling model of Rydh, Rapp, and Anderson provided a good description of the data, indicating the importance of the applied field on the pinning landscape. A magnetic field versus temperature (H  -  T) phase diagram has also been constructed for the films with x≥slant 0.14 , displaying the evolution of the vortex glass melting lines H g (T) across the superconducting regime.

  8. Neutron scattering study of spin ordering and stripe pinning in superconducting La 1.93 Sr 0.07 CuO 4

    DOE PAGES

    Jacobsen, H.; Zaliznyak, I. A.; Savici, A. T.; ...

    2015-11-20

    Tmore » he relationships among charge order, spin fluctuations, and superconductivity in underdoped cuprates remain controversial. We use neutron scattering techniques to study these phenomena in La 1.93 Sr 0.07 CuO 4 a superconductor with a transition temperature of c = 20 K. At << c, we find incommensurate spin fluctuations with a quasielastic energy spectrum and no sign of a gap within the energy range from 0.2 to 15 meV. A weak elastic magnetic component grows below ~ 10 K, consistent with results from local probes. Regarding the atomic lattice, we have discovered unexpectedly strong fluctuations of the CuO 6 octahedra about Cu-O bonds, which are associated with inequivalent O sites within the CuO 2 planes. Moreover, we observed a weak elastic (3 ⁻30) superlattice peak that implies a reduced lattice symmetry. he presence of inequivalent O sites rationalizes various pieces of evidence for charge stripe order in underdoped La 2-xSr xCuO 4. he coexistence of superconductivity with quasi-static spin-stripe order suggests the presence of intertwined orders; however, the rotation of the stripe orientation away from the Cu-O bonds might be connected with evidence for a finite gap at the nodal points of the superconducting gap function.« less

  9. Neutron scattering study of spin ordering and stripe pinning in superconducting La 1.93 Sr 0.07 CuO 4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jacobsen, H.; Zaliznyak, I. A.; Savici, A. T.

    Tmore » he relationships among charge order, spin fluctuations, and superconductivity in underdoped cuprates remain controversial. We use neutron scattering techniques to study these phenomena in La 1.93 Sr 0.07 CuO 4 a superconductor with a transition temperature of c = 20 K. At << c, we find incommensurate spin fluctuations with a quasielastic energy spectrum and no sign of a gap within the energy range from 0.2 to 15 meV. A weak elastic magnetic component grows below ~ 10 K, consistent with results from local probes. Regarding the atomic lattice, we have discovered unexpectedly strong fluctuations of the CuO 6 octahedra about Cu-O bonds, which are associated with inequivalent O sites within the CuO 2 planes. Moreover, we observed a weak elastic (3 ⁻30) superlattice peak that implies a reduced lattice symmetry. he presence of inequivalent O sites rationalizes various pieces of evidence for charge stripe order in underdoped La 2-xSr xCuO 4. he coexistence of superconductivity with quasi-static spin-stripe order suggests the presence of intertwined orders; however, the rotation of the stripe orientation away from the Cu-O bonds might be connected with evidence for a finite gap at the nodal points of the superconducting gap function.« less

  10. Growth And Patterning Of High-Tc Superconducting Films

    NASA Technical Reports Server (NTRS)

    Warner, J. D.; Bhasin, K. B.; Varaljay, N. C.; Bohman, D. Y.; Chorey, C. M.

    1992-01-01

    Superconducting films of YBa(2)Cu(3)O(7-delta), having high superconducting-transition temperatures (Tc's), deposited on LaAlO3 substrates and etched into patterns representative of passive microwave devices, with no deterioration of superconducting properties.

  11. Initial direct comparison of 99mTc-TOC and 99mTc-TATE in identifying sites of disease in patients with proven GEP NETs.

    PubMed

    Cwikla, Jaroslaw B; Mikolajczak, Renata; Pawlak, Dariusz; Buscombe, John R; Nasierowska-Guttmejer, Anna; Bator, Andrzej; Maecke, Helmut R; Walecki, Jerzy

    2008-07-01

    The imaging of neuroendocrine tumors has become one of the most significant areas in nuclear oncology. In an attempt to provide high-quality imaging and possible sensitivity at a reduced cost, time, and radiation dose, several (99m)Tc agents have been proposed. The aim of this initial study was to compare the tumor uptake and biodistribution of 2 new 6-hydrazinopyridine-3-carboxylic acid (HYNIC)-derivatized Tyr(3)-octreotide analogs, (99m)Tc-[HYNIC,Tyr(3)]octreotide ((99m)Tc-TOC) and (99m)Tc-[HYNIC,Tyr(3),Thr(8)]octreotide ((99m)Tc-TATE), in patients with somatostatin receptor-expressing tumors. Each of 12 patients with proven gastrointestinal pancreatic neuroendocrine tumors received a mean activity of 520 MBq of (99m)Tc-TOC and (99m)Tc-TATE. Scintigraphy with both tracers was performed 3-4 h after their injection using standard whole-body and SPECT imaging. The images were reviewed subjectively by 2 readers, who reported tumor uptake lesion by lesion. Both radiotracers demonstrated concordance between the results in 7 patients (58%). In total, 110 sites of disease were identified with (99m)Tc-TOC, compared with 115 with (99m)Tc-TATE. There was 1 case in which (99m)Tc-TOC identified sites of disease not seen on (99m)Tc-TATE imaging but 4 cases in which some sites of disease were seen with (99m)Tc-TATE and not (99m)Tc-TOC. In this initial study, both tracers seem to show similar sites of tumor, with (99m)Tc-TATE having a slight edge in the total number of lesions seen, especially in lymph node metastases.

  12. Molecular cloning and expression analysis of the sucrose transporter gene family from Theobroma cacao L.

    PubMed

    Li, Fupeng; Wu, Baoduo; Qin, Xiaowei; Yan, Lin; Hao, Chaoyun; Tan, Lehe; Lai, Jianxiong

    2014-08-10

    In this study, we performed cloning and expression analysis of six putative sucrose transporter genes, designated TcSUT1, TcSUT2, TcSUT3, TcSUT4, TcSUT5 and TcSUT6, from the cacao genotype 'TAS-R8'. The combination of cDNA and genomic DNA sequences revealed that the cacao SUT genes contained exon numbers ranging from 1 to 14. The average molecular mass of all six deduced proteins was approximately 56 kDa (range 52 to 66 kDa). All six proteins were predicted to exhibit typical features of sucrose transporters with 12 trans-membrane spanning domains. Phylogenetic analysis revealed that TcSUT2 and TcSUT4 belonged to Group 2 SUT and Group 4 SUT, respectively, and the other TcSUT proteins were belonging to Group 1 SUT. Real-time PCR was conducted to investigate the expression pattern of each member of the SUT family in cacao. Our experiment showed that TcSUT1 was expressed dominantly in pods and that, TcSUT3 and TcSUT4 were highly expressed in both pods and in bark with phloem. Within pods, TcSUT1 and TcSUT4 were expressed more in the seed coat and seed from the pod enlargement stage to the ripening stage. TcSUT5 expression sharply increased to its highest expression level in the seed coat during the ripening stage. Expression pattern analysis indicated that TcSUT genes may be associated with photoassimilate transport into developing seeds and may, therefore, have an impact on seed production. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Paclitaxel-loaded folate-coated long circulating and pH-sensitive liposomes as a potential drug delivery system: A biodistribution study.

    PubMed

    Monteiro, Liziane O F; Fernandes, Renata S; Oda, Caroline M R; Lopes, Sávia C; Townsend, Danyelle M; Cardoso, Valbert N; Oliveira, Mônica C; Leite, Elaine A; Rubello, Domenico; de Barros, André L B

    2018-01-01

    A range of antitumor agents for cancer treatment is available; however, they show low specificity, which often limit their use. Recently, we have reported the preparation of folate-coated long-circulating and pH-sensitive liposomes (SpHL-folate-PTX) loaded with paclitaxel (PTX), an effective drug for the treatment of solid tumors, including breast cancer. The purpose of this study was to prepare and characterize SpHL-PTX and SpHL-folate-PTX radiolabeled with technetium-99m ( 99m Tc). Biodistribution studies and scintigraphic images were performed after intravenous administration of 99m Tc-PTX, 99m Tc-SpHL-PTX and 99m Tc-SpHL-folate-PTX into healthy and tumor-bearing mice. High radiochemical purity (>98%) and in vitro stability (>90%) were achieved for both liposome formulations. The pharmacokinetic properties of 99m Tc-SpHL-DTPA-PTX and 99m Tc-SpHL-folate-DTPA-PTX decreased in a monophasic manner showing half-life of 400.1 and 541.8min, respectively. Scintigraphic images and biodistribution studies showed a significant uptake in liver, spleen and kidneys, demonstrating these routes as way for excretion. At 8h post-injection, the liposomal tumor uptake was higher than 99m Tc-PTX. Interesting, 4h after administration, the liposome folate coated showed higher tumor-to-muscle ratio than 99m Tc-SpHL-DTPA-PTX and 99m Tc-PTX. In conclusion, the liposomal systems, showed high tumor uptake by scintigraphic images, especially the 99m Tc-SpHL-folate-DTPA-PTX that showed a sustained and higher tumor-to-muscle ratio than non-functionalized liposome, which indicate its feasibility as a PTX delivery system to folate positive tumors. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. TC-325 versus the conventional combined technique for endoscopic treatment of peptic ulcers with high-risk bleeding stigmata: A randomized pilot study.

    PubMed

    Kwek, Boon Eu Andrew; Ang, Tiing Leong; Ong, Peng Lan Jeannie; Tan, Yi Lyn Jessica; Ang, Shih Wen Daphne; Law, Ngai Moh; Thurairajah, Prem Harichander; Fock, Kwong Ming

    2017-06-01

    Preliminary studies on a new topical hemostatic agent, TC-325, have shown its safety and effectiveness in treating active upper gastrointestinal (GI) bleeding. However, to date there have been no randomized trials comparing TC-325 with the conventional combined technique (CCT). Our pilot study aimed to compare the efficacy and safety of TC-325 with those of CCT in treating peptic ulcers with active bleeding or high-risk stigmata. This was a comparative randomized study of patients with upper GI bleeding who had Forrest class I, IIA or IIB ulcers. Altogether 20 patients with a mean age of 70 years (range 23-87 years) were recruited, including 16 men, with a mean hemoglobin of 97 g/L. Initial hemostasis was successful in 19 (95.0%) patients, including 90.0% (9/10) in the TC-325 group and 100% (10/10) in the CCT group. TC-325 monotherapy failed to stop bleeding in a patient with Forrest IB posterior duodenal wall ulcer. Rebleeding was seen in 33.3% (3/9) of the patients in the TC-325 group and 10.0% (1/10) in the CCT group. One patient required angio-embolization therapy while three had successful conventional endotherapy. Two patients from the TC-325 group had serious adverse events that were not procedure- or therapy-related. In patients with Forrest IIA or IIB ulcers, five received TC-325 monotherapy; none had rebleeding. Our pilot study showed that TC-325 has a tendency towards a higher rebleeding rate than CCT, when treating actively bleeding ulcers. Larger trials are necessary for definitive results. © 2017 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.

  15. 99mTc-zolmitriptan: radiolabeling, molecular modeling, biodistribution and gamma scintigraphy as a hopeful radiopharmaceutical for lung nuclear imaging.

    PubMed

    Rashed, H M; Marzook, F A; Farag, H

    2016-12-01

    Lung imaging radiopharmaceuticals are helpful agents for measuring pulmonary blood flow and allow detection of pulmonary embolism and lung cancer. The goal of this study was to develop a novel potential radiopharmaceutical for lung imaging. Zolmitriptan (a selective serotonin receptor agonist) was successfully labeled with 99m Tc via direct labeling method under reductive conditions studying different factors affecting the labeling efficiency. 99m Tc-zolmitriptan was obtained with a maximum labeling yield of 92.5 ± 0.61 % and in vitro stability up to 24 h. Molecular modeling was done to predict the structure of 99m Tc-zolmitriptan and ensure that radiolabeling did not affect binding ability of zolmitriptan to its receptor. Biodistribution studies showed that maximum lung uptake of 99m Tc-zolmitriptan was 23.89 ± 1.2 % injected dose/g tissue at 15 min post-injection and retention in lungs remained high up to 1 h, whereas the clearance from mice appeared to proceed mainly via the renal pathway. Scintigraphic images confirmed the biodistribution results showing a high resolution lung image with low accumulation of radioactivity in other organs except kidneys and urinary bladder. 99m Tc-zolmitriptan is not a blood product and so it is more safe than the currently available 99m Tc-MAA, and its lung uptake is higher than that of the recently discovered 123 I-IPMPD, 99m Tc(CO) 5 I and 99m Tc-DHPM. So, 99m Tc-zolmitriptan could be used as a hopeful radiopharmaceutical for lung scintigraphic imaging.

  16. Introduction of an 8-aminooctanoic acid linker enhances uptake of 99mTc-labeled lactam bridge-cyclized α-MSH peptide in melanoma.

    PubMed

    Guo, Haixun; Miao, Yubin

    2014-12-01

    The purpose of this study was to examine the effects of amino acid, hydrocarbon, and polyethylene glycol (PEG) linkers on the melanoma targeting and imaging properties of (99m)Tc-labeled lactam bridge-cyclized HYNIC-linker-Nle-CycMSHhex (hydrazinonicotinamide-linker-Nle-c[Asp-His-DPhe-Arg-Trp-Lys]-CONH2) peptides. Four novel peptides (HYNIC-GGGNle-CycMSHhex, HYNIC-GSGNle-CycMSHhex, HYNIC-PEG2Nle-CycMSHhex, and HYNIC-AocNle-CycMSHhex) were designed and synthesized. The melanocortin-1 receptor binding affinities of the peptides were determined in B16/F1 melanoma cells. The biodistribution of (99m)Tc(ethylenediaminediacetic acid [EDDA])-HYNIC-GGGNle-CycMSHhex, (99m)Tc(EDDA)-HYNIC-GSGNle-CycMSHhex, (99m)Tc(EDDA)-HYNIC-PEG2Nle-CycMSHhex, and (99m)Tc(EDDA)-HYNIC-AocNle-CycMSHhex were determined in B16/F1 melanoma-bearing C57 mice at 2 h after injection to select a lead peptide for further evaluation. The melanoma targeting and imaging properties of (99m)Tc(EDDA)-HYNIC-AocNle-CycMSHhex were further examined because of its high melanoma uptake. The inhibitory concentrations of 50% (IC50) for HYNIC-GGGNle-CycMSHhex, HYNIC-GSGNle-CycMSHhex, HYNIC-PEG2Nle-CycMSHhex, and HYNIC-AocNle-CycMSHhex were 0.7 ± 0.1, 0.8 ± 0.09, 0.4 ± 0.08, and 0.3 ± 0.06 nM, respectively, in B16/F1 melanoma cells. Among these four (99m)Tc-labeled peptides, (99m)Tc(EDDA)-HYNIC-AocNle-CycMSHhex displayed the highest melanoma uptake (22.3 ± 1.72 percentage injected dose/g) at 2 h after injection. (99m)Tc(EDDA)-HYNIC-AocNle-CycMSHhex exhibited high tumor-to-normal-organ uptake ratios except for the kidneys. The tumor-to-kidney uptake ratios of (99m)Tc(EDDA)-HYNIC-AocNle-CycMSHhex were 3.29, 3.63, and 6.78 at 2, 4, and 24 h, respectively, after injection. The melanoma lesions were clearly visualized by SPECT/CT using (99m)Tc(EDDA)-HYNIC-AocNle-CycMSHhex as an imaging probe at 2 h after injection. High melanoma uptake and fast urinary clearance of (99m)Tc(EDDA)-HYNIC-AocNle-CycMSHhex highlighted its potential for metastatic melanoma detection in the future. © 2014 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  17. Introduction of an 8-Aminooctanoic Acid Linker Enhances the melanoma uptake of Tc-99m-labeled Lactam Bridge-Cyclized Alpha-MSH Peptide

    PubMed Central

    Guo, Haixun; Miao, Yubin

    2015-01-01

    The purpose of this study was to examine the effects of amino acid, hydrocarbon and polyethylene glycol (PEG) linkers on melanoma targeting and imaging properties of 99mTc-labeled lactam bridge-cyclized HYNIC-linker-Nle-CycMSHhex {hydrazinonicotinamide-linker-Nle-c[Asp-His-DPhe-Arg-Trp-Lys]-CONH2} peptides. Methods four novel peptides {HYNIC-GGGNle-CycMSHhex, HYNIC-GSGNle-CycMSHhex, HYNIC-PEG2Nle-CycMSHhex and HYNIC-AocNle-CycMSHhex} were designed and synthesized. The melanocortin-1 (MC1) receptor binding affinities of the peptides were determined in B16/F1 melanoma cells. The biodistribution of 99mTc(EDDA)-HYNIC-GGGNle-CycMSHhex, 99mTc(EDDA)-HYNIC-GSGNle-CycMSHhex, 99mTc(EDDA)-HYNIC-PEG2Nle-CycMSHhex and 99mTc(EDDA)-HYNIC-AocNle-CycMSHhex were determined in B16/F1 melanoma-bearing C57 mice at 2 h post-injection to select a lead peptide for further evaluation. The melanoma targeting and imaging properties of 99mTc(EDDA)-HYNIC-AocNle-CycMSHhex were further examined because of its high melanoma uptake. Results The IC50 values of HYNIC-GGGNle-CycMSHhex, HYNIC-GSGNle-CycMSHhex, HYNIC-PEG2Nle-CycMSHhex, and HYNIC-AocNle-CycMSHhex were 0.7 ± 0.1, 0.8 ± 0.09, 0.4 ± 0.08, and 0.3 ± 0.06 nM in B16/F1 melanoma cells, respectively. Among these four 99mTc-labeled peptides, 99mTc(EDDA)-HYNIC-AocNle-CycMSHhex displayed the highest melanoma uptake (22.3 ± 1.72% ID/g) at 2 h post-injection. 99mTc(EDDA)-HYNIC-AocNle-CycMSHhex exhibited high tumor to normal organ uptake ratios except for the kidneys. The tumor/kidney uptake ratios of 99mTc(EDDA)-HYNIC-AocNle-CycMSHhex were 3.29, 3.63 and 6.78 at 2, 4 and 24 h post-injection. The melanoma lesions were clearly visualized by single photon emission computed tomography (SPECT)/CT using 99mTc(EDDA)-HYNIC-AocNle-CycMSHhex as an imaging probe at 2 h post-injection. Conclusion High melanoma uptake and fast urinary clearance of 99mTc(EDDA)-HYNIC-AocNle-CycMSHhex highlighted its potential for metastatic melanoma detection in the future. PMID:25453052

  18. TC-1 Overexpression Promotes Cell Proliferation in Human Non-Small Cell Lung Cancer that Can Be Inhibited by PD173074

    PubMed Central

    Zhang, Na; Bai, Guangzhen; Zhong, Daixing; Su, Kai; Liu, Boya; Li, Xiaofei; Wang, Yunjie; Wang, Xiaoping

    2014-01-01

    Thyroid cancer-1 (TC-1), a natively disordered protein, is widely expressed in vertebrates and overexpressed in many kinds of tumors. However, its exact role and regulation mechanism in human non-small cell lung cancer (NSCLC) are still unclear. In the present study, we found that TC-1 is highly expressed in NSCLC and that its aberrant expression is strongly associated with NSCLC cell proliferation. Exogenous TC-1 overexpression promotes cell proliferation, accelerates the cell G1-to-S-phase transition, and reduces apoptosis in NSCLC. The knockdown of TC-1, however, inhibits NSCLC cell proliferation, cycle transition, and apoptosis resistance. Furthermore, we also demonstrated that PD173074, which functions as an inhibitor of the TC-1 in NSCLC, decreases the expression of TC-1 and inhibits TC-1 overexpression mediated cell proliferation in vitro and in vivo. Nevertheless, the inhibition function of PD173074 on NSCLC cell proliferation was eliminated in cells with TC-1 knockdown. These results suggest that PD173074 plays a significant role in TC-1 overexpression mediated NSCLC cell proliferation and may be a potential intervention target for the prevention of cell proliferation in NSCLC. PMID:24941347

  19. Surface damage mitigation of TC4 alloy via micro arc oxidation for oil and gas exploitation application: Characterizations of microstructure and evaluations on surface performance

    NASA Astrophysics Data System (ADS)

    Xie, Ruizhen; Lin, Naiming; Zhou, Peng; Zou, Jiaojuan; Han, Pengju; Wang, Zhihua; Tang, Bin

    2018-04-01

    Because of its excellent corrosion resistance, high specific strength and high tensile strength, TC4 titanium alloys used as petroleum tubes have received wide interest from material engineers after many technical investigations and estimations. However, because of its low surface hardness values, high coefficient of friction and poor wear resistance, the TC4 alloy is seldom adopted in tribological-related engineering components. In this work, micro-arc oxidation (MAO) coatings were fabricated on TC4 alloys in NaAlO2 and (NaPO3)6 electrolytes with and without ultrasonic assistance. The microstructural characterizations of the produced MAO coatings were investigated. Comparative estimations of electrochemical corrosion in CO2-saturated simulated oilfield brine and tribological behaviours on MAO coatings and TC4 alloys were conducted. The results showed that the introduction of ultrasound increased the thickness of the MAO coatings. The thickness increased by 34% and 15% in the NaAlO2 and (NaPO3)6 electrolytes, respectively. There was no significant discrepancy in phase constitutions when the MAO processes were conducted with and without ultrasonic assistance. Both MAO coatings obtained with and without ultrasonic assistance were found to improve the corrosion and wear resistance of the TC4 alloy. MAO treatments made it possible to ensure the working surface of a TC4 alloy with an enhanced surface performance for oil and gas exploitation applications.

  20. Dominance of Cry1F resistance in Spodoptera frugiperda (Lepidoptera: Noctuidae) on TC1507 Bt maize in Brazil.

    PubMed

    Farias, Juliano R; Andow, David A; Horikoshi, Renato J; Sorgatto, Rodrigo J; dos Santos, Antonio C; Omoto, Celso

    2016-05-01

    Dominance of resistance has been one of the major parameters affecting the rate of evolution of resistance to Bt crops. High dose is the capacity of Bt crops to kill heterozygous insects and has been an essential component of the most successful strategy to manage resistance to these crops. Experiments were conducted to evaluate directly and indirectly whether the TC1507 event is high dose to Spodoptera frugiperda (JE Smith). About 8% of heterozygote neonate larvae were able to survive, complete larval development and emerge as normal adults on TC1507 leaves, while susceptible larvae could not survive for 5 days. The estimated dominance of resistance was 0.15 ± 0.09 and significantly higher than zero; therefore, the resistance to Cry1F expressed in TC1507 was not completely recessive. A 25-fold dilution of TC1507 maize leaf tissue in an artificial diet was able to cause a maximum mortality of only 37%, with growth inhibition of 82% at 7 days after larval infestation. Resistance to Cry1F in TC1507 maize is incompletely recessive in S. frugiperda. TC1507 maize is not high dose for S. frugiperda. Additional or alternative resistance management strategies, such as the replacement of single-trait Bt maize with pyramided Bt maize, which produces multiple proteins targeting the same insect pests, should be implemented wherever this technology is in use and S. frugiperda is the major pest. © 2015 Society of Chemical Industry.

  1. Simulated sensitivity of tropical cyclone track to the moisture in an idealized monsoon gyre

    NASA Astrophysics Data System (ADS)

    Yan, Ziyu; Ge, Xuyang; Guo, Bingyao

    2017-12-01

    In this study, the sensitivity of tropical cyclone (TC) track to the moisture condition in a nearby monsoon gyre (MG) is investigated. Numerical simulations reveal that TC track is highly sensitive to the spatial distribution of relative humidity (RH). In an experiment conducted with higher (lower) RH in the eastern (western) semicircle of an MG, the TC experiences a sharp northward turning. In contrast, when the RH pattern is reversed, the simulated TC does not show a sharp northward turning. The RH distribution modulates the intensity and structure of both the TC and MG, so that when the TC is initially embedded in a moister environment, convection is enhanced in the outer core, which favors an expansion of the outer core size. A TC with a larger outer size has greater beta-effect propagation, favoring a faster westward translational speed. Meanwhile, higher RH enhances the vorticity gradient within the MG and promotes a quicker attraction between the TC and MG centers through vorticity segregation process. These cumulative effects cause the TC to collocate with the MG center. Once the coalescence process takes place, the energy dispersion associated with the TC and MG is enhanced, which rapidly strengthens southwesterly flows on the eastern flanks. The resulting steering flow leads the TC to take a sharp northward track.

  2. A novel Tc-99m and fluorescence labeled peptide as a multimodal imaging agent for targeting angiogenesis in a murine hindlimb ischemia model.

    PubMed

    Hyoun Kim, Myoung; Kim, Seul-Gi; Guhn Kim, Chang; Kim, Dae-Weung

    2017-03-01

    The serine-aspartic acid-valine (SDV) peptide binds specifically to integrin αvβ3. We developed a Tc-99m and TAMRA labeled peptide, Tc-99m SDV-ECG-K-TAMRA for multimodal imaging of angiogenesis. Tc-99m SDV-ECG-K-TAMRA was prepared in high yield (>96%) and showed low cytotoxicity. Tc-99m tetrofosmin images 1 week after operation, revealed significantly decreased perfusion of the ischemic hindlimb, and the perfusion recovered gradually for 4 weeks. In contrast, Tc-99m SDV-ECG-K-TAMRA uptake was maximal 1 week after the operation (ischemic-to-non-ischemic uptake ratio =5.03±1.01) and decreased gradually. The ischemic-to-non-ischemic ratio of Tc-99m SDV-ECG-K-TAMRA and Tc-99m tetrofosmin was strongly negatively correlated (r =-0.94). A postmortem analysis revealed increased angiogenesis markers and uptake of Tc-99m SDV-ECG-K-TAMRA by ischemic tissue. Our in vivo and in vitro studies revealed substantial uptake of Tc-99m SDV-ECG-K-TAMRA by ischemic tissue. Tc-99m SDV-ECG-K-TAMRA could be a good candidate dual-modality imaging agent to assess angiogenesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Magnetically-related properties of bismuth containing high Tc superconductors

    NASA Astrophysics Data System (ADS)

    Vezzoli, Gary C.; Chen, M. F.; Craver, F.; Safari, A.; Moon, B. M.; Lalevic, B.; Burke, Terence; Shoga, M.

    1990-08-01

    The effect of magnetic fields to 15 T on electrical resistance has been measured for the BiSrCaCuO superconductor at precise temperatures during the transition to the superconducting state from pre-onset conditions to essentially zero resistance conditions. The results show that the temperature at which the magnetic field causes a divergence in the resistance versus 1000/ T curve is approximately the same temperature as the value at which, during cooling, the positive Hall coefficient begins its abrupt descent to zero. This temperature gives the best measure of Tc. It is also shown that small oscillations of low frequency start near onset conditions, the amplitude of which at a given temperature is B-field dependent. Additionally, Hall effect studies as a function of temperature at 4 T in three separate experiments (including high Tc BiSrCaCu PbO of > 90% theoretical density) show that sharp delta-function-like peaks in + RH are observed near Tc and are superimposed on a broader maximum. The Hall data are explicable in terms of exciton formation and ionization. The bound holes associated with these excitons are believed to be the mediators producing Cooper-pairing, and scale very well with Tc for all the known high Tc oxides.

  4. Impeding 99Tc(IV) mobility in novel waste forms

    PubMed Central

    Lee, Mal-Soon; Um, Wooyong; Wang, Guohui; Kruger, Albert A.; Lukens, Wayne W.; Rousseau, Roger; Glezakou, Vassiliki-Alexandra

    2016-01-01

    Technetium (99Tc) is an abundant, long-lived radioactive fission product whose mobility in the subsurface is largely governed by its oxidation state. Tc immobilization is crucial for radioactive waste management and environmental remediation. Tc(IV) incorporation in spinels has been proposed as a novel method to increase Tc retention in glass waste forms during vitrification. However, experiments under high-temperature and oxic conditions show reoxidation of Tc(IV) to volatile pertechnetate, Tc(VII). Here we examine this problem with ab initio molecular dynamics simulations and propose that, at elevated temperatures, doping with first row transition metal can significantly enhance Tc retention in magnetite in the order Co>Zn>Ni. Experiments with doped spinels at 700 °C provide quantitative confirmation of the theoretical predictions in the same order. This work highlights the power of modern, state-of-the-art simulations to provide essential insights and generate theory-inspired design criteria of complex materials at elevated temperatures. PMID:27357121

  5. Preoperative diagnosis of orbital cavernous hemangioma: a 99mTc-RBC SPECT study.

    PubMed

    Burroni, Luca; Borsari, Giulia; Pichierri, Patrizia; Polito, Ennio; Toscano, Olga; Grassetto, Gaia; Al-Nahhas, Adil; Rubello, Domenico; Vattimo, Angelo Giuseppe

    2012-11-01

    This study aimed to describe 99mTc-labeled RBC scintigraphy as a diagnostic method for orbital cavernous hemangiomas and to evaluate this diagnostic tool according to surgical outcomes. Fifty-five patients with clinical and radiological (US, CT, and/or MRI) suspicion of unilateral cavernous hemangioma of the orbit underwent 99mTc-RBC SPECT study.Qualitative and semiquantitative evaluations were performed, and results were statistically analyzed. SPECT images showed focal uptake in the orbital mass in 36 of 55 patients. Nineteen patients had a negative scintigraphic pattern, with concordance of early and late absence of uptake of 99mTc-RBC.Our procedure showed 100% sensitivity and 88.9% specificity for the diagnosis of orbital cavernous hemangioma, with a positive predictive value of 90.9% and a negative predictive value of 100%. 99mTc-RBC imaging is safe, easy to perform, and highly accurate in providing adequate clinical and surgical management. As a noninvasive and highly specific method for diagnosing orbital hemangioma, 99mTc-RBC scintigraphy can avoid more invasive imaging or biopsy.

  6. Evaluation of the technical performance of novel holotranscobalamin (holoTC) assays in a multicenter European demonstration project.

    PubMed

    Morkbak, Anne L; Heimdal, Randi M; Emmens, Kathleen; Molloy, Anne; Hvas, Anne-Mette; Schneede, Joern; Clarke, Robert; Scott, John M; Ueland, Per M; Nexo, Ebba

    2005-01-01

    A commercially available holotranscobalamin (holo-TC) radioimmunoassay (RIA) (Axis-Shield, Dundee, Scotland) was evaluated in four laboratories and compared with a holoTC ELISA run in one laboratory. The performance of the holoTC RIA assay was comparable in three of the four participating laboratories. The results from these three laboratories, involving at least 20 initial runs of "low", "medium" and "high" serum-based controls (mean holoTC concentrations 34, 60 and 110 pmol/L, respectively) yielded an intra-laboratory imprecision of 6-10%. No systematic inter-laboratory deviations were observed on runs involving 72 patient samples (holoTC concentration range 10-160 pmol/L). A fourth laboratory demonstrated higher assay imprecision for control samples and systematic deviation of results for the patient samples. Measurement of holoTC by ELISA showed an imprecision of 4-5%, and slightly higher mean values for the controls (mean holoTC concentrations 40, 70 and 114 pmol/L, respectively). Comparable results were obtained for the patient samples. The long-term intra-laboratory imprecision was 12% for the holoTC RIA and 6% for the ELISA. In conclusion, it would be prudent to check the calibration and precision prior to starting to use these holoTC assays in research or clinical practice. The results obtained using the holoTC RIA were similar to those obtained using the holoTC ELISA assay.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lukens, Wayne W.; Saslow, Sarah A.

    Technetium-99 (Tc) is a problematic fission product that complicates the long-term disposal of nuclear waste due to its long half-life, high fission yield, and the environmental mobility of pertechnetate, its stable form in aerobic environments. One approach to preventing Tc contamination is through incorporation into durable waste forms based on weathering-resistant minerals such as rutile (titanium dioxide). Here, the incorporation of technetium into titanium dioxide by means of simple, aqueous chemistry is presented. X-ray absorption fine structure spectroscopy and diffuse reflectance spectroscopy indicate that Tc(IV) replaces Ti(IV) within the structure. Rather than being incorporated as isolated Tc(IV) ions, Tc ismore » present as pairs of edge-sharing Tc(IV) octahedra similar to molecular Tc(IV) complexes such as [(H2EDTA)TcIV](u-O)2. Technetium-doped TiO2 was suspended in deionized water under aerobic conditions, and the Tc leached under these conditions was followed for 8 months. The normalized release rate of Tc (LRTc) from the TiO2 particles is low (3×10-6 g m-2 d-1), which illustrates the potential utility of TiO2 as waste form. However, the small size of the as-prepared TiO2 nanoparticles results in estimated retention of Tc for 104 years, which is only a fraction of the half-life of Tc (2×10-5 years).« less

  8. Estimating cancer risk from 99mTc pyrophosphate imaging for transthyretin cardiac amyloidosis.

    PubMed

    Einstein, Andrew J; Shuryak, Igor; Castaño, Adam; Mintz, Akiva; Maurer, Mathew S; Bokhari, Sabahat

    2018-05-30

    Increasing recognition that transthyretin cardiac amyloidosis (ATTR-CA) is much more common than previously appreciated and the emergence of novel disease-modifying therapeutic agents have led to a paradigm shift in which ATTR-CA screening is considered in high-risk populations, such as patients with heart failure with preserved ejection fraction (HFpEF) or aortic stenosis. Radiation risk from 99m Tc-pyrophosphate ( 99m Tc-PYP) scintigraphy, a test with very high sensitivity and specificity for ATTR-CA, has not been previously determined. Radiation doses to individual organs from 99m Tc-PYP were estimated using models developed by the Medical Internal Radiation Dose Committee and the International Commission on Radiological Protection. Excess future cancer risks were estimated from organ doses, using risk projection models developed by the National Academies and extended by the National Cancer Institute. Excess future risks were estimated for men and women aged 40-80 and compared to total (excess plus baseline) future risks. All-organ excess cancer risks (90% uncertainty intervals) ranged from 5.88 (2.45,11.4) to 12.2 (4.11,26.0) cases per 100,000 patients undergoing 99m Tc-PYP testing, were similar for men and women, and decreased with increasing age at testing. Cancer risks were highest to the urinary bladder, and bladder risk varied nearly twofold depending on which model was used. Excess 99m Tc-PYP-related cancers constituted < 1% of total future cancers to the critical organs. Very low cancer risks associated with 99m Tc-PYP testing suggest a favorable benefit-risk profile for 99m Tc-PYP as a screening test for ATTR-CA in high-risk populations, such as such as patients with HFpEF or aortic stenosis.

  9. 99mTc-HYNIC-(tricine/EDDA)-FROP peptide for MCF-7 breast tumor targeting and imaging.

    PubMed

    Ahmadpour, Sajjad; Noaparast, Zohreh; Abedi, Seyed Mohammad; Hosseinimehr, Seyed Jalal

    2018-02-19

    Breast cancer is the most common malignancy among women in the world. Development of novel tumor-specific radiopharmaceuticals for early breast tumor diagnosis is highly desirable. In this study we developed 99m Tc-HYNIC-(tricine/EDDA)-Lys-FROP peptide with the ability of specific binding to MCF-7 breast tumor. The FROP-1 peptide was conjugated with the bifunctional chelator hydrazinonicotinamide (HYNIC) and labeled with 99m Tc using tricine/EDDA co-ligand. The cellular specific binding of 99m Tc-HYNIC-FROP was evaluated on different cell lines as well as with blocking experiment on MCF-7 (human breast adenocarcinoma). The tumor targeting and imaging of this labeled peptide were performed on MCF-7 tumor bearing mice. Radiochemical purity for 99m Tc-HYNIC-(tricine/EDDA)-FROP was 99% which was determined with ITLC method. This radiolabeled peptide showed high stability in normal saline and serum about 98% which was monitored with HPLC method. In saturation binding experiments, the binding constant (K d ) to MCF-7 cells was determined to be 158 nM. Biodistribution results revealed that the 99m Tc-HYNIC-FROP was mainly exerted from urinary route. The maximum tumor uptake was found after 30 min post injection (p.i.); however maximum tumor/muscle ratio was seen at 15 min p.i. The tumor uptake of this labeled peptide was specific and blocked by co-injection of excess FROP. According to the planar gamma imaging result, tumor was clearly visible due to the tumor uptake of 99m Tc-HYNIC-(tricine/EDDA)-FROP in mouse after 15 min p.i. The 99m Tc-HYNIC-(tricine/EDDA)-FROP is considered a promising probe with high specific binding to MCF-7 breast cancer cells.

  10. A fast and simple dose-calibrator-based quality control test for the radionuclidic purity of cyclotron-produced (99m)Tc.

    PubMed

    Tanguay, J; Hou, X; Esquinas, P; Vuckovic, M; Buckley, K; Schaffer, P; Bénard, F; Ruth, T J; Celler, A

    2015-11-07

    Cyclotron production of 99mTc through the (100)Mo(p,2n)99mTc reaction channel is actively being investigated as an alternative to reactor-based (99)Mo generation by nuclear fission of (235)U. Like most radioisotope production methods, cyclotron production of 99mTc will result in creation of unwanted impurities, including Tc and non-Tc isotopes. It is important to measure the amounts of these impurities for release of cyclotron-produced 99mTc (CPTc) for clinical use. Detection of radioactive impurities will rely on measurements of their gamma (γ) emissions. Gamma spectroscopy is not suitable for this purpose because the overwhelming presence of 99mTc and the count-rate limitations of γ spectroscopy systems preclude fast and accurate measurement of small amounts of impurities. In this article we describe a simple and fast method for measuring γ emission rates from radioactive impurities in CPTc. The proposed method is similar to that used to identify (99)Mo breakthrough in generator-produced 99mTc: one dose calibrator (DC) reading of a CPTc source placed in a lead shield is followed by a second reading of the same source in air. Our experimental and theoretical analysis show that the ratio of DC readings in lead to those in air are linearly related to γ emission rates from impurities per MBq of 99mTc over a large range of clinically-relevant production conditions. We show that estimates of the γ emission rates from Tc impurities per MBq of 99mTc can be used to estimate increases in radiation dose (relative to pure 99mTc) to patients injected with CPTc-based radiopharmaceuticals. This enables establishing dosimetry-based clinical-release criteria that can be tested using commercially-available dose calibrators. We show that our approach is highly sensitive to the presence of 93gTc, 93mTc, 94gTc, 94mTc, 95mTc, 95gTc, and 96gTc, in addition to a number of non-Tc impurities.

  11. A fast and simple dose-calibrator-based quality control test for the radionuclidic purity of cyclotron-produced 99mTc

    NASA Astrophysics Data System (ADS)

    Tanguay, J.; Hou, X.; Esquinas, P.; Vuckovic, M.; Buckley, K.; Schaffer, P.; Bénard, F.; Ruth, T. J.; Celler, A.

    2015-11-01

    Cyclotron production of {{}99\\text{m}} Tc through the 100Mo(p,2n){{}99\\text{m}} Tc reaction channel is actively being investigated as an alternative to reactor-based 99Mo generation by nuclear fission of 235U. Like most radioisotope production methods, cyclotron production of {{}99\\text{m}} Tc will result in creation of unwanted impurities, including Tc and non-Tc isotopes. It is important to measure the amounts of these impurities for release of cyclotron-produced {{}99\\text{m}} Tc (CPTc) for clinical use. Detection of radioactive impurities will rely on measurements of their gamma (γ) emissions. Gamma spectroscopy is not suitable for this purpose because the overwhelming presence of {{}99\\text{m}} Tc and the count-rate limitations of γ spectroscopy systems preclude fast and accurate measurement of small amounts of impurities. In this article we describe a simple and fast method for measuring γ emission rates from radioactive impurities in CPTc. The proposed method is similar to that used to identify 99Mo breakthrough in generator-produced {{}99\\text{m}} Tc: one dose calibrator (DC) reading of a CPTc source placed in a lead shield is followed by a second reading of the same source in air. Our experimental and theoretical analysis show that the ratio of DC readings in lead to those in air are linearly related to γ emission rates from impurities per MBq of {{}99\\text{m}} Tc over a large range of clinically-relevant production conditions. We show that estimates of the γ emission rates from Tc impurities per MBq of {{}99\\text{m}} Tc can be used to estimate increases in radiation dose (relative to pure {{}99\\text{m}} Tc) to patients injected with CPTc-based radiopharmaceuticals. This enables establishing dosimetry-based clinical-release criteria that can be tested using commercially-available dose calibrators. We show that our approach is highly sensitive to the presence of {{}93\\text{g}} Tc, {{}93\\text{m}} Tc, {{}94\\text{g}} Tc, {{}94\\text{m}} Tc, {{}95\\text{m}} Tc, {{}95\\text{g}} Tc, and {{}96\\text{g}} Tc, in addition to a number of non-Tc impurities.

  12. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  13. Temperature Dependence of Quasiparticle Spectral Weight and Coherence in High Tc Superconductors

    NASA Astrophysics Data System (ADS)

    He, Yang; Zhang, Jessie; Hoffman, Jennifer; Hoffman Lab Team

    2014-03-01

    Superconductivity arises from the Cooper pairing of quasiparticles on the Fermi surface. Understanding the formation of Cooper pairs is an essential step towards unveiling the mechanism of high Tc superconductivity. We compare scanning tunneling microscope investigations of the temperature dependence of quasiparticle spectral weight and quasiparticle interference in several families of high Tc materials. We calculate the coherent spectral weight related to superconductivity, despite the coexistence of competing orders. The relation between pairing temperature and coherent spectral weight is discussed. We acknowledge support by the New York Community Trust-George Merck Fund.

  14. Impurities in Tc-99m radiopharmaceutical solution obtained from Mo-100 in cyclotron.

    PubMed

    Tymiński, Zbigniew; Saganowski, Paweł; Kołakowska, Ewa; Listkowska, Anna; Ziemek, Tomasz; Cacko, Daniel; Dziel, Tomasz

    2018-04-01

    The gamma emitting impurities in 99m Tc solution obtained from enriched molybdenum 100 Mo metallic target after its irradiation in a cyclotron were measured using a high-purity germanium (HPGe) detector. The radioactivity range of tested samples of 99m Tc was rather low, in the range from 0.34 to 2.39 MBq, thus creating a challenge to investigate the standard measurement HPGe system for impurity detection and quantification. In the process of 99m Tc separation from irradiated target the AnaLig® Tc-02 resin, Dionex H + and Alumina A columns were used. Fractions of eluates from various steps of separation process were taken and measured for radionuclidic purity. The overall measurement sensitivity of gamma emitters in terms of minimum detectable activity (MDA) was found at the level of 14-70Bq with emission lines in range of 36 - 1836keV resulting in impurity content range of 6.7 × 10 -4 to 3.4 × 10 -3 % for 93 Tc, 93m Tc, 94 Tc, 94m Tc, 95 Tc, 95m Tc, 96 Tc 96 Nb, 97 Nb, 99 Mo contaminants and 9.4 × 10 -3 % for 97m Tc. The usefulness of the chosen measurement conditions and the method applied to testing the potential contaminators was proved by reaching satisfactory results of MDAs less than the criteria of impurity concentration of all nuclides specified in the European Pharmacopoeia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Genetically different isolates of Trypanosoma cruzi elicit different infection dynamics in raccoons (Procyon lotor) and Virginia opossums (Didelphis virginiana)

    PubMed Central

    Roellig, Dawn M.; Ellis, Angela E.; Yabsley, Michael J.

    2009-01-01

    Trypanosoma cruzi is a genetically and biologically diverse species. In the current study we determined T. cruzi infection dynamics in two common North American reservoirs, Virginia opossums (Didelphis virginiana) and raccoons (Procyon lotor). Based on previous molecular and culture data from naturally-exposed animals, we hypothesized that raccoons would have a longer patent period than opossums, and raccoons would be competent reservoirs for both genotypes T. cruzi I (TcI) and TcIIa, while opossums would only serve as hosts for TcI. Individuals (n = 2 or 3) of each species were inoculated with 1 × 106 culture-derived T. cruzi trypomastigotes of TcIIa (North American (NA) - raccoon), TcI (NA - opossum), TcIIb (South American - human), or both TcI and TcIIa. Parasitemias in opossums gradually increased and declined rapidly, whereas parasitemias peaked sooner in raccoons and they maintained relatively high parasitemia for 5 weeks. Raccoons became infected with all three T. cruzi strains, while opossums only became infected with TcI and TcIIb. Although opossums were susceptible to TcIIb, infection dynamics were dramatically different compared with TcI. Opossums inoculated with TcIIb seroconverted, but parasitemia duration was short and only detectable by PCR. In addition, raccoons seroconverted sooner (3–7 days post inoculation) than opossums (10 days post inoculation). These data suggest that infection dynamics of various T. cruzi strains can differ considerably in different wildlife hosts. PMID:19607833

  16. Molecular mechanics of tropocollagen-hydroxyapatite biomaterials

    NASA Astrophysics Data System (ADS)

    Dubey, Devendra Kumar

    Hard biomaterials such as bone, dentin, and nacre show remarkable mechanical performance and serve as inspiration for development of next generation of composite materials with high strength and toughness. Such materials have primarily an organic phase (e.g. tropocollagen (TC) or chitin) and a mineral phase (e.g. hydroxyapatite (HAP) or aragonite) arranged in a staggered arrangement at nanoscopic length scales. Interfacial interactions between the organic phases and the mineral phases and structural effects arising due to the staggered and hierarchical arrangements are identified to be the two most important determinants for high mechanical performance of such biomaterials. Effects of these determinants in such biomaterials are further intertwined with factors such as loading configuration, chemical environment, mineral crystal shape, and residue sequences in polymer chains. Atomistic modeling is a desired approach to investigate such sub nanoscale issues as experimental techniques for investigations at such small scale are still in nascent stage. For this purpose, explicit three dimensional (3D) molecular dynamics (MD) and ab initio MD simulations of quasi-static mechanical deformations of idealized Tropocollagen-Hydroxyapatite (TC-HAP) biomaterials with distinct interfacial arrangements and different loading configurations are performed. Focus is on developing insights into the molecular level mechanics of TC-HAP biomaterials at fundamental lengthscale with emphasis on interface phenomenon. Idealized TC-HAP atomistic models are analyzed for their mechanical strength and fracture failure behavior from the viewpoint of interfacial interactions between TC and HAP and associated molecular mechanisms. In particular, study focuses on developing an understanding of factors such as role of interfacial structural arrangement, hierarchical structure design, influence of water, effect of changes in HAP crystal shape, and mutations in TC molecule on the mechanical strength of TC-HAP biomaterials. In conjunction, a continuum level tension-shear-chain (TSC) model is also implemented to analyze fracture resistance characteristics in TC-HAP nanocomposites. Results and analyses shed light on the failure mechanisms in TC-HAP type nanocomposite systems with a chemo-mechanical understanding of the interfacial interaction between TC and HAP. Analyses show that (1) failure of TC-HAP nanocomposites at nanoscale is predominantly peak strain dependent phenomenon, (2) presence of water in most cases strengthens the TC-HAP biomaterial by acting as a bridge via hydrogen bond mediated crosslinks, (3) TC-HAP nanostructures with plate shaped HAP crystals show higher toughness and stability as compared to TC-HAP nanostructures with needle shaped HAP crystals, and (4) mutations in TC are responsible for Osteogenesis Imperfecta bone disorder in an indirect manner, wherein mutations in TC affect the shape and distribution of mineral phase during growth and nucleation period of bone. Overall study emphasizes that interfacial structural arrangement between polymer phase and mineral phase in TC-HAP and similar nanocomposite biomaterials is an important factor in determining their mechanical strength and should be carefully studied and selected for development of high performance nanocomposite biomaterials. Findings and understandings from this research have significant impact on polymer-ceramic nanocomposite mechanics, biomaterial and biomimetic materials development, and bone fragility disorders related medical science development.

  17. ABCG-like transporter of Trypanosoma cruzi involved in benznidazole resistance: gene polymorphisms disclose inter-strain intragenic recombination in hybrid isolates.

    PubMed

    Franco, Jaques; Ferreira, Renata C; Ienne, Susan; Zingales, Bianca

    2015-04-01

    Benznidazole (BZ) is one of the two drugs for Chagas disease treatment. In a previous study we showed that the Trypanosoma cruzi ABCG-like transporter gene, named TcABCG1, is over-expressed in parasite strains naturally resistant to BZ and that the gene of TcI BZ-resistant strains exhibited several single nucleotide polymorphisms (SNPs) as compared to the gene of CL Brener BZ-susceptible strain. Here we report the sequence of TcABCG1 gene of fourteen T. cruzi strains, with diverse degrees of BZ sensitivity and belonging to different discrete typing units (DTUs) and Tcbat group. Although DTU-specific SNPs and amino acid changes were identified, no direct correlation with BZ-resistance phenotype was found. Thus, it is plausible that the transporter abundance is a determinant factor for drug resistance, as pointed out above. Sequence data were used for Bayesian phylogenies and network genealogy analysis. The network showed a high degree of reticulation suggesting genetic exchange between the parasites. TcI and TcII clades were clearly separated. Tcbat sequences were close to TcI. A fourth clade clustered TcABCG1 haplotypes of TcV, TcVI and TcIII strains, with closer proximity to TcI. Analysis of the recombination patterns indicated that hybrid strains contain haplotypes that are mosaics most likely derived by intragenic recombination of parental sequences. The data confirm that TcII and TcIII as the parentals of TcV and TcVI DTUs. Since genetic fingerprint of TcI was found in TcIII, we sustain the previously proposed "Two Hybridization model" for the origin of hybrid strains. Among the twenty best BLASTP hits in databases, orthologues of TcABCG1 transporter were found in Leishmania spp. and African trypanosomes, though their function remains undescribed. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Monoanionic 99mTc-tricarbonyl-aminopolycarboxylate complexes with uncharged pendant groups: Radiosynthesis and evaluation as potential renal tubular tracers.

    PubMed

    Lipowska, Malgorzata; Klenc, Jeffrey; Jarkas, Nashwa; Marzilli, Luigi G; Taylor, Andrew T

    2017-04-01

    99m Tc(CO) 3 -nitrilotriacetic acid, 99m Tc(CO) 3 (NTA), is a new renal tubular agent with pharmacokinetic properties comparable to those of 131 I-OIH but the clearance of 99m Tc(CO) 3 (NTA) and 131 I-OIH is still less than the clearance of PAH, the gold standard for the measurement of effective renal plasma flow. At physiological pH, dianionic 99m Tc(CO) 3 (NTA) has a mononegative inner metal-coordination sphere and a mononegative uncoordinated carboxyl group. To evaluate alternate synthetic approaches, we assessed the importance of an uncoordinated carboxyl group, long considered essential for tubular transport, by evaluating the pharmacokinetics of three analogs with the 99m Tc(CO) 3 (NTA) metal-coordination sphere but with uncharged pendant groups. 99m Tc(CO) 3 complexes with N-(2-acetamido)iminodiacetic acid (ADA), N-(2-hydroxyethyl)iminodiacetic acid (HDA) and N-(fluoroethyl)iminodiacetic acid (FEDA) were prepared using a tricarbonyl kit and isolated by HPLC. The pharmacokinetics were evaluated in Sprague-Dawley rats, with 131 I-OIH as an internal control; urine was analyzed for metabolites. Plasma protein binding and erythrocyte uptake were determined from the 10min blood samples. Re(CO) 3 (FEDA), the analog of 99m Tc(CO) 3 (FEDA), was prepared and characterized. 99m Tc(CO) 3 (ADA), 99m Tc(CO) 3 (HDA) and 99m Tc(CO) 3 (FEDA) were efficiently prepared as a single species with high radiochemical purities (>99%). These new monoanionic 99m Tc(CO) 3 tracers with uncharged dangling groups all showed rapid blood clearance and high specificity for renal excretion. Activity in the urine, as a percent of 131 I-OIH at 10 and 60min, was 96% and 99% for ADA, 96% and 100% for HDA, and 100% and 99% for FEDA, respectively. Each new tracer was excreted unchanged in the urine. The Re(CO) 3 (FEDA) structure adds compelling evidence that such 99m Tc(CO) 3 (NTA) analogs have metal-coordination spheres identical to that of 99m Tc(CO) 3 (NTA). New tracers lacking the negatively charged pendant carboxyl group previously thought to be essential for rapid renal extraction, 99m Tc(CO) 3 (ADA), 99m Tc(CO) 3 (HDA) and 99m Tc(CO) 3 (FEDA), exhibit pharmacokinetics in rats comparable to those of 99m Tc(CO) 3 (NTA) and 131 I-OIH. Furthermore, these encouraging results in rats warrant evaluation of this new tracer type in humans. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Metal-to-insulator crossover in YBa2Cu3Oy probed by low-temperature quasiparticle heat transport.

    PubMed

    Sun, X F; Segawa, Kouji; Ando, Yoichi

    2004-09-03

    It was recently demonstrated that in La2-xSrxCuO4 the magnetic-field (H) dependence of the low-temperature thermal conductivity kappa up to 16 T reflects whether the normal state under high magnetic field is a metal or an insulator. We measure the H dependence of kappa in YBa(2)Cu(3)O(y) (YBCO) at subkelvin temperatures for a wide doping range, and find that at low doping the kappa(H) behavior signifies the change in the ground state in this system as well. Surprisingly, the critical doping is found to be located deeply inside the underdoped region, about the hole doping of 0.07 hole/Cu; this critical doping is apparently related to the stripe correlations as revealed by the in-plane resistivity anisotropy.

  20. Tc-99m Glu-Cys-Gly-His-Gly-Lys (ECG-HGK), a novel Tc-99m labeled hexapeptide for molecular tumor imaging.

    PubMed

    Kim, Dae-Weung; Kim, Myoung Hyoun; Kim, Chang Guhn

    2016-03-01

    Domain 5 of kinin-free high molecular weight kininogen inhibits the adhesion of many tumor cell lines, and it has been reported that the histidine-glycine-lysine (HGK)-rich region might be responsible for inhibition of cell adhesion. The authors developed HGK-containing hexapeptide, glutamic acid-cysteine-glycine (ECG)-HGK, and evaluated the utility of Tc-99m ECG-HGK for tumor imaging. Hexapeptide, ECG-HGK was synthesized using Fmoc solid-phase peptide synthesis. Radiolabeling efficiency was evaluated. The uptake of Tc-99m ECG-HGK within HT-1080 cells was evaluated in vitro. In HT-1080 tumor-bearing mice, gamma imaging and biodistribution studies were performed. The complexes Tc-99m ECG-HGK was prepared in high yield. The uptake of Tc-99m ECG-HGK within the HT-1080 tumor cells had been demonstrated by in vitro studies. The gamma camera imaging in the murine model showed that Tc-99m ECG-HGK was accumulated substantially in the HT-1080 tumor (tumor-to-muscle ratio = 5.7 ± 1.4 at 4 h), and the tumoral uptake was blocked by the co-injection of excess HGK (tumor-to-muscle ratio = 2.8 ± 0.6 at 4 h). In the present study, Tc-99m ECG-HGK was developed as a new tumor imaging agents. Our in vitro and in vivo studies revealed specific function of Tc-99m ECG-HGK for tumor imaging. Copyright © 2016 John Wiley & Sons, Ltd.

  1. Synthesis and Characterization of 5- and 6- Coordinated Alkali Pertechnetates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weaver, Jamie; Soderquist, Chuck; Gassman, Paul

    ABSTRACT The local chemistry of technetium-99 ( 99Tc) in oxide glasses is important for understanding the incorporation and long-term release of Tc from nuclear waste glasses, both those for legacy defense wastes and fuel reprocessing wastes. Tc preferably forms Tc(VII), Tc(IV), or Tc(0) in glass, depending on the level of reduction of the melt. Tc(VII) in oxide glasses is normally assumed to be isolated pertechnetate TcO 4 -anions surrounded by alkali, but can occasionally precipitate as alkali pertechnetate salts such as KTcO 4and NaTcO 4when Tc concentration is high. In these cases, Tc(VII) is 4-coordinated by oxygen. A reinvestigation ofmore » the chemistry of alkali-technetium-oxides formed under oxidizing conditions and at temperatures used to prepare nuclear waste glasses showed that higher coordinated alkali Tc(VII) oxide species had been reported, including those with the TcO 5 -and TcO 6 -anions. The chemistry of alkali Tc(VII) and other alkali-Tc-oxides is reviewed, along with relevant synthesis conditions. Additionally, we report attempts to make 5- and 6-coordinate pertechnetate compounds of K, Na, and Li, i.e. TcO 5 -and TcO 6 -. It was found that higher coordinated species are very sensitive to water, and easily decompose into their respective pertechnetates. It was difficult to obtain pure compounds, but mixtures of the pertechnetate and other phase(s) were frequently found, as evidenced by x-ray absorption spectroscopy (XAS), neutron diffraction (ND), and Raman spectroscopy. Low temperature electron paramagnetic resonance (EPR) measurements showed the possibility of Tc(IV) and Tc(VI) in Na 3TcO 5and Na 5TcO 6compounds. It was hypothesized that the smaller counter cation would result in more stable pertechnetates. To confirm the synthesis method, LiReO 4and Li 5ReO 6were prepared, and their Raman spectra match those in the literature. Subsequently, the Tc versions LiTcO 4and Li 5TcO 6were synthesized and characterized by ND, Raman spectroscopy, XANES, and EXAFS. The Li 5TcO 6was a marginally stable compound that appears to have the same structure as that known for Li 5ReO 6. Implications of the experimental work on stability of alkali technetate compounds and possible role in the volatilization of Tc are discussed.« less

  2. Interaction between tetracycline and smectite in aqueous solution.

    PubMed

    Li, Zhaohui; Chang, Po-Hsiang; Jean, Jiin-Shuh; Jiang, Wei-Teh; Wang, Chih-Jen

    2010-01-15

    The fate and transport of commonly used antibiotics in soil and groundwater have attracted renewed studies due to increased sensitivities of analytical instruments and thus frequent detections of these compounds even in treated wastewater. Smectite, an important soil component, has large surface area and high cation exchange capacity, while tetracycline (TC) can exist in different forms and charges under different pH conditions. Thus, the interaction between smectite and TC in aqueous systems is of great importance. This research focused on elucidating the mechanisms of TC uptake by smectite, in terms of TC adsorption, cation desorption, and pH changes associated with TC adsorption by smectite and intercalation in smectite. TC adsorption onto smectite was a relatively fast process even though most of the adsorption sites were in the interlayer position involved in intercalation as confirmed by the expansion of d(001) spacing. The TC adsorption capacity was equivalent to 0.74-1.11 times the cation exchange capacity for three of the four smectite minerals studied. Accompanying TC adsorption was simultaneous adsorption of H(+), resulting in protonation of TC on the dimethylamine group. At higher TC input concentrations further adsorption of H(+) resulted in the ratio of H(+) adsorbed to TC adsorbed greater than one, suggesting that additionally adsorbed H(+) could serve as counterions to partially offset the negative charges on the tricarbonyl or phenolic diketone functional groups. The positive correlations between cations desorbed and TC adsorbed, as well as TC adsorbed and H(+) adsorbed, provided a first time evidence to confirm cation exchange as the main mechanism of TC uptake, even under neutral pH conditions.

  3. Vitamin B12 absorption judged by measurement of holotranscobalamin, active vitamin B12: evaluation of a commercially available EIA kit.

    PubMed

    Greibe, Eva; Nexo, Ebba

    2011-11-01

    Active vitamin B12 absorption is followed by an increase in holotranscobalamin (holoTC) upon loading with a high physiological dose of the vitamin (the CobaSorb test). This study evaluates the use of a newly launched EIA kit for measurement of holoTC (active B12) in relation to the CobaSorb test. Intra-assay imprecision and linearity of the EIA kit was examined, employing serum pools of increasing holoTC concentrations. For the CobaSorb test, holoTC was measured before and after loading with 3-times 9 μg of vitamin B12 employing both the in-house ELISA and the EIA kit (n=25). The EIA kit showed an intra-assay CV between 2.2% and 5.8% for holoTC values ranging from 21 to 80 pmol/L. Employing diluted serum samples resulted in spurious high values of holoTC. The EIA kit performed well in relation to the CobaSorb test and classified the patients studied as capable of absorbing vitamin B12 (n=10) or not (n=15), as did the in-house ELISA. The Active B12 (holoTC) EIA kit proved suitable for use with the CobaSorb test, but not for analysis of diluted serum samples.

  4. A validation study on the traditional Chinese version of Spinal Appearance Questionnaire for adolescent idiopathic scoliosis.

    PubMed

    Guo, Jing; Lau, Ajax Hong Yin; Chau, Jack; Ng, Bobby Kin Wah; Lee, Kwong Man; Qiu, Yong; Cheng, Jack Chun Yiu; Lam, Tsz Ping

    2016-10-01

    "Simplified Chinese" version of Spinal Appearance Questionnaire (SC-SAQ) for patients with adolescent idiopathic scoliosis (AIS) was available but did not fit for communities using "Traditional Chinese" as their primary language. We developed a traditional Chinese version of SAQ (TC-SAQ) and evaluated its reliability and validity. TC-SAQ was administered to 112 AIS patients, of which 101 bilingual (English and Chinese) patients completed E-SAQ and the traditional Chinese version of Scoliosis Research Society-22 questionnaire (TC-SRS-22). Internal consistency and test-retest reliability were evaluated. Concurrent validity was evaluated by comparing TC-SAQ score with E-SAQ score, and convergent validity by comparing TC-SAQ score with TC-SRS-22 self-image domain score, and discriminant validity by analyzing the relationship between TC-SAQ score and patients' characteristics. Internal consistency of individual TC-SAQ domain was high (Cronbach's α = 0.785 to 0.940), except for general (Cronbach's α = 0.665) and shoulders (Cronbach's α = 0.421) domain. Test-retest reliability of TC-SAQ was good (ICCs of each domain from 0.798 to 0.865). Concurrent validity demonstrated an excellent correlation between TC-SAQ and E-SAQ scores (r = 0.820 to 0.954, P < 0.0001 for all domains). Correlation between TC-SAQ domains and TC-SRS-22 self-image domain was weak to moderate. TC-SAQ total score and individual domain scores (except waist and chest domains) were positively correlated to major curve magnitude. TC-SAQ had good internal consistency and test-retest reliability. Concurrent validity evaluated against the original English version was excellent. TC-SAQ was both reliable and valid for clinical use for AIS patients using traditional Chinese as their primary language.

  5. 99 Tc NMR determination of the oxygen isotope content in 18 O-enriched water.

    PubMed

    Tarasov, Valerii P; Kirakosyan, Gayana А; German, Konstantin E

    2018-03-01

    99 Tc NMR has been suggested as an original method of evaluating the content of oxygen isotopes in oxygen-18-enriched water, a precursor for the production of radioisotope fluorine-18 used in positron emission tomography. To this end, solutions of NH 4 TcO 4 or NaTcO 4 (up to 0.28 mol/L) with natural abundance of oxygen isotopes in virgin or recycled 18 O-enriched water have been studied by 99 Tc NMR. The method is based on 16 O/ 17 O/ 18 O intrinsic isotope effects in the 99 Tc NMR chemical shifts, and the statistical distribution of oxygen isotopes in the coordination sphere of TcO 4 - and makes it possible to quantify the composition of enriched water by measuring the relative intensities of the 99 Tc NMR signals of the Tc 16 O 4-n 18 O n - isotopologues. Because the oxygen exchange between TcO 4 - and enriched water in neutral and alkaline solutions is characterized by slow kinetics, gaseous HCl was bubbled through a solution for a few seconds to achieve the equilibrium distribution of oxygen isotopes in the Tc coordination sphere without distortion of the oxygen composition of the water. Pertechnetate ion was selected as a probe due to its high stability in solutions and the significant 99 Tc NMR shift induced by a single 16 O→ 18 O substitution (-0.43 ± 0.01 ppm) in TcO 4 - and spin coupling constant 1 J( 99 Tc- 17 O) (131.46 Hz) favourable for the observation of individual signals of Tc 16 O 4-n 18 O n - isotopologues. Copyright © 2017 John Wiley & Sons, Ltd.

  6. Development of high Tc (greater than 100 K) Bi, Tl and Y-based materials as superconducting circuit elements

    NASA Technical Reports Server (NTRS)

    Haertling, Gene; Grabert, Gregory; Gilmour, Phillip

    1993-01-01

    Results on this project over the past three years have shown that the Bi and Tl-based superconducting materials in bulk form are noticeably different from the Y-based 123 material in that superconductivity is considerably harder to achieve, maintain and reproduce. This is due primarily to the difficulty in obtaining the higher Tc phase in pure form since it commonly co-exists with other undesirable, lower Tc phases. In particular, it has been found that long processing times for calcining and firing (20 - 200 hrs.) and close control of temperatures which are very near the melting point are required in order to obtain higher proportions of the desirable, high Tc (2223) phase.

  7. Dome-shaped magnetic order competing with high-temperature superconductivity at high pressures in FeSe.

    PubMed

    Sun, J P; Matsuura, K; Ye, G Z; Mizukami, Y; Shimozawa, M; Matsubayashi, K; Yamashita, M; Watashige, T; Kasahara, S; Matsuda, Y; Yan, J-Q; Sales, B C; Uwatoko, Y; Cheng, J-G; Shibauchi, T

    2016-07-19

    The coexistence and competition between superconductivity and electronic orders, such as spin or charge density waves, have been a central issue in high transition-temperature (Tc) superconductors. Unlike other iron-based superconductors, FeSe exhibits nematic ordering without magnetism whose relationship with its superconductivity remains unclear. Moreover, a pressure-induced fourfold increase of Tc has been reported, which poses a profound mystery. Here we report high-pressure magnetotransport measurements in FeSe up to ∼15 GPa, which uncover the dome shape of magnetic phase superseding the nematic order. Above ∼6 GPa the sudden enhancement of superconductivity (Tc≤38.3 K) accompanies a suppression of magnetic order, demonstrating their competing nature with very similar energy scales. Above the magnetic dome, we find anomalous transport properties suggesting a possible pseudogap formation, whereas linear-in-temperature resistivity is observed in the normal states of the high-Tc phase above 6 GPa. The obtained phase diagram highlights unique features of FeSe among iron-based superconductors, but bears some resemblance to that of high-Tc cuprates.

  8. Updating the Evidence on the Association between Serum Cholesterol and Risk of Late-Life Dementia: Review and Meta-Analysis.

    PubMed

    Anstey, Kaarin J; Ashby-Mitchell, Kimberly; Peters, Ruth

    2017-01-01

    Cohort studies have reported that midlife high total serum cholesterol (TC) is associated with increased risk of Alzheimer's disease (AD) in late-life but findings have been based on few studies and previous reviews have been limited by a lack of compatible data. We synthesized all high quality data from cohort studies reporting on the association between total serum cholesterol measured and late-life cognitive outcomes including Alzheimer's disease (AD), vascular dementia (VaD), any dementia, mild cognitive impairment (MCI), and cognitive decline. The literature was searched up to October 2016 using a registered protocol. Thirty-four articles meeting study criteria were identified. Seventeen studies published from 1996 to 2014, including 23,338 participants were included in meta-analyses. Relative risk of developing AD for adults with high TC in midlife was 2.14 (95% CI 1.33-3.44) compared with normal cholesterol. Individual studies that could not be pooled also reported high TC in midlife increased the risk of MCI and cognitive decline in late-life. High TC in late-life was not associated with MCI, AD, VaD, any dementia, or cognitive decline. Late-life measured HDL cholesterol and triglycerides were not associated with increased risk of VaD, and HDL was not associated with risk of MCI, AD, or any dementia. There were insufficient data to examine other cholesterol sub-fractions, sex differences, or APOE interactions. Significant gaps in the literature regarding TC and late-life dementia remain. Evidence suggests that high midlife TC increases risk of late-life AD, and may correlate with the onset of AD pathology.

  9. Development of a Trypanosoma cruzi strain typing assay using MS2 peptide spectral libraries (Tc-STAMS2)

    PubMed Central

    de Oliveira, Gilberto Santos; Kawahara, Rebeca; Rosa-Fernandes, Livia; Avila, Carla Cristi; Teixeira, Marta M. G.; Larsen, Martin R.

    2018-01-01

    Background Chagas disease also known as American trypanosomiasis is caused by the protozoan Trypanosoma cruzi. Over the last 30 years, Chagas disease has expanded from a neglected parasitic infection of the rural population to an urbanized chronic disease, becoming a potentially emergent global health problem. T. cruzi strains were assigned to seven genetic groups (TcI-TcVI and TcBat), named discrete typing units (DTUs), which represent a set of isolates that differ in virulence, pathogenicity and immunological features. Indeed, diverse clinical manifestations (from asymptomatic to highly severe disease) have been attempted to be related to T.cruzi genetic variability. Due to that, several DTU typing methods have been introduced. Each method has its own advantages and drawbacks such as high complexity and analysis time and all of them are based on genetic signatures. Recently, a novel method discriminated bacterial strains using a peptide identification-free, genome sequence-independent shotgun proteomics workflow. Here, we aimed to develop a Trypanosoma cruzi Strain Typing Assay using MS/MS peptide spectral libraries, named Tc-STAMS2. Methods/Principal findings The Tc-STAMS2 method uses shotgun proteomics combined with spectral library search to assign and discriminate T. cruzi strains independently on the genome knowledge. The method is based on the construction of a library of MS/MS peptide spectra built using genotyped T. cruzi reference strains. For identification, the MS/MS peptide spectra of unknown T. cruzi cells are identified using the spectral matching algorithm SpectraST. The Tc-STAMS2 method allowed correct identification of all DTUs with high confidence. The method was robust towards different sample preparations, length of chromatographic gradients and fragmentation techniques. Moreover, a pilot inter-laboratory study showed the applicability to different MS platforms. Conclusions and significance This is the first study that develops a MS-based platform for T. cruzi strain typing. Indeed, the Tc-STAMS2 method allows T. cruzi strain typing using MS/MS spectra as discriminatory features and allows the differentiation of TcI-TcVI DTUs. Similar to genomic-based strategies, the Tc-STAMS2 method allows identification of strains within DTUs. Its robustness towards different experimental and biological variables makes it a valuable complementary strategy to the current T. cruzi genotyping assays. Moreover, this method can be used to identify DTU-specific features correlated with the strain phenotype. PMID:29608573

  10. Development of a Trypanosoma cruzi strain typing assay using MS2 peptide spectral libraries (Tc-STAMS2).

    PubMed

    de Oliveira, Gilberto Santos; Kawahara, Rebeca; Rosa-Fernandes, Livia; Mule, Simon Ngao; Avila, Carla Cristi; Teixeira, Marta M G; Larsen, Martin R; Palmisano, Giuseppe

    2018-04-01

    Chagas disease also known as American trypanosomiasis is caused by the protozoan Trypanosoma cruzi. Over the last 30 years, Chagas disease has expanded from a neglected parasitic infection of the rural population to an urbanized chronic disease, becoming a potentially emergent global health problem. T. cruzi strains were assigned to seven genetic groups (TcI-TcVI and TcBat), named discrete typing units (DTUs), which represent a set of isolates that differ in virulence, pathogenicity and immunological features. Indeed, diverse clinical manifestations (from asymptomatic to highly severe disease) have been attempted to be related to T.cruzi genetic variability. Due to that, several DTU typing methods have been introduced. Each method has its own advantages and drawbacks such as high complexity and analysis time and all of them are based on genetic signatures. Recently, a novel method discriminated bacterial strains using a peptide identification-free, genome sequence-independent shotgun proteomics workflow. Here, we aimed to develop a Trypanosoma cruzi Strain Typing Assay using MS/MS peptide spectral libraries, named Tc-STAMS2. The Tc-STAMS2 method uses shotgun proteomics combined with spectral library search to assign and discriminate T. cruzi strains independently on the genome knowledge. The method is based on the construction of a library of MS/MS peptide spectra built using genotyped T. cruzi reference strains. For identification, the MS/MS peptide spectra of unknown T. cruzi cells are identified using the spectral matching algorithm SpectraST. The Tc-STAMS2 method allowed correct identification of all DTUs with high confidence. The method was robust towards different sample preparations, length of chromatographic gradients and fragmentation techniques. Moreover, a pilot inter-laboratory study showed the applicability to different MS platforms. This is the first study that develops a MS-based platform for T. cruzi strain typing. Indeed, the Tc-STAMS2 method allows T. cruzi strain typing using MS/MS spectra as discriminatory features and allows the differentiation of TcI-TcVI DTUs. Similar to genomic-based strategies, the Tc-STAMS2 method allows identification of strains within DTUs. Its robustness towards different experimental and biological variables makes it a valuable complementary strategy to the current T. cruzi genotyping assays. Moreover, this method can be used to identify DTU-specific features correlated with the strain phenotype.

  11. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    NASA Astrophysics Data System (ADS)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple bands (Science 336, 563 (2012)). Finally, the electron-electron interactions generating Cooper pairing are often conjectured to involve bosonic spin fluctuations generated by interband scattering of electrons. We explore the STM signatures of both the interband scattering and the electron-boson coupling self-energy in LiFeAs, and detect the signatures of the electron-boson coupling (M.P. Allan et al., in preparation). In collaboration with A.W. Rost, T.-M. Chuang, F. Massee, M.S. Golden, Y. Xie, M.H. Fisher, E.-A. Kim, K. Lee, Ni Ni, S.L. Bud'ko, P.C. Canfield, Q. Wang, D.S. Dessau, K. Kihou, C.H. Lee, A. Iyo, H. Eisaki, D.J. Scalapino, A.P. Mackenzie and J.C. Davis

  12. Nernst effect from fluctuating pairs in the pseudogap phase of the cuprates.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Levchenko, A.; Norman, M. R.; Varlamov, A. A.

    2011-01-31

    The observation of a large Nernst signal in cuprates above the superconducting transition temperature has attracted much attention. A potential explanation is that it originates from superconducting fluctuations. Although the Nernst signal is indeed consistent with Gaussian fluctuations for overdoped cuprates, Gaussian theory fails to describe the temperature dependence seen for underdoped cuprates. Here, we consider the vertex correction to Gaussian theory resulting from the pseudogap. This yields a Nernst signal in good agreement with the data.

  13. Getters for Tc and I Removal from Liquid Waste

    NASA Astrophysics Data System (ADS)

    Qafoku, N. P.; Asmussen, M.; Lawter, A.; Neeway, J.; Smith, G.

    2015-12-01

    A cementitious waste form, Cast Stone, is being evaluated as a possible supplemental waste form for the low activity waste (LAW) at the Hanford Site, which contains significant amounts of radioactive 99Tc and 129I, as part of the tank waste cleanup mission. To improve the retention of Tc and/or I in Cast Stone, materials with a high affinity for Tc and/or I, termed "getters," can be added to decrease the rate of contaminant release and diffusivity, and improve Cast Stone performance. A series of kinetic batch sorption experiments was performed to determine the effectiveness of the getter materials. Several Tc getters [blast furnace slag, Sn (II) apatite, SnCl2, nanoporous Sn phosphate, KMS-2 (a potassium-metal-sulfide), and Sn(II) hydroxyapatite] and I getters [layered Bi hydroxide, natural argentite mineral, synthetic argentite, Ag-impregnated carbon, and Ag-exchanged zeolite] were tested in different solution media, 18.2 MΩ DI H2O and a caustic LAW waste simulant containing 6.5 M Na or 7.8 M Na. The experiments were conducted at room temperature in the presence or absence of air. Results indicated that most Tc getters (with the exception of KMS-2) performed better in the DI H2O solution than in the 6.5 and 7.8 M Na LAW simulant. In addition, Tc sequestration may be affected by the presence of other redox sensitive elements that were present in the LAW simulant, such as Cr. The Tc getter materials have been examined through various solid-state characterization techniques such as XRD, SEM/EDS, XANES and EXAFS which provided evidence for plausible mechanisms of aqueous Tc removal. The results indicated that the Tc precipitates differ depending on the getter material and that Tc(VII) is reduced to Tc(IV) in most of the getters but to a differing extents. For the I getters, Ag-exchanged zeolite and synthetic argentite were the most effective ones. The other I getters showed limited effectiveness for sorbing I under the high ionic strength and caustic conditions of the LAW simulant.

  14. In-house cyclotron production of high-purity Tc-99m and Tc-99m radiopharmaceuticals.

    PubMed

    Martini, Petra; Boschi, Alessandra; Cicoria, Gianfranco; Zagni, Federico; Corazza, Andrea; Uccelli, Licia; Pasquali, Micòl; Pupillo, Gaia; Marengo, Mario; Loriggiola, Massimo; Skliarova, Hanna; Mou, Liliana; Cisternino, Sara; Carturan, Sara; Melendez-Alafort, Laura; Uzunov, Nikolay M; Bello, Michele; Alvarez, Carlos Rossi; Esposito, Juan; Duatti, Adriano

    2018-05-30

    In the last years, the technology for producing the important medical radionuclide technetium-99m by cyclotrons has become sufficiently mature to justify its introduction as an alternative source of the starting precursor [ 99m Tc][TcO 4 ] - ubiquitously employed for the production of 99m Tc-radiopharmaceuticals in hospitals. These technologies make use almost exclusively of the nuclear reaction 100 Mo(p,2n) 99m Tc that allows direct production of Tc-99m. In this study, it is conjectured that this alternative production route will not replace the current supply chain based on the distribution of 99 Mo/ 99m Tc generators, but could become a convenient emergency source of Tc-99m only for in-house hospitals equipped with a conventional, low-energy, medical cyclotron. On this ground, an outline of the essential steps that should be implemented for setting up a hospital radiopharmacy aimed at the occasional production of Tc-99m by a small cyclotron is discussed. These include (1) target production, (2) irradiation conditions, (3) separation/purification procedures, (4) terminal sterilization, (5) quality control, and (6) Mo-100 recovery. To address these issues, a comprehensive technology for cyclotron-production of Tc-99m, developed at the Legnaro National Laboratories of the Italian National Institute of Nuclear Physics (LNL-INFN), will be used as a reference example. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Selenium Level and Dyslipidemia in Rural Elderly Chinese

    PubMed Central

    Su, Liqin; Gao, Sujuan; Unverzagt, Frederick W.; Cheng, Yibin; Hake, Ann M.; Xin, Pengju; Chen, Chen; Liu, Jingyi; Ma, Feng; Bian, Jianchao; Li, Ping; Jin, Yinlong

    2015-01-01

    Objective Higher selenium level has been hypothesized to have the potential to reduce the risk of cardiovascular diseases including dyslipidemia. However, results from previous studies are inconsistent. This study aims to determine the association between selenium level and dyslipidemia in elderly Chinese with relatively low selenium status. Methods A cross-sectional study of 1859 participants aged 65 or older from four rural counties in China was conducted. Serum total cholesterol (TC), triglycerides (TG), high density lipoprotein-cholesterol (HDLC) and low-density lipoprotein-cholesterol (LDLC), nail selenium concentration and APOE genotype were measured in all subjects. The four types of dyslipidemia were defined as >5.17mmol/L for High-TC, >1.69 mmol/L for High-TG, >3.36 mmol/L for High-LDLC, and <1.04 mmol/L for Low-HDLC according to Chinese Guidelines on Prevention and Treatment of Dyslipidemia in Adults. Logistic models adjusting for age, gender, APOE genotype, body mass index, alcohol consumption, smoking, physical activity, medication use for cardiovascular diseases were used to examine the relationship between selenium levels and the risk of dyslipidemia. Results Mean nail selenium concentration was 0.465μg/gin this sample. Rates for High-TC, High-LDLC, High-TG, Low-HDLC were 18.13%, 13.23%, 12.21% and 32.76% respectively. Results from logistic models indicated that higher selenium levels were significantly associated with higher risk of High-TC, High-LDLC and lower risk of Low-HDLC adjusting for covariates (p < 0.0001). Compared with the lowest selenium quartile group, participants in selenium quartile groups 2, 3 and 4 had significantly higher rates of High-TC, High-LDLC, High-TG, and lower rate of Low-HDLC adjusting for covariates. No significant association was observed between selenium level and the risk of High-TG. APOEε4 carriers had higher rates of High-TC and High-LDLC. There was no interaction between selenium level and APOE with the rates of dyslipidemia. Conclusions Our results suggest long-term selenium exposure level may be associated with the risk of dyslipidemia in elderly population. Future studies are needed to examine the underlying mechanism of the association. PMID:26380972

  16. Toward organometallic (99m)Tc imaging agents: synthesis of water-stable (99)Tc-NHC complexes.

    PubMed

    Benz, Michael; Spingler, Bernhard; Alberto, Roger; Braband, Henrik

    2013-11-20

    (99)Tc(V)O2-NHC complexes containing monodentate and bidentate N-heterocyclic carbenes (NHCs) have been prepared by the reactions of [TcO(glyc)2](-) (glyc = ethyleneglycolato) with 1,3-dimethylimidazoline-2-ylidene (L1), 1,1'-methylene-3,3'-dimethyl-4,4'-diimidazoline-2,2'-diylidene (L2), and 1,1'-methylene-3,3'-diethyl-4,4'-diimidazoline-2,2'-diylidene (L3) in THF. The resulting complexes were fully characterized and their stabilities investigated. While complexes with monodentate NHCs only are hydrolytically unstable, complexes containing bidentate NHCs are water-stable over a broad pH range. The high water stability allows interconversion of the {(99)Tc(V)O2}(+) core into {(99)Tc(V)OCl}(2+) with HCl as the H(+) and Cl(-) source. An alternative procedure to obtain (99)Tc(V)O2-NHC complexes is the in situ deprotonation of imidazolium salts, enabling the preparation of (99)Tc(V)O2-NHC compounds without free NHCs, thus increasing the scope of NHC ligands drastically. The remarkable stability and pH-controllable reactivity of the new complexes underlines the potential of NHCs as stabilizing ligands for (99)Tc complexes and paves the way for the first (99m)Tc-NHC complexes in the future.

  17. Evaluation of Technetium Getters to Improve the Performance of Cast Stone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Neeway, James J.; Qafoku, Nikolla P.; Serne, R. Jeffrey

    2015-11-01

    Cast Stone has been selected as the preferred waste form for solidification of aqueous secondary liquid effluents from the Hanford Tank Waste Treatment and Immobilization Plant (WTP) process condensates and low-activity waste (LAW) melter off-gas caustic scrubber effluents. Cast Stone is also being evaluated as a supplemental immobilization technology to provide the necessary LAW treatment capacity to complete the Hanford tank waste cleanup mission in a timely and cost effective manner. One of the major radionuclides that Cast Stone has the potential to immobilize is technetium (Tc). The mechanism for immobilization is through the reduction of the highly mobile Tc(VII)more » species to the less mobile Tc(IV) species by the blast furnace slag (BFS) used in the Cast Stone formulation. Technetium immobilization through this method would be beneficial because Tc is one of the most difficult contaminants to address at the U.S. Department of Energy (DOE) Hanford Site due to its complex chemical behavior in tank waste, limited incorporation in mid- to high-temperature immobilization processes (vitrification, steam reformation, etc.), and high mobility in subsurface environments. In fact, the Tank Closure and Waste Management Environmental Impact Statement for the Hanford Site, Richland, Washington (TC&WM EIS) identifies technetium-99 ( 99Tc) as one of the radioactive tank waste components contributing the most to the environmental impact associated with the cleanup of the Hanford Site. The TC&WM EIS, along with an earlier supplemental waste-form risk assessment, used a diffusion-limited release model to estimate the release of different contaminants from the WTP process waste forms. In both of these predictive modeling exercises, where effective diffusivities based on grout performance data available at the time, groundwater at the 100-m down-gradient well exceeded the allowable maximum permissible concentrations for 99Tc. (900 pCi/L). Recent relatively short-term (63 day) leach tests conducted on both LAW and secondary waste Cast Stone monoliths indicated that 99Tc diffusivities were at or near diffusivities where the groundwater at the 100-m down-gradient well would exceed the allowable maximum permissible 99Tc concentrations. There is, therefore, a need and an opportunity to improve the retention of Tc in the Cast Stone waste form. One method to improve the performance of the Cast Stone waste form is through the addition of “getters” that selectively sequester Tc inside Cast Stone.« less

  18. Evaluating tetracycline degradation pathway and intermediate toxicity during the electrochemical oxidation over a Ti/Ti4O7 anode.

    PubMed

    Wang, Jianbing; Zhi, Dan; Zhou, Hao; He, Xuwen; Zhang, Dayi

    2018-06-15

    Tetracycline (TC) is one of the most widely used antibiotics with significant impacts on human health and thus it needs appropriate approaches for its removal. In the present study, we evaluated the performance and complete pathway of the TC electrochemical oxidation on a Ti/Ti 4 O 7 anode prepared by plasma spraying. Morphological data and composition analysis indicated a compact coating layer on the anode, which had the characteristic peaks of Ti 4 O 7 as active constituent. The TC electrochemical oxidation on the Ti/Ti 4 O 7 anode followed a pseudo-first-order kinetics, and the TC removal efficiency reached 95.8% in 40 min. The influential factors on TC decay kinetics included current density, anode-cathode distance and initial TC concentration. This anode also had high durability and the TC removal efficiency was maintained over 95% after five times reuse. For the first time, we unraveled the complete pathway of the TC electrochemical oxidation using high-performance liquid chromatograph (HPLC) and gas chromatograph (GC) coupled with mass spectrometer (MS). ·OH radicals produced from electrochemical oxidation attack the double bond, phenolic group and amine group of TC, forming a primary intermediate (m/z = 461), secondary intermediates (m/z = 432, 477 and 509) and tertiary intermediates (m/z = 480, 448 and 525). The latter were further oxidized to the key downstream intermediate (m/z = 496), followed by further downstream intermediates (m/z = 451, 412, 396, 367, 351, 298 and 253) and eventually short-chain carboxylic acids. We also evaluated the toxicity change during the electrochemical oxidation process with bioluminescent bacteria. The bioluminescence inhibition ratio peaked at 10 min (55.41%), likely owing to the high toxicity of intermediates with m/z = 461, 432 and 477 as obtained from quantitative structure activity relationship (QSAR) analysis. The bioluminescence inhibition ratio eventually decreased to 16.78% in 40 min due to further transformation of TC and intermediates. By comprehensively analyzing the influential factors and complete degradation pathway of TC electrochemical oxidation on the Ti/Ti 4 O 7 anode, our research provides deeper insights into the risk assessment of intermediates and their toxicity, assigning new perspectives for practical electrochemical oxidation to effectively eliminate the amount and toxicity of TC and other antibiotics in wastewater. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. The total cholesterol to high-density lipoprotein cholesterol as a predictor of poor outcomes in a Chinese population with acute ischaemic stroke.

    PubMed

    Chen, Lifang; Xu, Jianing; Sun, Hao; Wu, Hao; Zhang, Jinsong

    2017-11-01

    High admission cholesterol has been associated with better outcome after acute ischaemic stroke (AIS), but a paradox not completely illustrated. The purpose of this study was to investigate the effect of the total cholesterol to high-density lipoprotein cholesterol (TC/HDL-C) on short-term survival after AIS. Consecutive patients admitted in 2013 and 2015 were enrolled in the present study. The logistic regression analysis was conducted to evaluate predictors of 3-month outcomes. The primary endpoint was death. Secondary endpoint was good (modified Rankin Scale score 0-2 or equal to prestrike modified Rankin Scale score) at 3 months. Of 871 patients enrolled in the final analysis, 94 (10.8%) individuals died during 3 months of observation. The serum TC and TC/HDL-C levels at admission were significantly associated with stroke outcomes at 3 months, and the HDL-C level was only correlated with the good outcomes at 3 months. Mortality risk was markedly decreased for patients with high TC/HDL-C ratio (odds ratio: 0.23, 95% confidence interval [CI]: 0.10-0.50 for Q4:Q1; P-trend <.001) after adjustment. The effect of TC/HDL-C ratio on the probability of good outcomes was still obvious (odds ratio: 2.18, 95% CI: 1.40-3.39 for Q4:Q1; P-trend=.029). According to the receiver operating characteristic analyses, the best discriminating factor was a TG/HDL-C ≥3.37 (area under the ROC curve [AUC]=0.643, sensitivity 61.3%, specificity 61.7%) as well as the TC/HDL-C ≥4.09 for good outcomes (AUC: 0.587, sensitivity 63.9%, specificity 79.7%). High TC/HDL-C ratio may be associated with increased short-term survival and better outcomes after AIS. © 2017 Wiley Periodicals, Inc.

  20. 99mTc-labelled HYNIC-minigastrin with reduced kidney uptake for targeting of CCK-2 receptor-positive tumours.

    PubMed

    von Guggenberg, E; Dietrich, H; Skvortsova, I; Gabriel, M; Virgolini, I J; Decristoforo, C

    2007-08-01

    Different attempts have been made to develop a suitable radioligand for targeting CCK-2 receptors in vivo, for staging of medullary thyroid carcinoma (MTC) and other receptor-expressing tumours. After initial successful clinical studies with [DTPA(0),D: Glu(1)]minigastrin (DTPA-MG0) radiolabelled with (111)In and (90)Y, our group developed a (99m)Tc-labelled radioligand, based on HYNIC-MG0. A major drawback observed with these derivatives is their high uptake by the kidneys. In this study we describe the preclinical evaluation of the optimised shortened peptide analogue, [HYNIC(0),D: Glu(1),desGlu(2-6)]minigastrin (HYNIC-MG11). (99m)Tc labelling of HYNIC-MG11 was performed using tricine and EDDA as coligands. Stability experiments were carried out by reversed phase HPLC analysis in PBS, PBS/cysteine and plasma as well as rat liver and kidney homogenates. Receptor binding and cell uptake experiments were performed using AR4-2J rat pancreatic tumour cells. Animal biodistribution was studied in AR4-2J tumour-bearing nude mice. Radiolabelling was performed at high specific activities and radiochemical purity was >90%. (99m)Tc-EDDA-HYNIC-MG11 showed high affinity for the CCK-2 receptor and cell internalisation comparable to that of (99m)Tc-EDDA-HYNIC-MG0. Despite high stability in solution, a low metabolic stability in rat tissue homogenates was found. In a nude mouse tumour model, very low unspecific retention in most organs, rapid renal excretion with reduced renal retention and high tumour uptake were observed. (99m)Tc-EDDA-HYNIC-MG11 shows advantages over (99m)Tc-EDDA-HYNIC-MG0 in terms of lower kidney retention with unchanged uptake in tumours and CCK-2 receptor-positive tissue. However, the lower metabolic stability and impurities formed in the labelling process still leave room for further improvement.

  1. Phenomenological view at the two-component physics of cuprates

    NASA Astrophysics Data System (ADS)

    Teitel'baum, G. B.

    2017-08-01

    In the search for mechanisms of high- T c superconductivity it is critical to know the electronic spectrum in the pseudogap phase from which superconductivity evolves. The lack of ARPES data for every cuprate family precludes an agreement as to its structure, doping and temperature dependence and the role of charge ordering. No approach has been developed yet to address the issue theoretically, and we limit ourselves by the phenomenological analysis of the experimental data. We argue that, in the Fermi-liquid-like regime ubiquitous in underdoped cuprates, the spectrum consists of holes on the Fermi arcs and an electronic pocket in contrast to the idea of the Fermi surface reconstruction via charge ordering. At high temperatures, the electrons are dragged by holes while at lower temperatures they get decoupled. The longstanding issue of the origin of the negative Hall coefficient in YBCO and Hg1201 at low temperature is resolved: the electronic contribution prevails, as its mobility becomes temperature independent, while the mobility of holes, scattered by the shortwavelength charge density waves, decreases.

  2. pH-Sensitive, Long-Circulating Liposomes as an Alternative Tool to Deliver Doxorubicin into Tumors: a Feasibility Animal Study.

    PubMed

    Silva, Juliana O; Fernandes, Renata S; Lopes, Sávia C A; Cardoso, Valbert N; Leite, Elaine A; Cassali, Geovanni D; Marzola, Maria Cristina; Rubello, Domenico; Oliveira, Monica C; de Barros, Andre Luis Branco

    2016-12-01

    Therapeutic agents used in chemotherapy have low specificity leading to undesired severe side effects. Hence, the development of drug delivery systems that improve drug specificity, such as liposome moieties, is an alternative to overcome chemotherapy limitations and increase antitumor efficacy. In this study, the biodistribution profile evaluation of pH-sensitive long-circulating liposomes (SpHL) containing [ 99m Tc]DOX in 4T1 tumor-bearing BALB/c mice is described. [ 99m Tc]DOX was radiolabeled by direct method. Liposomes were prepared and characterized. [ 99m Tc]DOX was encapsulated into liposomes by freezing and thawing. Circulation time for SpHL-[ 99m Tc]DOX was determined by measuring the blood activity from healthy animals. Biodistribution studies were carried out in tumor-bearing mice at 1, 4, and 24 h after injection. Blood levels of the SpHL-[ 99m Tc]DOX declined in a biphasic manner, with an α half-life of 14.1 min and β half-life of 129.0 min. High uptake was achieved in the liver and spleen, due to the macrophages captured. Moreover, tumor uptake was higher than control tissue, resulting in high tumor-to-muscle ratios, indicating higher specificity for the tumor area. [ 99m Tc]DOX was successfully encapsulated in liposomes. Biodistribution indicated high tumor-to-muscle ratios in breast tumor-bearing BALB/c mice. In summary, these results showed the higher accumulation of SpHL-[ 99m Tc]DOX in the tumor area, suggesting selective delivery of doxorubicin into tumor.

  3. Preparation and first biological evaluation of novel Re-188/Tc-99m peptide conjugates with substance-P.

    PubMed

    Smilkov, Katarina; Janevik, Emilija; Guerrini, Remo; Pasquali, Micol; Boschi, Alessandra; Uccelli, Licia; Di Domenico, Giovanni; Duatti, Adriano

    2014-09-01

    New (188)Re and (99m)Tc peptide conjugates with substance- P (SP) were prepared and biologically evaluated. The radiopharmaceuticals have been labelled with the [M≡N](2+) (M=(99m)Tc, (188)Re) core using a combination of π-donor tridentate and π-acceptor monodentate ancillary ligands. The new radiopharmaceuticals have been prepared through a two-step reaction by simultaneous addition of the tridentate and monodentate ligands to a vial containing a preformed [M≡N](2+) core. The tridentate ligand was formed by linking two cysteine residues to the terminal arginine of the undecapeptide SP, whereas the monodentate ligand was a tertiary phosphine. The preparation of the corresponding Re-188 derivative required developing a more complex chemical procedure to obtain the [Re≡N](2+) core in satisfactory yields. Characterization of the resulting products was obtained by chromatographic methods. Biological evaluation was performed for both Tc-99m and Re-188 derivatives by in-vitro studies on isolated cells expressing NK1-receptors. In-vivo imaging in mice was carried out using a small-animal YAP(S)PET tomograph. New Tc-99m and Re-188 peptide radiopharmaceuticals with SP have been prepared in high-yield and with high-specific activity. Both Tc-99m and Re-188 peptide radioconjugates exhibit high affinity for NK1 receptors, thus giving further evidence to the empirical rule that structurally related Tc-99m and Re-188 radiopharmaceuticals exhibit identical biological properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Tissue expression pattern of ABCG transporter indicates functional roles in reproduction of Toxocara canis.

    PubMed

    Luo, Yong-Li; Ma, Guang-Xu; Luo, Yong-Fang; Kuang, Ce-Yan; Jiang, Ai-Yun; Li, Guo-Qing; Zhou, Rong-Qiong

    2018-03-01

    Toxocara canis is a zoonotic parasite with worldwide distribution. ATP-binding cassette (ABC) transporters are integral membrane proteins which involve in a range of biological processes in various organisms. In present study, the full-length coding sequence of abcg-5 gene of T. canis (Tc-abcg-5) was cloned and characterized. A 633 aa polypeptide containing two conserved Walker A and Walker B motifs was predicted from a continuous 1902 nt open reading frame. Quantitative real-time PCR was employed to determine the transcriptional levels of Tc-abcg-5 gene in adult male and female worms, which indicated high mRNA level of Tc-abcg-5 in the reproductive tract of adult female T. canis. Tc-abcg-5 was expressed to produce rabbit polyclonal antiserum against recombinant TcABCG5. Indirect-fluorescence immunohistochemical assays were carried out to detect the tissue distribution of TcABCG5, which showed predominant distribution of TcABCG5 in the uterus (especially in the germ cells) of adult female T. canis. Tissue transcription and expression pattern of Tc-abcg-5 indicated that Tc-abcg-5 might play essential roles in the reproduction of this parasitic nematode.

  5. Analysis of accumulation of 99mTc-octreotide and 99mTc-EDDA/HYNIC-Tyr3-octreotide in the rat kidneys.

    PubMed

    Kopecky, Martin; Semecky, Vladimir; Trejtnar, Frantisek; Laznicek, Milan; Laznickova, Alice; Nachtigal, Petr; Decristoforo, Clemens; Mather, Stephen J; Mäcke, Helmut R

    2004-02-01

    The aim of this study was to compare renal handling and distribution of (99m)Tc-octreotide and (99m)Tc-EDDA/HYNIC-Tyr(3)-octreotide (HYNIC-TOC) in rats. In kidney perfusion experiments, the renal clearance value of (99m)Tc-octreotide was three times lower than that of (99m)Tc-EDDA/HYNIC-TOC. The predominant renal excretion of (99m)Tc-EDDA/HYNIC-TOC was associated with a high and long-term renal accumulation up to 48 hrs. Microautoradiographic results indicated that (99m)Tc-EDDA/HYNIC-TOC was retained mainly in the renal medulla within the cells of the collecting ducts and in the surrounding tissue. Lower positivity was found in the proximal and distal tubular cells. We conclude that the mechanism of renal accumulation of somatostatin analogues renal accumulation is complex and that proximal tubular reabsorption is probably not the main mechanism for uptake of (99m)Tc-EDDA/HYNIC-TOC in the kidneys. The presence of the somatostatin receptors, differences in the tonicity level within kidneys and other possible mechanisms could participate in their renal accumulation.

  6. Pleural mesothelial cells promote expansion of IL-17-producing CD8+ T cells in tuberculous pleural effusion.

    PubMed

    Li, X; Zhou, Q; Yang, W B; Xiong, X Z; Du, R H; Zhang, J C

    2013-05-01

    IL-17-producing CD8(+) T lymphocytes (Tc17 cells) have recently been detected in many cancers and autoimmune diseases. However, the possible implication of Tc17 cells in tuberculous pleural effusion remains unclarified. In this study, distribution and phenotypic features of Tc17 cells in both tuberculous pleural effusion (TPE) and peripheral blood from patients with tuberculosis were determined. The effects of proinflammatory cytokines and local accessory cells (pleural mesothelial cells) on Tc17 cell expansion were also explored. We found that TPE contained more Tc17 cells than the blood. Compared with IFN-γ-producing CD8(+) T cells, Tc17 cells displayed higher expression of chemokine receptors (CCRs) and lower expression of cytotoxic molecules. In particularly, Tc17 cells in TPE exhibited high expression levels of CCR6, which could migrate in response to CCL20. Furthermore, IL-1β, IL-6, IL-23, or their various combinations could promote Tc17 cell expansion from CD8(+) T cells, whereas the proliferative response of Tc17 cells to above cytokines was lower than that of Th17 cells. Pleural mesothelial cells (PMCs) were able to stimulate Tc17 cell expansion via cell contact in an IL-1β/IL-6/IL-23 independent fashion. Thus this study demonstrates that Tc17 cells marks a subset of non-cytotoxic, CCR6(+) CD8(+) T lymphocytes with low proliferative capacity. The overrepresentation of Tc17 cells in TPE may be due to Tc17 cell expansion stimulated by pleural proinflammatory cytokines and to recruitment of Tc17 cells from peripheral blood. Additionally, PMCs may promote the production of IL-17 by CD8(+) T cells at sites of TPE via cell-cell interactions.

  7. Development and evaluation of superconducting circuit elements

    NASA Technical Reports Server (NTRS)

    Haertling, Gene H.; Lee, Burtrand; Hsi, Dennis; Modi, Vibhakar; Marone, Matt

    1990-01-01

    An approach to the application of high Tc ceramic superconductors to practical circuit elements was developed and demonstrated. This method, known as the rigid-conductor process (RCP), involves the combination of a pre-formed, sintered, and tested superconductor material with an appropriate, rigid substrate via an epoxy adhesive which also serves to encapsulate the element from the ambient environment. Emphasis was on the practical means to achieve functional, reliable, and reproducible components. Although all of the work described in this report involved a YBa2Cu3Osub(7-x) high Tc superconductor material, the techniques developed and conclusions reached are equally applicable to other high Tc materials.

  8. Tumor bombesin analog loaded long-circulating and pH-sensitive liposomes as tool for tumor identification.

    PubMed

    de Barros, André Luís Branco; Mota, Luciene das Graças; Soares, Daniel Crístian Ferreira; Coelho, Marina Melo Antunes; Oliveira, Mônica Cristina; Cardoso, Valbert Nascimento

    2011-12-15

    Long-circulating and pH-sensitive liposomes trapping (99m)Tc-HYNIC-βAla-bombesin((7-14)) (aSpHL-(99m)Tc-BBN((7-14))) were successfully prepared. Biodistribution studies and scintigraphic images were performed in Ehrlich tumor-bearing Swiss mice. This system showed high accumulation in tumor tissue with high tumor-to-muscle ratio. Therefore, aSpHL-(99m)Tc-BBN((7-14)) could be considered as a potential agent for tumor diagnosis. Published by Elsevier Ltd.

  9. Literature review of the potential impact of glycolic acid on the technetium chemistry of srs tank waste

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nash, Charles A.; McCabe, Daniel J.

    This document presents a literature study of the impact of glycolate on technetium chemistry in the Savannah River Site (SRS) waste system and specifically Saltstone. A predominant portion of the Tc at SRS will be sent to the Saltstone Facility where it will be immobilized. The Tc in the tank waste is in the highly soluble chemical form of pertechnetate ion (TcO 4 -) which is reduced by blast furnace slag (BFS) in Saltstone, rendering it highly insoluble and resistant to leaching.

  10. Development of kit formulations for (99m) TcN-MPO: a cationic radiotracer for myocardial perfusion imaging.

    PubMed

    Zheng, Yumin; Ji, Shundong; Tomaselli, Elena; Liu, Shuang

    2014-07-01

    The objective of this study was to develop a kit formulation for [(99m) TcN(mpo)(PNP5)](+) (MPO = 2-mercaptopyridine oxide), ((99m) TcN-MPO) to support its clinical evaluations as a SPECT radiotracer. Radiolabeling studies were performed using three different formulations (two-vial formulation and single-vial formulations with/without SnCl2 ) to explore the factors influencing radiochemical purity (RCP) of (99m) TcN-MPO. We found that the most important factor affecting the RCP of (99m) TcN-MPO was the purity of PNP5. (99m) TcN-MPO was prepared >98% RCP (n = 20) using the two-vial formulation. For single-vial formulations with/without SnCl2 , β-cyclodextrin (β-CD) is particularly useful as a stabilizer for PNP5. The RCP of (99m) TcN-MPO was 95-98% using β-CD, but its RCP was only 90-93% with γ-cyclodextrin (γ-CD). It seems that PNP5 fits better into the inner cavity of β-CD, which forms more stable inclusion complex than γ-CD in the single-vial formulations. The results from biodistribution and imaging studies in Sprague-Dawley rats clearly demonstrated biological equivalence of three different formulations. Single photon-emission computed tomography data suggested that high quality images could be obtained at 0-30-min post-injection without significant interference from the liver radioactivity. Considering the ease for (99m) Tc-labeling and high RCP of (99m) TcN-MPO, the non-SnCl2 single-vial formulation is an attractive choice for future clinical studies. Copyright © 2014 John Wiley & Sons, Ltd.

  11. Development of (99m)Tc-labeled asymmetric urea derivatives that target prostate-specific membrane antigen for single-photon emission computed tomography imaging.

    PubMed

    Kimura, Hiroyuki; Sampei, Sotaro; Matsuoka, Daiko; Harada, Naoya; Watanabe, Hiroyuki; Arimitsu, Kenji; Ono, Masahiro; Saji, Hideo

    2016-05-15

    Prostate-specific membrane antigen (PSMA) is expressed strongly in prostate cancers and is, therefore, an attractive diagnostic and radioimmunotherapeutic target. In contrast to previous reports of PMSA-targeting (99m)Tc-tricarbonyl complexes that are cationic or lack a charge, no anionic (99m)Tc-tricarbonyl complexes have been reported. Notably, the hydrophilicity conferred by both cationic and anionic charges leads to rapid hepatobiliary clearance, whereas an anionic charge might better enhance renal clearance relative to a cationic charge. Therefore, an improvement in rapid clearance would be expected with either cationic or anionic charges, particularly anionic charges. In this study, we designed and synthesized a novel anionic (99m)Tc-tricarbonyl complex ([(99m)Tc]TMCE) and evaluated its use as a single-photon emission computed tomography (SPECT) imaging probe for PSMA detection. Direct synthesis of [(99m)Tc]TMCE from dimethyl iminodiacetate, which contains both the asymmetric urea and succinimidyl moiety important for PSMA binding, was performed using our microwave-assisted one-pot procedure. The chelate formation was successfully achieved even though the precursor included a complicated bioactive moiety. The radiochemical yield of [(99m)Tc]TMCE was 12-17%, with a radiochemical purity greater than 98% after HPLC purification. [(99m)Tc]TMCE showed high affinity in vitro, with high accumulation in LNCaP tumors and low hepatic retention in biodistribution and SPECT/CT studies. These findings warrant further evaluation of [(99m)Tc]TMCE as an imaging agent and support the benefit of this strategy for the design of other PSMA imaging probes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rebec, S. N.; Jia, T.; Zhang, C.

    To elucidate the mechanisms behind the enhanced Tc in monolayer (1 ML) FeSe on SrTiO 3 (STO), we grew highly strained 1 ML FeSe on the rectangular (100) face of rutile TiO 2, and observed the coexistence of replica bands and superconductivity with a Tc of 63 K. From the similar Tc between this system and 1ML FeSe on STO (001), we conclude that strain and dielectric constant are likely unimportant to the enhanced Tc in these systems. Here, a systematic comparison of 1 ML FeSe on TiO 2 with other systems in the FeSe family shows that while chargemore » transfer alone can enhance Tc, it is only with the addition of interfacial electron-phonon coupling that Tc can be increased to the level seen in 1 ML FeSe on STO.« less

  13. Short-Run Prosocial Behavior in Response to Receiving Corrections and Affirmations in Three Therapeutic Communities

    ERIC Educational Resources Information Center

    Warren, Keith L.; Doogan, Nathan; De Leon, George; Phillips, Gary S.; Moody, James; Hodge, Ashleigh

    2013-01-01

    Therapeutic communities (TCs) have a strong record of maintaining high quality social climates in prison units. One possible reason for this is the system of mutual monitoring among TC residents, based on the assumption that peer affirmation of behavior in accord with TC norms, and peer correction of behavior contrary to TC norms, will lead to…

  14. Polymer Deposition from a Quasi-Vapor Phase as a New Route to Access a Wide Temperature Range for Crystallization

    NASA Astrophysics Data System (ADS)

    Jeong, Hyuncheol; Arnold, Craig; Priestley, Rodney

    Polymer crystallization is strongly governed by kinetics where crystallization temperature (Tc) plays an important role in determining materials properties. Due to the high entropic barrier required for reorganization, the long-chain molecules typically form folded-chain crystals, whose thickness and thermal stability decrease as Tc is lowered. Interesting questions remain regarding crystallization in the deeply supercooled regime. This is partially due to the difficulty in accessing the low Tc range without nucleation. For a strong crystal-former like polyethylene (PE), cooling from a melt or solution always confronts the onset of nucleation at a high Tc followed by rapid crystal growth. Here, we introduce an alternative approach to grow polymer crystals via Matrix Assisted Pulsed Laser Evaporation (MAPLE). This methodology achieves the crystallization of polymers from a quasi-vapor phase at a controlled temperature, allowing for the study of the empirical relationship between Tc and crystal structure over a wide range of Tc. With PE as a model polymer, we investigated the morphological and thermal properties of crystals grown over a wide temperature range down to 120 °C below bulk crystallization point.

  15. Epitaxial effects in thin films of high-Tc cuprates with the K2NiF4 structure

    NASA Astrophysics Data System (ADS)

    Naito, Michio; Sato, Hisashi; Tsukada, Akio; Yamamoto, Hideki

    2018-03-01

    La2-xSrxCuO4 (LSCO) and La2-xBaxCuO4 (LBCO) have been recognized as the archetype materials of "hole-doped" high-Tc superconductors. Their crystal structures are relatively simple with a small number of constituent cation elements. In addition, the doping level can be varied by the chemical substitution over a wide range enough to obtain the full spectrum of doping-dependent electronic and magnetic properties. These attractive features have dedicated many researchers to thin-film growth of LSCO and LBCO. The critical temperature (Tc) of LSCO and LBCO is sensitive to strain as manifested by a positive pressure coefficient of Tc in bulk samples. In general, films are strained if they are grown on lattice-mismatched substrates (epitaxial strain). Early attempts (before 1997) at the growth of LSCO and LBCO films resulted in depressed Tc below 30 K as they were grown on a commonly used SrTiO3 substrate (in-plane lattice parameter asub = 3.905 Å): the in-plane lattice parameters of LSCO and LBCO are ≤3.80 Å, and hence tensile epitaxial strain is introduced. The situation was changed by the use of LaSrAlO4 substrates with a slightly shorter in-plane lattice constant (asub = 3.756 Å). On LaSrAlO4 substrates, the Tc reaches 45 K in La1.85Sr0.15CuO4, 47 K in La1.85Ba0.15CuO4, and 56 K in ozone-oxidized La2CuO4+δ films, substantially higher than the Tc's of the bulk compounds. The Tc increase in La1.85Sr0.15CuO4 films on LaSrAlO4 and decrease on SrTiO3 are semi-quantitatively in accord with the phenomenological estimations based on the anisotropic strain coefficients of Tc (dTc/dεi). In this review article, we describe the growth and properties of films of cuprates having the K2NiF4 structure, mainly focusing on the increase/decrease of Tc by epitaxial strain and quasi-stable phase formation by epitaxial stabilization. We further extract the structural and/or physical parameters controlling Tc toward microscopic understanding of the variation of Tc by epitaxial strain.

  16. Evaluation of media for simultaneous enumeration of total coliform and Escherichia coli in drinking water supplies by membrane filtration techniques.

    PubMed

    Wang, Dunling; Fiessel, Wanda

    2008-01-01

    This study evaluated three different dehydrated media for simultaneous detection and enumeration of total coliform (TC) and Escherichia coli in drinking water samples with a standard membrane filtration procedure. The experiment indicated that the differential coliform agar (DCA) medium was the most effective among the tested media in enumerating TC and E. coli, without the need for extensive accompanying confirmation tests. The results for DCA medium were highly reproducible for both TC and E. coli with standard deviation of 6.0 and 6.1, respectively. A high agreement (82%) was found between DCA and m-Endo media on 152 drinking water samples in terms of TC positive. The DCA medium also reduced concealment of background bacteria.

  17. The function of Sn(II)-apatite as a Tc immobilizing agent

    NASA Astrophysics Data System (ADS)

    Asmussen, R. Matthew; Neeway, James J.; Lawter, Amanda R.; Levitskaia, Tatiana G.; Lukens, Wayne W.; Qafoku, Nikolla P.

    2016-11-01

    At the U.S. Department of Energy Hanford Site, Tc-99 is a component of low-activity waste (LAW) fractions of the nuclear tank waste and removal of Tc from LAW streams would greatly benefit the site remediation process. In this study, we investigated the removal of Tc(VII), as pertechnetate, from deionized water (DIW) and a LAW simulant through batch sorption testing and solid phase characterization using tin (II) apatite (Sn-A) and SnCl2. Sn-A showed higher levels of Tc removal from both DIW and LAW simulant. Scanning electron microscopy/energy dispersive X-ray spectroscopy (SEM/XEDS) and X-ray absorption spectroscopy (XAS) of reacted Sn-A in DIW showed that TcO4- is reduced to Tc(IV) on the Sn-A surface. The performance of Sn-A in the LAW simulant was lowered due to a combined effect of the high alkalinity, which lead to an increased dissolution of Sn from the Sn-A, and a preference for the reduction of Cr(VI).

  18. Comparison of the pressure dependences of Tc in the trivalent d -electron superconductors Sc, Y, La, and Lu up to megabar pressures

    NASA Astrophysics Data System (ADS)

    Debessai, M.; Hamlin, J. J.; Schilling, J. S.

    2008-08-01

    Whereas double hcp (dhcp) La superconducts at ambient pressure with Tc≃5K , the other trivalent d -electron metals Sc, Y, and Lu only superconduct if high pressures are applied. Earlier measurements of the pressure dependence of Tc for Sc and Lu metal are here extended to much higher pressures. Whereas Tc for Lu increases monotonically with pressure to 12.4 K at 174 GPa (1.74 Mbar), Tc for Sc reaches 19.6 K at 107 GPa, the second highest value observed for any elemental superconductor. At higher pressures a phase transition occurs whereupon Tc drops to 8.31 K at 111 GPa. The Tc(P) dependences for Sc and Lu are compared with those of Y and La. An interesting correlation is pointed out between the value of Tc and the fractional free volume available to the conduction electrons outside the ion cores, a quantity which is directly related to the number of d electrons in the conduction band.

  19. Phenology and spatial distribution of native and exotic Tetropium longhorned beetles (Coleoptera: Cerambycidae).

    PubMed

    Rhainds, Marc; Heard, Stephen B; Sweeney, Jon D; Silk, Peter; Flaherty, Leah

    2010-12-01

    The co-existence of two closely related Tetropium species in eastern Canada, invasive T. fuscum and native T. cinnamopterum (TF and TC, respectively), provides a model system to investigate seasonal and spatial demographic parameters of biological invasions at the interspecific level. In this study, we take advantage of the similar semiochemical communication of TF and TC to evaluate the abundance of adults of the two species concurrently using grids of traps baited with pheromone and host volatiles in stands of spruce. Adult TF emerged on average 2 wk before TC both in the field and under controlled laboratory conditions. This observation, combined with the early reproduction of emergent females, implies that the smaller (younger) larvae of native TC may be at increased risk of intra-guild predation by TF. The high spatial association between male and female TF in dense, aggregated populations suggests that the rate of mate encounter is depressed in sparse populations toward the edge of the invasive range. The higher level of spatial aggregation for TF than TC, particularly at high population density, suggests a higher propensity of adult TF to congregate at "landmarks." Considering the broader range of host conditions, earlier seasonal emergence, and presumably more effective mate encounter for TF than TC, the exotic TF may be a superior competitor with the potential to displace or reduce the abundance of TC. © 2010 Entomological Society of America

  20. A High Affinity Red Fluorescence and Colorimetric Probe for Amyloid β Aggregates

    NASA Astrophysics Data System (ADS)

    Rajasekhar, K.; Narayanaswamy, Nagarjun; Murugan, N. Arul; Kuang, Guanglin; Ågren, Hans; Govindaraju, T.

    2016-04-01

    A major challenge in the Alzheimer’s disease (AD) is its timely diagnosis. Amyloid β (Aβ) aggregates have been proposed as the most viable biomarker for the diagnosis of AD. Here, we demonstrate hemicyanine-based benzothiazole-coumarin (TC) as a potential probe for the detection of highly toxic Aβ42 aggregates through switch-on, enhanced (~30 fold) red fluorescence (Emax = 654 nm) and characteristic colorimetric (light red to purple) optical outputs. Interestingly, TC exhibits selectivity towards Aβ42 fibrils compared to other abnormal protein aggregates. TC probe show nanomolar binding affinity (Ka = 1.72 × 107 M-1) towards Aβ42 aggregates and also displace ThT bound to Aβ42 fibrils due to its high binding affinity. The Aβ42 fibril-specific red-shift in the absorption spectra of TC responsible for the observed colorimetric optical output has been attributed to micro-environment change around the probe from hydrophilic-like to hydrophobic-like nature. The binding site, binding energy and changes in optical properties observed for TC upon interaction with Aβ42 fibrils have been further validated by molecular docking and time dependent density functional theory studies.

  1. (99m)Tc-EDDA/HYNIC-octreotate - a new radiotracer for detection and staging of NET: a case of metastatic duodenal carcinoid.

    PubMed

    Hubalewska-Dydejczyk, Alicja; Szybiński, Piotr; Fröss-Baron, Katarzyna; Mikolajczak, Renata; Huszno, Bohdan; Sowa-Staszczak, Anna

    2005-01-01

    Somatostatin receptor scintigraphy (SRS) has become a routine imaging method for the diagnostics of neuroendocrine tumours (NET). (99m)Tc-EDDA/HYNIC-octreotate (Polatom, Poland) is a new radiotracer with high affinity for SSTR2 and similar physiological biodistribution to (111)In-Octreoscan. We present a case of a 47-year-old man with disseminated duodenal carcinoid. The patient had been operated due to the tumour mass detected in pancreatic head area. Histopathology revealed carcinoid of the duodenal wall with local lymph node and liver metastases. The patient was qualified for chemotherapy stopped due to severe leucopenia. (99m)Tc EDDA/HYNIC-octreotate scintigraphy was performed for staging and to determine SSTR status of the tumour before planned 90Y-DOTATATE therapy. The multiple metastatic lesions were detected all over the body. The high quality images with high target/non target ratio were obtained. (99m)Tc-MDP scintigraphy confirmed multiple bone metastases. On the basis of SRS result the patient was qualified for 90Y-DOTA-TATE therapy. In conclusion, (99m)Tc EDDA/HYNIC-octreotate can be regarded as a promising tracer for staging and to determine SSTR status of NET.

  2. Immune Protection against Trypanosoma cruzi Induced by TcVac4 in a Canine Model

    PubMed Central

    Aparicio-Burgos, José E.; Zepeda-Escobar, José A.; de Oca-Jimenez, Roberto Montes; Estrada-Franco, José G.; Barbabosa-Pliego, Alberto; Ochoa-García, Laucel; Alejandre-Aguilar, Ricardo; Rivas, Nancy; Peñuelas-Rivas, Giovanna; Val-Arreola, Margarita; Gupta, Shivali; Salazar-García, Felix; Garg, Nisha J.; Vázquez-Chagoyán, Juan C.

    2015-01-01

    Chagas disease, caused by Trypanosoma cruzi, is endemic in southern parts of the American continent. Herein, we have tested the protective efficacy of a DNA-prime/T. rangeli-boost (TcVac4) vaccine in a dog (Canis familiaris) model. Dogs were immunized with two-doses of DNA vaccine (pcDNA3.1 encoding TcG1, TcG2, and TcG4 antigens plus IL-12- and GM-CSF-encoding plasmids) followed by two doses of glutaraldehyde-inactivated T. rangeli epimastigotes (TrIE); and challenged with highly pathogenic T. cruzi (SylvioX10/4) isolate. Dogs given TrIE or empty pcDNA3.1 were used as controls. We monitored post-vaccination and post-challenge infection antibody response by an ELISA, parasitemia by blood analysis and xenodiagnosis, and heart function by electrocardiography. Post-mortem anatomic and pathologic evaluation of the heart was conducted. TcVac4 induced a strong IgG response (IgG2>IgG1) that was significantly expanded post-infection, and moved to a nearly balanced IgG2/IgG1 response in chronic phase. In comparison, dogs given TrIE or empty plasmid DNA only developed high IgG titers with IgG2 predominance in response to T. cruzi infection. Blood parasitemia, tissue parasite foci, parasite transmission to triatomines, electrocardiographic abnormalities were significantly lower in TcVac4-vaccinated dogs than was observed in dogs given TrIE or empty plasmid DNA only. Macroscopic and microscopic alterations, the hallmarks of chronic Chagas disease, were significantly decreased in the myocardium of TcVac4-vaccinated dogs. We conclude that TcVac4 induced immunity was beneficial in providing resistance to T. cruzi infection, evidenced by control of chronic pathology of the heart and preservation of cardiac function in dogs. Additionally, TcVac4 vaccination decreased the transmission of parasites from vaccinated/infected animals to triatomines. PMID:25853654

  3. Diagnostic accuracy of motor evoked potentials to detect neurological deficit during idiopathic scoliosis correction: a systematic review.

    PubMed

    Thirumala, Parthasarathy D; Crammond, Donald J; Loke, Yoon K; Cheng, Hannah L; Huang, Jessie; Balzer, Jeffrey R

    2017-03-01

    OBJECTIVE The goal of this study was to evaluate the efficacy of intraoperative transcranial motor evoked potential (TcMEP) monitoring in predicting an impending neurological deficit during corrective spinal surgery for patients with idiopathic scoliosis (IS). METHODS The authors searched the PubMed and Web of Science database for relevant lists of retrieved reports and/or experiments published from January 1950 through October 2014 for studies on TcMEP monitoring use during IS surgery. The primary analysis of this review fit the operating characteristic into a hierarchical summary receiver operating characteristic curve model to determine the efficacy of intraoperative TcMEP-predicted change. RESULTS Twelve studies, with a total of 2102 patients with IS were included. Analysis found an observed incidence of neurological deficits of 1.38% (29/2102) in the sample population. Of the patients who sustained a neurological deficit, 82.8% (24/29) also had irreversible TcMEP change, whereas 17.2% (5/29) did not. The pooled analysis using the bivariate model showed TcMEP change with sensitivity (mean 91% [95% CI 34%-100%]) and specificity (mean 96% [95% CI 92-98%]). The diagnostic odds ratio indicated that it is 250 times more likely to observe significant TcMEP changes in patients who experience a new-onset motor deficit immediately after IS correction surgery (95% CI 11-5767). TcMEP monitoring showed high discriminant ability with an area under the curve of 0.98. CONCLUSIONS A patient with a new neurological deficit resulting from IS surgery was 250 times more likely to have changes in TcMEPs than a patient without new deficit. The authors' findings from 2102 operations in patients with IS show that TcMEP monitoring is a highly sensitive and specific test for detecting new spinal cord injuries in patients undergoing corrective spinal surgery for IS. They could not assess the value of TcMEP monitoring as a therapeutic adjunct owing to the limited data available and their study design.

  4. Expressional and functional analysis of CYP15A1, a juvenile hormone epoxidase, in the red flour beetle Tribolium castaneum.

    PubMed

    Minakuchi, Chieka; Ishii, Fumika; Washidu, Yumiko; Ichikawa, Akio; Tanaka, Toshiharu; Miura, Ken; Shinoda, Tetsuro

    2015-09-01

    Juvenile hormone (JH) is synthesized and secreted by the corpora allata. In the final two steps of JH biosynthesis, farnesoic acid (FA) is converted to JH through methylation by JH acid O-methyltransferase (JHAMT) and epoxidation by the cytochrome P450 enzyme CYP15. In the present study, we identified a homolog of CYP15 from the red flour beetle Tribolium castaneum (TcCYP15A1), and analyzed its expression as well as its role in JH biosynthesis. Quantitative RT-PCR analysis showed that the level of TcCYP15A1 mRNA was high in the embryonic stage as well as in the middle of the final larval instar. In the embryonic stage, the transcript level of TcCYP15A1 started to increase 30h after egg laying (AEL), peaked 54-60h AEL, and was followed by an increase of TcJHAMT mRNA, suggesting that JH biosynthesis started at this time point. TcCYP15A1 mRNA was present, but not exclusively so in the larval corpora allata. The recombinant TcCYP15A1 protein epoxidized both FA and methyl farnesoate (MF) in highly stereo-specific manners. These results confirmed that TcCYP15A1 is involved in JH biosynthesis. The RNAi-mediated knockdown of TcCYP15A1 in the pre-final larval instar did not result in precocious metamorphosis to pupa, indicating that MF may exhibit JH-like activity in order to maintain the larval status. The double knockdown of TcJHAMT and TcCYP15A1 resulted in pupae and adults with shorter wings, suggesting that the precursors of JH, JH acid and MF, may be essential for wing expansion. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Immune protection against Trypanosoma cruzi induced by TcVac4 in a canine model.

    PubMed

    Aparicio-Burgos, José E; Zepeda-Escobar, José A; de Oca-Jimenez, Roberto Montes; Estrada-Franco, José G; Barbabosa-Pliego, Alberto; Ochoa-García, Laucel; Alejandre-Aguilar, Ricardo; Rivas, Nancy; Peñuelas-Rivas, Giovanna; Val-Arreola, Margarita; Gupta, Shivali; Salazar-García, Felix; Garg, Nisha J; Vázquez-Chagoyán, Juan C

    2015-04-01

    Chagas disease, caused by Trypanosoma cruzi, is endemic in southern parts of the American continent. Herein, we have tested the protective efficacy of a DNA-prime/T. rangeli-boost (TcVac4) vaccine in a dog (Canis familiaris) model. Dogs were immunized with two-doses of DNA vaccine (pcDNA3.1 encoding TcG1, TcG2, and TcG4 antigens plus IL-12- and GM-CSF-encoding plasmids) followed by two doses of glutaraldehyde-inactivated T. rangeli epimastigotes (TrIE); and challenged with highly pathogenic T. cruzi (SylvioX10/4) isolate. Dogs given TrIE or empty pcDNA3.1 were used as controls. We monitored post-vaccination and post-challenge infection antibody response by an ELISA, parasitemia by blood analysis and xenodiagnosis, and heart function by electrocardiography. Post-mortem anatomic and pathologic evaluation of the heart was conducted. TcVac4 induced a strong IgG response (IgG2>IgG1) that was significantly expanded post-infection, and moved to a nearly balanced IgG2/IgG1 response in chronic phase. In comparison, dogs given TrIE or empty plasmid DNA only developed high IgG titers with IgG2 predominance in response to T. cruzi infection. Blood parasitemia, tissue parasite foci, parasite transmission to triatomines, electrocardiographic abnormalities were significantly lower in TcVac4-vaccinated dogs than was observed in dogs given TrIE or empty plasmid DNA only. Macroscopic and microscopic alterations, the hallmarks of chronic Chagas disease, were significantly decreased in the myocardium of TcVac4-vaccinated dogs. We conclude that TcVac4 induced immunity was beneficial in providing resistance to T. cruzi infection, evidenced by control of chronic pathology of the heart and preservation of cardiac function in dogs. Additionally, TcVac4 vaccination decreased the transmission of parasites from vaccinated/infected animals to triatomines.

  6. Characteristics of YBa2Cu3O7 high-Tc superconductor with KCl

    NASA Astrophysics Data System (ADS)

    Yoon, Ki Hyun; Chang, Sung Sik

    1990-03-01

    The lattice parameters, microstructural change, transition temperature, and electrical properties of the YBa2-xKxCu3O7 high-Tc superconductor in the range from x=0 to x=0.25 have been investigated. The high-Tc orthorhombic phase increases with increasing KCl up to x=0.20, above which it decreases. The lattice parameters decrease with increasing KCl up to x=0.10, and then become nearly uniform. The grain size increases with increasing KCl up to x=0.20 due to its role as sintering agent. The specimens with x=0.2 have transition temperatures of 96 K and high magnetic susceptibility due to the contraction of lattice parameters a and b and the increase of orthorhombic distortion.

  7. Synthesis and Characterization of Tc(I) Carbonyl Nitrosyl Species Relevant to the Hanford Tank Waste: FY 2016 Status Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hall, Gabriel B.; Chatterjee, Sayandev; Levitskaia, Tatiana G.

    Among long-lived radioactive constituents in the Hanford tank waste, Tc presents a unique challenge in that it exists predominantly in the liquid phase, generally in the anionic form of pertechnetate, TcO 4 -, which is highly volatile at low-activity waste (LAW) vitrification melter temperatures and mobile in the Hanford site’s subsurface environment. The complex behavior of Tc under storage, treatment, and immobilization conditions significantly affects its management options, which to-date remain uncertain. In strongly alkaline environments, Tc exists as pertechnetate, TcO 4 - (oxidation state +7), and in the reduced forms (oxidation state < +7) collectively known as non-pertechnetate species.more » Pertechnetate is a well-characterized, anionic Tc species that can be removed from LAW by anion exchange or solvent extraction methods. There is no definitive information on the origin of the non-pertechnetate Tc species, nor is there a comprehensive description of their composition and behavior. It has been recently proposed that the non-pertechnetate species can comprise Tc(I) metal center and carbonyl or mixed carbonyl nitrosyl ligands stabilizing low-valent Tc. Recent work by our group has significantly expanded this previous work, generating a series of Tc(I) carbonyl compounds and demonstrating that they can be generated from reduction of TcO 4 - in the simulated Hanford tank waste in presence of CO at elevated temperature (Levitskaia et al. 2014). These results are consistent with the previous proposal that [Tc(CO) 3] + species can be present in the Hanford tank waste and suggest that the low Tc(I) oxidation state is stabilized by the π-accepting ability of the CO ligands. The continuation work has been initiated to develop model Tc carbonyl nitrosyl compounds and investigate their potential presence in the Hanford tank wastes. This report summarizes our to-date results.« less

  8. Effect of Electron Donor and Solution Chemistry on Products of Dissimilatory Reduction of Technetium by Shewanella putrefaciens

    PubMed Central

    Wildung, R. E.; Gorby, Y. A.; Krupka, K. M.; Hess, N. J.; Li, S. W.; Plymale, A. E.; McKinley, J. P.; Fredrickson, J. K.

    2000-01-01

    To help provide a fundamental basis for use of microbial dissimilatory reduction processes in separating or immobilizing 99Tc in waste or groundwaters, the effects of electron donor and the presence of the bicarbonate ion on the rate and extent of pertechnetate ion [Tc(VII)O4−] enzymatic reduction by the subsurface metal-reducing bacterium Shewanella putrefaciens CN32 were determined, and the forms of aqueous and solid-phase reduction products were evaluated through a combination of high-resolution transmission electron microscopy, X-ray absorption spectroscopy, and thermodynamic calculations. When H2 served as the electron donor, dissolved Tc(VII) was rapidly reduced to amorphous Tc(IV) hydrous oxide, which was largely associated with the cell in unbuffered 0.85% NaCl and with extracellular particulates (0.2 to 0.001 μm) in bicarbonate buffer. Cell-associated Tc was present principally in the periplasm and outside the outer membrane. The reduction rate was much lower when lactate was the electron donor, with extracellular Tc(IV) hydrous oxide the dominant solid-phase reduction product, but in bicarbonate systems much less Tc(IV) was associated directly with the cell and solid-phase Tc(IV) carbonate may have been present. In the presence of carbonate, soluble (<0.001 μm) electronegative, Tc(IV) carbonate complexes were also formed that exceeded Tc(VII)O4− in electrophoretic mobility. Thermodynamic calculations indicate that the dominant reduced Tc species identified in the experiments would be stable over a range of Eh and pH conditions typical of natural waters. Thus, carbonate complexes may represent an important pathway for Tc transport in anaerobic subsurface environments, where it has generally been assumed that Tc mobility is controlled by low-solubility Tc(IV) hydrous oxide and adsorptive, aqueous Tc(IV) hydrolysis products. PMID:10831424

  9. Apolipoprotein A-V: a potential modulator of plasma triglyceride levels in Turks.

    PubMed

    Hodoglugil, Ugur; Tanyolaç, Sinan; Williamson, David W; Huang, Yadong; Mahley, Robert W

    2006-01-01

    The apolipoprotein A-V gene (APOA5) plays an important role in determining plasma triglyceride levels. We studied the effects of APOA5 polymorphisms on plasma triglyceride levels in Turks, a population with low levels of HDL cholesterol and a high prevalence of coronary artery disease. We found 15 polymorphisms, three of which were novel. Seven haplotype-tagging single nucleotide polymorphisms (SNPs) were chosen and genotyped in approximately 3,000 subjects. The rare alleles of the -1464T>C, -1131T>C, S19W, and 1259T>C SNPs were significantly associated with increased triglyceride levels (19-86 mg/dl; P < 0.05) and had clear gene-dose effects. Haplotype analysis of the nine common APOA5 haplotypes revealed significant effects on triglyceride levels (P < 0.001). Detailed analysis of haplotypes clearly showed that the -1464T>C polymorphism had no effect by itself but was a marker for the -1131T>C, S19W, and 1259T>C polymorphisms. The -1131T>C and 1259T>C polymorphisms were in a strong but incomplete linkage disequilibrium and appeared to have independent effects. Thus, the APOA5 -1131T>C, S19W, and 1259T>C rare alleles were associated with significant increases in plasma triglyceride levels. At least one of these alleles was present in approximately 40% of the Turks. Similar associations were observed for -1131T>C and S19W in white Americans living in San Francisco, California.

  10. 99mTc-N4-[Tyr3]Octreotate Versus 99mTc-EDDA/HYNIC-[Tyr3]Octreotide: an intrapatient comparison of two novel Technetium-99m labeled tracers for somatostatin receptor scintigraphy.

    PubMed

    Gabriel, Michael; Decristoforo, Clemens; Maina, Theodosia; Nock, Berthold; vonGuggenberg, Elisabeth; Cordopatis, Paul; Moncayo, Roy

    2004-02-01

    Tetraamine-[Tyr3]octreotate (Demotate) is a somatostatin (SST) analogue that can be easily labeled with 99mTc at high specific activities and showed promising preclinical properties for SST receptor scintigraphy. This study reports on the first intra-patient comparison of 99mTc-Demotate and another 99mTc-labeled SST analogue, 99mTc-EDDA/HYNIC-TOC (HYNIC-TOC). Five patients with carcinoid tumors (n = 2) and endocrine pancreatic tumors (n = 3) were investigated with both radiopharmaceuticals. 99mTc-Demotate rapidly visualized somatostatin receptor positive tumors as early as 15 minutes post-injection (p.i.) with maximum tumor uptake and tumor/organ ratios already 1 hour p.i. Organs of predominant physiological uptake were the spleen and the kidneys with no intestinal excretion detectable up to 24 hours. 99mTc-Demotate exhibited faster pharmacokinetic properties compared to HYNIC-TOC. Tumor/organ ratios at equivalent time points were higher or comparable for 99mTc-Demotate in three patients with a matching scan result. Equivocal findings were observed in two patients, i.e. comparable uptake behavior in larger lesions with differences in smaller ones. 99mTc-Demotate is a promising agent for somatostatin receptor scintigraphy providing images of excellent quality as early as 1 hour after injection.

  11. Trypanosoma cruzi diversity in the Gran Chaco: mixed infections and differential host distribution of TcV and TcVI.

    PubMed

    Monje-Rumi, María M; Brandán, Cecilia Pérez; Ragone, Paula G; Tomasini, Nicolás; Lauthier, Juan J; Alberti D'Amato, Anahí M; Cimino, Rubén O; Orellana, Viviana; Basombrío, Miguel A; Diosque, Patricio

    2015-01-01

    The transmission cycles of Trypanosoma cruzi in the Gran Chaco are complex networks involving domestic and wild components, whose interrelationships are not well understood. Knowing the circuit of transmission of the different Discrete Typing Units (DTUs) of T. cruzi in the complex environment of the Chaco region is relevant to understanding how the different components (reservoirs, vectors, ecotopes) interact. In the present study we identified the DTUs infecting humans and dogs in two rural areas of the Gran Chaco in Argentina, using molecular methods which avoid parasite culture. Blood samples of humans and dogs were typified by PCR-DNA blotting and hybridization assays with five specific DNA probes (TcI, TcII, TcIII, TcV and TcVI). PCR analyses were performed on seropositive human and dog samples and showed the presence of T. cruzi DNA in 41.7% (98/235) and 53% (35/66) samples, respectively. The identification of infective DTUs was determined in 83.6% (82/98) and 91.4% (32/35) in human and dog samples, respectively. Single infections (36.7% - 36/98) and a previously not detected high proportion of mixed infections (47.9% - 47/98) were found. In a 15.3% (15/98) of samples the infecting DTU was not identified. Among the single infections TcV was the most prevalent DTU (30.6% - 30/98) in human samples; while TcVI (42.8% - 15/35) showed the highest prevalence in dog samples. TcV/TcVI was the most prevalent mixed infection in humans (32.6% - 32/98); and TcI/TcVI (14.3% - 5/35) in dogs. Significant associations between TcV with humans and TcVI with dogs were detected. For the first time, the presence of TcIII was detected in humans from this region. The occurrence of one human infected whit TcIII (a principally wild DTU) could be suggested the emergence of this, in domestic cycles in the Gran Chaco. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. The effect of time of day on cold water ingestion by high-level swimmers in a tropical climate.

    PubMed

    Hue, Olivier; Monjo, Roland; Lazzaro, Marc; Baillot, Michelle; Hellard, Philippe; Marlin, Laurent; Jean-Etienne, A

    2013-07-01

    The authors tested the effect of cold water ingestion during high-intensity training in the morning vs the evening on both core temperature (TC) and thermal perceptions of internationally ranked long-distance swimmers during a training period in a tropical climate. Nine internationally ranked long-distance swimmers (5 men and 4 women) performed 4 randomized training sessions (2 in the evening and 2 in the morning) with 2 randomized beverages with different temperatures for 3 consecutive days. After a standardized warm-up of 1000 m, the subjects performed a standardized training session that consisted of 10 x 100 m (start every 1'20″) at a fixed velocity. The swimmers were then followed for the next 3000 m of the training schedule. Heart rate (HR) was continuously monitored during the 10 x 100 m, whereas TC, thermal comfort, and thermal sensation (TS) were measured before and after each 1000-m session. Before and after each 1000 m, the swimmers were asked to drink 190 mL of neutral (26.5 ± 2.5°C) or cold (1.3 ± 0.3°C) water packaged in standardized bottles. Results demonstrated that cold water ingestion induced a significant effect on TC, with a pronounced decrease in the evening, resulting in significantly lower mean TC and lower mean delta TC in evening cold (EC) than in evening neutral (EN), concomitant with significantly lower TS in EC than in EN and a significant effect on exercise HR. Moreover, although TC increased significantly with time in MN, MC, and EN, TC was stabilized during exercise in EC. To conclude, we demonstrate that a cold beverage had a significant effect on TC, TS, and HR during training in high-level swimmers in a tropical climate, especially during evening training.

  13. Descriptive Epidemiology of Human Thyroid Cancer: Experience From a Regional Registry and The “Volcanic Factor”

    PubMed Central

    Malandrino, Pasqualino; Scollo, Claudia; Marturano, Ilenia; Russo, Marco; Tavarelli, Martina; Attard, Marco; Richiusa, Pierina; Violi, Maria Antonia; Dardanoni, Gabriella; Vigneri, Riccardo; Pellegriti, Gabriella

    2013-01-01

    Thyroid cancer (TC), the most common endocrine tumor, has steadily increased worldwide due to the increase of the papillary histotype. The reasons for this spread have not been established. In addition to more sensitive thyroid nodule screening, the effect of environmental factors cannot be excluded. Because high incidences of TC were found in volcanic areas (Hawaii and Iceland), a volcanic environment may play a role in the pathogenesis of TC. In January 2002, the Regional Register for TC was instituted in Sicily. With a population of approximately five million inhabitants with similar genetic and lifestyle features, the coexistence in Sicily of rural, urban, industrial, moderate-to-low iodine intake, and volcanic areas provides a conducive setting for assessing the environmental influences on the etiology of TC. In Sicily, between 2002 and 2004, 1,950 new cases of TC were identified, with an age-standardized rate (world) ASR(w) = 17.8/105 in females and 3.7/105 in males and a high female/male ratio (4.3:1.0). The incidence of TC was heterogeneous within Sicily. There were 2.3 times more cases in the Catania province (where most of the inhabitants live in the volcanic area of Mt. Etna): ASR(w) = 31.7/105 in females and 6.4/105 in males vs. 14.1 in females and 3.0 in males in the rest of Sicily. Multivariate analysis documented that residents in the volcanic area of Mt. Etna had a higher risk of TC, compared to the residents in urban, industrial, and iodine deficient areas of Sicily. An abnormally high concentration of several chemicals was found in the drinking water of the Mt. Etna aquifer, which provides water to most of the residents in the Catania province. Our data suggest that environmental carcinogen(s) of volcanic origin may promote papillary TC. Additional analyses, including cancer biological and molecular features, will allow a better understanding of risk factors and etiopathogenetic mechanisms. PMID:23761783

  14. Low temperature London penetration depth and superfluid density in Fe-based superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hyunsoo

    2013-01-01

    The superconducting gap symmetry of the Fe-based superconductors was studied by measurements and analysis of London penetration depth and super uid density. Tunnel diode resonator technique for these measurements was implemented in a dilution refrigerator allowing for the temperatures down to 50 mK. For the analysis of the super uid density, we used both experimental studies of Al-coated samples and original thermodynamic approach based on Rutgers relation. In three systems studied, we found that the superconducting gap at the optimal doping is best described in multi-gap full gap scenario. By performing experiments on samples with arti cially introduced disorder withmore » heavy ion irradiation, we show that evolution of the superconducting transition temperature and of the super uid density are consistent with full-gap sign changing s superconducting state. The superconducting gap develops strong modulation both in the under-doped and the over-doped regimes. In the terminal hole-doped KFe{sub 2}As{sub 2}, both temperature dependence of the super uid density and its evolution with increase of the scattering rate are consistent with symmetry imposed vertical line nodes in the superconducting gap. By comparative studies of hole-doped (Ba,K)Fe{sub 2}As{sub 2} and electron-doped Ca10-3-8, we show that the superconducting gap modulation in the under-doped regime is intrinsic and is not induced by the coexisting static magnetic order.« less

  15. A Structural and Mutagenic Blueprint for Molecular Recognition of Strychnine and d-Tubocurarine by Different Cys-Loop Receptors

    PubMed Central

    Kuzmin, Dmitry; van Elk, René; Krijnen, Liz; Yakel, Jerrel L.; Tsetlin, Victor; Smit, August B.; Ulens, Chris

    2011-01-01

    Cys-loop receptors (CLR) are pentameric ligand-gated ion channels that mediate fast excitatory or inhibitory transmission in the nervous system. Strychnine and d-tubocurarine (d-TC) are neurotoxins that have been highly instrumental in decades of research on glycine receptors (GlyR) and nicotinic acetylcholine receptors (nAChR), respectively. In this study we addressed the question how the molecular recognition of strychnine and d-TC occurs with high affinity and yet low specificity towards diverse CLR family members. X-ray crystal structures of the complexes with AChBP, a well-described structural homolog of the extracellular domain of the nAChRs, revealed that strychnine and d-TC adopt multiple occupancies and different ligand orientations, stabilizing the homopentameric protein in an asymmetric state. This introduces a new level of structural diversity in CLRs. Unlike protein and peptide neurotoxins, strychnine and d-TC form a limited number of contacts in the binding pocket of AChBP, offering an explanation for their low selectivity. Based on the ligand interactions observed in strychnine- and d-TC-AChBP complexes we performed alanine-scanning mutagenesis in the binding pocket of the human α1 GlyR and α7 nAChR and showed the functional relevance of these residues in conferring high potency of strychnine and d-TC, respectively. Our results demonstrate that a limited number of ligand interactions in the binding pocket together with an energetic stabilization of the extracellular domain are key to the poor selective recognition of strychnine and d-TC by CLRs as diverse as the GlyR, nAChR, and 5-HT3R. PMID:21468359

  16. A structural and mutagenic blueprint for molecular recognition of strychnine and d-tubocurarine by different cys-loop receptors.

    PubMed

    Brams, Marijke; Pandya, Anshul; Kuzmin, Dmitry; van Elk, René; Krijnen, Liz; Yakel, Jerrel L; Tsetlin, Victor; Smit, August B; Ulens, Chris

    2011-03-01

    Cys-loop receptors (CLR) are pentameric ligand-gated ion channels that mediate fast excitatory or inhibitory transmission in the nervous system. Strychnine and d-tubocurarine (d-TC) are neurotoxins that have been highly instrumental in decades of research on glycine receptors (GlyR) and nicotinic acetylcholine receptors (nAChR), respectively. In this study we addressed the question how the molecular recognition of strychnine and d-TC occurs with high affinity and yet low specificity towards diverse CLR family members. X-ray crystal structures of the complexes with AChBP, a well-described structural homolog of the extracellular domain of the nAChRs, revealed that strychnine and d-TC adopt multiple occupancies and different ligand orientations, stabilizing the homopentameric protein in an asymmetric state. This introduces a new level of structural diversity in CLRs. Unlike protein and peptide neurotoxins, strychnine and d-TC form a limited number of contacts in the binding pocket of AChBP, offering an explanation for their low selectivity. Based on the ligand interactions observed in strychnine- and d-TC-AChBP complexes we performed alanine-scanning mutagenesis in the binding pocket of the human α1 GlyR and α7 nAChR and showed the functional relevance of these residues in conferring high potency of strychnine and d-TC, respectively. Our results demonstrate that a limited number of ligand interactions in the binding pocket together with an energetic stabilization of the extracellular domain are key to the poor selective recognition of strychnine and d-TC by CLRs as diverse as the GlyR, nAChR, and 5-HT(3)R.

  17. Development of high Tc (greater than 100 K) Bi, Tl and Y-based materials as superconducting circuit elements

    NASA Technical Reports Server (NTRS)

    Haertling, Gene; Grabert, Gregory; Gilmour, Phillip

    1994-01-01

    Experimental work on this project over the last four years has resulted in establishing processing and characterization techniques for producing both the Bi-based and Tl-based superconductors in their high temperature (2223) forms. In the bulk, dry pressed form, maximum critical temperatures (Tc) of 108.2 K and 117.8 K, respectively, were measured. Results have further shown that the Bi and Tl-based superconducting materials in bulk form are noticeably different from the Y-based 123 material in that superconductivity is considerably harder to achieve, maintain, and reproduce. This is due primarily to the difficulty in obtaining the higher Tc phase in pure form since it commonly co-exists with other undesirable, lower Tc phases. In particular, it has been found that long processing times for calcining and firing (20 - 200 hrs.) and close control of temperatures which are very near the melting point are required in order to obtain higher proportions of the desirable, high Tc (2223) phase. Thus far, the BSCCO bulk materials has been prepared in uniaxially pressed, hot pressed, and tapecast form. The uniaxially pressed material has been synthesized by the mixed oxide, coprecipitation, and melt quenching processes. The tapecast and hot pressed materials have been prepared via the mixed oxide process. In addition, thick films of BSCCO (2223 phase) have been prepared by screen printing on to yttria and magnesia stabilized zirconia with only moderate success; i.e., superconductivity was achieved in these thick films, but the highest Tc obtained in these films was 89.0 K. The Tc's of the bulk hot pressed, tapecast, and screen printed thick film materials were found to be 108.2, 102.4, and 89.0 K, respectively.

  18. Abacavir/Lamivudine Versus Tenofovir DF/Emtricitabine as Part of Combination Regimens for Initial Treatment of HIV: Final Results

    PubMed Central

    Tierney, Camlin; Collier, Ann C.; Daar, Eric S.; Mollan, Katie; Budhathoki, Chakra; Godfrey, Catherine; Jahed, Nasreen C.; Myers, Laurie; Katzenstein, David; Farajallah, Awny; Rooney, James F.; Ha, Belinda; Woodward, William C.; Feinberg, Judith; Tashima, Karen; Murphy, Robert L.; Fischl, Margaret A.

    2011-01-01

    (See the editorial commentary by Hull and Montaner, on pages 1154–6.) Background. AIDS Clinical Trials Group A5202 compared blinded abacavir/lamivudine (ABC/3TC) to tenofovir DF/emtricitabine (TDF/FTC) with efavirenz (EFV) or atazanavir/ritonavir (ATV/r) in human immunodeficiency virus (HIV)-infected treatment-naive patients, stratified by screening HIV RNA (< or ≥105 copies/mL). Due to higher virologic failure with ABC/3TC in the high HIV RNA stratum, blinded treatment was stopped in this group, but study follow-up continued for all patients. Methods. Primary endpoints were times to virologic failure, regimen modification, and safety event. Results. In the low HIV RNA stratum, time to virologic failure was similar for ABC/3TC vs TDF/FTC with ATV/r (hazard ratio [HR] 1.25, 95% confidence interval [CI] 0.76, 2.05) or EFV (HR 1.23, 95% CI 0.77, 1.96), with significantly shorter times to regimen modification for ABC/3TC with EFV or ATV/r and to safety events with EFV. Prior to stopping blinded treatment in the high stratum, higher virologic failure rates were seen with ABC/3TC with EFV (HR 2.46, 95% CI 1.20, 5.05) or ATV/r (HR 2.22, 95% CI 1.19, 4.14). Conclusions. In the low HIV RNA stratum, times to virologic failure for ABC/3TC or TDF/FTC were not different with EFV or ATV/r. In the high stratum, virologic failure rate was significantly higher for ABC/3TC than for TDF/FTC when given with either EFV or ATV/r. PMID:21917892

  19. Utility of serum lipid ratios for predicting incident type 2 diabetes: the Isfahan Diabetes Prevention Study.

    PubMed

    Janghorbani, Mohsen; Amini, Masoud

    2016-09-01

    In this study, we evaluate the association between triglyceride to high-density lipoprotein cholesterol (TG/HDL) ratio and total cholesterol (TC) to HDL (TC/HDL) ratio and the risks of type 2 diabetes (T2D) in an Iranian high-risk population. We analysed 7-year follow-up data (n = 1771) in non-diabetic first-degree relatives of consecutive patients with T2D 30-70 years old. The primary outcome was the diagnosis of T2D based on repeated oral glucose tolerance tests. We used Cox proportional hazard models to estimate hazard ratio for incident T2D across tertiles of TG/HDL and TC/HDL ratios and plotted a receiver operating characteristic (ROC) curve to assess discrimination. The highest tertile of TG/HDL and TC/HDL ratios compared with the lowest tertile was not associated with T2D in age- and gender-adjusted models (HR 0.99, 95% CI: 0.88, 1.11 for TG/HDL ratio and 1.10, 95% CI: 0.97, 1.23 for TC/HDL ratio). Further adjustment for waist circumference or body mass index, fasting plasma glucose, and low-density lipoprotein cholesterol did not appreciably alter the hazard ratio compared with the age- and gender-adjusted model. The area under the ROC curve for TG/HDL ratio was 57.7% (95% CI: 54.0, 61.5) and for TC/HDL ratio was 55.1% (95% CI: 51.2, 59.0). TG/HDL and TC/HDL ratios were not robust predictors of T2D in high-risk individuals in Iran. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  20. Tropical cyclone fullness: A new concept for interpreting storm intensity

    NASA Astrophysics Data System (ADS)

    Guo, Xi; Tan, Zhe-Min

    2017-05-01

    Intensity and size are two crucial factors in determining the destructiveness of a tropical cyclone (TC), but little is known about the relationship between them because of a lack of observations. TC fullness, a new concept, is proposed to quantitatively measure the storm wind structure, which is defined as the ratio of the extent of the outer-core wind skirt to the outer-core size of the TC. TC intensity is more strongly correlated with fullness than with other measures comprising just a single size parameter. A scale is introduced to classify TCs into four categories based on TC fullness (FS1 to FS4). Regardless of the specific inner-core and outer-core size, the FS4 fullness structure is necessary for an intense TC's development, while category FS1 and FS2 TCs are generally weak. Most major TCs achieve FS4 fullness structure earlier and more frequently than nonmajor TCs. Rapidly increasing fullness favors the intensification of TC.Plain Language SummaryTropical cyclone (TC) disasters caused tremendous property loss and casualties all over the world every year, while the knowledge on what essentially determines TC intensity is far beyond enough. Should a large TC ought to be intense and disastrous? And is a small TC doomed to be weak? It confused us when some dapper small TCs struck us with their fierce wind and torrential rain, while other large TCs that finally turned out to be a false alarm tricked us with their puffiness body. The underlying factor that truly controls TC intensity has been grasped here. We unveil the mysteries between TC intensity and size by raising a new concept: TC fullness. Either small or large TC can be intense; it depends on the fullness. TCs should possess FS4 fullness structure (high fullness) as long as they are intense; on the other hand, TCs with low fullness are weak in majority. In addition, rapidly increasing fullness is beneficial for the intensification of TC. The concept of TC fullness may provide a new path in the exploration of TC intensity and intensity change and may also be helpful for the forecast of TC intensity even its future change.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_15");'>15</a></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li class="active"><span>17</span></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_17 --> <div id="page_18" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li class="active"><span>18</span></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="341"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22148678','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22148678"><span>Applicability of plasmid calibrant pTC1507 in quantification of TC1507 maize: an interlaboratory study.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Meng, Yanan; Liu, Xin; Wang, Shu; Zhang, Dabing; Yang, Litao</p> <p>2012-01-11</p> <p>To enforce the labeling regulations of genetically modified organisms (GMOs), the application of DNA plasmids as calibrants is becoming essential for the practical quantification of GMOs. This study reports the construction of plasmid pTC1507 for a quantification assay of genetically modified (GM) maize TC1507 and the collaborative ring trial in international validation of its applicability as a plasmid calibrant. pTC1507 includes one event-specific sequence of TC1507 maize and one unique sequence of maize endogenous gene zSSIIb. A total of eight GMO detection laboratories worldwide were invited to join the validation process, and test results were returned from all eight participants. Statistical analysis of the returned results showed that real-time PCR assays using pTC1507 as calibrant in both GM event-specific and endogenous gene quantifications had high PCR efficiency (ranging from 0.80 to 1.15) and good linearity (ranging from 0.9921 to 0.9998). In a quantification assay of five blind samples, the bias between the test values and true values ranged from 2.6 to 24.9%. All results indicated that the developed pTC1507 plasmid is applicable for the quantitative analysis of TC1507 maize and can be used as a suitable substitute for dried powder certified reference materials (CRMs).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26567193','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26567193"><span>A systematic review of high-oleic vegetable oil substitutions for other fats and oils on cardiovascular disease risk factors: implications for novel high-oleic soybean oils.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Huth, Peter J; Fulgoni, Victor L; Larson, Brian T</p> <p>2015-11-01</p> <p>High-oleic acid soybean oil (H-OSBO) is a trait-enhanced vegetable oil containing >70% oleic acid. Developed as an alternative for trans-FA (TFA)-containing vegetable oils, H-OSBO is predicted to replace large amounts of soybean oil in the US diet. However, there is little evidence concerning the effects of H-OSBO on coronary heart disease (CHD)(6) risk factors and CHD risk. We examined and quantified the effects of substituting high-oleic acid (HO) oils for fats and oils rich in saturated FAs (SFAs), TFAs, or n-6 (ω-6) polyunsaturated FAs (PUFAs) on blood lipids in controlled clinical trials. Searches of online databases through June 2014 were used to select studies that defined subject characteristics; described control and intervention diets; substituted HO oils compositionally similar to H-OSBO (i.e., ≥70% oleic acid) for equivalent amounts of oils high in SFAs, TFAs, or n-6 PUFAs for ≥3 wk; and reported changes in blood lipids. Studies that replaced saturated fats or oils with HO oils showed significant reductions in total cholesterol (TC), LDL cholesterol, and apolipoprotein B (apoB) (P < 0.05; mean percentage of change: -8.0%, -10.9%, -7.9%, respectively), whereas most showed no changes in HDL cholesterol, triglycerides (TGs), the ratio of TC to HDL cholesterol (TC:HDL cholesterol), and apolipoprotein A-1 (apoA-1). Replacing TFA-containing oil sources with HO oils showed significant reductions in TC, LDL cholesterol, apoB, TGs, TC:HDL cholesterol and increased HDL cholesterol and apoA-1 (mean percentage of change: -5.7%, -9.2%, -7.3%, -11.7%, -12.1%, 5.6%, 3.7%, respectively; P < 0.05). In most studies that replaced oils high in n-6 PUFAs with equivalent amounts of HO oils, TC, LDL cholesterol, TGs, HDL cholesterol, apoA-1, and TC:HDL cholesterol did not change. These findings suggest that replacing fats and oils high in SFAs or TFAs with either H-OSBO or oils high in n-6 PUFAs would have favorable and comparable effects on plasma lipid risk factors and overall CHD risk. © 2015 American Society for Nutrition.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/pages/biblio/1334432-deep-data-mining-real-space-separation-intertwined-electronic-responses-lightly-doped-bafe2as2','SCIGOV-DOEP'); return false;" href="https://www.osti.gov/pages/biblio/1334432-deep-data-mining-real-space-separation-intertwined-electronic-responses-lightly-doped-bafe2as2"><span>Deep data mining in a real space: Separation of intertwined electronic responses in a lightly doped BaFe 2As 2</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/pages">DOE PAGES</a></p> <p>Ziatdinov, Maxim; Maksov, Artem; Li, Li; ...</p> <p>2016-10-25</p> <p>Electronic interactions present in material compositions close to the superconducting dome play a key role in the manifestation of high-T c superconductivity. In many correlated electron systems, however, the parent or underdoped states exhibit strongly inhomogeneous electronic landscape at the nanoscale that may be associated with competing, coexisting, or intertwined chemical disorder, strain, magnetic, and structural order parameters. Here we demonstrate an approach based on a combination of scanning tunneling microscopy/spectroscopy and advanced statistical learning for an automatic separation and extraction of statistically significant electronic behaviors in the spin density wave regime of a lightly (~1%) gold-doped BaFe 2As 2.more » Lastly, we show that the decomposed STS spectral features have a direct relevance to fundamental physical properties of the system, such as SDW-induced gap, pseudogap-like state, and impurity resonance states.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1334432','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/1334432"><span>Deep data mining in a real space: Separation of intertwined electronic responses in a lightly doped BaFe 2As 2</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Ziatdinov, Maxim; Maksov, Artem; Li, Li</p> <p></p> <p>Electronic interactions present in material compositions close to the superconducting dome play a key role in the manifestation of high-T c superconductivity. In many correlated electron systems, however, the parent or underdoped states exhibit strongly inhomogeneous electronic landscape at the nanoscale that may be associated with competing, coexisting, or intertwined chemical disorder, strain, magnetic, and structural order parameters. Here we demonstrate an approach based on a combination of scanning tunneling microscopy/spectroscopy and advanced statistical learning for an automatic separation and extraction of statistically significant electronic behaviors in the spin density wave regime of a lightly (~1%) gold-doped BaFe 2As 2.more » Lastly, we show that the decomposed STS spectral features have a direct relevance to fundamental physical properties of the system, such as SDW-induced gap, pseudogap-like state, and impurity resonance states.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014APS..MARW40002P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014APS..MARW40002P"><span>Quantum critical point underlying the pseudogap state in underdoped cuprate superconductors</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Pepin, Catherine</p> <p>2014-03-01</p> <p>Cuprate superconductors rank among the most complex materials that are known in the universe. Faced with this complexity, scientists have adopted two types of approaches. In a bottom up approach, one considers that strong correlations occur at a high energy scale of roughly 1 eV upon very strong Coulomb interactions. In the top down approach one considers that one universal singularity at very low temperatures is responsible for complexity of the phase diagram. In this talk we will argue that the strong quantum fluctuations experienced at the proximity to a anti-ferromagnetic Quantum Critical Point (QCP) is responsible for a cascade of phase transitions in the charge and superconducting channels. We will discuss in this context the emergence of the pseudo-gap and charge order modulations. Symmetries and relations to experimental observations will be addressed. Work done in collaboration with K.B. Efetov (Bochum) and H. Meier (Yale).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27537699','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27537699"><span>Improved Quantification of the Beta Cell Mass after Pancreas Visualization with 99mTc-demobesin-4 and Beta Cell Imaging with 111In-exendin-3 in Rodents.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>van der Kroon, Inge; Joosten, Lieke; Nock, Berthold A; Maina, Theodosia; Boerman, Otto C; Brom, Maarten; Gotthardt, Martin</p> <p>2016-10-03</p> <p>Accurate assessment of the 111 In-exendin-3 uptake within the pancreas requires exact delineation of the pancreas, which is highly challenging by MRI and CT in rodents. In this study, the pancreatic tracer 99m Tc-demobesin-4 was evaluated for accurate delineation of the pancreas to be able to accurately quantify 111 In-exendin-3 uptake within the pancreas. Healthy and alloxan-induced diabetic Brown Norway rats were injected with the pancreatic tracer 99m Tc-demobesin-4 ([ 99m Tc-N 4 -Pro 1 ,Tyr 4 ,Nle 14 ]bombesin) and the beta cell tracer 111 In-exendin-3 ([ 111 In-DTPA-Lys 40 ]exendin-3). After dual isotope acquisition of SPECT images, 99m Tc-demobesin-4 was used to define a volume of interest for the pancreas in SPECT images subsequently the 111 In-exendin-3 uptake within this region was quantified. Furthermore, biodistribution and autoradiography were performed in order to gain insight in the distribution of both tracers in the animals. 99m Tc-demobesin-4 showed high accumulation in the pancreas. The uptake was highly homogeneous throughout the pancreas, independent of diabetic status, as demonstrated by autoradiography, whereas 111 In-exendin-3 only accumulates in the islets of Langerhans. Quantification of both ex vivo and in vivo SPECT images resulted in an excellent linear correlation between the pancreatic uptake, determined with ex vivo counting and 111 In-exendin-3 uptake, determined from the quantitative analysis of the SPECT images (Pearson r = 0.97, Pearson r = 0.92). 99m Tc-demobesin-4 shows high accumulation in the pancreas of rats. It is a suitable tracer for accurate delineation of the pancreas and can be conveniently used for simultaneous acquisition with 111 In labeled exendin-3. This method provides a straightforward, reliable, and objective method for preclinical beta cell mass (BCM) quantification with 111 In-exendin-3.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25603866','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25603866"><span>[99mTc-octreotide receptor scintigraphy in NCI-H446 small cell lung cancer nude mice model].</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Li, Chao; Zuo, Shuyao; Wang, Xufu; Liu, Xinfeng; Wang, Guoming; Wu, Fengyu</p> <p>2015-01-01</p> <p>For highly aggressive small cell lung cancer (SCLC), early diagnosis is important for its prognosis, but the current inspection methods are more limited, with poor specificity of the traditional imaging methods, and the high cost of PET/CT, difficult to popularization and application. SCLC is kind of neuroendocrine tumors, high expression of somatostatin receptors, which is the cornerstone of its early molecular imaging diagnosis. The aim of this study is to observe the biodistribution and metabolism of 99mTc-octreotide in normal and the human SCLC bearing nude mice. Dynamic and static scintigraphy at 0.5 h, 2 h, 3 h, 4 h were performed in both normal and tumor bearing nude mice after intravenous injection of 99mTc-octreotide. The technique of drawing region of interest (ROI) was used to obtain the averaged pixel counts and the activity-time (A-T) curve of brain, heart, lung, liver, kidney, tumor, respectively. ① The biodistribution study in normal nude mice showed highest uptake in kidney and liver, lower in lung and heart, lowest in brain. Most 99mTc-octreotide was excreted via kidney. ② All tumors were displayed clearly at 3 h postinjection of 99mTc-octreotide. The averaged T/N ratio at 0.5 h, 2 h, 3 h, 4 h postinjection of 99mTc-octreotide was 1.163 ± 0.03, 2.08 ± 0.12, 3.03 ± 0.23, 2.689 ± 0.31, respectively (F=51.69, P<0.000,1). The radioactivity of tumor was lower than liver, and similar with the lung. The curve of tumor showed a radioactivity peak at 2 min-3 min postinjection. 99mTc-octreotide receptor imaging on nude mice bearing SCLC shares high positive rate, especially at 3 h postinjection.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29291444','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29291444"><span>An improved 99mTc-HYNIC-(Ser)3-LTVSPWY peptide with EDDA/tricine as co-ligands for targeting and imaging of HER2 overexpression tumor.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Khodadust, Fatemeh; Ahmadpour, Sajjad; Aligholikhamseh, Nazan; Abedi, Seyed Mohammad; Hosseinimehr, Seyed Jalal</p> <p>2018-01-20</p> <p>Overexpression of human epidermal receptor 2 (HER2) has given the opportunity for targeting and delivering of imaging radiotracers. The aim of this study was to evaluate the 99m Tc-HYNIC-(EDDA/tricine)-(Ser) 3 -LTVSPWY peptide for tumor targeting and imaging of tumor with overexpression of HER2. The HYNIC-(Ser) 3 -LTVSPWY was labeled with 99m Tc in presence of EDDA/tricine mixture as co-ligands. The in vitro and in vivo studies of this radiolabeled peptide were performed for cellular specific binding and tumor targeting. The high radiochemical purity of 99m Tc-HYNIC (EDDA/tricine)-(Ser) 3 -LTVSPWY was obtained to be 99%. It exhibited high stability in normal saline and human serum. In HER2 binding affinity study, a significant reduction in uptake of radiolabeled peptide (7.7 fold) was observed by blocking SKOV-3 cells receptors with unlabeled peptide. The K D and B max values for this radiolabeled peptide were determined as 3.3 ± 1.0 nM and 2.9 ± 0.3 × 10 6 CPM/pMol, respectively. Biodistribution study revealed tumor to blood and tumor to muscle ratios about 6.9 and 4 respectively after 4 h. Tumor imaging by gamma camera demonstrated considerable high contrast tumor uptake. This developed 99m Tc-HYNIC-(Ser) 3 -LTVSPWY peptide selectively targeted on HER2 tumor and exhibited a high target uptake combined with acceptable low background activity for tumor imaging in mice. The results of this study and its comparison with another study showed that 99m Tc-HYNIC-(EDDA/tricine)-(Ser) 3 -LTVSPWY is much better than previously reported radiolabeled peptide as 99m Tc-CSSS-LTVSPWY for HER2 overexpression tumor targeting and imaging. Copyright © 2017 Elsevier Masson SAS. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28091980','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28091980"><span>Comparison of Tc-99m maraciclatide and Tc-99m sestamibi molecular breast imaging in patients with suspected breast cancer.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>O'Connor, Michael K; Morrow, Melissa M B; Hunt, Katie N; Boughey, Judy C; Wahner-Roedler, Dietlind L; Conners, Amy Lynn; Rhodes, Deborah J; Hruska, Carrie B</p> <p>2017-12-01</p> <p>Molecular breast imaging (MBI) performed with 99m Tc sestamibi has been shown to be a valuable technique for the detection of breast cancer. Alternative radiotracers such as 99m Tc maraciclatide may offer improved uptake in breast lesions. The purpose of this study was to compare relative performance of 99m Tc sestamibi and 99m Tc maraciclatide in patients with suspected breast cancer, using a high-resolution dedicated gamma camera for MBI. Women with breast lesions suspicious for malignancy were recruited to undergo two MBI examinations-one with 99m Tc sestamibi and one with 99m Tc maraciclatide. A radiologist interpreted MBI studies in a randomized, blinded fashion to assign an assessment score (1-5) and measured lesion size. Lesion-to-background (L/B) ratio was measured with region-of-interest analysis. Among 39 analyzable patients, 21 malignant tumors were identified in 21 patients. Eighteen of 21 tumors (86%) were seen on 99m Tc sestamibi MBI and 19 of 21 (90%) were seen on 99m Tc maraciclatide MBI (p = 1). Tumor extent measured with both radiopharmaceuticals correlated strongly with pathologic size ( 99m Tc sestamibi, r = 0.84; 99m Tc maraciclatide, r = 0.81). The L/B ratio in detected breast cancers was similar for the two radiopharmaceuticals: 1.55 ± 0.36 (mean ± S.D.) for 99m Tc sestamibi and 1.62 ± 0.37 (mean ± S.D.) for 99m Tc maraciclatide (p = 0.53). No correlation was found between the L/B ratio and molecular subtype for 99m Tc sestamibi (r s  = 0.12, p = 0.63) or 99m Tc maraciclatide (r s  = -0.12, p = 0.64). Of 20 benign lesions, 10 (50%) were seen on 99m Tc sestamibi and 9 of 20 (45%) were seen on 99m Tc maraciclatide images (p = 0.1). The average L/B ratio for benign lesions was 1.34 ±0.40 (mean ±S.D.) for 99m Tc sestamibi and 1.41 ±0.52 (mean ±S.D.) for 99m Tc maraciclatide (p = 0.75). Overall diagnostic performance was similar for both radiopharmaceuticals. AUC from ROC analysis was 0.83 for 99m Tc sestamibi and 0.87 for 99m Tc maraciclatide (p = 0.64). 99m Tc maraciclatide offered comparable lesion uptake to 99m Tc sestamibi, in both malignant and benign lesions. There was good correlation between lesion extent and uptake measured from both radiopharmaceuticals. 99m Tc maraciclatide offered a marginal (but not significant) improvement in sensitivity over 99m Tc sestamibi. Our findings did not support an association between the uptake of either radiopharmaceutical and tumor molecular subtype. ClinicalTrials.gov, NCT00888589.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2001PhyC..349....1L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2001PhyC..349....1L"><span>Superconductivity in nanostructured lead</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Lungu, Anca; Bleiweiss, Michael; Amirzadeh, Jafar; Saygi, Salih; Dimofte, Andreea; Yin, Ming; Iqbal, Zafar; Datta, Timir</p> <p>2001-01-01</p> <p>Three-dimensional nanoscale structures of lead were fabricated by electrodeposition of pure lead into artificial porous opal. The size of the metallic regions was comparable to the superconducting coherence length of bulk lead. Tc as high as 7.36 K was observed, also d Tc/d H was 2.7 times smaller than in bulk lead. Many of the characteristics of these differ from bulk lead, a type I superconductor. Irreversibility line and magnetic relaxation rates ( S) were also studied. S( T) displayed two maxima, with a peak value about 10 times smaller than that of typical high- Tc superconductors.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1247992','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/servlets/purl/1247992"><span>Production of radionuclide molybdenum 99 in a distributed and in situ fashion</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Gentile, Charles A.; Cohen, Adam B.; Ascione, George</p> <p>2016-04-19</p> <p>A method and apparatus for producing Mo-99 from Mo-100 for the use of the produced Mo-99 in a Tc-99m generator without the use of uranium is presented. Both the method and apparatus employ high energy gamma rays for the transformation of Mo-100 to Mo-99. The high energy gamma rays are produced by exposing a metal target to a moderated neutron output of between 6 MeV and 14 MeV. The resulting Mo-99 spontaneously decays into Tc-99m and can therefore be used in a Tc-99m generator.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3476334','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3476334"><span>HiTC: exploration of high-throughput ‘C’ experiments</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Servant, Nicolas; Lajoie, Bryan R.; Nora, Elphège P.; Giorgetti, Luca; Chen, Chong-Jian; Heard, Edith; Dekker, Job; Barillot, Emmanuel</p> <p>2012-01-01</p> <p>Summary: The R/Bioconductor package HiTC facilitates the exploration of high-throughput 3C-based data. It allows users to import and export ‘C’ data, to transform, normalize, annotate and visualize interaction maps. The package operates within the Bioconductor framework and thus offers new opportunities for future development in this field. Availability and implementation: The R package HiTC is available from the Bioconductor website. A detailed vignette provides additional documentation and help for using the package. Contact: nicolas.servant@curie.fr Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22923296</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013PhPro..45...25A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013PhPro..45...25A"><span>SCDFT Study of High Tc Nitride Superconductors</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Arita, R.</p> <p></p> <p>Based on the density functional theory for superconductors (SCDFT), we study the pairing mechanism of the layered nitride superconductors, β-LixMNCl (M=Zr, Hf). Recently, it has been shown that SCDFT reproduces experimental superconducting transition temperatures (Tc) of conventional superconductors very accurately. Here we use SCDFT as a "litmus paper" to determine whether the system is a conventional or unconventional superconductor. We show that Tc estimated by SCDFT is less than half of the experimental Tc and its doping dependence is opposite to that observed in the experiments. The present result suggests that β- LixMNCl is not a Migdal-Eliashberg type superconductor.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24503698','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24503698"><span>Toxicology and Carcinogenesis Studies of Mixtures of 3'-Azido-3'-Deoxythymidine (AZT), Lamivudine (3TC), and Nevirapine (NVP) (CAS Nos. 30516-87-1, 134678-17-4, 129618-40-2) in Genetically Modified C3B6.129F1-Trp53(tm1Brd) N12 Haploinsufficient Mice (in utero and postnatal gavage studies).</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p></p> <p>2013-10-01</p> <p>3'-Azido-3'-deoxythymidine (AZT) is the most widely used and evaluated chemotherapeutic agent for the treatment of persons with acquired immune deficiency syndrome (AIDS). Antiviral therapy is essential for treatment and prevention of AIDS in adults and children infected with human immunodeficiency virus (HIV), and to prevent mother-to-child transmission of HIV during pregnancy and labor. The studies described in this report were designed to determine possible long-term sequelae from AZT treatment, often used in combination with other antiviral drugs, such as lamivudine (3TC) and nevirapine (NVP) in preventing mother-to-child transmission of HIV. Male and female heterozygous F1 p53+/- mice were exposed to AZT, 3TC, NVP, or combinations of the chemicals in utero on gestation days (GD) 12 through 18, then administered the same chemical or combination of chemicals by gavage from postnatal day (PND) 1 through PND 28 and then observed until 45 weeks of age. Vehicle control mice received only an aqueous solution containing 0.2% methylcellulose and 0.1% Tween 80. Mice were dosed twice daily until PND 28. Genetic toxicology studies were conducted in mouse peripheral blood erythrocytes. The study compared three combination doses of AZT, 3TC and NVP (AZT/3TC/NVP-L, AZT/3TC/NVP-M, and AZT/3TC/NVP-H) with the vehicle controls, and compared the individual components with each other at the highest dose (AZT-H, 3TC-H, NVP-H, AZT/3TC-H and AZT/3TC/NVP-H). Because exposure to AZT/3TC/NVP-M and AZT/3TC/NVP-H reduced pup survival, additional litters were required to provide sufficient pups to load the 45-week study. 45-WEEK STUDY: In general, survival was relatively high once the pup exposure phase had been completed, with at least 75% of the mice surviving to terminal sacrifice in all groups. For males, survival was significantly greater in the AZT/3TC/NVP-L and AZT/3TC/NVP-M groups relative to the vehicle control group. There were no significant differences in survival between high dose groups of the constituent chemicals in either sex; however, survival of females in the AZT/3TC-H group was significantly less than that in the vehicle control group. Early deaths were predominantly associated with occurrences of malignant lymphoma, mammary gland tumors, and osteosarcomas. In the combination dose comparison, males and females dosed with the AZT/3TC/NVP-H combination had significantly decreased body weights compared to the vehicle control groups from PND 11 when individual monitoring began until 20 (males) or 11 (females) weeks. In addition, mean body weights for the male and female AZT/3TC/NVP-M groups were significantly less than those of the vehicle control groups until 14 weeks. In the high dose comparison, mean body weights of the male and female AZT-H groups were significantly less than those of the vehicle control groups during some of the early weeks of dosing. In male and female mice, absolute brain weights of the combination dose groups decreased with increasing dose and, except in low dose males, the absolute brain weights of the dosed groups were significantly less than those of the vehicle control groups. When the high doses of the constituent chemicals were compared, absolute brain weights of the male and female AZT-H and AZT/3TC/NVP-H groups were significantly less than those of the vehicle control groups. However, relative brain weights were not significantly altered. Relative liver weights of male combination dose groups followed a positive trend with dose. When the high dose groups were compared, increases in relative liver weights of male mice appeared to be associated with AZT exposure. In combination dose groups, the absolute heart weight of AZT/3TC/NVP-H females was significantly greater than that of the vehicle control group, and there was a positive trend in absolute heart weights. There was also a positive trend for relative heart weights in these combination dose groups, though no individual group relative weight was significantly greater than that of the vehicle control group. In females, absolute heart weight was also significantly increased in the AZT/3TC-H group relative to the vehicle control group. A small but statistically significant increase in serum alanine aminotransferase activity was observed in the male AZT/3TC/NVP-H group compared to the vehicle control group. In the combination dose comparison, the incidences of hepatocellular adenoma and hepatocellular adenoma or carcinoma (combined) in the liver of all groups of males dosed with AZT/3TC/NVP were significantly increased compared to the vehicle control group. In the high dose comparison, the incidences of hepatocellular adenoma in males in the AZT-H group and hepatocellular adenoma and hepatocellular adenoma or carcinoma (combined) in males in the AZT/3TC-H and AZT/3TC/NVP-H groups were significantly greater than those in the vehicle control group; the incidences of these lesions in the 3TC-H and NVP-H groups were significantly less than those in the AZT/3TC/NVP-H group. The incidences of malignant lymphoma in males administered AZT-H or AZT/3TC-H and in females administered AZT/3TC/NVP-M, AZT/3TC/NVP-H, NVP-H, or AZT/3TC-H were slightly greater than those in the vehicle control groups. The incidence of mammary gland adenoacanthoma or adenocarcinoma (combined) in females administered 3TC-H was slightly greater than that in the vehicle control group. In the peripheral blood of 1-day-old male and female mice, the percentage of total reticulocytes (RETs) was significantly decreased in groups exposed to doses that contained AZT. In addition, the percentages of micronucleated normochromatic erythrocytes (NCEs) and micronucleated RETs were generally significantly increased in groups exposed to doses containing AZT, but not in the 3TC-H or NVP-H groups. The percentages of micronucleated NCEs in the AZT/3TC/NVP-H groups were greater than in the AZT-H and the AZT/3TC-H groups. In peripheral blood of male pups evaluated at PND 28, both the percentage of micronucleated RETs and the percentage of micronucleated NCEs were significantly increased in the group where 3TC was coadministered with AZT compared to the group administered only AZT. Under the conditions of this gavage study, there was clear evidence of carcinogenic activity of AZT alone in male heterozygous F1 p53+/- mice based on increased incidences of hepatocellular adenoma. There was clear evidence of carcinogenic activity of AZT in combination with 3TC, and AZT in combination with 3TC and NVP in male heterozygous F1 p53+/- mice based on increased incidences of hepatocellular adenoma and hepatocellular adenoma or carcinoma (combined). The occurrence of malignant lymphoma may have been related to treatment with AZT alone and with AZT in combination with 3TC. There was no evidence of carcinogenic activity of 3TC alone in male heterozygous F1 p53+/- mice administered 150 mg/kg. There was no evidence of carcinogenic activity of NVP alone in male heterozygous F1 p53+/- mice administered 168 mg/kg. There was equivocal evidence of carcinogenic activity of NVP alone, AZT in combination with 3TC, and AZT in combination with 3TC and NVP in female heterozygous F1 p53+/- mice based on the occurrence of malignant lymphoma. There was equivocal evidence of carcinogenic activity of 3TC alone in female heterozygous F1 p53+/- mice based on the occurrence of mammary gland adenoacanthoma or adenocarcinoma (combined). There was no evidence of carcinogenic activity of AZT alone in female heterozygous F1 p53+/- mice administered 240 mg/kg. Synonyms: (3'-AZIDO-3'-DEOXYTHYMIDINE) 3'-azido-2',3'-dideoxythymidine; azidodeoxythymidine; azidothymidine; 3'-azidothymidine; AZT; BW A509U; Compound S; 3'-deoxy-3'-azidothymidine; 3'-deoxy-(8CI) (9CI); ZDV; zidovudine. Trade name: Retrovir® [Combivir® with 3TC] Synonyms: (2',3'-DIDEOXY-3'-THIACYTIDINE) 3TC; 4-amino-1-[(2R,5S)-2-(hydroxymethyl)-1,3-oxathiolan-5-yl]-1,2-dihydropyrimidin-2-one; L-2',3'-dideoxy-3'-thiacytidine; lamivudine Trade name: Epivir® [Combivir® with AZT] Synonyms: (NEVIRAPINE) NVP; 11-cyclopropyl-4-methyl-5,11-dihydro-6H- dipyrido[3,2-b:2',3'-e][1,4]diazepin-6-one Trade name: Viramune®</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018PhRvB..97f0501A','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018PhRvB..97f0501A"><span>Multiband full-bandwidth anisotropic Eliashberg theory of interfacial electron-phonon coupling and high - Tc superconductivity in FeSe /SrTiO3</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Aperis, Alex; Oppeneer, Peter M.</p> <p>2018-02-01</p> <p>We examine the impact of interfacial phonons on the superconducting state of FeSe /SrTiO3 developing a material's specific multiband, full bandwidth, and anisotropic Eliashberg theory for this system. Our self-consistent calculations highlight the importance of the interfacial electron-phonon interaction, which is hidden behind the seemingly weak-coupling constant λm=0.4 , in mediating the high Tc, and explain other puzzling experimental observations, such as the s -wave symmetry and replica bands. We discover that the formation of replica bands has a Tc decreasing effect that is nevertheless compensated by deep Fermi-sea Cooper pairing which has a Tc enhancing effect. We predict a strong-coupling dip-hump signature in the tunneling spectra due to the interfacial coupling.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017PhyA..465...91S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017PhyA..465...91S"><span>Extended nonlinear feedback model for describing episodes of high inflation</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Szybisz, Martín A.; Szybisz, Leszek</p> <p>2017-01-01</p> <p>An extension of the nonlinear feedback (NLF) formalism to describe regimes of hyper- and high-inflation in economy is proposed in the present work. In the NLF model the consumer price index (CPI) exhibits a finite time singularity of the type 1 /(tc - t) (1 - β) / β, with β > 0, predicting a blow up of the economy at a critical time tc. However, this model fails in determining tc in the case of weak hyperinflation regimes like, e.g., that occurred in Israel. To overcome this trouble, the NLF model is extended by introducing a parameter γ, which multiplies all terms with past growth rate index (GRI). In this novel approach the solution for CPI is also analytic being proportional to the Gaussian hypergeometric function 2F1(1 / β , 1 / β , 1 + 1 / β ; z) , where z is a function of β, γ, and tc. For z → 1 this hypergeometric function diverges leading to a finite time singularity, from which a value of tc can be determined. This singularity is also present in GRI. It is shown that the interplay between parameters β and γ may produce phenomena of multiple equilibria. An analysis of the severe hyperinflation occurred in Hungary proves that the novel model is robust. When this model is used for examining data of Israel a reasonable tc is got. High-inflation regimes in Mexico and Iceland, which exhibit weaker inflations than that of Israel, are also successfully described.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5155308','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5155308"><span>Switching from Controlled Ring-Opening Polymerization (cROP) to Controlled Ring-Closing Depolymerization (cRCDP) by Adjusting the Reaction Parameters That Determine the Ceiling Temperature</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p></p> <p>2016-01-01</p> <p>Full control over the ceiling temperature (Tc) enables a selective transition between the monomeric and polymeric state. This is exemplified by the conversion of the monomer 2-allyloxymethyl-2-ethyl-trimethylene carbonate (AOMEC) to poly(AOMEC) and back to AOMEC within 10 h by controlling the reaction from conditions that favor ring-opening polymerization (Tc > T0) (where T0 is the reaction temperature) to conditions that favor ring-closing depolymerization (Tc < T0). The ring-closing depolymerization (RCDP) mirrors the polymerization behavior with a clear relation between the monomer concentration and the molecular weight of the polymer, indicating that RCDP occurs at the chain end. The Tc of the polymerization system is highly dependent on the nature of the solvent, for example, in toluene, the Tc of AOMEC is 234 °C and in acetonitrile Tc = 142 °C at the same initial monomer concentration of 2 M. The control over the monomer to polymer equilibrium sets new standards for the selective degradation of polymers, the controlled release of active components, monomer synthesis and material recycling. In particular, the knowledge of the monomer to polymer equilibrium of polymers in solution under selected environmental conditions is of paramount importance for in vivo applications, where the polymer chain is subjected to both high dilution and a high polarity medium in the presence of catalysts, that is, very different conditions from which the polymer was formed. PMID:27783494</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014PhDT.......174W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014PhDT.......174W"><span>Understanding the influence of assimilating satellite-derived observations on mesoscale analyses and forecasts of tropical cyclone track and structure</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Wu, Ting-Chi</p> <p></p> <p>This dissertation research explores the influence of assimilating satellite-derived observations on mesoscale numerical analyses and forecasts of tropical cyclones (TC). The ultimate goal is to provide more accurate mesoscale analyses of TC and its surrounding environment for superior TC track and intensity forecasts. High spatial and temporal resolution satellite-derived observations are prepared for two TC cases, Typhoon Sinlaku and Hurricane Ike (both 2008). The Advanced Research version of the Weather and Research Forecasting Model (ARW-WRF) is employed and data is assimilated using the Ensemble Adjustment Kalman Filter (EAKF) implemented in the Data Assimilation Research Testbed. In the first part of this research, the influence of assimilating enhanced atmospheric motion vectors (AMVs) derived from geostationary satellites is examined by comparing three parallel WRF/EnKF experiments. The control experiment assimilates the same AMV dataset assimilated in NCEP operational analysis along with conventional observations from radiosondes, aircraft, and advisory TC position data. During Sinlaku and Ike, the Cooperative Institute for Meteorological Satellite Studies (CIMSS) generates hourly AMVs along with Rapid-Scan (RS) AMVs when the satellite RS mode is activated. With an order of magnitude more AMV data assimilated, the assimilation of hourly CIMSS AMV dataset exhibit superior initial TC position, intensity and structure estimates to the control analyses and the subsequent short-range forecasts. When RS AMVs are processed and assimilated, the addition of RS AMVs offers additional modification to the TC and its environment and leads to Sinlaku's recurvature toward Japan, albeit prematurely. The results demonstrate the promise of assimilating enhanced AMV data into regional TC models. The second part of this research continues the work in the first part and further explores the influence of assimilating enhanced AMV datasets by conducting parallel data-denial WRF/EnKF experiments that assimilate AMVs subsetted horizontally by their distances to the TC center (interior and exterior) and vertically by their assigned heights (upper, middle, and lower layers). For both Sinlaku and Ike, it is found: 1) interior AMVs are important for accurate TC intensity, 2) excluding upper-layer AMVs generally results in larger track errors and ensemble spread, 3) exclusion of interior AMVs has the largest impact on the forecast of TC size than exclusively removing AMVs in particular tropospheric layers, 4) the largest ensemble spreads are found in track, intensity, and size forecasts when interior and upper-layer AMVs are not included, 5) withholding the middle-layer AMVs can improve the track forecasts. Findings from this study could influence future scenarios that involve the targeted acquisition and assimilation of high-density AMV observations in TC events. The last part of the research focuses on the assimilation of hyperspectral temperature and moisture soundings and microwave based vertically-integrated total precipitable water (TPW) products derived from polar-orbiting satellites. A comparison is made between the assimilation of soundings retrieved from the combined use of Advanced Microwave Scanning Radiometer and Atmospheric Infrared Sounder (AMSU-AIRS) and sounding products provided by CIMSS (CIMSS-AIRS). AMSU-AIRS soundings provide broad spatial coverage albeit coarse resolution, whilst CIMSS-AIRS is geared towards mesoscale applications and thus provide higher spatial resolution but restricted coverage due to the use of radiance in clear sky. The assimilation of bias-corrected CIMSS-AIRS soundings provides slightly more accurate TC structure than the control case. The assimilation of AMSU-AIRS improves the track forecasts but produces weaker and smaller storm. Preliminary results of assimilating TPW product derived from the Advanced Microwave Scanning Radiometer-EOS indicate improved TC structure over the control case. However, the short-range forecasts exhibit the largest TC track errors. In all, this study demonstrates the influence of assimilating high-resolution satellite data on mesoscale analyses and forecasts of TC track and structure. The results suggest the inclusion and assimilation of observations with high temporal resolution, broad spatial coverage, and greater proximity to TCs does indeed improve TC track and structure forecasts. Such findings are beneficial for future decisions on data collecting and retrievals that are essential for TC forecasts.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014PhDT.......446K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014PhDT.......446K"><span>Global warming and tropical cyclone climate in the western North Pacific</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Kang, Nam-Young</p> <p></p> <p>Violent tropical cyclones (TCs) continue to inflict serious impacts on national economies and welfare, but how they are responding to global warming has not been fully clarified. Here I construct an empirical framework that shows the observations supporting a strong link between rising global ocean warmth and increasing trade-off between TC intensity and frequency in the western North Pacific. Thermodynamic structure of the tropical western North Pacific with high global ocean warmth is characterized by convectively more unstable lower troposphere with greater heat and moisture, but this instability is simultaneously accompanied by anomalous high pressure in the middle and upper troposphere over the same region. Increasing trade-off level between TC intensity and frequency in a warmer year proves that this environment further inhibits the TC occurrences over the region, but TCs that form tend to discharge stored energy to upper troposphere with stronger intensities. By increasing the intensity threshold at higher levels we confirmed that the TC climate connection with global ocean warmth occurs throughout the strongest portion of TCs, and the environmental connection of the TC climate is more conspicuous in the extreme portion of TCs. Intensities at the strongest 10~% of the western North Pacific TCs are comparable to super typhoons on average, the increasing trade-off magnitude clearly suggests that super typhoons in a warmer year gets stronger. Conclusively, the negative collinear feature of the thermodynamics influences the portion of TCs at the highest intensities, and super typhoons are likely to become stronger at the expense of overall TC frequencies in a warmer world. The consequence of this finding is that record-breaking TC intensities occur at the expense of overall TC frequencies under global warming. TC activity is understood as a variation which is independent of global warming, and could be assumed to be an internal variability having no trend. Frequency variation and super typhoon intensity variation are regarded as the addition of global warming influence on TC activity variation. The structure depicts how a previous intensity record is overtaken and frequency falls continuously in the global warming environment in a linear perspective. A peak TC activity year when global ocean warmth is the highest ever is likely to experience a record-breaking intensity. In the same way, the least number of annual TCs may appear when a lull of TC activity occurs in the warmest year.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2000SuScT..13..827F','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2000SuScT..13..827F"><span>Technical issues of a high-Tc superconducting bulk magnet</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Fujimoto, Hiroyuki</p> <p>2000-06-01</p> <p>Superconducting magnets made of high-Tc superconductors are promising for industrial applications. It is well known that REBa2Cu3O7-x superconductors prepared by melt processes have a high critical current density, Jc, at 77 K and high magnetic fields. The materials are very promising for high magnetic field applications as a superconducting permanent/bulk magnet with liquid-nitrogen refrigeration. Light rare-earth (LRE) BaCuO bulks, compared with REBaCuO bulks, exhibit a larger Jc in high magnetic fields and a much improved irreversibility field, Hirr, at 77 K. In this study, we discuss technical issues of a high-Tc superconducting bulk magnet, namely the aspects of the melt processing for bulk superconductors, their characteristic superconducting properties and mechanical properties, and trapped field properties of a superconducting bulk magnet. One of the possible applications is a superconducting bulk magnet for the magnetically levitated (Maglev) train in the future.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_16");'>16</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li class="active"><span>18</span></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_18 --> <div id="page_19" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li class="active"><span>19</span></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="361"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5080415','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5080415"><span>Enhancing electric-field control of ferromagnetism through nanoscale engineering of high-Tc MnxGe1−x nanomesh</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Nie, Tianxiao; Tang, Jianshi; Kou, Xufeng; Gen, Yin; Lee, Shengwei; Zhu, Xiaodan; He, Qinglin; Chang, Li-Te; Murata, Koichi; Fan, Yabin; Wang, Kang L.</p> <p>2016-01-01</p> <p>Voltage control of magnetism in ferromagnetic semiconductor has emerged as an appealing solution to significantly reduce the power dissipation and variability beyond current CMOS technology. However, it has been proven to be very challenging to achieve a candidate with high Curie temperature (Tc), controllable ferromagnetism and easy integration with current Si technology. Here we report the effective electric-field control of both ferromagnetism and magnetoresistance in unique MnxGe1−x nanomeshes fabricated by nanosphere lithography, in which a Tc above 400 K is demonstrated as a result of size/quantum confinement. Furthermore, by adjusting Mn doping concentration, extremely giant magnetoresistance is realized from ∼8,000% at 30 K to 75% at 300 K at 4 T, which arises from a geometrically enhanced magnetoresistance effect of the unique mesh structure. Our results may provide a paradigm for fundamentally understanding the high Tc in ferromagnetic semiconductor nanostructure and realizing electric-field control of magnetoresistance for future spintronic applications. PMID:27762320</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1989ApPhL..55..598F','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1989ApPhL..55..598F"><span>Photothermal measurements of high Tc superconductors</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Fanton, J. T.; Mitzi, D. B.; Kapitulnik, A.; Khuri-Yakub, B. T.; Kino, G. S.; Gazit, D.; Feigelson, R. S.</p> <p>1989-08-01</p> <p>We demonstrate a photothermal method for making point measurements of the thermal conductivities of high Tc superconductors. Images made at room temperature on polycrystalline materials show the thermal inhomogeneities. Measurements on single-crystal Bi2Sr2CaCu2Ox compounds reveal a very large anisotropy of about 7:1 in the thermal conductivity.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1990PhyC..171..401D','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1990PhyC..171..401D"><span>Non-resonant microwave absorption in high-T c thin films</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Durny, R.; Dulcic, A.; Crepeau, R. H.; Freed, J. H.; Kus, P.</p> <p>1990-11-01</p> <p>Magnetic-field-dependent non-resonant microwave absorption in thin film samples of various high- Tc superconductors is reported. Complex types of signals were observed as the temperature was lowered from Tc to ≈ 10 K. Possible correlation between the thin film quality and the occurrence of the signals is suggested.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19920050550&hterms=susceptibility&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D80%26Ntt%3Dsusceptibility','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19920050550&hterms=susceptibility&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D80%26Ntt%3Dsusceptibility"><span>High-temperature-superconducting magnetic susceptibility bolometer</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Brasunas, J.; Lakew, B.; Lee, C.</p> <p>1992-01-01</p> <p>An infrared detector called the magnetic susceptibility bolometer is introduced which is based on the tmperature dependence of the diamagnetic screening of a high-Tc superconductor film near Tc. Results are reported for the response of a prototype model to modulated blackbody radiation. Possible improvements are discussed as is the potential sensitivity of an improved device.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA256394','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA256394"><span>Innovative Techniques for Studying New Materials and New Developments in Solid State Physics</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>1992-09-14</p> <p>acoustic resonators to study superfluid-filled silica aerogel , high Tc superconductors, and quasicrystals", to be published in J. Low Temp. Phys. 4. J. D...McKenna, and J. D. Maynard, "Using acoustic resonators to study superfluid-filled silica aerogel , high Tc superconductors, and quasicrystals", Symposium</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1993stsc.book..265R','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1993stsc.book..265R"><span>NEUTRON SCATTERING STUDY OF THE HIGH-Tc SUPERCONDUCTING SYSTEM YBa2Cu3O6+x</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Rossat-Mignod, J.; Regnault, L. P.; Bourges, P.; Burlet, P.; Vettier, C.; Henry, J. Y.</p> <p></p> <p>The following sections are included: * Introduction * The neutron scattering technique * Phase diagrams of high-Tc superconductors * The undoped AF-doped * The doped AF-state * The weakly-doped metallic state * The heavily-doped metallic state * The overdoped metallic state * Discussion and concluding remarks * Acknowledgements * References</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1992MPLB....6..617C','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1992MPLB....6..617C"><span>Can Positron 2D-ACAR Resolve the Electronic Structure of HIGH-Tc Superconductors?</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Chan, L. P.; Lynn, K. G.; Harshman, D. R.</p> <p></p> <p>We examine the ability of the positron Two-Dimensional Angular Correlation Annihilation Radiation (2D-ACAR) technique to resolve the electronic structures of high-Tc cuprate superconductors. Following a short description of the technique, discussions of the theoretical assumptions, data analysis and experimental considerations, in relation to the high-Tc superconductors, are given. We briefly review recent 2D-ACAR experiments on YBa2Cu3O7-x, Bi2Sr2CaCuO8+δ and La2-xSrxCuO4. The 2D-ACAR technique is useful in resolving the band crossings associated with the layers of the superconductors that are preferentially sampled by the positrons. Together with other Fermi surface measurements (namely angle-resolved photoemission), 2D-ACAR can resolve some of the electronic structures of high-Tc cuprate superconductors. In addition, 2D-ACAR measurements of YBa2Cu3O7-x and Bi2Sr2CaCuO8+δ also reveal an interesting temperature dependence in the fine structures, and a change in the positron lifetime in the former.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23320645','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23320645"><span>Tuning of "antenna effect" of Eu(III) in ternary systems in aqueous medium through binding with protein.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Ghorai, Shyamal Kr; Samanta, Swarna Kamal; Mukherjee, Manini; Saha Sardar, Pinki; Ghosh, Sanjib</p> <p>2013-02-04</p> <p>A simple ternary system containing a protein [human serum albumin (HSA)/bovine serum albumin (BSA)], tetracycline hydrochloride (TC), and Eu(III) in suitable aqueous buffer medium at physiological pH (= 7.2) has been shown to exhibit highly efficient "antenna effect" compared to the binary complex of TC with Eu(III) (Eu(3)TC). The ternary system containing E. coli alkaline phosphatase (AP), TC, and Eu(III), however, shows a slight enhancement of Eu(III) emission, although the binding constant of AP with TC is 2 orders of magnitude greater than with BSA/HSA. The enhanced emission of bound TC in the binary systems containing proteins and TC gets quenched in the ternary systems containing HSA/BSA, showing the efficient energy transfer (ET) from TC to Eu(III). Steady state and time-resolved emission studies of each component in all the ternary systems in H(2)O and in D(2)O medium reveal that Eu(III) is very well protected from the O-H oscillator in the ternary system containing HSA/BSA compared to that containing AP. The docking studies locating the binding site of TC in the proteins suggest that TC binds near the surface of AP. In the case of HSA/BSA, TC resides in the interior of the protein resulting in a large shielding effect of Eu(III). The rotational correlation time (θ(c)) determined from the anisotropy decay of bound TC in the complexes and the accessible surface area (ASA) of the ligand in the complexes obtained from the docking studies also support the contention that Eu(3)TC is more exposed to solvent in the case of the ternary system consisting of AP, TC, and Eu(III). The calculated radiative lifetime and the sensitization efficiency ratio of Eu(III) in all the systems clearly demonstrate the protein mediated tuning of "antenna effect" in Eu(III).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5002266','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5002266"><span>Comparison of Biological Properties of 99mTc-Labeled Cyclic RGD Peptide Trimer and Dimer Useful as SPECT Radiotracers for Tumor Imaging</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Zhao, Zuo-Quan; Yang, Yong; Fang, Wei; Liu, Shuang</p> <p>2016-01-01</p> <p>Introduction This study sought to evaluate a 99mTc-labeled trimeric cyclic RGD peptide (99mTc-4P-RGD3) as the new radiotracer for tumor imaging. The objective was to compare its biological properties with those of 99mTc-3P-RGD2 in the same animal model. Methods HYNIC-4P-RGD3 was prepared by reacting 4P-RGD3 with excess HYNIC-OSu in the presence of diisopropylethylamine. 99mTc-4P-RGD3 was prepared using a kit formulation, and evaluated for its tumor-targeting capability and biodistribution properties in the BALB/c nude mice with U87MG human glioma xenografts. Planar and SPECT imaging studies were performed in athymic nude mice with U87MG glioma xenografts. For comparison purpose, 99mTc-3P-RGD2 (a αvβ3-targeted radiotracer currently under clinical evaluation for tumor imaging in cancer patients) was also evaluated in the same animal models. Blocking experiments were used to demonstrate the αvβ3 specificity of 99mTc-4P-RGD3. Results 99mTc-4P-RGD3 was prepared with >95% RCP and high specific activity (~200 GBq/µmol). 99mTc-4P-RGD3 and 99mTc-3P-RGD2 shared almost identical tumor uptake and similar biodistribution properties. 99mTc-4P-RGD3 had higher uptake than 99mTc-3P-RGD2 in the intestines and kidneys; but it showed better metabolic stability. The U87MG tumors were clearly visualized by SPECT with excellent contrast with 99mTc-4P-RGD3 and 99mTc-3P-RGD2. Conclusion Increasing peptide multiplicity from 3P-RGD2 to 4P-RGD3 offers no advantages with respect to the tumor-targeting capability. 99mTc-4P-RGD3 is as good a SPECT radiotracer as 99mTc-3P-RGD2 for imaging αvβ3-positive tumors. PMID:27556955</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/1027409-discovery-robust-magnetism-technetium-oxide-structure-catco3','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/1027409-discovery-robust-magnetism-technetium-oxide-structure-catco3"><span>The discovery of robust magnetism in a technetium oxide: The structure of CaTcO3</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Avdeev, Maxim; Thorogood, Gordon J.; Carter, Melody L.</p> <p></p> <p>The technetium perovskite CaTcO{sub 3} has been synthesized. Combining synchrotron X-ray and neutron diffraction, we found that CaTcO{sub 3} is an antiferromagnetic with a surprisingly high Neel temperature of 800 K. The transition to the magnetic state does not involve a structural change, but there is obvious magnetostriction. Electronic structure calculations confirm the experimental results.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/9436291','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/9436291"><span>Evaluation of 99mtechnetium-radiopharmaceutical binding to blood elements using different trichloroacetic acid concentrations.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Freitas, R S; Gutfilen, B; da Fonseca, L M; Bernardo-Filho, M</p> <p>1996-01-01</p> <p>Secure determination of the binding of 99mTc-radiopharmaceuticals to plasma (P) and blood cell (BC) constituents can help to understand the biodistribution of radiophamaceuticals. The reported precipitation studies of blood with radiopharmaceuticals have shown that the results can not be easily compared between studies. We decided to determine the "gold standard" concentration of trichloroacetic acid (TCA) to evaluate the binding to blood elements for several radiopharmaceuticals used in routine nuclear medicine. We have studied phytic (99mTc-PHY), diethylenetriaminepentaacetic (99mTc-DTPA), glucoheptonic (99mTc-GHA) and dimercaptosuccinic (99mTc-DMSA) acids. Blood was incubated with radiopharmaceuticals, centrifuged and P and BC separated. Samples of P and BC were also precipitated with TCA concentrations (20.0, 10.0, 5.0, 1.0, 0.5 and 0.1 percent) and soluble (SF) and insoluble fractions (IF) were isolated. The percent radioactivity (percent rad) in IF-P depends on TCA concentration. It varied from 36.4 to 65.0 (99mTc-PHY), from 17.9 to 32.0 (99mTc-DTPA), from 11.5 to 38.8 (99mTc-GHA) and from 52.8 to 66.2 (99mTc-DMSA). The results for the binding of 99mTc-PHY to IF-P show that there was no differences in the percent rad when TCA concentrations of 0.1 to 1.0 percent were used. For 99mTc-DTPA, 5.0 percent is the best TCA concentration. For 99mTc-GHA, low values of percent rad bound to IF-P is found with TCA concentrations of 0.1, 0.5 and 1.0. Interestingly, with 99mTc-DMSA, high values of bound radioactivity are not dependent on TCA concentrations (0.1 to 10.0). Radioactivity in IF-BC depends on TCA concentration and it varied for 99mTc-PHY (80.1 to 54.1) and for 99mTc-GHA (85.5 to 61.7). With 99mTc-DTPA and with 99mTc-DMSA the percent rad in IF-BC seems independent of TCA concentration. We suggest that the evaluation of the binding of the various 99mTc-radiopharmaceuticals to blood constituents, using only one TCA concentration, should be avoided.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/1987990','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/1987990"><span>Relation of family history and reversible risk factors to coronary heart disease prevalence in an Afrikaner community.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Rossouw, J E; Thompson, M L; Jooste, P L; Swanepoel, A S; Jordaan, P C</p> <p>1991-01-01</p> <p>In a cross-sectional study of an Afrikaner community (n = 2,722 men and n = 3,173 women aged 25-64 years), family history of coronary heart disease (CHD) was associated with an adverse risk factor profile and with prevalent CHD. Men with myocardial infarction (MI) and a family history of CHD had higher total minus high density lipoprotein cholesterol (TC-HDLC) levels than men with MI but no CHD family history. In preliminary multiple regression analyses, family history of CHD appeared to exert its effect partly independently of known risk factors and partly dependently through age, TC minus HDLC, and HDLC. Even though their association with MI was weakened after entering family history into the models, the reversible risk factors (particularly TC minus HDLC, HDLC, and uric acid levels) continued to contribute to CHD. For MI in men, there was an interaction between family history of CHD and TC minus HDLC, to the extent that raised TC minus HDLC levels were adverse only in the presence of a positive CHD family history. The findings suggest coinheritance of high blood cholesterol and increased susceptibility to CHD. If confirmed in prospective studies, the interaction between family history and TC minus HDLC will have implications for cholesterol screening and management.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28443689','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28443689"><span>Recent achievements in Tc-99m radiopharmaceutical direct production by medical cyclotrons.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Boschi, Alessandra; Martini, Petra; Pasquali, Micol; Uccelli, Licia</p> <p>2017-09-01</p> <p>99m Tc is the most commonly used radionuclide in the field of diagnostic imaging, a noninvasive method intended to diagnose a disease, assess the disease state and monitor the effects of treatments. Annually, the use of 99m Tc, covers about 85% of nuclear medicine applications. This isotope releases gamma rays at about the same wavelength as conventional X-ray diagnostic equipment, and owing to its short half-life (t ½  = 6 h) is ideal for diagnostic nuclear imaging. A patient can be injected with a small amount of 99m Tc and within 24 h almost 94% of the injected radionuclide would have decayed and left the body, limiting the patient's radiation exposure. 99m Tc is usually supplied to hospitals through a 99 Mo/ 99m Tc radionuclide generator system where it is produced from the β decay of the parent nuclide 99 Mo (t ½  = 66 h), which is produced in nuclear reactors via neutron fission. Recently, the interruption of the global supply chain of reactor-produced 99 Mo, has forced the scientific community to investigate alternative production routes for 99m Tc. One solution was to consider cyclotron-based methods as potential replacement of reactor-based technology and the nuclear reaction 100 Mo(p,2n) 99m Tc emerged as the most worthwhile approach. This review reports some achievements about 99m Tc produced by medical cyclotrons. In particular, the available technologies for target design, the most efficient extraction and separation procedure developed for the purification of 99m Tc from the irradiated targets, the preparation of high purity 99m Tc radiopharmaceuticals and the first clinical studies carried out with cyclotron produced 99m Tc are described.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2004GeCoA..68..643L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2004GeCoA..68..643L"><span>Experimental partitioning of Tc, Mo, Ru, and Re between solid and liquid during crystallization in Fe-Ni-S 1</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Lazar, C.; Walker, D.; Walker, R. J.</p> <p>2004-02-01</p> <p>Technetium isotopes 97Tc, 98Tc and 99Tc decay to 97Mo, 98Ru and 99Ru, with half-lives of 2.6 My, 4.1 My, and 0.21 My respectively. If there were early solar system processes that resulted in significant fractionation of Tc from the daughter elements, decay of extant Tc could have led to the creation of Mo and Ru isotopic heterogeneities. To assess the potential of metallic core crystallization to fractionate these elements, we examine the partitioning behavior of Tc relative to Re, Mo and Ru in the Fe-Ni-S system between solid metal and liquid metal alloy. The experimental evidence shows that Tc behaves more like the modestly compatible siderophile element Ru than the more highly compatible siderophile element Re, and that Tc is substantially more compatible than Mo. We also demonstrate a pressure effect in the partitioning of Mo during the crystallization of Fe-Ni-S melts. For a sulfur concentration in the liquid fraction of the core of 10 wt% (16.3 at%), the Jones and Malvin (1990) parameter is -ln(1-2 × 1.09 × 0.163) ≅ 0.44, which yields: D(Re) ≅ 4.1; D(Ru) ≅ 2.3; D(Tc) ≅ 1.7; D(Mo) Lo-P ≅ 1.0;.and D(Mo) Hi-P ≅ 0.5. Our results suggest that detectable Tc-induced isotopic anomalies (≥0.1 ɛ unit) in Ru and Mo could only be produced by unrealistically extreme degrees of crystallization of metal during asteroidal core fractionation, regardless of the time scales and initial Tc abundances involved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/14871625','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/14871625"><span>Characterization of two chitin synthase genes of the red flour beetle, Tribolium castaneum, and alternate exon usage in one of the genes during development.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Arakane, Yasuyuki; Hogenkamp, David G; Zhu, Yu Cheng; Kramer, Karl J; Specht, Charles A; Beeman, Richard W; Kanost, Michael R; Muthukrishnan, Subbaratnam</p> <p>2004-03-01</p> <p>Two chitin synthase (CHS) genes of the red flour beetle, Tribolium castaneum, were sequenced and their transcription patterns during development examined. By screening a BAC library of genomic DNA from T. castaneum (Tc) with a DNA probe encoding the catalytic domain of a putative Tribolium CHS, several clones that contained CHS genes were identified. Two distinct PCR products were amplified from these BAC clones and confirmed to be highly similar to CHS genes from other insects, nematodes and fungi. The DNA sequences of these genes, TcCHS1 and TcCHS2, were determined by amplification of overlapping PCR fragments from two of the BAC DNAs and mapped to different linkage groups. Each ORF was identified and full-length cDNAs were also amplified, cloned and sequenced. TcCHS1 and TcCHS2 encode transmembrane proteins of 1558 and 1464 amino acids, respectively. The TcCHS1 gene was found to use alternate exons, each encoding 59 amino acids, a feature not found in the TcCHS2 gene. During development, Tribolium expressed TcCHS1 predominantly in the embryonic and pupal stages, whereas TcCHS2 was prevalent in the late larval and adult stages. The alternate exon 8a of TcCHS1 was utilized over a much broader range of development than exon 8b. We propose that the two isoforms of the TcCHS1 enzyme are used predominantly for the formation of chitin in embryonic and pupal cuticles, whereas TcCHS2 is utilized primarily for the synthesis of peritrophic membrane-associated chitin in the midgut.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29524814','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29524814"><span>Response of ginger growth to a tetracycline-contaminated environment and residues of antibiotic and antibiotic resistance genes.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Liu, Xiaohui; Lv, Yao; Xu, Kun; Xiao, Xinxin; Xi, Beidou; Lu, Shaoyong</p> <p>2018-06-01</p> <p>The presence of antibiotic residues in vegetables has been highlighted as a risk to human health; antibiotics not only cause toxic effects to plants but can also induce antibiotic resistance gene (ARG) expression. Using a soil-free approach, this study aimed to explore the response of ginger growth to tetracycline (TC) pollution and to assess the levels of antibiotic residues in different plant organs and the presence of ARGs in the rhizome. Ginger growth in a highly TC-contaminated environment was remarkably inhibited. Photosynthetic parameters, fluorescence parameters, and some physiological indicators (oxidative substances, photosynthetic pigments, enzyme activity, etc.) were negatively influenced by TC contamination. Although the superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activity levels significantly increased, their effects appear to be limited. The accumulation of TC in the rhizome (28.1 mg kg -1 ) was greater than that in the roots, stem, or leaves. All tested antibiotic resistance genes except for tetL were detectable in the rhizome, and their relative abundance was in the order integron1>tetG > tetA > tetC > tetB > tetM. The level of TC in ginger rhizomes was much higher than the maximum residue limits. The potential dose of TC acquired from the consumption of ginger grown in a highly TC-contaminated environment poses no obvious risk to adults but may be a threat to children. Copyright © 2018 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24508013','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24508013"><span>Validation of transcutaneous bilirubin nomogram for identifying neonatal hyperbilirubinemia in healthy Chinese term and late-preterm infants: a multicenter study.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Yu, Zhangbin; Han, Shuping; Wu, Jinxia; Li, Mingxia; Wang, Huaiyan; Wang, Jimei; Liu, Jiebo; Pan, Xinnian; Yang, Jie; Chen, Chao</p> <p>2014-01-01</p> <p>to prospectively validate a previously constructed transcutaneous bilirubin (TcB) nomogram for identifying severe hyperbilirubinemia in healthy Chinese term and late-preterm infants. this was a multicenter study that included 9,174 healthy term and late-preterm infants in eight hospitals of China. TcB measurements were performed using a JM-103 bilirubinometer. TcB values were plotted on a previously developed TcB nomogram, to identify the predictive ability for subsequent significant hyperbilirubinemia. in the present study, 972 neonates (10.6%) developed significant hyperbilirubinemia. The 40(th) percentile of the nomogram could identify all neonates who were at risk of significant hyperbilirubinemia, but with a low positive predictive value (PPV) (18.9%). Of the 453 neonates above the 95(th) percentile, 275 subsequently developed significant hyperbilirubinemia, with a high PPV (60.7%), but with low sensitivity (28.3%). The 75(th) percentile was highly specific (81.9%) and moderately sensitive (79.8%). The area under the curve (AUC) for the TcB nomogram was 0.875. this study validated the previously developed TcB nomogram, which could be used to predict subsequent significant hyperbilirubinemia in healthy Chinese term and late-preterm infants. However, combining TcB nomogram and clinical risk factors could improve the predictive accuracy for severe hyperbilirubinemia, which was not assessed in the study. Further studies are necessary to confirm this combination. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/20538463','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/20538463"><span>Synthesis of Tc-99m labeled 1,2,3-triazole-4-yl c-met binding peptide as a potential c-met receptor kinase positive tumor imaging agent.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kim, Eun-Mi; Joung, Min-Hee; Lee, Chang-Moon; Jeong, Hwan-Jeong; Lim, Seok Tae; Sohn, Myung-Hee; Kim, Dong Wook</p> <p>2010-07-15</p> <p>The mesenchymal-epithelial transition factor (c-Met), which is related to tumor cell growth, angiogenesis and metastases, is known to be overexpressed in several tumor types. In this study, we synthesized technetium-99m labeled 1,2,3-triazole-4-yl c-Met binding peptide (cMBP) derivatives, prepared by solid phase peptide synthesis and the 'click-to-chelate' protocol for the introduction of tricarbonyl technetium-99m, as a potential c-Met receptor kinase positive tumor imaging agent, and evaluated their in vitro c-Met binding affinity, cellular uptake, and stability. The (99m)Tc labeled cMBP derivatives ([(99m)Tc(CO)(3)]12, [(99m)Tc(CO)(3)]13, and [(99m)Tc(CO)(3)]14) were prepared in 85-90% radiochemical yields. The cold surrogate cMBP derivatives, [Re(CO)(3)]12, [Re(CO)(3)]13, and [Re(CO)(3)]14, were shown to have high binding affinities (0.13 microM, 0.06 microM, and 0.16 microM, respectively) to a purified cMet/Fc chimeric recombinant protein. In addition, the in vitro cellular uptake and inhibition studies demonstrated the high specific binding of these (99m)Tc labeled cMBP derivatives ([(99m)Tc(CO)(3)]12-14) to c-Met receptor positive U87MG cells. 2010 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26315830','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26315830"><span>Predictive Value of 99mTc-MAA SPECT for 90Y-Labeled Resin Microsphere Distribution in Radioembolization of Primary and Secondary Hepatic Tumors.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Ilhan, Harun; Goritschan, Anna; Paprottka, Philipp; Jakobs, Tobias F; Fendler, Wolfgang P; Todica, Andrei; Bartenstein, Peter; Hacker, Marcus; Haug, Alexander R</p> <p>2015-11-01</p> <p>This study analyzed the predictive value of (99m)Tc-labeled macroaggregated albumin ((99m)Tc-MAA) SPECT for (90)Y-labeled resin microsphere therapy (radioembolization) by comparing uptake on pretherapeutic (99m)Tc-MAA SPECT with uptake on posttherapeutic (90)Y-bremsstrahlung SPECT. We included 502 patients (55% male; mean age ± SD, 62 ± 11 y) who underwent radioembolization between 2005 and 2013 because of primary or secondary liver malignancies (colorectal cancer [n = 195, 38.8%], neuroendocrine tumors [n = 77, 15.3%], breast cancer [n = 68, 13.5%], hepatocellular carcinoma [n = 59, 11.8%], cholangiocellular carcinoma [n = 40, 8.0%], or urologic tumors [n = 14, 2.8%]). Manually drawn regions of interest around tumors and adjacent healthy liver tissue for up to 3 lesions per patient on (99m)Tc-MAA and (90)Y-bremsstrahlung scans were used to quantify mean counts per pixel and evaluate the mean tumor-to-background ratio (TBR). Data were given as mean ± SD. Additionally, uptake in lesions on (99m)Tc-MAA and (90)Y-bremsstrahlung scans was graded visually as homogeneously higher than (grade 1), heterogeneously higher than (grade 2), equal to (grade 3), or lower than (grade 4) uptake in normal liver tissue. The Mann-Whitney U test and Spearman correlation were used to evaluate statistically significant differences between (99m)Tc-MAA and (90)Y-bremsstrahlung SPECT. In total, 1,008 lesions were analyzed. Of the 23% (230/1,008) of lesions that had grade 1 uptake on (99m)Tc-MAA SPECT, 81% (186/230) remained grade 1 after radioembolization whereas 16% (37/230) were grade 2. Of the lesions with grade 2 uptake on (99m)Tc-MAA SPECT, 16% had grade 1 uptake and 82% grade 2 uptake after radioembolization. Of the lesions with grade 3 uptake, however, 27% had grade 1 uptake and 47% grade 2 uptake after radioembolization. Even among the lesions with grade 4 uptake on (99m)Tc-MAA SPECT, 21% had grade 1 uptake and 46% grade 2 uptake after radioembolization. The mean TBR on (99m)Tc-MAA and (90)Y-bremsstrahlung SPECT showed a significant, though low, correlation in the total population (r = 0.26; P < 0.001) and in hepatocellular carcinoma (r = 0.4; P < 0.001), cholangiocellular carcinoma (r = 0.3; P < 0.05), breast cancer (r = 0.3; P < 0.001), colorectal cancer (r = 0.2; P < 0.001), and neuroendocrine tumors (r = 0.2; P < 0.01). Although significant for most lesions, the correlation between (99m)Tc-MAA and (90)Y-microsphere mean TBR was low. Classifying uptake into 4 grades revealed that lesions with high uptake on (99m)Tc-MAA SPECT maintain high uptake within radioembolization. More than 60% of lesions with a pretherapeutically lower uptake than in healthy liver tissue, however, showed high uptake within radioembolization. Patients with low tumor uptake on pretherapeutic (99m)Tc-MAA imaging should not be excluded from radioembolization. © 2015 by the Society of Nuclear Medicine and Molecular Imaging, Inc.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28533635','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28533635"><span>Tc-99m Ethylenedicysteine and Tc-99m Dimercaptosuccinic Acid Scintigraphy-Comparison of the Two for Detection of Scarring and Differential Cortical Function.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Dharmalingam, Anitha; Pawar, Shwetal U; Parelkar, Sandesh V; Shetye, Suruchi S; Ghorpade, Mangala K; Tilve, Gundu H</p> <p>2017-01-01</p> <p>The differential cortical function obtained by Tc-99m EC is comparable to that of Tc-99m DMSA. However, identification of scars on Tc-99m EC images needs to be studied. The aim of the study is to evaluate role of Tc-99m EC for detection of scarring and differential cortical function by comparing with Tc-99m DMSA. Prospective observational study of recurrent UTI; minimum 6 weeks after acute episode; when urine examination is negative for pus cells. Forty-seven children with normal positioned kidneys underwent Tc-99m EC and DMSA scintigraphy. The DRF and cortical phase images of both studies in the same image matrix size were evaluated by two independent observers for scarring; Tc-99m DMSA was considered as the gold standard. MS Excel 2007 and GraphPad Instat V3.1 and ROC analysis. There was no significant difference in the detection of scarring using two studies with Cohen's kappa coefficient (κ) 0.932. The sensitivity and specificity of Tc-99m EC for detection of scarring was 98.75% and 99.15%, respectively. There was good agreement between the differential cortical function calculated using two studies. The summed Tc-99m EC images with an acceptable high image contrast allow detection of cortical scarring in patients with normal kidney positions. It is an excellent single-modality comprehensive investigational agent for renal parenchymal defects, function, and excretion evaluation with the added advantages of lower cost, convenience, and low radiation exposure to the child.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_17");'>17</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li class="active"><span>19</span></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_19 --> <div id="page_20" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li class="active"><span>20</span></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="381"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28477335','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28477335"><span>2'β-Fluoro-Tricyclo Nucleic Acids (2'F-tc-ANA): Thermal Duplex Stability, Structural Studies, and RNase H Activation.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J</p> <p>2017-08-01</p> <p>We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/15025536','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/15025536"><span>A Tc-99m-labeled long chain fatty acid derivative for myocardial imaging.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Magata, Yasuhiro; Kawaguchi, Takayoshi; Ukon, Misa; Yamamura, Norio; Uehara, Tomoya; Ogawa, Kazuma; Arano, Yasushi; Temma, Takashi; Mukai, Takahiro; Tadamura, Eiji; Saji, Hideo</p> <p>2004-01-01</p> <p>C-11- and I-123-labeled long chain fatty acid derivatives have been reported as useful radiopharmaceuticals for the estimation of myocardial fatty acid metabolism. We have reported that Tc-99m-labeled N-[[[(2-mercaptoethyl)amino]carbonyl]methyl]-N-(2-mercaptoethyl)-6-aminohexanoic acid ([(99m)Tc]MAMA-HA), a medium chain fatty acid derivative, is metabolized by beta-oxidation in the liver and that the MAMA ligand is useful for attaching to the omega-position of fatty acid derivatives as a chelating group for Tc-99m. On the basis of these findings, we focused on developing a Tc-99m-labeled long chain fatty acid derivative that reflected fatty acid metabolism in the myocardium. In this study, we synthesized a dodecanoic acid derivative, MAMA-DA, and a hexadecanoic acid derivative, MAMA-HDA, and performed radiolabeling and biodistribution studies. [(99m)Tc]MAMA-DA and [(99m)Tc]MAMA-HDA were prepared using a ligand-exchange reaction. Biodistribution studies were carried out in normal mice and rats. Then, a high initial uptake of Tc-99m was observed, followed by a rapid clearance from the heart. The maximum heart/blood ratio was 3.6 at 2 min postinjection of [(99m)Tc]MAMA-HDA. These kinetics were similar to those with postinjection of p-[(125)I]iodophenylpentadecanoic acid. Metabolite analysis showed [(99m)Tc]MAMA-HDA was metabolized by beta-oxidation in the body. In conclusion, [(99m)Tc]MAMA-HDA is a promising compound as a long chain fatty acid analogue for estimating beta-oxidation of fatty acid in the heart.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2007APS..DPPNO6012L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2007APS..DPPNO6012L"><span>Collective stimulated Brillouin backscatter</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Lushnikov, Pavel; Rose, Harvey</p> <p>2007-11-01</p> <p>We develop the statistical theory of linear collective stimulated Brillouin backscatter (CBSBS) in spatially and temporally incoherent laser beam. Instability is collective because it does not depend on the dynamics of isolated hot spots (speckles) of laser intensity, but rather depends on averaged laser beam intensity, optic f/#, and laser coherence time, Tc. CBSBS has a much larger threshold than a classical coherent beam's in long-scale-length high temperature plasma. It is a novel regime in which Tc is too large for applicability of well-known statistical theories (RPA) but Tc must be small enough to suppress single speckle processes such as self-focusing. Even if laser Tc is too large for a priori applicability of our theory, collective forward SBS^1, perhaps enhanced by high Z dopant, and its resultant self-induced Tc reduction, may regain the CBSBS regime. We identified convective and absolute CBSBS regimes. The threshold of convective instability is inside the typical parameter region of NIF designs. Well above incoherent threshold, the coherent instability growth rate is recovered. ^1 P.M. Lushnikov and H.A. Rose, Plasma Physics and Controlled Fusion, 48, 1501 (2006).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4642420','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4642420"><span>A Systematic Review of High-Oleic Vegetable Oil Substitutions for Other Fats and Oils on Cardiovascular Disease Risk Factors: Implications for Novel High-Oleic Soybean Oils12</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Huth, Peter J; Fulgoni, Victor L; Larson, Brian T</p> <p>2015-01-01</p> <p>High–oleic acid soybean oil (H-OSBO) is a trait-enhanced vegetable oil containing >70% oleic acid. Developed as an alternative for trans-FA (TFA)-containing vegetable oils, H-OSBO is predicted to replace large amounts of soybean oil in the US diet. However, there is little evidence concerning the effects of H-OSBO on coronary heart disease (CHD)6 risk factors and CHD risk. We examined and quantified the effects of substituting high-oleic acid (HO) oils for fats and oils rich in saturated FAs (SFAs), TFAs, or n–6 (ω-6) polyunsaturated FAs (PUFAs) on blood lipids in controlled clinical trials. Searches of online databases through June 2014 were used to select studies that defined subject characteristics; described control and intervention diets; substituted HO oils compositionally similar to H-OSBO (i.e., ≥70% oleic acid) for equivalent amounts of oils high in SFAs, TFAs, or n–6 PUFAs for ≥3 wk; and reported changes in blood lipids. Studies that replaced saturated fats or oils with HO oils showed significant reductions in total cholesterol (TC), LDL cholesterol, and apolipoprotein B (apoB) (P < 0.05; mean percentage of change: −8.0%, −10.9%, −7.9%, respectively), whereas most showed no changes in HDL cholesterol, triglycerides (TGs), the ratio of TC to HDL cholesterol (TC:HDL cholesterol), and apolipoprotein A-1 (apoA-1). Replacing TFA-containing oil sources with HO oils showed significant reductions in TC, LDL cholesterol, apoB, TGs, TC:HDL cholesterol and increased HDL cholesterol and apoA-1 (mean percentage of change: −5.7%, −9.2%, −7.3%, −11.7%, −12.1%, 5.6%, 3.7%, respectively; P < 0.05). In most studies that replaced oils high in n–6 PUFAs with equivalent amounts of HO oils, TC, LDL cholesterol, TGs, HDL cholesterol, apoA-1, and TC:HDL cholesterol did not change. These findings suggest that replacing fats and oils high in SFAs or TFAs with either H-OSBO or oils high in n–6 PUFAs would have favorable and comparable effects on plasma lipid risk factors and overall CHD risk. PMID:26567193</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/918181','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/918181"><span>Immobilization of Technetium in a Metallic Waste Form</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>S.M. Frank; D. D. Keiser, Jr.; K. C. Marsden</p> <p></p> <p>Fission-product technetium accumulated during treatment of spent nuclear fuel will ultimately be disposed of in a geological repository. The exact form of Tc for disposal has yet to be determined; however, a reasonable solution is to incorporate elemental Tc into a metallic waste form similar to the waste form produced during the pyrochemical treatment of spent, sodium-bonded fuel. This metal waste form, produced at the Idaho National Laboratory, has undergone extensive qualification examination and testing for acceptance to the Yucca Mountain geological repository. It is from this extensive qualification effort that the behavior of Tc and other fission products inmore » the waste form has been elucidated, and that the metal waste form is extremely robust in the retention of fission products, such as Tc, in repository like conditions. This manuscript will describe the metal waste form, the behavior of Tc in the waste form; and current research aimed at determining the maximum possible loading of Tc into the metal waste and subsequent determination of the performance of high Tc loaded metal waste forms.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2008JPhCS.132a2012I','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2008JPhCS.132a2012I"><span>Uniaxial compression on the superconductivity of β-BDA-TTP salts</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Ito, Hiroshi; Ishihara, Tetsuo; Tanaka, Hisaaki; Kuroda, Shin-ichi; Yamada, Jun-ichi</p> <p>2008-10-01</p> <p>The β-type BDA-TTP superconductors attract attention due to the high transition temperature Tc at ambient pressure for organic superconductors. In order to get insight into the superconductivity in terms of the dimerized anisotropic triangular lattice model, Tc of β-(BDA-TTP)2X [X = SbF6, X = AsF6] is studied under uniaxial compression by resistivity measurements. Under compression parallel to the donor stack, Tc increases gradually up to 3 (X = SbF6), 5 (X = AsF6) kbar, and decreases under further piston pressure. Under compression perpendicular to the donor stack, Tc decreases gradually up to 2.5 (X = SbF6), 4 (X = AsF6) kbar and then decreases rapidly under further pressure. Only for X = AsF6, a Tc minimum at 3 kbar is found for both direction. These trends in Tc are understood as an interplay between the enhancement of antiferromagnetic spin fluctuation and frustration on the triangular lattice. By the interplane compression, Tc increased by 0.5 K up to 2 kbar for both salts, demonstrating the importance of the interlayer interaction.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016PhDT.......162W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016PhDT.......162W"><span>Localized chemistry of 99Tc in simulated low activity waste glass</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Weaver, Jamie L.</p> <p></p> <p>A priority of the United States Department of Energy (DOE) is to dispose of the nuclear waste accumulated in the underground tanks at the Hanford Nuclear Reservation in Richland, WA. Incorporation and stabilization of technetium (99Tc) from these tanks into vitrified waste forms is a concern to the waste glass community and DOE due to 99Tc's long half-life ( 2.13˙105 y), and its high mobility in the subsurface environment under oxidizing conditions. Working in collaboration with researchers at Pacific Northwest National Laboratory (PNNL) and other national laboratories, plans were formulated to obtain first-of-a-kind chemical structure determination of poorly understood and environmentally relevant technetium compounds that relate to the chemistry of the Tc in nuclear waste glasses. Knowledge of the structure and spectral signature of these compounds aid in refining the understanding of 99Tc incorporation into and release from oxide based waste glass. In this research a first-of-its kind mechanism for the behavior of 99Tc during vitrification is presented, and the structural role of Tc(VII) and (IV) in borosilicate waste glasses is readdressed.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016APS..MARH22003Q','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016APS..MARH22003Q"><span>van Hove Singularities and Spectral Smearing in High Temperature Superconducting H3S</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Quan, Yundi; Pickett, Warren E.</p> <p></p> <p>The superconducting phase of hydrogen sulfide at Tc=200 K observed by Drozdov and collaborators at pressures around 200 GPa is simple bcc Im 3 m H3S reopens questions about what is achievable in high Tc. The various ''extremes'' that are involved - pressure, implying extreme reduction of volume, extremely high H phonon energy scale around 1400K, extremely high temperature for a superconductor - necessitate a close look at new issues raised by these characteristics in relation to high Tc. We have applied first principles methods to analyze the H3S electronic structure, particularly the van Hove singularities (vHs) and the effect of sulfur. Focusing on the two closely spaced vHs near the Fermi level that give rise to the impressively sharp peak in the density of states, the implications of strong coupling Migdal-Eliashberg theory are assessed. The electron spectral density smearing due to virtual phonon emission and absorption, as done in earlier days for A15 superconductors, must be included explicitly to obtain accurate theoretical predictions and a correct understanding. Means for increasing Tc in H3S-like materials will be mentioned. NSF DMR Grant 1207622.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/19327602','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/19327602"><span>Gender differences in the lipid profile of dyslipidemic subjects.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Damaskos, Dimitris S; Bilianou, Helen I; Mihas, Constantinos; Milionis, Haralampos J; Kostakou, Peggy M; Cokkinos, Dennis V</p> <p>2009-03-01</p> <p>We evaluated the gender-associated differences in lipid profile of subjects intended to receive lipid-lowering therapy with emphasis on the associations between triglycerides (TG) and other plasma lipid variables. Lipid profiles of 1385 patients [aged 55+/-11 years, 549 women (40%)] were evaluated. Eligible subjects fulfilled one or more of the following criteria: total cholesterol (TC)>or=6.2 mmol/l, TG>or=1.7 mmol/l, and high-density lipoprotein cholesterol (HDL-C)<1.0 mmol/l. Patients were divided into subgroups according to TG and HDL-C levels. Women aged on average 3.5 years older, had higher TC and HDL-C, lower TG and a correspondingly lower TC/HDL-C ratio than men. High TG and low HDL-C in tandem appeared twice more frequently in men. Inverse correlations between HDL-C and TG levels were found to exist in the entire cohort (r=-0.354, p<0.001) and in all various subgroups. In the subgroup with TG<1.7 mmol/l, women had higher TC and HDL-C, lower TG levels and lower TC/HDL-C ratio compared with men. In the subgroup with TG>or=1.7 mmol/l, women had higher TC and HDL-C levels and lower TC/HDL ratio compared with men. In the subgroup with HDL-C>or=1.0 mmol/l women had higher HDL-C, lower TG levels and lower TC/HDL-C ratio compared with men. Elevated TG levels and low HDL-C in tandem are common lipid abnormalities in the clinical setting of primary and secondary preventions. Gender-associated differences in the lipid profile are evident in subjects presenting with dyslipidemia and might be of potential relevance for diagnostics and therapy for the prevention of atherosclerosis.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27406231','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27406231"><span>Influence of the chelator structures on the stability of Re and Tc tricarbonyl complexes with iminodiacetic acid tridentate ligands: a computational study.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Hernández-Valdés, Daniel; Rodríguez-Riera, Zalua; Díaz-García, Alicia; Benoist, Eric; Jáuregui-Haza, Ulises</p> <p>2016-08-01</p> <p>The development of novel radiopharmaceuticals for nuclear medicine based on M(CO)3 (M = Tc, Re) complexes has attracted great attention. The versatility of this core and the easy production of the fac-[M(CO)3(H2O)3](+) precursor could explain this interest. The main characteristics of these tricarbonyl complexes are the high substitution stability of the three CO ligands and the corresponding lability of the coordinated water molecules, yielding, via easy exchange of a variety of bi- and tridentate ligands, complexes xof very high kinetic stability. Here, a computational study of different tricarbonyl complexes of Re(I) and Tc(I) was performed using density functional theory. The solvent effect was simulated using the polarizable continuum model. These structures were used as a starting point to investigate the relative stabilities of tricarbonyl complexes with various tridentate ligands. These complexes included an iminodiacetic acid unit for tridentate coordination to the fac-[M(CO)3](+) moiety (M = Re, Tc), an aromatic ring system bearing a functional group (-NO2, -NH2, and -Cl) as a linking site model, and a tethering moiety (a methylene, ethylene, propylene butylene, or pentylene bridge) between the linking and coordinating sites. The optimized complexes showed geometries comparable to those inferred from X-ray data. In general, the Re complexes were more stable than the corresponding Tc complexes. Furthermore, using NH2 as the functional group, a medium length carbon chain, and ortho substitution increased complex stability. All of the bonds involving the metal center presented a closed shell interaction with dative or covalent character, and the strength of these bonds decreased in the sequence Tc-CO > Tc-O > Tc-N.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27479887','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27479887"><span>Limitations and pitfalls of 99mTc-EDDA/HYNIC-TOC (Tektrotyd) scintigraphy.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Garai, Ildikó; Barna, Sandor; Nagy, Gabor; Forgacs, Attila</p> <p>2016-01-01</p> <p>Tektrotyd kit was developed by Polatom company for 99mTc labeling to make an alternative tracer of somatostatin receptor scintigraphy available. Since 2005, 99mTc-EDDA/HYNIC-Tyr3-Octreotide has been used in clinical imaging and achieved high impact in management of patients with neuroendocrine tumors. Knowing the limitations and pitfalls is essential to provide ac-curate diagnosis. Therefore, the potential pitfalls associated with the use of 99mTc-EDDA/HYNIC-TOC are reviewed on the basis of own experience. Data were analyzed of 310 patients who underwent somatostatin receptor scintigraphy with 99mTc-Tektrotyd. Pitfalls during radiolabeling process or acquisition can worsen the sensitivity of SRS (somatostatin receptor scintigraphy). Recognizing physi-ological and clinical pitfalls, the diagnostic accuracy will improve.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013SuScT..26b5014K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013SuScT..26b5014K"><span>Electronic phase diagram of disordered Co doped BaFe2As2-δ</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Kurth, F.; Iida, K.; Trommler, S.; Hänisch, J.; Nenkov, K.; Engelmann, J.; Oswald, S.; Werner, J.; Schultz, L.; Holzapfel, B.; Haindl, S.</p> <p>2013-02-01</p> <p>Superconducting and normal state transport properties in iron pnictides are sensitive to disorder and impurity scattering. By investigation of Ba(Fe1-xCox)2As2-δ thin films with varying Co concentrations we demonstrate that in the dirty limit the superconducting dome in the electronic phase diagram of Ba(Fe1-xCox)2As2-δ shifts towards lower doping concentrations, which differs significantly from observations in single crystals. We show that especially in the underdoped regime superconducting transition temperatures higher than 27 K are possible.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018MMTB...49..902S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018MMTB...49..902S"><span>Improving the Strength of the ZrC-SiC and TC4 Brazed Joint Through Fabricating Graded Double-Layered Composite Structure on TC4 Surface</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Shi, J. M.; Zhang, L. X.; Chang, Q.; Sun, Z.; Feng, J. C.; Ma, N.</p> <p>2018-06-01</p> <p>In order to improve the ZrC-SiC ceramic and TC4 brazed joint property, graded double-layered SiC particles (SiCp)-reinforced TC4-based composite structure (named as GLS for convenience) was designed to relieve the residual stress in the joint. The GLS was successfully fabricated on TC4 substrate by double-layered laser deposition technology before the brazing process. The investigation of the GLS shows that the volume fraction of SiCp in the two composite layers was graded (20 and 39 vol pct, respectively). Ti5Si3 and TiC phases formed in the GLS due to the reaction of SiCp and TC4. The laser power-II (the laser power for the second deposition layer) affected the microstructure of the GLS significantly. Increasing the laser power-II would promote the reaction between the SiCp and TC4. But the high laser power-II made the layer I remelt completely and the two layers became homogeneous rather than graded structure. In the ZrC-SiC and TC4 brazed joint, the CTE (coefficient of thermal expansion) was graded from the TC4 to the ZrC-SiC due to the GLS, and the strength of the joint with the GLS (91 MPa) was higher than that without the GLS (43 MPa).</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/198111-assessment-antioxidative-ability-brain-imaging-glutathione-localization-technetium-meso-hexamethyl-propyleneamine-oxime','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/198111-assessment-antioxidative-ability-brain-imaging-glutathione-localization-technetium-meso-hexamethyl-propyleneamine-oxime"><span>Assessment of antioxidative ability in brain: Imaging of glutathione localization with technetium-99M meso-hexamethyl propyleneamine oxime</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Sasaki, T.; Toyama, H.; Oda, K.</p> <p>1994-05-01</p> <p>An oxidative stress is postulated to be important in tissue injury after ischemia and reperfusion, inflammation, aging and various disease. Glutathione (GSH), one of the major antioxidants in the brain, is presumed to be responsible for the metabolism and retention of [Tc-99m] HM-PAO. In order to visualize the regional localization of GSH in the brain, the relationship between the concentrations of tissue GSH and uptake of [Tc-99m] meso-HM-PAO and [Tc-99m] d,l-HM-PAO was studied in mice. Increasing load of diethyl maleate (DEM), a reducing agent of GSH and several other thiols, before [Tc-99m] meso-HM-PAO injection, led to a dose dependent decreasemore » of GSH and [Tc-99m] meso-HM-PAO. At the highest dose of loaded DEM, the uptake of [Tc-99m] meso-HM-PAO in the brain was decreased to 20-30% of the control. In contrast, pretreatment with DEM did little affect the [Tc-99m] d,l-HM-PAO uptake. To elucidate the retention mechanism of [Tc-99m] HM-PAO in brain, we studied the in vitro interactions of [Tc-99m] meso-HMPAO and [Tc-99m] d,l-HM-PAO with GSH, ascorbate and cysteine by measuring octanol-extractable radioactivity, which is remaining intact [Tc-99m] HM-PAO, as a function of incubation period. The disappearance raw of [Tc-99m] meso-HMPAO and [TC-99m] d,l-HM-PAO were 0.18 and 0.96%/min, respectively. Either meso or d,l-isomer did not interact with ascorbate or cysteine. This result suggested that the retention mechanism of [Tc-99m] meso- and d,l-isomers in brain was related to their specific interaction with GSH, and did not related to non-specific interaction with various thiols or other reducing agents. This extremely high reaction rate of [Tc-99m] d,l-HM-PAO with GSH could explain the capability of a small amount of GSH to trap [Tc-99m] d,l-HM-PAO in maximum DEM loading. These results indicated that [Tc-99m] meso-HMPAO would be suitable to image the concentration of GSH in the brain, as opposed d,l-isomer that images blood flow.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26684343','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26684343"><span>Synthesis, Characterization, and Preclinical Evaluation of (99m)Tc-Labeled Macrobicyclic and Tricyclic Chelators as Single Photon Emission Computed Tomography Tracer.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Yadav, Neelam; Chuttani, Krishna; Mishra, Anil K; Singh, Bachcha</p> <p>2016-05-01</p> <p>The novel tetraaza macrobicyclic chelator 3,6,9,15-tetraazabicyclo[9.3.1]pentadeca-1(15),11,13-triene-2,10-dione (TBPD) and pentaaza macrotricyclic chelator 9-oxa-3,6,12,15,21-pentaazatricyclo[15,3,2,1]trieicos-1(21),17,19-triene-2,7,11,16-tetradione (OPTT) were synthesized, characterized, and radiolabeled with (99m)Tc to produce (99m)Tc-TBPD and (99m)Tc-OPTT. These radiolabeled complexes were prepared with high radiolabeling yield, radiochemical purity, and good in vitro stability up to 24 h. The labeling efficiency of (99m)Tc-TBPD and (99m)Tc-OPTT was found 98% and 97%. In vitro serum stability of (99m)Tc-TBPD was found to be 95.2%, while that of (99m)Tc-OPTT 94.2% up to 24 h. Blood kinetics experiments of (99m)Tc-labeled complexes showed biphasic pattern of blood clearance. About 99.57 ± 0.89% activity of (99m)Tc-TBPD and 99.42 ± 0.88% activity of (9m)Tc-OPTT were cleared off blood stream at 24 h postadministration. The biological half-life of (99m) Tc-TBPD was observed: t1/2(F) 1 h 5 min and t1/2(S) 12 h and biological half-life of (99m)Tc-OPTT was observed: t1/2(F) 1 h 10 min and t1/2(S) 9 h 50 min, respectively. The biodistribution studies revealed that maximum uptake of (99m)Tc-TBPD was found in liver, concluded that excretory pathway is hepatobiliary, while that of (99m)Tc-OPTT was renal as well as hepatobiliary. The negligible activity observed in stomach confirming the stability of radiolabeled complex in biological milieu. In vitro cytotoxicity study of TBPD and OPTT did not show any considerable antiproliferative activity against cancer cells of human cervical SW756, HeLa, and glioblastoma U-87, U373 cell lines. © 2015 John Wiley & Sons A/S.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/868306','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/servlets/purl/868306"><span>Preparation of high specific activity technetium-96</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Mausner, Leonard F.; Srivastava, Suresh C.; Prach, Thomas</p> <p>1992-01-01</p> <p>The present invention relates to a method of producing Tc-96 from the proton irradiation of a rhodium target and a technique for isolating under remote hot cell conditions the Tc-96 from the proton irradiated target.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/5886191-meissner-motor-using-high-tc-ceramic-superconductors','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/5886191-meissner-motor-using-high-tc-ceramic-superconductors"><span>Meissner motor using high-Tc ceramic superconductors</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Takeoka, A.; Ishikawa, A.; Suzuki, M.</p> <p>1989-03-01</p> <p>The authors developed a brand new superconducting motor using high-Tc ceramic superconductors for the first time. This motor utilizes the repulsive force caused by the Meissner effect, which appears below Tc and disappears above that, and is therefore referred to as the Meissner Motor. The motor rotated at a maximum speed of 40 rpm. Though the repulsive force to drive the motor increased with the decrease of temperature or the increase of the gradient magnetic field, it was only about 1.1 gf/g at 77 K in 3500 G/cm. The motor has a maximum torque of 5.0 gf-cm theoretically, but actuallymore » had a torque below 0.66 gf-cm, because it took some time to be cooled below Tc. The rotating speed of the motor was limited by heating ability and its torque was limited by cooling ability.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26349310','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26349310"><span>Bombesin Encapsulated in Long-Circulating pH-Sensitive Liposomes as a Radiotracer for Breast Tumor Identification.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>De Barros, André Luís Branco; Mota, Luciene Das Graças; Coelho, Marina Melo Antunes; Corrêa, Natássia Caroline Resende; De Góes, Alfredo Miranda; Oliveira, Mônica Cristina; Cardoso, Valbert Nascimento</p> <p>2015-02-01</p> <p>Bombesin (BBN) is a tetradecapeptide that binds specifically to gastrin-releasing peptide receptors in humans. These receptors are over-expressed in several forms of cancer; radiolabeled BBN could therefore be used to detect such cancers. However, the degradation of peptides is a critical issue in the development of tumor tracers. Liposomes can be used to overcome this problem and improve the uptake of tracers by tumors. Therefore, the purpose of this study was to prepare and characterize long-circulating and pH-sensitive liposomes (SpHL) containing 99mTc-HYNIC-βAla-Bombesin(7-14) (99mTc-BBN(7-14). In addition, the ability of this system to identify human breast cancer tissue was evaluated using biodistribution studies and scintigraphic images. Long-circulating and pH-sensitive liposomes (SpHL) were prepared and freeze-dried in the presence of cryoprotectants (glucose, mannitol, and trehalose). They were subsequently reconstituted with a solution of 99mTc-HYNIC-βAla-Bombesin(7-14) (99mTc-BBN(7-14)). The liposomes were evaluated for size, encapsulation percentage, radiotracer leakage, and storage stability. In addition, in vivo studies were performed in breast tumor-bearing nude mice. Liposomes in the presence of glucose (SpHLG), exhibited a mean diameter of 164.5 ± 6.5 nm and exhibited a 99mTc-BBN(7-14) encapsulation percentage of 30%. In addition, they remained highly stable for up to 120 days of storage. SpHLG- 99mTc-BBN(7-14) showed longer blood circulation than free 99mTc-BBN(7-14), did. The tumor-to-muscle and tumor-to-blood ratios for SpHLG-99mTc-BBN(7-14 were high at 4 h post-injection (9.31%ID/g and 7.93%ID/g, respectively). Furthermore, scintigraphic images revealed a strong signal in the tumor area, indicating tumor specificity of SpHLG-99mTc-BBN(7-14). In summary, SpHLG-99mTc-BBN(7-14) presented characteristics suitable for a diagnostic agent, and is a potential tool for tumor identification.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29529469','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29529469"><span>Transglutaminase-mediated conjugation and nitride-technetium-99m labelling of a bis(thiosemicarbazone) bifunctional chelator.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Salvarese, Nicola; Spolaore, Barbara; Marangoni, Selena; Pasin, Anna; Galenda, Alessandro; Tamburini, Sergio; Cicoria, Gianfranco; Refosco, Fiorenzo; Bolzati, Cristina</p> <p>2018-06-01</p> <p>An assessment study involving the use of the transglutaminase (TGase) conjugation method and the nitride-technetium-99m labelling on a bis(thiosemicarbazone) (BTS) bifunctional chelating agent is presented. The previously described chelator diacetyl-2-(N 4 -methyl-3-thiosemicarbazone)-3-(N 4 -amino-3-thiosemicarbazone), H 2 ATSM/A, has been functionalized with 6-aminohexanoic acid (ε-Ahx) to generate the bifunctional chelating agent diacetyl-2-(N 4 -methyl-3-thiosemicarbazone)-3-[N 4 -(amino)-(6-aminohexanoic acid)-3-thiosemicarbazone], H 2 ATSM/A-ε-Ahx (1), suitable for conjugation to glutamine (Gln) residues of bioactive molecules via TGase. The feasibility of the TGase reaction in the synthesis of a bioconjugate derivative was investigated using Substance P (SP) as model peptide. Compounds 1 and H 2 ATSM/A-ε-Ahx-SP (2) were labelled with nitride-technetium-99m, obtaining the complexes [ 99m Tc][Tc(N)(ATSM/A-ε-Ahx)] ( 99m Tc1) and [ 99m Tc][Tc(N)(ATSM/A-ε-Ahx-SP)] ( 99m Tc2). The chemical identity of 99m Tc1 and 99m Tc2 was confirmed by radio/UV-RP-HPLC combined with ESI-MS analysis on the respective carrier-added products 99g/99m Tc1 and 99g/99m Tc2. The stability of the radiolabelled complexes after incubation in various environments was investigated. All the results were compared with those obtained for the corresponding 64 Cu-analogues, 64 Cu1 and 64 Cu2. The TGase reaction allows the conjugation of 1 with the peptide, but it is not highly efficient due to instability of the chelator in the required conditions. The SP-conjugated complexes are unstable in mouse and human sera. However, indeed the BTS system can be exploited as nitride-technetium-99m chelator for highly efficient technetium labelling, thus making compound 1 worthy of further investigations for new targeted technetium and copper radiopharmaceuticals encompassing Single Photon Emission Computed Tomography and Positron Emission Tomography imaging. Copyright © 2018 Elsevier Inc. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1082972','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/1082972"><span>High-Resolution Modeling to Assess Tropical Cyclone Activity in Future Climate Regimes</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Lackmann, Gary</p> <p>2013-06-10</p> <p>Applied research is proposed with the following objectives: (i) to determine the most likely level of tropical cyclone intensity and frequency in future climate regimes, (ii) to provide a quantitative measure of uncertainty in these predictions, and (iii) to improve understanding of the linkage between tropical cyclones and the planetary-scale circulation. Current mesoscale weather forecasting models, such as the Weather Research and Forecasting (WRF) model, are capable of simulating the full intensity of tropical cyclones (TC) with realistic structures. However, in order to accurately represent both the primary and secondary circulations in these systems, model simulations must be configured withmore » sufficient resolution to explicitly represent convection (omitting the convective parameterization scheme). Most previous numerical studies of TC activity at seasonal and longer time scales have not utilized such explicit convection (EC) model runs. Here, we propose to employ the moving nest capability of WRF to optimally represent TC activity on a seasonal scale using a downscaling approach. The statistical results of a suite of these high-resolution TC simulations will yield a realistic representation of TC intensity on a seasonal basis, while at the same time allowing analysis of the feedback that TCs exert on the larger-scale climate system. Experiments will be driven with analyzed lateral boundary conditions for several recent Atlantic seasons, spanning a range of activity levels and TC track patterns. Results of the ensemble of WRF simulations will then be compared to analyzed TC data in order to determine the extent to which this modeling setup can reproduce recent levels of TC activity. Next, the boundary conditions (sea-surface temperature, tropopause height, and thermal/moisture profiles) from the recent seasons will be altered in a manner consistent with various future GCM/RCM scenarios, but that preserves the large-scale shear and incipient disturbance activity. This will allow (i) a direct comparison of future TC activity that could be expected for an active or inactive season in an altered climate regime, and (ii) a measure of the level of uncertainty and variability in TC activity resulting from different carbon emission scenarios.« less</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_18");'>18</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li class="active"><span>20</span></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_20 --> <div id="page_21" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li class="active"><span>21</span></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="401"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28095298','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28095298"><span>Molecular identification and genotyping of Trypanosoma cruzi DNA in autochthonous Chagas disease patients from Texas, USA.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Garcia, Melissa N; Burroughs, Hadley; Gorchakov, Rodion; Gunter, Sarah M; Dumonteil, Eric; Murray, Kristy O; Herrera, Claudia P</p> <p>2017-04-01</p> <p>The parasitic protozoan Trypanosoma cruzi, the causative agent of Chagas disease, is widely distributed throughout the Americas, from the southern United States (US) to northern Argentina, and infects at least 6 million people in endemic areas. Much remains unknown about the dynamics of T. cruzi transmission among mammals and triatomine vectors in sylvatic and peridomestic eco-epidemiological cycles, as well as of the risk of transmission to humans in the US. Identification of T. cruzi DTUs among locally-acquired cases is necessary for enhancing our diagnostic and clinical prognostic capacities, as well as to understand parasite transmission cycles. Blood samples from a cohort of 15 confirmed locally-acquired Chagas disease patients from Texas were used for genotyping T. cruzi. Conventional PCR using primers specific for the minicircle variable region of the kinetoplastid DNA (kDNA) and the highly repetitive genomic satellite DNA (satDNA) confirmed the presence of T. cruzi in 12/15 patients. Genotyping was based on the amplification of the intergenic region of the miniexon gene of T. cruzi and sequencing. Sequences were analyzed by BLAST and phylogenetic analysis by Maximum Likelihood method allowed the identification of non-TcI DTUs infection in six patients, which corresponded to DTUs TcII, TcV or TcVI, but not to TcIII or TcIV. Two of these six patients were also infected with a TcI DTU, indicating mixed infections in those individuals. Electrocardiographic abnormalities were seen among patients with single non-TcI and mixed infections of non-TcI and TcI DTUs. Our results indicate a greater diversity of T. cruzi DTUs circulating among autochthonous human Chagas disease cases in the southern US, including for the first time DTUs from the TcII-TcV-TcVI group. Furthermore, the DTUs infecting human patients in the US are capable of causing Chagasic cardiac disease, highlighting the importance of parasite detection in the population. Copyright © 2017 Elsevier B.V. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016JNuM..479..331L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016JNuM..479..331L"><span>Sodalite as a vehicle to increase Re retention in waste glass simulant during vitrification</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Luksic, Steven A.; Riley, Brian J.; Parker, Kent E.; Hrma, Pavel</p> <p>2016-10-01</p> <p>Technetium (Tc) retention during Hanford waste vitrification can be increased if the volatility can be controlled. Incorporating Tc into a thermally stable mineral phase, such as sodalite, is one way to achieve increased retention. Here, rhenium (Re)-bearing sodalite was tested as a vehicle to transport perrhenate (ReO4-), a nonradioactive surrogate for pertechnetate (TcO4-), into high-level (HLW) and low-activity waste (LAW) glass simulants. After melting HLW and LAW simulant feeds, the retention of Re in the glass was measured and compared with the Re retention in glass prepared from a feed containing Re2O7. Phase analysis of sodalite in both these glasses across a profile of temperatures describes the durability of Re-sodalite during the feed-to-glass transition. The use of Re sodalite improved the Re retention by 21% for HLW glass and 85% for LAW glass, demonstrating the potential improvement in Tc-retention if TcO4- were to be encapsulated in a Tc-sodalite prior to vitrification.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014NatSR...4E4231H','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014NatSR...4E4231H"><span>Antisense Oligonucleotides Targeting Parasite Inositol 1,4,5-Trisphosphate Receptor Inhibits Mammalian Host Cell Invasion by Trypanosoma cruzi</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Hashimoto, Muneaki; Nara, Takeshi; Hirawake, Hiroko; Morales, Jorge; Enomoto, Masahiro; Mikoshiba, Katsuhiko</p> <p>2014-02-01</p> <p>Chagas disease is caused by an intracellular parasitic protist, Trypanosoma cruzi. As there are no highly effective drugs against this agent that also demonstrate low toxicity, there is an urgent need for development of new drugs to treat Chagas disease. We have previously demonstrated that the parasite inositol 1,4,5-trisphosphate receptor (TcIP3R) is crucial for invasion of the mammalian host cell by T. cruzi. Here, we report that TcIP3R is a short-lived protein and that its expression is significantly suppressed in trypomastigotes. Treatment of trypomastigotes, an infective stage of T. cruzi, with antisense oligonucleotides specific to TcIP3R deceased TcIP3R protein levels and impaired trypomastigote invasion of host cells. Due to the resulting instability and very low expression level of TcIP3R in trypomastigotes indicates that TcIP3R is a promising target for antisense therapy in Chagas disease.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1988PhyC..156..641K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1988PhyC..156..641K"><span>Superconductivity above 100 K in Bi(Pb)-Ca-Sr-Cu-O films made by thermal decomposition of metal carboxylates</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Klee, M.; de Vries, J. W. C.; Brand, W.</p> <p>1988-11-01</p> <p>Superconducting layers in the Bi(Pb)-Ca-Sr-Cu-O system are prepared by thermal decomposition of metal carboxylates. The films are deposited on MgO single crystal and ceramic substrates using a spin-coating and dip-coating process. The Bi-Ca-Sr-Cu-O films consist mainly of the low- Tc phase ( c-axis=3.073 nm), whereas partial substitution of Bi by Pb favours the formation of the high- Tc phase ( c-axis=3.707 nm). Films deposited on MgO (100) are strong c-axis preferentially oriented grown. While the Bi-Ca-Sr-Cu-O films show a step in the resistance versus temperature curve ( Tcf⋍80 K) due to the presence of the low- Tc and the high- Tc phase, the Bi(Pb)-Ca-Sr-Cu-O films have an onset at 110 K and are superconducting at 104 K. The temperature dependence of the critical current indicates that in the Bi-Ca-Sr-Cu-O system weak links of superconductor-isolator-superconductor type are present, while in the Bi(Pb)-Ca-Sr-Cu-O samples the contact is formed by normal-metal barriers. Using magnetic fields up to 5 T, the anisotropy of the resistive transition of the high- Tc phase was studied. In Bi(Pb)-Ca-Sr-Cu-O films the anisotropy ratio is about 18, and the corresponding coherence lengths are ξ ab(0)⋍3.6 nm and ξ c(0)⋍0.2 nm. These values are nearly the same as in the low- Tc phase.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25808412','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25808412"><span>Photoresponsive molecularly imprinted hydrogel casting membrane for the determination of trace tetracycline in milk.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Wang, Qiang; Lv, Zhen; Tang, Qian; Gong, Cheng-Bin; Lam, Michael Hon Wah; Ma, Xue-Bing; Chow, Cheuk-Fai</p> <p>2016-03-01</p> <p>This study aimed to develop a photoresponsive molecularly imprinted hydrogel (MIH) casting membrane for the determination of trace tetracycline (TC) in milk. This MIH casting membrane combined the specificity of MIHs, the photoresponsive properties of azobenzene, and the portable properties of a membrane. Photoresponsive TC-imprinted MIHs were initially fabricated and then cast on sodium dodecyl sulfonate polyacrylamide gel. After TC removal, a photoresponsive MIH casting membrane was obtained. The photoresponsive properties of the MIH casting membrane were robust, and no obvious photodegradation was observed after 20 cycles. The MIH casting membrane displayed specific affinity to TC upon alternate irradiation at 365 and 440 nm; it could quantitatively uptake and release TC. The TC concentration (0.0-2.0 × 10(-4) mol l(-1)) in aqueous solution displayed a linear relationship with the photoisomerization rate constant of azobenzene within the MIH casting membrane. As such, a quick detection method for trace TC in aqueous foodstuff samples was established. The recovery of this method for TC in milk was investigated with a simple pretreatment of milk, and a high recovery of 100.54-106.35% was obtained. Therefore, the fabricated membrane can be used as a portable molecular sensor that can be easily recycled. Copyright © 2015 John Wiley & Sons, Ltd.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/871813','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/servlets/purl/871813"><span>Method for generating a crystalline .sup.99 MoO.sub.3 product and the isolation .sup.99m Tc compositions therefrom</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Bennett, Ralph G.; Christian, Jerry D.; Kirkham, Robert J.; Tranter, Troy J.</p> <p>1998-01-01</p> <p>An improved method for producing .sup.99m Tc compositions. .sup.100 Mo metal is irradiated with photons in a particle (electron) accelerator to produce .sup.99 Mo metal which is dissolved in a solvent. A solvated .sup.99 Mo product is then dried to generate a supply of .sup.99 MoO.sub.3 crystals. The crystals are thereafter heated at a temperature which will sublimate the crystals and form a gaseous mixture containing vaporized .sup.99m TcO.sub.3 and vaporized .sup.99m TcO.sub.2 but will not cause the production of vaporized .sup.99 MoO.sub.3. The mixture is then combined with an oxidizing gas to generate a gaseous stream containing vaporized .sup.99m Tc.sub.2 O.sub.7. Next, the gaseous stream is cooled to a temperature sufficient to convert the vaporized .sup.99m Tc.sub.2 O.sub.7 into a condensed .sup.99m Tc-containing product. The product has high purity levels resulting from the use of reduced temperature conditions and ultrafine crystalline .sup.99 MoO.sub.3 starting materials with segregated .sup.99m Tc compositions therein which avoid the production of vaporized .sup.99 MoO.sub.3 contaminants.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/18753829','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/18753829"><span>Targeted imaging of gastrin-releasing peptide receptors with 99mTc-EDDA/HYNIC-[Lys3]-bombesin: biokinetics and dosimetry in women.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Santos-Cuevas, Clara L; Ferro-Flores, Guillermina; Arteaga de Murphy, Consuelo; Pichardo-Romero, Pablo A</p> <p>2008-08-01</p> <p>The gastrin-releasing peptide receptor (GRP-R) is expressed in several normal human tissues and is overexpressed in various human tumors including breast, prostate, small-cell lung cancer and pancreatic cancer. Recently, 99mTc-EDDA/HYNIC-[Lys]-bombesin (99mTc-HYNIC-BN) was reported as a radiopharmaceutical with high stability in human serum, specific cell GRP-R binding and rapid cell internalization. The aim of this study was to determine the biokinetics and dosimetry of 99mTc-HYNIC-BN and the feasibility of using this radiopharmaceutical to image GRP-R in four early breast cancer patients and seven healthy women. Whole-body images were acquired at 20, 90, 180 min, and 24 h after 99mTc-HYNIC-BN administration. The same regions of interest were drawn around source organs on each time frame and regions of interest were converted to activity (conjugate view counting method). The image sequence was used to extrapolate 99mTc-HYNIC-BN time-activity curves in each organ to calculate the total number of disintegrations (N) that occurred in the source regions. N data were the input for the OLINDA/EXM code to calculate internal radiation dose estimates. 99mTc-HYNIC-BN had a rapid blood clearance with mainly renal excretion. No statistically significant differences (P>0.05) in the radiation-absorbed doses among cancer patients and healthy women were observed. The average equivalent doses (n=11) were 24.8+/-8.8 mSv (kidneys), 7.3+/-1.8 mSv (lungs), 6.5+/-4.0 mSv (breast), 2.0+/-0.3 mSv (pancreas), 1.6+/-0.3 mSv (liver), 1.2+/-0.2 mSv (ovaries), and 1.0+/-0.2 mSv (red marrow). The effective dose was 3.3+/-0.6 mSv. The images showed well-differentiated concentration of 99mTc-HYNIC-BN in cancer mammary tissue. All the absorbed doses were comparable with those known for most of the 99mTc studies. 99mTc-HYNIC-BN shows high tumor uptake in breasts with malignant tumors so it is a promising imaging radiopharmaceutical to target site-specific early breast cancer. The results obtained warrant a further clinical study to determine specificity/sensibility of 99mTc-HYNIC-BN.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23050833','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23050833"><span>North American import? Charting the origins of an enigmatic Trypanosoma cruzi domestic genotype.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Zumaya-Estrada, Federico A; Messenger, Louisa A; Lopez-Ordonez, Teresa; Lewis, Michael D; Flores-Lopez, Carlos A; Martínez-Ibarra, Alejandro J; Pennington, Pamela M; Cordon-Rosales, Celia; Carrasco, Hernan V; Segovia, Maikel; Miles, Michael A; Llewellyn, Martin S</p> <p>2012-10-10</p> <p>Trypanosoma cruzi, the agent of Chagas disease, is currently recognized as a complex of six lineages or Discrete Typing Units (DTU): TcI-TcVI. Recent studies have identified a divergent group within TcI - TcI(DOM). TcI(DOM). is associated with a significant proportion of human TcI infections in South America, largely absent from local wild mammals and vectors, yet closely related to sylvatic strains in North/Central America. Our aim was to examine hypotheses describing the origin of the TcI(DOM) genotype. We propose two possible scenarios: an emergence of TcI(DOM) in northern South America as a sister group of North American strain progenitors and dispersal among domestic transmission cycles, or an origin in North America, prior to dispersal back into South American domestic cycles. To provide further insight we undertook high resolution nuclear and mitochondrial genotyping of multiple Central American strains (from areas of México and Guatemala) and included them in an analysis with other published data. Mitochondrial sequence and nuclear microsatellite data revealed a cline in genetic diversity across isolates grouped into three populations: South America, North/Central America and TcI(DOM). As such, greatest diversity was observed in South America (A(r) = 4.851, π = 0.00712) and lowest in TcI(DOM) (Ar = 1.813, π = 0.00071). Nuclear genetic clustering (genetic distance based) analyses suggest that TcI(DOM) is nested within the North/Central American clade. Declining genetic diversity across the populations, and corresponding hierarchical clustering suggest that emergence of this important human genotype most likely occurred in North/Central America before moving southwards. These data are consistent with early patterns of human dispersal into South America.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/757286','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/757286"><span>Small Column Testing of Superlig 639 for Removal of 99Tc from Hanford Tank Waste Envelope C (Tank 241-AN-107)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>DL Blanchard; DE Kurath; BM Rapko</p> <p></p> <p>The current BNFL Inc. flow sheet for pretreating Hanford High-Level tank wastes includes the use of Superlig(reg.sign)639 (SL-639) in a dual column system for removing technetium-99 ({sup 99}Tc) from the aqueous fraction of the waste. This sorbent material has been developed and supplied by IBC Advanced Technologies, Inc., American Fork, UT. This report documents the results of testing the SL-639 sorbent with diluted waste [Na{sup +}] {approx} 5 M from Tank 241-AN-107 (an Envelope C waste, abbreviated AN-107) at Battelle Northwest Laboratories (BNW). The equilibrium behavior was assessed with batch contacts between the sorbent and the waste. Two AN-107 samplesmore » were used: (1) an archived sample from previous testing and (2) a more recent sample collected specifically for BNFL. A portion of the archive sample and all of the BNFL sample were treated to remove Sr-90 and transuranic elements (TRU). All samples had also been Cs decontaminated by ion exchange (IX), and were spiked with a technetium-95m ({sup 95m}Tc) pertechnetate tracer, {sup 95m}TcO{sub 4}{sup -}.The TcO{sub 4}{sup -} and total Tc K{sub d} values, assumed equal to the {sup 95m}Tc and {sup 99}Tc K{sub d}'s, respectively, are shown in Table S1. Values are averages of duplicates, which showed significant scatter. The total Tc K{sub d} for the BNFL sample is much lower than the TcO{sub 4}{sup -}, indicating that a large fraction of the {sup 99}Tc is not pertechnetate.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22136886','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22136886"><span>Insights into the failure of the potential, neutral myocardial imaging agent TcN-NOET: physicochemical identification of by-products and degradation species.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Tisato, Francesco; Bolzati, Cristina; Refosco, Fiorenzo; Porchia, Marina; Seraglia, Roberta; Carta, Davide; Pasqualini, Roberto</p> <p>2012-04-01</p> <p>The neutral complex [(99m)Tc(N)(NOEt)(2)], often referred to as TcN-NOET [NOEt=N-ethoxy,N-ethyldithiocarbamate(1-)], was proposed several years ago as a myocardial imaging agent. Despite some favorable clinical properties evidenced during phase I and phase II studies, the overall results of the European and American phase III clinical studies have been judged insufficient for a successful approval process by the regulatory agencies. Non-carrier-added and carrier-added experiments using short-lived (99m)Tc and long-lived (99g)Tc have been utilized to prepare a series of bis-substituted [Tc(N)(DTC)(2)] complexes [DTC=dithiocarbamate(1-)]. They have been purified by means of chromatographic techniques (high-performance liquid chromatography and thin-layer chromatography) and identified via double detection (UV-vis and radiometry) by comparison with authenticated samples of (99g)Tc compounds prepared by conventional coordination chemistry procedures. The molecular structure of the lipophilic, neutral complex cis-[Tc(N)(NOEt)(2)] has been assigned by comparison with similar nitrido-Tc(V) complexes already reported in the literature. Novel bis-substituted nitrido-Tc complexes containing hydrolyzed portions of coordinated NOEt, namely, N-ethyldithiocarbamate [NHEt(1-)] and N-hydroxy, N-ethyldithiocarbamate [NOHEt(1-)], have been prepared and characterized by means of multinuclear nuclear magnetic resonance spectroscopy and mass spectrometry. Despite the identification of these "hydrolyzed" species, it is still unclear whether the failure to reach the clinical goal of the perfusion tracer [(99m)Tc(N)(NOEt)(2)] is related to the degradation processes evidenced in this study or is the result of the mediocre imaging properties of the tracer. Copyright © 2012 Elsevier Inc. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24758406','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24758406"><span>The Theobroma cacao B3 domain transcription factor TcLEC2 plays a duel role in control of embryo development and maturation.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Zhang, Yufan; Clemens, Adam; Maximova, Siela N; Guiltinan, Mark J</p> <p>2014-04-24</p> <p>The Arabidopsis thaliana LEC2 gene encodes a B3 domain transcription factor, which plays critical roles during both zygotic and somatic embryogenesis. LEC2 exerts significant impacts on determining embryogenic potential and various metabolic processes through a complicated genetic regulatory network. An ortholog of the Arabidopsis Leafy Cotyledon 2 gene (AtLEC2) was characterized in Theobroma cacao (TcLEC2). TcLEC2 encodes a B3 domain transcription factor preferentially expressed during early and late zygotic embryo development. The expression of TcLEC2 was higher in dedifferentiated cells competent for somatic embryogenesis (embryogenic calli), compared to non-embryogenic calli. Transient overexpression of TcLEC2 in immature zygotic embryos resulted in changes in gene expression profiles and fatty acid composition. Ectopic expression of TcLEC2 in cacao leaves changed the expression levels of several seed related genes. The overexpression of TcLEC2 in cacao explants greatly increased the frequency of regeneration of stably transformed somatic embryos. TcLEC2 overexpressing cotyledon explants exhibited a very high level of embryogenic competency and when cultured on hormone free medium, exhibited an iterative embryogenic chain-reaction. Our study revealed essential roles of TcLEC2 during both zygotic and somatic embryo development. Collectively, our evidence supports the conclusion that TcLEC2 is a functional ortholog of AtLEC2 and that it is involved in similar genetic regulatory networks during cacao somatic embryogenesis. To our knowledge, this is the first detailed report of the functional analysis of a LEC2 ortholog in a species other then Arabidopsis. TcLEC2 could potentially be used as a biomarker for the improvement of the SE process and screen for elite varieties in cacao germplasm.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29603784','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29603784"><span>A novel Tc-99m and fluorescence-labeled arginine-arginine-leucine-containing peptide as a multimodal tumor imaging agent in a murine tumor model.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kim, Myoung Hyoun; Kim, Seul-Gi; Kim, Dae-Weung</p> <p>2018-06-15</p> <p>We developed a Tc-99m and TAMRA-labeled peptide, Tc-99m arginine-arginine-leucine (RRL) peptide (TAMRA-GHEG-ECG-RRL), to target tumor cells and evaluated the diagnostic performance of Tc-99m TAMRA-GHEG-ECG-RRL as a dual-modality imaging agent for tumor in a murine model. TAMRA-GHEG-ECG-RRL was synthesized using Fmoc solid-phase peptide synthesis. Binding affinity and in vitro cellular uptake studies were performed. Gamma camera imaging, biodistribution, and ex vivo imaging studies were performed in murine models with PC-3 tumors. Tumor tissue slides were prepared and analyzed with immunohistochemistry using confocal microscopy. After radiolabeling procedures with Tc-99m, Tc-99m TAMRA-GHEG-ECG-RRL complexes were prepared in high yield (>96%). The K d of Tc-99m TAMRA-GHEG-ECG-RRL determined by saturation binding was 41.7 ± 7.8 nM. Confocal microscopy images of PC-3 cells incubated with TAMRA-GHEG-ECG-RRL showed strong fluorescence in the cytoplasm. Gamma camera imaging revealed substantial uptake of Tc-99m TAMRA-GHEG-ECG-RRL in tumors. Tumor uptake was effectively blocked by the coinjection of an excess concentration of RRL. Specific uptake of Tc-99m TAMRA-GHEG-ECG-RRL was confirmed by biodistribution, ex vivo imaging, and immunohistochemistry stain studies. In conclusion, in vivo and in vitro studies revealed substantial uptake of Tc-99m TAMRA-GHEG-ECG-RRL in tumors. Tc-99m TAMRA-GHEG-ECG-RRL has potential as a dual-modality tumor imaging agent. Copyright © 2018 John Wiley & Sons, Ltd.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29023950','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29023950"><span>Synthesis and evaluation of Tc-99m and fluorescence-labeled elastin-derived peptide, VAPG for multimodal tumor imaging in murine tumor model.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kim, Myoung Hyoun; Kim, Chang Guhn; Kim, Seul-Gi; Kim, Dae-Weung</p> <p>2017-12-01</p> <p>We developed a Tc-99m and fluorescence-labeled peptide, Tc-99m TAMRA-GHEG-ECG-VAPG to target tumor cells and evaluated the diagnostic performance as a dual-modality imaging agent for tumor in a murine model. TAMRA-GHEG-ECG-VAPG was synthesized by using Fmoc solid-phase peptide synthesis. Radiolabeling of TAMRA-GHEG-ECG-VAPG with Tc-99m was done by using ligand exchange via tartrate. Binding affinity and in vitro cellular uptake studies were performed. Gamma camera imaging, biodistribution, and ex vivo imaging studies were performed in murine models with SW620 tumors. Tumor tissue slides were prepared and analyzed with immunohistochemistry by using confocal microscopy. After radiolabeling procedures with Tc-99m, Tc-99m TAMRA-GHEG-ECG-VAPG complexes were prepared in high yield (>96%). The K d of Tc-99m TAMRA-GHEG-ECG-VAPG determined by saturation binding was 16.8 ± 3.6 nM. Confocal microscopy images of SW620 cells incubated with TAMRA-GHEG-ECG-VAPG showed strong fluorescence in the cytoplasm. Gamma camera imaging revealed substantial uptake of Tc-99m TAMRA-GHEG-ECG-VAPG in tumors. Tumor uptake was effectively blocked by the coinjection of an excess concentration of VAPG. Specific uptake of Tc-99m TAMRA-GHEG-ECG-VAPG was confirmed by biodistribution, ex vivo imaging, and immunohistochemistry stain studies. In vivo and in vitro studies revealed substantial uptake of Tc-99m TAMRA-GHEG-ECG-VAPG in tumor cells. Tc-99m TAMRA-GHEG-ECG-VAPG has potential as a dual-modality tumor imaging agent. Copyright © 2017 John Wiley & Sons, Ltd.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28205404','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28205404"><span>Macrocyclic triamine derived glucose analogues for 99m Tc(CO)3 labeling: synthesis and biological evaluation as potential tumor-imaging agents.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Liu, Teli; Gan, Qianqian; Zhang, Junbo</p> <p>2017-02-01</p> <p>[ 99m Tc(CO) 3 (H 2 O) 3 ] + has attracted great attention among 99m Tc-labeling techniques, due to its ease of preparation, readily substituted water molecules of the precursor fac-[ 99m Tc(CO) 3 (H 2 O) 3 ] + by a variety of functional groups, small size and inertness. Bifunctional chelator based on a macrocyclic polyamine framework shows easy complexation with [ 99m Tc(CO) 3 (H 2 O) 3 ] + to produce stable complex. In this study, two novel 1, 5, 9-triazacyclododecane derivatives containing a glucose group (6 and 7) were successfully synthesized by reacting different glucose-azides with alkyne-[12]aneN 3 via the so-called click chemistry and radiolabeled with [ 99m Tc(CO) 3 (H 2 O) 3 ] + to form 99m Tc(CO) 3 -6 (C-1-substituted complex) and 99m Tc(CO) 3 -7 (C-2-substituted complex) in high yields. The complexes were stable in vitro over 6 h when incubated in saline at room temperature and in mouse serum at 37 °C. The partition coefficient results showed that they were hydrophilic. The biodistribution studies in Kunming mice bearing S 180 tumor showed both complexes showed accumulation in the tumor. Between them, 99m Tc(CO) 3 -7 had the advantages of much higher tumor uptake and tumor/muscle ratio. Compared with other reported 99m Tc-radiolabeled glucose derivatives, 99m Tc(CO) 3 -7 also showed a higher tumor uptake and tumor/muscle ratio, suggesting it would be a potential candidate for further development as a tumor-imaging agent. © 2017 John Wiley & Sons A/S.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26993818','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26993818"><span>Preclinical evaluation of isostructural Tc-99m- and Re-188-folate-Gly-Gly-Cys-Glu for folate receptor-positive tumor targeting.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kim, Woo Hyoung; Kim, Chang Guhn; Kim, Myoung Hyoun; Kim, Dae-Weung; Park, Cho Rong; Park, Ji Yong; Lee, Yun-Sang; Youn, Hyewon; Kang, Keon Wook; Jeong, Jae Min; Chung, June-Key</p> <p>2016-06-01</p> <p>The purpose of the present study was to prepare isostructural Tc-99m- and Re-188-folate-Gly-Gly-Cys-Glu (folate-GGCE), and to evaluate the feasibility of their use for folate receptor (FR)-targeted molecular imaging and as theranostic agents in a mouse tumor model. Folate-GGCE was synthesized using solid-phase peptide synthesis and radiolabeled with Tc-99m or Re-188. Radiochemical characterization was performed by radio-high-performance liquid chromatography. The biodistribution of Tc-99m-folate-GGCE was studied, with or without co-injection of excess free folate, in mice bearing both FR-positive (KB cell) and FR-negative (HT1080 cell) tumors. Biodistribution of Re-188-folate-GGCE was studied in mice bearing KB tumors. Serial planar scintigraphy was performed in the dual tumor mouse model after intravenous injection of Tc-99m-folate-GGCE. Serial micro-single photon emission computed tomography/computed tomography (SPECT/CT) studies were performed, with or without co-injection of excess free folate, in the mouse tumor model after injection of Tc-99m-folate-GGCE or Re-188-folate-GGCE. The radiolabeling efficiency and radiochemical stability of Tc-99m- and Re-188-folate-GGCE were more than 95 % for up to 4 h after radiolabeling. Uptake of Tc-99m-folate-GGCE at 1, 2, and 4 h after injection in KB tumor was 16.4, 23.2, and 17.6 % injected dose per gram (%ID/g), respectively. This uptake was suppressed by 97.4 % when excess free folate was co-administered. Tumor:normal organ ratios at 4 h for blood, liver, lung, muscle, and kidney were 54.3, 25.2, 38.3, 97.8, and 0.3, respectively. Tumor uptake of Re-188-folate-GGCE at 2, 4, 8, and 16 h after injection was 17.4, 21.7, 24.1, and 15.6 %ID/g, respectively. Tumor:normal organ ratios at 8 h for blood, liver, lung, muscle, and kidney were 126.8, 21.9, 54.8, 80.3, and 0.4, respectively. KB tumors were clearly visualized at a high intensity using serial scintigraphy and micro-SPECT/CT in mice injected with Tc-99m- or Re-188-folate-GGCE. The tumor uptake of these molecules was completely suppressed when excess free folate was co-administered. Isostructural Tc-99m- and Re-188-folate-GGCE showed high and FR-specific uptake by tumors and generally favorable tumor:normal organ ratios. The tumor targeting capabilities of Tc-99m- and Re-188-folate-GGCE were clearly evident on serial imaging studies. This isostructural pair may have potential diagnostic and theranostic applications for FR-positive tumors.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23184308','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23184308"><span>Comparison between stress myocardial perfusion SPECT recorded with cadmium-zinc-telluride and Anger cameras in various study protocols.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Verger, Antoine; Djaballah, Wassila; Fourquet, Nicolas; Rouzet, François; Koehl, Grégoire; Imbert, Laetitia; Poussier, Sylvain; Fay, Renaud; Roch, Véronique; Le Guludec, Dominique; Karcher, Gilles; Marie, Pierre-Yves</p> <p>2013-02-01</p> <p>The results of stress myocardial perfusion SPECT could be enhanced by new cadmium-zinc-telluride (CZT) cameras, although differences compared to the results with conventional Anger cameras remain poorly known for most study protocols. This study was aimed at comparing the results of CZT and Anger SPECT according to various study protocols while taking into account the influence of obesity. The study population, which was from three different institutions equipped with identical CZT cameras, comprised 276 patients referred for study using protocols involving (201)Tl (n = 120) or (99m)Tc-sestamibi injected at low dose at stress ((99m)Tc-Low; stress/rest 1-day protocol; n = 110) or at high dose at stress ((99m)Tc-High; rest/stress 1-day or 2-day protocol; n = 46). Each Anger SPECT scan was followed by a high-speed CZT SPECT scan (2 to 4 min). Agreement rates between CZT and Anger SPECT were good irrespective of the study protocol (for abnormal SPECT, (201)Tl 92 %, (99m)Tc-Low 86 %, (99m)Tc-High 98 %), although quality scores were much higher for CZT SPECT with all study protocols. Overall correlations were high for the extent of myocardial infarction (r = 0.80) and a little lower for ischaemic areas (r = 0.72), the latter being larger on Anger SPECT (p < 0.001). This larger extent was mainly observed in 50 obese patients who were in the (201)Tl or (99m)Tc-Low group and in whom stress myocardial counts were particularly low with Anger SPECT (228 ± 101 kcounts) and dramatically enhanced with CZT SPECT (+279 ± 251 %). Concordance between the results of CZT and Anger SPECT is good regardless of study protocol and especially when excluding obese patients who have low-count Anger SPECT and for whom myocardial counts are dramatically enhanced on CZT SPECT.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24607434','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24607434"><span>Preparation of 99mTc-TRODAT-1 with high labeling yield in boiling water bath: a new formulation.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Erfani, Mostafa; Shafiei, Mohammad</p> <p>2014-04-01</p> <p>A new formulation for preparation of (99m)Tc-labeled tropane derivative, (99m)Tc-TRODAT-1, which is useful as a potential CNS dopamine transporter imaging agent, was evaluated and characterized. Preparation of (99m)Tc-TRODAT-1 was attained previously by a formulation in which vial has to be autoclaved at 121 °C for 30 min. It is highly desirable to further improve the preparation method by developing a simplified one vial formulation which will be labeled in boiling water bath (95 °C) for 15 min and a high labeling yield will be achieved. A formulation contained 10 μg of TRODAT-1, 20 μg tricine, 40 μg SnCl2 and 20mg manitol was prepared. Labeling was performed at 95 °C for 15 min and radiochemical analysis involved ITLC and HPLC methods. The stability of radioconjugate was checked in the presence of human serum at 37 °C up to 24h. (99m)Tc-TRODAT-1 was prepared with a radiochemical purity of more than 95% and specific activity of 64.3 MBq/nmol. Biodistribution studies of this new formulation in rats revealed similar regional brain distribution as compared with those obtained with the previous preparation in which brain uptake was high in striatum and striatum to cerebellum ratio was high. Requiring no autoclave facility for labeling, this new formulation will significantly improve the using feasibility of this radiopharmaceutical in clinic. Copyright © 2014 Elsevier Inc. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/15167522','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/15167522"><span>High radioactive concentration of 99mTc from a zirconium [99Mo]molybdate gel generator using an acidic alumina column for purification and concentration.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Sarkar, S K; Saraswathy, P; Arjun, G; Ramamoorthy, N</p> <p>2004-06-01</p> <p>Newer applications of radiopharmaceuticals in nuclear medicine require pertechnetate of moderate to high radioactive concentration. Hence there is a need to develop simple procedures for the concentration of pertechnetate, and such a procedure is given in this paper. Ten to 20 ml of sodium [Tc]pertechnetate eluted in de-ionized water from a zirconium [Mo]molybdate (ZrMo) gel column generator was passed through 2 g of an acidic alumina bed (35 x 8 mm) in order to remove the co-eluted traces of Mo and to retain the pertechnetate. The retained pertechnetate was then re-eluted, quantitatively, in 3 ml of normal saline, from the alumina column. About a 4-fold increase in radioactive concentration of Tc was obtained (cf. approximately 10-12 ml normal saline is required for the elution of Tc from the gel column). Generators containing up to 22.2 GBq (600 mCi) Mo in 6-7 g ZrMo gel column (35 x 13 mm) were prepared and a radioactive concentration of Tc up to 4 GBq x ml (110 mCi x ml) was obtained on the first day of use. The overall recovery of Tc was >90%, Mo breakthrough was 10 to 10% and the duration of concentration was 3-5 min. The chemical impurity in terms of Al, Mo and Zr was <10 ppm each. The same procedure for the concentration of pertechnetate was applied to generators with 12-15 g ZrMo gel beds to obtain a higher capacity Tc gel generator, with similar findings.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2006NIMPA.569..525S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2006NIMPA.569..525S"><span>Bombesin receptors and transplanted stem cells in rat brain: High-resolution scan with 99mTc BN1.1</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Scopinaro, F.; Paschali, E.; Di Santo, G.; Antonellis, T.; Massari, R.; Trotta, C.; Gourni, H.; Bouziotis, P.; David, V.; Soluri, A.; Varvarigou, A. D.</p> <p>2006-12-01</p> <p>The aim of this work is to detect the presence of transplanted stem cells (TSC) in rat brain with high-resolution (HR) scintigraphy and labelled bombesin (BN). BN is a morphogen for Central Nervous System (CNS) as well as for other organs: CNS-oriented TSC over-express BN Receptors (BNR). BN is also a neurotransmitter and modulates several functions of CNS. 99mTc labelled BN-like peptide scan of CNS is the ideal method to detect growing TSC once knowing normal distribution of BNRs in CNS. HR Planar and single photon emission computerized tomography (SPECT) images of rat brain were performed with new HR detectors (Li-tech, Italy). Pertechnetate, 99mTc HMPAO and the new 99mTc BN1.1 (patented) were i.v. administered in five rats. HR SPECT of 99mTc BN1.1 detected olfactory tract, fronto-lateral cortex, cerebellum, basal ganglia and amygdale. Results of SPECT were confirmed by bio-distribution study performed after autopsy of three of the five rats. The remaining two rats underwent cerebral lesions followed by transplant of TSC. Three months later, HR scintigraphy was repeated and showed images completely different from previous basal study, with hot spot of 99mTc BN1.1 corresponding to the site of TSC transplant. Immuno-histochemistry confirmed the presence of viable TSC. Not only 99mTc BN1.1 HR scan showed viability of transplanted TSC but also the "background brain" was the still now unknown map of BNR in mammalian brain.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22518610-tether-cutting-reconnection-between-two-solar-filaments-triggering-outflows-coronal-mass-ejection','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22518610-tether-cutting-reconnection-between-two-solar-filaments-triggering-outflows-coronal-mass-ejection"><span>TETHER-CUTTING RECONNECTION BETWEEN TWO SOLAR FILAMENTS TRIGGERING OUTFLOWS AND A CORONAL MASS EJECTION</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Chen, Huadong; Zhang, Jun; Li, Leping</p> <p></p> <p>Triggering mechanisms of solar eruptions have long been a challenge. A few previous case studies have indicated that preceding gentle filament merging via magnetic reconnection may launch following intense eruption, according to the tether-cutting (TC) model. However, the detailed process of TC reconnection between filaments has not been exhibited yet. In this work, we report the high-resolution observations from the Interface Region Imaging Spectrometer (IRIS) of TC reconnection between two sheared filaments in NOAA active region 12146. The TC reconnection commenced on ∼15:35 UT on 2014 August 29 and triggered an eruptive GOES C4.3-class flare ∼8 minutes later. An associatedmore » coronal mass ejection appeared in the field of view of the Solar and Heliospheric Observatory/LASCO C2 about 40 minutes later. Thanks to the high spatial resolution of IRIS data, bright plasma outflows generated by the TC reconnection are clearly observed, which moved along the subarcsecond fine-scale flux tube structures in the erupting filament. Based on the imaging and spectral observations, the mean plane-of-sky and line-of-sight velocities of the TC reconnection outflows are separately measured to be ∼79 and 86 km s{sup −1}, which derives an average real speed of ∼120 km s{sup −1}. In addition, it is found that spectral features, such as peak intensities, Doppler shifts, and line widths in the TC reconnection region are evidently enhanced compared to those in the nearby region just before the flare.« less</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_19");'>19</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li class="active"><span>21</span></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_21 --> <div id="page_22" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li class="active"><span>22</span></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="421"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2009APS..MARJ31004T','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2009APS..MARJ31004T"><span>Design of Co/Pd multilayer system with antiferromagnetic-to-ferromagnetic phase transition</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Thiele, Jan-Ulrich</p> <p>2009-03-01</p> <p>Among the known magnetic material systems there are only very few examples of materials that undergo a temperature dependent antiferromagnetic-to-ferromagnetic phase transition, and of these only the chemically ordered alloy FeRh exhibits this transition near room temperature [1, 2]. Here we present a perpendicular anisotropy multilayer structure that mimics FeRh. The basic idea is to use two stacks of Co/Pd multilayers with large perpendicular magnetic anisotropy and high Curie temperature, TC, separated by a layer providing antiferromagnetic coupling, and a CoNi/Pd multilayer with perpendicular anisotropy with a lower TC, interlayer, in the range of the desired AF-FM transition temperature, TAF-FM. At room temperature this system behaves as two antiferromagnetically coupled layers with a low perpendicular remanent magnetic moment. As the temperature is raised to approach TC, interlayer the magnetization of the interlayer is gradually reduced to zero, and consequently its coupling strength is reduced. Eventually, the effective coupling between the two high-KU, high-TC layers becomes dominated by their dipolar fields, resulting in a parallel alignment of their moments and a net remanent magnetic moment equal to the sum of the moments of the two high-TC layers [2]. [4pt] [1] J. S. Kouvel and C. C. Hartelius, J. Appl. Phys. 33 (1962) p1343 [0pt] [2] J.-U. Thiele, E. E. Fullerton, S. Maat, Appl. Phys. Lett. 82 (2003) p2859 [0pt] [3] J.-U. Thiele. T. Hauet. O. Hellwig, Appl. Phys. Lett. 92 (2008) 242502.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22619033','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22619033"><span>Relationship between potential aggregation-prone regions and HLA-DR-binding T-cell immune epitopes: implications for rational design of novel and follow-on therapeutic antibodies.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kumar, Sandeep; Mitchell, Mark A; Rup, Bonita; Singh, Satish K</p> <p>2012-08-01</p> <p>Aggregation and unwanted immunogenicity are hurdles to avoid in successful commercial development of antibody-based therapeutics. In this article, the relationship between aggregation-prone regions (APRs), capable of forming cross-β motifs/amyloid fibrils, and major histocompatibility complex class II-restricted human leukocyte antigen (HLA)-DR-binding T-cell immune epitopes (TcIEs) is analyzed using amino acid sequences of 25 therapeutic antibodies, 55 TcIEs recognized by T-regulatory cells (tregitopes), 1000 randomly generated 15-residue-long peptides, 2257 human self-TcIEs (autoantigens), and 11 peptides in HLA-peptide cocrystal structures. Sequence analyses from these diverse sources consistently show a high level of correlation between APRs and TcIEs: approximately one-third of TcIEs contain APRs, but the majority of APRs occur within TcIE regions (TcIERs). Tregitopes also contain APRs. Most APR-containing TcIERs can bind multiple HLA-DR alleles, suggesting that aggregation-driven adverse immune responses could impact a broad segment of patient population. This article has identified common molecular sequence-structure loci that potentially contribute toward both manufacturability and safety profiles of the therapeutic antibodies, thereby laying a foundation for simultaneous optimization of these attributes in novel and follow-on candidates. Incidence of APRs within TcIERs is not special to biotherapeutics, self-TcIEs from human proteins, involved in various diseases, also contain predicted APRs and experimentally proven amyloid-fibril-forming peptide sequence portions. Copyright © 2012 Wiley Periodicals, Inc.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/114867-technetium-hmpao-marker-chemical-irradiation-lung-injury-experimental-clinical-investigations','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/114867-technetium-hmpao-marker-chemical-irradiation-lung-injury-experimental-clinical-investigations"><span>Technetium-99m-HMPAO as a marker of chemical and irradiation lung injury: Experimental and clinical investigations</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Suga, Kazuyoshi; Uchisako, Hiromichi; Nishigauchi, Kazuya</p> <p>1994-09-01</p> <p>The authors evaluated the ability of {sup 99m}Tc-hexamethylpropyleneamine oxime ({sup 99m}Tc-HMPAO) to serve as a sensitive marker of lung injury. Two experiment rabbit models of minimal lung injury were designed using injections of a low dose (0.05 ml/kg) of oleic acid or 50 Gy of irradiation. In addition, they clinically investigated whether patients who received chemotherapy (n = 14) or radiotherapy (n = 13) for lung cancer showed high uptake of {sup 99m}Tc-HMPAO in the lungs. Despite the minimal endothelial lesions visualized by electron microscopy (edematous changes and blebbing), in both animal models, the lungs showed high uptake of {supmore » 99m}Tc-HMPAO, which occurred rapidly within 1 min after injection. Clinically, the mean lung-to-liver ratio of {sup 99m}Tc-HMPAO activity in the patients who received chemotherapy (0.649{+-}0.185, p < 0.01) was significantly higher than that of the controls (n = 16; 0.387{+-}0.108), and all 12 patients who received more than 30 Gy of irradiation showed abnormal uptake in the irradiated lungs, despite the lack of abnormal opacities on chest CT. These findings suggest that {sup 99m}Tc-HMPAO has the potential to be a sensitive marker of chemical and irradiation lung injury. 53 refs., 5 figs., 3 tabs.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018ThApC.tmp..154J','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018ThApC.tmp..154J"><span>Estimation of size of tropical cyclones in the North Indian Ocean using Oceansat-2 scatterometer high-resolution wind products</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Jaiswal, Neeru; Ha, Doan Thi Thu; Kishtawal, C. M.</p> <p>2018-03-01</p> <p>Tropical cyclone (TC) is one of the most intense weather hazards, especially for the coastal regions, as it causes huge devastation through gale winds and torrential floods during landfall. Thus, accurate prediction of TC is of great importance to reduce the loss of life and damage to property. Most of the cyclone track prediction model requires size of TC as an important parameter in order to simulate the vortex. TC size is also required in the impact assessment of TC affected regions. In the present work, the size of TCs formed in the North Indian Ocean (NIO) has been estimated using the high resolution surface wind observations from oceansat-2 scatterometer. The estimated sizes of cyclones were compared to the radius of outermost closed isobar (ROCI) values provided by Joint Typhoon warning Center (JTWC) by plotting their histograms and computing the correlation and mean absolute error (MAE). The correlation and MAE between the OSCAT wind based TC size estimation and JTWC-ROCI values was found 0.69 and 33 km, respectively. The results show that the sizes of cyclones estimated by OSCAT winds are in close agreement to the JTWC-ROCI. The ROCI values of JTWC were analyzed to study the variations in the size of tropical cyclones in NIO during different time of the diurnal cycle and intensity stages.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26844848','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26844848"><span>In Vitro/In Vivo Evaluation of Radiolabeled [(99m)Tc(CO)3](+)-Hydroxyurea and Fluorescein Isothiocyanate-Hydroxyurea.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Yilmaz, Baris; Teksoz, Serap; Kilcar, Ayfer Yurt; Ucar, Eser; Ichedef, Cigdem; Medine, Emin Ilker; Ari, Kadir</p> <p>2016-02-01</p> <p>The aim of current study is to examine hydroxyurea (HU), which is an antineoplastic drug used for the treatment of leukemia, sickle-cell disease, HIV, psoriasis, thrombocythemia, and various neoplastic diseases in two aspects. The active ingredient hydroxyurea was obtained by purification of the capsule form drug, commercially named as HYDREA. Then, [(99m)Tc(CO)3](+)core radiolabeling with HU was performed as first aspect. Quality control studies of (99m)Tc(CO)3-HU complex were performed by thin-layer radiochromatography and high-performance liquid radiochromatography methods. The results demonstrated that the radiolabeling yield was quite high (98.43% ± 2.29%). Also, (99m)Tc(CO)3-HU complex has good stability during the 24-hour period. Biological behavior of (99m)Tc(CO)3-HU complex is evaluated by biodistribution studies on Wistar Albino rats. Fluorescein isothiocyanate (FITC) labeling of HU was performed as second aspect. Fluorometric evaluation of binding efficacy and fluorescence imaging studies on MCF7 and Hela cell lines were carried out. It was thought that the knowledge achieved in this study would contribute to using (99m)Tc(CO)3-HU complex as an imaging agent, which inhibits the DNA synthesis selectively, by inhibiting ribonucleotide reductase enzyme. It was observed that FITC-HU has noteworthy incorporation on both cell lines.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018PhRvB..97v4504Z','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018PhRvB..97v4504Z"><span>Superconducting proximity effect in a topological insulator using Fe(Te, Se)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Zhao, He; Rachmilowitz, Bryan; Ren, Zheng; Han, Ruobin; Schneeloch, J.; Zhong, Ruidan; Gu, Genda; Wang, Ziqiang; Zeljkovic, Ilija</p> <p>2018-06-01</p> <p>Interest in the superconducting proximity effect has recently been reignited by theoretical predictions that it could be used to achieve topological superconductivity. Low-Tc superconductors have predominantly been used in this effort, but small energy scales of ˜1 meV have hindered the characterization of the emergent electronic phase, limiting it to extremely low temperatures. In this work, we use molecular beam epitaxy to grow topological insulator B i2T e3 in a range of thicknesses on top of a high-Tc superconductor Fe(Te,Se). Using scanning tunneling microscopy and spectroscopy, we detect Δind as high as ˜3.5 meV, which is the largest reported gap induced by proximity to an s -wave superconductor to date. We find that Δind decays with B i2T e3 thickness, but remains finite even after the topological surface states have been formed. Finally, by imaging the scattering and interference of surface state electrons, we provide a microscopic visualization of the fully gapped B i2T e3 surface state due to Cooper pairing. Our results establish Fe-based high-Tc superconductors as a promising new platform for realizing high-Tc topological superconductivity.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2010JAP...107iE721S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2010JAP...107iE721S"><span>Induction magnetometer using a high-Tc superconductor coil</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Sasada, Ichiro</p> <p>2010-05-01</p> <p>An induction magnetometer consisting of a search coil and an inverting operational amplifier is simple in structure and in signal transferring mechanism from the magnetic field input to the voltage output. Because this magnetometer is based on Faraday's law of induction, it has a lower cutoff frequency r/(2πL), where r is the resistance of the coil and L is its inductance. An attempt has been made to lower the cutoff frequency of the induction magnetometer by using a high-Tc superconductor coil. With a pancake coil (inner diameter ≈18 cm and outer diameter ≈23 cm, 92 turns, 3.23 mH) made of a Bismuth strontium calcium copper oxide (BSCCO) superconductor tape of 5 mm in width and 0.23 mm in thickness, the cutoff frequency achieved was 1.7 Hz which is much lower than that obtained with a bulky copper search coil which is typically in the range of 10-20 Hz. In the experiment, an inverting amplifier was made with a complementary metal-oxide semiconductor operational amplifier and was immersed in liquid nitrogen together with a BSCCO high-Tc superconducting coil. Discussion is made on the resolution of the induction magnetometer using a high-Tc superconductor search coil.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2009GeCoA..73.2299F','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2009GeCoA..73.2299F"><span>Oxidative dissolution potential of biogenic and abiogenic TcO 2 in subsurface sediments</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Fredrickson, James K.; Zachara, John M.; Plymale, Andrew E.; Heald, Steve M.; McKinley, James P.; Kennedy, David W.; Liu, Chongxuan; Nachimuthu, Ponnusamy</p> <p>2009-04-01</p> <p>Technetium-99 (Tc) is an important fission product contaminant associated with sites of nuclear fuels reprocessing and geologic nuclear waste disposal. Tc is highly mobile in its most oxidized state [Tc(VII)O4-] and less mobile in the reduced form [Tc(IV)O 2· nH 2O]. Here we investigate the potential for oxidation of Tc(IV) that was heterogeneously reduced by reaction with biogenic Fe(II) in two sediments differing in mineralogy and aggregation state; unconsolidated Pliocene-age fluvial sediment from the upper Ringold (RG) Formation at the Hanford Site and a clay-rich saprolite from the Field Research Center (FRC) background site on the Oak Ridge Site. Both sediments contained Fe(III) and Mn(III/IV) as redox active phases, but FRC also contained mass-dominant Fe-phyllosilicates of different types. Shewanella putrefaciens CN32 reduced Mn(III/IV) oxides and generated Fe(II) that was reactive with Tc(VII) in heat-killed, bioreduced sediment. After bioreduction and heat-killing, biogenic Fe(II) in the FRC exceeded that in RG by a factor of two. More rapid reduction rates were observed in the RG that had lower biogenic Fe(II), and less particle aggregation. EXAFS measurements indicated that the primary reduction product was a TcO 2-like phase in both sediments. The biogenic redox product Tc(IV) oxidized rapidly and completely in RG when contacted with air. Oxidation, in contrast, was slow and incomplete in the FRC, in spite of similar molecular scale speciation of Tc compared to RG. X-ray microprobe, electron microprobe, X-ray absorption spectroscopy, and micro X-ray diffraction were applied to the whole sediment and isolated Tc-containing particles. These analyses revealed that non-oxidizable Tc(IV) in the FRC existed as complexes with octahedral Fe(III) within intra-grain domains of 50-100 μm-sized, Fe-containing micas presumptively identified as celadonite. The markedly slower oxidation rates in FRC as compared to RG were attributed to mass-transfer-limited migration of O 2 into intra-aggregate and intraparticle domains where Tc(IV) existed; and the formation of unique, oxidation-resistant, intragrain Tc(IV)-Fe(III) molecular species.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://mo.water.usgs.gov/Reports/01-4123-kelly/index.htm','USGSPUBS'); return false;" href="http://mo.water.usgs.gov/Reports/01-4123-kelly/index.htm"><span>Relations Among River Stage, Rainfall, Ground-Water Levels, and Stage at Two Missouri River Flood-Plain Wetlands</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Kelly, Brian P.</p> <p>2001-01-01</p> <p>The source of water is important to the ecological function of Missouri River flood-plain wetlands. There are four potential sources of water to flood-plain wetlands: direct flow from the river channel during high river stage, ground-water movement into the wetlands in response to river-stage changes and aquifer recharge, direct precipitation, and runoff from surrounding uplands. Concurrent measurements of river stage, rainfall, ground-water level, and wetland stage were compared for two Missouri River flood-plain wetlands located near Rocheport, Missouri, to characterize the spatial and temporal relations between river stage, rainfall, ground-water levels and wetland stage, determine the source of water to each wetland, and compare measured and estimated stage and ground-water levels at each site. The two sites chosen for this study were wetland NC-5, a non-connected, 50 feet deep scour constantly filled with water, formed during the flood of 1993, and wetland TC-1, a shallow, temporary wetland intermittently filled with water. Because these two wetlands bracket a range of wetland types of the Missouri River flood plain, the responses of other Missouri River wetlands to changes in river stage, rainfall, and runoff should be similar to the responses exhibited by wetlands NC-5 and TC-1. For wetlands deep enough to intersect the ground-water table in the alluvial aquifer, such as wetland NC-5, the ground-water response factor can estimate flood-plain wetland stage changes in response to known river-stage changes. Measured maximum stage and ground-water-level changes at NC-5 fall within the range of estimated changes using the ground-water response factor. Measured maximum ground-water-level changes at TC-1 are similar to, but consistently greater than the estimated values, and are most likely the result of alluvial deposits with higher than average hydraulic conductivity located between wetland TC-1 and the Missouri River. Similarity between ground-water level and stage hydrography at wetland NC-5 indicate that ground-water-level fluctuations caused by river-stage changes control the stage of wetland NC-5. A 2-day lag time exists between river-stage changes and ground water and stage changes at wetland NC-5. The lack of a measurable response of wetland NC-5 stage to rainfall indicate that rainfall is not a large source of water to wetland NC-5. Stage in wetland TC-1 only increased at high river stage in June and July 1999, and from runoff caused by local rainfall during the winter. The 2-day lag time between peak stages at wetland TC-1 and peak Missouri River stages compared to the 1-day lag time between Missouri River stage and ground-water peaks at wetland TC-1 indicates ground-water flow does not directly affect wetland stage at TC-1, but surface-water flow does affect wetland stage at TC-1 during high river stage. Comparing wetland TC-1 stage to potential water sources indicates the most likely explanation for the rise in stage at wetland TC-1 is surface runoff supplied via seepage through the levees and upward flow of ground water through alluvial deposits of higher hydraulic conductivity during high river stage. The rate of decrease in wetland TC-1 stage was limited by the rate at which ground-water level decreased. Stage response to rainfall at wetland TC-1 during the winter months and no response to greater rainfall amounts during spring and summer months indicate that evapotranspiration may limit the affect of rainfall on stage at wetland TC-1 during the growing season.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018AIPA....8d7204N','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018AIPA....8d7204N"><span>Critical exponent analysis of lightly germanium-doped La0.7Ca0.3Mn1-xGexO3 (x = 0.05 and x = 0.07)</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Nanto, Dwi; Kurniawan, Budhy; Soegijono, Bambang; Ghosh, Nilotpal; Hwang, Jong-Soon; Yu, Seong-Cho</p> <p>2018-04-01</p> <p>We have used a critical behavior study of La0.7Ca0.3MnO3 (LCMO) manganite perovskites whose Mn sites have been doped with Ge to explore magnetic interactions. Light Ge doping of 5 or 7 percent tended to produce LCMOs with second order magnetic transitions. The critical parameters of 5- and 7-percent Ge-doped LCMO were determined to be TC = 185 K, β = 0.331 ± 0.019, and γ = 1.15 ± 0.017; and TC = 153 K, β = 0.496 ± 0.011, and γ = 1.03 ± 0.046, respectively, via the modified Arrott plot method. Isothermal magnetization data collected near the Curie temperature (TC) was split into a universal function with two branches M(H,ɛ) = |ɛ|βf±(H/|ɛ|β+γ), where ɛ=(T-TC)/TC is the reduced temperature. f+ is used when T>TC, while f̲ is used when T<TC. Such results demonstrate the existence of ferromagnetic short-range order in lightly Ge-doped LCMOs. Notably, doping with Ge at high concentrations tends to generate long-range ferromagnetic order.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017AIPC.1882b0070S','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017AIPC.1882b0070S"><span>Nuclear medicine in breast cancer diagnostics: Primary tumor and lymphatic metastasis</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Sinilkin, I.; Medvedeva, A.; Chernov, V.; Slonimskaya, E.; Zelchan, R.; Bragina, O.</p> <p>2017-09-01</p> <p>The purpose of the study: to assess the possibility of using nuclear medicine techniques at the stages of diagnosis and treatment of breast cancer. Materials and Methods: The study included 290 patients with breast cancer and 70 patients with benign breast tumors. The study was used as a radiopharmaceutical 99mTc-MIBI, 199Tl for imaging tumors and colloid 99mTc-Aloteh for visualization sentinel lymph nodes (SLN), colloid was injected peritumoral in four points to 80 MBq one day prior to the planned operation. Results: The sensitivity of SPECT using both 99mTc-MIBI and 199Tl for breast cancer detection was shown to be rather high, being 98.5% and 98%, respectively. It should be noted that the sensitivity of SPECT in detection of small tumors (less than 1 cm in diameter) and multicentric tumors was not high irrespective of the radioisotope used (60% and 65% with 99mTc-MIBI and 65% and 59% with 199Tl, respectively). The difference in the sensitivity was found between 99mTc-MIBI and 199T for the detection of regional lymph node metastasis (91% vs 70%). SLN were detected in 31 patients. The most commonly SLN were defined in the axillary region of 96.7%. In 22 (70.9%) patients there was no metastasis SLN. The sensitivity of the method was 91.2%, specificity of 100%. Conclusion: The specificity of SPECT with 199Tl was higher than that with 99mTc-MIBI. The data obtained show that SPECT with 199Tl can be recommended for its use as an additional breast cancer detection method in cases when other imaging techniques and histological findings are not accurate enough. The clinical study of 99mTc-Aloteh, a new radiopharmaceutical agent, has shown that the studied colloid has high uptake level in SLN and can be successfully used for visualization of SLN in patients with breast cancer.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5689602','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5689602"><span>Radiolabelled polymeric IgA: from biodistribution to a new molecular imaging tool in colorectal cancer lung metastases</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Carpenet, Helene; Cuvillier, Armelle; Perraud, Aurélie; Martin, Ophélie; Champier, Gaël; Jauberteau, Marie-Odile; Monteil, Jacques; Quelven, Isabelle</p> <p>2017-01-01</p> <p>By radiolabelling monomeric (m) and polymeric (p) IgA with technetium 99m (99mTc), this study assessed IgA biodistribution and tumour-targeting potency. IgA directed against carcinoembryonic antigen (CEA), a colorectal cancer marker, was selected to involve IgA mucosal tropism. Ig was radiolabelled with 99mTc-tricarbonyl after derivatisation by 2-iminothiolane. 99mTc-IgA was evaluated by in vitro analysis. The biodistributions of radiolabelled anti-CEA mIgA, pIgA and IgG were compared in normal mice. Anti-CEA pIgA tumour uptake was studied in mice bearing the WiDr caecal orthotopic graft. IgA radiolabelling was obtained with a high yield, was stable in PBS and murine plasma, and did not alter IgA binding functionality (Kd ≈ 25 nM). Biodistribution studies in normal mice confirmed that radiolabelled pIgA – and to a lesser extent, mIgA – showed strong and fast mucosal tropism and a shorter serum half-life than IgG. In caecal tumour model mice, evaluation of the anti-CEA-pIgA biodistribution showed a high uptake in lung metastases, confirmed by histological analysis. However, no radioactivity uptake increase in the tumoural caecum was discerned from normal intestinal tissue, probably due to high IgA caecal natural tropism. In microSPECT/CT imaging, 99mTc-IgA confirmed its diagnostic potency of tumour in mucosal tissue, even if detection threshold by in vivo imaging was higher than post mortem studies. Contribution of the FcαRI receptor, studied with transgenic mouse model (Tsg SCID-CD89), did not appear to be determinant in 99mTc-IgA uptake. Pre-clinical experiments highlighted significant differences between 99mTc-IgA and 99mTc-IgG biodistributions. Furthermore, tumoural model studies suggested potential targeting potency of pIgA in mucosal tissues. PMID:29156712</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28553700','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28553700"><span>Minimally invasive radioguided parathyroid surgery using low-dose Tc-99m-MIBI - comparison with standard high dose.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Jangjoo, Ali; Sadeghi, Ramin; Mousavi, Zohreh; Mohebbi, Masoud; Khaje, Mahtab; Asadi, Mehdi</p> <p>2017-01-01</p> <p>Surgery remains the most effective treatment for primary hyperparathyroidism (PHPT). Minimally invasive radioguided parathyroidectomy (MIRP) is a common technique for detecting and excising abnormal parathyroid glands. The aim of this study was to compare injections of low-dose and high-dose (99m) Tc methoxy isobutyl isonitrile (MIBI) for intraoperative localisation of parathyroid adenomas by means of a gamma probe in patients with primary hyperparathyroidism (PHPT). Thirty patients with PHPT and a preoperative diagnosis of parathyroid adenoma were enrolled between 2010 and 2012. They were considered as Group B and underwent MIRP using 5 mCi Tc-99m MIBI, and their perioperative data were compared with twenty patients treated with conventional 20 mCi Tc-99m MIBI previously (Group A). Group A was made up of 20 patients (mean age, 41.55 years; 14 women and 6 men), and group B included 30 patients (mean age, 40.43 years; 19 women and 11 men). The mean serum parathyroid hormone (PTH) and calcium values were recorded pre- and postoperatively. The mean follow-up period for the patients in the two groups was 18.4 and 16.5 months, respectively. Pre-operative evaluation demonstrated that the groups were statistically similar. Intraoperative data and success rate of surgery showed no difference between the two groups. No significant complication was detected after surgeries and no recurrence happened in either of the two groups during the follow-up period. A new protocol of MIRP using low doses of Tc-99m-MIBI resulted in an excellent success rate. Comparing results of the study, we conclude that low-dose Tc-99m-MIBI may be preferred for identification of parathyroid adenomas intraoperatively by means of a gamma probe in PHPT patients because it appears to be as effective as high-dose Tc-99m-MIBI.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://hdl.handle.net/2060/19850007787','NASA-TRS'); return false;" href="http://hdl.handle.net/2060/19850007787"><span>High temperature thermocouple and heat flux gauge using a unique thin film-hardware hot juncture</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Liebert, C. H.; Holanda, R.; Hippensteele, S. A.; Andracchio, C. A.</p> <p>1984-01-01</p> <p>A special thin film-hardware material thermocouple (TC) and heat flux gauge concept for a reasonably high temperature and high flux flat plate heat transfer experiment was fabricated and tested to gauge temperatures of 911 K. This concept was developed for minimal disturbance of boundary layer temperature and flow over the plates and minimal disturbance of heat flux through the plates. Comparison of special heat flux gauge Stanton number output at steady-state conditions with benchmark literature data was good and agreement was within a calculated uncertainty of the measurement system. Also, good agreement of special TC and standard TC outputs was obtained and the results are encouraging. Oxidation of thin film thermoelements was a primary failure mode after about 5 of operation.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/873436','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/servlets/purl/873436"><span>NMR/MRI with hyperpolarized gas and high Tc SQUID</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Schlenga, Klaus; de Souza, Ricardo E.; Wong-Foy, Annjoe; Clarke, John; Pines, Alexander</p> <p>2000-01-01</p> <p>A method and apparatus for the detection of nuclear magnetic resonance (NMR) signals and production of magnetic resonance imaging (MRI) from samples combines the use of hyperpolarized inert gases to enhance the NMR signals from target nuclei in a sample and a high critical temperature (Tc) superconducting quantum interference device (SQUID) to detect the NMR signals. The system operates in static magnetic fields of 3 mT or less (down to 0.1 mT), and at temperatures from liquid nitrogen (77K) to room temperature. Sample size is limited only by the size of the magnetic field coils and not by the detector. The detector is a high Tc SQUID magnetometer designed so that the SQUID detector can be very close to the sample, which can be at room temperature.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://ntrs.nasa.gov/search.jsp?R=19860028321&hterms=911&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D80%26Ntt%3D911','NASA-TRS'); return false;" href="https://ntrs.nasa.gov/search.jsp?R=19860028321&hterms=911&qs=Ntx%3Dmode%2Bmatchall%26Ntk%3DAll%26N%3D0%26No%3D80%26Ntt%3D911"><span>High-temperature thermocouple and heat flux gauge using a unique thin film-hardware hot junction</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://ntrs.nasa.gov/search.jsp">NASA Technical Reports Server (NTRS)</a></p> <p>Liebert, C. H.; Holanda, R.; Hippensteele, S. A.; Andracchio, C. A.</p> <p>1985-01-01</p> <p>A special thin film-hardware material thermocouple (TC) and heat flux gauge concept for a reasonably high temperature and high flux flat plate heat transfer experiment was fabricated and tested to gauge temperatures of 911 K. This concept was developed for minimal disturbance of boundary layer temperature and flow over the plates and minimal disturbance of heat flux through the plates. Comparison of special heat flux gauge Stanton number output at steady-state conditions with benchmark literature data was good and agreement was within a calculated uncertainty of the measurement system. Also, good agreement of special TC and standard TC outputs was obtained and the results are encouraging. Oxidation of thin film thermoelements was a primary failure mode after about 5 of operation.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4366026','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4366026"><span>Dose calibrator linearity test: 99mTc versus 18F radioisotopes*</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Willegaignon, José; Sapienza, Marcelo Tatit; Coura-Filho, George Barberio; Garcez, Alexandre Teles; Alves, Carlos Eduardo Gonzalez Ribeiro; Cardona, Marissa Anabel Rivera; Gutterres, Ricardo Fraga; Buchpiguel, Carlos Alberto</p> <p>2015-01-01</p> <p>Objective The present study was aimed at evaluating the viability of replacing 18F with 99mTc in dose calibrator linearity testing. Materials and Methods The test was performed with sources of 99mTc (62 GBq) and 18F (12 GBq) whose activities were measured up to values lower than 1 MBq. Ratios and deviations between experimental and theoretical 99mTc and 18F sources activities were calculated and subsequently compared. Results Mean deviations between experimental and theoretical 99mTc and 18F sources activities were 0.56 (± 1.79)% and 0.92 (± 1.19)%, respectively. The mean ratio between activities indicated by the device for the 99mTc source as measured with the equipment pre-calibrated to measure 99mTc and 18F was 3.42 (± 0.06), and for the 18F source this ratio was 3.39 (± 0.05), values considered constant over the measurement time. Conclusion The results of the linearity test using 99mTc were compatible with those obtained with the 18F source, indicating the viability of utilizing both radioisotopes in dose calibrator linearity testing. Such information in association with the high potential of radiation exposure and costs involved in 18F acquisition suggest 99mTc as the element of choice to perform dose calibrator linearity tests in centers that use 18F, without any detriment to the procedure as well as to the quality of the nuclear medicine service. PMID:25798005</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23552053','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23552053"><span>A comparison of rat SPECT images obtained using (99m)Tc derived from 99Mo produced by an electron accelerator with that from a reactor.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Galea, R; Wells, R G; Ross, C K; Lockwood, J; Moore, K; Harvey, J T; Isensee, G H</p> <p>2013-05-07</p> <p>Recent shortages of molybdenum-99 ((99)Mo) have led to an examination of alternate production methods that could contribute to a more robust supply. An electron accelerator and the photoneutron reaction were used to produce (99)Mo from which technetium-99m ((99m)Tc) is extracted. SPECT images of rat anatomy obtained using the accelerator-produced (99m)Tc with those obtained using (99m)Tc from a commercial generator were compared. Disks of (100)Mo were irradiated with x-rays produced by a 35 MeV electron beam to generate about 1110 MBq (30 mCi) of (99)Mo per disk. After target dissolution, a NorthStar ARSII unit was used to separate the (99m)Tc, which was subsequently used to tag pharmaceuticals suitable for cardiac and bone imaging. SPECT images were acquired for three rats and compared to images for the same three rats obtained using (99m)Tc from a standard reactor (99)Mo generator. The efficiency of (99)Mo-(99m)Tc separation was typically greater than 90%. This study demonstrated the delivery of (99m)Tc from the end of beam to the end user of approximately 30 h. Images obtained using the heart and bone scanning agents using reactor and linac-produced (99m)Tc were comparable. High-power electron accelerators are an attractive option for producing (99)Mo on a national scale.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3578743','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3578743"><span>Molecular Epidemiology of Human Oral Chagas Disease Outbreaks in Colombia</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Ramírez, Juan David; Montilla, Marleny; Cucunubá, Zulma M.; Floréz, Astrid Carolina; Zambrano, Pilar; Guhl, Felipe</p> <p>2013-01-01</p> <p>Background Trypanosoma cruzi, the causative agent of Chagas disease, displays significant genetic variability revealed by six Discrete Typing Units (TcI-TcVI). In this pathology, oral transmission represents an emerging epidemiological scenario where different outbreaks associated to food/beverages consumption have been reported in Argentina, Bolivia, Brazil, Ecuador and Venezuela. In Colombia, six human oral outbreaks have been reported corroborating the importance of this transmission route. Molecular epidemiology of oral outbreaks is barely known observing the incrimination of TcI, TcII, TcIV and TcV genotypes. Methodology and Principal Findings High-throughput molecular characterization was conducted performing MLMT (Multilocus Microsatellite Typing) and mtMLST (mitochondrial Multilocus Sequence Typing) strategies on 50 clones from ten isolates. Results allowed observing the occurrence of TcI, TcIV and mixed infection of distinct TcI genotypes. Thus, a majority of specific mitochondrial haplotypes and allelic multilocus genotypes associated to the sylvatic cycle of transmission were detected in the dataset with the foreseen presence of mitochondrial haplotypes and allelic multilocus genotypes associated to the domestic cycle of transmission. Conclusions These findings suggest the incrimination of sylvatic genotypes in the oral outbreaks occurred in Colombia. We observed patterns of super-infection and/or co-infection with a tailored association with the severe forms of myocarditis in the acute phase of the disease. The transmission dynamics of this infection route based on molecular epidemiology evidence was unraveled and the clinical and biological implications are discussed. PMID:23437405</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/11884498','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/11884498"><span>Preclinical evaluation of a new, stabilized neurotensin(8--13) pseudopeptide radiolabeled with (99m)tc.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>García-Garayoa, Elisa; Bläuenstein, Peter; Bruehlmeier, Matthias; Blanc, Alain; Iterbeke, Koen; Conrath, Peter; Tourwé, Dirk; Schubiger, P August</p> <p>2002-03-01</p> <p>The rapid degradation of neurotensin (NT) limits its clinical use in cancer imaging and therapy. Thus, a new NT(8--13) pseudopeptide, NT-VIII, was synthesized. Some changes were introduced in the sequence of NT(8--13) to stabilize the molecule against enzymatic degradation: Arg(8) was N-methylated, and Lys and Tle replaced Arg(9) and Ile(12), respectively. Finally, (NalphaHis)Ac was coupled to the N-terminus for (99m)Tc(CO)(3) labeling. This peptide was characterized both in vitro and in vivo. The new analog was labeled with (99m)Tc(CO)(3). Its metabolic stability was analyzed both in human plasma and in HT-29 cells. Binding properties, receptor downregulation, and internalization were tested with HT-29 cells. Biodistribution was evaluated in nude mice with HT-29 xenografts. (99m)Tc(CO)(3)NT-VIII showed a high stability in plasma, where most of the peptide remained intact after 24 h of incubation at 37 degreesC. However, the degradation in HT-29 cells was more rapid (46% of intact (99m)Tc(CO)(3)NT-VIII after 24 h at 37 degreesC). Binding to NT1 receptors (NTR1) was saturable and specific. Scatchard analysis showed a high affinity for (99m)Tc(CO)(3)NT-VIII, with a dissociation constant similar to (125)I-NT (1.8 vs. 1.6 nmol/L). After interacting with NTR1, (99m)Tc(CO)(3)NT-VIII was rapidly internalized, with more than 90% internalized after 30 min. It also distributed and cleared rapidly in nude mice bearing HT-29 xenografts. The highest rates of accumulation were found in kidney and tumor at all time points tested. Tumor uptake was highly specific because it could be blocked by coinjection with a high dose of (NalphaHis)Ac-NT(8--13). Tumors were clearly visualized in scintigraphy images. The changes that were introduced stabilized the molecule against enzymatic degradation without affecting binding properties. Moreover, the increase in stability enhanced tumor uptake, making this derivative a promising candidate for clinical use.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_20");'>20</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li class="active"><span>22</span></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_22 --> <div id="page_23" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li class="active"><span>23</span></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="441"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/12145720','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/12145720"><span>Once-daily, high-dose levofloxacin versus ticarcillin-clavulanate alone or followed by amoxicillin-clavulanate for complicated skin and skin-structure infections: a randomized, open-label trial.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Graham, Donald R; Talan, David A; Nichols, Ronald L; Lucasti, Christopher; Corrado, Michael; Morgan, Nancy; Fowler, Cynthia L</p> <p>2002-08-15</p> <p>This study tested whether levofloxacin, at a new high dose of 750 mg, was effective for the treatment of complicated skin and skin-structure infections (SSSIs). Patients with complicated SSSIs (n=399) were randomly assigned in a ratio of 1:1 to 2 treatment arms: levofloxacin (750 mg given once per day intravenously [iv], orally, or iv/orally) or ticarcillin-clavulanate (TC; 3.1 g given iv every 4-6 hours) followed, at the investigator's discretion, by amoxicillin-clavulanate (AC; 875 mg given orally every 12 hours). In the clinically evaluable population, therapeutic equivalence was demonstrated between the levofloxacin and TC/AC regimens (success rates of 84.1% and 80.3%, respectively). In the microbiologically evaluable population, the overall rate of eradication was 83.7% in the levofloxacin treatment group and 71.4% in the TC/AC treatment group (95% confidence interval, -24.3 to -0.2). Both levofloxacin and TC/AC were well tolerated. These data demonstrate that levofloxacin (750 mg once per day) is safe and at least as effective as TC/AC for complicated SSSIs.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/24657583','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/24657583"><span>Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You</p> <p>2014-06-01</p> <p>Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26878768','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26878768"><span>Differences of immune responses between Tongcheng (Chinese local breed) and Large White pigs after artificial infection with highly pathogenic porcine reproductive and respiratory syndrome virus.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Liang, Wan; Li, Zhenhong; Wang, Peng; Fan, Pengcheng; Zhang, Yu; Zhang, Qingde; Wang, Yan; Xu, Xuewen; Liu, Bang</p> <p>2016-04-02</p> <p>Porcine reproductive and respiratory syndrome (PRRS) is one of the severest infectious diseases of pigs throughout the world. Pigs of different breeds infected with PRRS virus (PRRSV) have been reported to vary in their immune responses. Here, the differences of immune responses to highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) were investigated by artificially infecting Tongcheng (TC) pigs (a Chinese indigenous breed) and Large White (LW) pigs with PRRSV WUH3. Compared to LW pigs, TC pigs showed less severe symptoms and lower level of viral load. The routine blood test results indicated that TC pigs were relatively steady in terms of erythrocyte, leukocyte and platelet. Additionally, PRRSV infection induced higher IFN-γ activity in TC pigs, but stimulated an excessive level of IL-10 and IL-12p40 in LW pigs. Our study provides direct evidence that TC pigs have stronger resistance to early PRRSV infection than LW pigs, suggesting that the resistance of pigs to PRRSV is likely associated with breed differences. Copyright © 2016 Elsevier B.V. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2018PhyB..536...12L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2018PhyB..536...12L"><span>Magnetic study of the low temperature anomalies in the underdoped PrBCO compound</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Lahoubi, Mahieddine</p> <p>2018-05-01</p> <p>The low temperature anomalous magnetic properties of a non-superconducting PrBCO6+x compound in an underdoped oxygen state of concentration (x = 0.44) are characterized by paraprocess magnetic susceptibility χH(T) measurements carried out as a function of temperature T under different values of a DC magnetic field H up to 110 kOe. The derivatives dχH(T)/dT curves reveal a significant reduction with increasing H in the Néel temperature TN = 9 K of the Pr antiferromagnetic (AFM) ordering for which the transition subsists at 100 kOe. The small anomaly at T2 = 6-7 K is confirmed at 20 kOe and the previous spin reorientation attributed to this transition temperature seems to be suppressed above 60 kOe. The well defined anomaly in the vicinity of the low-critical point Tcr = 4-5 K which occurs simultaneously, is still present when the strength of H is increased up to 100 kOe. Weak field induced phase transitions are observed between T2 and TN at a low transition-field (Ht<11 kOe) in the differential magnetic susceptibility dMT(H)/dH as a function of H deduced from the isothermal magnetizations MT(H) with H up to 21 kOe, whereas a weak ferromagnetic behavior of the Pr sublattice appears below Tcr. The magnetic field effects give rise to more evidence for the Pr-Cu(2) coupling with 'exchange-frustrated AFM' interactions and ascertain the main role of the Pr sublattice whereas the Cu(2) sublattice seems to be less efficient.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29782493','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29782493"><span>Dissecting the phyloepidemiology of Trypanosoma cruzi I (TcI) in Brazil by the use of high resolution genetic markers.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Roman, Fabiola; das Chagas Xavier, Samanta; Messenger, Louisa A; Pavan, Márcio G; Miles, Michael A; Jansen, Ana María; Yeo, Matthew</p> <p>2018-05-01</p> <p>Trypanosoma cruzi, the causal agent of Chagas disease, is monophyletic but genetically heterogeneous. It is currently represented by six genetic lineages (Discrete Typing Units, DTUs) designated TcI-TcVI. TcI is the most geographically widespread and genetically heterogeneous lineage, this as is evidenced by a wide range of genetic markers applied to isolates spanning a vast geographic range in Latin America. In total, 78 TcI isolated from hosts and vectors distributed in 5 different biomes of Brazil, were analyzed using 6 nuclear housekeeping genes, 25 microsatellite loci and one mitochondrial marker. Nuclear markers reveal substantial genetic diversity, significant gene flow between biomes, incongruence in phylogenies, and haplotypic analysis indicative of intra-DTU genetic exchange. Phylogenetic reconstructions based on mitochondrial and nuclear loci were incongruent, and consistent with introgression. Structure analysis of microsatellite data reveals that, amongst biomes, the Amazon is the most genetically diverse and experiences the lowest level of gene flow. Investigation of population structure based on the host species/genus, indicated that Didelphis marsupialis might play a role as the main disperser of TcI. The present work considers a large TcI sample from different hosts and vectors spanning multiple ecologically diverse biomes in Brazil. Importantly, we combine fast and slow evolving markers to contribute to the epizootiological understanding of TcI in five distinct Brazilian biomes. This constitutes the first instance in which MLST analysis was combined with the use of MLMT and maxicircle markers to evaluate the genetic diversity of TcI isolates in Brazil. Our results demonstrate the existence of substantial genetic diversity and the occurrence of introgression events. We provide evidence of genetic exchange in TcI isolates from Brazil and of the relative isolation of TcI in the Amazon biome. We observe the absence of strict associations with TcI genotypes to geographic areas and/or host species.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4406414','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4406414"><span>Differential Lung Uptake of 99mTc-HMPAO and 99mTc-Duramycin in the Chronic Hyperoxia Rat Model</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Clough, Anne V.; Audi, Said H.; Haworth, Steven T.; Roerig, David L.</p> <p>2015-01-01</p> <p>Noninvasive radionuclide imaging has the potential to identify and assess mechanisms involved in particular stages of lung injury which occur with acute respiratory distress syndrome, for example. Lung uptake of 99mTc-hexamethylpropyleneamine oxime (HMPAO) is reported to be partially dependent on the redox status of the lung tissue while 99mTc-duramycin, a new marker of cell injury, senses cell death via apoptosis and/or necrosis. Thus, we investigated changes in lung uptake of these agents in rat exposed to hyperoxia for prolonged periods, a common model of acute lung injury. Methods Male Sprague-Dawley rats were pre-exposed to either normoxia (21% O2) or hyperoxia (85% O2) for up to 21 days. For imaging, the rats were anesthetized, injected i.v. with either 99mTc-HMPAO or 99mTc-duramycin (37-74 MBq) and planar images were acquired using a high sensitivity modular gamma camera. Subsequently, 99mTc-macroagreggated albumin (37 MBq, diam=10-40 μm) was injected i.v., imaged, and used to define a lung region-of-interest. The lung to background ratio was used as a measure of lung uptake. Results Hyperoxia exposure resulted in a 74% increase in 99mTc-HMPAO lung uptake, which peaked at 7 days and persisted for the 21 days of exposure. 99mTc-duramycin lung uptake was also maximal at 7 days of exposure but decreased to near control levels by 21 days. The sustained elevation of 99mTc-HMPAO uptake suggests ongoing changes in lung redox status whereas cell death appears to have subsided by 21 days. Conclusion These results suggest the potential use of 99mTc-HMPAO and 99mTc-duramycin as redox and cell-death imaging biomarkers, respectively, for in vivo identification and assessment of different stages of lung injury. PMID:23086010</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/29746871','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/29746871"><span>Discrete typing units of Trypanosoma cruzi detected by real-time PCR in Chilean patients with chronic Chagas cardiomyopathy.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Muñoz-San Martín, Catalina; Zulantay, Inés; Saavedra, Miguel; Fuentealba, Cristián; Muñoz, Gabriela; Apt, Werner</p> <p>2018-05-07</p> <p>Chagas disease is a major public health problem in Latin America and has spread to other countries due to immigration of infected persons. 10-30% of patients with chronic Chagas disease will develop cardiomyopathy. Chagas cardiomyopathy is the worst form of the disease, due to its high morbidity and mortality. Because of its prognostic value and adequate medical monitoring, it is very important to identify infected people who could develop Chagas cardiomyopathy. The aim of this study was to determine if discrete typing units (DTUs) of Trypanosoma cruzi are related to the presence of heart disease in patients with chronic Chagas disease. A total of 86 untreated patients, 41 with cardiomyopathy and 45 without heart involvement were submitted to clinical study. Electrocardiograms and echocardiograms were performed on the group of cardiopaths, in which all important known causes of cardiomyopathy were discarded. Sinus bradycardia and prolonged QTc interval were the most frequent electrocardiographic alterations and patients were classified in group I (46%) and group II (54%) of New York Hearth Association. In all cases real-time PCR genotyping assays were performed. In the group with cardiomyopathy, the most frequent DTU was TcI (56.1%), followed by TcII (19.5%). Mixed infections TcI + TcII were observed in 7.3% of the patients. In the group without cardiac pathologies, TcI and TcII were found at similar rates (28.9 and 31.1%, respectively) and mixed infections TcI + TcII in 17.8% of the cases. TcIII and TcIV were not detected in any sample. Taken together, our data indicate that chronic Chagas cardiomyopathy in Chile can be caused by strains belonging to TcI and TcII. Copyright © 2018 Elsevier B.V. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5983858','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5983858"><span>Dissecting the phyloepidemiology of Trypanosoma cruzi I (TcI) in Brazil by the use of high resolution genetic markers</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>das Chagas Xavier, Samanta; Messenger, Louisa A.; Pavan, Márcio G.; Miles, Michael A.; Jansen, Ana María; Yeo, Matthew</p> <p>2018-01-01</p> <p>Background Trypanosoma cruzi, the causal agent of Chagas disease, is monophyletic but genetically heterogeneous. It is currently represented by six genetic lineages (Discrete Typing Units, DTUs) designated TcI-TcVI. TcI is the most geographically widespread and genetically heterogeneous lineage, this as is evidenced by a wide range of genetic markers applied to isolates spanning a vast geographic range in Latin America. Methodology/Principal findings In total, 78 TcI isolated from hosts and vectors distributed in 5 different biomes of Brazil, were analyzed using 6 nuclear housekeeping genes, 25 microsatellite loci and one mitochondrial marker. Nuclear markers reveal substantial genetic diversity, significant gene flow between biomes, incongruence in phylogenies, and haplotypic analysis indicative of intra-DTU genetic exchange. Phylogenetic reconstructions based on mitochondrial and nuclear loci were incongruent, and consistent with introgression. Structure analysis of microsatellite data reveals that, amongst biomes, the Amazon is the most genetically diverse and experiences the lowest level of gene flow. Investigation of population structure based on the host species/genus, indicated that Didelphis marsupialis might play a role as the main disperser of TcI. Conclusions/Significance The present work considers a large TcI sample from different hosts and vectors spanning multiple ecologically diverse biomes in Brazil. Importantly, we combine fast and slow evolving markers to contribute to the epizootiological understanding of TcI in five distinct Brazilian biomes. This constitutes the first instance in which MLST analysis was combined with the use of MLMT and maxicircle markers to evaluate the genetic diversity of TcI isolates in Brazil. Our results demonstrate the existence of substantial genetic diversity and the occurrence of introgression events. We provide evidence of genetic exchange in TcI isolates from Brazil and of the relative isolation of TcI in the Amazon biome. We observe the absence of strict associations with TcI genotypes to geographic areas and/or host species. PMID:29782493</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26506873','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26506873"><span>Relationship between toxicities and clinical benefits of newly approved tyrosine kinase inhibitors in thyroid cancer: A meta-analysis of literature.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Ye, Xiaobing; Zhu, Yiping; Cai, Juan</p> <p>2015-10-01</p> <p>The aim of this meta-analysis was to analyze the relationship of toxicities and clinical benefits of newly approved lenvatinib and sorafenib to thyroid cancer (TC) in patients. Three major medical databases, PubMed, EMBASE, and ISI web of science were systematically searched to identify all studies on lenvatinib and sorafenib in TC. A meta-analysis was performed to clarify the toxicities and clinical benefits of newly Food and Drug Administration (FDA) approved lenvatinib and sorafenib to thyroid cancer. Ten studies (n = 749) were included which evaluated the toxicities and clinical benefits of newly FDA approved lenvatinib and sorafenib to thyroid cancer. 537 (71.7%) of the 749 patients bearing TC (radioiodine-refractory, differentiated thyroid cancer) clinical benefits from lenvatinib or sorafenib, and serious adverse events occurred in 430 (57.4%) of the 749 patients ([risk ratio (RR) = 1.27, 95% confidence interval (CI) = (1.05-1.53), P = 0.01]). While 31 (4.1%) of the 749 patients died due to various reasons, that mainly accounts for severe bleeding events and cardiac arrest. The clinical benefit is obvious compared to deaths ([RR = 17.06, 95% CI = (12.08-24.11), P < 0.001]). Subgroup analyses were then conducted according to cancer type (radioiodine-refractory thyroid cancer [RR-TC] and TC). We found that in treating RR-TC, the clinical benefits are close to toxicities. While in treating TC, the clinical benefits are better than toxicities. And we found that sorafenib and lenvatinib might be proper to deal with TC (benefits rate 79.7%) compared to RR-TC (benefits rate 69.5%), taking consider of toxicities. Lenvatinib and sorafenib are useful in the treatment of TC. Although, their toxicities remain high (57.4%) in the patients, the death rate is controlled (4.1%). Take consider of toxicities, lenvatinib, and sorafenib are more useful for TC compared to RR-TC.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015ApPhL.106g2602K','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015ApPhL.106g2602K"><span>Unusually high critical current of clean P-doped BaFe2As2 single crystalline thin film</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Kurth, F.; Tarantini, C.; Grinenko, V.; Hänisch, J.; Jaroszynski, J.; Reich, E.; Mori, Y.; Sakagami, A.; Kawaguchi, T.; Engelmann, J.; Schultz, L.; Holzapfel, B.; Ikuta, H.; Hühne, R.; Iida, K.</p> <p>2015-02-01</p> <p>Microstructurally clean, isovalently P-doped BaFe2As2 (Ba-122) single crystalline thin films have been prepared on MgO (001) substrates by molecular beam epitaxy. These films show a superconducting transition temperature (Tc) of over 30 K although P content is around 0.22, which is lower than the optimal one for single crystals (i.e., 0.33). The enhanced Tc at this doping level is attributed to the in-plane tensile strain. The strained film shows high transport self-field critical current densities (Jc) of over 6 MA/cm2 at 4.2 K, which are among the highest for Fe based superconductors (FeSCs). In-field Jc exceeds 0.1 MA/cm2 at μ 0 H = 35 T for H ‖ a b and μ 0 H = 18 T for H ‖ c at 4.2 K, respectively, in spite of moderate upper critical fields compared to other FeSCs with similar Tc. Structural investigations reveal no defects or misoriented grains pointing to strong pinning centers. We relate this unexpected high Jc to a strong enhancement of the vortex core energy at optimal Tc, driven by in-plane strain and doping. These unusually high Jc make P-doped Ba-122 very favorable for high-field magnet applications.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5116262','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5116262"><span>Quantitation of left ventricular ejection fraction reserve from early gated regadenoson stress Tc-99m high efficiency SPECT</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Brodov, Yafim; Fish, Mathews; Rubeaux, Mathieu; Otaki, Yuka; Gransar, Heidi; Lemley, Mark; Gerlach, Jim; Berman, Daniel; Germano, Guido; Slomka, Piotr</p> <p>2016-01-01</p> <p>Background Ejection fraction (EF) reserve has been found to be a useful adjunct for identifying high risk coronary artery disease in cardiac positron emission tomography (PET). We aimed to evaluate EF reserve obtained from technetium-99m sestamibi (Tc-99m) high-efficiency (HE) SPECT. Methods Fifty patients (mean age 69 y) undergoing regadenoson same-day rest (8–11 mCi)/stress (32–42mCi) Tc-99m gated HE SPECT were enrolled. Stress imaging was started one min after sequential intravenous regadenoson 0.4mg and Tc-99m injection, and was composed of five 2 min supine gated acquisitions followed by two 4 min supine and upright images. Ischemic total perfusion deficit (ITPD) ≥ 5 % was considered as significant ischemia. Results Significantly lower mean EF reserve was obtained in the 5th and 9th min after regadenoson bolus in patients with significant ischemia versus patients without (5th min: −4.2 ± 4.6% vs. 1.3 ± 6.6%, p = 0.006; 9th min: −2.7 ± 4.8% vs. 2.0 ± 6.6%, p = 0.03). Conclusions Negative EF reserve obtained between 5th and 9th min of regadenoson stress demonstrated best concordance with significant ischemia and may be a promising tool for detection of myocardial stunning with Tc-99m HE-SPECT. PMID:27387521</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27387521','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27387521"><span>Quantitation of left ventricular ejection fraction reserve from early gated regadenoson stress Tc-99m high-efficiency SPECT.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Brodov, Yafim; Fish, Mathews; Rubeaux, Mathieu; Otaki, Yuka; Gransar, Heidi; Lemley, Mark; Gerlach, Jim; Berman, Daniel; Germano, Guido; Slomka, Piotr</p> <p>2016-12-01</p> <p>Ejection fraction (EF) reserve has been found to be a useful adjunct for identifying high risk coronary artery disease in cardiac positron emission tomography (PET). We aimed to evaluate EF reserve obtained from technetium-99m sestamibi (Tc-99m) high-efficiency (HE) SPECT. Fifty patients (mean age 69 years) undergoing regadenoson same-day rest (8-11 mCi)/stress (32-42 mCi) Tc-99m gated HE SPECT were enrolled. Stress imaging was started 1 minute after sequential intravenous regadenoson .4 mg and Tc-99m injections, and was composed of five 2 minutes supine gated acquisitions followed by two 4 minutes supine and upright images. Ischemic total perfusion deficit (ITPD) ≥5 % was considered as significant ischemia. Significantly lower mean EF reserve was obtained in the 5th and 9th minute after regadenoson bolus in patients with significant ischemia vs patients without (5th minute: -4.2 ± 4.6% vs 1.3 ± 6.6%, P = .006; 9th minute: -2.7 ± 4.8% vs 2.0 ± 6.6%, P = .03). Negative EF reserve obtained between 5th and 9th minutes of regadenoson stress demonstrated best concordance with significant ischemia and may be a promising tool for detection of transient ischemic functional changes with Tc-99m HE-SPECT.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/6514766-spect-measurements-sup-tc-hm-pao-focal-epilepsy','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/6514766-spect-measurements-sup-tc-hm-pao-focal-epilepsy"><span>SPECT measurements with /sup 99m/Tc-HM-PAO in focal epilepsy</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Ryding, E.; Rosen, I.; Elmqvist, D.</p> <p>1988-12-01</p> <p>The ability of SPECT measurements with (/sup 99m/Tc)-HM-PAO (Ceretec) to find the location of the epileptic focus was studied in patients under consideration for neurosurgical treatment for therapy-resistant focal epilepsy. The location of low (/sup 99m/Tc)-HM-PAO uptake regions found at interictal measurements, and of high (/sup 99m/Tc)-HM-PAO uptake regions found at ictal measurements, was compared to the findings of extensive ictal and interictal EEG examinations, and to the results of CT and MRT. While EEG revealed focal epileptic activity in all of the 14 patients, SPECT showed regional abnormalities in 13 (93%). CT and MRT showed abnormal findings in 30%.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2013ApPhL.103j2404J','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2013ApPhL.103j2404J"><span>Tuning the Curie temperature of FeCo compounds by tetragonal distortion</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Jakobsson, A.; Şaşıoǧlu, E.; Mavropoulos, Ph.; Ležaić, M.; Sanyal, B.; Bihlmayer, G.; Blügel, S.</p> <p>2013-09-01</p> <p>Combining density-functional theory calculations with a classical Monte Carlo method, we show that for B2-type FeCo compounds, tetragonal distortion gives rise to a strong reduction of the Curie temperature TC. The TC monotonically decreases from 1575 K (for c /a=1) to 940 K (for c /a=√2 ). We find that the nearest neighbor Fe-Co exchange interaction is sufficient to explain the c/a behavior of the TC. Combination of high magnetocrystalline anisotropy energy with a moderate TC value suggests tetragonal FeCo grown on the Rh substrate with c /a=1.24 to be a promising material for heat-assisted magnetic recording applications.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4702086','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4702086"><span>Genesis of charge orders in high temperature superconductors</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Tu, Wei-Lin; Lee, Ting-Kuo</p> <p>2016-01-01</p> <p>One of the most puzzling facts about cuprate high-temperature superconductors in the lightly doped regime is the coexistence of uniform superconductivity and/or antiferromagnetism with many low-energy charge-ordered states in a unidirectional charge density wave or a bidirectional checkerboard structure. Recent experiments have discovered that these charge density waves exhibit different symmetries in their intra-unit-cell form factors for different cuprate families. Using a renormalized mean-field theory for a well-known, strongly correlated model of cuprates, we obtain a number of charge-ordered states with nearly degenerate energies without invoking special features of the Fermi surface. All of these self-consistent solutions have a pair density wave intertwined with a charge density wave and sometimes a spin density wave. Most of these states vanish in the underdoped regime, except for one with a large d-form factor that vanishes at approximately 19% doping of the holes, as reported by experiments. Furthermore, these states could be modified to have a global superconducting order, with a nodal-like density of states at low energy. PMID:26732076</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/1988JaJAP..27L1268W','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/1988JaJAP..27L1268W"><span>Formation of high-Tc YBa2Cu3O(7-delta) films on Y2BaCuO5 substrate</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Wang, W. N.; Lu, H. B.; Lin, W. J.; Yao, P. C.; Hsu, H. E.</p> <p>1988-07-01</p> <p>High-Tc superconducting YBa2Cu3O(7-delta) films have been successfully prepared on green Y2BaCuO5 (2115) ceramic substrate. The films have been formed by RF sputtering and screen printing with post annealing at 925 C. Regarding superconducting features, the sharp resistivity drop with Tc onset around 95 K (midpoint 84 K) and 99 K (midpoint 89 K) has been observed for RF sputtered and printed films respectively. Both films show the excellent adhesion towards the 2115 substrate. Powder X-ray diffraction profiles indicate a majority of 1237 phase with preferred orientation for RF sputtered thin film.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017PhRvB..96t5153M','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017PhRvB..96t5153M"><span>Hall effect measurements of high-quality M n3CuN thin films and the electronic structure</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Matsumoto, Toshiki; Hatano, Takafumi; Urata, Takahiro; Iida, Kazumasa; Takenaka, Koshi; Ikuta, Hiroshi</p> <p>2017-11-01</p> <p>The physical properties of M n3CuN were studied using thin films. We found that an annealing process was very effective to improve the film quality, the key of which was the use of Ti that prevented the formation of oxide impurities. Using these high-quality thin films, we found strong strain dependence for the ferromagnetic transition temperature (TC) and a sign change of the Hall coefficient at TC. The analysis of Hall coefficient data revealed a sizable decrease of hole concentration and a large increase of electron mobility below TC, which is discussed in relation to the electronic structure of this material.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/ADA575528','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/ADA575528"><span>Improvement of High-Resolution Tropical Cyclone Structure and Intensity Forecasts using COAMPS-TC</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>2012-09-30</p> <p>techniques, as well as observational results from the scientific community including the recent T- PARC /TCS08 and ITOP field campaigns to build upon the...real-time COAMPS-TC forecast for the recent Hurricane Irene is shown in Figure 2. The composite National Weather Service radar reflectivity is shown in...the top panel near the time of landfall in North Carolina at 1148 UTC 27 August 2011 and the COAMPS-TC predicted radar reflectivity at 36 h valid</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://www.dtic.mil/docs/citations/AD1009887','DTIC-ST'); return false;" href="http://www.dtic.mil/docs/citations/AD1009887"><span>Human Transcriptome Response to Immunization with Live- Attenuated Venezuelan equine encephalitis Virus Vaccine (TC 83): Analysis of Whole Blood</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.dtic.mil/">DTIC Science & Technology</a></p> <p></p> <p>2016-11-21</p> <p>strain of VEEV though tissue culture in fetal guinea pig heart cells.9 The second, C-84, is a 70 formalin-inactivated version of the TC-83 strain.10...71 Live-attenuated TC-83 has been used extensively in humans and has demonstrated high 72 protective data as measured by the production of...contributing to the lack of 76 neutralizing antibody production for individuals receiving sequential alphavirus immunizations, 77 including circumstances</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/985275-prediction-uranium-technetium-sorption-during-titration-contaminated-acidic-groundwater','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/985275-prediction-uranium-technetium-sorption-during-titration-contaminated-acidic-groundwater"><span></span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Zhang, Fan; Parker, Jack C.; Watson, David B</p> <p></p> <p>This study investigates uranium and technetium sorption onto aluminum and iron hydroxides during titration of acidic groundwater. The contaminated groundwater exhibits oxic conditions with high concentrations of NO{sub 3}{sup -}, SO{sub 4}{sup 2-}, U, Tc, and various metal cations. More than 90% of U and Tc was removed from the aqueous phase as Al and Fe precipitated above pH 5.5, but was partially resolublized at higher pH values. An equilibrium hydrolysis and precipitation reaction model adequately described variations in aqueous concentrations of metal cations. An anion exchange reaction model was incorporated to simulate sulfate, U and Tc sorption onto variablymore » charged (pH-dependent) Al and Fe hydroxides. Modeling results indicate that competitive sorption/desorption on mixed mineral phases needs to be considered to adequately predict U and Tc mobility. The model could be useful for future studies of the speciation of U, Tc and co-existing ions during pre- and post-groundwater treatment practices.« less</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li class="active"><span>23</span></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_23 --> <div id="page_24" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li class="active"><span>24</span></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="461"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2014JPhD...47Q5303P','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2014JPhD...47Q5303P"><span>Magnetodielectric behaviour in La0.53Ca0.47MnO3</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Pandey, Suchita; Kumar, Jitender; Awasthi, A. M.</p> <p>2014-10-01</p> <p>We explore magneto-dielectricity in La0.53Ca0.47MnO3 across its paramagnetic (PMI) to ferromagnetic (FMM) isostructural transition at TC ˜ 253 K, by magnetic (M), caloric (W), dielectric (ɛ‧), magnetoresistive (MR), and magnetocapacitance (MC) investigations. A skew-broadened first-order transition character is confirmed via heating/cooling hystereses in M(T) and W(T), with a superheating temperature T** next to TC and supercooling temperature T* exhibiting kinetics. Above TC, linearly related MC and MR reflect purely a magnetoresistance effect. Near TC, the high-frequency MC (5 Tesla (T)), far exceeds the magneto-losses, and is uncorrelated with dc MR (5 T) in the FM-ordered state. The intrinsic magneto-dielectricity manifest below TC and above ˜kHz is traced to an intra-granular Maxwell-Wagner-type effect at the interface region of PMI-FMM phase coexistence.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2015JPCS...78..118R','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2015JPCS...78..118R"><span>First principles study of structural stability, electronic structure and mechanical properties of ReN and TcN</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Rajeswarapalanichamy, R.; Kavitha, M.; Sudha Priyanga, G.; Iyakutti, K.</p> <p>2015-03-01</p> <p>The crystal structure, structural stability, electronic and mechanical properties of ReN and TcN are investigated using first principles calculations. We have considered five different crystal structures: NaCl, zinc blende (ZB), NiAs, tungsten carbide (WC) and wurtzite (WZ). Among these ZB phase is found to be the lowest energy phase for ReN and TcN at normal pressure. Pressure induced structural phase transitions from ZB to WZ phase at 214 GPa in ReN and ZB to NiAs phase at 171 GPa in TcN are predicted. The electronic structure reveals that both ReN and TcN are metallic in nature. The computed elastic constants indicate that both the nitrides are mechanically stable. As ReN in NiAs phase has high bulk and shear moduli and low Poisson's ratio, it is found to be a potential ultra incompressible super hard material.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27072904','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27072904"><span>Synthesis and biological assessment of folate-accepted developer (99m)Tc-DTPA-folate-polymer.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Chen, Fei; Shao, Kejing; Zhu, Bao; Jiang, Mengjun</p> <p>2016-05-15</p> <p>A novel cancer-targetable folate-poly(2-hydroxyethyl methacrylate) (PFDH) copolymer containing DTPA segment was prepared by conventional chemical synthesis and labeled with (99m)Tc subsequently. The (99m)Tc-labled PFDH could be produced easily with high radiochemical yield of 91% and radiochemical purity of 95%. The LogP octanol-water value for the (99m)Tc-labled PFDH was -2.19 and the radiotracer was stable in phosphate-buffered saline and human serum for 2h (>95% in PBS or ∼90% in human serum). To investigate (99m)Tc-labled PFDH tumor targeting, the in vitro and in vivo stability, cell uptake, in vivo biodistribution, and SPECT imaging were evaluated, respectively. These preliminary results strongly suggest that the novel folate conjugated dendrimer maybe developed to be potential for delivery of therapeutic radionuclides. Copyright © 2016 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23674153','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23674153"><span>High cell density cultivation of a novel Aurantiochytrium sp. strain TC 20 in a fed-batch system using glycerol to produce feedstock for biodiesel and omega-3 oils.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Lee Chang, Kim Jye; Dumsday, Geoff; Nichols, Peter D; Dunstan, Graeme A; Blackburn, Susan I; Koutoulis, Anthony</p> <p>2013-08-01</p> <p>A recently isolated Australian Aurantiochytrium sp. strain TC 20 was investigated using small-scale (2 L) bioreactors for the potential of co-producing biodiesel and high-value omega-3 long-chain polyunsaturated fatty acids. Higher initial glucose concentration (100 g/L compared to 40 g/L) did not result in markedly different biomass (48 g/L) or fatty acid (12-14 g/L) yields by 69 h. This comparison suggests factors other than carbon source were limiting biomass production. The effect of both glucose and glycerol as carbon sources for Aurantiochytrium sp. strain TC 20 was evaluated in a fed-batch process. Both glucose and glycerol resulted in similar biomass yields (57 and 56 g/L, respectively) by 69 h. The agro-industrial waste from biodiesel production-glycerol-is a suitable carbon source for Aurantiochytrium sp. strain TC 20. Approximately half the fatty acids from Aurantiochytrium sp. strain TC 20 are suitable for development of sustainable, low emission sources of transportation fuels and bioproducts. To further improve biomass and oil production, fortification of the feed with additional nutrients (nitrogen sources, trace metals and vitamins) improved the biomass yield from 56 g/L (34 % total fatty acids) to 71 g/L (52 % total fatty acids, cell dry weight) at 69 h; these yields are to our knowledge around 70 % of the biomass yields achieved, however, in less than half of the time by other researchers using glycerol and markedly greater than achieved using other industrial wastes. The fast growth and suitable fatty acid profile of this newly isolated Aurantiochytrium sp. strain TC 20 highlights the potential of co-producing the drop-in biodiesel and high value omega-3 oils.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22824418','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22824418"><span>Multilocus PCR-RFLP profiling in Trypanosoma cruzi I highlights an intraspecific genetic variation pattern.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Ramírez, Juan David; Duque, María Clara; Montilla, Marleny; Cucunubá, Zulma M; Guhl, Felipe</p> <p>2012-12-01</p> <p>Chagas disease represents a serious problem in public health. This zoonotic pathology is caused by the kinetoplastid Trypanosoma cruzi which displays a high genetic diversity falling into six Discrete Typing Units (TcI-TcVI). In Colombia, the prevalent DTU is TcI with findings of TcII, TcIII and TcIV in low proportions. The aim of this work was to observe the genetic variability within TcI using a multilocus PCR-RFLP strategy. We analyzed 70 single-celled clones from triatomines, reservoirs and humans that were amplified and restricted via ten PCR-RFLPs targets across TcI genome, the restriction fragments were used to construct phylograms according to calculated genetic distances. We obtained five polymorphic targets (1f8, HSP60, HSP70, SAPA and H1) and the consensus tree constructed according to these regions allowed us to observe two well-defined groups with close association to the transmission cycles (domestic/peridomestic and sylvatic) of Chagas disease in Colombia. Our findings allowed us to corroborate the previous reported genotypes based on the intergenic region of mini-exon gene. More studies examining the genetic diversity among T. cruzi I populations must be conducted in order to obtain a better understanding in regions where this DTU is endemic. Copyright © 2012 Elsevier B.V. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/12672639','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/12672639"><span>Dietary factors and the risk of testicular cancer.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Bonner, Matthew R; McCann, Susan E; Moysich, Kirsten B</p> <p>2002-01-01</p> <p>The etiology of testicular cancer (TC) remains largely unknown. Few studies have investigated the role diet may play in the etiology of TC. We report on a hospital-based case-control study of TC and selected nutrients and food groups. Cases included 117 patients with primary, incident TC treated at Roswell Park Cancer Institute between 1982 and 1998. A total of 334 hospital controls were frequency matched on age to cases. Cases were categorized by histology (seminoma, nonseminoma, and mixed germ cell TC), and multinomial logistic regression and unconditional logistic regression were used to compute odds ratios (ORs) and 95% confidence intervals (CIs) comparing each histological type with the controls. For nonseminoma and mixed germ cell TC, vitamin E intake was suggestive of reduced risk (OR = 0.51, 95% CI = 0.15-1.76 and OR = 0.36, 95% CI = 0.01-1.31, respectively); for seminoma, it was suggestive of an increased risk (OR = 2.94, 95% CI = 0.99-8.78). Fat intakes were not associated with nonseminoma or mixed germ cell risk; high saturated, animal, and total fat intakes were suggestive of an increase in risk of seminoma. Overall, diet was not associated with TC. However, risk seemed to differ by histology, suggesting that seminoma, nonseminoma, and mixed germ cell TC may have different etiologies. We suggest that future investigations should continue to stratify cases by histology.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3383755','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3383755"><span>Geographical Distribution of Trypanosoma cruzi Genotypes in Venezuela</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Carrasco, Hernán J.; Segovia, Maikell; Llewellyn, Martin S.; Morocoima, Antonio; Urdaneta-Morales, Servio; Martínez, Cinda; Martínez, Clara E.; Garcia, Carlos; Rodríguez, Marlenes; Espinosa, Raul; de Noya, Belkisyolé A.; Díaz-Bello, Zoraida; Herrera, Leidi; Fitzpatrick, Sinead; Yeo, Matthew; Miles, Michael A.; Feliciangeli, M. Dora</p> <p>2012-01-01</p> <p>Chagas disease is an endemic zoonosis native to the Americas and is caused by the kinetoplastid protozoan parasite Trypanosoma cruzi. The parasite is also highly genetically diverse, with six discrete typing units (DTUs) reported TcI – TcVI. These DTUs broadly correlate with several epidemiogical, ecological and pathological features of Chagas disease. In this manuscript we report the most comprehensive evaluation to date of the genetic diversity of T. cruzi in Venezuela. The dataset includes 778 samples collected and genotyped over the last twelve years from multiple hosts and vectors, including nine wild and domestic mammalian host species, and seven species of triatomine bug, as well as from human sources. Most isolates (732) can be assigned to the TcI clade (94.1%); 24 to the TcIV group (3.1%) and 22 to TcIII (2.8%). Importantly, among the 95 isolates genotyped from human disease cases, 79% belonged to TcI - a DTU common in the Americas, however, 21% belonged to TcIV- a little known genotype previously thought to be rare in humans. Furthermore, were able to assign multiple oral Chagas diseases cases to TcI in the area around the capital, Caracas. We discuss our findings in the context of T. cruzi DTU distributions elsewhere in the Americas, and evaluate the impact they have on the future of Chagas disease control in Venezuela. PMID:22745843</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/22745843','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/22745843"><span>Geographical distribution of Trypanosoma cruzi genotypes in Venezuela.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Carrasco, Hernán J; Segovia, Maikell; Llewellyn, Martin S; Morocoima, Antonio; Urdaneta-Morales, Servio; Martínez, Cinda; Martínez, Clara E; Garcia, Carlos; Rodríguez, Marlenes; Espinosa, Raul; de Noya, Belkisyolé A; Díaz-Bello, Zoraida; Herrera, Leidi; Fitzpatrick, Sinead; Yeo, Matthew; Miles, Michael A; Feliciangeli, M Dora</p> <p>2012-01-01</p> <p>Chagas disease is an endemic zoonosis native to the Americas and is caused by the kinetoplastid protozoan parasite Trypanosoma cruzi. The parasite is also highly genetically diverse, with six discrete typing units (DTUs) reported TcI - TcVI. These DTUs broadly correlate with several epidemiogical, ecological and pathological features of Chagas disease. In this manuscript we report the most comprehensive evaluation to date of the genetic diversity of T. cruzi in Venezuela. The dataset includes 778 samples collected and genotyped over the last twelve years from multiple hosts and vectors, including nine wild and domestic mammalian host species, and seven species of triatomine bug, as well as from human sources. Most isolates (732) can be assigned to the TcI clade (94.1%); 24 to the TcIV group (3.1%) and 22 to TcIII (2.8%). Importantly, among the 95 isolates genotyped from human disease cases, 79% belonged to TcI - a DTU common in the Americas, however, 21% belonged to TcIV- a little known genotype previously thought to be rare in humans. Furthermore, were able to assign multiple oral Chagas diseases cases to TcI in the area around the capital, Caracas. We discuss our findings in the context of T. cruzi DTU distributions elsewhere in the Americas, and evaluate the impact they have on the future of Chagas disease control in Venezuela.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/672652','DOE-PATENT-XML'); return false;" href="https://www.osti.gov/biblio/672652"><span>Method for generating a crystalline {sup 99}MoO{sub 3} product and the isolation {sup 99m}Tc compositions therefrom</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/doepatents">DOEpatents</a></p> <p>Bennett, R.G.; Christian, J.D.; Kirkham, R.J.; Tranter, T.J.</p> <p>1998-09-01</p> <p>An improved method is described for producing {sup 99m}Tc compositions. {sup 100}Mo metal is irradiated with photons in a particle (electron) accelerator to produce {sup 99}Mo metal which is dissolved in a solvent. A solvated {sup 99}Mo product is then dried to generate a supply of {sup 99}MoO{sub 3} crystals. The crystals are thereafter heated at a temperature which will sublimate the crystals and form a gaseous mixture containing vaporized {sup 99m}TcO{sub 3} and vaporized {sup 99m}TcO{sub 2} but will not cause the production of vaporized {sup 99}MoO{sub 3}. The mixture is then combined with an oxidizing gas to generate a gaseous stream containing vaporized {sup 99m}Tc{sub 2}O{sub 7}. Next, the gaseous stream is cooled to a temperature sufficient to convert the vaporized {sup 99m}Tc{sub 2}O{sub 7} into a condensed {sup 99m}Tc-containing product. The product has high purity levels resulting from the use of reduced temperature conditions and ultrafine crystalline {sup 99}MoO{sub 3} starting materials with segregated {sup 99m}Tc compositions therein which avoid the production of vaporized {sup 99}MoO{sub 3} contaminants. 1 fig.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/17896585','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/17896585"><span>High-dose ascorbic acid decreases cholesterolemic factors of an atherogenic diet in guinea pigs.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Filis, Konstantinos; Anastassopoulou, Aikaterini; Sigala, Fragiska; Theodorou, Dimitrios; Manouras, Andreas; Leandros, Emanouel; Sigalas, Panagiotis; Hepp, Wolfgang; Bramis, John</p> <p>2007-03-01</p> <p>The study evaluates the effect of a high supplemental dose of ascorbic acid (AA) on plasma concentrations of total cholesterol (TC), triglycerides (TG), total lipids (TL), and lipoprotein fractions high-density, very-low-density-, and low-density lipoprotein (HDL, VLDL, LDL) in guinea pigs fed with atherogenic diet. Group I consisted of 5 normally fed guinea pigs plus a low dose of AA (1 mg/100 g/day), group II consisted of 7 guinea pigs fed with food enriched with 2% cholesterol plus a low dose of AA (1 mg/100 g/day), and group III consisted of 7 guinea pigs fed with food enriched with 2% cholesterol plus a high dose of AA (30 mg/100 g/day). Cholesterolemic factors concentrations were determined after nine weeks. Concentrations of TC, TG, TL, LDL, and VLDL were increased in group II compared to group I (p < 0.01 for all differences). Supplementation with a high dose of AA resulted in decreased concentrations of TC (p < 0.01), TG (p < 0.01), TL (p < 0.01), and LDL (p < 0.01) in group III compared to group II. Additionally, concentration of HDL was increased in group III compared to group II (p < 0.01). High-dose AA supplementation to an atherogenic diet decreases concentrations of TC, TG, TL, and LDL and increases concentration of HDL compared to low-dose AA.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25461848','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25461848"><span>Comparative study of the biological properties of Trypanosoma cruzi I genotypes in a murine experimental model.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Cruz, Lissa; Vivas, Angie; Montilla, Marleny; Hernández, Carolina; Flórez, Carolina; Parra, Edgar; Ramírez, Juan David</p> <p>2015-01-01</p> <p>Chagas disease is an endemic zoonosis in Latin America and caused by the parasite Trypanosoma cruzi. This kinetoplastid displays remarkable genetic variability, allowing its classification into six Discrete Typing Units (DTUs) from TcI to TcVI. T. cruzi I presents the broadest geographical distribution in the continent and has been associated to severe forms of cardiomyopathies. Recently, a particular genotype associated to human infections has been reported and named as TcIDOM (previously named TcIa-b). This genotype shows to be clonal and adapted to the domestic cycle but so far no studies have determined the biological properties of domestic (TcIDOM) and sylvatic TcI strains (previously named TcIc-e). Hence, the aim of this study was to untangle the biological features of these genotypes in murine models. We infected ICR-CD1 mice with five TcI strains (two domestic, two sylvatic and one natural mixture) and determined the course of infection during 91 days (acute and chronic phase of the disease) in terms of parasitemia, tissue tropism, immune response (IgG titers) and tissue invasion by means of histopathology studies. Statistically significant differences were observed in terms of parasitemia curves and prepatent period between domestic (TcIDOM) and sylvatic strains. There were no differences in terms of IgG antibodies response across the mice infected with the five strains. Regarding the histopathology, our results indicate that domestic strains present higher parasitemias and low levels of histopathological damage. In contrast, sylvatic strains showed lower parasitemias and high levels of histopathological damage. These results highlight the sympatric and behavioral differences of domestic and sylvatic TcI strains; the clinical and epidemiological implications are herein discussed. Copyright © 2014 Elsevier B.V. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/25090650','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/25090650"><span>Geographic variation of Trypanosoma cruzi discrete typing units from Triatoma infestans at different spatial scales.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Fernández, María Del Pilar; Cecere, María Carla; Lanati, Leonardo Alejandro; Lauricella, Marta Alicia; Schijman, Alejandro Gabriel; Gürtler, Ricardo Esteban; Cardinal, Marta Victoria</p> <p>2014-12-01</p> <p>We assessed the diversity and distribution of Trypanosoma cruzi discrete typing units (DTU) in Triatoma infestans populations and its association with local vector-borne transmission levels at various geographic scales. At a local scale, we found high predominance (92.4%) of TcVI over TcV in 68 microscope-positive T. infestans collected in rural communities in Santiago del Estero province in northern Argentina. TcV was more often found in communities with higher house infestation prevalence compatible with active vector-borne transmission. Humans and dogs were the main bloodmeal sources of the TcV- and TcVI-infected bugs. At a broader scale, the greatest variation in DTU diversity was found within the Argentine Chaco (227 microscope-positive bugs), mainly related to differences in equitability between TcVI and TcV among study areas. At a country-wide level, a meta-analysis of published data revealed clear geographic variations in the distribution of DTUs across countries. A correspondence analysis showed that DTU distributions in domestic T. infestans were more similar within Argentina (dominated by TcVI) and within Bolivia (where TcI and TcV had similar relative frequencies), whereas large heterogeneity was found within Chile. DTU diversity was lower in the western Argentine Chaco region and Paraguay (D=0.14-0.22) than in the eastern Argentine Chaco, Bolivia and Chile (D=0.20-0.68). Simultaneous DTU identifications of T. cruzi-infected hosts and triatomines across areas differing in epidemiological status are needed to shed new light on the structure and dynamics of parasite transmission cycles. Copyright © 2014 Elsevier B.V. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28344884','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28344884"><span>The differentiation and plasticity of Tc17 cells are regulated by CTLA-4-mediated effects on STATs.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Arra, Aditya; Lingel, Holger; Kuropka, Benno; Pick, Jonas; Schnoeder, Tina; Fischer, Thomas; Freund, Christian; Pierau, Mandy; Brunner-Weinzierl, Monika C</p> <p>2017-01-01</p> <p>As the blockade of inhibitory surface-molecules such as CTLA-4 on T cells has led to recent advances in antitumor immune therapy, there is great interest in identifying novel mechanisms of action of CD8 + T cells to evoke effective cytotoxic antitumor responses. Using in vitro and in vivo models, we investigated the molecular pathways underlying the CTLA-4-mediated differentiation of IL-17-producing CD8 + T cells (Tc17 cells) that strongly impairs cytotoxicity. Our studies demonstrate that Tc17 cells lacking CTLA-4 signaling have limited production of STAT3-target gene products such as IL-17, IL-21, IL-23R and RORγt. Upon re-stimulation with IL-12, these cells display fast downregulation of Tc17 hallmarks and acquire Tc1 characteristics such as IFNγ and TNF-α co-expression, which is known to correlate with tumor control. Indeed, upon adoptive transfer, these cells were highly efficient in the antigen-specific rejection of established OVA-expressing B16 melanoma in vivo . Mechanistically, in primary and re-stimulated Tc17 cells, STAT3 binding to the IL-17 promoter was strongly augmented by CTLA-4, associated with less binding of STAT5 and reduced relative activation of STAT1 which is known to block STAT3 activity. Inhibiting CTLA-4-induced STAT3 activity reverses enhancement of signature Tc17 gene products, rendering Tc17 cells susceptible to conversion to Tc1-like cells with enhanced cytotoxic potential. Thus, CTLA-4 critically shapes the characteristics of Tc17 cells by regulating relative STAT3 activation, which provides new perspectives to enhance cytotoxicity of antitumor responses.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017CSR...139...35D','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017CSR...139...35D"><span>The effects of tropical cyclone characteristics on the surface wave fields in Australia's North West region</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Drost, Edwin J. F.; Lowe, Ryan J.; Ivey, Greg N.; Jones, Nicole L.; Péquignet, Christine A.</p> <p>2017-05-01</p> <p>The numerical wave model SWAN (Simulating WAves Nearshore) and historical wave buoy observations were used to investigate the response of surface wave fields to tropical cyclone (TC) wind forcing on the Australian North West Shelf (NWS). Analysis of historical wave data during TC events at a key location on the NWS showed that an average of 1.7 large TCs impacted the region each year, albeit with high variability in TC track, intensity and size, and also in the surface wave field response. An accurately modeled TC wind field resulted in a good prediction of the observed extreme wave conditions by SWAN. Results showed that the presence of strong background winds during a TC and a long TC lifetime (with large variations in translation speed) can provide additional energy input. This potentially enhances the generated swell waves and increases the spatial extent of the TC generated surface wave fields. For the TC translation speeds in this study, a positive relationship between TC translation speed and the resulting maximum significant wave height and wave field asymmetry was observed. Bottom friction across the wide NWS limited the amount of wave energy reaching the coastal region; consistently reducing wave energy in depths below 50 m, and in the case of the most extreme conditions, in depths up to 100 m that comprise much of the shelf. Nevertheless, whitecapping was still the dominant dissipation mechanism on the broader shelf region. Shelf-scale refraction had little effect on the amount of wave energy reaching the nearshore zone; however, refraction locally enhanced or reduced wave energy depending on the orientation of the isobaths with respect to the dominant wave direction during the TC.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/28662949','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/28662949"><span>Patched Skin Bilirubin Assay to Monitor Neonates Born Extremely Preterm Undergoing Phototherapy.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>De Luca, Daniele; Dell'Orto, Valentina</p> <p>2017-09-01</p> <p>To verify the reliability and safety of transcutaneous bilirubin (TcB) measurements in patched skin areas in neonates born extremely preterm under phototherapy. Sixty neonates (<30 weeks' gestation) receiving phototherapy were enrolled and TcB was measured via a second-generation transcutaneous bilirubinometer in patched skin areas (of at least 2.5 cm diameter). Total serum bilirubin (TSB), lactate, pH, hemoglobin, and skin temperature were measured within 10 minutes of the TcB assay. Clinicians were blinded to TcB values, and clinical decisions about phototherapy were made with the TSB measurement only. TcB and TSB significantly were correlated (r = 0.84; P <.001), even after adjustment for hemoglobin, pH, lactate, gestational and postnatal age (standardized β = 0.8; P <.001; adjusted R 2  = 0.75), or treatment duration (standardized β = 0.8; P <.001; adjusted R 2  = 0.7). When the Bland-Altman analysis was used, TcB overestimated TSB at high values (mean difference TSB - TcB: -2.8 [2.4] mg/dL). If clinicians used the TcB only, no neonate would have had phototherapy stopped prematurely, and 21 (35%) would have continued phototherapy when it could have been stopped. The correlation between TSB and TcB (measured in patched skin areas) was comparable with that obtained in more mature neonates, and it was not influenced by clinical variables or factors affecting skin bilirubin passage. TcB overestimated TSB, and this may expose infants born preterm to unnecessary phototherapy, although it could spare approximately 65% of TSB assays. Copyright © 2017 Elsevier Inc. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/1396022','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/1396022"><span>Direct production of 99mTc using a small medical cyclotron</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Lapi, Suzanne</p> <p></p> <p>This project describes an investigation towards the production of 99mTc with a small medical cyclotron. This endeavor addresses the current urgent problem of availability of 99mTc due to the ongoing production reactor failures and the upcoming Canadian reactor shut down. Currently, 99mTc is produced via nuclear fission using highly enriched uranium which is a concern due to nuclear proliferation risks. In addition to this, the United States is dependent solely on currently unreliable foreign sources of this important medical isotope. Clearly, a need exists to probe alternative production routes of 99mTc. In the first year, this project measured cross-sections andmore » production yields of potential pathways to 99mTc and associated radionuclidic impurities produced via these pathways using a small 15 MeV medical cyclotron. During the second and third years target systems for the production of 99mTc via the most promising reaction routes were developed and separation techniques for the isolation of 99mTc from the irradiated target material will be investigated. Systems for the recycling of the enriched target isotopes as well as automated target processing systems were examined in years four and five. This project has the potential to alleviate some of the current crisis in the medical community by developing a technique to produce 99mTc on location at a university hospital. This technology will be applicable at many other sites in the United States as many other similar, low energy (<20 MeV) cyclotrons (currently used for a few hours per day for the production of [ 18F]fluorodeoxyglucose) are available for production of 99mTc though this method, thus leading to job creation and preservation.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26179963','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26179963"><span>Synthesis and evaluation of Tc-99m-labeled RRL-containing peptide as a non-invasive tumor imaging agent in a mouse fibrosarcoma model.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kim, Dae-Weung; Kim, Woo Hyoung; Kim, Myoung Hyoun; Kim, Chang Guhn</p> <p>2015-11-01</p> <p>Arginine-arginine-leucine (RRL) is considered a tumor endothelial cell-specific binding sequence. RRL-containing peptide targeting tumor vessels is an excellent candidate for tumor imaging. In this study, we developed RRL-containing hexapeptides and evaluated their feasibility as a tumor imaging agent in a HT-1080 fibrosarcoma-bearing murine model. The hexapeptide, glutamic acid-cysteine-glycine (ECG)-RRL was synthesized using Fmoc solid-phase peptide synthesis. Radiolabeling efficiency was evaluated using instant thin-layer chromatography. Uptake of Tc-99m ECG-RRL within HT-1080 cells was evaluated in vitro by confocal microscopy and cellular binding affinity was calculated. Gamma images were acquired In HT-1080 fibrosarcoma tumor-bearing mice, and the tumor-to-muscle uptake ratio was calculated. The inflammatory-to-normal muscle uptake ratio was also calculated in an inflammation mouse model. A biodistribution study was performed to calculate %ID/g. A high yield of Tc-99m ECG-RRL complexes was prepared after Tc-99m radiolabeling. Binding of Tc-99m ECG-RRL to tumor cells had was confirmed by in vitro studies. Gamma camera imaging in the murine model showed that Tc-99m ECG-RRL accumulated substantially in the subcutaneously engrafted tumor and that tumoral uptake was blocked by co-injecting excess RRL. Moreover, Tc-99m ECG-RRL accumulated minimally in inflammatory lesions. We successfully developed Tc-99m ECG-RRL as a new tumor imaging candidate. Specific tumoral uptake of Tc-99m ECG-RRL was evaluated both in vitro and in vivo, and it was determined to be a good tumor imaging candidate. Additionally, Tc-99m ECG-RRL effectively distinguished between cancerous tissue and inflammatory lesions.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/servlets/purl/918777','SCIGOV-STC'); return false;" href="https://www.osti.gov/servlets/purl/918777"><span>Uncertainty analysis of thermocouple measurements used in normal and abnormal thermal environment experiments at Sandia's Radiant Heat Facility and Lurance Canyon Burn Site.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Nakos, James Thomas</p> <p>2004-04-01</p> <p>It would not be possible to confidently qualify weapon systems performance or validate computer codes without knowing the uncertainty of the experimental data used. This report provides uncertainty estimates associated with thermocouple data for temperature measurements from two of Sandia's large-scale thermal facilities. These two facilities (the Radiant Heat Facility (RHF) and the Lurance Canyon Burn Site (LCBS)) routinely gather data from normal and abnormal thermal environment experiments. They are managed by Fire Science & Technology Department 09132. Uncertainty analyses were performed for several thermocouple (TC) data acquisition systems (DASs) used at the RHF and LCBS. These analyses apply tomore » Type K, chromel-alumel thermocouples of various types: fiberglass sheathed TC wire, mineral-insulated, metal-sheathed (MIMS) TC assemblies, and are easily extended to other TC materials (e.g., copper-constantan). Several DASs were analyzed: (1) A Hewlett-Packard (HP) 3852A system, and (2) several National Instrument (NI) systems. The uncertainty analyses were performed on the entire system from the TC to the DAS output file. Uncertainty sources include TC mounting errors, ANSI standard calibration uncertainty for Type K TC wire, potential errors due to temperature gradients inside connectors, extension wire uncertainty, DAS hardware uncertainties including noise, common mode rejection ratio, digital voltmeter accuracy, mV to temperature conversion, analog to digital conversion, and other possible sources. Typical results for 'normal' environments (e.g., maximum of 300-400 K) showed the total uncertainty to be about {+-}1% of the reading in absolute temperature. In high temperature or high heat flux ('abnormal') thermal environments, total uncertainties range up to {+-}2-3% of the reading (maximum of 1300 K). The higher uncertainties in abnormal thermal environments are caused by increased errors due to the effects of imperfect TC attachment to the test item. 'Best practices' are provided in Section 9 to help the user to obtain the best measurements possible.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26396630','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26396630"><span>Tc-99m Hydroxymethylene Diphosphonate (HMDP) Renal Uptake as a Surrogate Marker of Postoperative Impairment of the Glomerular Filtration Rate in Renal Tumor Patients Following Nephron-Sparing Surgery.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Choi, Hongyoon; Lee, Won Woo; So, Young; Ha, Seunggyun; Byun, Seok-Soo; Kim, Sang Eun</p> <p>2014-12-01</p> <p>We investigated Tc-99m hydroxymethylene diphosphonate (HMDP) scintigraphy findings in renal tumor patients from the perspective of postoperative renal dysfunction following nephron-sparing surgery (NSS). Forty-three renal tumor patients (M:F = 28:15, age 53.9 ± 12.5 years) who had undergone Tc-99m HMDP scintigraphy after NSS were enrolled. The patients were divided into HMDP(+) or HMDP(-) groups by visual assessment, and the asymmetric index (ASI) was calculated using a region-of-interest analysis. In 16 patients, the total and split glomerular filtration rate (GFR) was assessed using Tc-99m diethylenetriaminepentaacetic acid (DTPA) scintigraphy at baseline and at 3 and 6 months post-NSS. High Tc-99m HMDP uptake was observed in the operated kidneys, but this did not persist later than 7 days post-NSS. Split GFR of the operated kidneys at baseline (58.5 ± 9.3 ml/min) was significantly reduced at 6 months post-NSS (40.1 ± 5.9 ml/min, p < 0.001) in only those who showed intense uptake of Tc-99m HMDP. Declines in both total GFR (p = 0.010 and p = 0.002 for 3 and 6 months, respectively) and split GFR of the operated kidneys (p < 0.001 and p < 0.001 for 3 and 6 months, respectively) were clearly evidenced at 3 and 6 months post-NSS only in patients with high Tc-99m HMDP in the operated kidneys. The ASI was negatively correlated with %change in the split GFR of these operated kidneys at 6 months post-NSS (rho =-0.578, p = 0.0304). Tc-99m HMDP uptake within 1 week following NSS is a surrogate marker of GFR impairment over 6 months post-NSS.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2004PEPI..143..369L','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2004PEPI..143..369L"><span>Shock-induced superheating and melting curves of geophysically important minerals</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Luo, Sheng-Nian; Ahrens, Thomas J.</p> <p>2004-06-01</p> <p>Shock-state temperature and sound-speed measurements on crystalline materials, demonstrate superheating-melting behavior distinct from equilibrium melting. Shocked solid can be superheated to the maximum temperature, Tc'. At slightly higher pressure, Pc, shock melting occurs, and induces a lower shock temperature, Tc. The Hugoniot state, ( Pc, Tc), is inferred to lie along the equilibrium melting curve. The amount of superheating achieved on Hugoniot is, ΘH+= Tc'/ Tc-1. Shock-induced superheating for a number of silicates, alkali halides and metals agrees closely with the predictions of a systematic framework describing superheating at various heating rates [Appl. Phys. Lett. 82 (12) (2003) 1836]. High-pressure melting curves are constructed by integration from ( Pc, Tc) based on the Lindemann law. We calculate the volume and entropy changes upon melting at ( Pc, Tc) assuming the R ln 2 rule ( R is the gas constant) for the disordering entropy of melting [J. Chem. Phys. 19 (1951) 93; Sov. Phys. Usp. 117 (1975) 625; Poirier, J.P., 1991. Introduction to the Physics of the Earth's Interior. Cambridge University Press, Cambridge, 102 pp.]. ( Pc, Tc) and the Lindemann melting curves are in excellent accord with diamond-anvil cell (DAC) results for NaCl, KBr and stishovite. But significant discrepancies exist for transition metals. If we extrapolate the DAC melting data [Phys. Rev. B 63 (2001) 132104] for transition metals (Fe, V, Mo, W and Ta) to 200-400 GPa where shock melting occurs, shock temperature measurement and calculation would indicate ΘH+˜0.7-2.0. These large values of superheating are not consistent with the superheating systematics. The discrepancies could be reconciled by possible solid-solid phase transitions at high pressures. In particular, this work suggests that Fe undergoes a possible solid-solid phase transition at ˜200 GPa and melts at ˜270 GPa upon shock wave loading, and the melting temperature is ˜6300 K at 330 GPa.</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li class="active"><span>24</span></li> <li><a href="#" onclick='return showDiv("page_25");'>25</a></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_24 --> <div id="page_25" class="hiddenDiv"> <div class="row"> <div class="col-sm-12"> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li class="active"><span>25</span></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div> </div> <div class="row"> <div class="col-sm-12"> <ol class="result-class" start="481"> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5227693','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5227693"><span>High-field transport properties of a P-doped BaFe2As2 film on technical substrate</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Iida, Kazumasa; Sato, Hikaru; Tarantini, Chiara; Hänisch, Jens; Jaroszynski, Jan; Hiramatsu, Hidenori; Holzapfel, Bernhard; Hosono, Hideo</p> <p>2017-01-01</p> <p>High temperature (high-Tc) superconductors like cuprates have superior critical current properties in magnetic fields over other superconductors. However, superconducting wires for high-field-magnet applications are still dominated by low-Tc Nb3Sn due probably to cost and processing issues. The recent discovery of a second class of high-Tc materials, Fe-based superconductors, may provide another option for high-field-magnet wires. In particular, AEFe2As2 (AE: Alkali earth elements, AE-122) is one of the best candidates for high-field-magnet applications because of its high upper critical field, Hc2, moderate Hc2 anisotropy, and intermediate Tc. Here we report on in-field transport properties of P-doped BaFe2As2 (Ba-122) thin films grown on technical substrates by pulsed laser deposition. The P-doped Ba-122 coated conductor exceeds a transport Jc of 105 A/cm2 at 15 T for main crystallographic directions of the applied field, which is favourable for practical applications. Our P-doped Ba-122 coated conductors show a superior in-field Jc over MgB2 and NbTi, and a comparable level to Nb3Sn above 20 T. By analysing the E − J curves for determining Jc, a non-Ohmic linear differential signature is observed at low field due to flux flow along the grain boundaries. However, grain boundaries work as flux pinning centres as demonstrated by the pinning force analysis. PMID:28079117</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017NatSR...739951I','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017NatSR...739951I"><span>High-field transport properties of a P-doped BaFe2As2 film on technical substrate</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Iida, Kazumasa; Sato, Hikaru; Tarantini, Chiara; Hänisch, Jens; Jaroszynski, Jan; Hiramatsu, Hidenori; Holzapfel, Bernhard; Hosono, Hideo</p> <p>2017-01-01</p> <p>High temperature (high-Tc) superconductors like cuprates have superior critical current properties in magnetic fields over other superconductors. However, superconducting wires for high-field-magnet applications are still dominated by low-Tc Nb3Sn due probably to cost and processing issues. The recent discovery of a second class of high-Tc materials, Fe-based superconductors, may provide another option for high-field-magnet wires. In particular, AEFe2As2 (AE: Alkali earth elements, AE-122) is one of the best candidates for high-field-magnet applications because of its high upper critical field, Hc2, moderate Hc2 anisotropy, and intermediate Tc. Here we report on in-field transport properties of P-doped BaFe2As2 (Ba-122) thin films grown on technical substrates by pulsed laser deposition. The P-doped Ba-122 coated conductor exceeds a transport Jc of 105 A/cm2 at 15 T for main crystallographic directions of the applied field, which is favourable for practical applications. Our P-doped Ba-122 coated conductors show a superior in-field Jc over MgB2 and NbTi, and a comparable level to Nb3Sn above 20 T. By analysing the E - J curves for determining Jc, a non-Ohmic linear differential signature is observed at low field due to flux flow along the grain boundaries. However, grain boundaries work as flux pinning centres as demonstrated by the pinning force analysis.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/19863676','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/19863676"><span>Anti-retroviral therapy fails to restore the severe Th-17: Tc-17 imbalance observed in peripheral blood during simian immunodeficiency virus infection.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Kader, M; Bixler, S; Piatak, M; Lifson, J; Mattapallil, J J</p> <p>2009-10-01</p> <p>Human immuno deficiency virus and simian immunodeficiency virus infections are characterized by a severe loss of Th-17 cells (IL-17(+)CD4(+) T cells) that has been associated with disease progression and systemic dissemination of bacterial infections. Anti-retroviral therapy (ART) has led to repopulation of CD4(+) T cells in peripheral tissues with little sustainable repopulation in mucosal tissues. Given the central importance of Th-17 cells in mucosal homeostasis, it is not known if the failure of ART to permanently repopulate mucosal tissues is associated with a failure to restore Th-17 cells that are lost during infection. Dynamics of alpha4(+)beta7(hi) CD4(+) T cells in peripheral blood of SIV infected rhesus macaques were evaluated and compared to animals that were treated with ART. The frequency of Th-17 and Tc-17 cells was determined following infection and after therapy. Relative expression of IL-21, IL-23, and TGFbeta was determined using Taqman PCR. Treatment of SIV infected rhesus macaques with anti-retroviral therapy was associated with a substantial repopulation of mucosal homing alpha4(+)beta7(hi)CD4(+) T cells in peripheral blood. This repopulation, however, was not accompanied by a restoration of Th-17 responses. Interestingly, SIV infection was associated with an increase in Tc-17 responses (IL-17(+)CD8(+) T cells) suggesting to a skewing in the ratio of Th-17: Tc-17 cells from a predominantly Th-17 phenotype to a predominantly Tc-17 phenotype. Surprisingly, Tc-17 responses remained high during the course of therapy suggesting that ART failed to correct the imbalance in Th-17 : Tc-17 responses induced following SIV infection. ART was associated with substantial repopulation of alpha4(+)beta7(hi) CD4(+) T cells in peripheral blood with little or no rebound of Th-17 cells. On the other hand, repopulation of alpha4(+)beta7(hi) CD4(+) T cells was accompanied by persistence of high levels of Tc-17 cells in peripheral blood. The dysregulation of Th-17 and Tc-17 responses likely plays a role in disease progression.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4985291','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=4985291"><span>Clinical features of Hispanic thyroid cancer cases and the role of known genetic variants on disease risk</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Estrada-Florez, Ana P.; Bohórquez, Mabel E.; Sahasrabudhe, Ruta; Prieto, Rodrigo; Lott, Paul; Duque, Carlos S.; Donado, Jorge; Mateus, Gilbert; Bolaños, Fernando; Vélez, Alejandro; Echeverry, Magdalena; Carvajal-Carmona, Luis G.</p> <p>2016-01-01</p> <p>Abstract Thyroid cancer (TC) is the second most common cancer among Hispanic women. Recent genome-wide association (GWA) and candidate studies identified 6 single nucleotide polymorphisms (SNPs; rs966423, rs2439302, rs965513, rs6983267, rs944289, and rs116909374), associated with increased TC risk in Europeans but their effects on disease risk have not been comprehensively tested in Hispanics. In this study, we aimed to describe the main clinicopathological manifestations and to evaluate the effects of known SNPs on TC risk and on clinicopathological manifestations in a Hispanic population. We analyzed 281 nonmedullary TC cases and 1146 cancer-free controls recruited in a multicenter population-based study in Colombia. SNPs were genotyped by Kompetitive allele specific polymerase chain reaction (KASP) technique. Association between genetic variants and TC risk was assessed by computing odds ratios (OR) and confidence intervals (CIs). Consistent with published data in U.S. Hispanics, our cases had a high prevalence of large tumors (>2 cm, 43%) and a high female/male ratio (5:1). We detected significant associations between TC risk and rs965513A (OR = 1.41), rs944289T (OR = 1.26), rs116909374A (OR = 1.96), rs2439302G (OR = 1.19), and rs6983267G (OR = 1.18). Cases carried more risk alleles than controls (5.16 vs. 4.78, P = 4.8 × 10−6). Individuals with ≥6 risk alleles had >6-fold increased TC risk (OR = 6.33, P = 4.0 × 10−6) compared to individuals with ≤2 risk alleles. rs944289T and rs116909374A were strongly associated with follicular histology (ORs = 1.61 and 3.33, respectively); rs2439302G with large tumors (OR = 1.50); and rs965513A with regional disease (OR = 1.92). To our knowledge, this is the first study of known TC risk variants in South American Hispanics and suggests that they increase TC susceptibility in this population and can identify patients at higher risk of severe disease. PMID:27512836</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/22608296-study-potential-utility-new-radiopharmaceuticals-based-technetium-labeled-derivative-glucose','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/22608296-study-potential-utility-new-radiopharmaceuticals-based-technetium-labeled-derivative-glucose"><span>Study of potential utility of new radiopharmaceuticals based on technetium-99m labeled derivative of glucose</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Zeltchan, R., E-mail: r.zelchan@yandex.ru; Medvedeva, A.; Sinilkin, I.</p> <p></p> <p>Purpose: to study the potential utility of 1-thio-D-glucose labeled with {sup 99m}Tc for cancer imaging in laboratory animals. Materials and method: the study was carried out in cell cultures of normal CHO (Chinese hamster ovary cells CHO) and malignant tissues MCF-7 (human breast adenocarcinoma MCF-7). To evaluate the uptake of {sup 99m}Tc-1-thio-D-glucose in normal and tumor tissue cells, 25 MBq of 1-thio-D-glucose labeled with {sup 99m}Tc was added to the vials with 3 million cells and incubated for 30 min at room temperature. After centrifugation of the vials with cells, the supernatant was removed. The radioactivity in vials with normalmore » and tumor cells was then measured. In addition, the study included 40 mice of C57B1/6j lines with tumor lesion of the right femur. For neoplastic lesions, Lewis lung carcinoma model was used. Following anesthesia, mice were injected intravenously with 25 MBq of {sup 99m}Tc-1-thio-D-glucose. Planar scintigraphy was performed 15 minutes later in a matrix of 512x512 pixels for 5 min. Results: when measuring the radioactivity of normal and malignant cells after incubation with {sup 99m}Tc-1-thio-D-glucose, it was found that the radioactivity of malignant cells was higher than that of normal cells. The mean values of radioactivity levels in normal and malignant cells were 0.3 ± 0.15 MBq and 1.07 ± 0.6 MBq, respectively. All examined animals had increased accumulation of {sup 99m}Tc-1-thio-D-glucose at the tumor site. The accumulation of {sup 99m}Tc-1-thio-D-glucose in the tumor was on average twice as high as compared to the symmetric region. Conclusion: The present study demonstrated that {sup 99m}Tc-1-thio-D-glucose is a prospective radiopharmaceutical for cancer visualization. In addition, high accumulation of {sup 99m}Tc-1-thio-D-glucose in the culture of cancer cells and in tumor tissue of animals demonstrates tumor tropism of the radiopharmaceutical.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://pubs.er.usgs.gov/publication/70178613','USGSPUBS'); return false;" href="https://pubs.er.usgs.gov/publication/70178613"><span>Metaultramafic schists and dismembered ophiolites of the Ashe Metamorphic Suite of northwestern North Carolina, USA</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://pubs.er.usgs.gov/pubs/index.jsp?view=adv">USGS Publications Warehouse</a></p> <p>Raymond, Loren A.; Merschat, Arthur J.; Vance, R. Kelly</p> <p>2016-01-01</p> <p>Metaultramafic rocks (MUR) in the Ashe Metamorphic Suite (AMS) of northwestern North Carolina include quartz ± feldspar-bearing QF-amphibolites and quartz-deficient, locally talc-, chlorite-, and/or Mg-amphibole-bearing TC-amphibolites. Some workers divide TC-amphibolites into Todd and Edmonds types, based on mineral and geochemical differences, and we provisionally add a third type – olivine ± pyroxene-rich, Rich Mountain-type rocks. Regionally, MUR bodies range from equant, Rich Mountain- to highly elongate, Todd-TC-amphibolite-type bodies. The MURs exhibit three to five mineral associations containing assemblages with olivine, anthophyllitic amphibole, Mg-hornblende, Mg-actinolite, cummingtonite, and serpentine representing decreasing eclogite to greenschist facies grades of metamorphism over time. MUR protoliths are difficult to determine. Southwestern MUR bodies have remnant olivine ± pyroxene-rich assemblages representing ultrabasic-basic, dunite-peridotite-pyroxenite protoliths. Northeastern TC-amphibolite MURs contain hornblende and actinolitic amphiboles plus chlorites – aluminous and calcic assemblages suggesting to some that metasomatism of basic, QF-amphibolites yields all TC-amphibolites. Yet MgO-CaO-Al2O3 and trace element chemistries of many TC-amphibolites resemble compositions of plagioclase peridotites. We show that a few AMS TC-amphibolites had basaltic/gabbroic protoliths, while presenting arguments opposing application of the metasomatic hypothesis to all TC-amphibolites. We establish that MUR bodies are petrologically heterolithic and that TC-amphibolites are in contact with many rock types; that those with high Cr, Ni, and Mg have olivine- or pyroxene-dominated protoliths; that most exhibit three or more metamorphic mineral associations; and that contacts thought to be metasomatic are structural. Clearly, different MUR bodies have different chemistries representing various protoliths, and have different mineral assemblages, reflecting both chemical composition and metamorphic history. Spot sampling of heterolithic MUR bodies does not reveal MUR body character or history or allow ‘type’ designations. We recommend that the subdivision of MUR bodies into ‘types’ be abandoned and that the metasomatic hypothesis be carefully applied. AMS MURs and associated metamafic rocks likely represent fragments of dismembered ophiolites from various ophiolite types.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27512836','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27512836"><span>Clinical features of Hispanic thyroid cancer cases and the role of known genetic variants on disease risk.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Estrada-Florez, Ana P; Bohórquez, Mabel E; Sahasrabudhe, Ruta; Prieto, Rodrigo; Lott, Paul; Duque, Carlos S; Donado, Jorge; Mateus, Gilbert; Bolaños, Fernando; Vélez, Alejandro; Echeverry, Magdalena; Carvajal-Carmona, Luis G</p> <p>2016-08-01</p> <p>Thyroid cancer (TC) is the second most common cancer among Hispanic women. Recent genome-wide association (GWA) and candidate studies identified 6 single nucleotide polymorphisms (SNPs; rs966423, rs2439302, rs965513, rs6983267, rs944289, and rs116909374), associated with increased TC risk in Europeans but their effects on disease risk have not been comprehensively tested in Hispanics. In this study, we aimed to describe the main clinicopathological manifestations and to evaluate the effects of known SNPs on TC risk and on clinicopathological manifestations in a Hispanic population.We analyzed 281 nonmedullary TC cases and 1146 cancer-free controls recruited in a multicenter population-based study in Colombia. SNPs were genotyped by Kompetitive allele specific polymerase chain reaction (KASP) technique. Association between genetic variants and TC risk was assessed by computing odds ratios (OR) and confidence intervals (CIs).Consistent with published data in U.S. Hispanics, our cases had a high prevalence of large tumors (>2 cm, 43%) and a high female/male ratio (5:1). We detected significant associations between TC risk and rs965513A (OR = 1.41), rs944289T (OR = 1.26), rs116909374A (OR = 1.96), rs2439302G (OR = 1.19), and rs6983267G (OR = 1.18). Cases carried more risk alleles than controls (5.16 vs. 4.78, P = 4.8 × 10). Individuals with ≥6 risk alleles had >6-fold increased TC risk (OR = 6.33, P = 4.0 × 10) compared to individuals with ≤2 risk alleles. rs944289T and rs116909374A were strongly associated with follicular histology (ORs = 1.61 and 3.33, respectively); rs2439302G with large tumors (OR = 1.50); and rs965513A with regional disease (OR = 1.92).To our knowledge, this is the first study of known TC risk variants in South American Hispanics and suggests that they increase TC susceptibility in this population and can identify patients at higher risk of severe disease.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016MS%26E..135a2054Z','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016MS%26E..135a2054Z"><span>Experimental study of radiopharmaceuticals based on technetium-99m labeled derivative of glucose for tumor diagnosis</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Zeltchan, R.; Medvedeva, A.; Sinilkin, I.; Bragina, O.; Chernov, V.; Stasyuk, E.; Rogov, A.; Il'ina, E.; Larionova, L.; Skuridin, V.; Dergilev, A.</p> <p>2016-06-01</p> <p>Purpose: to study the potential utility of 1-thio-D-glucose labeled with 99mTc for cancer imaging in laboratory animals. Materials and method: the study was carried out in cell cultures of normal CHO (Chinese hamster ovary cells CHO) and malignant tissues MCF-7 (human breast adenocarcinoma MCF-7). To evaluate the uptake of 99mTc-1-thio-D-glucose in normal and tumor tissue cells, 25 MBq of 1-thio-D-glucose labeled with 99mTc was added to the vials with 3 million cells and incubated for 30 minutes at room temperature. After centrifugation of the vials with cells, the supernatant was removed. Radioactivity in vials with normal and tumor cells was then measured. In addition, the study included 40 mice of C57B 1/6j lines with tumor lesion of the right femur. For neoplastic lesions, Lewis lung carcinoma model was used. Following anesthesia, mice were injected intravenously with 25MBq of 99mTc-1-thio-D-glucose. Planar scintigraphy was performed 15 minutes later in a matrix of 512x512 pixels for 5 minutes. Results: when measuring the radioactivity of normal and malignant cells after incubation with 99mTc-1-thio-D- glucose, it was found that the radioactivity of malignant cells was higher than that of normal cells. The mean values of radioactivity levels in normal and malignant cells were 0.3±0.15MBq and 1.07±0.6MBq, respectively. All examined animals had increased accumulation of 99mTc-1-thio- D-glucose at the tumor site. The accumulation of 99mTc-1-thio-D-glucose in the tumor was on average twice as high as compared to the symmetric region. Conclusion: The present study demonstrated that 99mTc-1-thio-D-glucose is a prospective radiopharmaceutical for cancer visualization. In addition, high accumulation of 99mTc-1-thio-D-glucose in the culture of cancer cells and in tumor tissue of animals demonstrates tumor tropism of the radiopharmaceutical.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2016AIPC.1760b0072Z','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2016AIPC.1760b0072Z"><span>Study of potential utility of new radiopharmaceuticals based on technetium-99m labeled derivative of glucose</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Zeltchan, R.; Medvedeva, A.; Sinilkin, I.; Chernov, V.; Stasyuk, E.; Rogov, A.; Il'ina, E.; Larionova, L.; Skuridin, V.</p> <p>2016-08-01</p> <p>Purpose: to study the potential utility of 1-thio-D-glucose labeled with 99mTc for cancer imaging in laboratory animals. Materials and method: the study was carried out in cell cultures of normal CHO (Chinese hamster ovary cells CHO) and malignant tissues MCF-7 (human breast adenocarcinoma MCF-7). To evaluate the uptake of 99mTc-1-thio-D-glucose in normal and tumor tissue cells, 25 MBq of 1-thio-D-glucose labeled with 99mTc was added to the vials with 3 million cells and incubated for 30 min at room temperature. After centrifugation of the vials with cells, the supernatant was removed. The radioactivity in vials with normal and tumor cells was then measured. In addition, the study included 40 mice of C57B1/6j lines with tumor lesion of the right femur. For neoplastic lesions, Lewis lung carcinoma model was used. Following anesthesia, mice were injected intravenously with 25 MBq of 99mTc-1-thio-D-glucose. Planar scintigraphy was performed 15 minutes later in a matrix of 512x512 pixels for 5 min. Results: when measuring the radioactivity of normal and malignant cells after incubation with 99mTc-1-thio-D-glucose, it was found that the radioactivity of malignant cells was higher than that of normal cells. The mean values of radioactivity levels in normal and malignant cells were 0.3 ± 0.15 MBq and 1.07 ± 0.6 MBq, respectively. All examined animals had increased accumulation of 99mTc-1-thio-D-glucose at the tumor site. The accumulation of 99mTc-1-thio-D-glucose in the tumor was on average twice as high as compared to the symmetric region. Conclusion: The present study demonstrated that 99mTc-1-thio-D-glucose is a prospective radiopharmaceutical for cancer visualization. In addition, high accumulation of 99mTc-1-thio-D-glucose in the culture of cancer cells and in tumor tissue of animals demonstrates tumor tropism of the radiopharmaceutical.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/26778326','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/26778326"><span>A Detailed Motion Analysis of the Angular Velocity Between the Vocal Folds During Throat Clearing Using High-speed Digital Imaging.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Iwahashi, Toshihiko; Ogawa, Makoto; Hosokawa, Kiyohito; Kato, Chieri; Inohara, Hidenori</p> <p>2016-11-01</p> <p>To assess the angular velocity between the vocal folds just before the compression phase of throat clearing (TC) using high-speed digital imaging (HSDI) of the larynx. Twenty normal healthy adults (13 males and seven females) were enrolled in the study. Each participant underwent transnasal laryngo-fiberscopy, and was asked to perform weak/strong TC followed by a comfortable, sustained vowel phonation while recording an HSDI movie (4000 frames/s) of the larynx. Using a motion analysis, the changes in the vocal fold angle and angular velocity during vocal fold adduction were assessed. Subsequently, we calculated the average angular velocities in the ranges of 100-80%, 80-20%, and 20-0% from all of the angular changes. The motion analysis demonstrated that the changes in the angular velocity resulted in polynomial-like and sigmoid curves during TC and vowel phonation, respectively. The angular velocities during weak TC were significantly higher in the 20-0%, 80-20%, and 100-80% regions (in order); the 80-20% angular velocity in vocal fold adduction during phonation was highest. The 20-0% angular velocity during strong TC was more than twofold higher than 20-0% angular velocity during phonation. The present results confirmed that the closing motions of the vocal folds accelerate throughout the precompression closing phase of a TC episode, and decelerate just before the impact between the vocal folds at the onset of phonation, suggesting that the vocal fold velocity generated by TC is sufficient to damage the laryngeal tissues. Copyright © 2016 The Voice Foundation. Published by Elsevier Inc. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/10473195','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/10473195"><span>Radiochemical studies of 99mTc complexes of modified cysteine ligands and bifunctional chelating agents.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Pillai, M R; Kothari, K; Banerjee, S; Samuel, G; Suresh, M; Sarma, H D; Jurisson, S</p> <p>1999-07-01</p> <p>The synthesis of four novel ligands using the amino-acid cysteine and its ethyl carboxylate derivative is described. The synthetic method involves a two-step procedure, wherein the intermediate Schiff base formed by the condensation of the amino group of the cysteine substrate and salicylaldehyde is reduced to give the target ligands. The intermediates and the final products were characterized by high resolution nuclear magnetic resonance spectroscopy. Complexation studies of the ligands with 99mTc were optimized using stannous tartrate as the reducing agent under varying reaction conditions. The complexes were characterized using standard quality control techniques such as thin layer chromatography, paper electrophoresis, and paper chromatography. Lipophilicities of the complexes were estimated by solvent extraction into chloroform. Substantial changes in net charge and lipophilicity of the 99mTc complexes were observed on substituting the carboxylic acid functionality in ligands I and II with the ethyl carboxylate groups (ligands II and IV). All the ligands formed 99mTc complexes in high yield. Whereas the complexes with ligands I and II were observed to be hydrophilic in nature and not extractable into CHCl3, ligands III and IV resulted in neutral and lipophilic 99mTc complexes. The 99mTc complex with ligand II was not stable and on storage formed a hydrophilic and nonextractable species. The biodistribution of the complexes of ligands I and II showed that they cleared predominantly through the kidneys, whereas the complexes with ligands III and IV were excreted primarily through the hepatobiliary system. No significant brain uptake was observed with the 99mTc complexes with ligands III and IV despite their favorable properties of neutrality, lipophilicity, and conversion into a hydrophilic species. These ligands offer potential for use as bifunctional chelating agents.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/biblio/1340749-zirconium-based-metalorganic-framework-removal-perrhenate-from-water','SCIGOV-STC'); return false;" href="https://www.osti.gov/biblio/1340749-zirconium-based-metalorganic-framework-removal-perrhenate-from-water"><span>Zirconium-Based Metal–Organic Framework for Removal of Perrhenate from Water</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/search">DOE Office of Scientific and Technical Information (OSTI.GOV)</a></p> <p>Banerjee, Debasis; Xu, Wenqian; Nie, Zimin</p> <p>2016-09-06</p> <p>Efficient removal of pertechnetate (TcO4-) anions from liquid waste or melter off-gas solution for alternative treatment is one of the promising options to manage 99Tc in legacy nuclear waste. Safe immobilization of 99Tc is of major importance due to its long half-life (t1/2= 2.13 × 105 yrs) and environmental mobility. Different types of inorganic and solid state ion-exchange materials such as layered double hydroxides have been shown to absorb TcO4- anions from water. However, both high capacity and selectivity have yet to be achieved in a single material. Herein, we show that a protonated version of an ultra-stable zirconium basedmore » metal-organic framework can adsorb perrhenate (ReO4-) anions, a non-radioactive sur-rogate for TcO4-, from water even in the presence of other common anions. Synchrotron based powder X-ray diffraction and molecular simulations were used to identify the position of the adsorbed ReO4- (surrogate for TcO4-) molecule within the framework.« less</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('http://adsabs.harvard.edu/abs/2017JMMM..423...27Y','NASAADS'); return false;" href="http://adsabs.harvard.edu/abs/2017JMMM..423...27Y"><span>Measurement of magnetic property of FePt granular media at near Curie temperature</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://adsabs.harvard.edu/abstract_service.html">NASA Astrophysics Data System (ADS)</a></p> <p>Yang, H. Z.; Chen, Y. J.; Leong, S. H.; An, C. W.; Ye, K. D.; Hu, J. F.</p> <p>2017-02-01</p> <p>The characterization of the magnetic switching behavior of heat assisted magnetic recording (HAMR) media at near Curie temperature (Tc) is important for high density recording. In this study, we measured the magnetic property of FePt granular media (with room temperature coercivity 25 kOe) at near Tc with a home built HAMR testing instrument. The local area of HAMR media is heated to near Tc by a flat-top optical heating beam. The magnetic property in the heated area was in-situ measured by a magneto-optic Kerr effect (MOKE) testing beam. The switching field distribution (SFD) and coercive field (Hc) of the FePt granular media and their dependence on the optical heating power at near Tc were studied. We measured the DC demagnetization (DCD) signal with pulsed laser heating at different optical powers. We also measured the Tc distribution of the media by measuring the AC magnetic signal as a function of optical heating power. In a summary, we studied the SFD, Hc of the HAMR media at near Tc in a static manner. The present methodology will facilitate the HAMR media testing.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/23587856','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/23587856"><span>Mechanistic understanding of tetracycline sorption on waste tire powder and its chars as affected by Cu(2+) and pH.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Lian, Fei; Song, Zhengguo; Liu, Zhongqi; Zhu, Lingyan; Xing, Baoshan</p> <p>2013-07-01</p> <p>The sorption characteristics of tetracycline (TC) by waste tire powder and its chars were investigated to explore the potential of using waste tires as effective sorbents for removal of TC from aqueous solution. Naphthalene (NAPH), a typical hydrophobic organic compound, was selected as asorbate for comparison. TC displayed much lower sorption affinity to tire powder than NAPH. However, it exhibited similar adsorption affinity as NAPH on the pyrolyzed tire chars, which was mainly attributed to π-π electron-donor-acceptor interactions of TC with the graphite surface of chars. TC and Cu(2+) could mutually facilitate the sorption of each other on both tire powder and pyrolyzed chars in a wide pH range. This could be explained by the metallic complexation and/or surface-bridging mechanisms (i.e., Cu- or TC-bridging). However, Cu(2+) and NAPH depressed the sorption of each other on tire powder and displayed negligible impact to each other on the highly pyrolyzed chars. Copyright © 2013 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/27702503','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/27702503"><span>Carbon disulfide-modified magnetic ion-imprinted chitosan-Fe(III): A novel adsorbent for simultaneous removal of tetracycline and cadmium.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Chen, Anwei; Shang, Cui; Shao, Jihai; Lin, Yiqing; Luo, Si; Zhang, Jiachao; Huang, Hongli; Lei, Ming; Zeng, Qingru</p> <p>2017-01-02</p> <p>A novel composite of carbon disulfide-modified magnetic ion-imprinted chitosan-Fe(III), i.e., MMIC-Fe(III) composite, was prepared as an efficient adsorbent for the simultaneous removal of tetracycline (TC) and Cd(II). This adsorbent showed excellent performance in removing TC and Cd(II) due to its rapid kinetics, high adsorption capacity, good reusability, and was well suited for use with real water samples. Kinetics studies demonstrated that the adsorption proceeded according to a pseudo-second order model. The adsorption isotherms were well described by the Langmuir model, with maximum adsorption capacity for TC and Cd(II) being 516.29 and 194.31mg/g, respectively. The synergistic effect of TC and Cd(II) adsorption might be due to the formation of TC-Cd(II) complex bridging the adsorbate and adsorbent. These properties demonstrate the potential application of MMIC-Fe(III) for the simultaneous removal of TC and Cd(II), and may provide some information for the synergistic removal of antibiotics and heavy metals from aquatic environments. Copyright © 2016 Elsevier Ltd. All rights reserved.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5456798','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5456798"><span>Two Novel C3N4 Phases: Structural, Mechanical and Electronic Properties</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Fan, Qingyang; Chai, Changchun; Wei, Qun; Yang, Yintang</p> <p>2016-01-01</p> <p>We systematically studied the physical properties of a novel superhard (t-C3N4) and a novel hard (m-C3N4) C3N4 allotrope. Detailed theoretical studies of the structural properties, elastic properties, density of states, and mechanical properties of these two C3N4 phases were carried out using first-principles calculations. The calculated elastic constants and the hardness revealed that t-C3N4 is ultra-incompressible and superhard, with a high bulk modulus of 375 GPa and a high hardness of 80 GPa. m-C3N4 and t-C3N4 both exhibit large anisotropy with respect to Poisson’s ratio, shear modulus, and Young’s modulus. Moreover, m-C3N4 is a quasi-direct-bandgap semiconductor, with a band gap of 4.522 eV, and t-C3N4 is also a quasi-direct-band-gap semiconductor, with a band gap of 4.210 eV, with the HSE06 functional. PMID:28773550</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5482549','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5482549"><span>Above 400-K robust perpendicular ferromagnetic phase in a topological insulator</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Tang, Chi; Chang, Cui-Zu; Zhao, Gejian; Liu, Yawen; Jiang, Zilong; Liu, Chao-Xing; McCartney, Martha R.; Smith, David J.; Chen, Tingyong; Moodera, Jagadeesh S.; Shi, Jing</p> <p>2017-01-01</p> <p>The quantum anomalous Hall effect (QAHE) that emerges under broken time-reversal symmetry in topological insulators (TIs) exhibits many fascinating physical properties for potential applications in nanoelectronics and spintronics. However, in transition metal–doped TIs, the only experimentally demonstrated QAHE system to date, the QAHE is lost at practically relevant temperatures. This constraint is imposed by the relatively low Curie temperature (Tc) and inherent spin disorder associated with the random magnetic dopants. We demonstrate drastically enhanced Tc by exchange coupling TIs to Tm3Fe5O12, a high-Tc magnetic insulator with perpendicular magnetic anisotropy. Signatures showing that the TI surface states acquire robust ferromagnetism are revealed by distinct squared anomalous Hall hysteresis loops at 400 K. Point-contact Andreev reflection spectroscopy confirms that the TI surface is spin-polarized. The greatly enhanced Tc, absence of spin disorder, and perpendicular anisotropy are all essential to the occurrence of the QAHE at high temperatures. PMID:28691097</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1525044','PMC'); return false;" href="https://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1525044"><span>Imaging Thromboembolism with Fibrin-Avid 99mTc-Peptide: Evaluation in Swine</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pmc">PubMed Central</a></p> <p>Aruva, Mohan R.; Daviau, Judy; Sharma, Shubh S.; Thakur, Mathew L.</p> <p>2006-01-01</p> <p>A pentapeptide, Gly-Pro-Arg-Pro-Pro, with high affinity for α-chain-fibrin was labeled with 99mTc (99mTc-TP850) and evaluated in swine to image experimental venous thromboembolism (deep vein thrombosis [DVT]) and pulmonary embolism (PE). Methods Scatchard analysis was performed to determine fibrin affinity for TP850 and the number of binding sites (receptors) per milligram of fibrin. DVT was induced in the left jugular vein and PE was induced by introducing a preformed autologous blood clot into the right atrium using a 7-French introducer sheath inserted into the right jugular vein. 99mTc-TP850 was injected at 4, 24, 48, 72, 96, or 120 h later. Animals were imaged for up to 4 h after injection, heparinized, and sacrificed. Lungs were extirpated, radiographed, and imaged, and the PE was removed. Other tissues, including blood and normal lungs, were harvested and, concomitantly, 99mTc was counted for determination of target-to-tissue ratios and the percentage injected dose per gram of tissue. Results The affinity for human fibrin was 10−9 mol/L and there were >1015 receptors per milligram of fibrin. DVT and PE were visualized for up to 4 h after injection with high DVT/blood (7.9–22.6), DVT/muscle (31.1–89.4), PE/blood (1–155), and PE/lung (0.8–245) ratios. Thereafter, the PEs fragmented spontaneously below the spatial resolution of the γ-camera and, despite the high associated radioactivity, could not be localized in vivo. The fragmented clots were detectable by scintigraphy on excised lungs and provided excellent concordance with radiograms. Conclusion 99mTc-TP850 with its modest affinity (10−9 mol/L), rapid blood clearance, and high DVT and PE uptake is a promising agent for imaging vascular thrombosis. PMID:16391200</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.ncbi.nlm.nih.gov/pubmed/12899958','PUBMED'); return false;" href="https://www.ncbi.nlm.nih.gov/pubmed/12899958"><span>An efficient HPLC method for the analysis of isomeric purity of technetium-99m-exametazime and identity confirmation using LC-MS.</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed">PubMed</a></p> <p>Vanderghinste, D; Van Eeckhoudt, M; Terwinghe, C; Mortelmans, L; Bormans, G M; Verbruggen, A M; Vanbilloen, H P</p> <p>2003-08-08</p> <p>99mTc-exametazime (99mTc-d,l-HMPAO, 99mTc-d,l-hexamethylpropyleneamine oxime) is a neutral rather unstable complex of short-lived 99mTc (t(1/2)=6 h) with the d,l-isomer (mixture of D,D- and L,L-isomers) of a bis-amine bis-oxime tetraligand. It is widely used for measurement of regional cerebral perfusion in nuclear medicine. The meso-isomer (D,L-form) should not be present in a preparation as it is not retained in brain and thus does not provide clinically useful information. Meso-HMPAO is removed from the ligand during the synthesis procedure by repeated recrystallization, but can still be present as impurity in d,l-isomer. Due to the lack of a suitable chromatographic method for analysis of the isomeric purity of 99mTc-exametazime preparations, United States Pharmacopoeia 25 (USP 25) prescribes a biological test in rats for quality control purpose. In this study, we developed a suitable high-performance liquid chromatography (HPLC) method which allows to demonstrate the relative amounts of d,l- and meso-isomer in 99mTc-exametazime and so obviates the need for a biodistribution test in animals as part of the quality control. Due to the low concentrations in which 99mTc-d,l-HMPAO is obtained (typically 2-6 ng/ml), confirmation of the identity of 99mTc-d,l-HMPAO in the monograph of the European Pharmacopoeia is now performed only indirectly by TLC and assessment of its retention time on RP-HPLC. To investigate the potential of radio-LC-MS for assessment of the identity of 99mTc-exametazime, 99mTc-d,l-HMPAO and 99mTc-meso-HMPAO prepared using a Tc-rich eluate were analyzed using a radio-LC-MS system equipped with a time-of-flight mass spectrometer with electrospray ionization. The main peak in the radiometric channel coincided with the molecular ion mass of 99mTc-d,l-HMPAO in the mass spectrometer channel and the measured accurate mass differed only by 0.26 ppm from the theoretical mass. The identity of 99mTc-meso-HMPAO was also confirmed. Thus, radio-LC-MS allowed to obtain strong evidence for the structure of 99mTc-d,l-HMPAO and 99mTc-meso-HMPAO at nanomolar concentration. It is concluded that radio-LC-MS can become a sensitive aid in quality control of "no carrier added" radiopharmaceutical preparations.</p> </li> <li> <p><a target="_blank" rel="noopener noreferrer" onclick="trackOutboundLink('https://www.osti.gov/pages/biblio/1347259-coherent-charge-spin-density-waves-underdoped-hgba2cuo4+','SCIGOV-DOEP'); return false;" href="https://www.osti.gov/pages/biblio/1347259-coherent-charge-spin-density-waves-underdoped-hgba2cuo4+"><span>Coherent charge and spin density waves in underdoped HgBa 2CuO 4+δ</span></a></p> <p><a target="_blank" rel="noopener noreferrer" href="http://www.osti.gov/pages">DOE PAGES</a></p> <p>Lee, Jeongseop A.; Xin, Yizhou; Halperin, W. P.; ...</p> <p>2017-03-16</p> <p>Charge order in cuprate superconductors appears to be a universal characteristic, often associated with pseudogap behavior in the normal state. The central question is whether such charge ordering or the pseudogap are required for the existence of high temperature superconductivity and embody its mechanism. An important but phenomenological approach to this question is to examine whether these phenomena extend over various members of the cuprate family. Recent nuclear magnetic resonance (NMR) measurements on oxygen chain-ordered single crystals of YBa 2Cu 3O 6+y (Y123) have demonstrated temperature and magnetic field induced charge ordering that was confirmed in x-ray experiments. In themore » present work on high-quality single crystals of the tetragonal compound, HgBa 2CuO 4+δ, we use 17O NMR to investigate the interplay between charge and spin order deduced from the full quadrupolar-split NMR spectrum over a wide range of temperature and magnetic field. We have found evidence for a coherent modulation of charge and spin order in this compound. Furthermore, neither temperature nor magnetic field induced ordering was observed and we infer that this aspect of high temperature superconductivity is not universal.« less</p> </li> </ol> <div class="pull-right"> <ul class="pagination"> <li><a href="#" onclick='return showDiv("page_1");'>«</a></li> <li><a href="#" onclick='return showDiv("page_21");'>21</a></li> <li><a href="#" onclick='return showDiv("page_22");'>22</a></li> <li><a href="#" onclick='return showDiv("page_23");'>23</a></li> <li><a href="#" onclick='return showDiv("page_24");'>24</a></li> <li class="active"><span>25</span></li> <li><a href="#" onclick='return showDiv("page_25");'>»</a></li> </ul> </div> </div><!-- col-sm-12 --> </div><!-- row --> </div><!-- page_25 --> <div class="footer-extlink text-muted" style="margin-bottom:1rem; text-align:center;">Some links on this page may take you to non-federal websites. Their policies may differ from this site.</div> </div><!-- container --> <a id="backToTop" href="#top"> Top </a> <footer> <nav> <ul class="links"> <li><a href="/sitemap.html">Site Map</a></li> <li><a href="/website-policies.html">Website Policies</a></li> <li><a href="https://www.energy.gov/vulnerability-disclosure-policy" target="_blank">Vulnerability Disclosure Program</a></li> <li><a href="/contact.html">Contact Us</a></li> </ul> </nav> </footer> <script type="text/javascript"><!-- // var lastDiv = ""; function showDiv(divName) { // hide last div if (lastDiv) { document.getElementById(lastDiv).className = "hiddenDiv"; } //if value of the box is not nothing and an object with that name exists, then change the class if (divName && document.getElementById(divName)) { document.getElementById(divName).className = "visibleDiv"; lastDiv = divName; } } //--> </script> <script> /** * Function that tracks a click on an outbound link in Google Analytics. * This function takes a valid URL string as an argument, and uses that URL string * as the event label. */ var trackOutboundLink = function(url,collectionCode) { try { h = window.open(url); setTimeout(function() { ga('send', 'event', 'topic-page-click-through', collectionCode, url); }, 1000); } catch(err){} }; </script> <!-- Google Analytics --> <script> (function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){ (i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o), m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m) })(window,document,'script','//www.google-analytics.com/analytics.js','ga'); ga('create', 'UA-1122789-34', 'auto'); ga('send', 'pageview'); </script> <!-- End Google Analytics --> <script> showDiv('page_1') </script> </body> </html>