Sample records for underlying impaired glur1-dependent

  1. Roles of Fragile X Mental Retardation Protein in Dopaminergic Stimulation-induced Synapse-associated Protein Synthesis and Subsequent α-Amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) Receptor Internalization*

    PubMed Central

    Wang, Hansen; Kim, Susan S.; Zhuo, Min

    2010-01-01

    Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of α-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome. PMID:20457613

  2. Roles of fragile X mental retardation protein in dopaminergic stimulation-induced synapse-associated protein synthesis and subsequent alpha-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) receptor internalization.

    PubMed

    Wang, Hansen; Kim, Susan S; Zhuo, Min

    2010-07-09

    Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of alpha-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome.

  3. The aniracetam metabolite 2-pyrrolidinone induces a long-term enhancement in AMPA receptor responses via a CaMKII pathway.

    PubMed

    Nishizaki, Tomoyuki; Matsumura, Takuro

    2002-01-31

    The present study was conducted to assess the effect of aniracetam and its metabolites, such as 2-pyrrolidinone, p-anisic acid, and anisamide butyrate, on the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors, heteromerically formed of GluR1,2 (GluR1 and GluR2), GluR1,3 (GluR1 and GluR3), and GluR1,2,3 (GluR1, GluR2, and GluR3), expressed in Xenopus oocytes. 2-Pyrrolidinone potentiated kainate-evoked currents through GluR1,2,3 channels in a bell-shaped dose-dependent manner at concentrations ranged from 1 nM to 300 microM, with a maximal effect at 100 microM. The potentiation was long-lasting, reaching approximately 180% of basal levels 60 min after 5-min treatment with 2-pyrrolidinone at 100 microM. 2-Pyrrolidinone (100 microM) potentiated GluR1,3 channel currents as observed in GluR1,2,3, but instead it depressed GluR1,2 currents. Aniracetam and p-anisic acid potentiated GluR1,2,3 channel currents, but to a lesser extent, each about 130 and 103% of basal levels 60 min after treatment at 100 microM. In contrast, anisamide butyrate had no potentiating effect on the currents. Potentiation of GluR1,2,3 channel currents obtained with 2-pyrrolidinone was inhibited by KN-93, a selective inhibitor of calcium/calmodulin-dependent protein kinase (CaMKII), while it was not affected by GF109203X, a selective inhibitor of protein kinase C or H-89, a selective inhibitor of cAMP-dependent protein kinase. The results of the present study suggest that 2-pyrrolidinone persistently enhances activity of the Ca2+-permeable AMPA receptors, GluR1,3 and GluR1,2,3, by interacting with CaMKII.

  4. Opposing effects of AMPA and 5-HT1A receptor blockade on passive avoidance and object recognition performance: correlation with AMPA receptor subunit expression in rat hippocampus.

    PubMed

    Schiapparelli, L; Simón, A M; Del Río, J; Frechilla, D

    2006-06-01

    It has been suggested that antagonists at serotonin 5-HT1A receptors may exert a procognitive effect by facilitating glutamatergic neurotransmission. Here we further explored this issue by looking for the ability of a 5-HT1A antagonist to prevent the learning deficit induced by AMPA receptor blockade in two behavioural procedures in rats, and for concomitant molecular changes presumably involved in memory formation in the hippocampus. Pretraining administration of the competitive AMPA receptor antagonist, NBQX, produced a dose-related retention impairment in a passive avoidance task 24h later, and also impaired retention in a novel object recognition test when an intertrial interval of 3h was selected. Pretreatment with the selective 5-HT1A receptor antagonist, WAY-100635, prevented the learning deficit induced by NBQX in the two behavioural procedures. In biochemical studies performed on rat hippocampus after the retention tests, we found that learning increased the membrane levels of AMPA receptor GluR1 and GluR2/3 subunits, as well as the phosphorylated forms of GluR1, effects that were abolished by NBQX administration before the training session. Pretreatment with WAY-100635 counteracted the NBQX effects and restored the initial learning-specific increase in Ca2+/calmodulin-dependent protein kinase II (CaMKII) function and the later increase in GluR2/3 and phosphorylated GluR1 surface expression. Moreover, administration of WAY-100635 before object recognition training improved recognition memory 24h later and potentiated the learning-associated increase in AMPA receptor subunits. The results support the proposed utility of 5-HT1A antagonists in the treatment of cognitive disorders.

  5. PICK1 interacts with ABP/GRIP to regulate AMPA receptor trafficking.

    PubMed

    Lu, Wei; Ziff, Edward B

    2005-08-04

    PICK1 and ABP/GRIP bind to the AMPA receptor (AMPAR) GluR2 subunit C terminus. Transfer of the receptor from ABP/GRIP to PICK1, facilitated by GluR2 S880 phosphorylation, may initiate receptor trafficking. Here we report protein interactions that regulate these steps. The PICK1 BAR domain interacts intermolecularly with the ABP/GRIP linker II region and intramolecularly with the PICK1 PDZ domain. Binding of PKCalpha or GluR2 to the PICK1 PDZ domain disrupts the intramolecular interaction and facilitates the PICK1 BAR domain association with ABP/GRIP. Interference with the PICK1-ABP/GRIP interaction impairs S880 phosphorylation of GluR2 by PKC and decreases the constitutive surface expression of GluR2, the NMDA-induced endocytosis of GluR2, and recycling of internalized GluR2. We suggest that the PICK1 interaction with ABP/GRIP is a critical step in controlling GluR2 trafficking.

  6. Regulation of Fear Extinction in the Basolateral Amygdala by Dopamine D2 Receptors Accompanied by Altered GluR1, GluR1-Ser845 and NR2B Levels.

    PubMed

    Shi, Yan-Wei; Fan, Bu-Fang; Xue, Li; Wen, Jia-Ling; Zhao, Hu

    2017-01-01

    The amygdala, a critical structure for both Pavlovian fear conditioning and fear extinction, receives sparse but comprehensive dopamine innervation and contains dopamine D1 and D2 receptors. Fear extinction, which involves learning to suppress the expression of a previously learned fear, appears to require the dopaminergic system. The specific roles of D2 receptors in mediating associative learning underlying fear extinction require further study. Intra-basolateral amygdala (BLA) infusions of a D2 receptor agonist, quinpirole, and a D2 receptor antagonist, sulpiride, prior to fear extinction and extinction retention were tested 24 h after fear extinction training for long-term memory (LTM). LTM was facilitated by quinpirole and attenuated by sulpiride. In addition, A-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor glutamate receptor 1 (GluR1) subunit, GluR1 phospho-Ser845, and N -methyl-D-aspartic acid receptor NR2B subunit levels in the BLA were generally increased by quinpirole and down-regulated by sulpiride. The present study suggests that activation of D2 receptors facilitates fear extinction and that blockade of D2 receptors impairs fear extinction, accompanied by changes in GluR1, GluR1-Ser845 and NR2B levels in the amygdala.

  7. Regulation of a glutamyl-tRNA synthetase by the heme status

    PubMed Central

    Levicán, Gloria; Katz, Assaf; de Armas, Merly; Núñez, Harold; Orellana, Omar

    2007-01-01

    Glutamyl-tRNA (Glu-tRNA), formed by Glu-tRNA synthetase (GluRS), is a substrate for protein biosynthesis and tetrapyrrole formation by the C5 pathway. In this route Glu-tRNA is transformed to δ-aminolevulinic acid, the universal precursor of tetrapyrroles (e.g., heme and chlorophyll) by the action of Glu-tRNA reductase (GluTR) and glutamate semialdehyde aminotransferase. GluTR is a target of feedback regulation by heme. In Acidithiobacillus ferrooxidans, an acidophilic bacterium that expresses two GluRSs (GluRS1 and GluRS2) with different tRNA specificity, the intracellular heme level varies depending on growth conditions. Under high heme requirement for respiration increased levels of GluRS and GluTR are observed. Strikingly, when intracellular heme is in excess, the cells respond by a dramatic decrease of GluRS activity and the level of GluTR. The recombinant GluRS1 enzyme is inhibited in vitro by hemin, but NADPH restores its activity. These results suggest that GluRS plays a major role in regulating the cellular level of heme. PMID:17360620

  8. Agonist- and subunit-dependent potentiation of glutamate receptors by a nootropic drug aniracetam.

    PubMed

    Tsuzuki, K; Takeuchi, T; Ozawa, S

    1992-11-01

    GluR1 and GluR2 cDNAs encoding non-NMDA subtypes of glutamate receptor were isolated from a rat brain cDNA library by Boulter et al. (Science, 249 (1990) 1033-1037). Functional receptors activated by kainate, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and glutamate were expressed in Xenopus oocytes injected with GluR1, GluR2 or a mixture of GluR1 and GluR2 RNAs. In GluR1-expressed oocytes, 1 mM aniracetam potentiated AMPA-induced currents by 99 +/- 10% (mean +/- S.E.M., n = 5) and glutamate-induced currents by 140 +/- 8% (n = 4), but little affected kainate-induced currents. Aniracetam was effective from a concentration of 0.1 mM, and it exhibited more conspicuous effects with the increase of the dose. In oocytes injected with GluR1 plus GluR2 RNAs, aniracetam more markedly potentiated current responses to AMPA and glutamate than those in oocytes injected with GluR1 RNA alone. For example, 1 mM aniracetam potentiated AMPA-induced currents by 396 +/- 76% (n = 4) and glutamate-induced currents by 970 +/- 65% (n = 5) in oocytes injected with 10% GluR1 and 90% GluR2 RNAs. In these oocytes, however, the potentiation of kainate-induced currents by 1 mM aniracetam was only 8 +/- 5% (n = 4). Thus, we conclude that the potentiation of the AMPA/kainate receptor by aniracetam depends on both species of agonists and subunit composition of the receptor.

  9. Early memory formation disrupted by atypical PKC inhibitor ZIP in the medial prefrontal cortex but not hippocampus

    PubMed Central

    Evuarherhe, Obaro; Barker, Gareth R. I.; Savalli, Giorgia; Warburton, Elizabeth C.; Brown, Malcolm W.

    2014-01-01

    Atypical isoforms of protein kinase C (aPKCs; particularly protein kinase M zeta: PKMζ) have been hypothesised to be necessary and sufficient for the maintenance of long-term potentiation (LTP) and long term memory by maintaining postsynaptic AMPA receptors via the GluR2 subunit. A myristoylated PKMζ pseudosubstrate peptide (ZIP) blocks PKMζ activity. We examined the actions of ZIP in medial prefrontal cortex (mPFC) and hippocampus in associative recognition memory in rats during early memory formation and memory maintenance. ZIP infusion in either hippocampus or mPFC impaired memory maintenance. However, early memory formation was impaired by ZIP in mPFC but not hippocampus; and blocking GluR2-dependent removal of AMPA receptors did not affect this impairment caused by ZIP in the mPFC. The findings indicate: (i) a difference in the actions of ZIP in hippocampus and medial prefrontal cortex, and (ii) a GluR2-independent target of ZIP (possibly PKCλ) in the mPFC during early memory formation. PMID:24729442

  10. An essential role for UBE2A/HR6A in learning and memory and mGLUR-dependent long-term depression.

    PubMed

    Bruinsma, Caroline F; Savelberg, Sanne M C; Kool, Martijn J; Jolfaei, Mehrnoush Aghadavoud; Van Woerden, Geeske M; Baarends, Willy M; Elgersma, Ype

    2016-01-01

    UBE2A deficiency syndrome (also known as X-linked intellectual disability type Nascimento) is an intellectual disability syndrome characterized by prominent dysmorphic features, impaired speech and often epilepsy. The syndrome is caused by Xq24 deletions encompassing the UBE2A (HR6A) gene or by intragenic UBE2A mutations. UBE2A encodes an E2 ubiquitin-conjugating enzyme involved in DNA repair and female fertility. A recent study in Drosophila showed that dUBE2A binds to the E3 ligase Parkin, which is required for mitochondrial function and responsible for juvenile Parkinson's disease. In addition, these studies showed impairments in synaptic transmission in dUBE2A mutant flies. However, a causal role of UBE2A in of cognitive deficits has not yet been established. Here, we show that Ube2a knockout mice have a major deficit in spatial learning tasks, whereas other tested phenotypes, including epilepsy and motor coordination, were normal. Results from electrophysiological measurements in the hippocampus showed no deficits in synaptic transmission nor in the ability to induce long-term synaptic potentiation. However, a small but significant deficit was observed in mGLUR-dependent long-term depression, a pathway previously implied in several other mouse models for neurodevelopmental disorders. Our results indicate a causal role of UBE2A in learning and mGLUR-dependent long-term depression, and further indicate that the Ube2a knockout mouse is a good model to study the molecular mechanisms underlying UBE2A deficiency syndrome. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. ApoE4 expression accelerates hippocampus-dependent cognitive deficits by enhancing Aβ impairment of insulin signaling in an Alzheimer’s disease mouse model

    PubMed Central

    Chan, Elizabeth S.; Shetty, Mahesh Shivarama; Sajikumar, Sreedharan; Chen, Christopher; Soong, Tuck Wah; Wong, Boon-Seng

    2016-01-01

    The apolipoprotein E4 (ApoE4) is the strongest genetic risk factor for Alzheimer’s disease (AD). The AD brain was shown to be insulin resistant at end stage, but the interplay between insulin signaling, ApoE4 and Aβ across time, and their involvement in memory decline is unclear. To investigate insulin response in the ageing mouse hippocampus, we crossed the human ApoE-targeted replacement mice with the mutant human amyloid precursor protein (APP) mice (ApoExAPP). While hippocampal Aβ levels were comparable between ApoE3xAPP and ApoE4xAPP mice at 26 weeks, insulin response was impaired in the ApoE4xAPP hippocampus. Insulin treatment was only able to stimulate insulin signaling and increased AMPA-GluR1 phosphorylation in forskolin pre-treated hippocampal slices from ApoE3xAPP mice. In ApoE4xAPP mice, insulin dysfunction was also associated with poorer spatial memory performance. Using dissociated hippocampal neuron in vitro, we showed that insulin response in ApoE3 and ApoE4 neurons increased AMPA receptor-mediated miniature excitatory postsynaptic current (mEPSC) amplitudes and GluR1-subunit insertion. Pre-treatment of ApoE3 neurons with Aβ42 did not affect insulin-mediated GluR1 subunit insertion. However, impaired insulin sensitivity observed only in the presence of ApoE4 and Aβ42, attenuated GluR1-subunit insertion. Taken together, our results suggest that ApoE4 enhances Aβ inhibition of insulin-stimulated AMPA receptor function, which accelerates memory impairment in ApoE4xAPP mice. PMID:27189808

  12. Input- and subunit-specific AMPA receptor trafficking underlying long-term potentiation at hippocampal CA3 synapses.

    PubMed

    Kakegawa, Wataru; Tsuzuki, Keisuke; Yoshida, Yukari; Kameyama, Kimihiko; Ozawa, Seiji

    2004-07-01

    Hippocampal CA3 pyramidal neurons receive synaptic inputs from both mossy fibres (MFs) and associational fibres (AFs). Long-term potentiation (LTP) at these synapses differs in its induction sites and N-methyl-D-aspartate receptor (NMDAR) dependence. Most evidence favours the presynaptic and postsynaptic mechanisms for induction of MF LTP and AF LTP, respectively. This implies that molecular and functional properties differ between MF and AF synapses at both presynaptic and postsynaptic sites. In this study, we focused on the difference in the postsynaptic trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) between these synapses. To trace the subunit-specific trafficking of AMPARs at each synapse, GluR1 and GluR2 subunits were introduced into CA3 pyramidal neurons in hippocampal organotypic cultures using the Sindbis viral expression system. The electrophysiologically-tagged GluR2 AMPARs, produced by the viral-mediated transfer of the unedited form of GluR2 (GluR2Q), were inserted into both MF and AF postsynaptic sites in a neuronal activity-independent manner. Endogenous Ca(2+)-impermeable AMPARs at these synapses were replaced with exogenous Ca(2+)-permeable receptors, and Ca(2+) influx via the newly expressed postsynaptic AMPARs induced NMDAR-independent LTP at AF synapses. In contrast, no GluR1 AMPAR produced by the gene transfer was constitutively incorporated into AF postsynaptic sites, and only a small amount into MF postsynaptic sites. The synaptic trafficking of GluR1 AMPARs was triggered by the activity of Ca(2+)/calmodulin-dependent kinase II or high-frequency stimulation to induce LTP at AF synapses, but not at MF synapses. These results indicate that MF and AF postsynaptic sites possess distinct properties for AMPAR trafficking in CA3 pyramidal neurons.

  13. Isoflurane unveils a critical role of glutamate transporter type 3 in regulating hippocampal GluR1 trafficking and context-related learning and memory in mice.

    PubMed

    Cao, J; Wang, Z; Mi, W; Zuo, Z

    2014-07-11

    Glutamate transporter type 3 (EAAT3) may play a role in cognition. Isoflurane enhances EAAT3 trafficking to the plasma membrane. Thus, we used isoflurane to determine how EAAT3 might regulate learning and memory and the trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, such as GluR1, to the plasma membrane, a fundamental biochemical process for learning and memory. Here, isoflurane increased EAAT3 but did not change GluR1 levels in the plasma membrane of wild-type mouse hippocampus. Isoflurane increased protein phosphatase activity in the wild-type and EAAT3(-/-) mouse hippocampus. Also, isoflurane reduced GluR1 in the plasma membrane and decreased phospho-GluR1 in EAAT3(-/-) mice. The phosphatase inhibitor okadaic acid attenuated these effects. Finally, isoflurane inhibited context-related fear conditioning in EAAT3(-/-) mice but not in wild-type mice. Thus, isoflurane may increase GluR1 trafficking to the plasma membrane via EAAT3 and inhibit GluR1 trafficking via protein phosphatase. Lack of EAAT3 effects leads to decreased GluR1 trafficking and impaired cognition after isoflurane exposure in EAAT3(-/-) mice. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  14. A Single Brief Burst Induces GluR1-Dependent Associative Short-Term Potentiation: A Potential Mechanism for Short-Term Memory

    ERIC Educational Resources Information Center

    Erickson, Martha A.; Maramara, Lauren A.; Lisman, John

    2010-01-01

    Recent work showed that short-term memory (STM) is selectively reduced in GluR1 knockout mice. This raises the possibility that a form of synaptic modification dependent on GluR1 might underlie STM. Studies of synaptic plasticity have shown that stimuli too weak to induce long-term potentiation induce short-term potentiation (STP), a phenomenon…

  15. The AMPA receptor subunit GluR1 regulates dendritic architecture of motor neurons

    NASA Technical Reports Server (NTRS)

    Inglis, Fiona M.; Crockett, Richard; Korada, Sailaja; Abraham, Wickliffe C.; Hollmann, Michael; Kalb, Robert G.

    2002-01-01

    The morphology of the mature motor neuron dendritic arbor is determined by activity-dependent processes occurring during a critical period in early postnatal life. The abundance of the AMPA receptor subunit GluR1 in motor neurons is very high during this period and subsequently falls to a negligible level. To test the role of GluR1 in dendrite morphogenesis, we reintroduced GluR1 into rat motor neurons at the end of the critical period and quantitatively studied the effects on dendrite architecture. Two versions of GluR1 were studied that differed by the amino acid in the "Q/R" editing site. The amino acid occupying this site determines single-channel conductance, ionic permeability, and other essential electrophysiologic properties of the resulting receptor channels. We found large-scale remodeling of dendritic architectures in a manner depending on the amino acid occupying the Q/R editing site. Alterations in the distribution of dendritic arbor were not prevented by blocking NMDA receptors. These observations suggest that the expression of GluR1 in motor neurons modulates a component of the molecular substrate of activity-dependent dendrite morphogenesis. The control of these events relies on subunit-specific properties of AMPA receptors.

  16. Endocytosis and recycling of AMPA receptors lacking GluR2/3.

    PubMed

    Biou, Virginie; Bhattacharyya, Samarjit; Malenka, Robert C

    2008-01-22

    Excitatory synapses in the mammalian brain contain two types of ligand-gated ion channels: AMPA receptors (AMPARs) and NMDA receptors (NMDARs). AMPARs are responsible for generating excitatory synaptic responses, whereas NMDAR activation triggers long-lasting changes in these responses by modulating the trafficking of AMPARs toward and away from synapses. AMPARs are tetramers composed of four subunits (GluR1-GluR4), which current models suggest govern distinct AMPAR trafficking behavior during synaptic plasticity. Here, we address the roles of GluR2 and GluR3 in controlling the recycling- and activity-dependent endocytosis of AMPARs by using cultured hippocampal neurons prepared from knockout (KO) mice lacking these subunits. We find that synapses and dendritic spines form normally in cells lacking GluR2/3 and that upon NMDAR activation, GluR2/3-lacking AMPARs are endocytosed in a manner indistinguishable from GluR2-containing AMPARs in wild-type (WT) neurons. AMPARs lacking GluR2/3 also recycle to the plasma membrane identically to WT AMPARs. However, because of their permeability to calcium, GluR2-lacking but not WT AMPARs exhibited robust internalization throughout the dendritic tree in response to AMPA application. Dendritic endocytosis of AMPARs also was observed in GABAergic neurons, which express a high proportion of GluR2-lacking AMPARs. These results demonstrate that GluR2 and GluR3 are not required for activity-dependent endocytosis of AMPARs and suggest that the most important property of GluR2 in the context of AMPAR trafficking may be its influence on calcium permeability.

  17. A desensitization-selective potentiator of AMPA-type glutamate receptors

    PubMed Central

    Sekiguchi, Masayuki; Nishikawa, Kaori; Aoki, Shunsuke; Wada, Keiji

    2002-01-01

    We examined the effects of PEPA, an allosteric potentiator of AMPA receptors, on AMPA receptor kinetics. PEPA did not affect the deactivation of glutamate responses but potently attenuated the extent of receptor desensitization without slowing the onset of desensitization in most of the recombinant AMPA receptors (GluR1-flip, GluR1-flop, GluR3-flip, GluR3-flip + GluR2-flip, and GluR3-flop + GluR2-flop) expressed in Xenopus oocytes. For the GluR3-flop subunit, PEPA attenuated the extent of desensitization and only weakly prolonged deactivation (1.3 fold). PEPA did not significantly affect recovery from desensitization in oocytes expressing GluR3-flip, GluR1-flop, and GluR1-flop, but weakly accelerated (2.6 fold) recovery from desensitization in oocytes expressing GluR3-flop. PEPA's effect on desensitization of GluR3-flop-containing receptors is unique in that onset is very slow. Simulation studies using simplified kinetic models for AMPA receptors are utilized to explore the differential effects of PEPA on GluR3-flip and -flop. It is possible to simulate the action on GluR3-flip by modulating two rate constants in a 12-state kinetic model. For simulation of the action on GluR3-flop, the 12-state kinetic model is not enough, and it is necessary to invoke a 13th state, a PEPA-bound receptor to which glutamate cannot bind. These results suggest that attenuation of extent of desensitization represents the principal mechanism underlying the potentiation of AMPA receptors by PEPA, and that PEPA exhibits different mechanisms with respect to GluR3-flip and GluR3-flop. PMID:12145103

  18. Chronic renal failure induces cell death in rat hippocampal CA1 via upregulation of αCaMKII/NR2A synaptic complex and phosphorylated GluR1-containing AMPA receptor cascades.

    PubMed

    Kim, Jong Wan; Ha, Gyoung Yim; Jung, Yong Wook

    2014-09-01

    N-methyl-D-aspartate (NMDA) and alpha-amino-3-hydroxy-5-methylisoxazole-4-propinoic acid (AMPA) receptors bound to postsynaptic density-95 (PSD-95) and α isoform of calcium/calmodulin-dependent protein kinase II (αCaMKII) is fundamentally involved in the regulation of working memory. The aim of present study was to investigate the alterations of NMDA and AMPA receptors responsible for hippocampal synaptic dysfunction and selective neuronal cell death after chronic renal failure (CRF) which may be associated with impairment of working memory. Altered interactions between NMDA and AMPA receptors and PSD-95 and αCaMKII were analyzed in the cornu ammonis (CA) 1 and CA3/dentate gyrus (DG) subfields of the uremic rat hippocampi using the immunoblotting and immunoprecipitation methods. Uremia induced by CRF produced necrotic cell death and decreased neuronal nucleoli protein levels in the hippocampal CA1 subfield, but not in the CA3/DG subfields. The CA1 subfields of CRF rats exhibited significant decreases and increases, respectively, in the expressions of PSD-95/NR2B and αCaMKII/NR2A synaptic complex. Moreover, increased phosphorylation of glutamate receptor type 1 (GluR1) AMPA receptor at ser831 was observed in the CA1 subfield after CRF. These hippocampal CA1 neuronal vulnerability may be responsible for memory dysfunction after CRF as mediated by an increase in NR2A-containing NMDA receptors bound to αCaMKII and subsequent activation of GluR1-containing AMPA receptors caused by the phosphorylation of GluR1 at ser831.

  19. Glutamate receptor antibodies directed against AMPA receptors subunit 3 peptide B (GluR3B) can be produced in DBA/2J mice, lower seizure threshold and induce abnormal behavior.

    PubMed

    Ganor, Yonatan; Goldberg-Stern, Hadassa; Cohen, Ran; Teichberg, Vivian; Levite, Mia

    2014-04-01

    Anti-GluR3B antibodies (GluR3B Ab's), directed against peptide B/aa372-395 of GluR3 subunit of glutamate/AMPA receptors, are found in ∼35% of epilepsy patients, activate glutamate/AMPA receptors, evoke ion currents, kill neurons and damage the brain. We recently found that GluR3B Ab's also associate with neurological/psychiatric/behavioral abnormalities in epilepsy patients. Here we asked if GluR3B Ab's could be produced in DBA/2J mice, and also modulate seizure threshold and/or cause behavioral/motor impairments in these mice. DBA/2J mice were immunized with the GluR3B peptide in Complete Freund's Adjuvant (CFA), or with controls: ovalbumin (OVA), CFA, or phosphate-buffer saline (PBS). GluR3B Ab's and OVA Ab's were tested. Seizures were induced in all mice by the chemoconvulsant pentylenetetrazole (PTZ) at three time points, each time with less PTZ to avoid non-specific death. Behavior was examined in Open-Field, RotaRod and Grip tests. GluR3B Ab's were produced only in GluR3B-immunized mice, while OVA Ab's were produced only in OVA-immunized mice, showing high Ab's specificity. In GluR3B Ab's negative mice, seizure severity scores and percentages of animals developing generalized seizures declined in response to decreasing PTZ doses. In contrast, both parameters remained unchanged/high in the GluR3B Ab's positive mice, showing that these mice were more susceptible to seizures. The seizure scores associated significantly with the GluR3B Ab's levels. GluR3B Ab's positive mice were also more anxious in Open-Field test, fell faster in RotaRod test, and fell more in Grip test, compared to all the control mice. GluR3B Ab's are produced in DBA/2J mice, facilitate seizures and induce behavioral/motor impairments. This animal model can therefore serve for studying autoimmune epilepsy and abnormal behavior mediated by pathogenic anti-GluR3B Ab's. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Opiate withdrawal induces dynamic expressions of AMPA receptors and its regulatory molecule CaMKIIalpha in hippocampal synapses.

    PubMed

    Zhong, Weixia; Dong, Zhifang; Tian, Meng; Cao, Jun; Xu, Tianle; Xu, Lin; Luo, Jianhong

    2006-07-24

    Adaptive changes in brain areas following drug withdrawal are believed to contribute to drug seeking and relapse. Cocaine withdrawal alters the expression of GluR1 and GluR2/3 subunits of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors in nucleus accumbens or amygdala, but the influence of drug withdrawal on hippocampus is little known. Here, we have examined the expression of GluR1 and GluR2/3 in hippocampal membrane and synaptic fractions following repeated morphine exposure and subsequent withdrawal. Repeated morphine exposure for 12 d increased GluR1 and GluR2/3 in synaptosome but not in membrane fraction. Interestingly, CaMKIIalpha, known to be able to regulate the function of AMPA receptors, was decreased in synaptosome but not in membrane fraction; pCaMKIIalpha, the phosphorylated form of CaMKIIalpha, was increased in both fractions. However, during opiate withdrawal, GluR1 was generally reduced while GluR2/3 was prominently increased in both fractions; pCaMKIIalpha was strongly decreased immediately after withdrawal, but detectably increased in late phase of morphine withdrawal in both fractions. Importantly, the opiate withdrawal-induced increase in GluR2/3 was dependent on the activation of glucocorticoid receptors and NMDA receptors, as it was prevented by the glucocorticoid receptor antagonist RU38486, or intrahippocampal injection of the NMDA receptor antagonist AP-5 or the antagonist to NR2B-containing NMDA receptors, Ro25-6981. These findings indicate that opiate withdrawal induces dynamic expression of GluR1 and GluR2/3 subunits of AMPA receptors in hippocampal synapses, possibly revealing an adaptive process of the hippocampal functions following opiate withdrawal.

  1. Regulation of cellular plasticity and resilience by mood stabilizers: the role of AMPA receptor trafficking

    PubMed Central

    Du, Jing; Quiroz, Jorge A.; Gray, Neil A.; Szabo, Steve T.; Zarate Jr, Carlos A.; Manji, Husseini K.

    2004-01-01

    There is increasing evidence from a variety of sources that severe mood disorders are associated with regional reductions in brain volume, as well as reductions in the number, size, and density of glia and neurons in discrete brain areas. Although the precise pathophysiology underlying these morphometric changes remains to be fully elucidated, the data suggest that severe mood disorders are associated with impairments of structural plasticity and cellular resilience. In this context, it is noteworthy that a growing body of data suggests that the glutamaiergic system (which is known to play a major role in neuronal plasticity and cellular resilience) may be involved in the pathophysiology and treatment of mood disorders. Glutamate α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) GluR1 receptor trafficking plays a critical role in regulating various forms of neural plasticity. It is thus noteworthy that recent studies have shown that structurally dissimilar mood stabilizers lithium and valproate regulate GluR1 receptor subunit trafficking and localization at synapses. These studies suggest that regulation of glutamatergically mediated synaptic plasticity may play a role in the treatment of mood disorders, and raises the possibility that agents more directly affecting synaptic GluR1 represent novel therapies for these devastating illnesses. PMID:22034247

  2. NAc Shell Arc/Arg3.1 Protein Mediates Reconsolidation of Morphine CPP by Increased GluR1 Cell Surface Expression: Activation of ERK-Coupled CREB is Required

    PubMed Central

    Lv, Xiu-Fang; Sun, Lin-Lin; Han, Ji-Sheng

    2015-01-01

    Background: Relapse into drug abuse evoked by reexposure to the drug-associated context has been a primary problem in the treatment of drug addiction. Disrupting the reconsolidation of drug-related context memory would therefore limit the relapse susceptibility. Methods: Morphine conditioned place preference (CPP) was used to assess activity-regulated cytoskeleton-associated protein (Arc/Arg3.1) and correlative molecule expression in the Nucleus accumbens (NAc) shell during the reconsolidation of morphine CPP. U0126 and Arc/Arg3.1 antisense oligodeoxynucleotide were adapted to evaluate the role and the underlying mechanism of Arc/Arg3.1 during the reconsolidation. Results: The retrieval of morphine CPP in rats specifically increased the Arc/Arg3.1 protein level in the NAc shell, accompanied simultaneously by increases in the phosphorylation of extracellular signal-regulated kinase1/2 (pERK1/2), the phosphorylation of Cyclic Adenosine monophosphate (cAMP) response element-binding (pCREB), and the up-regulation of the membrane α-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors GluR1 subunit level. Intra-NAc shell infusion U0126, an inhibitor of the Mitogen-activated protein kinase kinase (MEK), prevented the retrieval-induced up-regulation of pERK1/2, pCREB, Arc/Arg3.1, and membrane GluR1 immediately after retrieval of morphine CPP. The effect of disrupting the reconsolidation of morphine CPP by U0126 could last for at least 14 days, and could not be evoked by a priming injection of morphine. Furthermore, the specific knockdown of Arc/Arg3.1 in the NAc shell decreased the membrane GluR1 level, and impaired both the reconsolidation and the reinstatement of morphine CPP. Conclusions: Arc/Arg3.1 in the NAc shell mediates the reconsolidation of morphine-associated context memory via up-regulating the level of membrane of GluR1, for which the local activation of the ERK-CREB signal pathway, as an upstream mechanism of Arc/Arg3.1, is required. PMID:25746394

  3. Ethanol up-regulates nucleus accumbens neuronal activity dependent pentraxin (Narp): implications for alcohol-induced behavioral plasticity.

    PubMed

    Ary, Alexis W; Cozzoli, Debra K; Finn, Deborah A; Crabbe, John C; Dehoff, Marlin H; Worley, Paul F; Szumlinski, Karen K

    2012-06-01

    Neuronal activity dependent pentraxin (Narp) interacts with α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) glutamate receptors to facilitate excitatory synapse formation by aggregating them at established synapses. Alcohol is well-characterized to influence central glutamatergic transmission, including AMPA receptor function. Herein, we examined the influence of injected and ingested alcohol upon Narp protein expression, as well as basal Narp expression in mouse lines selectively bred for high blood alcohol concentrations under limited access conditions. Alcohol up-regulated accumbens Narp levels, concomitant with increases in levels of the GluR1 AMPA receptor subunit. However, accumbens Narp or GluR1 levels did not vary as a function of selectively bred genotype. We next employed a Narp knock-out (KO) strategy to begin to understand the behavioral relevance of alcohol-induced changes in protein expression in several assays of alcohol reward. Compared to wild-type mice, Narp KO animals: fail to escalate daily intake of high alcohol concentrations under free-access conditions; shift their preference away from high alcohol concentrations with repeated alcohol experience; exhibit a conditioned place-aversion in response to the repeated pairing of 3 g/kg alcohol with a distinct environment and fail to exhibit alcohol-induced locomotor hyperactivity following repeated alcohol treatment. Narp deletion did not influence the daily intake of either food or water, nor did it alter any aspect of spontaneous or alcohol-induced motor activity, including the development of tolerance to its motor-impairing effects with repeated treatment. Taken together, these data indicate that Narp induction, and presumably subsequent aggregation of AMPA receptors, may be important for neuroplasticity within limbic subcircuits mediating or maintaining the rewarding properties of alcohol. Published by Elsevier Inc.

  4. Ethanol up-regulates nucleus accumbens neuronal activity dependent pentraxin (Narp): implications for alcohol-induced behavioral plasticity

    PubMed Central

    Ary, Alexis W.; Cozzoli, Debra K.; Finn, Deborah A.; Crabbe, John C.; Dehoff, Marlin H.; Worley, Paul F.; Szumlinski, Karen K.

    2012-01-01

    Neuronal activity-dependent pentraxin (Narp) interacts with α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) glutamate receptors to facilitate excitatory synapse formation by aggregating them at established synapses. Alcohol is well-characterized to influence central glutamatergic transmission, including AMPA receptor function. Herein, we examined the influence of injected and ingested alcohol upon Narp protein expression, as well as basal Narp expression in mouse lines selectively bred for high blood alcohol concentrations under limited access conditions. Alcohol up-regulated accumbens Narp levels, concomitant with increases in levels of the GluR1 AMPA receptor subunit. However, accumbens Narp or GluR1 levels did not vary as a function of selectively bred genotype. We next employed a Narp knock-out (KO) strategy to begin to understand the behavioral relevance of alcohol-induced changes in protein expression in several assays of alcohol reward. Compared to wild-type mice, Narp KO animals: fail to escalate daily intake of high alcohol concentrations under free-access conditions; shift their preference away from high alcohol concentrations with repeated alcohol experience; exhibit a conditioned place-aversion in response to the repeated pairing of 3 g/kg alcohol with a distinct environment and fail to exhibit alcohol-induced locomotor hyperactivity following repeated alcohol treatment. Narp deletion did not influence the daily intake of either food or water, nor did it alter any aspect of spontaneous or alcohol-induced motor activity, including the development of tolerance to its motor-impairing effects with repeated treatment. Taken together, these data indicate that Narp induction, and presumably subsequent aggregation of AMPA receptors, may be important for neuroplasticity within limbic subcircuits mediating or maintaining the rewarding properties of alcohol. PMID:22444953

  5. Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

    PubMed Central

    Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

    2013-01-01

    A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

  6. Drosophila fragile X mental retardation protein and metabotropic glutamate receptor A convergently regulate the synaptic ratio of ionotropic glutamate receptor subclasses.

    PubMed

    Pan, Luyuan; Broadie, Kendal S

    2007-11-07

    A current hypothesis proposes that fragile X mental retardation protein (FMRP), an RNA-binding translational regulator, acts downstream of glutamatergic transmission, via metabotropic glutamate receptor (mGluR) G(q)-dependent signaling, to modulate protein synthesis critical for trafficking ionotropic glutamate receptors (iGluRs) at synapses. However, direct evidence linking FMRP and mGluR function with iGluR synaptic expression is limited. In this study, we use the Drosophila fragile X model to test this hypothesis at the well characterized glutamatergic neuromuscular junction (NMJ). Two iGluR classes reside at this synapse, each containing common GluRIIC (III), IID and IIE subunits, and variable GluRIIA (A-class) or GluRIIB (B-class) subunits. In Drosophila fragile X mental retardation 1 (dfmr1) null mutants, A-class GluRs accumulate and B-class GluRs are lost, whereas total GluR levels do not change, resulting in a striking change in GluR subclass ratio at individual synapses. The sole Drosophila mGluR, DmGluRA, is also expressed at the NMJ. In dmGluRA null mutants, both iGluR classes increase, resulting in an increase in total synaptic GluR content at individual synapses. Targeted postsynaptic dmGluRA overexpression causes the exact opposite GluR phenotype to the dfmr1 null, confirming postsynaptic GluR subtype-specific regulation. In dfmr1; dmGluRA double null mutants, there is an additive increase in A-class GluRs, and a similar additive impact on B-class GluRs, toward normal levels in the double mutants. These results show that both dFMRP and DmGluRA differentially regulate the abundance of different GluR subclasses in a convergent mechanism within individual postsynaptic domains.

  7. Characterization and reversal of synaptic defects in the amygdala in a mouse model of fragile X syndrome.

    PubMed

    Suvrathan, Aparna; Hoeffer, Charles A; Wong, Helen; Klann, Eric; Chattarji, Sumantra

    2010-06-22

    Fragile X syndrome (FXS), a common inherited form of mental impairment and autism, is caused by transcriptional silencing of the fragile X mental retardation 1 (FMR1) gene. Earlier studies have identified a role for aberrant synaptic plasticity mediated by the metabotropic glutamate receptors (mGluRs) in FXS. However, many of these observations are derived primarily from studies in the hippocampus. The strong emotional symptoms of FXS, on the other hand, are likely to involve the amygdala. Unfortunately, little is known about how exactly FXS affects synaptic function in the amygdala. Here, using whole-cell recordings in brain slices from adult Fmr1 knockout mice, we find mGluR-dependent long-term potentiation to be impaired at thalamic inputs to principal neurons in the lateral amygdala. Consistent with this long-term potentiation deficit, surface expression of the AMPA receptor subunit, GluR1, is reduced in the lateral amygdala of knockout mice. In addition to these postsynaptic deficits, lower presynaptic release was manifested by a decrease in the frequency of spontaneous miniature excitatory postsynaptic currents (mEPSCs), increased paired-pulse ratio, and slower use-dependent block of NMDA receptor currents. Strikingly, pharmacological inactivation of mGluR5 with 2-methyl-6-phenylethynyl-pyridine (MPEP) fails to rescue either the deficit in long-term potentiation or surface GluR1. However, the same acute MPEP treatment reverses the decrease in mEPSC frequency, a finding of potential therapeutic relevance. Therefore, our results suggest that synaptic defects in the amygdala of knockout mice are still amenable to pharmacological interventions against mGluR5, albeit in a manner not envisioned in the original hippocampal framework.

  8. AMPA receptors mediate passive avoidance deficits induced by sleep deprivation.

    PubMed

    Dubiela, Francisco Paulino; Queiroz, Claudio Marcos; Moreira, Karin Di Monteiro; Nobrega, Jose N; Sita, Luciane Valéria; Tufik, Sergio; Hipolide, Debora Cristina

    2013-11-15

    The present study addressed the effects of sleep deprivation (SD) on AMPA receptor (AMPAR) binding in brain regions associated with learning and memory, and investigated whether treatment with drugs acting on AMPAR could prevent passive avoidance deficits in sleep deprived animals. [(3)H]AMPA binding and GluR1 in situ hybridization signals were quantified in different brain regions of male Wistar rats either immediately after 96 h of sleep deprivation or after 24h of sleep recovery following 96 h of sleep deprivation. Another group of animals were sleep deprived and then treated with either the AMPAR potentiator, aniracetam (25, 50 and 100mg/kg, acute administration) or the AMPAR antagonist GYKI-52466 (5 and 10mg/kg, acute and chronic administration) before passive avoidance training. Task performance was evaluated 2h and 24h after training. A significant reduction in [(3)H]AMPA binding was found in the hippocampal formation of SD animals, while no alterations were observed in GluR1 mRNA levels. The highest dose of aniracetam (100mg/kg) reverted SD-induced impairment of passive avoidance performance in both retention tests, whereas GYKI-52466 treatment had no effect. Pharmacological enhancement of AMPAR function may revert hippocampal-dependent learning impairments produced after SD. We argue that such effects might be associated with reduced AMPAR binding in the hippocampus of sleep deprived animals. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Subunit-specific rules governing AMPA receptor trafficking to synapses in hippocampal pyramidal neurons.

    PubMed

    Shi, S; Hayashi, Y; Esteban, J A; Malinow, R

    2001-05-04

    AMPA-type glutamate receptors (AMPA-Rs) mediate a majority of excitatory synaptic transmission in the brain. In hippocampus, most AMPA-Rs are hetero-oligomers composed of GluR1/GluR2 or GluR2/GluR3 subunits. Here we show that these AMPA-R forms display different synaptic delivery mechanisms. GluR1/GluR2 receptors are added to synapses during plasticity; this requires interactions between GluR1 and group I PDZ domain proteins. In contrast, GluR2/GluR3 receptors replace existing synaptic receptors continuously; this occurs only at synapses that already have AMPA-Rs and requires interactions by GluR2 with NSF and group II PDZ domain proteins. The combination of regulated addition and continuous replacement of synaptic receptors can stabilize long-term changes in synaptic efficacy and may serve as a general model for how surface receptor number is established and maintained.

  10. Gating characteristics control glutamate receptor distribution and trafficking in vivo.

    PubMed

    Petzoldt, Astrid G; Lee, Yü-Hien; Khorramshahi, Omid; Reynolds, Eric; Plested, Andrew J R; Herzel, Hanspeter; Sigrist, Stephan J

    2014-09-08

    Glutamate-releasing synapses dominate excitatory release in the brain. Mechanisms governing their assembly are of major importance for circuit development and long-term plasticity underlying learning and memory. AMPA/Kainate-type glutamate receptors (GluRs) are tetrameric ligand-gated ion channels that open their ion-conducting pores in response to binding of the neurotransmitter. Changes in subunit composition of postsynaptic GluRs are highly relevant for plasticity and development of glutamatergic synapses [1-4]. To date, posttranslational modifications, mostly operating via the intracellular C-terminal domains (CTDs) of GluRs, are presumed to be the major regulator of trafficking [5]. In recent years, structural and electrophysiological analyses have improved our understanding of GluR gating mechanism [6-11]. However, whether conformational changes subsequent to glutamate binding may per se be able to influence GluR trafficking has remained an unaddressed question. Using a Drosophila system allowing for extended visualization of GluR trafficking in vivo, we here provide evidence that mutations changing the gating behavior alter GluR distribution and trafficking. GluR mutants associated with reduced charge transfer segregated from coexpressed wild-type GluRs on the level of individual postsynaptic densities. Segregation was lost upon blocking of evoked glutamate release. Photobleaching experiments suggested increased mobility of mutants with reduced charge transfer, which accumulated prematurely during early steps of synapse assembly, but failed to further increase their level in accordance with assembly of the presynaptic scaffold. In summary, gating characteristics seem to be a new variable for the understanding of GluR trafficking relevant to both development and plasticity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Straight-chain alcohols exhibit a cutoff in potency for the inhibition of recombinant glutamate receptor subunits

    PubMed Central

    Akinshola, B Emmanuel

    2001-01-01

    The effects of n-alcohols (methanol to 1-decanol) on kainate-activated AMPA receptor subunit GluR1 and GluR3 ion currents were studied in Xenopus oocytes using the two-electrode voltage-clamp recording technique. For short-chain alcohols from methanol to 1-hexanol, potency for inhibition of GluR1 and GluR3 receptor-mediated current increased in proportion to the chain length or hydrophobicity of the alcohol. The IC50 values of these alcohols for GluR1 were: methanol, 702 mM; ethanol, 170 mM; 1-propanol, 69 mM; 1-butanol, 20 mM; 1-pentanol, 17 mM; and 1-hexanol, 10 mM. For GluR3, IC50 values were: methanol, 712 mM; ethanol, 238 mM; 1-propanol, 50 mM; 1-butanol, 32 mM; 1-pentanol, 13 mM; and 1-hexanol, 7 mM. For long-chain alcohols, 1-heptanol was less potent than 1-hexanol (estimated IC50: 19 mM for GluR1 and 18 mM for GluR3), 1-octanol had little effect only on GluR3, and 1-nonanol and 1-decanol did not significantly inhibit both GluR1 and GluR3 responses. The observations indicate that straight-chain n-alcohols exhibit a cutoff in their potency for inhibition of the function of non-NMDA glutamate receptor subunits, GluR1 and GluR3. The cutoff in potency of n-alcohols for inhibition of non-NMDA glutamate receptor function is consistent with the interpretation that alcohols affect the function of these receptor-channels by interacting with an alcohol binding site of specific dimensions on the receptor protein. PMID:11429388

  12. Bacopa monnieri ameliorates memory deficits in olfactory bulbectomized mice: possible involvement of glutamatergic and cholinergic systems.

    PubMed

    Le, Xoan Thi; Pham, Hang Thi Nguyet; Do, Phuong Thi; Fujiwara, Hironori; Tanaka, Ken; Li, Feng; Van Nguyen, Tai; Nguyen, Khoi Minh; Matsumoto, Kinzo

    2013-10-01

    This study investigated the effects of alcoholic extract of Bacopa monnieri (L.) Wettst. (BM) on cognitive deficits using olfactory bulbectomized (OBX) mice and the underlying molecular mechanisms of its action. OBX mice were treated daily with BM (50 mg/kg, p.o.) or a reference drug, tacrine (2.5 mg/kg, i.p.), 1 week before and continuously 3 days after OBX. Cognitive performance of the animals was analyzed by the novel object recognition test, modified Y maze test, and fear conditioning test. Brain tissues of OBX animals were used for neurochemical and immunohistochemical studies. OBX impaired non-spatial short-term memory, spatial working memory, and long-term fair memory. BM administration ameliorated these memory disturbances. The effect of BM on short-term memory deficits was abolished by a muscarinic receptor antagonist, scopolamine. OBX downregulated phosphorylation of synaptic plasticity-related signaling proteins: NR1 subunit of N-methyl-D-aspartate receptor, glutamate receptor 1 (GluR1), and calmodulin-dependent kinase II but not cyclic AMP-responsive element binding protein (CREB), and reduced brain-derived neurotrophic factor (BDNF) mRNA in the hippocampus. OBX also reduced choline acetyltransferase in the hippocampus and cholinergic neurons in the medial septum, and enlarged the size of lateral ventricle. BM administration reversed these OBX-induced neurochemical and histological alterations, except the decrease of GluR1 phosphorylation, and enhanced CREB phosphorylation. Moreover, BM treatment inhibited ex vivo activity of acetylcholinesterase in the brain. These results indicate that BM treatment ameliorates OBX-induced cognition dysfunction via a mechanism involving enhancement of synaptic plasticity-related signaling and BDNF transcription and protection of cholinergic systems from OBX-induced neuronal damage.

  13. AMPK Signaling in the Dorsal Hippocampus Negatively Regulates Contextual Fear Memory Formation

    PubMed Central

    Han, Ying; Luo, Yixiao; Sun, Jia; Ding, Zengbo; Liu, Jianfeng; Yan, Wei; Jian, Min; Xue, Yanxue; Shi, Jie; Wang, Ji-Shi; Lu, Lin

    2016-01-01

    Both the formation of long-term memory (LTM) and dendritic spine growth that serves as a physical basis for the long-term storage of information require de novo protein synthesis. Memory formation also critically depends on transcription. Adenosine monophosphate-activated protein kinase (AMPK) is a transcriptional regulator that has emerged as a major energy sensor that maintains cellular energy homeostasis. However, still unknown is its role in memory formation. In the present study, we found that AMPK is primarily expressed in neurons in the hippocampus, and then we demonstrated a time-dependent decrease in AMPK activity and increase in mammalian target of rapamycin complex 1 (mTORC1) activity after contextual fear conditioning in the CA1 but not CA3 area of the dorsal hippocampus. Using pharmacological methods and adenovirus gene transfer to bidirectionally regulate AMPK activity, we found that increasing AMPK activity in the CA1 impaired the formation of long-term fear memory, and decreasing AMPK activity enhanced fear memory formation. These findings were associated with changes in the phosphorylation of AMPK and p70s6 kinase (p70s6k) and expression of BDNF and membrane GluR1 and GluR2 in the CA1. Furthermore, the prior administration of an mTORC1 inhibitor blocked the enhancing effect of AMPK inhibition on fear memory formation, suggesting that this negative regulation of contextual fear memory by AMPK in the CA1 depends on the mTORC1 signaling pathway. Finally, we found that AMPK activity regulated hippocampal spine growth associated with memory formation. In summary, our results indicate that AMPK is a key negative regulator of plasticity and fear memory formation. PMID:26647974

  14. Type II and III Taste Bud Cells Preferentially Expressed Kainate Glutamate Receptors in Rats.

    PubMed

    Lee, Sang-Bok; Lee, Cil-Han; Kim, Se-Nyun; Chung, Ki-Myung; Cho, Young-Kyung; Kim, Kyung-Nyun

    2009-12-01

    Glutamate-induced cobalt uptake reveals that non-NMDA glutamate receptors (GluRs) are present in rat taste bud cells. Previous studies involving glutamate induced cobalt staining suggest this uptake mainly occurs via kainate type GluRs. It is not known which of the 4 types of taste bud cells express subunits of kainate GluR. Circumvallate and foliate papillae of Sprague-Dawley rats (45~60 days old) were used to search for the mRNAs of subunits of non-NMDA GluRs using RT-PCR with specific primers for GluR1-7, KA1 and KA2. We also performed RT-PCR for GluR5, KA1, PLCbeta2, and NCAM/SNAP 25 in isolated single cells from taste buds. Taste epithelium, including circumvallate or foliate papilla, express mRNAs of GluR5 and KA1. However, non-taste tongue epithelium expresses no subunits of non-NMDA GluRs. Isolated single cell RT-PCR reveals that the mRNAs of GluR5 and KA1 are preferentially expressed in Type II and Type III cells over Type I cells.

  15. A Critical Role for Protein Degradation in the Nucleus Accumbens Core in Cocaine Reward Memory

    PubMed Central

    Ren, Zhen-Yu; Liu, Meng-Meng; Xue, Yan-Xue; Ding, Zeng-Bo; Xue, Li-Fen; Zhai, Suo-Di; Lu, Lin

    2013-01-01

    The intense associative memories that develop between cocaine-paired contexts and rewarding stimuli contribute to cocaine seeking and relapse. Previous studies have shown impairment in cocaine reward memories by manipulating a labile state induced by memory retrieval, but the mechanisms that underlie the destabilization of cocaine reward memory are unknown. In this study, using a Pavlovian cocaine-induced conditioned place preference (CPP) procedure in rats, we tested the contribution of ubiquitin-proteasome system-dependent protein degradation in destabilization of cocaine reward memory. First, we found that polyubiquitinated protein expression levels and polyubiquitinated N-ethylmaleimide-sensitive fusion (NSF) markedly increased 15 min after retrieval while NSF protein levels decreased 1 h after retrieval in the synaptosomal membrane fraction in the nucleus accumbens (NAc) core. We then found that infusion of the proteasome inhibitor lactacystin into the NAc core prevented the impairment of memory reconsolidation induced by the protein synthesis inhibitor anisomycin and reversed the effects of anisomycin on NSF and glutamate receptor 2 (GluR2) protein levels in the synaptosomal membrane fraction in the NAc core. We also found that lactacystin infusion into the NAc core but not into the shell immediately after extinction training sessions inhibited CPP extinction and reversed the extinction training-induced decrease in NSF and GluR2 in the synaptosomal membrane fraction in the NAc core. Finally, infusions of lactacystin by itself into the NAc core immediately after each training session or before the CPP retrieval test had no effect on the consolidation and retrieval of cocaine reward memory. These findings suggest that ubiquitin-proteasome system-dependent protein degradation is critical for retrieval-induced memory destabilization. PMID:23303053

  16. Expression of messenger RNAs encoding ionotropic glutamate receptors in rat brain: regulation by haloperidol.

    PubMed

    Brené, S; Messer, C; Nestler, E J

    1998-06-01

    In situ hybridization was used to study the regional distribution of messenger RNAs encoding ionotropic glutamate receptor subtypes in the rat brain's dopaminergic cell body regions and their forebrain projection areas. Short oligonucleotide probes specific for the messenger RNAs encoding the flip or flop splice forms of the GluR1 and GluR2 AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate) receptor subunits, or for the messenger RNAs encoding the N-methyl-D-aspartate R1 subunit, were used. Significant differences were seen in the relative messenger RNA levels, and the distribution of the flip and flop splice forms, of GluR1 and GluR2. In the dopaminergic cell groups of the substantia nigra pars compacta and the ventral tegmental area, the flip form of both GluR1 and GluR2 dominated over the flop form. Similarly, in the core division of the nucleus accumbens, GluR1 and GluR2 flip forms dominated over the flop forms. In contrast, in the accumbens shell, the GluR1 and GluR2 flop forms dominated over the flip forms. As a comparison to the AMPA receptor subunits, N-methyl-D-aspartate R1 messenger RNA was relatively evenly distributed in all the regions analysed. The results demonstrate a heterogeneous distribution of the flip and flop splice forms of GluR1 and GluR2 in the brain's dopaminergic pathways, which could contribute to physiological differences in regulation of the pathways by glutamatergic neurotransmission. We also studied regulation of glutamate receptor subunit expression in these regions by antipsychotic drugs, based on previous reports of altered levels of subunit immunoreactivity after drug treatment. Chronic administration of the typical antipsychotic drug, haloperidol, caused a small but significant induction of GluR2 flip messenger RNA in the dorsolateral caudate putamen. This effect was not seen after chronic administration of the atypical antipsychotic drug, clozapine. Significant drug regulation of the other glutamate receptor subunits studied was not observed.

  17. Distribution of AMPA receptor subunits GluR1-4 in the dorsal vagal complex of the rat: a light and electron microscope immunocytochemical study.

    PubMed

    Kessler, J P; Baude, A

    1999-10-01

    The dorsal vagal complex, localized in the dorsomedial medulla, includes the nucleus tractus solitarii (NTS), the dorsal motor nucleus of the vagus nerve (DMN) and the area postrema (AP). The distribution of AMPA-preferring glutamate receptors (AMPA receptors) within this region was investigated using immunohistochemistry and antibodies recognizing either one (GluR1 or GluR4) or two (GluR2 and GluR3) AMPA receptors subunits. The distribution of GluR1 immunoreactivity showed high contrast of staining between strongly and lightly labeled areas. Labeling was intense in the AP and weak in the NTS, except for its medial and dorsalmost parts which exhibited moderate staining. Almost no GluR1 immunoreactivity was found in the DMN. GluR2/3 immunolabeling was present in the entire dorsal vagal complex. This labeling was strong in the AP, the DMN and the medial half of the NTS and moderate in the lateral half of the NTS, except for the interstitial subdivision which exhibited intense staining. Labeling induced by the GluR4 antibody was very weak throughout the dorsal vagal complex. Ultrastructural examination showed that GluR1 and GluR2/3 immunoreactivity was localized in neuronal cell bodies and dendrites. No labeled axon terminal or glial cell body was found. Immunoperoxidase staining in labeled cell bodies and dendrites was associated with intracellular organelles (microtubules, mitochondria, cisternae of the endoplasmic reticulum,.) and/or parts of the plasma membrane. Plasma membrane labeling was often associated with asymmetrical synaptic differentiations. No labeled symmetrical synapse was found using either GluR1 or GluR2/3 antibody. The present results show that AMPA receptors have a widespread distribution in neuronal perikarya and dendrites of the rat dorsal vagal complex. They suggest differences in subunit composition between AMPA receptors localized in the NTS, the DMN and the AP. Ultrastructural data are consistent with the fact that AMPA receptors associated with the plasma membrane are mostly synaptic receptors. However, they also suggest the existence of a large intracellular pool of receptor subunits in neuronal soma and dendrites. Copyright 1999 Wiley-Liss, Inc.

  18. Alterations in Hippocampal Oxidative Stress, Expression of AMPA Receptor GluR2 Subunit and Associated Spatial Memory Loss by Bacopa monnieri Extract (CDRI-08) in Streptozotocin-Induced Diabetes Mellitus Type 2 Mice.

    PubMed

    Pandey, Surya P; Singh, Hemant K; Prasad, S

    2015-01-01

    Bacopa monnieri extract has been implicated in the recovery of memory impairments due to various neurological disorders in animal models and humans. However, the precise molecular mechanism of the role of CDRI-08, a well characterized fraction of Bacopa monnieri extract, in recovery of the diabetes mellitus-induced memory impairments is not known. Here, we demonstrate that DM2 mice treated orally with lower dose of CDRI-08 (50- or 100 mg/kg BW) is able to significantly enhance spatial memory in STZ-DM2 mice and this is correlated with a significant decline in oxidative stress and up regulation of the AMPA receptor GluR2 subunit gene expression in the hippocampus. Treatment of DM2 mice with its higher dose (150 mg/kg BW or above) shows anti-diabetic effect in addition to its ability to recover the spatial memory impairment by reversing the DM2-induced elevated oxidative stress and decreased GluR2 subunit expression near to their values in normal and CDRI-08 treated control mice. Our results provide evidences towards molecular basis of the memory enhancing and anti diabetic role of the Bacopa monnieri extract in STZ-induced DM2 mice, which may have therapeutic implications.

  19. Alterations in Hippocampal Oxidative Stress, Expression of AMPA Receptor GluR2 Subunit and Associated Spatial Memory Loss by Bacopa monnieri Extract (CDRI-08) in Streptozotocin-Induced Diabetes Mellitus Type 2 Mice

    PubMed Central

    Pandey, Surya P.; Singh, Hemant K.; Prasad, S.

    2015-01-01

    Bacopa monnieri extract has been implicated in the recovery of memory impairments due to various neurological disorders in animal models and humans. However, the precise molecular mechanism of the role of CDRI-08, a well characterized fraction of Bacopa monnieri extract, in recovery of the diabetes mellitus-induced memory impairments is not known. Here, we demonstrate that DM2 mice treated orally with lower dose of CDRI-08 (50- or 100 mg/kg BW) is able to significantly enhance spatial memory in STZ-DM2 mice and this is correlated with a significant decline in oxidative stress and up regulation of the AMPA receptor GluR2 subunit gene expression in the hippocampus. Treatment of DM2 mice with its higher dose (150 mg/kg BW or above) shows anti-diabetic effect in addition to its ability to recover the spatial memory impairment by reversing the DM2-induced elevated oxidative stress and decreased GluR2 subunit expression near to their values in normal and CDRI-08 treated control mice. Our results provide evidences towards molecular basis of the memory enhancing and anti diabetic role of the Bacopa monnieri extract in STZ-induced DM2 mice, which may have therapeutic implications. PMID:26161865

  20. Membrane Localization is Critical for Activation of the PICK1 BAR Domain

    PubMed Central

    Madsen, Kenneth L.; Eriksen, Jacob; Milan-Lobo, Laura; Han, Daniel S.; Niv, Masha Y.; Ammendrup-Johnsen, Ina; Henriksen, Ulla; Bhatia, Vikram K.; Stamou, Dimitrios; Sitte, Harald H.; McMahon, Harvey T.; Weinstein, Harel; Gether, Ulrik

    2013-01-01

    The PSD-95/Discs-large/ZO-1 homology (PDZ) domain protein, protein interacting with C kinase 1 (PICK1) contains a C-terminal Bin/amphiphysin/Rvs (BAR) domain mediating recognition of curved membranes; however, the molecular mechanisms controlling the activity of this domain are poorly understood. In agreement with negative regulation of the BAR domain by the N-terminal PDZ domain, PICK1 distributed evenly in the cytoplasm, whereas truncation of the PDZ domain caused BAR domain-dependent redistribution to clusters colocalizing with markers of recycling endosomal compartments. A similar clustering was observed both upon truncation of a short putative α-helical segment in the linker between the PDZ and the BAR domains and upon coexpression of PICK1 with a transmembrane PDZ ligand, including the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor GluR2 subunit, the GluR2 C-terminus transferred to the single transmembrane protein Tac or the dopamine transporter C-terminus transferred to Tac. In contrast, transfer of the GluR2 C-terminus to cyan fluorescent protein, a cytosolic protein, did not elicit BAR domain-dependent clustering. Instead, localizing PICK1 to the membrane by introducing an N-terminal myristoylation site produced BAR domain-dependent, but ligand-independent, PICK1 clustering. The data support that in the absence of PDZ ligand, the PICK1 BAR domain is inhibited through a PDZ domain-dependent and linker-dependent mechanism. Moreover, they suggest that unmasking of the BAR domain’s membrane-binding capacity is not a consequence of ligand binding to the PDZ domain per se but results from, and coincides with, recruitment of PICK1 to a membrane compartment. PMID:18466293

  1. Reduced calcium/calmodulin-dependent protein kinase II activity in the hippocampus is associated with impaired cognitive function in MPTP-treated mice.

    PubMed

    Moriguchi, Shigeki; Yabuki, Yasushi; Fukunaga, Kohji

    2012-02-01

    Parkinson's disease (PD) patients frequently reveal deficit in cognitive functions during the early stage in PD. The dopaminergic neurotoxin, MPTP-induced neurodegeneration causes an injury of the basal ganglia and is associated with PD-like behaviors. In this study, we demonstrated that deficits in cognitive functions in MPTP-treated mice were associated with reduced calcium/calmodulin-dependent protein kinase II (CaMKII) autophosphorylation and impaired long-term potentiation (LTP) induction in the hippocampal CA1 region. Mice were injected once a day for 5days with MPTP (25mg/kg i.p.). The impaired motor coordination was observed 1 or 2week after MPTP treatment as assessed by rota-rod and beam-walking tasks. In immunoblotting analyses, the levels of tyrosine hydroxylase protein and CaMKII autophosphorylation in the striatum were significantly decreased 1week after MPTP treatment. By contrast, deficits of cognitive functions were observed 3-4weeks after MPTP treatment as assessed by novel object recognition and passive avoidance tasks but not Y-maze task. Impaired LTP in the hippocampal CA1 region was also observed in MPTP-treated mice. Concomitant with impaired LTP induction, CaMKII autophosphorylation was significantly decreased 3weeks after MPTP treatment in the hippocampal CA1 region. Finally, the reduced CaMKII autophosphorylation was closely associated with reduced AMPA-type glutamate receptor subunit 1 (GluR1; Ser-831) phosphorylation in the hippocampal CA1 region of MPTP-treated mice. Taken together, decreased CaMKII activity with concomitant impaired LTP induction in the hippocampus likely account for the learning disability observed in MPTP-treated mice. © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

  2. Modulation of spinal nociception by GluR5 kainate receptor ligands in acute and hyperalgesic states and the role of gabaergic mechanisms.

    PubMed

    Mascias, Paula; Scheede, Manuela; Bloms-Funke, Petra; Chizh, Boris

    2002-09-01

    GluR5 receptors modulate spinal nociception, however, their role in nociceptive hypersensitivity remains unclear. Using behavioural and electrophysiological approaches, we have investigated several GluR5 ligands in acute and hyperalgesic states. Furthermore, as the GABAergic system plays a role in GluR5 mediated effects in the brain, we also analysed the interaction between GluR5 agonists and GABA(A) antagonists in the spinal cord. In young rats in vivo, the GluR5 selective agonist ATPA was antinociceptive and antihyperalgesic in a model of inflammatory hyperalgesia (ED(50) approximately 4.6 and approximately 5.2 mg/kg, respectively), whereas the GluR5/GluR6 agonist SYM2081 was only antihyperalgesic. ATPA, but not SYM2081, was also able to inhibit nociceptive motoneurone responses in anaesthetised adult rats after intrathecal administration. In hemisected spinal cords in vitro, SYM2081 was inactive, whereas ATPA and another GluR5 agonist, (S)-5-iodowillardiine, inhibited nociceptive reflexes (EC(50) 1.1+/-0.4 micro M and 0.36+/-0.05 micro M, respectively). Both GluR5 agonists also inhibited motoneurone responses to repetitive dorsal root stimulation and their cumulative depolarisation, a correlate of wind-up. The GABA(A) antagonists bicuculline (10 micro M) and SR95531 (1 micro M) enhanced polysynaptic responses to single stimuli but abolished the cumulative depolarisation. Both bicuculline and SR95531 significantly attenuated the inhibition of nociceptive responses by 1 micro M ATPA (by approximately 50%). We conclude that selective GluR5 kainate receptor activation inhibits spinal nociception and its sensitisation caused by ongoing peripheral nociceptive drive. GABA(A) receptors are involved in tonic inhibition of segmental responses, but contribute to their sensitisation by repetitive primary afferent stimulation. Furthermore, there is a cross-talk between the two systems, presumably due to GluR5-mediated activation of GABAergic inhibitory interneurones in the spinal cord.

  3. Glutamate receptor 1 phosphorylation at serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability after early life seizures.

    PubMed

    Rakhade, Sanjay N; Fitzgerald, Erin F; Klein, Peter M; Zhou, Chengwen; Sun, Hongyu; Huganir, Richard L; Hunganir, Richard L; Jensen, Frances E

    2012-12-05

    Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We showed previously that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of serine-831 (S831) and Serine 845 (S845) sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced posttranslational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild-type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation [GluR1 double-phosphomutant (GluR1 DPM) mice]. Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex after a single episode of pentyleneterazol-induced seizures in postnatal day 7 (P7) wild-type mouse pups and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild-type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex and were associated with enhanced seizure susceptibility to later-life kainic-acid-induced seizures. In contrast, later-life seizure susceptibility after hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for posttranslational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue.

  4. Glutamate receptor 1 phosphorylation at Serine 831 and 845 modulates seizure susceptibility and hippocampal hyperexcitability following early life seizures

    PubMed Central

    Rakhade, S.N.; Fitzgerald, E.F.; Klein, P.M.; Zhou, C.; Sun, H; Huganir, R.L.; Jensen, F.E.

    2012-01-01

    Neonatal seizures can lead to later life epilepsy and neurobehavioral deficits, and there are no treatments to prevent these sequelae. We previously showed that hypoxia-induced seizures in a neonatal rat model induce rapid phosphorylation of S831 and S845 sites of the AMPA receptor GluR1 subunit and later neuronal hyperexcitability and epilepsy, suggesting that seizure-induced post-translational modifications may represent a novel therapeutic target. To unambiguously assess the contribution of these sites, we examined seizure susceptibility in wild type mice versus transgenic knock-in mice with deficits in GluR1 S831 and S845 phosphorylation (GluR1 double phosphomutant (GluR1DPM) mice). Phosphorylation of the GluR1 S831 and S845 sites was significantly increased in the hippocampus and cortex following a single episode of pentyleneterazol (PTZ) induced seizures in postnatal day 9 (P9) wild type mouse pups, and that transgenic knock-in mice have a higher threshold and longer latencies to seizures. Like the rat, hypoxic seizures in P9 C57BL/6N wild type mice resulted in transient increases in GluR1 S831 and GluR1 S845 phosphorylation in cortex, and were associated with enhanced seizure susceptibility to later-life kainic acid induced seizures. In contrast, later-life seizure susceptibility following hypoxia-induced seizures was attenuated in GluR1 DPM mice, supporting a role for post-translational modifications in seizure-induced network excitability. Finally, human hippocampal samples from neonatal seizure autopsy cases also showed an increase in GluR1 S831 and S845, supporting the validation of this potential therapeutic target in human tissue. PMID:23223299

  5. [Effect of rhynchophylline on behaviors of methamphetamine-dependent zebrafish and the mechanism].

    PubMed

    Chen, Yi-Fei; Peng, Ju; Fang, Miao; Liu, Yi; Nie, Ling-Hui; Mo, Zhi-Xian; Zhu, Ling-Ling

    2016-11-20

    To observe the effect of rhynchophylline on methamphetamine-dependent zebrafish and explore the possible mechanism. Zebrafish were divided into control group, amphetamine group, low- (50 mg/kg) and high (100 mg/kg)-dose rhynchophylline groups, and ketamine (150 mg/kg) group. Conditioned place preference (CPP) was induced in zebrafish with methamphetamine, and the staying time in the drug box and the tracking map of the zebrafish were observed with Noldus Ethovision XT system. The protein expressions of TH, NR2B and GLUR2 in the brain of zebrafish with CPP were detected with Western blotting. Compared with the control group, zebrafish in methamphetamine group showed significant variations in the staying time and swimming distance in the drug box after conditioning (P<0.05) with obvious alterations of NR2B, TH and GLUR2 expressions in the brain (P<0.05). Treatment of methamphetamine-dependent zebrafish with high-dose rhynchophylline significantly reduced the variations in the staying time and swimming distance in the drug box (P<0.05) and in the expressions of NR2B, TH and GLUR2 in the brain (P<0.05). Rhynchophylline can inhibit methamphetamine dependence in zebrafish, the mechanism of which may involve the expressions of TH, NR2B and GLUR2 proteins in the brain.

  6. Sex-specific effects of prenatal chronic mild stress on adult spatial learning capacity and regional glutamate receptor expression profiles.

    PubMed

    Wang, Yan; Ma, Yuchao; Hu, Jingmin; Zhang, Xinxin; Cheng, Wenwen; Jiang, Han; Li, Min; Ren, Jintao; Zhang, Xiaosong; Liu, Mengxi; Sun, Anji; Wang, Qi; Li, Xiaobai

    2016-07-01

    Both animal experiments and clinical studies have demonstrated that prenatal stress can cause cognitive disorders in offspring. To explore the scope of these deficits and identify potential underlying mechanisms, we examined the spatial learning and memory performance and glutamate receptor (GluR) expression patterns of adult rats exposed to prenatal chronic mild stress (PCMS). Principal component analysis (PCA) was employed to reveal the interrelationships among spatial learning indices and GluR expression changes. Female PCMS-exposed offspring exhibited markedly impaired spatial learning and memory in the Morris water maze (MWM) task compared to control females, while PCMS-exposed males showed better initial spatial learning in the MWM compared to control males. PCMS also altered basal and post-MWM glutamate receptor expression patterns, but these effects differed markedly between sexes. Male PCMS-exposed offspring exhibited elevated basal expression of NR1, mGluR5, and mGluR2/3 in the prefrontal cortex (PFC), whereas females showed no basal expression changes. Following MWM training, PCMS-exposed males expressed higher NR1 in the PFC and mammillary body (MB), higher mGluR2/3 in PFC, and lower NR2B in the hippocampus (HIP), PFC, and MB compared to unstressed MWM-trained males. Female PCMS-exposed offspring showed strongly reduced NR1 in MB and NR2B in the HIP, PFC, and MB, and increased mGluR2/3 in PFC compared to unstressed MWM-trained females. This is the first report suggesting that NMDA subunits in the MB are involved in spatial learning. Additionally, PCA further suggests that the NR1-NR2B form is the most important for spatial memory formation. These results reveal long-term sex-specific effects of PCMS on spatial learning and memory performance in adulthood and implicate GluR expression changes within HIP, PFC, and MB as possible molecular mechanisms underlying cognitive dysfunction in offspring exposed to prenatal stress. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Long-term exposure to endogenous levels of tributyltin decreases GluR2 expression and increases neuronal vulnerability to glutamate.

    PubMed

    Nakatsu, Yusuke; Kotake, Yaichiro; Takishita, Tomoko; Ohta, Shigeru

    2009-10-15

    Tributyltin (TBT), an endocrine-disrupting chemical, has been used commercially as a heat stabilizer, agricultural pesticide and component of antifouling paints. In this study, we investigated the effect of long-term exposure to endogenous levels of TBT on neuronal glutamate receptors. Cultured rat cortical neurons were exposed to 1-50 nM TBT for 9 days (from day 2 to day 10 in vitro). The number of neurons was reduced by long-term exposure to 50 nM TBT, but not to 1-20 nM TBT. Long-term exposure to 20 nM TBT decreased the mRNA expression of glutamate receptors NR1, NR2A, GluR1 and GluR2, and increased that of NR2B, GluR3 and GluR4. GluR2 protein was also reduced by long-term exposure to TBT. Because AMPA receptor lacking GluR2 exhibits Ca2+ permeability, we investigated whether Ca2+ influx or glutamate toxicity was affected. Indeed, glutamate-induced Ca2+ influx was increased in TBT-treated neurons. Consistent with this, neurons became more susceptible to glutamate toxicity as a result of long-term exposure to TBT and this susceptibility was abolished by an antagonist of GluR2-lacking AMPA receptor. Thus, it is suggested that long-term exposure to endogenous levels of TBT induces a decrease of GluR2 protein, causing neurons become more susceptible to glutamate toxicity.

  8. Delayed Noradrenergic Activation in the Dorsal Hippocampus Promotes the Long-Term Persistence of Extinguished Fear

    PubMed Central

    Chai, Ning; Liu, Jian-Feng; Xue, Yan-Xue; Yang, Chang; Yan, Wei; Wang, Hui-Min; Luo, Yi-Xiao; Shi, Hai-Shui; Wang, Ji-Shi; Bao, Yan-Ping; Meng, Shi-Qiu; Ding, Zeng-Bo; Wang, Xue-Yi; Lu, Lin

    2014-01-01

    Fear extinction has been extensively studied, but little is known about the molecular processes that underlie the persistence of extinction long-term memory (LTM). We found that microinfusion of norepinephrine (NE) into the CA1 area of the dorsal hippocampus during the early phase (0 h) after extinction enhanced extinction LTM at 2 and 14 days after extinction. Intra-CA1 infusion of NE during the late phase (12 h) after extinction selectively promoted extinction LTM at 14 days after extinction that was blocked by the β-receptor antagonist propranolol, protein kinase A (PKA) inhibitor Rp-cAMPS, and protein synthesis inhibitors anisomycin and emetine. The phosphorylation levels of PKA, cyclic adenosine monophosphate response element-binding protein (CREB), GluR1, and the membrane GluR1 level were increased by NE during the late phase after extinction that was also blocked by propranolol and Rp-cAMPS. These results suggest that the enhancement of extinction LTM persistence induced by NE requires the activation of the β-receptor/PKA/CREB signaling pathway and membrane GluR1 trafficking. Moreover, extinction increased the phosphorylation levels of Erk1/2, CREB, and GluR1, and the membrane GluR1 level during the late phase, and anisomycin/emetine alone disrupted the persistence of extinction LTM, indicating that the persistence of extinction LTM requires late-phase protein synthesis in the CA1. Propranolol and Rp-cAMPS did not completely disrupt the persistence of extinction LTM, suggesting that another β-receptor/PKA-independent mechanism underlies the persistence of extinction LTM. Altogether, our results showed that enhancing hippocampal noradrenergic activity during the late phase after extinction selectively promotes the persistence of extinction LTM. PMID:24553734

  9. Plasticity-Related PKMζ Signaling in the Insular Cortex Is Involved in the Modulation of Neuropathic Pain after Nerve Injury

    PubMed Central

    Han, Jeongsoo; Kwon, Minjee; Cha, Myeounghoon; Tanioka, Motomasa; Hong, Seong-Karp; Bai, Sun Joon; Lee, Bae Hwan

    2015-01-01

    The insular cortex (IC) is associated with important functions linked with pain and emotions. According to recent reports, neural plasticity in the brain including the IC can be induced by nerve injury and may contribute to chronic pain. Continuous active kinase, protein kinase Mζ (PKMζ), has been known to maintain the long-term potentiation. This study was conducted to determine the role of PKMζ in the IC, which may be involved in the modulation of neuropathic pain. Mechanical allodynia test and immunohistochemistry (IHC) of zif268, an activity-dependent transcription factor required for neuronal plasticity, were performed after nerve injury. After ζ-pseudosubstrate inhibitory peptide (ZIP, a selective inhibitor of PKMζ) injection, mechanical allodynia test and immunoblotting of PKMζ, phospho-PKMζ (p-PKMζ), and GluR1 and GluR2 were observed. IHC demonstrated that zif268 expression significantly increased in the IC after nerve injury. Mechanical allodynia was significantly decreased by ZIP microinjection into the IC. The analgesic effect lasted for 12 hours. Moreover, the levels of GluR1, GluR2, and p-PKMζ were decreased after ZIP microinjection. These results suggest that peripheral nerve injury induces neural plasticity related to PKMζ and that ZIP has potential applications for relieving chronic pain. PMID:26457205

  10. Subunit-dependent postsynaptic expression of kainate receptors on hippocampal interneurons in area CA1

    PubMed Central

    Wondolowski, Joyce; Frerking, Matthew

    2009-01-01

    Kainate receptors (KARs) contribute to postsynaptic excitation in only a select subset of neurons. To define the parameters that specify the postsynaptic expression of KARs, we examined the contribution of KARs to EPSCs on hippocampal interneurons in area CA1. Interneurons in stratum radiatum/lacunosum-moleculare (SR/SLM) express KARs both with and without the GluR5 subunit, but KAR-mediated EPSCs are generated mainly, if not entirely, by GluR5-containing KARs. Extrasynaptic glutamate spillover profoundly recruits AMPARs with little effect on KARs, indicating that KARs are targeted at the synapse more precisely than AMPARs. However, spontaneous EPSCs with a conventional AMPAR component did not have a resolvable contribution of KARs, suggesting that the KARs that contribute to the evoked EPSCs are at a distinct set of synapses. GluR5-containing KARs on interneurons in stratum oriens do not contribute substantially to the EPSC. We conclude that KARs are localized to synapses by cell type-, synapse-, and subunit-selective mechanisms. PMID:19144856

  11. [Rasmussen encephalitis and non-herpetic acute limbic encephalitis].

    PubMed

    Takahashi, Yukitoshi; Kubota, Yuko; Yamasaki, Etsuko; Matsuda, Kazumi

    2008-03-01

    Rasmussen syndrome (RS) and non-herpetic acute limbic encephalitis (NHALE) have pathophysiological background related with autoimmunity to glutamate receptors (GluRs) after infections. RS and NHALE were reviewed, depending mainly on our recent studies. RS is the prototype of autoimmune-mediated epilepsy. In patients with RS, several kinds of autoantibodies against neuronal molecules, for example, GluR3, GluRepsilon2 (NMDA-R2B), etc., are reported. These autoantibodies are not specific for RS. About autoantibodies against GluR3, significance and stimulating effects to GluR3 are controversial. Autoantibodies against GluRepsilon2 were detected in all patients within six months from epilepsy onset, and in some patients at chronic stage. These data suggest that autoantibodies against GluRepsilon2 may be involved in the pathological mechanisms in the early stage, but we could not confirm the effect of the autoantibodies from RS patients on excitatory postsynaptic NMDA current using patch clump methods. However, anti-double-stranded DNA antibodies in patients with SLE are reported to cross-react with n-terminal of GluRepsilon2, and cause neuronal apoptosis in rat hippocampus, ensuing memory impairment, and emotional behavior impairment in mice. Therefore, autoantibodies against GluRepsilon2 may contribute to the cognitive and behavioral changes in RS. Concerning about cellular immunity in RS, lymphocytes stimulating tests revealed peripheral lymphocytes sensitized by antigens containing GluRepsilon2. Cytotoxic T cells (CTLs) excreting Granzyme B were reported in resected brain tissue, and we confirmed the elevated levels of Granzyme B, not in sera, but in CSF. These data suggest that CTLs activated by infection invade into CNS, and recognize neural antigens, and excrete Granzyme B. The incidence of NHALE is 4.1/1 million/year in Japanese adults. Our study in 91 adult patients with NHALE revealed the following characteristics. Mean onset age was 35.2 +/- 16.9 years old, and preceding infections existed in 68.7% of patients, and predominant symptoms at the onset were psychiatric symptoms (33.3%) and convulsions (25.0%). CSF showed slightly elevated cell counts (55.5 +/- 139.9), protein levels (48.1 +/- 36.0 mg/dl), and IgG levels (4.5 +/- 3.9 mg/dl). MRI lesions with high intensity were found in 40.8% (DWI) and 54.2% (FLAIR) of patients in various stages after onsets. Autoantibodies against GluRepsilon2 in sera were detected in approximately 60% of NHALE patients from acute to chronic stages, and the autoantibodies in CSF were detected in 51.8% (acute stage), 41.4% (recovery stage), 28.6% (chronic stage) of patients and included epitopes to n-terminal of GluRepsilon2 (NT1). These data suggest that autoantibodies against GluRepsilon2 produced in sera after infection infiltrate into CNS through damaged BBB in acute stages, and affect n-terminal of GluRepsilon2. In chronic stage, recovery of function of BBB reduces levels of the autoantibodies in CSF. Because BBB in hippocampi and amygdala are vulnerable, autoantibodies against GluRepsilon2 including epitopes to n-terminal may contribute to the limbic symptoms around onset. Among several autoantibodies related with NHALE, autoantibodies against GluRepsilon2 were found in patients around 15-34 years old, autoantibodies against VGKC were around 50.4 years old, autoantibodies against NAE were around 59 years old, autoantibodies against Hu were around 61.5 years old. These data suggest that autoantibodies related with NHALE have age-dependent heterogeneity.

  12. Preservation of long-term memory and synaptic plasticity despite short-term impairments in the Tc1 mouse model of Down syndrome.

    PubMed

    Morice, Elise; Andreae, Laura C; Cooke, Sam F; Vanes, Lesley; Fisher, Elizabeth M C; Tybulewicz, Victor L J; Bliss, Timothy V P

    2008-07-01

    Down syndrome (DS) is a genetic disorder arising from the presence of a third copy of the human chromosome 21 (Hsa21). Recently, O'Doherty and colleagues in an earlier study generated a new genetic mouse model of DS (Tc1) that carries an almost complete Hsa21. Since DS is the most common genetic cause of mental retardation, we have undertaken a detailed analysis of cognitive function and synaptic plasticity in Tc1 mice. Here we show that Tc1 mice have impaired spatial working memory (WM) but spared long-term spatial reference memory (RM) in the Morris watermaze. Similarly, Tc1 mice are selectively impaired in short-term memory (STM) but have intact long-term memory (LTM) in the novel object recognition task. The pattern of impaired STM and normal LTM is paralleled by a corresponding phenotype in long-term potentiation (LTP). Freely-moving Tc1 mice exhibit reduced LTP 1 h after induction but normal maintenance over days in the dentate gyrus of the hippocampal formation. Biochemical analysis revealed a reduction in membrane surface expression of the AMPAR (alpha-amino-3-hydroxy-5-methyl-4-propionic acid receptor) subunit GluR1 in the hippocampus of Tc1 mice, suggesting a potential mechanism for the impairment in early LTP. Our observations also provide further evidence that STM and LTM for hippocampus-dependent tasks are subserved by parallel processing streams.

  13. Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition

    PubMed Central

    Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro

    2017-01-01

    Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 (GluR2) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2. This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT. PMID:28800112

  14. Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition.

    PubMed

    Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro

    2017-08-11

    Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 ( GluR2 ) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2 . This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT.

  15. Ketogenic diet does not impair spatial ability controlled by the hippocampus in male rats.

    PubMed

    Fukushima, Atsushi; Ogura, Yuji; Furuta, Miyako; Kakehashi, Chiaki; Funabashi, Toshiya; Akema, Tatsuo

    2015-10-05

    A ketogenic diet was recently shown to reduce glutamate accumulation in synaptic vesicles, decreasing glutamate transmission. We questioned whether a ketogenic diet affects hippocampal function, as glutamate transmission is critically involved in visuospatial ability. In the present study, male Wistar rats were maintained on a ketogenic diet containing 10% protein and 90% fat with complements for 3 weeks to change their energy expenditure from glucose-dependent to fat-dependent. Control rats were fed a diet containing 10% protein, 10% fat, and 80% carbohydrates. The fat-dependent energy expenditure induced by the ketogenic diet led to decreased body weight and increased blood ketone production, though the rats in the two groups consumed the same number of calories. The ketogenic diet did not alter food preferences for the control or high-fat diet containing 10% protein, 45% fat, and 45% carbohydrates. Anxiety in the open field was not altered by ingestion the ketogenic diet. However, rats fed the ketogenic diet performed better in the Y-maze test than rats fed the control diet. No difference was observed between the two groups in the Morris water maze test. Finally, Western blot revealed that the hippocampal expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-type glutamate receptor subunit 1 (GluR1) was significantly increased in mice fed a ketogenic diet. These results suggest that hippocampal function is not impaired by a ketogenic diet and we speculate that the fat-dependent energy expenditure does not impair visuospatial ability. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Premyelinated central axons express neurotoxic NMDA receptors: relevance to early developing white-matter injury

    PubMed Central

    Huria, Tahani; Beeraka, Narasimha Murthy; Al-Ghamdi, Badrah; Fern, Robert

    2015-01-01

    Ischemic-type injury to developing white matter is associated with the significant clinical condition cerebral palsy and with the cognitive deficits associated with premature birth. Premyelinated axons are the major cellular component of fetal white matter and loss of axon function underlies the disability, but the cellular mechanisms producing ischemic injury to premyelinated axons have not previously been described. Injury was found to require longer periods of modelled ischemia than at latter developmental points. Ischemia produced initial hyperexcitability in axons followed by loss of function after Na+ and Ca2+ influx. N-methyl-D-aspartate- (NMDA) type glutamate receptor (GluR) agonists potentiated axon injury while antagonists were protective. The NMDA GluR obligatory Nr1 subunit colocalized with markers of small premyelinated axons and expression was found at focal regions of axon injury. Ischemic injury of glial cells present in early developing white matter was NMDA GluR independent. Axons in human postconception week 18 to 23 white matter had a uniform prediameter expansion phenotype and postembedded immuno-gold labelling showed Nr1 subunit expression on the membrane of these axons, demonstrating a shared key neuropathologic feature with the rodent model. Premyelinated central axons therefore express high levels of functional NMDA GluRs that confer sensitivity to ischemic injury. PMID:25515212

  17. Alterations in GluR2 AMPA receptor phosphorylation at serine 880 following group I metabotropic glutamate receptor stimulation in the rat dorsal striatum.

    PubMed

    Ahn, Sung Min; Choe, Eun Sang

    2010-04-01

    Phosphorylation of ionotropic glutamate receptors in the brain plays a crucial role in the regulation of synaptic plasticity. In this study, we investigated the regulation of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor phosphorylation by the stimulation of group I metabotropic glutamate receptors (mGluRs) in the dorsal striatum in vivo. The results showed that intrastriatal infusion of the group I mGluR agonist, (RS)-3,5-dihydroxyphenylglycine (DHPG, 250 nmol), enhanced the sensitivity of GluR2 subunit in its phosphorylation at serine 880 (S880) in the dorsal striatum. This enhancement of the sensitivity of GluR2-S880 phosphorylation was reduced by blocking group I mGluRs and N-methyl-D-aspartate (NMDA) receptors. Similar reduction of the enhancement was also induced by inhibiting phospholipase C (PLC), calcium/calmodulin-dependent protein kinase (CaMK), c-Jun N-terminal kinase (JNK), and protein kinase C (PKC). Inhibition of protein phosphatase (PP) 1/2A and calcineurin (PP2B) alone enhanced GluR2-S880 phosphorylation in the dorsal striatum, whereas inhibition of these phosphatases did not further enhance the S880 phosphorylation by DHPG stimulation. In addition, inhibition of PP1/2A or PP2B also enhanced the phosphorylation of CaMKII, JNK and PKC. These data suggest that the phosphorylation of AMPA receptor GluR2 subunit at S880 is subject to the upregulation by the stimulation of group I mGluRs. Interactions among glutamate receptors, protein kinases, and PPs participate in this upregulation. (c) 2009 Wiley-Liss, Inc.

  18. GluR2-3Y Inhibits the Acquisition and Reinstatement of Morphine-Induced Conditioned Place Preference in Rats.

    PubMed

    Lin, Xiao-Jing; Zhang, Jian-Jun; Yu, Long-Chuan

    2016-04-01

    Accumulating evidence indicates that α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors (AMPARs) are involved in the relapse to abused drugs. However, the role of AMPARs containing the GluR2 subunit in opiate addiction is still unclear. GluR2-3Y, an interfering peptide, prevents the endocytosis of AMPARs containing the GluR2 subunit. In this study, we explored the effect of intravenous injection of GluR2-3Y on the acquisition, expression, and reinstatement of morphine-induced conditioned place preference (mCPP) in rats. We found that infusion of GluR2-3Y (1.5 nmol/g) one hour before morphine during the conditioning phase inhibited the acquisition of mCPP, while an identical injection one hour before the post-conditioning test had no influence on the expression of mCPP. Injection of GluR2-3Y (1.5 nmol/g) after mCPP extinction blocked the morphine-induced reinstatement of mCPP. Our results strongly support the hypothesis that inhibition of AMPAR endocytosis provides a new target for the treatment of opiate addiction.

  19. Chronic SO2 inhalation above environmental standard impairs neuronal behavior and represses glutamate receptor gene expression and memory-related kinase activation via neuroinflammation in rats.

    PubMed

    Yao, Gaoyi; Yue, Huifeng; Yun, Yang; Sang, Nan

    2015-02-01

    Sulfur dioxide (SO2), as a ubiquitous air pollutant implicated in the genesis of pulmonary disease, is now being considered to be involved in neurotoxicity and increased risk for hospitalization of brain disorders. However, comparatively little is known about the impact of chronically SO2 inhalation on neuronal function. In the present study, by exposing male Wistar rats to SO2 at 3.50 and 7.00 mg/m(3) (approximately 1225 and 2450 ppb, 4.08-8.16 (24h average concentration) times higher than the EPA standard for environmental air concentrations) or filtered air for 90 days, we investigated the impact of chronic SO2 inhalation on performance in Morris water maze, and probed the accompanying neurobiological effects, including activity-regulated cytoskeletal associated gene (Arc) and glutamate receptor gene expression, memory-related kinase level and inflammatory cytokine release in the hippocampus. Here, we found that SO2 exposure reduced the number of target zone crossings and time spent in the target quadrant during the test session in the spatial memory retention of the Morris water maze. Following the neuro-functional abnormality, we detected that SO2 inhalation reduced the expression of Arc and glutamate receptor subunits (GluR1, GluR2, NR1, NR2A, and NR2B) with a concentration-dependent property in comparison to controls. Additionally, the expression of memory kinases was attenuated statistically in the animals receiving the higher concentration, including protein kinase A (PKA), protein kinase C (PKC) and calcium/calmodulin-dependent protein kinaseIIα (CaMKIIα). And the inflammatory cytokine release was increased in rats exposed to SO2. Taken together, our results suggest that long-term exposure to SO2 air pollution at concentrations above the environmental standard in rats impaired spatial learning and memory, and indicate a close link between the neurobiological changes highlighted in the brain and the behavioral disturbances. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Identification of the kainate receptor subunits underlying modulation of excitatory synaptic transmission in the CA3 region of the hippocampus.

    PubMed

    Contractor, A; Swanson, G T; Sailer, A; O'Gorman, S; Heinemann, S F

    2000-11-15

    To understand the physiological role of kainate receptors and their participation in seizure induction in animal models of epilepsy, it will be necessary to develop a comprehensive description of their action in the CA3 region of the hippocampus. Activation of presynaptic kainate receptors depresses excitatory synaptic transmission at mossy fiber and associational-commissural inputs to CA3 pyramidal neurons (Vignes et al., 1998; Bortolotto et al., 1999; Kamiya and Ozawa, 2000). In this study, we use gene-targeted mice lacking glutamate receptor 5 (GluR5) or GluR6 kainate receptor subunits to identify the receptor subunits that comprise the kainate receptors responsible for presynaptic modulation of CA3 transmission. We found that bath application of kainate (3 microm) profoundly reduced EPSCs at mossy fiber and collateral synapses in neurons from wild-type and GluR5(-/-) mice but had no effect on EPSCs in neurons from GluR6(-/-) mice. These results therefore contrast with previous studies that supported a role for GluR5-containing receptors at mossy fiber and associational-commissural synapses (Vignes et al., 1998; Bortolotto et al., 1999). Surprisingly, at perforant path synapses kainate receptor activation enhanced transmission; this potentiation was abolished in both GluR5 and GluR6 knock-out mice. Kainate receptors thus play multiple and complex roles to modulate excitatory synaptic transmission in the CA3 region of the hippocampus.

  1. 4-Alkylated homoibotenic acid (HIBO) analogues: versatile pharmacological agents with diverse selectivity profiles towards metabotropic and ionotropic glutamate receptor subtypes.

    PubMed

    Madsen, Ulf; Pickering, Darryl S; Nielsen, Birgitte; Bräuner-Osborne, Hans

    2005-01-01

    4-Alkylated analogues of homoibotenic acid (HIBO) have previously shown high potency and selectivity at ionotropic and metabotropic glutamic acid receptor (iGluR and mGluR) subtypes. Compounds with different selectivity profiles are valuable pharmacological tools for neuropharmacological studies, and the series of 4-alkyl-HIBO analogues have been extended in this paper in the search for versatile agents. Pharmacological characterization of five new analogues, branched and unbranched 4-alkyl-HIBO analogues, have been carried out. The present compounds are all weak antagonists at Group I mGluRs (mGluR1 and 5) presenting only small differences in potencies (Ki values ranging from 89 to 670 microM). Affinities were studied at native and cloned iGluRs, and the compounds described show preference for the AMPA receptor subtypes GluR1 and 2 over GluR3 and 4. However, compared to previous 4-alkyl-HIBO analogues, these compounds show a remarkably high affinity for the Kain preferring subtype GluR5. The observed GluR5 affinities were either similar or higher compared to their GluR1 and 2 affinity. Isopropyl-HIBO showed the highest affinity for GluR5 (Ki=0.16 microM), and represents a unique compound with high affinity towards the three subtypes GluR1, 2 and 5. In general, these compounds represent new selectivity profiles compared to previously reported Glu receptor analogues.

  2. Neuroplasticity and Calcium Signaling in Stressed Rat Amygdala

    DTIC Science & Technology

    2005-02-01

    kainate receptor and neuroplasticity in the amygdala. National Institute of aging, November, 2001. • He Li: GluR5 kainate receptor mediated synaptic...functions in the amygdala. National Institute of Mental Health, April, 2002. 50 " Maria F. M. Braga: Chronic Stress Causes Impairment of aI-Adrenoceptor...resistance All animal experiments were performed in accordance with of 1.5-5.0 Mf when filled with a solution containing (in our institutional guidelines

  3. Editing for an AMPA receptor subunit RNA in prefrontal cortex and striatum in Alzheimer's disease, Huntington's disease and schizophrenia

    NASA Technical Reports Server (NTRS)

    Akbarian, S.; Smith, M. A.; Jones, E. G.; Bloom, F. E. (Principal Investigator)

    1995-01-01

    Animal studies and cell culture experiments demonstrated that posttranscriptional editing of the transcript of the GluR-2 gene, resulting in substitution of an arginine for glutamine in the second transmembrane region (TM II) of the expressed protein, is associated with a reduction in Ca2+ permeability of the receptor channel. Thus, disturbances in GluR-2 RNA editing with alteration of intracellular Ca2+ homeostasis could lead to neuronal dysfunction and even neuronal degeneration. The present study determined the proportions of edited and unedited GluR-2 RNA in the prefrontal cortex of brains from patients with Alzheimer's disease, in the striatum of brains from patients with Huntington's disease, and in the same areas of brains from age-matched schizophrenics and controls, by using reverse transcriptase-polymerase chain reaction, restriction endonuclease digestion, gel electrophoresis and scintillation radiometry. In the prefrontal cortex of controls, < 0.1% of all GluR-2 RNA molecules were unedited and > 99.9% were edited; in the prefrontal cortex both of schizophrenics and of Alzheimer's patients approximately 1.0% of all GluR-2 RNA molecules were unedited and 99% were edited. In the striatum of controls and of schizophrenics, approximately 0.5% of GluR-2 RNA molecules were unedited and 99.5% were edited; in the striatum of Huntington's patients nearly 5.0% of GluR-2 RNA was unedited. In the prefrontal white matter of controls, approximately 7.0% of GluR-2 RNA was unedited. In the normal human prefrontal cortex and striatum, the large majority of GluR-2 RNA molecules contains a CGG codon for arginine in the TMII coding region; this implies that the corresponding AMPA receptors have a low Ca2+ permeability, as previously demonstrated for the rat brain. The process of GluR-2 RNA editing is compromised in a region-specific manner in schizophrenia, in Alzheimer's disease and Huntington's Chorea although in each of these disorders there is still a large excess of edited GluR-2 RNA molecules. Disturbances of GluR-2 RNA editing leading to excessive Ca2+ permeability, may contribute to neuronal dysfunction in schizophrenia and to neuronal death in Alzheimer's disease and Huntington's disease.

  4. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  5. Prenatal chronic mild stress induces depression-like behavior and sex-specific changes in regional glutamate receptor expression patterns in adult rats.

    PubMed

    Wang, Y; Ma, Y; Hu, J; Cheng, W; Jiang, H; Zhang, X; Li, M; Ren, J; Li, X

    2015-08-20

    Chronic stress during critical periods of human fetal brain development is associated with cognitive, behavioral, and mood disorders in later life. Altered glutamate receptor (GluR) expression has been implicated in the pathogenesis of stress-dependent disorders. To test whether prenatal chronic mild stress (PCMS) enhances offspring's vulnerability to stress-induced behavioral and neurobiological abnormalities and if this enhanced vulnerability is sex-dependent, we measured depression-like behavior in the forced swimming test (FST) and regional changes in GluR subunit expression in PCMS-exposed adult male and female rats. Both male and female PCMS-exposed rats exhibited stronger depression-like behavior than controls. Males and females exhibited unique regional changes in GluR expression in response to PCMS alone, FST alone (CON-FST), and PCMS with FST (PCMS-FST). In females, PCMS alone did not alter N-methyl-d-aspartate receptor (NMDAR) or metabotropic glutamate receptor (mGluR) expression, while in PCMS males, higher mGluR2/3, mGluR5, and NR1 expression levels were observed in the prefrontal cortex. In addition, PCMS altered the change in GluR expression induced by acute stress (the FST test), and this too was sex-specific. Male PCMS-FST rats expressed significantly lower mGluR5 levels in the hippocampus, lower mGluR5, NR1, postsynaptic density protein (PSD)95, and higher mGluR2/3 in the prefrontal cortex, and higher mGluR5 and PSD95 in the amygdala than male CON-FST rats. Female PCMS-FST rats expressed lower NR1 in the hippocampus, lower NR2B and PSD95 in the prefrontal cortex, lower mGluR2/3 in the amygdala, and higher PSD95 in the amygdala than female CON-FST rats. PCMS may increase the offspring's vulnerability to depression by altering sex-specific stress-induced changes in glutamatergic signaling. Copyright © 2015. Published by Elsevier Ltd.

  6. The Rewarding and Locomotor-Sensitizing Effects of Repeated Cocaine Administration are Distinct and Separable in Mice

    PubMed Central

    Riday, Thorfinn T.; Kosofsky, Barry E.; Malanga, C.J.

    2011-01-01

    Repeated psychostimulant exposure progressively increases their potency to stimulate motor activity in rodents. This behavioral or locomotor sensitization is considered a model for some aspects of drug addiction in humans, particularly drug craving during abstinence. However, the role of increased motor behavior in drug reward remains incompletely understood. Intracranial self-stimulation (ICSS) was measured concurrently with locomotor activity to determine if acute intermittent cocaine administration had distinguishable effects on motor behavior and perception of brain stimulation-reward (BSR) in the same mice. Sensitization is associated with changes in neuronal activity and glutamatergic neurotransmission in brain reward circuitry. Expression of AMPA receptor subunits (GluR1 and GluR2) and CRE binding protein (CREB) was measured in the ventral tegmental area (VTA), dorsolateral striatum (STR) and nucleus accumbens (NAc) before and after a sensitizing regimen of cocaine, with and without ICSS. Repeated cocaine administration sensitized mice to its locomotor stimulating effects but not its ability to potentiate BSR. ICSS increased GluR1 in the VTA but not NAc or STR, demonstrating selective changes in protein expression with electrical stimulation of discrete brain structures. Repeated cocaine reduced GluR1, GluR2 and CREB expression in the NAc, and reductions of GluR1 and GluR2 but not CREB were further enhanced by ICSS. These data suggest that the effects of repeated cocaine exposure on reward and motor processes are dissociable in mice, and that reduction of excitatory neurotransmission in the NAc may predict altered motor function independently from changes in reward perception. PMID:22197517

  7. Characteristics of AMPA receptor-mediated responses of cultured cortical and spinal cord neurones and their correlation to the expression of glutamate receptor subunits, GluR1-4

    PubMed Central

    Dai, Wei-Min; Egebjerg, Jan; Lambert, John D C

    2001-01-01

    Electrophysiological recordings have been used to characterize responses mediated by AMPA receptors expressed by cultured rat cortical and spinal cord neurones. The EC50 values for AMPA were 17 and 11 μM, respectively.Responses of cortical neurones to AMPA were inhibited competitively by NBQX (pKi=6.6). Lower concentrations of NBQX (⩽1 μM) also potentiated the plateau responses of spinal cord neurones to AMPA, which could be attributed to a depression of desensitization to AMPA.GYKI 52466 inhibited responses of spinal cord neurones to AMPA to about twice the extent of responses of cortical neurones.Blockade of AMPA receptor desensitization by cyclothiazide (CTZ) potentiated responses of spinal cord neurones (6.8 fold) significantly more than responses of cortical neurones (4.8 fold). Responses of cortical neurones to KA were potentiated 3.5 fold by CTZ, while responses of spinal cord neurones were unaffected.Ultra-fast applications of AMPA to outside-out patches showed responses of spinal cord neurones desensitized by 97.5% and exhibit marked inward rectification, whereas cortical neurones desensitized by 91% and exhibited slight outward rectification. The time constants of deactivation and desensitization were about twice as fast in spinal cord than cortical neurones.In cortical neurones, single-cell RT – PCR showed GluR2 and GluR1 accounted for 91% of all subunits and were expressed together in 67% of neurones, predominantly as the flip variants (78%). GluR2 was detected alone in 24% of neurones. GluR3 and GluR4 were present in only 14 and 29% of neurones, respectively. For spinal cord neurones, GluR4o was detected in 81% of neurones, whereas predominantly flop versions of GluR1, 2 and 3 were detected in 38, 13 and 13% of neurones, respectively. These expression patterns are related to the respective pharmacological and mechanistic properties. PMID:11309259

  8. [Expression of AMPA receptors and related protein in immobilization stressed rats and effect of Xiaoyaosan].

    PubMed

    Yue, Guang-Xin; Wang, Zhu-Feng; Zhang, Qiao-Li; Zhao, Xin; Yue, Li-Feng; Ding, Jie; Chen, Jia-Xu

    2008-05-01

    To observe protein expression changes of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor and related regulatory protein in the hippocampus and amygdala in chronic immobilization stressed rat and Xiaoyaosan's regulatory effect. Rats were tied 3 h per day to establish immobilization stress condition and treatment with Xiaoyaosan. After 7 days and 21 days stress, the protein expression of AMPA receptor subunit (GluR2/3), N-ethylmaleimide sensitive factor (NSF) and protein interacting with C-kinase 1 (PICK1) in hippocampus and amygdala were detected by using Western blot techniques. The expression of GluR2/3, NSF in dentate gyrus (DG) and amygdala were markedly attenuated (P < 0.05) and PICK1 in CA1 region were significantly increased (P < 0.05) in 7 d immobilization stressed rats while 7 days xiaoyaosan treatment showed an effective regulatory result to PICK1's changes. Under 21 days immobilization stressed condition, the expression of GluR2/3, NSF in CA1 region showed an increasing trend, and GluR2/3 showed a markedly increase (P < 0.01), but showed an significantly decreased trend in amygdala, Xiaoyaosan showed an effective result to such changes above (P < 0.05). The expression of PICK1 showed increasing trend in amygdala and xiaoyaosan could lower its expression (P < 0.05). There are different trends of the expression of AMPA receptor in repeat short-term stress versus chronic immobilization stress, and in hippocampal CA1 region versus amygdala. Xiaoyaosan has better regulation effect on the expression of AMPA receptors in the condition of chronic immobilization stress than those of repeat shortterm stress.

  9. Late calcium EDTA rescues hippocampal CA1 neurons from global ischemia-induced death.

    PubMed

    Calderone, Agata; Jover, Teresa; Mashiko, Toshihiro; Noh, Kyung-min; Tanaka, Hidenobu; Bennett, Michael V L; Zukin, R Suzanne

    2004-11-03

    Transient global ischemia induces a delayed rise in intracellular Zn2+, which may be mediated via glutamate receptor 2 (GluR2)-lacking AMPA receptors (AMPARs), and selective, delayed death of hippocampal CA1 neurons. The molecular mechanisms underlying Zn2+ toxicity in vivo are not well delineated. Here we show the striking finding that intraventricular injection of the high-affinity Zn2+ chelator calcium EDTA (CaEDTA) at 30 min before ischemia (early CaEDTA) or at 48-60 hr (late CaEDTA), but not 3-6 hr, after ischemia, afforded robust protection of CA1 neurons in approximately 50% (late CaEDTA) to 75% (early CaEDTA) of animals. We also show that Zn2+ acts via temporally distinct mechanisms to promote neuronal death. Early CaEDTA attenuated ischemia-induced GluR2 mRNA and protein downregulation (and, by inference, formation of Zn2+-permeable AMPARs), the delayed rise in Zn2+, and neuronal death. These findings suggest that Zn2+ acts at step(s) upstream from GluR2 gene downregulation and implicate Zn2+ in transcriptional regulation and/or GluR2 mRNA stability. Early CaEDTA also blocked mitochondrial release of cytochrome c and Smac/DIABLO (second mitochondria-derived activator of caspases/direct inhibitor of apoptosis protein-binding protein with low pI), caspase-3 activity (but not procaspase-3 cleavage), p75NTR induction, and DNA fragmentation. These findings indicate that CaEDTA preserves the functional integrity of the mitochondrial outer membrane and arrests the caspase death cascade. Late injection of CaEDTA at a time when GluR2 is downregulated and caspase is activated inhibited the delayed rise in Zn2+, p75NTR induction, DNA fragmentation, and cell death. The finding of neuroprotection by late CaEDTA administration has striking implications for intervention in the delayed neuronal death associated with global ischemia.

  10. FMRP acts as a key messenger for dopamine modulation in the forebrain.

    PubMed

    Wang, Hansen; Wu, Long-Jun; Kim, Susan S; Lee, Frank J S; Gong, Bo; Toyoda, Hiroki; Ren, Ming; Shang, Yu-Ze; Xu, Hui; Liu, Fang; Zhao, Ming-Gao; Zhuo, Min

    2008-08-28

    The fragile X mental retardation protein (FMRP) is an RNA-binding protein that controls translational efficiency and regulates synaptic plasticity. Here, we report that FMRP is involved in dopamine (DA) modulation of synaptic potentiation. AMPA glutamate receptor subtype 1 (GluR1) surface expression and phosphorylation in response to D1 receptor stimulation were reduced in cultured Fmr1(-/-) prefrontal cortex (PFC) neurons. Furthermore, D1 receptor signaling was impaired, accompanied by D1 receptor hyperphosphorylation at serine sites and subcellular redistribution of G protein-coupled receptor kinase 2 (GRK2) in both PFC and striatum of Fmr1(-/-) mice. FMRP interacted with GRK2, and pharmacological inhibition of GRK2 rescued D1 receptor signaling in Fmr1(-/-) neurons. Finally, D1 receptor agonist partially rescued hyperactivity and enhanced the motor function of Fmr1(-/-) mice. Our study has identified FMRP as a key messenger for DA modulation in the forebrain and may provide insights into the cellular and molecular mechanisms underlying fragile X syndrome.

  11. Bisphenol A Impairs Synaptic Plasticity by Both Pre‐ and Postsynaptic Mechanisms

    PubMed Central

    Li, Tingting; Gong, Huarui; Chen, Zhi; Jin, Yan; Xu, Guangwei

    2017-01-01

    Bisphenol A (BPA), an environmental xenoestrogen, has been reported to induce learning and memory impairments in rodent animals. However, effects of BPA exposure on synaptic plasticity and the underlying physiological mechanisms remain elusive. Our behavioral and electrophysiological analyses show that BPA obviously perturbs hippocampal spatial memory of juvenile Sprague–Dawley rats after four weeks exposure, with significantly impaired long‐term potentiation (LTP) in the hippocampus. These effects involve decreased spine density of pyramidal neurons, especially the apical dendritic spine. Further presynaptic findings show an overt inhibition of pulse‐paired facilitation during electrophysiological recording, which suggest the decrease of presynaptic transmitter release and is consistent with reduced production of presynaptic glutamate after BPA exposure. Meanwhile, LTP‐related glutamate receptors, NMDA receptor 2A (NR2A) and AMPA receptor 1 (GluR1), are significantly downregulated in BPA‐exposed rats. Excitatory postsynaptic currents (EPSCs) results also show that EPSCNMDA, but not EPSCAMPA, is declined by 40% compared to the baseline in BPA‐perfused brain slices. Taken together, these findings reveal that juvenile BPA exposure has negative effects on synaptic plasticity, which result from decreases in dendritic spine density and excitatory synaptic transmission. Importantly, this study also provides new insights into the dynamics of BPA‐induced memory deterioration during the whole life of rats. PMID:28852612

  12. Ionotropic glutamate receptor GluR2/3-immunoreactive neurons in the cat, rabbit, and hamster superficial superior colliculus.

    PubMed

    Park, Won-Mee; Kim, Min-Jeong; Jeon, Chang-Jin

    2004-06-01

    Ionotropic glutamate receptor (GluR) subtypes occur in various types of cells in the central nervous system. We studied the distribution of AMPA glutamate receptor subtype GluR2/3 in the superficial layers of cat, rabbit, and hamster superior colliculus (SC) with antibody immunocytochemistry and the effect of enucleation on this distribution. Furthermore, we compared this labeling to that of calbindin D28K and parvalbumin. Anti-GluR2/3-immunoreactive (IR) cells formed a dense band of labeled cells within the lower superficial gray layer (SGL) and upper optic layer (OL) in the cat SC. By contrast, GluR2/3-IR cells formed a dense band within the upper OL in the rabbit and within the OL in the hamster SC. Calbindin D28K-IR cells are located in three layers in the SC: one within the zonal layer (ZL) and the upper SGL in all three animals, a second within the lower OL and upper IGL in the cat, within the IGL in the rabbit and within the OL in the hamster, and a third within the deep gray layer (DGL) in all three animals. Many parvalbumin-IR neurons were found within the lower SGL and upper OL. Thus, the GluR2/3-IR band was sandwiched between the first and second layers of calbindin D28K-IR cells in the cat and rabbit SC while the distribution of GluR2/3-IR cells in the hamster matches the second layer of calbindin D28K-IR cells. The patterned distribution of GluR2/3-IR cells overlapped the tier of parvalbumin-IR neurons in cat, but only partially overlapped in hamster and rabbit. Two-color immunofluorescence revealed that more than half (55.1%) of the GluR2/3-IR cells in the hamster SC expressed calbindin D28K. By contrast, only 9.9% of GluR2/3-IR cells expressed calbindin D28K in the cat. Double-labeled cells were not found in the rabbit SC. Some (4.8%) GluR2/3-IR cells in the cat SC also expressed parvalbumin, while no GluR2/3-IR cells in rabbit and hamster SC expressed parvalbumin. In this dense band of GluR2/3, the majority of labeled cells were small to medium-sized round/oval or stellate cells. Immunoreactivity for the GluR2/3 was clearly reduced in the contralateral SC following unilateral enucleation in the hamster. By contrast, enucleation appeared to have had no effect on the GluR2/3 immunoreactivity in the cat and rabbit SC. The results indicate that neurons in the mammalian SC express GluR2/3 in specific layers, which does not correlate with the expression of calbindin D28K and parvalbumin among the animals.

  13. Orchestrated Regulation of Nogo Receptors, Lotus, AMPA Receptors and BDNF in an ECT Model Suggests Opening and Closure of a Window of Synaptic Plasticity

    PubMed Central

    Nordgren, Max; Karlsson, Tobias; Svensson, Maria; Koczy, Josefin; Josephson, Anna; Olson, Lars; Tingström, Anders; Brené, Stefan

    2013-01-01

    Electroconvulsive therapy (ECT) is an efficient and relatively fast acting treatment for depression. However, one severe side effect of the treatment is retrograde amnesia, which in certain cases can be long-term. The mechanisms behind the antidepressant effect and the amnesia are not well understood. We hypothesized that ECT causes transient downregulation of key molecules needed to stabilize synaptic structure and to prevent Ca2+ influx, and a simultaneous increase in neurotrophic factors, thus providing a short time window of increased structural synaptic plasticity. Here we followed regulation of NgR1, NgR3, LOTUS, BDNF, and AMPA subunits GluR1 and GluR2 flip and flop mRNA levels in hippocampus at 2, 4, 12, 24, and 72 hours after a single episode of induced electroconvulsive seizures (ECS) in rats. NgR1 and LOTUS mRNA levels were transiently downregulated in the dentate gyrus 2, 4, 12 and 4, 12, 24 h after ECS treatment, respectively. GluR2 flip, flop and GluR1 flop were downregulated at 4 h. GluR2 flip remained downregulated at 12 h. In contrast, BDNF, NgR3 and GluR1 flip mRNA levels were upregulated. Thus, ECS treatment induces a transient regulation of factors important for neuronal plasticity. Our data provide correlations between ECS treatment and molecular events compatible with the hypothesis that both effects and side effects of ECT may be caused by structural synaptic rearrangements. PMID:24244357

  14. Orchestrated regulation of Nogo receptors, LOTUS, AMPA receptors and BDNF in an ECT model suggests opening and closure of a window of synaptic plasticity.

    PubMed

    Nordgren, Max; Karlsson, Tobias; Svensson, Maria; Koczy, Josefin; Josephson, Anna; Olson, Lars; Tingström, Anders; Brené, Stefan

    2013-01-01

    Electroconvulsive therapy (ECT) is an efficient and relatively fast acting treatment for depression. However, one severe side effect of the treatment is retrograde amnesia, which in certain cases can be long-term. The mechanisms behind the antidepressant effect and the amnesia are not well understood. We hypothesized that ECT causes transient downregulation of key molecules needed to stabilize synaptic structure and to prevent Ca2+ influx, and a simultaneous increase in neurotrophic factors, thus providing a short time window of increased structural synaptic plasticity. Here we followed regulation of NgR1, NgR3, LOTUS, BDNF, and AMPA subunits GluR1 and GluR2 flip and flop mRNA levels in hippocampus at 2, 4, 12, 24, and 72 hours after a single episode of induced electroconvulsive seizures (ECS) in rats. NgR1 and LOTUS mRNA levels were transiently downregulated in the dentate gyrus 2, 4, 12 and 4, 12, 24 h after ECS treatment, respectively. GluR2 flip, flop and GluR1 flop were downregulated at 4 h. GluR2 flip remained downregulated at 12 h. In contrast, BDNF, NgR3 and GluR1 flip mRNA levels were upregulated. Thus, ECS treatment induces a transient regulation of factors important for neuronal plasticity. Our data provide correlations between ECS treatment and molecular events compatible with the hypothesis that both effects and side effects of ECT may be caused by structural synaptic rearrangements.

  15. Disruption of the endocytic protein HIP1 results in neurological deficits and decreased AMPA receptor trafficking.

    PubMed

    Metzler, Martina; Li, Bo; Gan, Lu; Georgiou, John; Gutekunst, Claire-Anne; Wang, Yushan; Torre, Enrique; Devon, Rebecca S; Oh, Rosemary; Legendre-Guillemin, Valerie; Rich, Mark; Alvarez, Christine; Gertsenstein, Marina; McPherson, Peter S; Nagy, Andras; Wang, Yu Tian; Roder, John C; Raymond, Lynn A; Hayden, Michael R

    2003-07-01

    Huntingtin interacting protein 1 (HIP1) is a recently identified component of clathrin-coated vesicles that plays a role in clathrin-mediated endocytosis. To explore the normal function of HIP1 in vivo, we created mice with targeted mutation in the HIP1 gene (HIP1(-/-)). HIP1(-/-) mice develop a neurological phenotype by 3 months of age manifest with a failure to thrive, tremor and a gait ataxia secondary to a rigid thoracolumbar kyphosis accompanied by decreased assembly of endocytic protein complexes on liposomal membranes. In primary hippocampal neurons, HIP1 colocalizes with GluR1-containing AMPA receptors and becomes concentrated in cell bodies following AMPA stimulation. Moreover, a profound dose-dependent defect in clathrin-mediated internalization of GluR1-containing AMPA receptors was observed in neurons from HIP1(-/-) mice. Together, these data provide strong evidence that HIP1 regulates AMPA receptor trafficking in the central nervous system through its function in clathrin-mediated endocytosis.

  16. [Effect of electroacupuncture on expression of ionotropic glutamate receptor subunits and their genes in lumbar segments of spinal cord in rats with neuropathic pain].

    PubMed

    Ma, Cheng; Yu, Li; Yan, Li-ping

    2010-12-01

    To observe the effect of electroacupuncture (EA) on the expression of ionotropic glutamate receptor (iGluR) subunits and their mRNAs in the lumbar segments of spinal cord in rats with neuropathic pain, so as to explore its underlying mechanism in relieving spinal hyperalgesia. Thirty SD rats were randomly divided into control, model, and EA groups, with 10 rats in each. The spared nerve injury (SNI) model was established by ligature of the sural nerve after cutting off the common peroneal nerve and anterior tibial nerve. EA (2 Hz, 1 mA) was applied to "Huantiao" (GB 30) and "Weizhong" (BL 40) for 30 min, once daily for 7 days. Mechanical pain threshold was detected before and after modeling and before and after EA treatment. The expression levels of N-methyl-d-aspartic acid (NMDA) receptor subunits NR1 and NR 2 B,and AMPA receptor subunit GluR 1 of iGluR and their genes were assayed by Western blot and reverse transcription polymerase chain reaction (RT-PCR) separately. In comparison with control group, the mechanical pain thresholds were decreased significantly on day 2, 7 and day 14 following modeling in the model group (P < 0.05, P < 0.01). While compared with the model group, the pain threshold was increased considerably on day 14 in the EA group (P < 0.01). Compared with the control group, the expression levels of lumbar spinal cord NR 2 B and NR 2 B mRNA in the model group were increased significantly (P < 0.05), and those of lumbar spinal cord NR 1 and NR 1 mRNA, GluR 1 and GluR 1 mRNA in the model group increased slightly (P > 0.05). In comparison with the model group, the expression levels of lumbar spinal cord NR 2 B and NR 2 B mRNA in the EA group were downregulated remarkably (P < 0.05), and those of lumbar spinal cord NR 1 and NR 1 mRNA, GluR 1 and GluR 1 mRNA in the EA group down-regulated slightly (P > 0.05). EA can significantly suppress pain reaction in rats with neuropathic pain probably through down-regulating the expression of lumbar spinal cord NR 2 B protein and NR 2 B mRNA.

  17. Role of spinal cord alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors in complete Freund's adjuvant-induced inflammatory pain.

    PubMed

    Park, Jang-Su; Yaster, Myron; Guan, Xiaowei; Xu, Ji-Tian; Shih, Ming-Hung; Guan, Yun; Raja, Srinivasa N; Tao, Yuan-Xiang

    2008-12-30

    Spinal cord alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) mediate acute spinal processing of nociceptive and non-nociceptive information, but whether and how their activation contributes to the central sensitization that underlies persistent inflammatory pain are still unclear. Here, we examined the role of spinal AMPARs in the development and maintenance of complete Freund's adjuvant (CFA)-induced persistent inflammatory pain. Intrathecal application of two selective non-competitive AMPAR antagonists, CFM-2 (25 and 50 microg) and GYKI 52466 (50 microg), significantly attenuated mechanical and thermal hypersensitivities on the ipsilateral hind paw at 2 and 24 h post-CFA injection. Neither CFM-2 nor GYKI 52466 affected the contralateral basal responses to thermal and mechanical stimuli. Locomotor activity was not altered in any of the drug-treated animals. CFA-induced inflammation did not change total expression or distribution of AMPAR subunits GluR1 and GluR2 in dorsal horn but did alter their subcellular distribution. The amount of GluR2 was markedly increased in the crude cytosolic fraction and decreased in the crude membrane fraction from the ipsilateral L4-5 dorsal horn at 24 h (but not at 2 h) post-CFA injection. Conversely, the level of GluR1 was significantly decreased in the crude cytosolic fraction and increased in the crude membrane fraction from the ipsilateral L4-5 dorsal horn at 24 h (but not at 2 h) post-CFA injection. These findings suggest that spinal AMPARs might participate in the central spinal mechanism of persistent inflammatory pain.

  18. LY404187: a novel positive allosteric modulator of AMPA receptors.

    PubMed

    Quirk, Jennifer C; Nisenbaum, Eric S

    2002-01-01

    LY404187 is a selective, potent and centrally active positive allosteric modulator of AMPA receptors. LY404187 preferentially acts at recombinant human homomeric GluR2 and GluR4 versus GluR1 and GluR3 AMPA receptors. In addition, LY404187 potentiates the flip splice variant of these AMPA receptors to a greater degree than the flop splice variant. In both recombinant and native AMPA receptors, potentiation by LY404187 displays a unique time-dependent growth that appears to involve a suppression of the desensitization process of these ion channels. LY404187 has been shown to enhance glutamatergic synaptic transmission both in vitro and in vivo. This augmentation of synaptic activity is due to the direct potentiation of AMPA receptor function, as well as an indirect recruitment of voltage-dependent NMDA receptor activity. Enhanced calcium influx through NMDA receptors is known to be a critical step in initiating long-term modifications in synaptic function (e.g., long-term potentiation, LTP). These modifications in synaptic function may be substrates for certain forms of memory encoding. Consistent with a recruitment of NMDA receptor activity, LY404187 has been shown to enhance performance in animal models of cognitive function requiring different mnemonic processes. These data suggest that AMPA receptor potentiators may be therapeutically beneficial for treating cognitive deficits in a variety of disorders, particularly those that are associated with reduced glutamatergic signaling such as schizophrenia. In addition, LY404187 has been demonstrated to be efficacious in animal models of behavioral despair that possess considerable predictive validity for antidepressant activity. Although the therapeutic efficacy of AMPA receptor potentiators in these and other diseases will ultimately be determined in the clinic, evidence suggests that the benefit of these compounds will be mediated by multiple mechanisms of action. These mechanisms include direct enhancement of AMPA receptor function, secondary mobilization of intracellular signaling cascades, and prolonged modulation of gene expression.

  19. AMPA/kainate glutamate receptors contribute to inflammation, degeneration and pain related behaviour in inflammatory stages of arthritis

    PubMed Central

    Bonnet, Cleo S; Williams, Anwen S; Gilbert, Sophie J; Harvey, Ann K; Evans, Bronwen A; Mason, Deborah J

    2015-01-01

    Objectives Synovial fluid glutamate concentrations increase in arthritis. Activation of kainate (KA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors (GluRs) increase interleukin-6 (IL-6) release and cause arthritic pain, respectively. We hypothesised that AMPA and KA GluRs are expressed in human arthritis, and that intra-articular NBQX (AMPA/KA GluR antagonist) prevents pain and pathology in antigen-induced arthritis (AIA). Methods GluR immunohistochemistry was related to synovial inflammation and degradation in osteoarthritis (OA) and rheumatoid arthritis (RA). A single intra-articular NBQX injection was given at induction, and knee swelling and gait of AIA and AIA+NBQX rats compared over 21 days, before imaging, RT-qPCR, histology and immunohistochemistry of joints. Effects of NBQX on human primary osteoblast (HOB) activity were determined. Results AMPAR2 and KA1 immunolocalised to remodelling bone, cartilage and synovial cells in human OA and RA, and rat AIA. All arthritic tissues showed degradation and synovial inflammation. NBQX reduced GluR abundance, knee swelling (p<0.001, days 1–21), gait abnormalities (days 1–2), end-stage joint destruction (p<0.001), synovial inflammation (p<0.001), and messenger RNA expression of meniscal IL-6 (p<0.05) and whole joint cathepsin K (p<0.01). X-ray and MRI revealed fewer cartilage and bone erosions, and less inflammation after NBQX treatment. NBQX reduced HOB number and prevented mineralisation. Conclusions AMPA/KA GluRs are expressed in human OA and RA, and in AIA, where a single intra-articular injection of NBQX reduced swelling by 33%, and inflammation and degeneration scores by 34% and 27%, respectively, exceeding the efficacy of approved drugs in the same model. AMPA/KA GluR antagonists represent a potential treatment for arthritis. PMID:24130267

  20. Crystal structure and association behaviour of the GluR2 amino-terminal domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jin, Rongsheng; Singh, Satinder K.; Gu, Shenyan

    2009-09-02

    Fast excitatory neurotransmission is mediated largely by ionotropic glutamate receptors (iGluRs), tetrameric, ligand-gated ion channel proteins comprised of three subfamilies, AMPA, kainate and NMDA receptors, with each subfamily sharing a common, modular-domain architecture. For all receptor subfamilies, active channels are exclusively formed by assemblages of subunits within the same subfamily, a molecular process principally encoded by the amino-terminal domain (ATD). However, the molecular basis by which the ATD guides subfamily-specific receptor assembly is not known. Here we show that AMPA receptor GluR1- and GluR2-ATDs form tightly associated dimers and, by the analysis of crystal structures of the GluR2-ATD, propose mechanismsmore » by which the ATD guides subfamily-specific receptor assembly.« less

  1. A noncognate aminoacyl-tRNA synthetase that may resolve a missing link in protein evolution.

    PubMed

    Skouloubris, Stephane; Ribas de Pouplana, Lluis; De Reuse, Hilde; Hendrickson, Tamara L

    2003-09-30

    Efforts to delineate the advent of many enzymes essential to protein translation are often limited by the fact that the modern genetic code evolved before divergence of the tree of life. Glutaminyl-tRNA synthetase (GlnRS) is one noteworthy exception to the universality of the translation apparatus. In eukaryotes and some bacteria, this enzyme is essential for the biosynthesis of Gln-tRNAGln, an obligate intermediate in translation. GlnRS is absent, however, in archaea, and most bacteria, organelles, and chloroplasts. Phylogenetic analyses predict that GlnRS arose from glutamyl-tRNA synthetase (GluRS), via gene duplication with subsequent evolution of specificity. A pertinent question to ask is whether, in the advent of GlnRS, a transient GluRS-like intermediate could have been retained in an extant organism. Here, we report the discovery of an essential GluRS-like enzyme (GluRS2), which coexists with another GluRS (GluRS1) in Helicobacter pylori. We show that GluRS2's primary role is to generate Glu-tRNAGln, not Glu-tRNAGlu. Thus, GluRS2 appears to be a transient GluRS-like ancestor of GlnRS and can be defined as a GluGlnRS.

  2. Regulation of GluR2 promoter activity by neurotrophic factors via a neuron-restrictive silencer element.

    PubMed

    Brené, S; Messer, C; Okado, H; Hartley, M; Heinemann, S F; Nestler, E J

    2000-05-01

    The AMPA glutamate receptor subunit GluR2, which plays a critical role in regulation of AMPA channel function, shows altered levels of expression in vivo after several chronic perturbations. To evaluate the possibility that transcriptional mechanisms are involved, we studied a 1254-nucleotide fragment of the 5'-promoter region of the mouse GluR2 gene in neural-derived cell lines. We focused on regulation of GluR2 promoter activity by two neurotrophic factors, which are known to be altered in vivo in some of the same systems that show GluR2 regulation. Glial-cell line derived neurotrophic factor (GDNF) and brain-derived neurotrophic factor (BDNF) both induced GluR2 promoter activity. This was associated with increased expression of endogenous GluR2 immunoreactivity in the cells as measured by Western blotting. The effect of GDNF and BDNF appeared to be mediated via a NRSE (neuron-restrictive silencer element) present within the GluR2 promoter. The response to these neurotrophic factors was lost upon mutating or deleting this site, but not several other putative response elements present within the promoter. Moreover, overexpression of REST (restrictive element silencer transcription factor; also referred to as NRSF or neuron restrictive silencer factor), which is known to act on NRSEs in other genes to repress gene expression, blocked the ability of GDNF to induce GluR2 promoter activity. However, GDNF did not alter endogenous levels of REST in the cells. Together, these findings suggest that GluR2 expression can be regulated by neurotrophic factors via an apparently novel mechanism involving the NRSE present within the GluR2 gene promoter.

  3. tRNAGlu increases the affinity of glutamyl-tRNA synthetase for its inhibitor glutamyl-sulfamoyl-adenosine, an analogue of the aminoacylation reaction intermediate glutamyl-AMP: mechanistic and evolutionary implications.

    PubMed

    Blais, Sébastien P; Kornblatt, Jack A; Barbeau, Xavier; Bonnaure, Guillaume; Lagüe, Patrick; Chênevert, Robert; Lapointe, Jacques

    2015-01-01

    For tRNA-dependent protein biosynthesis, amino acids are first activated by aminoacyl-tRNA synthetases (aaRSs) yielding the reaction intermediates aminoacyl-AMP (aa-AMP). Stable analogues of aa-AMP, such as aminoacyl-sulfamoyl-adenosines, inhibit their cognate aaRSs. Glutamyl-sulfamoyl-adenosine (Glu-AMS) is the best known inhibitor of Escherichia coli glutamyl-tRNA synthetase (GluRS). Thermodynamic parameters of the interactions between Glu-AMS and E. coli GluRS were measured in the presence and in the absence of tRNA by isothermal titration microcalorimetry. A significant entropic contribution for the interactions between Glu-AMS and GluRS in the absence of tRNA or in the presence of the cognate tRNAGlu or of the non-cognate tRNAPhe is indicated by the negative values of -TΔSb, and by the negative value of ΔCp. On the other hand, the large negative enthalpy is the dominant contribution to ΔGb in the absence of tRNA. The affinity of GluRS for Glu-AMS is not altered in the presence of the non-cognate tRNAPhe, but the dissociation constant Kd is decreased 50-fold in the presence of tRNAGlu; this result is consistent with molecular dynamics results indicating the presence of an H-bond between Glu-AMS and the 3'-OH oxygen of the 3'-terminal ribose of tRNAGlu in the Glu-AMS•GluRS•tRNAGlu complex. Glu-AMS being a very close structural analogue of Glu-AMP, its weak binding to free GluRS suggests that the unstable Glu-AMP reaction intermediate binds weakly to GluRS; these results could explain why all the known GluRSs evolved to activate glutamate only in the presence of tRNAGlu, the coupling of glutamate activation to its transfer to tRNA preventing unproductive cleavage of ATP.

  4. tRNAGlu Increases the Affinity of Glutamyl-tRNA Synthetase for Its Inhibitor Glutamyl-Sulfamoyl-Adenosine, an Analogue of the Aminoacylation Reaction Intermediate Glutamyl-AMP: Mechanistic and Evolutionary Implications

    PubMed Central

    Blais, Sébastien P.; Kornblatt, Jack A.; Barbeau, Xavier; Bonnaure, Guillaume; Lagüe, Patrick; Chênevert, Robert; Lapointe, Jacques

    2015-01-01

    For tRNA-dependent protein biosynthesis, amino acids are first activated by aminoacyl-tRNA synthetases (aaRSs) yielding the reaction intermediates aminoacyl-AMP (aa-AMP). Stable analogues of aa-AMP, such as aminoacyl-sulfamoyl-adenosines, inhibit their cognate aaRSs. Glutamyl-sulfamoyl-adenosine (Glu-AMS) is the best known inhibitor of Escherichia coli glutamyl-tRNA synthetase (GluRS). Thermodynamic parameters of the interactions between Glu-AMS and E. coli GluRS were measured in the presence and in the absence of tRNA by isothermal titration microcalorimetry. A significant entropic contribution for the interactions between Glu-AMS and GluRS in the absence of tRNA or in the presence of the cognate tRNAGlu or of the non-cognate tRNAPhe is indicated by the negative values of –TΔSb, and by the negative value of ΔCp. On the other hand, the large negative enthalpy is the dominant contribution to ΔGb in the absence of tRNA. The affinity of GluRS for Glu-AMS is not altered in the presence of the non-cognate tRNAPhe, but the dissociation constant K d is decreased 50-fold in the presence of tRNAGlu; this result is consistent with molecular dynamics results indicating the presence of an H-bond between Glu-AMS and the 3’-OH oxygen of the 3’-terminal ribose of tRNAGlu in the Glu-AMS•GluRS•tRNAGlu complex. Glu-AMS being a very close structural analogue of Glu-AMP, its weak binding to free GluRS suggests that the unstable Glu-AMP reaction intermediate binds weakly to GluRS; these results could explain why all the known GluRSs evolved to activate glutamate only in the presence of tRNAGlu, the coupling of glutamate activation to its transfer to tRNA preventing unproductive cleavage of ATP. PMID:25860020

  5. Disruption of the endocytic protein HIP1 results in neurological deficits and decreased AMPA receptor trafficking

    PubMed Central

    Metzler, Martina; Li, Bo; Gan, Lu; Georgiou, John; Gutekunst, Claire-Anne; Wang, Yushan; Torre, Enrique; Devon, Rebecca S.; Oh, Rosemary; Legendre-Guillemin, Valerie; Rich, Mark; Alvarez, Christine; Gertsenstein, Marina; McPherson, Peter S.; Nagy, Andras; Wang, Yu Tian; Roder, John C.; Raymond, Lynn A.; Hayden, Michael R.

    2003-01-01

    Huntingtin interacting protein 1 (HIP1) is a recently identified component of clathrin-coated vesicles that plays a role in clathrin-mediated endocytosis. To explore the normal function of HIP1 in vivo, we created mice with targeted mutation in the HIP1 gene (HIP1–/–). HIP1–/– mice develop a neurological phenotype by 3 months of age manifest with a failure to thrive, tremor and a gait ataxia secondary to a rigid thoracolumbar kyphosis accompanied by decreased assembly of endocytic protein complexes on liposomal membranes. In primary hippocampal neurons, HIP1 colocalizes with GluR1-containing AMPA receptors and becomes concentrated in cell bodies following AMPA stimulation. Moreover, a profound dose-dependent defect in clathrin-mediated internalization of GluR1-containing AMPA receptors was observed in neurons from HIP1–/– mice. Together, these data provide strong evidence that HIP1 regulates AMPA receptor trafficking in the central nervous system through its function in clathrin-mediated endocytosis. PMID:12839988

  6. Input from the medial geniculate nucleus modulates amygdala encoding of fear memory discrimination.

    PubMed

    Ferrara, Nicole C; Cullen, Patrick K; Pullins, Shane P; Rotondo, Elena K; Helmstetter, Fred J

    2017-09-01

    Generalization of fear can involve abnormal responding to cues that signal safety and is common in people diagnosed with post-traumatic stress disorder. Differential auditory fear conditioning can be used as a tool to measure changes in fear discrimination and generalization. Most prior work in this area has focused on elevated amygdala activity as a critical component underlying generalization. The amygdala receives input from auditory cortex as well as the medial geniculate nucleus (MgN) of the thalamus, and these synapses undergo plastic changes in response to fear conditioning and are major contributors to the formation of memory related to both safe and threatening cues. The requirement for MgN protein synthesis during auditory discrimination and generalization, as well as the role of MgN plasticity in amygdala encoding of discrimination or generalization, have not been directly tested. GluR1 and GluR2 containing AMPA receptors are found at synapses throughout the amygdala and their expression is persistently up-regulated after learning. Some of these receptors are postsynaptic to terminals from MgN neurons. We found that protein synthesis-dependent plasticity in MgN is necessary for elevated freezing to both aversive and safe auditory cues, and that this is accompanied by changes in the expressions of AMPA receptor and synaptic scaffolding proteins (e.g., SHANK) at amygdala synapses. This work contributes to understanding the neural mechanisms underlying increased fear to safety signals after stress. © 2017 Ferrara et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Characterization, cell-surface expression and ligand-binding properties of different truncated N-terminal extracellular domains of the ionotropic glutamate receptor subunit GluR1.

    PubMed

    McIlhinney, R A; Molnár, E

    1996-04-01

    To identify the location of the first transmembrane segment of the GluR1 glutamate receptor subunit artificial stop codons have been introduced into the N-terminal domain at amino acid positions 442, 510, and 563, namely just before and spanning the proposed first two transmembrane regions. The resultant truncated N-terminal fragments of GluR1, termed NT1, NT2, and NT3 respectively were expressed in Cos-7 cells and their cellular distribution and cell-surface expression analysed using an N-terminal antibody to GluR1. All of the fragments were fully glycosylated and were found to be associated with cell membranes but none was secreted. Differential extraction of the cell membranes indicated that both NT1 and NT2 behave as peripheral membrane proteins. In contrast NT3, like the full subunit, has integral membrane protein properties. Furthermore only NT3 is expressed at the cell surface as determined by immunofluorescence and cell-surface biotinylation. Protease protection assays indicated that only NT3 had a cytoplasmic tail. Binding studies using the selective ligand [(3)H]alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate ([(3)H]AMPA) demonstrated that NT3 does not bind ligand. Together these results indicate that the first transmembrane domain of the GluR1 subunit lies between residues 509 and 562, that the N-terminal domain alone cannot form a functional ligand-binding site and that this domain can be targeted to the cell surface provided that it has a transmembrane-spanning region.

  8. Blast waves from detonated military explosive reduce GluR1 and synaptophysin levels in hippocampal slice cultures✩

    PubMed Central

    Smith, Marquitta; Piehler, Thuvan; Benjamin, Richard; Farizatto, Karen L.; Pait, Morgan C.; Almeida, Michael F.; Ghukasyan, Vladimir V.; Bahr, Ben A.

    2017-01-01

    Explosives create shockwaves that cause blast-induced neurotrauma, one of the most common types of traumatic brain injury (TBI) linked to military service. Blast-induced TBIs are often associated with reduced cognitive and behavioral functions due to a variety of factors. To study the direct effects of military explosive blasts on brain tissue, we removed systemic factors by utilizing rat hippocampal slice cultures. The long-term slice cultures were briefly sealed air-tight in serum-free medium, lowered into a 37 °C water-filled tank, and small 1.7-gram assemblies of cyclotrimethylene trinitramine (RDX) were detonated 15 cm outside the tank, creating a distinct shockwave recorded at the culture plate position. Compared to control mock-treated groups of slices that received equal submerge time, 1–3 blast impacts caused a dose-dependent reduction in the AMPA receptor subunit GluR1. While only a small reduction was found in hippocampal slices exposed to a single RDX blast and harvested 1–2 days later, slices that received two consecutive RDX blasts 4 min apart exhibited a 26–40% reduction in GluR1, and the receptor subunit was further reduced by 64–72% after three consecutive blasts. Such loss correlated with increased levels of HDAC2, a histone deacetylase implicated in stress-induced reduction of glutamatergic transmission. No evidence of synaptic marker recovery was found at 72 h post-blast. The presynaptic marker synaptophysin was found to have similar susceptibility as GluR1 to the multiple explosive detonations. In contrast to the synaptic protein reductions, actin levels were unchanged, spectrin breakdown was not detected, and Fluoro-Jade B staining found no indication of degenerating neurons in slices exposed to three RDX blasts, suggesting that small, sub-lethal explosives are capable of producing selective alterations to synaptic integrity. Together, these results indicate that blast waves from military explosive cause signs of synaptic compromise without producing severe neurodegeneration, perhaps explaining the cognitive and behavioral changes in those blast-induced TBI sufferers that have no detectable neuropathology. PMID:27720798

  9. Dendritic Glutamate Receptor mRNAs Show Contingent Local Hotspot-Dependent Translational Dynamics

    PubMed Central

    Kim, Tae Kyung; Sul, Jai-Yoon; Helmfors, Henrik; Langel, Ulo; Kim, Junhyong; Eberwine, James

    2014-01-01

    SUMMARY Protein synthesis in neuronal dendrites underlies long-term memory formation in the brain. Local translation of reporter mRNAs has demonstrated translation in dendrites at focal points called translational hotspots. Various reports have shown that hundreds to thousands of mRNAs are localized to dendrites, yet the dynamics of translation of multiple dendritic mRNAs has remained elusive. Here, we show that the protein translational activities of two dendritically localized mRNAs are spatiotemporally complex but constrained by the translational hotspots in which they are colocalized. Cotransfection of glutamate receptor 2 (GluR2) and GluR4 mRNAs (engineered to encode different fluorescent proteins) into rat hippocampal neurons demonstrates a heterogeneous distribution of translational hotspots for the two mRNAs along dendrites. Stimulation with s-3,5-dihydroxy-phenylglycine modifies the translational dynamics of both of these RNAs in a complex saturable manner. These results suggest that the translational hotspot is a primary structural regulator of the simultaneous yet differential translation of multiple mRNAs in the neuronal dendrite. PMID:24075992

  10. Synaptic Neurotransmission Depression in Ventral Tegmental Dopamine Neurons and Cannabinoid-Associated Addictive Learning

    PubMed Central

    Liu, Zhiqiang; Han, Jing; Jia, Lintao; Maillet, Jean-Christian; Bai, Guang; Xu, Lin; Jia, Zhengping; Zheng, Qiaohua; Zhang, Wandong; Monette, Robert; Merali, Zul; Zhu, Zhou; Wang, Wei; Ren, Wei; Zhang, Xia

    2010-01-01

    Drug addiction is an association of compulsive drug use with long-term associative learning/memory. Multiple forms of learning/memory are primarily subserved by activity- or experience-dependent synaptic long-term potentiation (LTP) and long-term depression (LTD). Recent studies suggest LTP expression in locally activated glutamate synapses onto dopamine neurons (local Glu-DA synapses) of the midbrain ventral tegmental area (VTA) following a single or chronic exposure to many drugs of abuse, whereas a single exposure to cannabinoid did not significantly affect synaptic plasticity at these synapses. It is unknown whether chronic exposure of cannabis (marijuana or cannabinoids), the most commonly used illicit drug worldwide, induce LTP or LTD at these synapses. More importantly, whether such alterations in VTA synaptic plasticity causatively contribute to drug addictive behavior has not previously been addressed. Here we show in rats that chronic cannabinoid exposure activates VTA cannabinoid CB1 receptors to induce transient neurotransmission depression at VTA local Glu-DA synapses through activation of NMDA receptors and subsequent endocytosis of AMPA receptor GluR2 subunits. A GluR2-derived peptide blocks cannabinoid-induced VTA synaptic depression and conditioned place preference, i.e., learning to associate drug exposure with environmental cues. These data not only provide the first evidence, to our knowledge, that NMDA receptor-dependent synaptic depression at VTA dopamine circuitry requires GluR2 endocytosis, but also suggest an essential contribution of such synaptic depression to cannabinoid-associated addictive learning, in addition to pointing to novel pharmacological strategies for the treatment of cannabis addiction. PMID:21187978

  11. Enriched environment influences hormonal status and hippocampal brain derived neurotrophic factor in a sex dependent manner.

    PubMed

    Bakos, J; Hlavacova, N; Rajman, M; Ondicova, K; Koros, C; Kitraki, E; Steinbusch, H W M; Jezova, D

    2009-12-01

    The present study is aimed at testing the hypothesis that an enriched environment (EE) induces sex-dependent changes in stress hormone release and in markers of increased brain plasticity. The focus was on hypothalamic-pituitary-adrenocortical (HPA) axis activity, plasma levels of stress hormones, gene expression of glutamate receptor subunits and concentrations of brain-derived neurotrophic factor (BDNF) in selected brain regions. Rats exposed to EE were housed in groups of 12 in large cages with various objects, which were frequently changed, for 6 weeks. Control animals were housed four per cage under standard conditions. In females the EE-induced rise in hippocampal BDNF, a neurotrophic factor associated with increased neural plasticity, was more pronounced than in males. Similar sex-specific changes were observed in BDNF concentrations in the hypothalamus. EE also significantly attenuated oxytocin and aldosterone levels only in female but not male rats. Plasma testosterone positively correlated with hippocampal BDNF in female but not male rats housed in EE. In male rats housing in EE led to enhanced levels of testosterone and adrenocorticotropic hormone (ACTH), this was not seen in females. Hippocampal glucocorticoid but not mineralocorticoid receptor levels decreased in rats housed in EE irrespective of sex. Housing conditions failed to modify mRNA levels of glutamate receptor type 1 (Glur1) and metabotropic glutamate receptor subtype 5 (mGlur5) subunits of glutamate receptors in the forebrain. Moreover, a negative association between corticosterone and BDNF was observed in both sexes. The results demonstrate that the association between hormones and changes in brain plasticity is sex related. In particular, testosterone seems to be involved in the regulatory processes related to neuroplasticity in females.

  12. Different structural requirements for functional ion pore transplantation suggest different gating mechanisms of NMDA and kainate receptors.

    PubMed

    Villmann, Carmen; Hoffmann, Jutta; Werner, Markus; Kott, Sabine; Strutz-Seebohm, Nathalie; Nilsson, Tanja; Hollmann, Michael

    2008-10-01

    Although considerable progress has been made in characterizing the physiological function of the high-affinity kainate (KA) receptor subunits KA1 and KA2, no homomeric ion channel function has been shown. An ion channel transplantation approach was employed in this study to directly test if homomerically expressed KA1 and KA2 pore domains are capable of conducting currents. Transplantation of the ion pore of KA1 or KA2 into GluR6 generated perfectly functional ion channels that allowed characterization of those electrophysiological and pharmacological properties that are determined exclusively by the ion pore of KA1 or KA2. This demonstrates for the first time that KA1 and KA2 ion pore domains are intrinsically capable of conducting ions even in homomeric pore assemblies. NMDA receptors, similar to KA1- or KA2-containing receptors, function only as heteromeric complexes. They are composed of NR1 and NR2 subunits, which both are non-functional when expressed homomerically. In contrast to NR1, the homomeric NR2B ion pore failed to translate ligand binding into pore opening when transplanted into GluR6. Similarly, heteromeric coexpression of the ion channel domains of both NR1 and NR2 inserted into GluR6 failed to produce functional channels. Therefore, we conclude that the mechanism underlying the ion channel opening in the obligatorily heterotetrameric NMDA receptors differs significantly from that in the facultatively heterotetrameric alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate and KA receptors.

  13. Trafficking of presynaptic AMPA receptors mediating neurotransmitter release: neuronal selectivity and relationships with sensitivity to cyclothiazide.

    PubMed

    Pittaluga, Anna; Feligioni, Marco; Longordo, Fabio; Luccini, Elisa; Raiteri, Maurizio

    2006-03-01

    Postsynaptic glutamate AMPA receptors (AMPARs) can recycle between plasma membrane and intracellular pools. In contrast, trafficking of presynaptic AMPARs has not been investigated. AMPAR surface expression involves interactions between the GluR2 carboxy tail and various proteins including glutamate receptor-interacting protein (GRIP), AMPA receptor-binding protein (ABP), protein interacting with C kinase 1 (PICK1), N-ethyl-maleimide-sensitive fusion protein (NSF). Here, peptides known to selectively block the above interactions were entrapped into synaptosomes to study the effects on the AMPA-evoked release of [3H]noradrenaline ([3H]NA) and [3H]acetylcholine ([3H]ACh) from rat hippocampal and cortical synaptosomes, respectively. Internalization of pep2-SVKI to prevent GluR2-GRIP/ABP/PICK1 interactions potentiated the AMPA-evoked release of [3H]NA but left unmodified that of [3H]ACh. Similar potentiation was caused by pep2-AVKI, the blocker of GluR2-PICK1 interaction. Conversely, a decrease in the AMPA-evoked release of [3H]NA, but not of [3H]ACh, was caused by pep2m, a selective blocker of the GluR2-NSF interaction. In the presence of pep2-SVKI the presynaptic AMPARs on noradrenergic terminals lost sensitivity to cyclothiazide. AMPARs releasing [3H]ACh, but not those releasing [3H]NA, were sensitive to spermine, suggesting that they are GluR2-lacking AMPARs. To conclude: (i) release-regulating presynaptic AMPARs constitutively cycle in isolated nerve terminals; (ii) the process exhibits neuronal selectivity; (iii) AMPAR trafficking and desensitization may be interrelated.

  14. Differential glutamate AMPA-receptor plasticity in subpopulations of VTA neurons in the presence or absence of residual cocaine: Implications for the development of addiction

    PubMed Central

    Lane, D.A.; Reed, B.; Kreek, M.J.; Pickel, V.M.

    2011-01-01

    Cocaine-induced plasticity of mesocorticolimbic dopamine (DA) neurons, originating in the ventral tegmental area (VTA), persists in the absence of cocaine and may contribute to both drug-craving and relapse. Glutamate AMPA receptors (AMPARs) in these neurons are implicated in this plasticity. However, there is no ultrastructural evidence that the absence of cocaine following repeated administrations affects the critical surface/synaptic availability of AMPAR GluR1 subunits in either DA or non-DA, putative GABAergic neurons within the VTA. To assess this, we used electron microscopic immunolabeling in the VTA of adult male mice sacrificed at 30 minutes or 72 hours after receiving the final of six (15 mg/kg) cocaine injections, a dosing paradigm that resulted in development of locomotor sensitization. At each time point, both cocaine- and saline-injected mice showed AMPAR GluR1 immunogold labeling in somatodendritic profiles, many of which contained immunoperoxidase labeling for the DA-synthesizing enzyme, tyrosine hydroxylase (TH). At 30 minutes after the last injection, when cocaine was systemically present, only the non-TH labeled dendrites showed a significant increase in the synaptic/plasmalemmal density of GluR1 immunogold particles. At 72 hours, when systemic cocaine was depleted, synaptic GluR1 labeling was greatly enhanced in TH-containing dendrites throughout the VTA and in non-TH dendrites of the limbic-associated paranigral VTA. Our results demonstrate that systemic cocaine produces GluR1 trafficking specifically in non-DA neurons of the VTA, which may subsequently contribute to the abstinent-induced enhancement of AMPA receptor synaptic transmission in mesocorticolimbic DA neurons leading to heightened drug seeking behavior. PMID:21215761

  15. Increased Glutamate Receptor and Transporter Expression in the Cerebral Cortex and Striatum of Gcdh -/- Mice: Possible Implications for the Neuropathology of Glutaric Acidemia Type I

    PubMed Central

    Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M.; Woontner, Michael; Goodman, Stephen I.; de Souza, Diogo Onofre Gomes; Wajner, Moacir

    2014-01-01

    We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh -/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh -/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh -/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh -/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh -/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh -/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh -/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh -/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I. PMID:24594605

  16. Increased glutamate receptor and transporter expression in the cerebral cortex and striatum of gcdh-/- mice: possible implications for the neuropathology of glutaric acidemia type I.

    PubMed

    Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M; Woontner, Michael; Goodman, Stephen I; de Souza, Diogo Onofre Gomes; Wajner, Moacir

    2014-01-01

    We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh-/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh-/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh-/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh-/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh-/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh-/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh-/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh-/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I.

  17. N-linked glycosylation of cortical N-methyl-D-aspartate and kainate receptor subunits in schizophrenia.

    PubMed

    Tucholski, Janusz; Simmons, Micah S; Pinner, Anita L; McMillan, Laurence D; Haroutunian, Vahram; Meador-Woodruff, James H

    2013-08-21

    Dysfunctional glutamate neurotransmission has been implicated in the pathophysiology of schizophrenia. Abnormal expressions in schizophrenia of ionotropic glutamate receptors (iGluRs) and the proteins that regulate their trafficking have been found to be region and subunit specific in brain, suggesting that abnormal trafficking of iGluRs may contribute toward altered glutamatergic neurotransmission. The post-translational modification N-glycosylation of iGluR subunits can be used as a proxy for their intracellular localization. Receptor complexes assemble in the lumen of the endoplasmic reticulum, where N-glycosylation begins with the addition of N-linked oligomannose glycans, and is subsequently trimmed and replaced by more elaborate glycans while trafficking through the Golgi apparatus. Previously, we found abnormalities in N-glycosylation of the GluR2 AMPA receptor subunit in schizophrenia. Here, we investigated N-glycosylation of N-methyl-D-aspartate and kainate (KA) receptor subunits in the dorsolateral prefrontal cortex from patients with schizophrenia and a comparison group. We used enzymatic deglycosylation with two glycosidases: endoglycosidase H (Endo H), which removes immature high mannose-containing sugars, and peptide-N-glycosidase F (PNGase F), which removes all N-linked sugars. The NR1, NR2A, NR2B, GluR6, and KA2 subunits were all sensitive to treatment with Endo H and PNGase F. The GluR6 KA receptor subunit was significantly more sensitive to Endo H-mediated deglycosylation in schizophrenia, suggesting a larger molecular mass of N-linked high mannose and/or hybrid sugars on GluR6. This finding, taken with our previous work, suggests that a cellular mechanism underlying abnormal glutamate neurotransmission in schizophrenia may involve abnormal trafficking of both AMPA and KA receptors.

  18. Prenatal Exposure to Tributyltin Decreases GluR2 Expression in the Mouse Brain.

    PubMed

    Ishida, Keishi; Saiki, Takashi; Umeda, Kanae; Miyara, Masatsugu; Sanoh, Seigo; Ohta, Shigeru; Kotake, Yaichiro

    2017-01-01

    Tributyltin (TBT), a common environmental contaminant, is widely used as an antifouling agent in paint. We previously reported that exposure of primary cortical neurons to TBT in vitro decreased the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit glutamate receptor 2 (GluR2) expression and subsequently increased neuronal vulnerability to glutamate. Therefore, to identify whether GluR2 expression also decreases after TBT exposure in vivo, we evaluated the changes in GluR2 expression in the mouse brain after prenatal or postnatal exposure to 10 and 25 ppm TBT through pellet diets. Although the mean feed intake and body weight did not decrease in TBT-exposed mice compared with that in control mice, GluR2 expression in the cerebral cortex and hippocampus decreased after TBT exposure during the prenatal period. These results indicate that a decrease in neuronal GluR2 may be involved in TBT-induced neurotoxicity, especially during the fetal period.

  19. AMPA Receptors Mediate Acetylcholine Release from Starburst Amacrine Cells in the Rabbit Retina

    PubMed Central

    FIRTH, SALLY I.; LI, WEI; MASSEY, STEPHEN C.; MARSHAK, DAVID W.

    2012-01-01

    The light response of starburst amacrine cells is initiated by glutamate released from bipolar cells. To identify the receptors that mediate this response, we used a combination of anatomical and physiological techniques. An in vivo, rabbit eyecup was preloaded with [3H]-choline, and the [3H]-acetylcholine (ACh) released into the superfusate was monitored. A photopic, 3 Hz flashing light increased ACh release, and the selective AMPA receptor antagonist, GYKI 53655, blocked this light-evoked response. Nonselective AMPA/kainate agonists increased the release of ACh, but the specific kainate receptor agonist, SYM 2081, did not increase ACh release. Selective AMPA receptor antagonists, GYKI 53655 or GYKI 52466, also blocked the responses to agonists. We conclude that the predominant excitatory input to starburst amacrine cells is mediated by AMPA receptors. We also labeled lightly fixed rabbit retinas with antisera to choline acetyltransferase (ChAT), AMPA receptor subunits GluR1, GluR2/3, or GluR4, and kainate receptor subunits GluR6/7 and KA2. Labeled puncta were observed in the inner plexiform layer with each of these antisera to glutamate receptors, but only GluR2/3-IR puncta and GluR4-IR puncta were found on the ChAT-IR processes. The same was true of starburst cells injected intracellularly with Neurobiotin, and these AMPA receptor subunits were localized to two populations of puncta. The AMPA receptors are expected to desensitize rapidly, enhancing the sensitivity of starburst amacrine cells to moving or other rapidly changing stimuli. PMID:14515241

  20. Myelin Proteolipid Protein Complexes with αv Integrin and AMPA Receptors In Vivo and Regulates AMPA-Dependent Oligodendrocyte Progenitor Cell Migration through the Modulation of Cell-Surface GluR2 Expression

    PubMed Central

    Harlow, Danielle E.; Saul, Katherine E.; Komuro, Hitoshi

    2015-01-01

    In previous studies, stimulation of ionotropic AMPA/kainate glutamate receptors on cultured oligodendrocyte cells induced the formation of a signaling complex that includes the AMPA receptor, integrins, calcium-binding proteins, and, surprisingly, the myelin proteolipid protein (PLP). AMPA stimulation of cultured oligodendrocyte progenitor cells (OPCs) also caused an increase in OPC migration. The current studies focused primarily on the formation of the PLP–αv integrin–AMPA receptor complex in vivo and whether complex formation impacts OPC migration in the brain. We found that in wild-type cerebellum, PLP associates with αv integrin and the calcium-impermeable GluR2 subunit of the AMPA receptor, but in mice lacking PLP, αv integrin did not associate with GluR2. Live imaging studies of OPC migration in ex vivo cerebellar slices demonstrated altered OPC migratory responses to neurotransmitter stimulation in the absence of PLP and GluR2 or when αv integrin levels were reduced. Chemotaxis assays of purified OPCs revealed that AMPA stimulation was neither attractive nor repulsive but clearly increased the migration rate of wild-type but not PLP null OPCs. AMPA receptor stimulation of wild-type OPCs caused decreased cell-surface expression of the GluR2 AMPA receptor subunit and increased intracellular Ca2+ signaling, whereas PLP null OPCs did not reduce GluR2 at the cell surface or increase Ca2+ signaling in response to AMPA treatment. Together, these studies demonstrate that PLP is critical for OPC responses to glutamate signaling and has important implications for OPC responses when levels of glutamate are high in the extracellular space, such as following demyelination. SIGNIFICANCE STATEMENT After demyelination, such as occurs in multiple sclerosis, remyelination of axons is often incomplete, leading to loss of neuronal function and clinical disability. Remyelination may fail because oligodendrocyte precursor cells (OPCs) do not completely migrate into demyelinated areas or OPCs in lesions may not mature into myelinating oligodendrocytes. We have found that the myelin proteolipid protein is critical to regulating OPC migratory responses to the neurotransmitter glutamate through modulation of cell-surface expression of the calcium-impermeable GluR2 subunit of the AMPA glutamate receptor and increased intercellular Ca2+ signaling. Altered glutamate homeostasis has been reported in demyelinated lesions. Therefore, understanding how OPCs respond to glutamate has important implications for treatment after white matter injury and disease. PMID:26311781

  1. Differences in kainate receptor involvement in hippocampal mossy fibre long-term potentiation depending on slice orientation.

    PubMed

    Sherwood, John L; Amici, Mascia; Dargan, Sheila L; Culley, Georgia R; Fitzjohn, Stephen M; Jane, David E; Collingridge, Graham L; Lodge, David; Bortolotto, Zuner A

    2012-09-01

    Long-term potentiation (LTP) is a well-established experimental model used to investigate the synaptic basis of learning and memory. LTP at mossy fibre - CA3 synapses in the hippocampus is unusual because it is normally N-methyl-d-aspartate (NMDA) receptor-independent. Instead it seems that the trigger for mossy fibre LTP involves kainate receptors (KARs). Although it is generally accepted that pre-synaptic KARs play an essential role in frequency facilitation and LTP, their subunit composition remains a matter of significant controversy. We have reported previously that both frequency facilitation and LTP can be blocked by selective antagonism of GluK1 (formerly GluR5/Glu(K5))-containing KARs, but other groups have failed to reproduce this effect. Moreover, data from receptor knockout and mRNA expression studies argue against a major role of GluK1, supporting a more central role for GluK2 (formerly GluR6/Glu(K6)). A potential reason underlying the controversy in the pharmacological experiments may reside in differences in the preparations used. Here we show differences in pharmacological sensitivity of synaptic plasticity at mossy fibre - CA3 synapses depend critically on slice orientation. In transverse slices, LTP of fEPSPs was invariably resistant to GluK1-selective antagonists whereas in parasagittal slices LTP was consistently blocked by GluK1-selective antagonists. In addition, there were pronounced differences in the magnitude of frequency facilitation and the sensitivity to the mGlu2/3 receptor agonist DCG-IV. Using anterograde labelling of granule cells we show that slices of both orientations possess intact mossy fibres and both large and small presynaptic boutons. Transverse slices have denser fibre tracts but a smaller proportion of giant mossy fibre boutons. These results further demonstrate a considerable heterogeneity in the functional properties of the mossy fibre projection. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Nuclear and membrane estrogen receptor antagonists induce similar mTORC2 activation-reversible changes in synaptic protein expression and actin polymerization in the mouse hippocampus.

    PubMed

    Xing, Fang-Zhou; Zhao, Yan-Gang; Zhang, Yuan-Yuan; He, Li; Zhao, Ji-Kai; Liu, Meng-Ying; Liu, Yan; Zhang, Ji-Qiang

    2018-06-01

    Estrogens play pivotal roles in hippocampal synaptic plasticity through nuclear receptors (nERs; including ERα and ERβ) and the membrane receptor (mER; also called GPR30), but the underlying mechanism and the contributions of nERs and mER remain unclear. Mammalian target of rapamycin complex 2 (mTORC2) is involved in actin cytoskeleton polymerization and long-term memory, but whether mTORC2 is involved in the regulation of hippocampal synaptic plasticity by ERs is unclear. We treated animals with nER antagonists (MPP/PHTPP) or the mER antagonist (G15) alone or in combination with A-443654, an activator of mTORC2. Then, we examined the changes in hippocampal SRC-1 expression, mTORC2 signaling (rictor and phospho-AKTSer473), actin polymerization (phospho-cofilin and profilin-1), synaptic protein expression (GluR1, PSD95, spinophilin, and synaptophysin), CA1 spine density, and synapse density. All of the examined parameters except synaptophysin expression were significantly decreased by MPP/PHTPP and G15 treatment. MPP/PHTPP and G15 induced a similar decrease in most parameters except p-cofilin, GluR1, and spinophilin expression. The ER antagonist-induced decreases in these parameters were significantly reversed by mTORC2 activation, except for the change in SRC-1, rictor, and synaptophysin expression. nERs and mER contribute similarly to the changes in proteins and structures associated with synaptic plasticity, and mTORC2 may be a novel target of hippocampal-dependent dementia such as Alzheimer's disease as proposed by previous studies. © 2018 John Wiley & Sons Ltd.

  3. Activation of PPARγ Ameliorates Spatial Cognitive Deficits through Restoring Expression of AMPA Receptors in Seipin Knock-Out Mice.

    PubMed

    Zhou, Libin; Chen, Tingting; Li, Guoxi; Wu, Chaoming; Wang, Conghui; Li, Lin; Sha, Sha; Chen, Lei; Liu, George; Chen, Ling

    2016-01-27

    A characteristic phenotype of congenital generalized lipodystrophy 2 (CGL2) that is caused by loss-of-function of seipin gene is mental retardation. Here, we show that seipin deficiency in hippocampal CA1 pyramidal cells caused the reduction of peroxisome proliferator-activated receptor gamma (PPARγ). Twelve-week-old systemic seipin knock-out mice and neuronal seipin knock-out (seipin-nKO) mice, but not adipose seipin knock-out mice, exhibited spatial cognitive deficits as assessed by the Morris water maze and Y-maze, which were ameliorated by the treatment with the PPARγ agonist rosiglitazone (rosi). In addition, seipin-nKO mice showed the synaptic dysfunction and the impairment of NMDA receptor-dependent LTP in hippocampal CA1 regions. The density of AMPA-induced current (IAMPA) in CA1 pyramidal cells and GluR1/GluR2 expression were significantly reduced in seipin-nKO mice, whereas the NMDA-induced current (INMDA) and NR1/NR2 expression were not altered. Rosi treatment in seipin-nKO mice could correct the decrease in expression and activity of AMPA receptor (AMPAR) and was accompanied by recovered synaptic function and LTP induction. Furthermore, hippocampal ERK2 and CREB phosphorylation in seipin-nKO mice were reduced and this could be rescued by rosi treatment. Rosi treatment in seipin-nKO mice elevated BDNF concentration. The MEK inhibitor U0126 blocked rosi-restored AMPAR expression and LTP induction in seipin-nKO mice, but the Trk family inhibitor K252a did not. These findings indicate that the neuronal seipin deficiency selectively suppresses AMPAR expression through reducing ERK-CREB activities, leading to the impairment of LTP and spatial memory, which can be rescued by PPARγ activation. Congenital generalized lipodystrophy 2 (CGL2), caused by loss-of-function mutation of seipin gene, is characterized by mental retardation. By the generation of systemic or neuronal seipin knock-out mice, the present study provides in vivo evidence that neuronal seipin deficiency causes deficits in spatial memory and hippocampal LTP induction. Neuronal seipin deficiency selectively suppresses AMPA receptor expression, ERK-CREB phosphorylation with the decline of PPARγ. The PPARγ agonist rosiglitazone can ameliorate spatial cognitive deficits and rescue the LTP induction in seipin knock-out mice by restoring AMPA receptor expression and ERK-CREB activities. Copyright © 2016 the authors 0270-6474/16/361242-12$15.00/0.

  4. Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

    2005-11-01

    The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

  5. Early continuous white noise exposure alters l-alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor subunit glutamate receptor 2 and gamma-aminobutyric acid type a receptor subunit beta3 protein expression in rat auditory cortex.

    PubMed

    Xu, Jinghong; Yu, Liping; Zhang, Jiping; Cai, Rui; Sun, Xinde

    2010-02-15

    Auditory experience during the postnatal critical period is essential for the normal maturation of auditory function. Previous studies have shown that rearing infant rat pups under conditions of continuous moderate-level noise delayed the emergence of adult-like topographic representational order and the refinement of response selectivity in the primary auditory cortex (A1) beyond normal developmental benchmarks and indefinitely blocked the closure of a brief, critical-period window. To gain insight into the molecular mechanisms of these physiological changes after noise rearing, we studied expression of the AMPA receptor subunit GluR2 and GABA(A) receptor subunit beta3 in the auditory cortex after noise rearing. Our results show that continuous moderate-level noise rearing during the early stages of development decreases the expression levels of GluR2 and GABA(A)beta3. Furthermore, noise rearing also induced a significant decrease in the level of GABA(A) receptors relative to AMPA receptors. However, in adult rats, noise rearing did not have significant effects on GluR2 and GABA(A)beta3 expression or the ratio between the two units. These changes could have a role in the cellular mechanisms involved in the delayed maturation of auditory receptive field structure and topographic organization of A1 after noise rearing. Copyright 2009 Wiley-Liss, Inc.

  6. Protective effect of the daming capsule on impaired baroreflexes in STZ-induced diabetic rats with hyperlipoidemia.

    PubMed

    Ai, Jing; Wang, Li-Hong; Zhang, Rong; Qiao, Guo-Fen; Wang, Ning; Sun, Li-Hua; Lu, Guan-Yi; Sun, Chao; Yang, Bao-Feng

    2010-12-22

    The Daming capsule (DMC) is a traditional Chinese medicine used to treat hyperlipoidemia. Both clinic trials and studies on animal models have demonstrated that DMC is beneficial against diabetic symptoms. Impairment of the baroreflex can cause life-threatening arrhythmias and sudden cardiac death in patients with diabetes mellitus (DM). This study was designed to elucidate the effects of DMC on baroreflexes in streptozocin (STZ)-induced diabetic rats with hyperlipoidemia. Wistar rats were randomly divided into three groups: untreated controls, rats pretreated STZ and high lipids (a diabetes model or DM rats), and DM rats treated with DMC. The baroreflex sensitivity was examined during intravenous injection of phenylephrine (PE) or sodium nitroprusside (SNP) and quantified by the change in heart rate over the change in mean arterial blood pressure (ΔHR/ΔMABP). Morphological remodeling of baroreceptors was analyzed by transmission electron microscopy (TEM). The mRNA levels and expression of GluR2 and a GABAA receptor subunit were measured by quantitative RT-PCR and Western blotting. Compared to untreated DM rats, DMC significantly elevated the ratio of ΔHR/ΔMABP by enhancing the compensatory reduction in HR (-ΔHR) in response to PE-induced hypertension (+ΔMABP) (P < 0.05). In the presence of SNP, DMC increased the ΔMABP (P < 0.05). In addition, DMC markedly shortened the duration of blood pressure changes elicited by PE or SNP in DM rats compared to the untreated DM group (P < 0.05). Electron microscopy revealed disrupted myelin sheaths, swollen ER, and lysed mitochondria in the nucleus ambiguous (NAm) DM rats. These signs of neuropathology were largely prevented by treatment with DMC for 30 days. Treatment with DMC elevated both mRNA and protein level of GluR2 in the NAm of DM rats, but had no effect on GABAA receptor expression. The Daming capsule partially reversed the parasympathetic baroreflex impairment observed in STZ-induced diabetic rats with hyperlipoidemia. Treatment with DMC also prevented the degeneration of neurons and myelinated axons in the brain stem NAm and reversed the down-regulation of GluR2 mRNA. Rescue of NAm function may contribute to the medicinal properties of DMC in diabetic rats.

  7. Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus

    PubMed Central

    Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

    2007-01-01

    Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566

  8. Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus.

    PubMed

    Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

    2007-09-25

    Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC(50) values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins.

  9. Conformation change of tRNA/sub Glu/ in the complex with glutamyl-tRNA synthetase is required for the specific binding of L-glutamate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hara-Yokoyama, M.; Yokoyama, S.; Miyazawa, T.

    1986-11-04

    The binding of Thermus thermophilus glutamyl-tRNA synthetase (GluRS) with T. thermophilus tRNA/sup Glu/, Escherichia coli tRNA/sup Glu/, and amino acids was studied by fluorescence measurements. In the absence of tRNA/sup Glu/, GluRS binds with D-glutamate as well as L-glutamate. However, in the presence of E.coli tRNA/sup Glu/, GluRS binds specifically with L-glutamate. The KCl effects on the Michaelis constants (K/sub m/) for tRNA/sup Glu/, L-glutamate, and ATP were studied for the aminoacylation of the homologous tRNA/sup Glu/ and heterologous tRNA/sup Glu/ species. As the KCl concentration is raised from 0 to 100 mM, the K/sub m/ value for L-glutamate inmore » the heterologous system is remarkably increased whereas the K/sub m/ value for L-glutamate in the homologous system is only slightly increased. The circular dichroism analyses were made mainly of the bands due to the 2-thiouridine derivatives of tRNA/sup Glu/ in the complex. The conformation change of T. thermophilus tRNA/sup Glu/ upon complex formation with GluRS is not affected by addition of KCl. In contrast, the heterologous tRNA/sup Glu/GluRS complex is in equilibrium of two forms that depends on KCl concentration. The predominant form at low KCl concentration is closely related to the small K/sub m/ value for L-glutamate. In this form of the complex, the conformation of tRNA/sup Glu/ is appreciably different from that of free molecule. Accordingly, such a conformation change of tRNA/sup Glu/ in the complex with GluRS is required for the specific binding of L-glutamate as the substrate.« less

  10. Capsaicin-induced glutamate release is implicated in nociceptive processing through activation of ionotropic glutamate receptors and group I metabotropic glutamate receptor in primary afferent fibers.

    PubMed

    Jin, You-Hong; Yamaki, Fumiko; Takemura, Motohide; Koike, Yuichi; Furuyama, Akira; Yonehara, Norifumi

    2009-02-01

    Glutamate (Glu) is the major excitatory neurotransmitter in the central nervous system. The role of peripheral Glu and Glu receptors (GluRs) in nociceptive transmission is, however, still unclear. In the present study, we examined Glu levels released in the subcutaneous perfusate of the rat hind instep using a microdialysis catheter and the thermal withdrawal latency using the Plantar Test following injection of drugs associated with GluRs with/without capsaicin into the hindpaw. The injection of capsaicin into the rat hind instep caused an increase of Glu level in the s.c. perfusate. Capsaicin also significantly decreased withdrawal latency to irradiation. These effects of capsaicin were inhibited by pretreatment with capsazepine, a transient receptor potential vanilloid receptor 1 (TRPV1) competitive antagonist. Capsaicin-induced Glu release was also suppressed by combination with each antagonist of ionotropic GluRs (iGluRs: NMDA/AMPA receptors) and group I metabotropic GluR (mGluR), but not group II and group III mGluRs. Furthermore, these GluRs antagonists showed remarkable inhibition against capsaicin-induced thermal hyperalgesia. These results suggest that Glu is released from the peripheral endings of small-diameter afferent fibers by noxious stimulation and then activates peripheral iGluRs and group I mGluR in development and/or maintenance of nociception. Furthermore, the activation of peripheral NMDA/AMPA receptors and group I mGluR may be important in mechanisms whereby capsaicin evokes nociceptive responses.

  11. Effect of Progesterone on Cerebral Vasospasm and Neurobehavioral Outcomes in a Rodent Model of Subarachnoid Hemorrhage.

    PubMed

    Turan, Nefize; Miller, Brandon A; Huie, J Russell; Heider, Robert A; Wang, Jun; Wali, Bushra; Yousuf, Seema; Ferguson, Adam R; Sayeed, Iqbal; Stein, Donald G; Pradilla, Gustavo

    2018-02-01

    Subarachnoid hemorrhage (SAH) induces widespread inflammation leading to cellular injury, vasospasm, and ischemia. Evidence suggests that progesterone (PROG) can improve functional recovery in acute brain injury owing to its anti-inflammatory and neuroprotective properties, which could also be beneficial in SAH. We hypothesized that PROG treatment attenuates inflammation-mediated cerebral vasospasm and microglial activation, improves synaptic connectivity, and ameliorates functional recovery after SAH. We investigated the effect of PROG in a cisternal SAH model in adult male C57BL/6 mice. Neurobehavioral outcomes were evaluated using rotarod latency and grip strength tests. Basilar artery perimeter, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid glutamate receptor 1 (GluR1)/synaptophysin colocalization, and Iba-1 immunoreactivity were quantified histologically. PROG (8 mg/kg) significantly improved rotarod latency at day 6 and grip strength at day 9. PROG-treated mice had significantly reduced basilar artery vasospasm at 24 hours. GluR1/synaptophysin colocalization, indicative of synaptic GluR1, was significantly reduced in the SAH+Vehicle group at 24 hours, and PROG treatment significantly attenuated this reduction. PROG treatment significantly reduced microglial cell activation and proliferation in cerebellum and cortex but not in the brainstem at 10 days. PROG treatment ameliorated cerebral vasospasm, reduced microglial activation, restored synaptic GluR1 localization, and improved neurobehavioral performance in a murine model of SAH. These results provide a rationale for further translational testing of PROG therapy in SAH. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Glutamate receptor mutations in psychiatric and neurodevelopmental disorders

    PubMed Central

    Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Àlex

    2014-01-01

    Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications. PMID:24605182

  13. Glutamate receptor mutations in psychiatric and neurodevelopmental disorders.

    PubMed

    Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Alex

    2014-01-01

    Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications.

  14. Comparative analysis of A-to-I editing in human and non-human primate brains reveals conserved patterns and context-dependent regulation of RNA editing.

    PubMed

    O'Neil, Richard T; Wang, Xiaojing; Morabito, Michael V; Emeson, Ronald B

    2017-04-06

    A-to-I RNA editing is an important process for generating molecular diversity in the brain through modification of transcripts encoding several proteins important for neuronal signaling. We investigated the relationships between the extent of editing at multiple substrate transcripts (5HT2C, MGLUR4, CADPS, GLUR2, GLUR4, and GABRA3) in brain tissue obtained from adult humans and rhesus macaques. Several patterns emerged from these studies revealing conservation of editing across primate species. Additionally, variability in the human population allows us to make novel inferences about the co-regulation of editing at different editing sites and even across different brain regions.

  15. Glutamate increases pancreatic cancer cell invasion and migration via AMPA receptor activation and Kras-MAPK signaling.

    PubMed

    Herner, Alexander; Sauliunaite, Danguole; Michalski, Christoph W; Erkan, Mert; De Oliveira, Tiago; Abiatari, Ivane; Kong, Bo; Esposito, Irene; Friess, Helmut; Kleeff, Jörg

    2011-11-15

    Glutamate has been implicated in tumorigenesis through activation of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors (AMPAR). However, the function of a glutamate-to-AMPAR signal in pancreatic ductal adenocarcinoma (PDAC) has remained elusive. We now show that glutamate-mediated AMPA receptor activation increases invasion and migration of pancreatic cancer cells via activation of the classical MAPK pathway. Glutamate levels were increased in pancreatic cancer accompanied by downregulation of GluR subunits 1, 2, and 4. In pancreatic cancer precursor lesions, pancreatic intraepithelial neoplasia (PanIN), GluR1 subunit levels were strikingly and step-wise increased but its expression was rare in PDAC. Pharmacological inhibition or RNAi-mediated suppression of GluR1 or GluR2 did not affect cancer cell growth but significantly decreased invasion. In a K-ras wildtype cell line, AMPA receptor activation enhanced K-ras activity and--further downstream--phosphorylation of p38 and of p44/42. Preemptive blockade of AMPA receptors in a mouse model of pancreatic cancer inhibited tumor cell settling. AMPA receptor activation thus not only activates MAPK signalling but also directly increases activity of K-ras. Glutamate might serve as a molecular switch that decreases the threshold of K-ras-induced oncogenic signalling and increases the chance of malignant transformation of pancreatic cancer precursor lesions. Copyright © 2011 UICC.

  16. ERK-GluR1 phosphorylation in trigeminal spinal subnucleus caudalis neurons is involved in pain associated with dry tongue.

    PubMed

    Nakaya, Yuka; Tsuboi, Yoshiyuki; Okada-Ogawa, Akiko; Shinoda, Masamichi; Kubo, Asako; Chen, Jui Yen; Noma, Noboru; Batbold, Dulguun; Imamura, Yoshiki; Sessle, Barry J; Iwata, Koichi

    2016-01-01

    Dry mouth is known to cause severe pain in the intraoral structures, and many dry mouth patients have been suffering from intraoral pain. In development of an appropriate treatment, it is crucial to study the mechanisms underlying intraoral pain associated with dry mouth, yet the detailed mechanisms are not fully understood. To evaluate the mechanisms underlying pain related to dry mouth, the dry-tongue rat model was developed. Hence, the mechanical or heat nocifensive reflex, the phosphorylated extracellular signal-regulated kinase and phosphorylated GluR1-IR immunohistochemistries, and the single neuronal activity were examined in the trigeminal spinal subnucleus caudalis of dry-tongue rats. The head-withdrawal reflex threshold to mechanical, but not heat, stimulation of the tongue was significantly decreased on day 7 after tongue drying. The mechanical, but not heat, responses of trigeminal spinal subnucleus caudalis nociceptive neurons were significantly enhanced in dry-tongue rats compared to sham rats on day 7. The number of phosphorylated extracellular signal-regulated kinase-immunoreactive cells was also significantly increased in the trigeminal spinal subnucleus caudalis following noxious stimulation of the tongue in dry-tongue rats compared to sham rats on day 7. The decrement of the mechanical head-withdrawal reflex threshold (HWT) was reversed during intracisternal administration of the mitogen-activated protein kinase kinase 1 inhibitor, PD98059. The trigeminal spinal subnucleus caudalis neuronal activities and the number of phosphorylated extracellular signal-regulated kinase-immunoreactive cells following noxious mechanical stimulation of dried tongue were also significantly decreased following intracisternal administration of PD98059 compared to vehicle-administrated rats. Increased number of the phosphorylated GluR1-IR cells was observed in the trigeminal spinal subnucleus caudalis of dry-tongue rats, and the number of phosphorylated GluR1-IR cells was significantly reduced in PD98059-administrated rats compared to the vehicle-administrated tongue-dry rats. These findings suggest that the pERK-pGluR1 cascade is involved in central sensitization of trigeminal spinal subnucleus caudalis nociceptive neurons, thus resulting in tongue mechanical hyperalgesia associated with tongue drying. © The Author(s) 2016.

  17. Functional kainate-selective glutamate receptors in cultured hippocampal neurons.

    PubMed

    Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B

    1993-12-15

    Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors.

  18. Functional kainate-selective glutamate receptors in cultured hippocampal neurons.

    PubMed Central

    Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B

    1993-01-01

    Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors. PMID:7505445

  19. Contextual Information Drives the Reconsolidation-Dependent Updating of Retrieved Fear Memories

    PubMed Central

    Jarome, Timothy J; Ferrara, Nicole C; Kwapis, Janine L; Helmstetter, Fred J

    2015-01-01

    Stored memories enter a temporary state of vulnerability following retrieval known as ‘reconsolidation', a process that can allow memories to be modified to incorporate new information. Although reconsolidation has become an attractive target for treatment of memories related to traumatic past experiences, we still do not know what new information triggers the updating of retrieved memories. Here, we used biochemical markers of synaptic plasticity in combination with a novel behavioral procedure to determine what was learned during memory reconsolidation under normal retrieval conditions. We eliminated new information during retrieval by manipulating animals' training experience and measured changes in proteasome activity and GluR2 expression in the amygdala, two established markers of fear memory lability and reconsolidation. We found that eliminating new contextual information during the retrieval of memories for predictable and unpredictable fear associations prevented changes in proteasome activity and glutamate receptor expression in the amygdala, indicating that this new information drives the reconsolidation of both predictable and unpredictable fear associations on retrieval. Consistent with this, eliminating new contextual information prior to retrieval prevented the memory-impairing effects of protein synthesis inhibitors following retrieval. These results indicate that under normal conditions, reconsolidation updates memories by incorporating new contextual information into the memory trace. Collectively, these results suggest that controlling contextual information present during retrieval may be a useful strategy for improving reconsolidation-based treatments of traumatic memories associated with anxiety disorders such as post-traumatic stress disorder. PMID:26062788

  20. Dominant negative mutant of ionotropic glutamate receptor subunit GluR3: implications for the role of a cysteine residue for its channel activity and pharmacological properties.

    PubMed Central

    Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K

    1997-01-01

    We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754

  1. Sorting of β1-Adrenergic Receptors Is Mediated by Pathways That Are Either Dependent on or Independent of Type I PDZ, Protein Kinase A (PKA), and SAP97*

    PubMed Central

    Nooh, Mohammed M.; Chumpia, Maryanne M.; Hamilton, Thomas B.; Bahouth, Suleiman W.

    2014-01-01

    The β1-adrenergic receptor (β1-AR) is a target for treatment of major cardiovascular diseases, such as heart failure and hypertension. Recycling of agonist-internalized β1-AR is dependent on type I PSD-95/DLG/ZO1 (PDZ) in the C-tail of the β1-AR and on protein kinase A (PKA) activity (Gardner, L. A., Naren, A. P., and Bahouth, S. W. (2007) J. Biol. Chem. 282, 5085–5099). We explored the effects of point mutations in the PDZ and in the activity of PKA on recycling of the β1-AR and its binding to the PDZ-binding protein SAP97. These studies indicated that β1-AR recycling was inhibited by PKA inhibitors and by mutations in the PDZ that interfered with SAP97 binding. The trafficking effects of short sequences differing in PDZ and SAP97 binding were examined using chimeric mutant β1-AR. β1-AR chimera containing the type I PDZ of the β2-adrenergic receptor that does not bind to SAP97 failed to recycle except when serine 312 was mutated to aspartic acid. β1-AR chimera with type I PDZ sequences from the C-tails of aquaporin-2 or GluR1 recycled in a SAP97- and PKA-dependent manner. Non-PDZ β1-AR chimera derived from μ-opioid, dopamine 1, or GluR2 receptors promoted rapid recycling of chimeric β1-AR in a SAP97- and PKA-independent manner. Moreover, the nature of the residue at position −3 in the PDZ regulated whether the β1-AR was internalized alone or in complex with SAP97. These results indicate that divergent pathways were involved in trafficking the β1-AR and provide a roadmap for its trafficking via type I PDZs versus non-PDZs. PMID:24324269

  2. Dopamine D1 vs D5 receptor-dependent induction of seizures in relation to DARPP-32, ERK1/2 and GluR1-AMPA signalling

    PubMed Central

    O’Sullivan, Gerard J.; Dunleavy, Mark; Hakansson, Kerstin; Clementi, Mario; Kinsella, Anthony; Croke, David T.; Drago, John; Fienberg, Allen A.; Greengard, Paul; Sibley, David R.; Fisone, Gilberto; Henshall, David C.; Waddington, John L.

    2013-01-01

    Summary Recent reports have shown that the selective dopamine D1-like agonist SKF 83822 [which stimulates adenylate cyclase, but not phospholipase C] induces prominent behavioral seizures in mice, whereas its benzazepine congener SKF 83959 [which stimulates phospholipase C, but not adenylate cyclase] does not. To investigate the relative involvement of D1 vs D5 receptors in mediating seizures, ethological behavioral topography and cortical EEGs were recorded in D1, D5 and DARPP-32 knockout mice in response to a convulsant dose of SKF 83822. SKF 83822-induced behavioral and EEG seizures were gene dose-dependently abolished in D1 knockouts. In both heterozygous and homozygous D5 knockouts, the latency to first seizure was significantly increased and total EEG seizures were reduced relative to wild-types. The majority (60%) of homozygous DARPP-32 knockouts did not have seizures; of those having seizures (40%), the latency to first seizure was significantly increased and the number of high amplitude, high frequency polyspike EEG events was reduced. In addition, immunoblotting was performed to investigate downstream intracellular signalling mechanisms at D1-like receptors following challenge with SKF 83822 and SKF 83959. In wild-types administered SKF 83822, levels of ERK1/2 and GluR1 AMPA receptor phosphorylation increased two-fold in both the striatum and hippocampus; in striatal slices DARPP-32 phosphorylation at Thr34 increased five-fold relative to vehicle-treated controls. These findings indicate that D1, and to a lesser extent D5, receptor coupling to DARPP-32, ERK1/2 and glutamatergic signalling is involved in mediating the convulsant effects of SKF 83822. PMID:18367215

  3. Novel nootropic drug sunifiram improves cognitive deficits via CaM kinase II and protein kinase C activation in olfactory bulbectomized mice.

    PubMed

    Moriguchi, Shigeki; Tanaka, Tomoya; Tagashira, Hideaki; Narahashi, Toshio; Fukunaga, Kohji

    2013-04-01

    Alzheimer's disease (AD) shows degeneration of the cholinergic system in the medial septum, thereby eliciting down-regulation of the olfactory function in patients. We have previously reported that olfactory bulbectomized (OBX) mice show hippocampus-dependent memory impairment as assessed by memory-related behavioral tasks and hippocampal long-term potentiation (LTP). In the present study, we focused whether novel pyrrolidone nootropic drug sunifiram improves both memory impairment and depression observed in OBX mice. OBX mice were administered once a day for 7-12 days with sunifiram (0.01-1.0mg/kg p.o.) from 10 days after operation with or without gavestinel (10mg/kg i.p.), which is glycine-binding site inhibitor of N-methyl-d-aspartate receptor (NMDAR). The spatial reference memory assessed by Y-maze and short-term memory assessed by novel object recognition task were significantly improved by sunifiram treatment in OBX mice. Sunifiram also restored hippocampal LTP injured in OBX mice without treatment with gavestinel. By contrast, sunifiram treatment did not ameliorate the depressive behaviors assessed by tail suspension task in OBX mice. Notably, sunifiram treatment restored CaMKIIα (Thr-286) autophosphorylation and GluR1 (Ser-831) phosphorylation in the hippocampal CA1 region from OBX mice to the levels of control mice. Likewise, sunifiram treatment improved PKCα (Ser-657) autophosphorylation and NR1 (Ser-896) phosphorylation to the control levels. Stimulation of CaMKII and PKC autophosphorylation by sunifiram was significantly inhibited by pre-treatment with gavestinel. However, sunifiram treatment did not affect the phosphorylation of CaMKIV (Thr-196) and ERK. Taken together, sunifiram ameliorates OBX-induced deficits of memory-related behaviors and impaired LTP in the hippocampal CA1 region via stimulation of glycine-binding site of NMDAR. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Ethanol-mediated facilitation of AMPA receptor function in the dorsomedial striatum: implications for alcohol drinking behavior.

    PubMed

    Wang, Jun; Ben Hamida, Sami; Darcq, Emmanuel; Zhu, Wenheng; Gibb, Stuart L; Lanfranco, Maria Fe; Carnicella, Sebastien; Ron, Dorit

    2012-10-24

    We found previously that acute ex vivo as well as repeated cycles of in vivo ethanol exposure and withdrawal, including excessive voluntary consumption of ethanol, produces a long-lasting increase in the activity of NR2B-containing NMDA receptors (NR2B-NMDARs) in the dorsomedial striatum (DMS) of rats (Wang et al., 2010a). Activation of NMDARs is required for the induction of long-term potentiation (LTP) of AMPA receptor (AMPAR)-mediated synaptic response. We therefore examined whether the ethanol-mediated upregulation of NMDAR activity alters the induction of LTP in the DMS. We found that ex vivo acute exposure of striatal slices to, and withdrawal from, ethanol facilitates the induction of LTP in DMS neurons, which is abolished by the inhibition of NR2B-NMDARs. We also report that repeated systemic administration of ethanol causes an NR2B-NMDAR-dependent facilitation of LTP in the DMS. LTP is mediated by the insertion of AMPAR subunits into the synaptic membrane, and we found that repeated systemic administration of ethanol, as well as cycles of excessive ethanol consumption and withdrawal, produced a long-lasting increase in synaptic localization of the GluR1 and GluR2 subunits of AMPARs in the DMS. Importantly, we report that inhibition of AMPARs in the DMS attenuates operant self-administration of ethanol, but not of sucrose. Together, our data suggest that aberrant synaptic plasticity in the DMS induced by repeated cycles of ethanol exposure and withdrawal contributes to the molecular mechanisms underlying the development and/or maintenance of excessive ethanol consumption.

  5. Changes of several brain receptor complexes in the cerebral cortex of patients with Alzheimer disease: probable new potential pharmaceutical targets.

    PubMed

    Falsafi, Soheil Keihan; Roßner, Steffen; Ghafari, Maryam; Groessl, Michael; Morawski, Markus; Gerner, Christopher; Lubec, Gert

    2014-01-01

    Although Alzheimer disease (AD) has been linked to defects in major brain receptors, studies thus far have been limited to the determination of receptor subunits or specific ligand binding studies. However, the availability of current technology enables the determination and quantification of brain receptor complexes. Thus, we examined levels of native receptor complexes in the brains of patients with AD. Cortical tissue was obtained from control subjects (n = 12 females and 12 males) and patients with AD (n = 12 females and 12 males) within a 3-h postmortem time period. The tissues were kept frozen until further biochemical analyses. Membrane proteins were extracted and subsequently enriched by ultracentrifugation using a sucrose gradient. Membrane proteins were then electrophoresed onto native gels and immunoblotted using antibodies against individual brain receptors. We found that the levels were comparable for complexes containing GluR2, GluR3 and GluR4 as well as 5-HT1A. Moreover, the levels of complexes containing muscarinic AChR M1, NR1 and GluR1 were significantly increased in male patients with AD. Nicotinic AChRs 4 and 7 as well as dopaminergic receptors D1 and D2 were also increased in males and females with AD. These findings reveal a pattern of altered receptor complex levels that may contribute to the deterioration of the concerted activity of these receptors and thus result in cognitive deficits observed in patients with AD. It should be emphasised that receptor complexes function as working units rather than individual subunits. Thus, the receptor deficits identified may be relevant for the design of experimental therapies. Therefore, specific pharmacological modulation of these receptors is within the pharmaceutical repertoire.

  6. Neuron-to-glia signaling mediated by excitatory amino acid receptors regulates ErbB receptor function in astroglial cells of the neuroendocrine brain.

    PubMed

    Dziedzic, Barbara; Prevot, Vincent; Lomniczi, Alejandro; Jung, Heike; Cornea, Anda; Ojeda, Sergio R

    2003-02-01

    Hypothalamic astroglial erbB tyrosine kinase receptors are required for the timely initiation of mammalian puberty. Ligand-dependent activation of these receptors sets in motion a glia-to-neuron signaling pathway that prompts the secretion of luteinizing hormone-releasing hormone (LHRH), the neuropeptide controlling sexual development, from hypothalamic neuroendocrine neurons. The neuronal systems that may regulate this growth factor-mediated back signaling to neuroendocrine neurons have not been identified. Here we demonstrate that hypothalamic astrocytes contain metabotropic receptors of the metabotropic glutamate receptor 5 subtype and the AMPA receptor subunits glutamate receptor 2 (GluR2) and GluR3. As in excitatory synapses, these receptors are in physical association with their respective interacting/clustering proteins Homer and PICK1. In addition, they are associated with erbB-1 and erbB-4 receptors. Concomitant activation of astroglial metabotropic and AMPA receptors results in the recruitment of erbB tyrosine kinase receptors and their respective ligands to the glial cell membrane, transactivation of erbB receptors via a mechanism requiring metalloproteinase activity, and increased erbB receptor gene expression. By facilitating erbB-dependent signaling and promoting erbB receptor gene expression in astrocytes, a neuron-to-glia glutamatergic pathway may represent a basic cell-cell communication mechanism used by the neuroendocrine brain to coordinate the facilitatory transsynaptic and astroglial input to LHRH neurons during sexual development.

  7. Phenylbutyrate ameliorates cognitive deficit and reduces tau pathology in an Alzheimer's disease mouse model.

    PubMed

    Ricobaraza, Ana; Cuadrado-Tejedor, Mar; Pérez-Mediavilla, Alberto; Frechilla, Diana; Del Río, Joaquin; García-Osta, Ana

    2009-06-01

    Chromatin modification through histone acetylation is a molecular pathway involved in the regulation of transcription underlying memory storage. Sodium 4-phenylbutyrate (4-PBA) is a well-known histone deacetylase inhibitor, which increases gene transcription of a number of genes, and also exerts neuroprotective effects. In this study, we report that administration of 4-PBA reversed spatial learning and memory deficits in an established mouse model of Alzheimer's disease (AD) without altering beta-amyloid burden. We also observed that the phosphorylated form of tau was decreased in the AD mouse brain after 4-PBA treatment, an effect probably due to an increase in the inactive form of the glycogen synthase kinase 3beta (GSK3beta). Interestingly, we found a dramatic decrease in brain histone acetylation in the transgenic mice that may reflect an indirect transcriptional repression underlying memory impairment. The administration of 4-PBA restored brain histone acetylation levels and, as a most likely consequence, activated the transcription of synaptic plasticity markers such as the GluR1 subunit of the AMPA receptor, PSD95, and microtubule-associated protein-2. The results suggest that 4-PBA, a drug already approved for clinical use, may provide a novel approach for the treatment of AD.

  8. Presynaptic establishment of the synaptic cleft extracellular matrix is required for post-synaptic differentiation

    PubMed Central

    Rohrbough, Jeffrey; Rushton, Emma; Woodruff, Elvin; Fergestad, Tim; Vigneswaran, Krishanthan; Broadie, Kendal

    2007-01-01

    Formation and regulation of excitatory glutamatergic synapses is essential for shaping neural circuits throughout development. In a Drosophila genetic screen for synaptogenesis mutants, we identified mind the gap (mtg), which encodes a secreted, extracellular N-glycosaminoglycan-binding protein. MTG is expressed neuronally and detected in the synaptic cleft, and is required to form the specialized transsynaptic matrix that links the presynaptic active zone with the post-synaptic glutamate receptor (GluR) domain. Null mtg embryonic mutant synapses exhibit greatly reduced GluR function, and a corresponding loss of localized GluR domains. All known post-synaptic signaling/scaffold proteins functioning upstream of GluR localization are also grossly reduced or mislocalized in mtg mutants, including the dPix–dPak–Dock cascade and the Dlg/PSD-95 scaffold. Ubiquitous or neuronally targeted mtg RNA interference (RNAi) similarly reduce post-synaptic assembly, whereas post-synaptically targeted RNAi has no effect, indicating that presynaptic MTG induces and maintains the post-synaptic pathways driving GluR domain formation. These findings suggest that MTG is secreted from the presynaptic terminal to shape the extracellular synaptic cleft domain, and that the cleft domain functions to mediate transsynaptic signals required for post-synaptic development. PMID:17901219

  9. Dual-targeted tRNA-dependent amidotransferase ensures both mitochondrial and chloroplastic Gln-tRNAGln synthesis in plants

    PubMed Central

    Pujol, Claire; Bailly, Marc; Kern, Daniel; Maréchal-Drouard, Laurence; Becker, Hubert; Duchêne, Anne-Marie

    2008-01-01

    Aminoacyl-tRNAs are generally formed by direct attachment of an amino acid to tRNAs by aminoacyl-tRNA synthetases, but Gln-tRNA is an exception to this rule. Gln-tRNAGln is formed by this direct pathway in the eukaryotic cytosol and in protists or fungi mitochondria but is formed by an indirect transamidation pathway in most of bacteria, archaea, and chloroplasts. We show here that the formation of Gln-tRNAGln is also achieved by the indirect pathway in plant mitochondria. The mitochondrial-encoded tRNAGln, which is the only tRNAGln present in mitochondria, is first charged with glutamate by a nondiscriminating GluRS, then is converted into Gln-tRNAGln by a tRNA-dependent amidotransferase (AdT). The three subunits GatA, GatB, and GatC are imported into mitochondria and assemble into a functional GatCAB AdT. Moreover, the mitochondrial pathway of Gln-tRNAGln formation is shared with chloroplasts as both the GluRS, and the three AdT subunits are dual-imported into mitochondria and chloroplasts. PMID:18441100

  10. Association of the AMPA receptor-related postsynaptic density proteins GRIP and ABP with subsets of glutamate-sensitive neurons in the rat retina.

    PubMed

    Gábriel, Robert; de Souza, Sunita; Ziff, Edward B; Witkovsky, Paul

    2002-07-22

    We used specific antibodies against two postsynaptic density proteins, GRIP (glutamate receptor interacting protein) and ABP (AMPA receptor-binding protein), to study their distribution in the rat retina. In the central nervous system, it has been shown that both proteins bind strongly to the AMPA glutamate receptor (GluR) 2/3 subunits, but not other GluRs, through a set of three PDZ domains. Western blots detected a single GRIP protein that was virtually identical in retina and brain, whereas retinal ABP corresponded to only one of three ABP peptides found in brain. The retinal distributions of GluR2/3, GRIP, and ABP immunoreactivity (IR) were similar but not identical. GluR2/3 immunoreactivity (IR) was abundant in both plexiform layers and in large perikarya. ABP IR was concentrated in large perikarya but was sparse in the plexiform layers, whereas GRIP IR was relatively more abundant in the plexiform layers than in perikarya. Immunolabel for these three antibodies consisted of puncta < or = 0.2 microm in diameter. The cellular localization of GRIP and ABP IR was examined by double labeling subclasses of retinal neuron with characteristic marker proteins, e.g., calbindin. GRIP, ABP, and GluR2/3 IR were detected in horizontal cells, dopaminergic and glycinergic AII amacrine cells and large ganglion cells. Immunolabel was absent in rod bipolar and weak or absent in cholinergic amacrine cells. By using the tyramide method of signal amplification, a colocalization of GluR2/3 was found with either GRIP or ABP in horizontal cell terminals, and perikarya of amacrine and ganglion cells. Our results show that ABP and GRIP colocalize with GluR2/3 in particular subsets of retinal neuron, as was previously established for certain neurons in the brain. Copyright 2002 Wiley-Liss, Inc.

  11. Spinal electro-magnetic stimulation combined with transgene delivery of neurotrophin NT-3 and exercise: novel combination therapy for spinal contusion injury

    PubMed Central

    Petrosyan, Hayk A.; Alessi, Valentina; Hunanyan, Arsen S.; Sisto, Sue A.

    2015-01-01

    Our recent terminal experiments revealed that administration of a single train of repetitive spinal electromagnetic stimulation (sEMS; 35 min) enhanced synaptic plasticity in spinal circuitry following lateral hemisection spinal cord injury. In the current study, we have examined effects of repetitive sEMS applied as a single train and chronically (5 wk, every other day) following thoracic T10 contusion. Chronic studies involved examination of systematic sEMS administration alone and combined with exercise training and transgene delivery of neurotrophin [adeno-associated virus 10-neurotrophin 3 (AAV10-NT3)]. Electrophysiological intracellular/extracellular recordings, immunohistochemistry, behavioral testing, and anatomical tracing were performed to assess effects of treatments. We found that administration of a single sEMS train induced transient facilitation of transmission through preserved lateral white matter to motoneurons and hindlimb muscles in chronically contused rats with effects lasting for at least 2 h. These physiological changes associated with increased immunoreactivity of GluR1 and GluR2/3 glutamate receptors in lumbar neurons. Systematic administration of sEMS alone for 5 wk, however, was unable to induce cumulative improvements of transmission in spinomuscular circuitry or improve impaired motor function following thoracic contusion. Encouragingly, chronic administration of sEMS, followed by exercise training (running in an exercise ball and swimming), induced the following: 1) sustained strengthening of transmission to lumbar motoneurons and hindlimb muscles, 2) better retrograde transport of anatomical tracer, and 3) improved locomotor function. Greatest improvements were seen in the group that received exercise combined with sEMS and AAV-NT3. PMID:26424579

  12. Spinal electro-magnetic stimulation combined with transgene delivery of neurotrophin NT-3 and exercise: novel combination therapy for spinal contusion injury.

    PubMed

    Petrosyan, Hayk A; Alessi, Valentina; Hunanyan, Arsen S; Sisto, Sue A; Arvanian, Victor L

    2015-11-01

    Our recent terminal experiments revealed that administration of a single train of repetitive spinal electromagnetic stimulation (sEMS; 35 min) enhanced synaptic plasticity in spinal circuitry following lateral hemisection spinal cord injury. In the current study, we have examined effects of repetitive sEMS applied as a single train and chronically (5 wk, every other day) following thoracic T10 contusion. Chronic studies involved examination of systematic sEMS administration alone and combined with exercise training and transgene delivery of neurotrophin [adeno-associated virus 10-neurotrophin 3 (AAV10-NT3)]. Electrophysiological intracellular/extracellular recordings, immunohistochemistry, behavioral testing, and anatomical tracing were performed to assess effects of treatments. We found that administration of a single sEMS train induced transient facilitation of transmission through preserved lateral white matter to motoneurons and hindlimb muscles in chronically contused rats with effects lasting for at least 2 h. These physiological changes associated with increased immunoreactivity of GluR1 and GluR2/3 glutamate receptors in lumbar neurons. Systematic administration of sEMS alone for 5 wk, however, was unable to induce cumulative improvements of transmission in spinomuscular circuitry or improve impaired motor function following thoracic contusion. Encouragingly, chronic administration of sEMS, followed by exercise training (running in an exercise ball and swimming), induced the following: 1) sustained strengthening of transmission to lumbar motoneurons and hindlimb muscles, 2) better retrograde transport of anatomical tracer, and 3) improved locomotor function. Greatest improvements were seen in the group that received exercise combined with sEMS and AAV-NT3.

  13. Organophosphates dysregulate dopamine signaling, glutamatergic neurotransmission, and induce neuronal injury markers in striatum

    PubMed Central

    Torres-Altoro, Melissa I.; Mathur, Brian N.; Drerup, Justin M.; Thomas, Rachel; Lovinger, David; O’Callaghan, James P.; Bibb, James A.

    2011-01-01

    The neurological effects of organophosphate pesticides, commonly used on foods and in households, are an important public health concern. Furthermore, subclinical exposure to combinations of organophosphates is implicated in Gulf War illness. Here we characterized the effects of the broadly-used insecticide chlorpyrifos on dopamine and glutamatergic neurotransmission effectors in corticostriatal motor/reward circuitry. Chlorpyrifos potentiated PKA-dependent phosphorylation of the striatal protein DARPP-32 and the GluR1 subunit of AMPA receptors in mouse brain slices. It also increased GluR1 phosphorylation by PKA when administered systemically. This correlated with enhanced glutamate release from cortical projections in rat striatum. Similar effects were induced by the sarin congener, diisopropyl fluorophosphate, alone or in combination with the putative neuroprotectant, pyridostigmine bromide and the pesticide DEET. This combination, meant to mimic the neurotoxicant exposure encountered by veterans of the 1991 Persian Gulf War, also induced hyperphosphorylation of the neurofibrillary tangle-associated protein tau. Diisopropyl fluorophosphate and pyrodostigmine bromide, alone or in combination, also increased the aberrant activity of the protein kinase, Cdk5, as indicated by conversion of its activating cofactor p35 to p25. Thus consistent with recent findings in humans and animals, organophosphate exposure causes dysregulation in the motor/reward circuitry and invokes mechanisms associated with neurological disorders and neurodegeneration. PMID:21848865

  14. Losartan Improves Impaired Nitric Oxide Synthase-Dependent Dilatation of Cerebral Arterioles in Type 1 Diabetic Rats

    PubMed Central

    Arrick, Denise M.; Sharpe, Glenda M.; Sun, Hong; Mayhan, William G.

    2009-01-01

    We examined whether activation of angiotensin-1 receptors (AT1R) could account for impaired responses of cerebral arterioles during Type 1 diabetes (T1D). First, we measured responses of cerebral arterioles in nondiabetic rats to eNOS-dependent (acetylcholine and adenosine diphosphate (ADP)) and -independent (nitroglycerin) agonists before and during application of angiotensin II. Next, we examined whether losartan could improve impaired responses of cerebral arterioles during T1D. In addition, we harvested cerebral microvessels for Western blot analysis of AT1R protein and measured production of superoxide anion by brain tissue under basal conditions and in response to angiotensin II in the absence or presence of losartan. We found that angiotensin II specifically impaired eNOS-dependent reactivity of cerebral arterioles. In addition, while losartan did not alter responses in nondiabetics, losartan restored impaired eNOS-dependent vasodilatation in diabetics. Further, AT1R protein was higher in diabetics compared to nondiabetics. Finally, superoxide production was higher in brain tissue from diabetics compared to nondiabetics under basal conditions, angiotensin II increased superoxide production in nondiabetics and diabetics, and losartan decreased basal (diabetics) and angiotensin II-induced production of superoxide (nondiabetics and diabetics). We suggest that activation of AT1R during T1D plays a critical role in impaired eNOS-dependent dilatation of cerebral arterioles. PMID:18400212

  15. Genetic Evidence for a Role for Protein Kinase A in the Maintenance of Sleep and Thalamocortical Oscillations

    PubMed Central

    Hellman, Kevin; Hernandez, Pepe; Park, Alice; Abel, Ted

    2010-01-01

    Study Objectives: Genetic manipulation of cAMP-dependent protein kinase A (PKA) in Drosophila has implicated an important role for PKA in sleep/wake state regulation. Here, we characterize the role of this signaling pathway in the regulation of sleep using electroencephalographic (EEG) and electromyographic (EMG) recordings in R(AB) transgenic mice that express a dominant negative form of the regulatory subunit of PKA in neurons within cortex and hippocampus. Previous studies have revealed that these mutant mice have reduced PKA activity that results in the impairment of hippocampus-dependent long-term memory and long-lasting forms of hippocampal synaptic plasticity. Design: PKA assays, in situ hybridization, immunoblots, and sleep studies were performed in R(AB) transgenic mice and wild-type control mice. Measurements and Results: We have found that R(AB) transgenic mice have reduced PKA activity within cortex and reduced Ser845 phosphorylation of the glutamate receptor subunit GluR1. R(AB) transgenic mice exhibit non-rapid eye movement (NREM) sleep fragmentation and increased amounts of rapid eye movement (REM) sleep relative to wild-type mice. Further, R(AB) transgenic mice have more delta power but less sigma power during NREM sleep relative to wild-type mice. After sleep deprivation, the amounts of NREM and REM sleep were comparable between wild-type and R(AB) transgenic mice. However, the homeostatic rebound of sigma power in R(AB) transgenic mice was reduced. Conclusions: Alterations in cortical synaptic receptors, impairments in sleep continuity, and alterations in sleep oscillations in R(AB) mice imply that PKA is involved not only in synaptic plasticity and memory storage but also in the regulation of sleep/wake states. Citation: Hellman K; Hernandez P; Park A; Abel T. Genetic evidence for a role for protein kinase a in the maintenance of sleep and thalamocortical oscillations. SLEEP 2010;33(1):19-28. PMID:20120617

  16. The phosphorylation status and cytoskeletal remodeling of striatal astrocytes treated with quinolinic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pierozan, Paula; Ferreira, Fernanda; Ortiz de Lima, Bárbara

    2014-04-01

    Quinolinic acid (QUIN) is a glutamate agonist which markedly enhances the vulnerability of neural cells to excitotoxicity. QUIN is produced from the amino acid tryptophan through the kynurenine pathway (KP). Dysregulation of this pathway is associated with neurodegenerative conditions. In this study we treated striatal astrocytes in culture with QUIN and assayed the endogenous phosphorylating system associated with glial fibrillary acidic protein (GFAP) and vimentin as well as cytoskeletal remodeling. After 24 h incubation with 100 µM QUIN, cells were exposed to {sup 32}P-orthophosphate and/or protein kinase A (PKA), protein kinase dependent of Ca{sup 2+}/calmodulin II (PKCaMII) or protein kinasemore » C (PKC) inhibitors, H89 (20 μM), KN93 (10 μM) and staurosporin (10 nM), respectively. Results showed that hyperphosphorylation was abrogated by PKA and PKC inhibitors but not by the PKCaMII inhibitor. The specific antagonists to ionotropic NMDA and non-NMDA (50 µM DL-AP5 and CNQX, respectively) glutamate receptors as well as to metabotropic glutamate receptor (mGLUR; 50 µM MCPG), mGLUR1 (100 µM MPEP) and mGLUR5 (10 µM 4C3HPG) prevented the hyperphosphorylation provoked by QUIN. Also, intra and extracellular Ca{sup 2+} quelators (1 mM EGTA; 10 µM BAPTA-AM, respectively) prevented QUIN-mediated effect, while Ca{sup 2+} influx through voltage-dependent Ca{sup 2+} channel type L (L-VDCC) (blocker: 10 µM verapamil) is not implicated in this effect. Morphological analysis showed dramatically altered actin cytoskeleton with concomitant change of morphology to fusiform and/or flattened cells with retracted cytoplasm and disruption of the GFAP meshwork, supporting misregulation of actin cytoskeleton. Both hyperphosphorylation and cytoskeletal remodeling were reversed 24 h after QUIN removal. Astrocytes are highly plastic cells and the vulnerability of astrocyte cytoskeleton may have important implications for understanding the neurotoxicity of QUIN in neurodegenerative disorders. - Highlights: • Quinolinic acid (QUIN) induces hypersphorylation of cytoskeletal proteins in striatal astrocytes. • Glutamate, Ca{sup 2+}, PKA and PKC are implicated in the aberrantly phosphorylated GFAP and vimentin. • QUIN induces reorganization of actin and GFAP cytoskeleton. • Hyperphosphorylation and cytoskeletal remodeling are reversed after QUIN removal. • Disruption of cytoskeleton is a cytotoxic action of QUIN in striatal astrocytes.« less

  17. Propofol inhibits invasion and proliferation of C6 glioma cells by regulating the Ca2+ permeable AMPA receptor-system xc- pathway.

    PubMed

    Wang, Xin-Yue; Li, Yan-Li; Wang, Hai-Yun; Zhu, Min; Guo, Di; Wang, Guo-Lin; Gao, Ying-Tang; Yang, Zhuo; Li, Tang; Yang, Chen-Yi; Chen, Yi-Meng

    2017-10-01

    Anesthetics are documented to affect tumors; therefore, we studied the antiglioma effect of propofol on proliferation and invasiveness of glioma cells and explored the underlying mechanism. C6 glioma cells were cultured and treated with propofol, and cell viability, invasiveness, and migration were measured. Glutamate release was measured using an enzyme-catalyzed kinetic reaction. xCT protein and α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor GluR2 subunit protein expression was assessed with Western blot analysis and immunofluorescent staining. We observed that propofol significantly inhibited C6 glioma cell viability, invasiveness, and migration and decreased glutamate release. An agonist of the cystine/glutamate antiporter system (system x c - ), N-acetylcysteine (NAC), reversed propofol's effects, and propofol could inhibit C6 glioma cell proliferation by adding excess exogenous glutamate (100μM). Finally, propofol increased the surface expression of GluR2, but decreased surface expression of xCT. The effects of propofol on surface expression of GluR2 and xCT could be rescued by (R, S)-AMPA, an agonist of Ca 2+ permeable AMPA receptor (CPAR). Thus, propofol can inhibit cell viability, invasiveness, and migration of C6 glioma cells, and the CPAR-system x c - pathway contributes to these events. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Structure and assembly mechanism for heteromeric kainate receptors.

    PubMed

    Kumar, Janesh; Schuck, Peter; Mayer, Mark L

    2011-07-28

    Native glutamate receptor ion channels are tetrameric assemblies containing two or more different subunits. NMDA receptors are obligate heteromers formed by coassembly of two or three divergent gene families. While some AMPA and kainate receptors can form functional homomeric ion channels, the KA1 and KA2 subunits are obligate heteromers which function only in combination with GluR5-7. The mechanisms controlling glutamate receptor assembly involve an initial step in which the amino terminal domains (ATD) assemble as dimers. Here, we establish by sedimentation velocity that the ATDs of GluR6 and KA2 coassemble as a heterodimer of K(d) 11 nM, 32,000-fold lower than the K(d) for homodimer formation by KA2; we solve crystal structures for the GluR6/KA2 ATD heterodimer and heterotetramer assemblies. Using these structures as a guide, we perform a mutant cycle analysis to probe the energetics of assembly and show that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Immunocytochemical localization of metabotropic (mGluR2/3 and mGluR4a) and ionotropic (GluR2/3) glutamate receptors in adrenal medullary ganglion cells.

    PubMed

    Sarría, R; Díez, J; Losada, J; Doñate-Oliver, F; Kuhn, R; Grandes, P

    2006-02-01

    The localization of metabotropic glutamate receptors of groups II (mGluR2/3) and III (mGluR4a) and the subunits 2 and 3 of alfa-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) ionotropic glutamate receptors (GluR2/3) was investigated with immunocytochemical methods in the rat adrenal gland. MGluR2/3, mGluR4a and GluR2/3 immunoreactivities were observed in large-sized, centrally located type I adrenal medullary ganglion neurons. Furthermore, the small-sized type II adrenal ganglion neurons identified by their immunoreactivity to brain nitric oxide synthase (bNOS), also expressed mGluR2/3, mGluR4a and GluR2/3. These cells were disposed in the peripheral portion of the adrenal medulla. None of the type I neurons were positively labeled for bNOS. These morphological observations suggest that activation of glutamate receptors in ganglion neurons may be instrumental in the control of adrenal endocrine systems as well as blood regulation.

  20. Distinct subunits in heteromeric kainate receptors mediate ionotropic and metabotropic function at hippocampal mossy fiber synapses.

    PubMed

    Ruiz, Arnaud; Sachidhanandam, Shankar; Utvik, Jo Kristian; Coussen, Françoise; Mulle, Christophe

    2005-12-14

    Heteromeric kainate receptors (KARs) containing both glutamate receptor 6 (GluR6) and KA2 subunits are involved in KAR-mediated EPSCs at mossy fiber synapses in CA3 pyramidal cells. We report that endogenous glutamate, by activating KARs, reversibly inhibits the slow Ca2+-activated K+ current I(sAHP) and increases neuronal excitability through a G-protein-coupled mechanism. Using KAR knockout mice, we show that KA2 is essential for the inhibition of I(sAHP) in CA3 pyramidal cells by low nanomolar concentrations of kainate, in addition to GluR6. In GluR6(-/-) mice, both ionotropic synaptic transmission and inhibition of I(sAHP) by endogenous glutamate released from mossy fibers was lost. In contrast, inhibition of I(sAHP) was absent in KA2(-/-) mice despite the preservation of KAR-mediated EPSCs. These data indicate that the metabotropic action of KARs did not rely on the activation of a KAR-mediated inward current. Biochemical analysis of knock-out mice revealed that KA2 was required for the interaction of KARs with Galpha(q/11)-proteins known to be involved in I(sAHP) modulation. Finally, the ionotropic and metabotropic actions of KARs at mossy fiber synapses were differentially sensitive to the competitive glutamate receptor ligands kainate (5 nM) and kynurenate (1 mM). We propose a model in which KARs could operate in two modes at mossy fiber synapses: through a direct ionotropic action of GluR6, and through an indirect G-protein-coupled mechanism requiring the binding of glutamate to KA2.

  1. STRIATAL-ENRICHED PROTEIN TYROSINE PHOSPHATASE (STEP) KNOCKOUT MICE HAVE ENHANCED HIPPOCAMPAL MEMORY

    PubMed Central

    Venkitaramani, Deepa V.; Moura, Paula J.; Picciotto, Marina R.; Lombroso, Paul J.

    2011-01-01

    STEP is a brain-specific phosphatase that opposes synaptic strengthening by the regulation of key synaptic signaling proteins. Previous studies suggest a possible role for STriatal-Enriched protein tyrosine Phosphatase (STEP) in learning and memory. To demonstrate the functional importance of STEP in learning and memory, we generated STEP knockout (KO) mice and examined the effect of deletion of STEP on behavioral performance, as well as the phosphorylation and expression of its substrates. Here we report that loss of STEP leads to significantly enhanced performance in hippocampal-dependent learning and memory tasks. In addition, STEP KO mice displayed greater dominance behavior, although they were normal in their motivation, motor coordination, visual acuity and social interactions. STEP KO mice displayed enhanced tyrosine phosphorylation of extracellular-signal regulated kinase 1/2 (ERK1/2), the NR2B subunit of the N-methyl-D-aspartate receptor (NMDAR), Proline-rich tyrosine kinase (Pyk2), as well as an increased phosphorylation of ERK1/2 substrates. Concomitant to the increased phosphorylation of NR2B, synaptosomal expression of NR1/NR2B NMDARs was increased in STEP KO mice, as was the GluR1/GluR2 containing α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid receptors (AMPAR), providing a potential molecular mechanism for the improved cognitive performance. The data support a role for STEP in the regulation of synaptic strengthening. The absence of STEP improves cognitive performance, and may do so by the regulation of downstream effectors necessary for synaptic transmission. PMID:21501258

  2. Boutons containing vesicular zinc define a subpopulation of synapses with low AMPAR content in rat hippocampus.

    PubMed

    Sindreu, Carlos Balet; Varoqui, Hélène; Erickson, Jeffrey D; Pérez-Clausell, Jeús

    2003-08-01

    Cortical regions of the brain stand out for their high content in synaptic zinc, which may thus be involved in synaptic function. The relative number, chemical nature and transmitter receptor profile of synapses that sequester vesicular zinc are largely unknown. To address this, we combined pre-embedding zinc histochemistry and post-embedding immunogold electron microscopy in rat hippocampus. All giant mossy fibre (MF) terminals in the CA3 region and approximately 45% of boutons making axospinous synapses in stratum radiatum in CA1 contained synaptic vesicles that stained for zinc. Both types of zinc-positive boutons selectively expressed the vesicular zinc transporter ZnT-3. Zinc-positive boutons further immunoreacted to the vesicular glutamate transporter VGLUT-1, but not to the transmitter gamma-aminobutyric acid. Most dendritic spines in CA1 immunoreacted to alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) subunits GluR1-3 (approximately 80%) and to N-methyl-D-aspartate receptor (NMDAR) subunits NR1 + NR2A/B (approximately 90%). Synapses made by zinc-positive boutons contained 40% less AMPAR particles than those made by zinc-negative boutons, whereas NMDAR counts were similar. Further analysis indicated that this was due to the reduced synaptic expression of both GluR1 and GluR2 subunits. Hence, the levels of postsynaptic AMPARs may vary according to the presence of vesicular zinc in excitatory afferents to CA1. Zinc-positive and zinc-negative synapses may represent two glutamatergic subpopulations with distinct synaptic signalling.

  3. Lead Exposure Impairs Hippocampus Related Learning and Memory by Altering Synaptic Plasticity and Morphology During Juvenile Period.

    PubMed

    Wang, Tao; Guan, Rui-Li; Liu, Ming-Chao; Shen, Xue-Feng; Chen, Jing Yuan; Zhao, Ming-Gao; Luo, Wen-Jing

    2016-08-01

    Lead (Pb) is an environmental neurotoxic metal. Pb exposure may cause neurobehavioral changes, such as learning and memory impairment, and adolescence violence among children. Previous animal models have largely focused on the effects of Pb exposure during early development (from gestation to lactation period) on neurobehavior. In this study, we exposed Sprague-Dawley rats during the juvenile stage (from juvenile period to adult period). We investigated the synaptic function and structural changes and the relationship of these changes to neurobehavioral deficits in adult rats. Our results showed that juvenile Pb exposure caused fear-conditioned memory impairment and anxiety-like behavior, but locomotion and pain behavior were indistinguishable from the controls. Electrophysiological studies showed that long-term potentiation induction was affected in Pb-exposed rats, and this was probably due to excitatory synaptic transmission impairment in Pb-exposed rats. We found that NMDA and AMPA receptor-mediated current was inhibited, whereas the GABA synaptic transmission was normal in Pb-exposed rats. NR2A and phosphorylated GluR1 expression decreased. Moreover, morphological studies showed that density of dendritic spines declined by about 20 % in the Pb-treated group. The spine showed an immature form in Pb-exposed rats, as indicated by spine size measurements. However, the length and arborization of dendrites were unchanged. Our results suggested that juvenile Pb exposure in rats is associated with alterations in the glutamate receptor, which caused synaptic functional and morphological changes in hippocampal CA1 pyramidal neurons, thereby leading to behavioral changes.

  4. Xenon reduces glutamate-, AMPA-, and kainate-induced membrane currents in cortical neurones.

    PubMed

    Dinse, A; Föhr, K J; Georgieff, M; Beyer, C; Bulling, A; Weigt, H U

    2005-04-01

    The anaesthetic, analgesic, and neuroprotective effects of xenon (Xe) are believed to be mediated by a block of the NMDA (N-methyl-D-aspartate) receptor channel. Interestingly, the clinical profile of the noble gas differs markedly from that of specific NMDA receptor antagonists. The aim of this study was, therefore, to investigate whether Xe might be less specific, also inhibiting the two other subtypes of glutamate receptor channels, such as the alpha-amino-3-hydroxy-5-methyl-4-isoxazolole propionate (AMPA) and kainate receptors. The study was performed on voltage-clamped cortical neurones from embryonic mice and SH-SY5Y cells expressing GluR6 kainate receptors. Drugs were applied by a multi-barreled fast perfusion system. Xe, dissolved at approximately 3.45 mM in aqueous solution, diminished the peak and even more the plateau of AMPA and glutamate induced currents. At the control EC(50) value for AMPA (29 microM) these reductions were by about 40 and 56% and at 3 mM glutamate the reductions were by 45 and 66%, respectively. Currents activated at the control EC(50) value for kainate (57 microM) were inhibited by 42%. Likewise, Xe showed an inhibitory effect on kainate-induced membrane currents of SH-SY5Y cells transfected with the GluR6 subunit of the kainate receptor. Xe reduced kainate-induced currents by between 35 and 60%, depending on the kainate concentration. Xe blocks not only NMDA receptors, but also AMPA and kainate receptors in cortical neurones as well as GluR6-type receptors expressed in SH-SY5Y cells. Thus, Xe seems to be rather non-specific as a channel blocker and this may contribute to the analgesic and anaesthetic potency of Xe.

  5. Somatic and neuritic spines on tyrosine hydroxylase–immunopositive cells of rat retina

    PubMed Central

    Fasoli, Anna; Dang, James; Johnson, Jeffrey S.; Gouw, Aaron H.; Iseppe, Alex Fogli; Ishida, Andrew T.

    2018-01-01

    Dopamine- and tyrosine hydroxylase–immunopositive cells (TH cells) modulate visually driven signals as they flow through retinal photoreceptor, bipolar, and ganglion cells. Previous studies suggested that TH cells release dopamine from varicose axons arborizing in the inner and outer plexiform layers after glutamatergic synapses depolarize TH cell dendrites in the inner plexiform layer and these depolarizations propagate to the varicosities. Although it has been proposed that these excitatory synapses are formed onto appendages resembling dendritic spines, spines have not been found on TH cells of most species examined to date or on TH cell somata that release dopamine when exposed to glutamate receptor agonists. By use of protocols that preserve proximal retinal neuron morphology, we have examined the shape, distribution, and synapse-related immunoreactivity of adult rat TH cells. We report here that TH cell somata, tapering and varicose inner plexiform layer neurites, and varicose outer plexiform layer neurites all bear spines, that some of these spines are immunopositive for glutamate receptor and postsynaptic density proteins (viz., GluR1, GluR4, NR1, PSD-95, and PSD-93), that TH cell somata and tapering neurites are also immunopositive for a γ-aminobutyric acid (GABA) receptor subunit (GABAARα1), and that a synaptic ribbon-specific protein (RIBEYE) is found adjacent to some colocalizations of GluR1 and TH in the inner plexiform layer. These results identify previously undescribed sites at which glutamatergic and GABAergic inputs may stimulate and inhibit dopamine release, especially at somata and along varicose neurites that emerge from these somata and arborize in various levels of the retina. PMID:28035673

  6. Role of Major NMDA or AMPA Receptor Subunits in MK-801 Potentiation of Ethanol Intoxication

    PubMed Central

    Palachick, Benjamin; Chen, Yi-Chyan; Enoch, Abigail J.; Karlsson, Rose-Marie; Mishina, Masayoshi; Holmes, Andrew

    2008-01-01

    Background The glutamate system plays a major role in mediating EtOH’s effects on brain and behavior, and is implicated in the pathophysiology of alcohol-related disorders. N-methyl-D-aspartate receptor (NMDAR) antagonists such as MK-801 (dizocilpine) interact with EtOH at the behavioral level, but the molecular basis of this interaction is unclear. Methods We first characterized the effects of MK-801 treatment on responses to the ataxic (accelerating rotarod), hypothermic and sedative/hypnotic effects of acute EtOH administration in C57BL/6J and 129/SvImJ inbred mice. Effects of another NMDAR antagonist, phencyclidine, on EtOH-induced sedation/hypnosis were also assessed. Gene knockout of the NMDAR subunit NR2A or L-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate GluR1 or pharmacological antagonism of the NMDAR subunit NR2B (via Ro 25-6981) was employed to examine whether inactivating any one of these glutamate signaling molecules modified MK-801’s effect on EtOH-related behaviors. Results MK-801 markedly potentiated the ataxic effects of 1.75 g/kg EtOH and the sedative/hypnotic effects of 3.0 g/kg EtOH, but not the hypothermic effects of 3.0 g/kg EtOH, in C57BL/6J and 129/SvImJ mice. Phencyclidine potentiated EtOH-induced sedation/hypnosis in both inbred strains. Neither NR2A nor GluR1 KO significantly altered basal EtOH-induced ataxia, hypothermia, or sedation/hypnosis. Ro 25-6981 modestly increased EtOH-induced sedation/hypnosis. The ability of MK-801 to potentiate EtOH-induced ataxia and sedation/hypnosis was unaffected by GluR1 KO or NR2B antagonism. NR2A KO partially reduced MK-801 + EtOH-induced sedation/hypnosis, but not ataxia or hypothermia. Conclusions Data confirm a robust and response-specific potentiating effect of MK-801 on sensitivity to EtOH’s intoxicating effects. Inactivation of three major components of glutamate signaling had no or only partial impact on the ability of MK-801 to potentiate behavioral sensitivity to EtOH. Further work to elucidate the mechanisms underlying NMDAR × EtOH interactions could ultimately provide novel insight into the role of NMDARs in alcoholism and its treatment. PMID:18565157

  7. Hippocampal and extrahippocampal systems compete for control of contextual fear: Role of ventral subiculum and amygdala

    PubMed Central

    Biedenkapp, Joseph C.; Rudy, Jerry W.

    2009-01-01

    Two neural systems, a hippocampal system and an extrahippocampal system compete for control over contextual fear, and the hippocampal system normally dominates. Our experiments reveal that output provided by the ventral subiculum is critical for the hippocampal system to win this competition. Bilateral electrolytic lesions of the ventral subiculum after conditioning, but not before conditioning, impaired contextual fear conditioning. Reversibly inactivating this region by bilateral injections of muscimol produced the same results—no impairment when the injection occurred prior to conditioning but a significant impairment when this region was inactivated after conditioning. Thus, the extrahippocampal system can support contextual fear conditioning if the ventral subiculum is disabled before conditioning but not if it is disabled after conditioning. Our experiments also reveal that the basolateral region of the amygdala (BLA) is where the two systems compete for associative control of the fear system. To test this hypothesis we reasoned that the extrahippocampal system would also acquire associative control over the fear system, even if the hippocampal system were functional, if the basal level of plasticity potential in the BLA could be increased. We did this by injecting the D1 dopamine agonist, SKF82958, into the BLA just prior to conditioning. This treatment resulted in a significant increase in freezing when the ventral subiculum was disabled prior to the test. These results are discussed in relationship to the idea that D1 agonists increase plasticity potential by increasing the pool of available extrasynaptic GluR1 receptors in the population of neurons supporting acquired fear. PMID:19117915

  8. Gender dependent contribution of muscarinic receptors in memory retrieval under sub-chronic stress.

    PubMed

    Rashid, Habiba; Ahmed, Touqeer

    2018-05-15

    Stress induces retrograde amnesia in humans and rodents. Muscarinic antagonism under normal physiological conditions causes gender dependent impairment in episodic memory retrieval. We aimed to explore the gender dependent role of muscarinic receptors in memory retrieval under sub-chronic stress condition. Male and female mice were trained for Morris water maze test and contextual fear conditioning, followed by 3 h restraint stress per day for five days. Stress was either given alone or in combination with a daily subcutaneous injection of scopolamine (1 mg/kg) or donepezil (1 mg/kg). Control mice were given saline without any stress. Sub-chronic stress (induced for five days) impaired spatial memory retrieval in males (P < 0.005) but not in females (P > 0.05). Stress induced spatial memory recall deficit in male mice was independent of muscarinic receptor activity (P > 0.05). However, stress induced contextual fear memory recall impairment was reversed by donepezil treatment in male (P < 0.005) and female (P < 0.0001) mice. These findings suggest that differential role of muscarinic activity in retrieving different types of memories under stress depends on gender of subjects. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Cytochemical Organization of the Retino-Suprachiasmatic System

    DTIC Science & Technology

    1994-03-11

    strongly expiessed of the, non-NMDA ionotropic receptors . Other AMPA-preferring receptors , GluR3 and -R4, were also found, but to lesser extent...kainate, and NMDA receptor RN was found in the hypothalamus. GluRi and GluR2 were ang the nmst strongly expressed of the non-NvDA ionotropic receptors ...several different glutamate receptors . The expression of many different types of ionotropic glutamate receptors throughout the hypothalamus suggests that

  10. Cocaine-Induced Behavioral Sensitization Is Associated With Changes in the Expression of Endocannabinoid and Glutamatergic Signaling Systems in the Mouse Prefrontal Cortex

    PubMed Central

    Blanco, Eduardo; Pavón, Francisco J.; Palomino, Ana; Luque-Rojas, María Jesús; Serrano, Antonia; Rivera, Patricia; Bilbao, Ainhoa; Alen, Francisco; Vida, Margarita; Suárez, Juan

    2015-01-01

    Background: Endocannabinoids modulate the glutamatergic excitatory transmission by acting as retrograde messengers. A growing body of studies has reported that both signaling systems in the mesocorticolimbic neural circuitry are involved in the neurobiological mechanisms underlying drug addiction. Methods: We investigated whether the expression of both endocannabinoid and glutamatergic systems in the prefrontal cortex (PFC) were altered by an acute and/or repeated cocaine administration schedule that resulted in behavioral sensitization. We measured the protein and mRNA expression of the main endocannabinoid metabolic enzymes and the cannabinoid receptor type 1 (CB1). We also analyzed the mRNA expression of relevant components of the glutamate-signaling system, including glutamate-synthesizing enzymes, metabotropic receptors, and ionotropic receptors. Results: Although acute cocaine (10mg/kg) produced no significant changes in the endocannabinoid-related proteins, repeated cocaine administration (20mg/kg daily) induced a pronounced increase in the CB1 receptor expression. In addition, acute cocaine administration (10mg/kg) in cocaine-sensitized mice (referred to as cocaine priming) induced a selective increase in the endocannabinoid-degrading enzymes fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL). These protein changes were accompanied by an overall decrease in the ratios of endocannabinoid synthesis/degradation, especially the N-acyl phosphatidylethanolamine phospholipase D/FAAH and diacylglycerol lipase alpha/MAGL ratios. Regarding mRNA expression, while acute cocaine administration produced a decrease in CB1 receptors and N-acyl phosphatidylethanolamine phospholipase D, repeated cocaine treatment enhanced CB1 receptor expression. Cocaine-sensitized mice that were administered priming injections of cocaine mainly displayed an increased FAAH expression. These endocannabinoid changes were associated with modifications in glutamatergic transmission-related genes. An overall decrease was observed in the mRNA expression of the glutamate-synthesizing gene kidney-type glutaminase (KGA), the metabotropic glutamate receptors (mGluR3 and GluR), and subunits of NMDA ionotropic receptors (NR1, NR2A, NR2B and NR2C) after acute cocaine administration, while mice repeatedly exposed to cocaine only displayed an increase in NR2C. However, in cocaine-sensitized mice primed with cocaine, this inhibition was reversed and a strong increase was detected in the mGluR5, NR2 subunits, and both GluR1 and GluR3. Conclusions: These findings indicate that cocaine sensitization is associated with an endocannabinoid downregulation and a hyperglutamatergic state in the PFC that, overall, contribute to an enhanced glutamatergic input into PFC-projecting areas. PMID:25539508

  11. Aging-induced dysregulation of dicer1-dependent microRNA expression impairs angiogenic capacity of rat cerebromicrovascular endothelial cells.

    PubMed

    Ungvari, Zoltan; Tucsek, Zsuzsanna; Sosnowska, Danuta; Toth, Peter; Gautam, Tripti; Podlutsky, Andrej; Csiszar, Agnes; Losonczy, Gyorgy; Valcarcel-Ares, M Noa; Sonntag, William E; Csiszar, Anna

    2013-08-01

    Age-related impairment of angiogenesis is likely to play a central role in cerebromicrovascular rarefaction and development of vascular cognitive impairment, but the underlying mechanisms remain elusive. To test the hypothesis that dysregulation of Dicer1 (ribonuclease III, a key enzyme of the microRNA [miRNA] machinery) impairs endothelial angiogenic capacity in aging, primary cerebromicrovascular endothelial cells (CMVECs) were isolated from young (3 months old) and aged (24 months old) Fischer 344 × Brown Norway rats. We found an age-related downregulation of Dicer1 expression both in CMVECs and in small cerebral vessels isolated from aged rats. In aged CMVECs, Dicer1 expression was increased by treatment with polyethylene glycol-catalase. Compared with young cells, aged CMVECs exhibited altered miRNA expression profile, which was associated with impaired proliferation, adhesion to vitronectin, collagen and fibronectin, cellular migration (measured by a wound-healing assay using electric cell-substrate impedance sensing technology), and impaired ability to form capillary-like structures. Overexpression of Dicer1 in aged CMVECs partially restored miRNA expression profile and significantly improved angiogenic processes. In young CMVECs, downregulation of Dicer1 (siRNA) resulted in altered miRNA expression profile associated with impaired proliferation, adhesion, migration, and tube formation, mimicking the aging phenotype. Collectively, we found that Dicer1 is essential for normal endothelial angiogenic processes, suggesting that age-related dysregulation of Dicer1-dependent miRNA expression may be a potential mechanism underlying impaired angiogenesis and cerebromicrovascular rarefaction in aging.

  12. Loss of PINK1 attenuates HIF-1α induction by preventing 4E-BP1-dependent switch in protein translation under hypoxia.

    PubMed

    Lin, William; Wadlington, Natasha L; Chen, Linan; Zhuang, Xiaoxi; Brorson, James R; Kang, Un Jung

    2014-02-19

    Parkinson's disease (PD) has multiple proposed etiologies with implication of abnormalities in cellular homeostasis ranging from proteostasis to mitochondrial dynamics to energy metabolism. PINK1 mutations are associated with familial PD and here we discover a novel PINK1 mechanism in cellular stress response. Using hypoxia as a physiological trigger of oxidative stress and disruption in energy metabolism, we demonstrate that PINK1(-/-) mouse cells exhibited significantly reduced induction of HIF-1α protein, HIF-1α transcriptional activity, and hypoxia-responsive gene upregulation. Loss of PINK1 impairs both hypoxia-induced 4E-BP1 dephosphorylation and increase in the ratio of internal ribosomal entry site (IRES)-dependent to cap-dependent translation. These data suggest that PINK1 mediates adaptive responses by activating IRES-dependent translation, and the impairments in translation and the HIF-1α pathway may contribute to PINK1-associated PD pathogenesis that manifests under cellular stress.

  13. Segregation and Crosstalk of D1 Receptor-Mediated Activation of ERK in Striatal Medium Spiny Neurons upon Acute Administration of Psychostimulants

    PubMed Central

    Gutierrez-Arenas, Omar; Eriksson, Olivia; Hellgren Kotaleski, Jeanette

    2014-01-01

    The convergence of corticostriatal glutamate and dopamine from the midbrain in the striatal medium spiny neurons (MSN) triggers synaptic plasticity that underlies reinforcement learning and pathological conditions such as psychostimulant addiction. The increase in striatal dopamine produced by the acute administration of psychostimulants has been found to activate not only effectors of the AC5/cAMP/PKA signaling cascade such as GluR1, but also effectors of the NMDAR/Ca2+/RAS cascade such as ERK. The dopamine-triggered effects on both these cascades are mediated by D1R coupled to Golf but while the phosphorylation of GluR1 is affected by reductions in the available amount of Golf but not of D1R, the activation of ERK follows the opposite pattern. This segregation is puzzling considering that D1R-induced Golf activation monotonically increases with DA and that there is crosstalk from the AC5/cAMP/PKA cascade to the NMDAR/Ca2+/RAS cascade via a STEP (a tyrosine phosphatase). In this work, we developed a signaling model which accounts for this segregation based on the assumption that a common pool of D1R and Golf is distributed in two D1R/Golf signaling compartments. This model integrates a relatively large amount of experimental data for neurons in vivo and in vitro. We used it to explore the crosstalk topologies under which the sensitivities of the AC5/cAMP/PKA signaling cascade to reductions in D1R or Golf are transferred or not to the activation of ERK. We found that the sequestration of STEP by its substrate ERK together with the insensitivity of STEP activity on targets upstream of ERK (i.e. Fyn and NR2B) to PKA phosphorylation are able to explain the experimentally observed segregation. This model provides a quantitative framework for simulation based experiments to study signaling required for long term potentiation in MSNs. PMID:24499932

  14. Presynaptic DLG regulates synaptic function through the localization of voltage-activated Ca2+ Channels

    PubMed Central

    Astorga, César; Jorquera, Ramón A.; Ramírez, Mauricio; Kohler, Andrés; López, Estefanía; Delgado, Ricardo; Córdova, Alex; Olguín, Patricio; Sierralta, Jimena

    2016-01-01

    The DLG-MAGUK subfamily of proteins plays a role on the recycling and clustering of glutamate receptors (GLUR) at the postsynaptic density. discs-large1 (dlg) is the only DLG-MAGUK gene in Drosophila and originates two main products, DLGA and DLGS97 which differ by the presence of an L27 domain. Combining electrophysiology, immunostaining and genetic manipulation at the pre and postsynaptic compartments we study the DLG contribution to the basal synaptic-function at the Drosophila larval neuromuscular junction. Our results reveal a specific function of DLGS97 in the regulation of the size of GLUR fields and their subunit composition. Strikingly the absence of any of DLG proteins at the presynaptic terminal disrupts the clustering and localization of the calcium channel DmCa1A subunit (Cacophony), decreases the action potential-evoked release probability and alters short-term plasticity. Our results show for the first time a crucial role of DLG proteins in the presynaptic function in vivo. PMID:27573697

  15. Presynaptic DLG regulates synaptic function through the localization of voltage-activated Ca(2+) Channels.

    PubMed

    Astorga, César; Jorquera, Ramón A; Ramírez, Mauricio; Kohler, Andrés; López, Estefanía; Delgado, Ricardo; Córdova, Alex; Olguín, Patricio; Sierralta, Jimena

    2016-08-30

    The DLG-MAGUK subfamily of proteins plays a role on the recycling and clustering of glutamate receptors (GLUR) at the postsynaptic density. discs-large1 (dlg) is the only DLG-MAGUK gene in Drosophila and originates two main products, DLGA and DLGS97 which differ by the presence of an L27 domain. Combining electrophysiology, immunostaining and genetic manipulation at the pre and postsynaptic compartments we study the DLG contribution to the basal synaptic-function at the Drosophila larval neuromuscular junction. Our results reveal a specific function of DLGS97 in the regulation of the size of GLUR fields and their subunit composition. Strikingly the absence of any of DLG proteins at the presynaptic terminal disrupts the clustering and localization of the calcium channel DmCa1A subunit (Cacophony), decreases the action potential-evoked release probability and alters short-term plasticity. Our results show for the first time a crucial role of DLG proteins in the presynaptic function in vivo.

  16. Activation of 5-HT7 serotonin receptors reverses metabotropic glutamate receptor-mediated synaptic plasticity in wild-type and Fmr1 knockout mice, a model of Fragile X syndrome.

    PubMed

    Costa, Lara; Spatuzza, Michela; D'Antoni, Simona; Bonaccorso, Carmela M; Trovato, Chiara; Musumeci, Sebastiano A; Leopoldo, Marcello; Lacivita, Enza; Catania, Maria V; Ciranna, Lucia

    2012-12-01

    Fragile X syndrome (FXS) is a genetic cause of intellectual disability and autism. Fmr1 knockout (Fmr1 KO) mice, an animal model of FXS, exhibit spatial memory impairment and synapse malfunctioning in the hippocampus, with abnormal enhancement of long-term depression mediated by metabotropic glutamate receptors (mGluR-LTD). The neurotransmitter serotonin (5-HT) modulates hippocampal-dependent learning through serotonin 1A (5-HT1A) and serotonin 7 (5-HT7) receptors; the underlying mechanisms are unknown. We used electrophysiology to test the effects of 5-HT on mGluR-LTD in wild-type and Fmr1 KO mice and immunocytochemistry and biotinylation assay to study related changes of 2-amino-3-(5-methyl-3-oxo-1,2-oxazol-4-yl)propanoic acid (AMPA) glutamate receptor surface expression. Application of 5-HT or 8-OH-DPAT (a mixed 5-HT1A/5-HT7 agonist) reversed mGluR-LTD in hippocampal slices. Reversal of mGluR-LTD by 8-OH-DPAT persisted in the presence of the 5-HT1A receptor antagonist WAY-100635, was abolished by SB-269970 (5-HT7 receptor antagonist), and was mimicked by LP-211, a novel selective 5-HT7 receptor agonist. Consistently, 8-OH-DPAT decreased mGluR-mediated reduction of AMPA glutamate receptor 2 (GluR2) subunit surface expression in hippocampal slices and cultured hippocampal neurons, an effect mimicked by LP-211 and blocked by SB-269970. In Fmr1 KO mice, mGluR-LTD was abnormally enhanced; similarly to wild-type, 8-OH-DPAT reversed mGluR-LTD and decreased mGluR-induced reduction of surface AMPA receptors, an effect antagonized by SB-269970. Serotonin 7 receptor activation reverses metabotropic glutamate receptor-induced AMPA receptor internalization and LTD both in wild-type and in Fmr1 KO mice, correcting excessive mGluR-LTD. Therefore, selective activation of 5-HT7 receptors may represent a novel strategy in the therapy of FXS. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  17. Oral status, cognitive function and dependency among New Zealand nursing home residents.

    PubMed

    Thomson, William M; Smith, Moira B; Ferguson, Catherine Anna; Kerse, Ngaire M; Peri, Kathryn; Gribben, Barry

    2018-04-23

    To investigate clinical oral disease and its association with cognitive function and dependency among older New Zealanders in residential aged care. National survey of oral health in aged residential care throughout New Zealand. We classified residents into 1 of 3 levels of care: "low dependency care (or assisted living)"; "high dependency care"; or "specialist dementia care/psychogeriatric care." The Abbreviated Mental Test characterised cognitive function as "unimpaired" (scores of 7-10), "moderately impaired" (4-6) or "severely impaired" (0-3). Intra-oral examinations were conducted, along with a computer-assisted personal interview. Most of the 987 clinically examined participants were either at low or high dependency care level, with another 1 in 6 in psychogeriatric care. Almost half overall had severely impaired cognitive function. Just under half of the sample had 1 or more natural teeth remaining. Negative binomial regression modelling showed that the number of carious teeth was lower among women and higher among those who were older, those with more teeth and in those with severely impaired cognitive function. Oral debris scores (representing plaque biofilm and other soft deposits on teeth) were higher in men, those with more teeth, and in those with severely impaired cognitive function. Impaired cognitive function is a risk indicator for both dental caries and oral debris in aged residential care. © 2018 John Wiley & Sons A/S and The Gerodontology Association. Published by John Wiley & Sons Ltd.

  18. Gene transfer of constitutively active protein kinase C into striatal neurons accelerates onset of levodopa-induced motor response alterations in parkinsonian rats

    PubMed Central

    Oh, Justin D.; Geller, Alfred I.; Zhang, Guo-rong; Chase, Thomas N.

    2006-01-01

    Alterations in motor response that complicate levodopa treatment of Parkinson’s disease appear to involve sensitization of striatal ionotropic glutamate receptors. Since protein kinase C (PKC)-mediated phosphorylation regulates glutamatergic receptors of the α-amino-3-hydroxyl-5-methyl-4-isoxazole propionic acid (AMPA) subtype and has been linked to several forms of behavioral plasticity, activation of PKC signaling in striatal spiny neurons may also contribute to the motor plasticity changes associated with chronic levodopa therapy. To evaluate this possibility, we sought to augment PKC signaling by using Herpes Simplex Virus type 1 vectors (pHSVpkcΔ) to directly transfer the catalytic domain of the PKCβII gene into striatal neurons of parkinsonian rats. Microinjection of pHSVpkcΔ vectors lead to the persistent expression of PkcΔ (35% loss over 21 days) in medium spiny neurons together with an increase in serine 831 phosphorylation on AMPA receptor GluR1 subunits and hastened the appearance of the shortened response duration produced by chronic levodopa treatment (P<0.05). In pHSVpkcΔ-infected animals, intrastriatal injection of the PKC inhibitor NPC-15437 (1.0 μg) attenuated both the increased GluR1 phosphorylation (P<0.01) and the accelerated onset of the levodopa-induced response modifications (P<0.01). However, in rats that received levodopa treatment for 21 days without the gene transfer, intrastriatal NPC-15437 had no effect on the response shortening or on GluR1 S831 phosphorylation. The results suggest that an increase in PKC-mediated signaling, including, in part, phosphorylation of AMPA receptors, on striatal spiny neurons may be sufficient to promote the initial appearance, but not necessary the ultimate expression, of the levodopa-induced motor response changes occurring in a rodent model of the human motor complication syndrome. PMID:12691833

  19. Prostacyclin regulates spinal nociceptive processing through cyclic adenosine monophosphate-induced translocation of glutamate receptors.

    PubMed

    Schuh, Claus Dieter; Brenneis, Christian; Zhang, Dong Dong; Angioni, Carlo; Schreiber, Yannick; Ferreiros-Bouzas, Nerea; Pierre, Sandra; Henke, Marina; Linke, Bona; Nüsing, Rolf; Scholich, Klaus; Geisslinger, Gerd

    2014-02-01

    Prostacyclin (PGI2) is known to be an important mediator of peripheral pain sensation (nociception) whereas little is known about its role in central sensitization. The levels of the stable PGI2-metabolite 6-keto-prostaglandin F1α (6-keto-PGF1α) and of prostaglandin E2 (PGE2) were measured in the dorsal horn with the use of mass spectrometry after peripheral inflammation. Expression of the prostanoid receptors was determined by immunohistology. Effects of prostacyclin receptor (IP) activation on spinal neurons were investigated with biochemical assays (cyclic adenosine monophosphate-, glutamate release-measurement, Western blot analysis) in embryonic cultures and adult spinal cord. The specific IP antagonist Cay10441 was applied intrathecally after zymosan-induced mechanical hyperalgesia in vivo. Peripheral inflammation caused a significant increase of the stable PGI2 metabolite 6-keto-PGF1α in the dorsal horn of wild-type mice (n = 5). IP was located on spinal neurons and did not colocalize with the prostaglandin E2 receptors EP2 or EP4. The selective IP-agonist cicaprost increased cyclic adenosine monophosphate synthesis in spinal cultures from wild-type but not from IP-deficient mice (n = 5-10). The combination of fluorescence-resonance-energy transfer-based cyclic adenosine monophosphate imaging and calcium imaging showed a cicaprost-induced cyclic adenosine monophosphate synthesis in spinal cord neurons (n = 5-6). Fittingly, IP activation increased glutamate release from acute spinal cord sections of adult mice (n = 13-58). Cicaprost, but not agonists for EP2 and EP4, induced protein kinase A-dependent phosphorylation of the GluR1 subunit and its translocation to the membrane. Accordingly, intrathecal administration of the IP receptor antagonist Cay10441 had an antinociceptive effect (n = 8-11). Spinal prostacyclin synthesis during early inflammation causes the recruitment of GluR1 receptors to membrane fractions, thereby augmenting the onset of central sensitization.

  20. Decreased levels of NMDA but not AMPA receptors in the lipid-raft fraction of 3xTg-AD model of Alzheimer's disease: Relation to Arc/Arg3.1 protein expression.

    PubMed

    Morin, Jean-Pascal; Díaz-Cintra, Sofía; Bermúdez-Rattoni, Federico; Delint-Ramírez, Ilse

    2016-11-01

    It was recently suggested that alteration in lipid raft composition in Alzheimer's disease may lead to perturbations in neurons signalosome, which may help explain the deficits observed in synaptic plasticity mechanisms and long-term memory impairments in AD models. As a first effort to address this issue, we evaluated lipid-raft contents of distinct NMDA and AMPA receptor subunits in the hippocampus of the 3xTg-AD model of Alzheimer's disease. Our results show that compared to controls, 10 months-old 3xTg-AD mice have diminished levels of NMDA receptors in rafts but not in post-synaptic density or total fractions. Additionally, the levels of GluR1 were unaltered in all the analyzed fractions. Finally, we went on to show that the diminished levels of NMDA receptors in rafts correlated with diminished global levels of Arc/Arg3.1, a synaptic protein with a central role in long-term memory formation. This study adds to our current understanding of the signaling pathways disruptions observed in current Alzheimer's disease models. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Impaired decision-making under risk in individuals with alcohol dependence

    PubMed Central

    Brevers, Damien; Bechara, Antoine; Cleeremans, Axel; Kornreich, Charles; Verbanck, Paul; Noël, Xavier

    2014-01-01

    Background Alcohol dependence is associated with poor decision-making under ambiguity, that is, when decisions are to be made in the absence of known probabilities of reward and loss. However, little is known regarding decisions made by individuals with alcohol dependence in the context of known probabilities (decision under risk). In this study, we investigated the relative contribution of these distinct aspects of decision making to alcohol dependence. Methods Thirty recently detoxified and sober asymptomatic alcohol-dependent individuals, and thirty healthy control participants were tested for decision-making under ambiguity (using the Iowa Gambling Task), and decision-making under-risk (using the Cups Task and Coin Flipping Task). We also tested their capacities for working memory storage (Digit-span Forward), and dual-tasking (Operation-span Task). Results Compared to healthy control participants, alcohol-dependent individuals made disadvantageous decisions on the Iowa Gambling Task, reflecting poor decisions under ambiguity. They also made more risky choices on the Cups and Coin Flipping Tasks reflecting poor decision-making under risk. In addition, alcohol-dependent participants showed some working memory impairments, as measured by the dual tasking, and the degree of this impairment correlated with high-risk decision-making, thus suggesting a relationship between processes sub-serving working memory and risky decisions. Conclusion These results suggest that alcohol dependent individuals are impaired in their ability to decide optimally in multiple facets of uncertainty (i.e., both risk and ambiguity), and that at least some aspects of these deficits are linked to poor working memory processes. PMID:24948198

  2. Functional Impairment and Hospital Readmission in Medicare Seniors

    PubMed Central

    Greysen, S. Ryan; Cenzer, Irena Stijacic; Auerbach, Andrew D.; Covinsky, Kenneth E.

    2015-01-01

    Importance Medicare currently penalizes hospitals for high rates of readmission for seniors but does not account for common age-related syndromes such as functional impairment. Objectives Given the high prevalence of functional impairments in community-dwelling seniors, we assessed effects of functional impairment on Medicare hospital readmissions. Study Design, Participants, and Setting We created a nationally-representative cohort of 7,854 community-dwelling seniors in the Health and Retirement Study (HRS) with 22,289 Medicare hospitalizations from 2000–2010. Main Outcome and Measurements Outcome was 30-day readmission, assessed by Medicare claims. Main predictor was functional impairment determined from HRS interview preceding hospitalization, stratified into 5 levels: no functional impairments, difficulty with ≥1 instrumental activity of daily living (IADL), difficulty with ≥1 activity of daily living (ADL), dependency (need for help) in 1–2 ADLs, and dependency in ≥3 ADLs. Adjustment variables included age, race, gender, income, and net worth and comorbid conditions (Elixhauser score from Medicare claims), and prior admission. We performed multivariable logistic regression adjusted for clustering at patient level to characterize the association of functional impairments and readmission. Results Mean age 79 (±8; 65–105), 58% female, 85% White, 90% reported ≥3 comorbidities, 86% had ≥1 hospitalization in previous year. Overall, 48% had some level of functional impairment prior to admission and 15% experienced a 30-day readmission. We found a progressive increase in adjusted risk of readmission as the degree of functional impairment increased: 13.5% with no functional impairment, 14.3% with ≥ 1 IADL difficulty (OR 1.06; 95% CI 0.94–1.20), 14.4% with ≥1 ADL difficulty (OR 1.08; 0.96–1.21), 16.5% with dependency in 1–2 ADLs (OR 1.26; 1.11–1.44), and 18.2% with dependency in ≥3 ADLs (1.42; 1.20–1.69). Sub-analysis restricted to patients admitted with conditions targeted by Medicare (heart failure, myocardial infarction, and pneumonia) revealed a parallel trend with larger effects for the most-impaired (16.9% readmission rate for no impairment vs. 25.7% for dependency in ≥3 ADLs, OR 1.70; 1.04–2.78). Conclusions Functional impairment is associated with increased risk of 30-day, all-cause hospital readmission in Medicare seniors, especially those admitted for heart failure, myocardial infarction or pneumonia. Functional impairment on admission may be an overlooked but highly suitable target for interventions to reduce Medicare hospital readmissions. Relevance Functional impairment may be an important but under-addressed factor in preventing readmissions for Medicare seniors. PMID:25642907

  3. Bidirectional Regulation of Amyloid Precursor Protein-Induced Memory Defects by Nebula/DSCR1: A Protein Upregulated in Alzheimer's Disease and Down Syndrome

    PubMed Central

    Shaw, Jillian L.; Zhang, Shixing

    2015-01-01

    Aging individuals with Down syndrome (DS) have an increased risk of developing Alzheimer's disease (AD), a neurodegenerative disorder characterized by impaired memory. Memory problems in both DS and AD individuals usually develop slowly and progressively get worse with age, but the cause of this age-dependent memory impairment is not well understood. This study examines the functional interactions between Down syndrome critical region 1 (DSCR1) and amyloid-precursor protein (APP), proteins upregulated in both DS and AD, in regulating memory. Using Drosophila as a model, we find that overexpression of nebula (fly homolog of DSCR1) initially protects against APP-induced memory defects by correcting calcineurin and cAMP signaling pathways but accelerates the rate of memory loss and exacerbates mitochondrial dysfunction in older animals. We report that transient upregulation of Nebula/DSCR1 or acute pharmacological inhibition of calcineurin in aged flies protected against APP-induced memory loss. Our data suggest that calcineurin dyshomeostasis underlies age-dependent memory impairments and further imply that chronic Nebula/DSCR1 upregulation may contribute to age-dependent memory impairments in AD in DS. SIGNIFICANCE STATEMENT Most Down syndrome (DS) individuals eventually develop Alzheimer's disease (AD)-like dementia, but mechanisms underlying this age-dependent memory impairment remain poorly understood. This study examines Nebula/Down syndrome critical region 1 (DSCR1) and amyloid-precursor protein (APP), proteins upregulated in both DS and AD, in regulating memory. We uncover a previously unidentified role for Nebula/DSCR1 in modulating APP-induced memory defects during aging. We show that upregulation of Nebula/DSCR1, an inhibitor of calcineurin, rescues APP-induced memory defects in young flies but enhances memory loss of older flies. Excitingly, transient Nebula/DSCR1 overexpression or calcineurin inhibition in aged flies ameliorates APP-mediated memory problems. These results suggest that chronic Nebula/DSCR1 upregulation may contribute to age-dependent memory loss in DS and AD and points to correcting calcineurin signaling as a means to improve memory during aging. PMID:26269644

  4. Bidirectional Regulation of Amyloid Precursor Protein-Induced Memory Defects by Nebula/DSCR1: A Protein Upregulated in Alzheimer's Disease and Down Syndrome.

    PubMed

    Shaw, Jillian L; Zhang, Shixing; Chang, Karen T

    2015-08-12

    Aging individuals with Down syndrome (DS) have an increased risk of developing Alzheimer's disease (AD), a neurodegenerative disorder characterized by impaired memory. Memory problems in both DS and AD individuals usually develop slowly and progressively get worse with age, but the cause of this age-dependent memory impairment is not well understood. This study examines the functional interactions between Down syndrome critical region 1 (DSCR1) and amyloid-precursor protein (APP), proteins upregulated in both DS and AD, in regulating memory. Using Drosophila as a model, we find that overexpression of nebula (fly homolog of DSCR1) initially protects against APP-induced memory defects by correcting calcineurin and cAMP signaling pathways but accelerates the rate of memory loss and exacerbates mitochondrial dysfunction in older animals. We report that transient upregulation of Nebula/DSCR1 or acute pharmacological inhibition of calcineurin in aged flies protected against APP-induced memory loss. Our data suggest that calcineurin dyshomeostasis underlies age-dependent memory impairments and further imply that chronic Nebula/DSCR1 upregulation may contribute to age-dependent memory impairments in AD in DS. Most Down syndrome (DS) individuals eventually develop Alzheimer's disease (AD)-like dementia, but mechanisms underlying this age-dependent memory impairment remain poorly understood. This study examines Nebula/Down syndrome critical region 1 (DSCR1) and amyloid-precursor protein (APP), proteins upregulated in both DS and AD, in regulating memory. We uncover a previously unidentified role for Nebula/DSCR1 in modulating APP-induced memory defects during aging. We show that upregulation of Nebula/DSCR1, an inhibitor of calcineurin, rescues APP-induced memory defects in young flies but enhances memory loss of older flies. Excitingly, transient Nebula/DSCR1 overexpression or calcineurin inhibition in aged flies ameliorates APP-mediated memory problems. These results suggest that chronic Nebula/DSCR1 upregulation may contribute to age-dependent memory loss in DS and AD and points to correcting calcineurin signaling as a means to improve memory during aging. Copyright © 2015 the authors 0270-6474/15/3511374-10$15.00/0.

  5. Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors

    PubMed Central

    Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

    2006-01-01

    Glutamate acts at central synapses via ionotropic (iGluR – NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed. PMID:16945965

  6. Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors.

    PubMed

    Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

    2006-11-15

    Glutamate acts at central synapses via ionotropic (iGluR--NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed.

  7. Mice Deficient in lysophosphatidic acid acyltransferase delta (Lpaatδ)/acylglycerophosphate acyltransferase 4 (Agpat4) Have Impaired Learning and Memory.

    PubMed

    Bradley, Ryan M; Mardian, Emily B; Bloemberg, Darin; Aristizabal Henao, Juan J; Mitchell, Andrew S; Marvyn, Phillip M; Moes, Katherine A; Stark, Ken D; Quadrilatero, Joe; Duncan, Robin E

    2017-11-15

    We previously characterized LPAATδ/AGPAT4 as a mitochondrial lysophosphatidic acid acyltransferase that regulates brain levels of phosphatidylcholine (PC), phosphatidylethanolamine (PE), and phosphatidylinositol (PI). Here, we report that Lpaat δ -/- mice display impaired spatial learning and memory compared to wild-type littermates in the Morris water maze and our investigation of potential mechanisms associated with brain phospholipid changes. Marker protein immunoblotting suggested that the relative brain content of neurons, glia, and oligodendrocytes was unchanged. Relative abundance of the important brain fatty acid docosahexaenoic acid was also unchanged in phosphatidylserine, phosphatidylglycerol, and cardiolipin, in agreement with prior data on PC, PE and PI. In phosphatidic acid, it was increased. Specific decreases in ethanolamine-containing phospholipids were detected in mitochondrial lipids, but the function of brain mitochondria in Lpaat δ -/- mice was unchanged. Importantly, we found that Lpaat δ -/- mice have a significantly and drastically lower brain content of the N -methyl-d-asparate (NMDA) receptor subunits NR1, NR2A, and NR2B, as well as the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit GluR1, compared to wild-type mice. However, general dysregulation of PI-mediated signaling is not likely responsible, since phospho-AKT and phospho-mTOR pathway regulation was unaffected. Our findings indicate that Lpaat δ deficiency causes deficits in learning and memory associated with reduced NMDA and AMPA receptors. Copyright © 2017 American Society for Microbiology.

  8. H3K9me3 Inhibition Improves Memory, Promotes Spine Formation, and Increases BDNF Levels in the Aged Hippocampus

    PubMed Central

    Prieto, G. Aleph; Petrosyan, Arpine; Loertscher, Brad M.; Dieskau, André P.; Overman, Larry E.; Cotman, Carl W.

    2016-01-01

    An increasing number of studies show that an altered epigenetic landscape may cause impairments in regulation of learning and memory-related genes within the aged hippocampus, eventually resulting in cognitive deficits in the aged brain. One such epigenetic repressive mark is trimethylation of H3K9 (H3K9me3), which is typically implicated in gene silencing. Here, we identify, for the first time, an essential role for H3K9me3 and its histone methyl transferase (SUV39H1) in mediating hippocampal memory functions. Pharmacological inhibition of SUV39H1 using a novel and selective inhibitor decreased levels of H3K9me3 in the hippocampus of aged mice, and improved performance in the objection location memory and fear conditioning tasks and in a complex spatial environment learning task. The inhibition of SUV39H1 induced an increase in spine density of thin and stubby but not mushroom spines in the hippocampus of aged animals and increased surface GluR1 levels in hippocampal synaptosomes, a key index of spine plasticity. Furthermore, there were changes at BDNF exon I gene promoter, in concert with overall BDNF levels in the hippocampus of drug-treated animals compared with control animals. Together, these data demonstrate that SUV39H1 inhibition and the concomitant H3K9me3 downregulation mediate gene transcription in the hippocampus and reverse age-dependent deficits in hippocampal memory. SIGNIFICANCE STATEMENT Cognitive decline is a debilitating condition associated with not only neurodegenerative diseases but also aging in general. However, effective treatments have been slow to emerge so far. In this study, we demonstrate that epigenetic regulation of key synaptic proteins may be an underlying, yet reversible, cause of this decline. Our findings suggest that histone 3 trimethylation is a probable target for pharmacological intervention that can counteract cognitive decline in the aging brain. Finally, we provide support to the hypothesis that, by manipulating the enzyme that regulates H3K9me3 (using a newly developed specific inhibitor of SUV39H1), it is possible to alter the chromatin state of subjects and restore memory and synaptic function in the aging brain. PMID:27013689

  9. The type II cGMP dependent protein kinase regulates GluA1 levels at the plasma membrane of developing cerebellar granule cells

    PubMed Central

    Incontro, Salvatore; Ciruela, Francisco; Ziff, Edward; Hofmann, Franz; Sánchez-Prieto, José; Torres, Magdalena

    2014-01-01

    Trafficking of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) is regulated by specific interactions with other proteins and by post-translational mechanisms, such as phosphorylation. We have found that the type II cGMP-dependent protein kinase (cGKII) phosphorylates GluA1 (formerly GluR1) at S845, augmenting the surface expression of AMPARs at both synaptic and extrasynaptic sites. Activation of cGKII by 8-Br-cGMP enhances the surface expression of GluA1, whereas its inhibition or suppression effectively diminished the expression of this protein at the cell surface. In granule cells, NMDA receptor activation (NMDAR) stimulates nitric oxide and cGMP production, which in turn activates cGKII and induces the phosphorylation of GluA1, promoting its accumulation in the plasma membrane. GluA1 is mainly incorporated into calcium permeable AMPARs as exposure to 8-Br-cGMP or NMDA activation enhanced AMPA-elicited calcium responses that are sensitive to NASPM inhibition. We summarize evidence for an increase of calcium permeable AMPA receptors downstream of NMDA receptor activation that might be relevant for granule cell development and plasticity. PMID:23545413

  10. Genetic disruption of the core circadian clock impairs hippocampus-dependent memory.

    PubMed

    Wardlaw, Sarah M; Phan, Trongha X; Saraf, Amit; Chen, Xuanmao; Storm, Daniel R

    2014-08-01

    Perturbing the circadian system by electrolytically lesioning the suprachiasmatic nucleus (SCN) or varying the environmental light:dark schedule impairs memory, suggesting that memory depends on the circadian system. We used a genetic approach to evaluate the role of the molecular clock in memory. Bmal1-/- mice, which are arrhythmic under constant conditions, were examined for hippocampus-dependent memory, LTP at the Schaffer-collateral synapse, and signal transduction activity in the hippocampus. Bmal1-/- mice exhibit impaired contextual fear and spatial memory. Furthermore, LTP in hippocampal slices from Bmal1-/- mice is also significantly decreased relative to that from wild-type mice. Activation of Erk1,2 MAP kinase (MAPK) during training for contextual fear memory and diurnal oscillation of MAPK activity and cAMP in the hippocampus is also lost in Bmal1-/- mice, suggesting that the memory defects are due to reduction of the memory consolidation pathway in the hippocampus. We conclude that critical signaling events in the hippocampus required for memory depend on BMAL1. © 2014 Wardlaw et al.; Published by Cold Spring Harbor Laboratory Press.

  11. A comparison of GluR-A-deficient and wild-type mice on a test battery assessing sensorimotor, affective, and cognitive behaviors.

    PubMed

    Bannerman, D M; Deacon, R M J; Brady, S; Bruce, A; Sprengel, R; Seeburg, P H; Rawlins, J N P

    2004-06-01

    Previous studies have demonstrated a spatial working memory deficit in glutamate receptor (GluR)-A (GluR1) AMPA receptor subunit knockout mice. The present study evaluated male and female wild-type and GluR-A-/- mice on a test battery that assessed sensorimotor, affective, and cognitive behaviors. Results revealed a behavioral phenotype more extensive than previously described. GluR-A-/- mice were hyperactive, displayed a subtle lack of motor coordination, and were generally more anxious than wild-type controls. In addition, they showed a deficit in spontaneous alternation, consistent with previous reports of a role for GluR-A-dependent plasticity in hippocampus-dependent, spatial working memory. Although changes in motor coordination or anxiety cannot explain the dissociations already reported within the spatial memory domain, it is clear that they could significantly affect interpretation of results obtained in other kinds of behavioral tasks. ((c) 2004 APA, all rights reserved)

  12. Obesogenic diet intake during pregnancy programs aberrant synaptic plasticity and addiction-like behavior to a palatable food in offspring.

    PubMed

    Camacho, Alberto; Montalvo-Martinez, Larisa; Cardenas-Perez, Robbi E; Fuentes-Mera, Lizeth; Garza-Ocañas, Lourdes

    2017-07-14

    Contextual food conditioned behaviors require plasticity of glutamatergic neurotransmission in the reward system, involving changes in the expression of including a-amino-3-hydroxy-5-methylisoxazole 4-propionate receptors (AMPA), N-methyl-d-aspartic acid (NMDA) and metabotropic glutamate 2,3 (mGlur 2,3). However, the role of changes in glutamatergic synaptic markers on energy-dense palatable food preference during development has not been described. Here, we determine the effect of nutritional programing during gestation on fat food choices using a conditioned place preference (CPP) test and an operant training response and its effect on glutamatergic markers in the nucleus accumbens (Nac) shell and prefrontal cortex (PFC). Our data showed that rats displayed preference for palatable fat food and an increase in caloric intake when compared to a chow diet. Notably, 74% of rats showing a preference for fat food intake correlate with a positive HFD-paired score whereas 26% failed to get HFD-conditioned. Also, male rats trained under an operant training response schedule (FR1, FR5 and PR) showed high and low responder groups to work for food. Notably, hypercaloric nutritional programing of female rats leads to exacerbation for reinforcers in female offspring compared to offspring from chow diet. Finally, we found that an operant training response to palatable reinforcers correlates with upregulation of mGlur 2,3 in the NAc shell and PFC of male rats and female offspring. Also, we found selective Nr1 upregulation in NAc shell and the PFC of female offspring. Our data suggest that nutritional programing by hypercaloric intake leads to incentive motivation to work for food and synaptic plasticity alteration in the mesolimbic system. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Motor Skills Training Enhances α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid Receptor Subunit mRNA Expression in the Ipsilateral Sensorimotor Cortex and Striatum of Rats Following Intracerebral Hemorrhage.

    PubMed

    Tamakoshi, Keigo; Ishida, Kazuto; Kawanaka, Kentaro; Takamatsu, Yasuyuki; Tamaki, Hiroyuki

    2017-10-01

    We investigated the effects of acrobatic training (AT) on expression of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) subunits in the sensorimotor cortex and striatum after intracerebral hemorrhage (ICH). Male Wistar rats were divided into 4 groups: ICH without AT (ICH), ICH with AT (ICH + AT), sham operation without AT (SHAM), and sham operation with AT (SHAM + AT). ICH was induced by collagenase injection into the left striatum. The ICH + AT group performed 5 acrobatic tasks daily on days 4-28 post ICH. Forelimb sensorimotor function was evaluated using the forelimb placing test. On days 14 and 29, mRNA expression levels of AMPAR subunits GluR1-4 were measured by real-time reverse transcription-polymerase chain reaction. Forelimb placing test scores were significantly higher in the ICH + AT group than in the ICH group. Expression levels of all AMPAR subunit mRNAs were significantly higher in the ipsilateral sensorimotor cortex of rats in the ICH + AT group than in that of rats in the ICH group on day 29. GluR3 and GluR4 expression levels were reduced in the ipsilateral striatum of rats in the ICH group compared with that of rats in the SHAM group on day 14. These changes may play a critical role in motor skills training-induced recovery after ICH. Copyright © 2017 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  14. Genistein inhibition of OGD-induced brain neuron death correlates with its modulation of apoptosis, voltage-gated potassium and sodium currents and glutamate signal pathway.

    PubMed

    Ma, Xue-Ling; Zhang, Feng; Wang, Yu-Xiang; He, Cong-Cong; Tian, Kun; Wang, Hong-Gang; An, Di; Heng, Bin; Liu, Yan-Qiang

    2016-07-25

    In the present study, we established an in vitro model of hypoxic-ischemia via exposing primary neurons of newborn rats to oxygen-glucose deprivation (OGD) and observing the effects of genistein, a soybean isoflavone, on hypoxic-ischemic neuron viability, apoptosis, voltage-activated potassium (Kv) and sodium (Nav) currents, and glutamate receptor subunits. The results indicated that OGD exposure reduced the viability and increased the apoptosis of brain neurons. Meanwhile, OGD exposure caused changes in the current-voltage curves and current amplitude values of voltage-activated potassium and sodium currents; OGD exposure also decreased GluR2 expression and increased NR2 expression. However, genistein at least partially reversed the effects caused by OGD. The results suggest that hypoxic-ischemia-caused neuronal apoptosis/death is related to an increase in K(+) efflux, a decrease in Na(+) influx, a down-regulation of GluR2, and an up-regulation of NR2. Genistein may exert some neuroprotective effects via the modulation of Kv and Nav currents and the glutamate signal pathway, mediated by GluR2 and NR2. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. NMDA and AMPA receptors in the anterior cingulate cortex mediates visceral pain in visceral hypersensitivity rats.

    PubMed

    Zhou, Lin; Huang, Junjing; Gao, Jun; Zhang, Guanpo; Jiang, Jinjin

    2014-02-01

    Several studies have shown that N-methyl-D-aspartate (NMDA)-receptor activation in anterior cingulate cortex (ACC) neurons plays critical roles in modulating visceral pain responses in visceral hypersensitivity (VH) rats. However, there are few reports about the expressions of NMDA and α-amino-3-hydroxy-5-methyl-4-isox-azolepropionic-acid (AMPA) receptor subtypes in ACC of VH model rats at different time points. The current study was undertaken to investigate NR2A, NR2B and GluR2 expressions in ACC of VH rats that were induced by administration with 5% mustard oil. Our results indicated that NR2B, but not NR2A, was highly expressed in VH model group on day 15, 22, and 36 compared with normal group (p < 0.05). GluR2 expression was also higher in VH model group on day 15, 22, and 36 than that of normal group (p < 0.05). These findings suggested increased expression of NR2B and GluR2 might be key mechanisms for long-term synaptic plastic changes in VH rats. Copyright © 2014. Published by Elsevier Inc.

  16. Environmental Enrichment Mitigates Deficits after Repetitive Mild Traumatic Brain Injury.

    PubMed

    Liu, Xixia; Qiu, Jianhua; Alcon, Sasha; Hashim, Jumana; Meehan, William P; Mannix, Rebekah

    2017-08-15

    Although environmental enrichment has been shown to improve functional and histologic outcomes in pre-clinical moderate-to-severe traumatic brain injury (TBI), there are a paucity of pre-clinical data regarding enrichment strategies in the setting of repetitive mild traumatic brain injury (rmTBI). Given the vast numbers of athletes and those in the military who sustain rmTBI, the mounting evidence of the long-term and progressive sequelae of rmTBI, and the lack of targeted therapies to mitigate these sequelae, successful enrichment interventions in rmTBI could have large public health significance. Here, we evaluated enrichment strategies in an established pre-clinical rmTBI model. Seventy-one male C57BL/6 mice were randomized to two different housing conditions, environmental enrichment (EE) or normal condition (NC), then subjected to rmTBI injury (seven injuries in 9 days) or sham injury (anesthesia only). Functional outcomes in all four groups (NC-TBI, EE-TBI, NC-sham, and EE-sham) were assessed by motor, exploratory/anxiety, and mnemonic behavioral tests. At the synaptic level, N-methyl d-aspartate receptor (NMDAR) subunit expression of phosphorylated glutamate receptor 1 (GluR1), phosphorylated Ca 2+ /calmodulin-dependent protein kinase II (CaMKII), and calpain were evaluated by western blot. Compared to injured NC-TBI mice, EE-TBI mice had improved memory and decreased anxiety and exploratory activity post-injury. Treatment with enrichment also corresponded to normal NMDAR subunit expression, decreased GluR1 phosphorylation, decreased phosphorylated CaMKII, and normal calpain expression post-rmTBI. These data suggest that enrichment strategies may improve functional outcomes and mitigate synaptic changes post-rmTBI. Given that enrichment strategies are feasible in the clinical setting, particularly for athletes and soldiers for whom the risk of repetitive injury is greatest, these data suggest that clinical trials may be warranted.

  17. Role of ionotropic glutamate receptors in LTP in rat hippocampal CA1 oriens-lacunosum moleculare interneurons

    PubMed Central

    Oren, Iris; Nissen, Wiebke; Kullmann, Dimitri M.; Somogyi, Peter; Lamsa, Karri P.

    2009-01-01

    Some interneurons of the hippocampus exhibit NMDA receptor-independent long-term potentiation (LTP) that is induced by presynaptic glutamate release when the postsynaptic membrane potential is hyperpolarized. This ‘anti-Hebbian’ form of LTP is prevented by postsynaptic depolarization or by blocking AMPA and kainate receptors. Although both AMPA and kainate receptors are expressed in hippocampal interneurons, their relative roles in anti-Hebbian LTP are not known. Because interneuron diversity potentially conceals simple rules underlying different forms of plasticity, we focus on glutamatergic synapses onto a subset of interneurons with dendrites in stratum oriens and a main ascending axon that projects to stratum lacunosum-moleculare, the O-LM cells. We show that anti-Hebbian LTP in O-LM interneurons has consistent induction and expression properties, and is prevented by selective inhibition of AMPA receptors. The majority of the ionotropic glutamatergic synaptic current in these cells is mediated by inwardly rectifying Ca2+ -permeable AMPA receptors. Although GluR5-containing kainate receptors contribute to synaptic currents at high stimulus frequency, they are not required for LTP induction. Glutamatergic synapses on O-LM cells thus behave in a homogeneous manner, and exhibit LTP dependent on Ca2+-permeable AMPA receptors. PMID:19176803

  18. Systemic lipopolysaccharide administration impairs retrieval of context-object discrimination, but not spatial, memory: Evidence for selective disruption of specific hippocampus-dependent memory functions during acute neuroinflammation

    PubMed Central

    Czerniawski, Jennifer; Miyashita, Teiko; Lewandowski, Gail; Guzowski, John F.

    2014-01-01

    Neuroinflammation is implicated in impairments in neuronal function and cognition that arise with aging, trauma, and/or disease. Therefore, understanding the underlying basis of the effect of immune system activation on neural function could lead to therapies for treating cognitive decline. Although neuroinflammation is widely thought to preferentially impair hippocampus-dependent memory, data on the effects of cytokines on cognition are mixed. One possible explanation for these inconsistent results is that cytokines may disrupt specific neural processes underlying some forms of memory but not others. In an earlier study, we tested the effect of systemic administration of bacterial lipopolysaccharide (LPS) on retrieval of hippocampus-dependent context memory and neural circuit function in CA3 and CA1 (Czerniawski and Guzowski, 2014). Paralleling impairment in context discrimination memory, we observed changes in neural circuit function consistent with disrupted pattern separation function. In the current study we tested the hypothesis that acute neuroinflammation selectively disrupts memory retrieval in tasks requiring hippocampal pattern separation processes. Male Sprague-Dawley rats given LPS systemically prior to testing exhibited intact performance in tasks that do not require hippocampal pattern separation processes: novel object recognition and spatial memory in the water maze. By contrast, memory retrieval in a task thought to require hippocampal pattern separation, context-object discrimination, was strongly impaired in LPS-treated rats in the absence of any gross effects on exploratory activity or motivation. These data show that LPS administration does not impair memory retrieval in all hippocampus-dependent tasks, and support the hypothesis that acute neuroinflammation impairs context discrimination memory via disruption of pattern separation processes in hippocampus. PMID:25451612

  19. Systemic lipopolysaccharide administration impairs retrieval of context-object discrimination, but not spatial, memory: Evidence for selective disruption of specific hippocampus-dependent memory functions during acute neuroinflammation.

    PubMed

    Czerniawski, Jennifer; Miyashita, Teiko; Lewandowski, Gail; Guzowski, John F

    2015-02-01

    Neuroinflammation is implicated in impairments in neuronal function and cognition that arise with aging, trauma, and/or disease. Therefore, understanding the underlying basis of the effect of immune system activation on neural function could lead to therapies for treating cognitive decline. Although neuroinflammation is widely thought to preferentially impair hippocampus-dependent memory, data on the effects of cytokines on cognition are mixed. One possible explanation for these inconsistent results is that cytokines may disrupt specific neural processes underlying some forms of memory but not others. In an earlier study, we tested the effect of systemic administration of bacterial lipopolysaccharide (LPS) on retrieval of hippocampus-dependent context memory and neural circuit function in CA3 and CA1 (Czerniawski and Guzowski, 2014). Paralleling impairment in context discrimination memory, we observed changes in neural circuit function consistent with disrupted pattern separation function. In the current study we tested the hypothesis that acute neuroinflammation selectively disrupts memory retrieval in tasks requiring hippocampal pattern separation processes. Male Sprague-Dawley rats given LPS systemically prior to testing exhibited intact performance in tasks that do not require hippocampal pattern separation processes: novel object recognition and spatial memory in the water maze. By contrast, memory retrieval in a task thought to require hippocampal pattern separation, context-object discrimination, was strongly impaired in LPS-treated rats in the absence of any gross effects on exploratory activity or motivation. These data show that LPS administration does not impair memory retrieval in all hippocampus-dependent tasks, and support the hypothesis that acute neuroinflammation impairs context discrimination memory via disruption of pattern separation processes in hippocampus. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Agonist-stimulated cobalt uptake provides selective visualization of neurons expressing AMPA- or kainate-type glutamate receptors in the retina.

    PubMed

    Pourcho, Roberta G; Qin, Pu; Goebel, Dennis J; Fyk-Kolodziej, Bozena

    2002-12-16

    Fast-acting excitatory neurotransmission in the retina is mediated primarily by glutamate, acting at alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) -selective and kainate-selective receptors. To localize these sites of action, cat retinas were stimulated with either AMPA or kainate and processed for histochemical visualization of cobalt uptake through calcium-permeable channels. Treatment with both agonists resulted in staining of A- and B-type horizontal cells and several types of OFF cone bipolar cells; there was no evidence for staining of ON cone bipolar cells or rod bipolar cells. The subpopulations of OFF cone bipolar cells differed in their responses with two distinct types that stained heavily with cobalt after exposure to AMPA and three different types that were preferentially labeled after exposure to kainate. Although many amacrine and ganglion cells appeared to respond to both agonists, AII amacrine cells were stained after stimulation by AMPA but not by kainate. The OFF cone bipolar cells that exhibit AMPA-stimulated cobalt uptake were found to have a high level of correspondence with cells that show immunocytochemical staining for the AMPA-selective glutamate receptor subunits GluR1 and GluR2/3. Similarly, the cone bipolar cells exhibiting kainate-stimulated cobalt uptake resemble those that are immunoreactive for the kainate subunit GluR5. The results indicate that, whereas many retinal neurons express both AMPA and kainate receptors, AII amacrine cells and subpopulations of OFF cone bipolar cells are limited to the expression of either AMPA or kainate receptors. This differential expression may contribute to the unique character of transmission by these cell types. Copyright 2002 Wiley-Liss, Inc.

  1. Human Neural Cell-Based Biosensor

    DTIC Science & Technology

    2010-04-26

    SNAP25 (SNAP25), GluR1 (GRIA1) glutamate receptor , ionotropic , AMPA1, Nav1.2 (SCN2A), Nav1.6 (SCN8A), CaV 2.1 (CACNA1A), HERG (KCNH2), and KCC2...transitions to mesenchymal progenitor cells." Tissue Eng Part A 15(8): 1897-907. Haltiwanger, R. S. and P. Stanley (2002). "Modulation of receptor ...cytometry studies previously conducted by the Stice lab identified ciliary neurotrophic factor receptor alpha (CNTFRα) as a novel cell surface marker to

  2. Phrenic motoneuron expression of serotonergic and glutamatergic receptors following upper cervical spinal cord injury

    PubMed Central

    Mantilla, Carlos B.; Bailey, Jeffrey P.; Zhan, Wen-Zhi; Sieck, Gary C.

    2012-01-01

    Following cervical spinal cord injury at C2 (SH hemisection model) there is progressive recovery of phrenic activity. Neuroplasticity in the postsynaptic expression of neurotransmitter receptors may contribute to functional recovery. Phrenic motoneurons express multiple serotonergic (5-HTR) and glutamatergic (GluR) receptors, but the timing and possible role of these different neurotransmitter receptor subtypes in the neuroplasticity following SH are not clear. The current study was designed to test the hypothesis that there is an increased expression of serotonergic and glutamatergic neurotransmitter receptors within phrenic motoneurons after SH. In adult male rats, phrenic motoneurons were labeled retrogradely by intrapleural injection of Alexa 488-conjugated cholera toxin B. In thin (10 μm) frozen sections of the spinal cord, fluorescently-labeled phrenic motoneurons were visualized for laser capture microdissection (LCM). Using quantitative real-time RT-PCR in LCM samples, the time course of changes in 5-HTR and GluR mRNA expression was determined in phrenic motoneurons up to 21 days post-SH. Expression of 5-HTR subtypes 1b, 2a and 2c and GluR subtypes AMPA, NMDA, mGluR1 and mGluR5 was evident in phrenic motoneurons from control and SH rats. Phrenic motoneuron expression of 5-HTR2a increased ~8-fold (relative to control) at 14 days post-SH, whereas NMDA expression increased ~16-fold by 21-days post-SH. There were no other significant changes in receptor expression at any time post-SH. This is the first study to systematically document changes in motoneuron expression of multiple neurotransmitter receptors involved in regulation of motoneuron excitability. By providing information on the neuroplasticity of receptors expressed in a motoneuron pool that is inactivated by a higher-level spinal cord injury, appropriate pharmacological targets can be identified to alter motoneuron excitability. PMID:22227062

  3. Glutamate Receptor Aptamers and ALS

    DTIC Science & Technology

    2008-01-01

    XXGATC ACC Consensus sequence RNA library Cloning and sequencing SELEX DIAGRAM Fig. 1. (a) Flow chart of SELEX. The library we used for SELEX...recording electrode and placed ~100 µm away from the hole. The linear flow rate of the solution is 1-4 cm/s. An optical fiber through which laser light for...channel recording (26) GluR6Q 1.1 × 104 4.2 × 102 Laser-pulse photolysis (67) 1.0 × 104 4.4 × 102 Fitting (52) 1.0 × 104 Flow measurement (46

  4. Molecular alterations in the hippocampus after experimental subarachnoid hemorrhage

    PubMed Central

    Han, Sang Myung; Wan, Hoyee; Kudo, Gen; Foltz, Warren D; Vines, Douglass C; Green, David E; Zoerle, Tommaso; Tariq, Asma; Brathwaite, Shakira; D'Abbondanza, Josephine; Ai, Jinglu; Macdonald, R Loch

    2014-01-01

    Patients with aneurysmal subarachnoid hemorrhage (SAH) frequently have deficits in learning and memory that may or may not be associated with detectable brain lesions. We examined mediators of long-term potentiation after SAH in rats to determine what processes might be involved. There was a reduction in synapses in the dendritic layer of the CA1 region on transmission electron microscopy as well as reduced colocalization of microtubule-associated protein 2 (MAP2) and synaptophysin. Immunohistochemistry showed reduced staining for GluR1 and calmodulin kinase 2 and increased staining for GluR2. Myelin basic protein staining was decreased as well. There was no detectable neuronal injury by Fluoro-Jade B, TUNEL, or activated caspase-3 staining. Vasospasm of the large arteries of the circle of Willis was mild to moderate in severity. Nitric oxide was increased and superoxide anion radical was decreased in hippocampal tissue. Cerebral blood flow, measured by magnetic resonance imaging, and cerebral glucose metabolism, measured by positron emission tomography, were no different in SAH compared with control groups. The results suggest that the etiology of loss of LTP after SAH is not cerebral ischemia but may be mediated by effects of subarachnoid blood such as oxidative stress and inflammation. PMID:24064494

  5. Prolonged seizure activity leads to increased Protein Kinase A activation in the rat pilocarpine model of status epilepticus.

    PubMed

    Bracey, James M; Kurz, Jonathan E; Low, Brian; Churn, Severn B

    2009-08-04

    Status epilepticus is a life-threatening form of seizure activity that represents a major medical emergency associated with significant morbidity and mortality. Protein Kinase A is an important regulator of synaptic strength that may play an important role in the development of status epilepticus-induced neuronal pathology. This study demonstrated an increase in PKA activity against exogenous and endogenous substrates during later stages of SE. As SE progressed, a significant increase in PKA-mediated phosphorylation of an exogenous peptide substrate was demonstrated in cortical structures. The increased activity was not due to altered expression of either regulatory or catalytic subunits of the enzyme. Through the use of phospho-specific antibodies, this study also investigated the effects of SE on the phosphorylation of the GluR1 subunit of the AMPA subtype of glutamate receptor. After the onset of continuous seizure activity, an increase in phosphorylation of the PKA site on the GluR1 subunit of the AMPA receptor was observed. These data suggest a potential mechanism by which SE may increase neuronal excitability in the cortex, potentially leading to maintenance of seizure activity or long-term neuronal pathology.

  6. Focused microwave irradiation-assisted immunohistochemistry to study effects of ketamine on phospho-ERK expression in the mouse brain.

    PubMed

    Fernandes, Alda; Li, Yu-Wen

    2017-09-01

    Ketamine produces rapid and long-lasting antidepressant effects in depressive patients. Preclinical studies demonstrate that ketamine stimulates AMPA receptor transmission and activates BDNF/TrkB-Akt/ERK-mTOR signaling cascades, leading to a sustained increase in synaptic protein synthesis and strengthening of synaptic plasticity, a potential mechanism underlying the antidepressant effects. The purpose of this study was to develop an immunohistochemistry (IHC) assay to map the distribution of extracellular signal-regulated kinase (ERK) phosphorylation in the mouse brain in response to systemic ketamine treatment. We established a focused microwave irradiation-assisted IHC assay to detect phosphorylated (phospho) proteins including phospho-ERK, phospho- cAMP-response- element-binding protein (CREB), phospho- glutamate receptor 1 (GluR1) and phospho- calcium/calmodulin-dependent protein kinase II (CaMKII) with greater sensitivity and reproducibility in comparison to conventional IHC methods. A single dose of ketamine produced a robust, dose- and time-dependent increase in phospho-ERK immunoreactive (phospho-ERK-ir) neurons in the medial prefrontal cortex (mPFC) and the central nucleus of the amygdala. Phospho-ERK-ir neurons in the mPFC were primarily located in the prelimbic and anterior cingulate subregions with the morphology resembling pyramidal neurons. An increase in phospho-ERK-ir was also observed in the brainstem dorsal raphe nucleus and locus coeruleus. The NMDA GluN2B subtype receptor antagonist Ro 25-6981 increased phospho-ERK expression in the brain in a similar pattern as ketamine. In summary, we have established a sensitive and reliable focused microwave irradiation-assisted IHC assay, and defined the activation pattern of ERK, in response to systemic ketamine and Ro 25-6981 treatment, in brain regions that are potentially responsible for mediating the antidepressant effects. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. The Timing of Multiple Retrieval Events Can Alter GluR1 Phosphorylation and the Requirement for Protein Synthesis in Fear Memory Reconsolidation

    ERIC Educational Resources Information Center

    Jarome, Timothy J.; Kwapis, Janine L.; Werner, Craig T.; Parsons, Ryan G.; Gafford, Georgette M.; Helmstetter, Fred J.

    2012-01-01

    Numerous studies have indicated that maintaining a fear memory after retrieval requires de novo protein synthesis. However, no study to date has examined how the temporal dynamics of repeated retrieval events affect this protein synthesis requirement. The present study varied the timing of a second retrieval of an established auditory fear memory…

  8. SIRT1 Activity Is Linked to Its Brain Region-Specific Phosphorylation and Is Impaired in Huntington’s Disease Mice

    PubMed Central

    Tulino, Raffaella; Benjamin, Agnesska C.; Jolinon, Nelly; Smith, Donna L.; Chini, Eduardo N.; Carnemolla, Alisia; Bates, Gillian P.

    2016-01-01

    Huntington’s disease (HD) is a neurodegenerative disorder for which there are no disease-modifying treatments. SIRT1 is a NAD+-dependent protein deacetylase that is implicated in maintaining neuronal health during development, differentiation and ageing. Previous studies suggested that the modulation of SIRT1 activity is neuroprotective in HD mouse models, however, the mechanisms controlling SIRT1 activity are unknown. We have identified a striatum-specific phosphorylation-dependent regulatory mechanism of SIRT1 induction under normal physiological conditions, which is impaired in HD. We demonstrate that SIRT1 activity is down-regulated in the brains of two complementary HD mouse models, which correlated with altered SIRT1 phosphorylation levels. This SIRT1 impairment could not be rescued by the ablation of DBC1, a negative regulator of SIRT1, but was linked to changes in the sub-cellular distribution of AMPK-α1, a positive regulator of SIRT1 function. This work provides insights into the regulation of SIRT1 activity with the potential for the development of novel therapeutic strategies. PMID:26815359

  9. The epidemiology of dependence in older people in Nigeria: prevalence, determinants, informal care, and health service utilization. A 10/66 dementia research group cross-sectional survey.

    PubMed

    Uwakwe, Richard; Ibeh, Christian C; Modebe, Anne Ifeoma; Bo, Emeka; Ezeama, Nkiru; Njelita, Ifeoma; Ferri, Cleusa P; Prince, Martin J

    2009-09-01

    To describe the prevalence and determinants of dependence in older Nigerians and associations with informal care and health service utilization. A single-phase cross-sectional catchment area survey. Dunukofia, a rural community in southeastern Nigeria. One thousand two hundred thirty-eight adults aged 65 and older, for whom full data were available on 914. The full 10/66 Dementia Research Group survey protocol was applied, including ascertainment of depression, cognitive impairment, physical impairments, and self-reported diagnoses. The interviewer rated dependence as not needing care, needing some care, or needing much care. The prevalence of dependence and the independent contribution of underlying health conditions were estimated. Sources of income, care arrangements, caregiver strain, and health service use are described according to level of dependence. The prevalence of dependence was 24.3% (95% confidence interval=22.1-26.5%), with a concentration in participants aged 80 and older. Only 1% of participants received a pension, and fewer than 7% had paid work. Those who were dependent were less likely than others to receive income from their family. Cognitive impairment, physical impairments, stroke, and depression were each independently associated with dependence. Depression made the largest contribution. Dependence was strongly associated with health service use (particularly private doctor and traditional healer services) and with high levels of out-of-pocket expenditure. In Nigeria, dependence is an important outcome given rapid demographic aging and increases in chronic disease prevalence in all developing regions. Enhancing the social protection of dependent older adults should be a policy priority. Cognitive and mental disorders are important contributors to disability and dependence; more attention should be given to their prevention, detection, and treatment.

  10. TPEN, a Specific Zn2+ Chelator, Inhibits Sodium Dithionite and Glucose Deprivation (SDGD)-Induced Neuronal Death by Modulating Apoptosis, Glutamate Signaling, and Voltage-Gated K+ and Na+ Channels.

    PubMed

    Zhang, Feng; Ma, Xue-Ling; Wang, Yu-Xiang; He, Cong-Cong; Tian, Kun; Wang, Hong-Gang; An, Di; Heng, Bin; Xie, Lai-Hua; Liu, Yan-Qiang

    2017-03-01

    Hypoxia-ischemia-induced neuronal death is an important pathophysiological process that accompanies ischemic stroke and represents a major challenge in preventing ischemic stroke. To elucidate factors related to and a potential preventative mechanism of hypoxia-ischemia-induced neuronal death, primary neurons were exposed to sodium dithionite and glucose deprivation (SDGD) to mimic hypoxic-ischemic conditions. The effects of N,N,N',N'-tetrakis (2-pyridylmethyl) ethylenediamine (TPEN), a specific Zn 2+ -chelating agent, on SDGD-induced neuronal death, glutamate signaling (including the free glutamate concentration and expression of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor (GluR2) and N-methyl-D-aspartate (NMDA) receptor subunits (NR2B), and voltage-dependent K + and Na + channel currents were also investigated. Our results demonstrated that TPEN significantly suppressed increases in cell death, apoptosis, neuronal glutamate release into the culture medium, NR2B protein expression, and I K as well as decreased GluR2 protein expression and Na + channel activity in primary cultured neurons exposed to SDGD. These results suggest that TPEN could inhibit SDGD-induced neuronal death by modulating apoptosis, glutamate signaling (via ligand-gated channels such as AMPA and NMDA receptors), and voltage-gated K + and Na + channels in neurons. Hence, Zn 2+ chelation might be a promising approach for counteracting the neuronal loss caused by transient global ischemia. Moreover, TPEN could represent a potential cell-targeted therapy.

  11. Sex and HIV serostatus differences in decision making under risk among substance-dependent individuals.

    PubMed

    Martin, Eileen; Gonzalez, Raul; Vassileva, Jasmin; Maki, Pauline M; Bechara, Antoine; Brand, Matthias

    2016-01-01

    HIV+ individuals with and without substance use disorders make significantly poorer decisions when information about the probability and magnitude of wins and losses is not available. We administered the Game of Dice Task, a measure of decision making under risk that provides this information explicitly, to 92 HIV+ and 134 HIV- substance-dependent men and women. HIV+ participants made significantly poorer decisions than HIV- participants, but this deficit appeared more prominent among HIV+ women. These data indicate that decision making under risk is impaired among HIV+ substance-dependent individuals (SDIs). Potential factors for the HIV+ women's relatively greater impairment are discussed.

  12. Inhibiting PKMζ reveals dorsal lateral and dorsal medial striatum store the different memories needed to support adaptive behavior.

    PubMed

    Pauli, Wolfgang M; Clark, Alexandra D; Guenther, Heidi J; O'Reilly, Randall C; Rudy, Jerry W

    2012-06-20

    Evidence suggests that two regions of the striatum contribute differential support to instrumental response selection. The dorsomedial striatum (DMS) is thought to support expectancy-mediated actions, and the dorsolateral striatum (DLS) is thought to support habits. Currently it is unclear whether these regions store task-relevant information or just coordinate the learning and retention of these solutions by other brain regions. To address this issue, we developed a two-lever concurrent variable-interval reinforcement operant conditioning task and used it to assess the trained rat's sensitivity to contingency shifts. Consistent with the view that these two regions make different contributions to actions and habits, injecting the NMDA antagonist DL-AP5 into the DMS just prior to the shift impaired the rat's performance but enhanced performance when injected into the DLS. To determine if these regions support memory content, we first trained rats on a biased concurrent schedule (Lever 1: VI 40" and Lever 2: VI 10"). With the intent of "erasing" the memory content stored in striatum, after this training we inhibited the putative memory-maintenance protein kinase C isozyme protein kinase Mζ (PKMζ). Infusing zeta inhibitory peptide (ZIP) into the DLS enhanced the rat's ability to adapt to the contingency shift 2 d later, whereas injecting it into the DMS had the opposite effect. Infusing GluR2(3Y) into the DMS 1 h before ZIP infusions prevented ZIP from impairing the rat's sensitivity to the contingency shift. These results support the hypothesis that the DMS stores information needed to support actions and the DLS stores information needed to support habits.

  13. WITHDRAWN: H-reflex up-conditioning after sciatic nerve transection and regeneration may increase VGLUT-1 terminals and GluR2/3 immunoreactivity in spinal motoneurons.

    PubMed

    Sun, Chenyou; Wang, Yu; Chen, Xiang Yang

    2011-12-17

    This article has been withdrawn at the request of the author(s) and/or editor. The Publisher apologizes for any inconvenience this may cause. The full Elsevier Policy on Article Withdrawal can be found at http://www.elsevier.com/locate/withdrawalpolicy. Copyright © 2011. Published by Elsevier Ireland Ltd.. All rights reserved.

  14. Extinction Training Regulates Neuroadaptive Responses to Withdrawal from Chronic Cocaine Self-Administration

    PubMed Central

    Self, David W.; Choi, Kwang-Ho; Simmons, Diana; Walker, John R.; Smagula, Cynthia S.

    2004-01-01

    Cocaine produces multiple neuroadaptations with chronic repeated use. Many of these neuroadaptations can be reversed or normalized by extinction training during withdrawal from chronic cocaine self-administration in rats. This article reviews our past and present studies on extinction-induced modulation of the neuroadaptive response to chronic cocaine in the mesolimbic dopamine system, and the role of this modulation in addictive behavior in rats. Extinction training normalizes tyrosine hydroxylase levels in the nucleus accumbens (NAc) shell, an effect that could help ameliorate dysphoria and depression associated with withdrawal from chronic cocaine use. Extinction training also increases levels of GluR1 and GluR2/3 AMPA receptor subunits, while normalizing deficits in NR1 NMDA receptor subunits, in a manner consistent with long-term potentiation of excitatory synapses in the NAc shell. Our results suggest that extinction-induced increases in AMPA and NMDA receptors may restore deficits in cortico-accumbal neurotransmission in the NAc shell and facilitate inhibitory control over cocaine-seeking behavior. Other changes identified by gene expression profiling, including up-regulation in the AMPA receptor aggregating protein Narp, suggest that extinction training induces extensive synaptic reorganization. These studies highlight potential benefits for extinction training procedures in the treatment of drug addiction. PMID:15466321

  15. Glutamate mediates platelet activation through the AMPA receptor

    PubMed Central

    Morrell, Craig N.; Sun, Henry; Ikeda, Masahiro; Beique, Jean-Claude; Swaim, Anne Marie; Mason, Emily; Martin, Tanika V.; Thompson, Laura E.; Gozen, Oguz; Ampagoomian, David; Sprengel, Rolf; Rothstein, Jeffrey; Faraday, Nauder; Huganir, Richard; Lowenstein, Charles J.

    2008-01-01

    Glutamate is an excitatory neurotransmitter that binds to the kainate receptor, the N-methyl-D-aspartate (NMDA) receptor, and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each receptor was first characterized and cloned in the central nervous system (CNS). Glutamate is also present in the periphery, and glutamate receptors have been identified in nonneuronal tissues, including bone, heart, kidney, pancreas, and platelets. Platelets play a central role in normal thrombosis and hemostasis, as well as contributing greatly to diseases such as stroke and myocardial infarction. Despite the presence of glutamate in platelet granules, the role of glutamate during hemostasis is unknown. We now show that activated platelets release glutamate, that platelets express AMPAR subunits, and that glutamate increases agonist-induced platelet activation. Furthermore, we demonstrate that glutamate binding to the AMPAR increases intracellular sodium concentration and depolarizes platelets, which are important steps in platelet activation. In contrast, platelets treated with the AMPAR antagonist CNQX or platelets derived from GluR1 knockout mice are resistant to AMPA effects. Importantly, mice lacking GluR1 have a prolonged time to thrombosis in vivo. Our data identify glutamate as a regulator of platelet activation, and suggest that the AMPA receptor is a novel antithrombotic target. PMID:18283118

  16. Alleviating neuropathic pain mechanical allodynia by increasing Cdh1 in the anterior cingulate cortex.

    PubMed

    Tan, Wei; Yao, Wen-Long; Hu, Rong; Lv, You-You; Wan, Li; Zhang, Chuan-Han; Zhu, Chang

    2015-09-12

    Plastic changes in the anterior cingulate cortex (ACC) are critical in the pathogenesis of pain hypersensitivity caused by injury to peripheral nerves. Cdh1, a co-activator subunit of anaphase-promoting complex/cyclosome (APC/C) regulates synaptic differentiation and transmission. Based on this, we hypothesised that the APC/C-Cdh1 played an important role in long-term plastic changes induced by neuropathic pain in ACC. We employed spared nerve injury (SNI) model in rat and found Cdh1 protein level in the ACC was down-regulated 3, 7 and 14 days after SNI surgery. We detected increase in c-Fos expression, numerical increase of organelles, swollen myelinated fibre and axon collapse of neuronal cells in the ACC of SNI rat. Additionally, AMPA receptor GluR1 subunit protein level was up-regulated on the membrane through a pathway that involves EphA4 mediated by APC/C-Cdh1, 3 and 7 days after SNI surgery. To confirm the effect of Cdh1 in neuropathic pain, Cdh1-expressing lentivirus was injected into the ACC of SNI rat. Intra-ACC treatment with Cdh1-expressing lentivirus vectors elevated Cdh1 levels, erased synaptic strengthening, as well as alleviating established mechanical allodynia in SNI rats. We also found Cdh1-expressing lentivirus normalised SNI-induced redistribution of AMPA receptor GluR1 subunit in ACC by regulating AMPA receptor trafficking. These results provide evidence that Cdh1 in ACC synapses may offer a novel therapeutic strategy for treating chronic neuropathic pain.

  17. Exposure to 50 Hz electromagnetic radiation promote early maturation and differentiation in newborn rat cerebellar granule neurons.

    PubMed

    Lisi, A; Ciotti, M T; Ledda, M; Pieri, M; Zona, C; Mercanti, D; Rieti, S; Giuliani, L; Grimaldi, S

    2005-08-01

    The wish of this work is the study of the effect of electromagnetic (EMF) radiations at a frequency of 50 Hz on the development of cerebellar granule neurons (CGN). Granule neurons, prepared from newborn rat cerebellum (8 days after birth), were cultured after plate-seeding in the presence of EMF radiations, with the plan of characterizing their cellular and molecular biochemistry, after exposure to the electromagnetic stimulus. Five days challenge to EMF radiations showed, by the cytotoxic glutamate (Glu) pulse test, a 30% decrease of cells survival, while only 5% of mortality was reported for unexposed sample. Moreover, blocking the glutamate receptor (GluR) with the Glu competitor MK-801, no toxicity effect after CGN challenge to EMF radiations and Glu was detected. By patch-clamp recording technique, the Kainate-induced currents from 6 days old exposed CGN exhibited a significant increase with respect to control cells. Western blot and reverse transcription-polymerase chain reaction (RT-PCR) analyses show that EMF exposure of rats CGN, induces a change in both GluRs proteins and mRNAs expression with respect to control. In addition, the use of monoclonal antibody raised against neurofilament protein (NF-200) reveals an increase in NF-200 synthesis in the exposed CGN. All these results indicate that exposure to non-ionizing radiations contribute to a premature expression of GluRs reducing the life span of CGN, leading to a more rapid cell maturation. (c) 2005 Wiley-Liss, Inc.

  18. Gain-of-function STAT1 mutations impair STAT3 activity in patients with chronic mucocutaneous candidiasis (CMC).

    PubMed

    Zheng, Jie; van de Veerdonk, Frank L; Crossland, Katherine L; Smeekens, Sanne P; Chan, Chun M; Al Shehri, Tariq; Abinun, Mario; Gennery, Andrew R; Mann, Jelena; Lendrem, Dennis W; Netea, Mihai G; Rowan, Andrew D; Lilic, Desa

    2015-10-01

    Signal transducer and activator of transcription 3 (STAT3) triggered production of Th-17 cytokines mediates protective immunity against fungi. Mutations affecting the STAT3/interleukin 17 (IL-17) pathway cause selective susceptibility to fungal (Candida) infections, a hallmark of chronic mucocutaneous candidiasis (CMC). In patients with autosomal dominant CMC, we and others previously reported defective Th17 responses and underlying gain-of-function (GOF) STAT1 mutations, but how this affects STAT3 function leading to decreased IL-17 is unclear. We also assessed how GOF-STAT1 mutations affect STAT3 activation, DNA binding, gene expression, cytokine production, and epigenetic modifications. We excluded impaired STAT3 phosphorylation, nuclear translocation, and sequestration of STAT3 into STAT1/STAT3 heterodimers and confirm significantly reduced transcription of STAT3-inducible genes (RORC/IL-17/IL-22/IL-10/c-Fos/SOCS3/c-Myc) as likely underlying mechanism. STAT binding to the high affinity sis-inducible element was intact but binding to an endogenous STAT3 DNA target was impaired. Reduced STAT3-dependent gene transcription was reversed by inhibiting STAT1 activation with fludarabine or enhancing histone, but not STAT1 or STAT3 acetylation with histone deacetylase (HDAC) inhibitors trichostatin A or ITF2357. Silencing HDAC1, HDAC2, and HDAC3 indicated a role for HDAC1 and 2. Reduced STAT3-dependent gene transcription underlies low Th-17 responses in GOF-STAT1 CMC, which can be reversed by inhibiting acetylation, offering novel targets for future therapies. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Phosphodiesterase 2A Inhibitor TAK-915 Ameliorates Cognitive Impairments and Social Withdrawal in N-Methyl-d-Aspartate Receptor Antagonist-Induced Rat Models of Schizophrenia.

    PubMed

    Nakashima, Masato; Imada, Haruka; Shiraishi, Eri; Ito, Yuki; Suzuki, Noriko; Miyamoto, Maki; Taniguchi, Takahiko; Iwashita, Hiroki

    2018-04-01

    The pathophysiology of schizophrenia has been associated with glutamatergic dysfunction. Modulation of the glutamatergic signaling pathway, including N -methyl-d-aspartate (NMDA) receptors, can provide a new therapeutic target for schizophrenia. Phosphodiesterase 2A (PDE2A) is highly expressed in the forebrain, and is a dual substrate enzyme that hydrolyzes both cAMP and cGMP, which play pivotal roles as intracellular second messengers downstream of NMDA receptors. Here we characterize the in vivo pharmacological profile of a selective and brain-penetrant PDE2A inhibitor, ( N -{(1 S )-1-[3-fluoro-4-(trifluoromethoxy)phenyl]-2-methoxyethyl}-7-methoxy-2-oxo-2,3-dihydropyrido[2,3- b ]pyrazine-4(1 H )-carboxamide) (TAK-915) as a novel treatment of schizophrenia. Oral administration of TAK-915 at 3 and 10 mg/kg significantly increased cGMP levels in the frontal cortex, hippocampus, and striatum of rats. TAK-915 at 10 mg/kg significantly upregulated the phosphorylation of α -amino-3-hydroxy-5-methylisoxazole-4-proprionic acid receptor subunit GluR1 in the rat hippocampus. TAK-915 at 3 and 10 mg/kg significantly attenuated episodic memory deficits induced by the NMDA receptor antagonist (+)-MK-801 hydrogen maleate (MK-801) in the rat passive avoidance test. TAK-915 at 10 mg/kg significantly attenuated working memory deficits induced by MK-801 in the rat radial arm maze test. Additionally, TAK-915 at 10 mg/kg prevented subchronic phencyclidine-induced social withdrawal in social interaction in rats. In contrast, TAK-915 did not produce antipsychotic-like activity; TAK-915 had little effect on MK-801- or methamphetamine-induced hyperlocomotion in rats. These results suggest that TAK-915 has a potential to ameliorate cognitive impairments and social withdrawal in schizophrenia. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

  20. CB1 receptor-mediated signaling underlies the hippocampal synaptic, learning, and memory deficits following treatment with JWH-081, a new component of spice/K2 preparations.

    PubMed

    Basavarajappa, Balapal S; Subbanna, Shivakumar

    2014-02-01

    Recently, synthetic cannabinoids have been sprayed onto plant material, which is subsequently packaged and sold as "Spice" or "K2" to mimic the effects of marijuana. A recent report identified several synthetic additives in samples of "Spice/K2", including JWH-081, a synthetic ligand for the cannabinoid receptor 1 (CB1). The deleterious effects of JWH-081 on brain function are not known, particularly on CB1 signaling, synaptic plasticity, learning and memory. Here, we evaluated the effects of JWH-081 on pCaMKIV, pCREB, and pERK1/2 signaling events followed by long-term potentiation (LTP), hippocampal-dependent learning and memory tasks using CB1 receptor wild-type (WT) and knockout (KO) mice. Acute administration of JWH-081 impaired CaMKIV phosphorylation in a dose-dependent manner, whereas inhibition of CREB phosphorylation in CB1 receptor WT mice was observed only at higher dose of JWH-081 (1.25 mg/kg). JWH-081 at higher dose impaired CaMKIV and CREB phosphorylation in a time-dependent manner in CB1 receptor WT mice but not in KO mice and failed to alter ERK1/2 phosphorylation. In addition, SR treated or CB1 receptor KO mice have a lower pCaMKIV/CaMKIV ratio and higher pCREB/CREB ratio compared with vehicle or WT littermates. In hippocampal slices, JWH-081 impaired LTP in CB1 receptor WT but not in KO littermates. Furthermore, JWH-081 at higher dose impaired object recognition, spontaneous alternation and spatial memory on the Y-maze in CB1 receptor WT mice but not in KO mice. Collectively our findings suggest that deleterious effects of JWH-081 on hippocampal function involves CB1 receptor mediated impairments in CaMKIV and CREB phosphorylation, LTP, learning and memory in mice. © 2013 Wiley Periodicals, Inc.

  1. Spermidine Suppresses Age-Associated Memory Impairment by Preventing Adverse Increase of Presynaptic Active Zone Size and Release

    PubMed Central

    Gupta, Varun K.; Pech, Ulrike; Fulterer, Andreas; Ender, Anatoli; Mauermann, Stephan F.; Andlauer, Till F. M.; Beuschel, Christine; Thriene, Kerstin; Quentin, Christine; Schwärzel, Martin; Mielke, Thorsten; Madeo, Frank; Dengjel, Joern; Fiala, André; Sigrist, Stephan J.

    2016-01-01

    Memories are assumed to be formed by sets of synapses changing their structural or functional performance. The efficacy of forming new memories declines with advancing age, but the synaptic changes underlying age-induced memory impairment remain poorly understood. Recently, we found spermidine feeding to specifically suppress age-dependent impairments in forming olfactory memories, providing a mean to search for synaptic changes involved in age-dependent memory impairment. Here, we show that a specific synaptic compartment, the presynaptic active zone (AZ), increases the size of its ultrastructural elaboration and releases significantly more synaptic vesicles with advancing age. These age-induced AZ changes, however, were fully suppressed by spermidine feeding. A genetically enforced enlargement of AZ scaffolds (four gene-copies of BRP) impaired memory formation in young animals. Thus, in the Drosophila nervous system, aging AZs seem to steer towards the upper limit of their operational range, limiting synaptic plasticity and contributing to impairment of memory formation. Spermidine feeding suppresses age-dependent memory impairment by counteracting these age-dependent changes directly at the synapse. PMID:27684064

  2. Phosphatidylinositol 3-kinase is a key mediator of central sensitization in painful inflammatory conditions

    PubMed Central

    Pezet, Sophie; Marchand, Fabien; D'Mello, Richard; Grist, John; Clark, Anna K.; Malcangio, Marzia; Dickenson, Anthony H.; Williams, Robert J.; McMahon, Stephen B.

    2010-01-01

    Here we show that phosphatidylinositol 3-kinase (PI3K) is a key player in the establishment of central sensitization, the spinal cord phenomenon associated with persistent afferent inputs and contributing to chronic pain states. We demonstrated electrophysiologically that PI3K is required for the full expression of spinal neuronal wind-up. In an inflammatory pain model, intrathecal administration of LY294002, a potent PI3K inhibitor, dose-dependently inhibited pain related behavior. This effect was correlated with a reduction of the phosphorylation of extracellular signal-regulated kinase (ERK) and CaMKinase II. In addition, we observed a significant decrease in the phosphorylation of the NMDA receptor subunit NR2B, decreased translocation to the plasma membrane of the GluR1 AMPA receptor subunit in the spinal cord and a reduction of evoked neuronal activity as measured using c-Fos immunohistochemistry. Our study suggests that PI3K is a major factor in the expression of central sensitization after noxious inflammatory stimuli. PMID:18417706

  3. Performance in hippocampus- and PFC-dependent cognitive domains are not concomitantly impaired in rats exposed to 20 cGy of 1 GeV/n 56Fe particles

    NASA Astrophysics Data System (ADS)

    Britten, Richard A.; Miller, Vania D.; Hadley, Melissa M.; Jewell, Jessica S.; Macadat, Evangeline

    2016-08-01

    NASA is currently conducting ground based experiments to determine whether the radiation environment that astronauts will encounter on deep space missions will have an impact on their long-term health and their ability to complete the various tasks during the mission. Emerging data suggest that exposure of rodents to mission-relevant HZE radiation doses does result in the impairment of various neurocognitive processes. An essential part of mission planning is a probabilistic risk assessment process that takes into account the likely incidence and severity of a problem. To date few studies have reported the impact of space radiation in a format that is amenable to PRA, and those that have only reported data for a single cognitive process. This study has established the ability of individual male Wistar rats to conduct a hippocampus-dependent (spatial memory) task and a cortex-dependent (attentional set shifting task) 90 days after exposure to 20 cGy 1 GeV/n 56Fe particles. Radiation-induced impairment of performance in one cognitive domain was not consistently associated with impaired performance in the other domain. Thus sole reliance upon a single measure of cognitive performance may substantially under-estimate the risk of cognitive impairment, and ultimately it may be necessary to establish the likelihood that mission-relevant HZE doses will impair performance in the three or four cognitive domains that NASA considers to be most critical for mission success, and build a PRA using the composite data from such studies.

  4. NADPH oxidase promotes Parkinsonian phenotypes by impairing autophagic flux in an mTORC1-independent fashion in a cellular model of Parkinson’s disease

    PubMed Central

    Pal, Rituraj; Bajaj, Lakshya; Sharma, Jaiprakash; Palmieri, Michela; Di Ronza, Alberto; Lotfi, Parisa; Chaudhury, Arindam; Neilson, Joel; Sardiello, Marco; Rodney, George G.

    2016-01-01

    Oxidative stress and aberrant accumulation of misfolded proteins in the cytosol are key pathological features associated with Parkinson’s disease (PD). NADPH oxidase (Nox2) is upregulated in the pathogenesis of PD; however, the underlying mechanism(s) of Nox2-mediated oxidative stress in PD pathogenesis are still unknown. Using a rotenone-inducible cellular model of PD, we observed that a short exposure to rotenone (0.5 μM) resulted in impaired autophagic flux through activation of a Nox2 dependent Src/PI3K/Akt axis, with a consequent disruption of a Beclin1-VPS34 interaction that was independent of mTORC1 activity. Sustained exposure to rotenone at a higher dose (10 μM) decreased mTORC1 activity; however, autophagic flux was still impaired due to dysregulation of lysosomal activity with subsequent induction of the apoptotic machinery. Cumulatively, our results highlight a complex pathogenic mechanism for PD where short- and long-term oxidative stress alters different signaling pathways, ultimately resulting in anomalous autophagic activity and disease phenotype. Inhibition of Nox2-dependent oxidative stress attenuated the impaired autophagy and cell death, highlighting the importance and therapeutic potential of these pathways for treating patients with PD. PMID:26960433

  5. The N-terminal domain of GluR6-subtype glutamate receptor ion channels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Janesh; Schuck, Peter; Jin, Rongsheng

    2009-09-25

    The amino-terminal domain (ATD) of glutamate receptor ion channels, which controls their selective assembly into AMPA, kainate and NMDA receptor subtypes, is also the site of action of NMDA receptor allosteric modulators. Here we report the crystal structure of the ATD from the kainate receptor GluR6. The ATD forms dimers in solution at micromolar protein concentrations and crystallizes as a dimer. Unexpectedly, each subunit adopts an intermediate extent of domain closure compared to the apo and ligand-bound complexes of LIVBP and G protein-coupled glutamate receptors (mGluRs), and the dimer assembly has a markedly different conformation from that found in mGluRs.more » This conformation is stabilized by contacts between large hydrophobic patches in the R2 domain that are absent in NMDA receptors, suggesting that the ATDs of individual glutamate receptor ion channels have evolved into functionally distinct families.« less

  6. Increasing the GluN2A/GluN2B Ratio in Neurons of the Mouse Basal and Lateral Amygdala Inhibits the Modification of an Existing Fear Memory Trace.

    PubMed

    Holehonnur, Roopashri; Phensy, Aarron J; Kim, Lily J; Milivojevic, Milica; Vuong, Dat; Daison, Delvin K; Alex, Saira; Tiner, Michael; Jones, Lauren E; Kroener, Sven; Ploski, Jonathan E

    2016-09-07

    Reconsolidation updating is a form of memory modification in which an existing memory can become destabilized upon retrieval and subsequently be modified via protein-synthesis-dependent reconsolidation. However, not all memories appear to destabilize upon retrieval and thus are not modifiable via reconsolidation updating approaches and the neurobiological basis for this remains poorly understood. Here, we report that auditory fear memories created with 10 tone-shock pairings are resistant to retrieval-dependent memory destabilization and are associated with an increase in the synaptic GluN2A/GluN2B ratio in neurons of the basal and lateral amygdala (BLA) compared with weaker fear memories created via one or three tone-shock pairings. To increase the GluN2A/GluN2B ratio after learning, we generated a line of mice that expresses an inducible and doxycycline-dependent GFP-GluN2A transgene specifically in α-CaMKII-positive neurons. Our findings indicate that increasing the GluN2A/GluN2B ratio in BLA α-CaMKII-positive neurons after a weak fear memory has consolidated inhibits retrieval-dependent memory destabilization and modification of the fear memory trace. This was associated with a reduction in retrieval-dependent AMPA receptor trafficking, as evidenced by a reduction in retrieval-dependent phosphorylation of GluR1 at serine-845. In addition, we determined that increasing the GluN2A/GluN2B ratio before fear learning significantly impaired long term memory consolidation, whereas short-term memory remained unaltered. An increase in the GluN2A/GluN2B ratio after fear learning had no influence on fear extinction or expression. Our results underscore the importance of NMDAR subunit composition for memory destabilization and suggest a mechanism for why some memories are resistant to modification. Memory modification using reconsolidation updating is being examined as one of the potential treatment approaches for attenuating maladaptive memories associated with emotional disorders. However, studies have shown that, whereas weak memories can be modified using reconsolidation updating, strong memories can be resistant to this approach. Therefore, treatments targeting the reconsolidation process are unlikely to be clinically effective unless methods are devised to enhance retrieval-dependent memory destabilization. Currently, little is known about the cellular and molecular events that influence the induction of reconsolidation updating. Here, we determined that an increase in the GluN2A/GluN2B ratio interferes with retrieval-dependent memory destabilization and inhibits the initiation of reconsolidation updating. Copyright © 2016 the authors 0270-6474/16/369490-15$15.00/0.

  7. Rho-kinase inhibitor and nicotinamide adenine dinucleotide phosphate oxidase inhibitor prevent impairment of endothelium-dependent cerebral vasodilation by acute cigarette smoking in rats.

    PubMed

    Iida, Hiroki; Iida, Mami; Takenaka, Motoyasu; Fukuoka, Naokazu; Dohi, Shuji

    2008-06-01

    We previously reported that acute cigarette smoking can cause a dysfunction of endothelium-dependent vasodilation in cerebral vessels, and that blocking the angiotensin II (Ang II) type 1 (AT1) receptor with valsartan prevented this impairment. Our aim was to investigate the effects of a Rho-kinase inhibitor (fasudil) and a Nicotinamide Adenine Dinucleotide PHosphate (NADPH) oxidase inhibitor (apocynin) on smoking-induced endothelial dysfunction in cerebral arterioles. In Sprague-Dawley rats, we used a closed cranial window preparation to measure changes in pial vessel diameters following topical acetylcholine (ACh) before smoking. After one-minute smoking, we again examined the arteriolar responses to ACh. Finally, after intravenous fasudil or apocynin pre-treatment we re-examined the vasodilator responses to topical ACh (before and after cigarette smoking). Under control conditions, cerebral arterioles were dose-dependently dilated by topical ACh (10(-6) M and 10(-5) M). One hour after a one-minute smoking (1 mg-nicotine cigarette), 10(-5) M ACh constricted cerebral arterioles. However, one hour after a one-minute smoking, 10(-5) M ACh dilated cerebral pial arteries both in the fasudil pre-treatment and the apocynin pre-treatment groups, responses that were significantly different from those obtained without fasudil or apocynin pre-treatment. Thus, inhibition of Rho-kinase and NADPH oxidase activities may prevent the above smoking-induced impairment of endothelium-dependent vasodilation.

  8. Glutamate-dependent transcriptional regulation in bergmann glia cells: involvement of p38 MAP kinase.

    PubMed

    Zepeda, Rossana C; Barrera, Iliana; Castelán, Francisco; Soto-Cid, Abraham; Hernández-Kelly, Luisa C; López-Bayghen, Esther; Ortega, Arturo

    2008-07-01

    Glutamate (Glu) is the major excitatory neurotransmitter in the Central Nervous System (CNS). Ionotropic and metabotropic glutamate receptors (GluRs) are present in neurons and glial cells and are involved in gene expression regulation. Mitogen-activated proteins kinases (MAPK) are critical for all the membrane to nuclei signaling pathways described so far. In cerebellar Bergmann glial cells, glutamate-dependent transcriptional regulation is partially dependent on p42/44 MAPK activity. Another member of this kinase family, p38 MAPK is activated by non-mitogenic stimuli through its Thr180/Tyr182 phosphorylation and phosphorylates cytoplasmic and nuclear protein targets involved in translational and transcriptional events. Taking into consideration that the role of p38MAPK in glial cells is not well understood, we demonstrate here that glutamate increases p38 MAPK phosphorylation in a time and dose dependent manner in cultured chick cerebellar Bergmann glial cells (BGC). Moreover, p38 MAPK is involved in the glutamate-induced transcriptional activation in these cells. Ionotropic as well as metabotropic glutamate receptors participate in p38 MAPK activation. The present findings demonstrate the involvement of p38 MAPK in glutamate-dependent gene expression regulation in glial cells.

  9. Acquisition and expression of conditioned taste aversion differentially affects extracellular signal regulated kinase and glutamate receptor phosphorylation in rat prefrontal cortex and nucleus accumbens

    PubMed Central

    Marotta, Roberto; Fenu, Sandro; Scheggi, Simona; Vinci, Stefania; Rosas, Michela; Falqui, Andrea; Gambarana, Carla; De Montis, M. Graziella; Acquas, Elio

    2014-01-01

    Conditioned taste aversion (CTA) can be applied to study associative learning and its relevant underpinning molecular mechanisms in discrete brain regions. The present study examined, by immunohistochemistry and immunocytochemistry, the effects of acquisition and expression of lithium-induced CTA on activated Extracellular signal Regulated Kinase (p-ERK) in the prefrontal cortex (PFCx) and nucleus accumbens (Acb) of male Sprague-Dawley rats. The study also examined, by immunoblotting, whether acquisition and expression of lithium-induced CTA resulted in modified levels of phosphorylation of glutamate receptor subunits (NR1 and GluR1) and Thr34- and Thr75-Dopamine-and-cAMP-Regulated PhosphoProtein (DARPP-32). CTA acquisition was associated with an increase of p-ERK-positive neurons and phosphorylated NR1 receptor subunit (p-NR1) in the PFCx, whereas p-GluR1, p-Thr34- and p-Thr75-DARPP-32 levels were not changed in this brain region. CTA expression increased the number of p-ERK-positive neurons in the shell (AcbSh) and core (AcbC) but left unmodified p-NR1, p-GluR1, p-Thr34- and p-Thr75-DARPP-32 levels. Furthermore, post-embedding immunogold quantitative analysis in AcbSh revealed that CTA expression significantly increased nuclear p-ERK immunostaining as well as p-ERK-labeled axo-spinous contacts. Overall, these results indicate that ERK and NR1, but not GluR1 and DARPP-32, are differentially phosphorylated as a consequence of acquisition and expression of aversive associative learning. Moreover, these results confirm that CTA represents an useful approach to study the molecular basis of associative learning in rats and suggest the involvement of ERK cascade in learning-associated synaptic plasticity. PMID:24847227

  10. Impaired bidirectional NMDA receptor dependent synaptic plasticity in the dentate gyrus of adult female Fmr1 heterozygous knockout mice.

    PubMed

    Yau, S Y; Bostrom, C A; Chiu, J; Fontaine, C J; Sawchuk, S; Meconi, A; Wortman, R C; Truesdell, E; Truesdell, A; Chiu, C; Hryciw, B N; Eadie, B D; Ghilan, M; Christie, B R

    2016-12-01

    Fragile-X syndrome (FXS) is caused by the transcriptional repression of the Fmr1 gene resulting in loss of the Fragile-X mental retardation protein (FMRP). This leads to cognitive impairment in both male and female patients, however few studies have focused on the impact of FXS in females. Significant cognitive impairment has been reported in approximately 35% of women who exhibit a heterozygous Fmr1 gene mutation, however to date there is a paucity of information regarding the mechanistic underpinnings of these deficits. We, and others, have recently reported that there is significant impairment in N-methyl-d-aspartate receptor (NMDAR)-dependent long-term potentiation (LTP) and long-term depression (LTD) in the hippocampal dentate gyrus (DG) of male Fmr1 knock out mice. Here we examined if female mice displaying a heterozygous loss of the Fmr1 gene (Fmr1 +/- ) would exhibit similar impairments in DG-dependent spatial memory processing and NMDAR hypofunction. We found that Female Fmr1 +/- mice did not show impaired metabotropic glutamate receptor (mGluR)-LTD in the CA1 region, and could perform well on a temporal ordering task that is thought to involve this brain region. In contrast, female Fmr1 +/- mice showed impairments in a pattern separation task thought to involve the DG, and also displayed a significant impairment in both NMDAR-dependent LTD and LTP in this region. The LTP impairment could be rescued by administering the NMDAR co-agonist, glycine. Our data suggests that NMDAR hypofunction in the DG may partly contribute to learning and memory impairment in female Fmr1 +/- mice. Targeting NMDAR-dependent mechanisms may offer hope as a new therapeutic approach for treating female FXS patients with learning and memory impairments. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. 20 CFR 10.405 - Who is considered a dependent in a claim based on disability or impairment?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Who is considered a dependent in a claim based on disability or impairment? 10.405 Section 10.405 Employees' Benefits OFFICE OF WORKERS... Disability and Impairment § 10.405 Who is considered a dependent in a claim based on disability or impairment...

  12. Repeated Exposure to Ketamine-Xylazine during Early Development Impairs Motor Learning-dependent Dendritic Spine Plasticity in Adulthood

    PubMed Central

    Huang, Lianyan; Yang, Guang

    2014-01-01

    Background Recent studies in rodents suggest that repeated and prolonged anesthetic exposure at early stages of development leads to cognitive and behavioral impairments later in life. However, the underlying mechanism remains unknown. In this study, we tested whether exposure to general anesthesia during early development will disrupt the maturation of synaptic circuits and compromise learning-related synaptic plasticity later in life. Methods Mice received ketamine/xylazine (20/3 mg/kg) anesthesia for one or three times, starting at either early [postnatal day 14 (P14)] or late (P21) stages of development (n=105). Control mice received saline injections (n=34). At P30, mice were subjected to rotarod motor training and fear conditioning. Motor learning-induced synaptic remodeling was examined in vivo by repeatedly imaging fluorescently-labeled postsynaptic dendritic spines in the primary motor cortex before and after training using two-photon microscopy. Results Three exposures to ketamine/xylazine anesthesia between P14–18 impair the animals’ motor learning and learning-dependent dendritic spine plasticity [new spine formation, 8.4 ± 1.3% (mean ± SD) versus 13.4 ± 1.8%, P = 0.002] without affecting fear memory and cell apoptosis. One exposure at P14 or three exposures between P21–25 has no effects on the animals’ motor learning or spine plasticity. Finally, enriched motor experience ameliorates anesthesia-induced motor learning impairment and synaptic deficits. Conclusion Our study demonstrates that repeated exposures to ketamine/xylazine during early development impair motor learning and learning-dependent dendritic spine plasticity later in life. The reduction in synaptic structural plasticity may underlie anesthesia-induced behavioral impairment. PMID:25575163

  13. Performance in hippocampus- and PFC-dependent cognitive domains are not concomitantly impaired in rats exposed to 20cGy of 1GeV/n (56)Fe particles.

    PubMed

    Britten, Richard A; Miller, Vania D; Hadley, Melissa M; Jewell, Jessica S; Macadat, Evangeline

    2016-08-01

    NASA is currently conducting ground based experiments to determine whether the radiation environment that astronauts will encounter on deep space missions will have an impact on their long-term health and their ability to complete the various tasks during the mission. Emerging data suggest that exposure of rodents to mission-relevant HZE radiation doses does result in the impairment of various neurocognitive processes. An essential part of mission planning is a probabilistic risk assessment process that takes into account the likely incidence and severity of a problem. To date few studies have reported the impact of space radiation in a format that is amenable to PRA, and those that have only reported data for a single cognitive process. This study has established the ability of individual male Wistar rats to conduct a hippocampus-dependent (spatial memory) task and a cortex-dependent (attentional set shifting task) 90 days after exposure to 20cGy 1GeV/n (56)Fe particles. Radiation-induced impairment of performance in one cognitive domain was not consistently associated with impaired performance in the other domain. Thus sole reliance upon a single measure of cognitive performance may substantially under-estimate the risk of cognitive impairment, and ultimately it may be necessary to establish the likelihood that mission-relevant HZE doses will impair performance in the three or four cognitive domains that NASA considers to be most critical for mission success, and build a PRA using the composite data from such studies. Copyright © 2016 The Committee on Space Research (COSPAR). Published by Elsevier Ltd. All rights reserved.

  14. Inhibition of spontaneous recovery of fear by mGluR5 after prolonged extinction training.

    PubMed

    Mao, Sheng-Chun; Chang, Chih-Hua; Wu, Chia-Chen; Orejarena, M Juliana; Orejanera, Maria Juliana; Manzoni, Olivier J; Gean, Po-Wu

    2013-01-01

    Fear behavior is vital for survival and involves learning contingent associations of non-threatening cues with aversive stimuli. In contrast, excessive levels of fear can be maladaptive and lead to anxiety disorders. Generally, extensive sessions of extinction training correlates with reduced spontaneous recovery. The molecular mechanisms underlying the long-term inhibition of fear recovery following repeated extinction training are not fully understood. Here we show that in rats, prolonged extinction training causes greater reduction in both fear-potentiated startle and spontaneous recovery. This effect was specifically blocked by metabotropic glutamate receptor 5 (mGluR5), but not by mGluR1 antagonists and by a protein synthesis inhibitor. Similar inhibition of memory recovery following prolonged extinction training was also observed in mice. In agreement with the instrumental role of mGluR5 in the prolonged inhibition of fear recovery, we found that FMR1-/- mice which exhibit enhanced mGluR5-mediated signaling exhibit lower spontaneous recovery of fear after extinction training than wild-type littermates. At the molecular level, we discovered that prolonged extinction training reversed the fear conditioning-induced increase in surface expression of GluR1, AMPA/NMDA ratio, postsynaptic density-95 (PSD-95) and synapse-associated protein-97 (SAP97). Accordingly, delivery of Tat-GluR2(3Y), a synthetic peptide that blocks AMPA receptor endocytosis, inhibited prolonged extinction training-induced inhibition of fear recovery. Together, our results demonstrate that prolonged extinction training results in the mGluR5-dependent long-term inhibition of fear recovery. This effect may involve the degradation of original memory and may explain the beneficial effects of prolonged exposure therapy for the treatment of phobias.

  15. Acute cannabinoids impair working memory through astroglial CB1 receptor modulation of hippocampal LTD.

    PubMed

    Han, Jing; Kesner, Philip; Metna-Laurent, Mathilde; Duan, Tingting; Xu, Lin; Georges, Francois; Koehl, Muriel; Abrous, Djoher Nora; Mendizabal-Zubiaga, Juan; Grandes, Pedro; Liu, Qingsong; Bai, Guang; Wang, Wei; Xiong, Lize; Ren, Wei; Marsicano, Giovanni; Zhang, Xia

    2012-03-02

    Impairment of working memory is one of the most important deleterious effects of marijuana intoxication in humans, but its underlying mechanisms are presently unknown. Here, we demonstrate that the impairment of spatial working memory (SWM) and in vivo long-term depression (LTD) of synaptic strength at hippocampal CA3-CA1 synapses, induced by an acute exposure of exogenous cannabinoids, is fully abolished in conditional mutant mice lacking type-1 cannabinoid receptors (CB(1)R) in brain astroglial cells but is conserved in mice lacking CB(1)R in glutamatergic or GABAergic neurons. Blockade of neuronal glutamate N-methyl-D-aspartate receptors (NMDAR) and of synaptic trafficking of glutamate α-amino-3-hydroxy-5-methyl-isoxazole propionic acid receptors (AMPAR) also abolishes cannabinoid effects on SWM and LTD induction and expression. We conclude that the impairment of working memory by marijuana and cannabinoids is due to the activation of astroglial CB(1)R and is associated with astroglia-dependent hippocampal LTD in vivo. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Blocking GSK3β-mediated dynamin1 phosphorylation enhances BDNF-dependent TrkB endocytosis and the protective effects of BDNF in neuronal and mouse models of Alzheimer's disease.

    PubMed

    Liu, Xiang-Hua; Geng, Zhao; Yan, Jing; Li, Ting; Chen, Qun; Zhang, Qun-Ye; Chen, Zhe-Yu

    2015-02-01

    Endocytosis of tropomyosin related kinase B (TrkB) receptors has critical roles in brain-derived neurotrophic factor (BDNF) mediated signal transduction and biological function, however the mechanism that is governing TrkB endocytosis is still not completely understood. In this study, we showed that GSK3β, a key kinase in neuronal development and survival, could regulate TrkB endocytosis through phosphorylating dynamin1 (Dyn1) but not dynamin2 (Dyn2). Moreover, we found that beta-amyloid (Aβ) oligomer exposure could impair BDNF-dependent TrkB endocytosis and Akt activation through enhancing GSK3β activity in cultured hippocampal neurons, which suggested that BDNF-induced TrkB endocytosis and the subsequent signaling were impaired in neuronal model of Alzheimer's disease (AD). Notably, we found that inhibiting GSK3β phosphorylating Dyn1 by using TAT-Dyn1SpS could rescue the impaired TrkB endocytosis and Akt activation upon BDNF stimuli under Aβ exposure. Finally, TAT-Dyn1SpS could facilitate BDNF-mediated neuronal survival and cognitive enhancement in mouse models of AD. These results clarified a role of GSK3β in BDNF-dependent TrkB endocytosis and the subsequent signaling, and provided a potential new strategy by inhibiting GSK3β-induced Dyn1 phosphorylation for AD treatment. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Role of amino acids in salivation and the localization of their receptors in the rat salivary gland.

    PubMed

    Shida, T; Kondo, E; Ueda, Y; Takai, N; Yoshida, Y; Araki, T; Kiyama, H; Tohyama, M

    1995-11-01

    The distribution of gamma-aminobutyric acid (GABA) receptor subunits such as GABAAR-gamma 1 and GABAAR-gamma 2, and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) type receptor subunits such as GluR-1, GluR-2/3 and GluR-4, and N-methyl-D-aspartic acid (NMDA) type subunits such as NR1 were investigated by immunocytochemistry. Furthermore, the roles of these amino acids, GABA and glutamate, on salivation were analyzed in the rat submandibular and sublingual glands. Some similarities were observed in the distribution patterns of GABAA type receptors and AMPA receptors. In the submandibular ganglion cells, collecting ducts and striated ducts, these subunits were expressed strongly; however, there were some differences in their expression patterns between the submandibular and sublingual gland acinar cells. Since these receptor subunits were expressed in the acinar cell bodies of the submandibular gland, they were not expressed in the acinar cells but were expressed in the myoepithelial cells in the sublingual gland. On the other hand, no NR1 expression was observed. To examine the roles of GABA and glutamate in salivation, the submandibular and sublingual glands were perfused partially with Ringer's solution via a facial artery to avoid systemic influence, and substrates were infused into the perfusion solution. No salivary secretion was evoked by GABA or glutamate infusion in the absence of electrical stimulation (2-3 V, 5 ms, 20 Hz). Salivary flow evoked by electrical stimulation of the chorda-lingual nerve caused significant inhibition by GABA (10(-6), 10(-5), 10(-4) and 10(-3) M) and the GABAAR agonist muscimol 10(-3) and 10(-6) M) (n = 6, P < 0.05). Such GABA-induced inhibition was antagonized by the GABAAR antagonists bicuculline (BCC; 10(-6) and 10(-3) M) and picrotoxin (PTX; 10(-6) and 10(-3) M). On the other hand, salivary flow evoked by electrical stimulation (8-10 V, 5 ms, 20 Hz) of the superior cervical ganglion (SCG) was not affected by GABA. While high doses of glutamate (10(-1) M) and NMDA (10(-1) M) showed no effects on salivary flow despite application of electrical stimulation, AMPA at a high concentration (10(-1) M) significantly inhibited salivary secretion (n = 6, P < 0.05). These studies revealed that inhibitory and excitatory amino acid receptors such as GABAA and AMPA type receptors are coexpressed in the rat salivary glands, and that GABA inhibits salivary secretion via GABAA receptors which may act with acetylcholine. However, the role of glutamate in salivation remains unclear despite the presence of AMPA type receptors. The present findings suggest that glutamate does not act alone but with other substances such as peptides and/or other amino acids.

  18. 20 CFR 30.900 - Who can receive impairment benefits under Part E?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Who can receive impairment benefits under... Impairment Benefits Under Part E of EEOICPA General Provisions § 30.900 Who can receive impairment benefits under Part E? In order to receive impairment benefits under Part E, the employee must show that: (a) He...

  19. Early effects of 16O radiation on neuronal morphology and cognition in a murine model

    NASA Astrophysics Data System (ADS)

    Carr, Hannah; Alexander, Tyler C.; Groves, Thomas; Kiffer, Frederico; Wang, Jing; Price, Elvin; Boerma, Marjan; Allen, Antiño R.

    2018-05-01

    Astronauts exposed to high linear energy transfer radiation may experience cognitive injury. The pathogenesis of this injury is unknown but may involve glutamate receptors or modifications to dendritic structure and/or dendritic spine density and morphology. Glutamate is the major excitatory neurotransmitter in the central nervous system, where it acts on ionotropic and metabotropic glutamate receptors located at the presynaptic terminal and in the postsynaptic membrane at synapses in the hippocampus. Dendritic spines are sites of excitatory synaptic transmission, and changes in spine structure and dendrite morphology are thought to be morphological correlates of altered brain function associated with hippocampal-dependent learning and memory. The aim of the current study is to assess whether behavior, glutamate receptor gene expression, and dendritic structure in the hippocampus are altered in mice after early exposure to 16O radiation in mice. Two weeks post-irradiation, animals were tested for hippocampus-dependent cognitive performance in the Y-maze. During Y-maze testing, mice exposed to 0.1 Gy and 0.25 Gy radiation failed to distinguish the novel arm, spending approximately the same amount of time in all 3 arms during the retention trial. Exposure to 16O significantly reduced the expression of Nr1 and GluR1 in the hippocampus and modulated spine morphology in the dentate gyrus and cornu Ammon 1 within the hippocampus. The present data provide evidence that 16O radiation has early deleterious effects on mature neurons that are associated with hippocampal learning and memory.

  20. Morphology and kainate-receptor immunoreactivity of identified neurons within the entorhinal cortex projecting to superior temporal sulcus in the cynomolgus monkey

    NASA Technical Reports Server (NTRS)

    Good, P. F.; Morrison, J. H.; Bloom, F. E. (Principal Investigator)

    1995-01-01

    Projections of the entorhinal cortex to the hippocampus are well known from the classical studies of Cajal (Ramon y Cajal, 1904) and Lorente de No (1933). Projections from the entorhinal cortex to neocortical areas are less well understood. Such connectivity is likely to underlie the consolidation of long-term declarative memory in neocortical sites. In the present study, a projection arising in layer V of the entorhinal cortex and terminating in a polymodal association area of the superior temporal gyrus has been identified with the use of retrograde tracing. The dendritic arbors of neurons giving rise to this projection were further investigated by cell filling and confocal microscopy with computer reconstruction. This analysis demonstrated that the dendritic arbor of identified projection neurons was largely confined to layer V, with the exception of a solitary, simple apical dendrite occasionally ascending to superficial laminae but often confined to the lamina dissecans (layer IV). Finally, immunoreactivity for glutamate-receptor subunit proteins GluR 5/6/7 of the dendritic arbor of identified entorhinal projection neurons was examined. The solitary apical dendrite of identified entorhinal projection neurons was prominently immunolabeled for GluR 5/6/7, as was the dendritic arbor of basilar dendrites of these neurons. The restriction of the large bulk of the dendritic arbor of identified entorhinal projection neurons to layer V implies that these neurons are likely to be heavily influenced by hippocampal output arriving in the deep layers of the entorhinal cortex. Immunoreactivity for GluR 5/6/7 throughout the dendritic arbor of such neurons indicates that this class of glutamate receptor is in a position to play a prominent role in mediating excitatory neurotransmission within hippocampal-entorhinal circuits.

  1. Changes in expression of c-Fos protein following cocaine-cue extinction learning.

    PubMed

    Nic Dhonnchadha, B Á; Lovascio, B F; Shrestha, N; Lin, A; Leite-Morris, K A; Man, H Y; Kaplan, G B; Kantak, K M

    2012-09-01

    Extinguishing abnormally strengthened learned responses to cues associated with drugs of abuse remains a key tactic for alleviating addiction. To assist in developing pharmacotherapies to augment exposure therapy for relapse prevention, investigation into neurobiological underpinnings of drug-cue extinction learning is needed. We used regional analyses of c-Fos and GluR2 protein expression to delineate neural activity and plasticity that may be associated with cocaine-cue extinction learning. Rats were trained to self-administer cocaine paired with a light cue, and later underwent a single 2h extinction session for which cocaine was withheld but response-contingent cues were presented (cocaine-cue extinction). Control groups consisted of rats yoked to animals self-administering cocaine and receiving saline non-contingently followed by an extinction session, or rats trained to self-administer cocaine followed by a no-extinction session for which levers were retracted, and cocaine and cues were withheld. Among 11 brain sites examined, extinction training increased c-Fos expression in basolateral amygdala and prelimbic prefrontal cortex of cocaine-cue extinguished rats relative to both control conditions. In dorsal subiculum and infralimbic prefrontal cortex, extinction training increased c-Fos expression in both cocaine-cue and saline-cue extinguished rats relative to the no-extinction control condition. GluR2 protein expression was not altered in any site examined after extinction or control training. Findings suggest that basolateral amygdala and prelimbic prefrontal cortex neurons are activated during acquisition of cocaine-cue extinction learning, a process that is independent of changes in GluR2 abundance. Other sites are implicated in processing the significance of cues that are present early in extinction training. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Assessment of FUN-1 vital dye staining: Yeast with a block in the vacuolar sorting pathway have impaired ability to form CIVS when stained with FUN-1 fluorescent dye.

    PubMed

    Essary, Brandin D; Marshall, Pamela A

    2009-08-01

    FUN-1 [2-chloro-4-(2,3-dihydro-3-methyl-(benzo-1,3-thiazol-2-yl)-methylidene)-1-phenylquinolinium iodide] is a fluorescent dye used in studies of yeast and other fungi to monitor cell viability in the research lab and to assay for active fungal infection in the clinical setting. When the plasma membrane is intact, fungal cells internalize FUN-1 and the dye is seen as diffuse green cytosolic fluorescence. FUN-1 is then transported to the vacuole in metabolically active wild type cells and subsequently is compacted into fluorescent red cylindrical intravacuolar structures (CIVS) by an unknown transport pathway. This dye is used to determine yeast viability, as only live cells form CIVS. However, in live Saccharomyces cerevisiae with impaired protein sorting to the yeast vacuole, we report decreased to no CIVS formation, depending on the cellular location of the block in the sorting pathway. Cells with a block in vesicle-mediated transport from the Golgi to prevacuolar compartment (PVC) or with a block in recycling from the PVC to the Golgi demonstrate a substantial impairment in CIVS formation. Instead, the FUN-1 dye is seen either in small punctate structures under fluorescence or as diffuse red cytosol under white light. Thus, researchers using FUN-1 should be cognizant of the limitations of this procedure in determining cell viability as there are viable yeast mutants with impaired CIVS formation.

  3. Early in vivo changes in calcium ions, oxidative stress markers, and ion channel immunoreactivity following partial injury to the optic nerve.

    PubMed

    Wells, Jonathan; Kilburn, Matthew R; Shaw, Jeremy A; Bartlett, Carole A; Harvey, Alan R; Dunlop, Sarah A; Fitzgerald, Melinda

    2012-03-01

    CNS injury is often localized but can be followed by more widespread secondary degenerative events that usually result in greater functional loss. Using a partial transection model in rat optic nerve (ON). we recently demonstrated in vivo increases in the oxidative stress-associated enzyme MnSOD 5 min after injury. However, mechanisms by which early oxidative stress spreads remain unclear. In the present study, we assessed ion distributions, additional oxidative stress indicators, and ion channel immunoreactivity in ON in the first 24 hr after partial transection. Using nanoscale secondary ion mass spectroscopy (NanoSIMS), we demonstrate changes in the distribution pattern of Ca ions following partial ON transection. Regions of elevated Ca ions in normal ON in vivo rapidly decrease following partial ON transection, but there is an increasingly punctate distribution at 5 min and 24 hr after injury. We also show rapid decreases in catalase activity and later increases in immunoreactivity of the advanced glycation end product carboxymethyl lysine in astrocytes. Increased oxidative stress in astrocytes is accompanied by significantly increased immunoreactivity of the AMPA receptor subunit GluR1 and aquaporin 4 (AQP4). Taken together, the results indicate that Ca ion changes and oxidative stress are early events following partial ON injury that are associated with changes in GluR1 AMPA receptor subunits and altered ionic balance resulting from increased AQP4. Copyright © 2011 Wiley Periodicals, Inc.

  4. Tramadol state-dependent memory: involvement of dorsal hippocampal muscarinic acetylcholine receptors.

    PubMed

    Jafari-Sabet, Majid; Jafari-Sabet, Ali-Reza; Dizaji-Ghadim, Ali

    2016-08-01

    The effects on tramadol state-dependent memory of bilateral intradorsal hippocampal (intra-CA1) injections of physostigmine, an acetylcholinesterase inhibitor, and atropine, a muscarinic acetylcholine receptor antagonist, were examined in adult male NMRI mice. A single-trial step-down passive avoidance task was used for the assessment of memory retention. Post-training intra-CA1 administration of an atypical μ-opioid receptor agonist, tramadol (0.5 and 1 μg/mouse), dose dependently impaired memory retention. Pretest injection of tramadol (0.5 and 1 μg/mouse, intra-CA1) induced state-dependent retrieval of the memory acquired under the influence of post-training tramadol (1 μg/mouse, intra-CA1). A pretest intra-CA1 injection of physostigmine (1 μg/mouse) reversed the memory impairment induced by post-training administration of tramadol (1 μg/mouse, intra-CA1). Moreover, pretest administration of physostigmine (0.5 and 1 μg/mouse, intra-CA1) with an ineffective dose of tramadol (0.25 μg/mouse, intra-CA1) also significantly restored retrieval. Pretest administration of physostigmine (0.25, 0.5, and 1 μg/mouse, intra-CA1) by itself did not affect memory retention. A pretest intra-CA1 injection of the atropine (1 and 2 μg/mouse) 5 min before the administration of tramadol (1 μg/mouse, intra-CA1) dose dependently inhibited tramadol state-dependent memory. Pretest administration of atropine (0.5, 1, and 2 μg/mouse, intra-CA1) by itself did not affect memory retention. It can be concluded that dorsal hippocampal muscarinic acetylcholine receptor mechanisms play an important role in the modulation of tramadol state-dependent memory.

  5. Deletion of the GluA1 AMPA receptor subunit impairs recency-dependent object recognition memory

    PubMed Central

    Sanderson, David J.; Hindley, Emma; Smeaton, Emily; Denny, Nick; Taylor, Amy; Barkus, Chris; Sprengel, Rolf; Seeburg, Peter H.; Bannerman, David M.

    2011-01-01

    Deletion of the GluA1 AMPA receptor subunit impairs short-term spatial recognition memory. It has been suggested that short-term recognition depends upon memory caused by the recent presentation of a stimulus that is independent of contextual–retrieval processes. The aim of the present set of experiments was to test whether the role of GluA1 extends to nonspatial recognition memory. Wild-type and GluA1 knockout mice were tested on the standard object recognition task and a context-independent recognition task that required recency-dependent memory. In a first set of experiments it was found that GluA1 deletion failed to impair performance on either of the object recognition or recency-dependent tasks. However, GluA1 knockout mice displayed increased levels of exploration of the objects in both the sample and test phases compared to controls. In contrast, when the time that GluA1 knockout mice spent exploring the objects was yoked to control mice during the sample phase, it was found that GluA1 deletion now impaired performance on both the object recognition and the recency-dependent tasks. GluA1 deletion failed to impair performance on a context-dependent recognition task regardless of whether object exposure in knockout mice was yoked to controls or not. These results demonstrate that GluA1 is necessary for nonspatial as well as spatial recognition memory and plays an important role in recency-dependent memory processes. PMID:21378100

  6. Glutamate receptors as seen by light: Spectroscopic studies of structure-function relationships

    PubMed Central

    Mankiewicz, Kimberly A.; Jayaraman, Vasanthi

    2010-01-01

    Ionotropic glutamate receptors are major excitatory receptors in the central nervous system and also have far reaching influence in other areas of the body. Their modular nature has allowed for the isolation of the ligand binding domain and subsequent structural studies using a variety of spectroscopic techniques. This review will discuss the role of specific ligand:protein interactions in mediating activation in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) subtype of glutamate receptors as established by various spectroscopic investigations of the GluR2 and GluR4 subunits of this receptor. Specifically, this review will provide an introduction of the insight gained from X-ray crystallography and nuclear magnetic resonance (NMR) investigations and then go on to focus on studies utilizing vibrational spectroscopy and fluorescence resonance energy transfer (FRET) to study the behavior of the isolated ligand binding domain in solution and discuss the importance of specific ligand:protein interactions in the mechanism of receptor activation. PMID:17934637

  7. Combination of chronic stress and ovariectomy causes conditioned fear memory deficits and hippocampal cholinergic neuronal loss in mice.

    PubMed

    Takuma, K; Mizoguchi, H; Funatsu, Y; Hoshina, Y; Himeno, Y; Fukuzaki, E; Kitahara, Y; Arai, S; Ibi, D; Kamei, H; Matsuda, T; Koike, K; Inoue, M; Nagai, T; Yamada, K

    2012-04-05

    We have recently found that the combination of ovariectomy (OVX) and chronic restraint stress (CS) causes hippocampal pyramidal cell loss and cognitive dysfunction in female rats and that estrogen replacement prevents the OVX/CS-induced morphological and behavioral changes. In this study, to clarify the mechanisms underlying the OVX/CS-mediated memory impairment further, we examined the roles of cholinergic systems in the OVX/CS-induced memory impairment in mice. Female Slc:ICR strain mice were randomly divided into two groups: OVX and sham-operated groups. Two weeks after the operation, the mice of each group were further assigned to CS (6 h/day) or non-stress group. Following the 3-week-stress period, all mice were subjected to contextual fear conditioning, and context- and tone-dependent memory tests were conducted 1 or 24 h after the conditioning. Overburden with 3 weeks of CS from 2 weeks after OVX impaired context- and tone-dependent freezing and the OVX/CS caused significant Nissl-stained neuron-like cell loss in the hippocampal CA3 region, although OVX and CS alone did not cause such behavioral and histological changes. Replacement of 17β-estradiol for 5 weeks after OVX suppressed OVX/CS-induced memory impairment and hippocampal Nissl-positive cell loss. Furthermore, the OVX/CS mice exhibited a significant decrease in choline acetyltransferase in the hippocampus compared with other groups. The cholinesterase inhibitors donepezil and galantamine ameliorated OVX/CS-induced memory impairment. These data suggest that cholinergic dysfunction may be involved in the OVX/CS-induced conditioned fear memory impairment. Overall, our findings suggest that the OVX/CS mouse model is useful to study the mechanisms underlying estrogen loss-induced memory deficits. Copyright © 2012 IBRO. Published by Elsevier Ltd. All rights reserved.

  8. Extinction of avoidance behavior by safety learning depends on endocannabinoid signaling in the hippocampus.

    PubMed

    Micale, Vincenzo; Stepan, Jens; Jurik, Angela; Pamplona, Fabricio A; Marsch, Rudolph; Drago, Filippo; Eder, Matthias; Wotjak, Carsten T

    2017-07-01

    The development of exaggerated avoidance behavior is largely responsible for the decreased quality of life in patients suffering from anxiety disorders. Studies using animal models have contributed to the understanding of the neural mechanisms underlying the acquisition of avoidance responses. However, much less is known about its extinction. Here we provide evidence in mice that learning about the safety of an environment (i.e., safety learning) rather than repeated execution of the avoided response in absence of negative consequences (i.e., response extinction) allowed the animals to overcome their avoidance behavior in a step-down avoidance task. This process was context-dependent and could be blocked by pharmacological (3 mg/kg, s.c.; SR141716) or genetic (lack of cannabinoid CB1 receptors in neurons expressing dopamine D1 receptors) inactivation of CB1 receptors. In turn, the endocannabinoid reuptake inhibitor AM404 (3 mg/kg, i.p.) facilitated safety learning in a CB1-dependent manner and attenuated the relapse of avoidance behavior 28 days after conditioning. Safety learning crucially depended on endocannabinoid signaling at level of the hippocampus, since intrahippocampal SR141716 treatment impaired, whereas AM404 facilitated safety learning. Other than AM404, treatment with diazepam (1 mg/kg, i.p.) impaired safety learning. Drug effects on behavior were directly mirrored by drug effects on evoked activity propagation through the hippocampal trisynaptic circuit in brain slices: As revealed by voltage-sensitive dye imaging, diazepam impaired whereas AM404 facilitated activity propagation to CA1 in a CB1-dependent manner. In line with this, systemic AM404 enhanced safety learning-induced expression of Egr1 at level of CA1. Together, our data render it likely that AM404 promotes safety learning by enhancing information flow through the trisynaptic circuit to CA1. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Functional impairment and hospital readmission in Medicare seniors.

    PubMed

    Greysen, S Ryan; Stijacic Cenzer, Irena; Auerbach, Andrew D; Covinsky, Kenneth E

    2015-04-01

    Medicare currently penalizes hospitals for high readmission rates for seniors but does not account for common age-related syndromes, such as functional impairment. To assess the effects of functional impairment on Medicare hospital readmissions given the high prevalence of functional impairments in community-dwelling seniors. We created a nationally representative cohort of 7854 community-dwelling seniors in the Health and Retirement Study, with 22,289 Medicare hospitalizations from January 1, 2000, through December 31, 2010. Outcome was 30-day readmission assessed by Medicare claims. The main predictor was functional impairment determined from the Health and Retirement Study interview preceding hospitalization, stratified into the following 5 levels: no functional impairments, difficulty with 1 or more instrumental activities of daily living, difficulty with 1 or more activities of daily living (ADL), dependency (need for help) in 1 to 2 ADLs, and dependency in 3 or more ADLs. Adjustment variables included age, race/ethnicity, sex, annual income, net worth, comorbid conditions (Elixhauser score from Medicare claims), and prior admission. We performed multivariable logistic regression to adjust for clustering at the patient level to characterize the association of functional impairments and readmission. Patients had a mean (SD) age of 78.5 (7.7) years (range, 65-105 years); 58.4% were female, 84.9% were white, 89.6% reported 3 or more comorbidities, and 86.0% had 1 or more hospitalizations in the previous year. Overall, 48.3% had some level of functional impairment before admission, and 15.5% of hospitalizations were followed by readmission within 30 days. We found a progressive increase in the adjusted risk of readmission as the degree of functional impairment increased: 13.5% with no functional impairment, 14.3% with difficulty with 1 or more instrumental activities of daily living (odds ratio [OR], 1.06; 95% CI, 0.94-1.20), 14.4% with difficulty with 1 or more ADL (OR, 1.08; 95% CI, 0.96-1.21), 16.5% with dependency in 1 to 2 ADLs (OR, 1.26; 95% CI, 1.11-1.44), and 18.2% with dependency in 3 or more ADLs (OR, 1.42; 95% CI, 1.20-1.69). Subanalysis restricted to patients admitted with conditions targeted by Medicare (ie, heart failure, myocardial infarction, and pneumonia) revealed a parallel trend with larger effects for the most impaired (16.9% readmission rate for no impairment vs 25.7% for dependency in 3 or more ADLs [OR, 1.70; 95% CI, 1.04-2.78]). Functional impairment is associated with increased risk of 30-day all-cause hospital readmission in Medicare seniors, especially those admitted for heart failure, myocardial infarction, or pneumonia. Functional impairment may be an important but underaddressed factor in preventing readmissions for Medicare seniors.

  10. The effect on endothelial function of vitamin C during methionine induced hyperhomocysteinaemia.

    PubMed

    Hanratty, C G; McGrath, L T; McAuley, D F; Young, I S; Johnston, D G

    2001-01-01

    Manipulation of total homocysteine concentration with oral methionine is associated with impairment of endothelial-dependent vasodilation. This may be caused by increased oxidative stress. Vitamin C is an aqueous phase antioxidant vitamin and free radical scavenger. We hypothesised that if the impairment of endothelial function related to experimental hyperhomocysteinaemia was free radically mediated then co-administration of vitamin C should prevent this. Ten healthy adults took part in this crossover study. Endothelial function was determined by measuring forearm blood flow (FBF) in response to intra-arterial infusion of acetylcholine (endothelial-dependent) and sodium nitroprusside (endothelial-independent). Subjects received methionine (100 mg/Kg) plus placebo tablets, methionine plus vitamin C (2 g orally) or placebo drink plus placebo tablets. Study drugs were administered at 9 am on each study date, a minimum of two weeks passed between each study. Homocysteine (tHcy) concentration was determined at baseline and after 4 hours. Endothelial function was determined at 4 hours. Responses to the vasoactive substances are expressed as the area under the curve of change in FBF from baseline. Data are mean plus 95% Confidence Intervals. Following oral methionine tHcy concentration increased significantly versus placebo. At this time endothelial-dependent responses were significantly reduced compared to placebo (31.2 units [22.1-40.3] vs. 46.4 units [42.0-50.8], p < 0.05 vs. Placebo). Endothelial-independent responses were unchanged. Co-administration of vitamin C did not alter the increase in homocysteine or prevent the impairment of endothelial-dependent responses (31.4 [19.5-43.3] vs. 46.4 units [42.0-50.8], p < 0.05 vs. Placebo) This study demonstrates that methionine increased tHcy with impairment of the endothelial-dependent vasomotor responses. Administration of vitamin C did not prevent this impairment and our results do not support the hypothesis that the endothelial impairment is mediated by adverse oxidative stress.

  11. The Blue Light-Dependent Polyubiquitination and Degradation of Arabidopsis Cryptochrome2 Requires Multiple E3 Ubiquitin Ligases.

    PubMed

    Liu, Qing; Wang, Qin; Liu, Bin; Wang, Wei; Wang, Xu; Park, Joon; Yang, Zhenming; Du, Xinglin; Bian, Mingdi; Lin, Chentao

    2016-10-01

    Cryptochromes are blue light receptors regulated by light-dependent ubiquitination and degradation in both plant and animal lineages. The Arabidopsis genome encodes two cryptochromes, CRY1 and CRY2, of which CRY2 undergoes blue light-dependent ubiquitination and 26S proteasome-dependent degradation. The molecular mechanism regulating blue light-dependent proteolysis of CRY2 is still not fully understood. We found that the F-box proteins ZEITLUPE (ZTL) and Lov Kelch Protein2 (LKP2), which mediate blue light suppression of degradation of the CRY2 signaling partner CIB1, are not required for the blue light-dependent CRY2 degradation. We further showed that the previously reported function of the COP1-SPA1 protein complex in blue light-dependent CRY2 degradation is more likely to be attributable to its cullin 4 (CUL4)-based E3 ubiquitin ligase activity than its activity as the cryptochrome signaling partner. However, the blue light-dependent CRY2 degradation is only partially impaired in the cul4 mutant, the cop1-5 null mutant and the spa1234 quadruple mutant, suggesting a possible involvement of additional E3 ubiquitin ligases in the regulation of CRY2. Consistent with this hypothesis, we demonstrated that the blue light-dependent CRY2 degradation is significantly impaired in the temperature-sensitive cul1 mutant allele (axr6-3), especially under the non-permissive temperature. Based on these and other results presented, we propose that photoexcited CRY2 undergoes Lys48-linked polyubiquitination catalyzed by the CUL4- and CUL1-based E3 ubiquitin ligases. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  12. Intrahippocampal glutamine administration inhibits mTORC1 signaling and impairs long-term memory

    PubMed Central

    Rozas, Natalia S.; Redell, John B.; Pita-Almenar, Juan D.; Mckenna, James; Moore, Anthony N.; Gambello, Michael J.

    2015-01-01

    The mechanistic Target of Rapamycin Complex 1 (mTORC1), a key regulator of protein synthesis and cellular growth, is also required for long-term memory formation. Stimulation of mTORC1 signaling is known to be dependent on the availability of energy and growth factors, as well as the presence of amino acids. In vitro studies using serum- and amino acid-starved cells have reported that glutamine addition can either stimulate or repress mTORC1 activity, depending on the particular experimental system that was used. However, these experiments do not directly address the effect of glutamine on mTORC1 activity under physiological conditions in nondeprived cells in vivo. We present experimental results indicating that intrahippocampal administration of glutamine to rats reduces mTORC1 activity. Moreover, post-training administration of glutamine impairs long-term spatial memory formation, while coadministration of glutamine with leucine had no influence on memory. Intracellular recordings in hippocampal slices showed that glutamine did not alter either excitatory or inhibitory synaptic activity, suggesting that the observed memory impairments may not result from conversion of glutamine to either glutamate or GABA. Taken together, these findings indicate that glutamine can decrease mTORC1 activity in the brain and may have implications for treatments of neurological diseases associated with high mTORC1 signaling. PMID:25878136

  13. Soman Induces Ictogenesis in the Amygdala and Interictal Activity in the Hippocampus That Are Blocked by a GluR5 Kainate Receptor Antagonist In Vitro

    DTIC Science & Technology

    2009-01-01

    to organophosphorus nerve agents in- uces brain seizures, which can cause profound brain dam- ge resulting in death or long-term cognitive deficits...The mygdala and the hippocampus are two of the most seizure- rone brain structures, but their relative contribution to the eneration of seizures after...nerve agent exposure is unclear. ere, we report that application of 1 M soman for 30 min, in at coronal brain slices containing both the hippocampus

  14. CORM-A1 prevents blood-brain barrier dysfunction caused by ionotropic glutamate receptor-mediated endothelial oxidative stress and apoptosis.

    PubMed

    Basuroy, Shyamali; Leffler, Charles W; Parfenova, Helena

    2013-06-01

    In cerebral microvascular endothelial cells (CMVEC) of newborn pigs, glutamate at excitotoxic concentrations (mM) causes apoptosis mediated by reactive oxygen species (ROS). Carbon monoxide (CO) produced by CMVEC or delivered by a CO-releasing molecule, CORM-A1, has antioxidant properties. We tested the hypothesis that CORM-A1 prevents cerebrovascular endothelial barrier dysfunction caused by glutamate excitotoxicity. First, we identified the glutamate receptors (GluRs) and enzymatic sources of ROS involved in the mechanism of endothelial apoptosis. In glutamate-exposed CMVEC, ROS formation and apoptosis were blocked by rotenone, 2-thenoyltrifluoroacetone (TTFA), and antimycin, indicating that mitochondrial complexes I, II, and III are the major sources of oxidative stress. Agonists of ionotropic GluRs (iGluRs) N-methyl-D-aspartate (NMDA), cis-ACPD, AMPA, and kainate increased ROS production and apoptosis, whereas iGluR antagonists exhibited antiapoptotic properties, suggesting that iGluRs mediate glutamate-induced endothelial apoptosis. The functional consequences of endothelial injury were tested in the model of blood-brain barrier (BBB) composed of CMVEC monolayer on semipermeable membranes. Glutamate and iGluR agonists reduced transendothelial electrical resistance and increased endothelial paracellular permeability to 3-kDa dextran. CORM-A1 exhibited potent antioxidant and antiapoptotic properties in CMVEC and completely prevented BBB dysfunction caused by glutamate and iGluR agonists. Overall, the endothelial component of the BBB is a cellular target for excitotoxic glutamate that, via a mechanism involving a iGluR-mediated activation of mitochondrial ROS production and apoptosis, leads to BBB opening that may be prevented by the antioxidant and antiapoptotic actions of CORMs. Antioxidant CORMs therapy may help preserve BBB functional integrity in neonatal cerebrovascular disease.

  15. Rescuing effects of RXR agonist bexarotene on aging-related synapse loss depend on neuronal LRP1.

    PubMed

    Tachibana, Masaya; Shinohara, Mitsuru; Yamazaki, Yu; Liu, Chia-Chen; Rogers, Justin; Bu, Guojun; Kanekiyo, Takahisa

    2016-03-01

    Apolipoprotein E (apoE) plays a critical role in maintaining synaptic integrity by transporting cholesterol to neurons through the low-density lipoprotein receptor related protein-1 (LRP1). Bexarotene, a retinoid X receptor (RXR) agonist, has been reported to have potential beneficial effects on cognition by increasing brain apoE levels and lipidation. To investigate the effects of bexarotene on aging-related synapse loss and the contribution of neuronal LRP1 to the pathway, forebrain neuron-specific LRP1 knockout (nLrp1(-/-)) and littermate control mice were administered with bexarotene-formulated diet (100mg/kg/day) or control diet at the age of 20-24 months for 8 weeks. Upon bexarotene treatment, levels of brain apoE and ATP-binding cassette sub-family A member 1 (ABCA1) were significantly increased in both mice. While levels of PSD95, glutamate receptor 1 (GluR1), and N-methyl-d-aspartate receptor NR1 subunit (NR1), which are key postsynaptic proteins that regulate synaptic plasticity, were decreased with aging, they were restored by bexarotene treatment in the brains of control but not nLrp1(-/-) mice. These results indicate that the beneficial effects of bexarotene on synaptic integrity depend on the presence of neuronal LRP1. However, we also found that bexarotene treatment led to the activation of glial cells, weight loss and hepatomegaly, which are likely due to hepatic failure. Taken together, our results demonstrate that apoE-targeted treatment through the RXR pathway has a potential beneficial effect on synapses during aging; however, the therapeutic application of bexarotene requires extreme caution due to its toxic side effects. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Blunted Myocardial Oxygenation Response During Vasodilator Stress in Patients With Hypertrophic Cardiomyopathy

    PubMed Central

    Karamitsos, Theodoros D.; Dass, Sairia; Suttie, Joseph; Sever, Emily; Birks, Jacqueline; Holloway, Cameron J.; Robson, Matthew D.; Jerosch-Herold, Michael; Watkins, Hugh; Neubauer, Stefan

    2013-01-01

    Objectives This study sought to assess myocardial perfusion and tissue oxygenation during vasodilator stress in patients with overt hypertrophic cardiomyopathy (HCM), as well as in HCM mutation carriers without left ventricular (LV) hypertrophy, and to compare findings to those in athletes with comparable hypertrophy and normal controls. Background Myocardial perfusion under vasodilator stress is impaired in patients with HCM. Whether this is associated with impaired myocardial oxygenation and tissue ischemia is unknown. Furthermore, it is not known whether perfusion and oxygenation are impaired in HCM mutation carriers without left ventricular hypertrophy (LVH). Methods A total of 27 patients with overt HCM, 10 HCM mutation carriers without LVH, 11 athletes, and 20 healthy controls underwent cardiovascular magnetic resonance (CMR) scanning at 3-T. Myocardial function, perfusion (perfusion reserve index [MPRI]), and oxygenation (blood-oxygen level dependent signal intensity [SI] change) under adenosine stress were assessed. Results MPRI was significantly reduced in HCM (1.3 ± 0.1) compared to controls (1.8 ± 0.1, p < 0.001) and athletes (2.0 ± 0.1, p < 0.001), but remained normal in HCM mutation carriers without LVH (1.7 ± 0.1; p = 0.61 vs. controls, p = 0.02 vs. overt HCM). Oxygenation response was attenuated in overt HCM (SI change 6.9 ± 1.4%) compared to controls (18.9 ± 1.4%, p < 0.0001) and athletes (18.7 ± 2.0%, p < 0.001). Interestingly, HCM mutation carriers without LVH also showed an impaired oxygenation response to adenosine (10.4 ± 2.0%; p = 0.001 vs. controls, p = 0.16 vs. overt HCM, p = 0.003 vs. athletes). Conclusions In overt HCM, both perfusion and oxygenation are impaired during vasodilator stress. However, in HCM mutation carriers without LVH, only oxygenation is impaired. In athletes, stress perfusion and oxygenation are normal. CMR assessment of myocardial oxygenation has the potential to become a novel risk factor in HCM. PMID:23498131

  17. Glutamate receptors in the nucleus tractus solitarius contribute to ventilatory acclimatization to hypoxia in rat

    PubMed Central

    Pamenter, Matthew E; Carr, J Austin; Go, Ariel; Fu, Zhenxing; Reid, Stephen G; Powell, Frank L

    2014-01-01

    When exposed to a hypoxic environment the body's first response is a reflex increase in ventilation, termed the hypoxic ventilatory response (HVR). With chronic sustained hypoxia (CSH), such as during acclimatization to high altitude, an additional time-dependent increase in ventilation occurs, which increases the HVR. This secondary increase persists after exposure to CSH and involves plasticity within the circuits in the central nervous system that control breathing. Currently these mechanisms of HVR plasticity are unknown and we hypothesized that they involve glutamatergic synapses in the nucleus tractus solitarius (NTS), where afferent endings from arterial chemoreceptors terminate. To test this, we treated rats held in normoxia (CON) or 10% O2 (CSH) for 7 days and measured ventilation in conscious, unrestrained animals before and after microinjecting glutamate receptor agonists and antagonists into the NTS. In normoxia, AMPA increased ventilation 25% and 50% in CON and CSH, respectively, while NMDA doubled ventilation in both groups (P < 0.05). Specific AMPA and NMDA receptor antagonists (NBQX and MK801, respectively) abolished these effects. MK801 significantly decreased the HVR in CON rats, and completely blocked the acute HVR in CSH rats but had no effect on ventilation in normoxia. NBQX decreased ventilation whenever it was increased relative to normoxic controls; i.e. acute hypoxia in CON and CSH, and normoxia in CSH. These results support our hypothesis that glutamate receptors in the NTS contribute to plasticity in the HVR with CSH. The mechanism underlying this synaptic plasticity is probably glutamate receptor modification, as in CSH rats the expression of phosphorylated NR1 and GluR1 proteins in the NTS increased 35% and 70%, respectively, relative to that in CON rats. PMID:24492841

  18. Glutamate receptors in the nucleus tractus solitarius contribute to ventilatory acclimatization to hypoxia in rat.

    PubMed

    Pamenter, Matthew E; Carr, J Austin; Go, Ariel; Fu, Zhenxing; Reid, Stephen G; Powell, Frank L

    2014-04-15

    When exposed to a hypoxic environment the body's first response is a reflex increase in ventilation, termed the hypoxic ventilatory response (HVR). With chronic sustained hypoxia (CSH), such as during acclimatization to high altitude, an additional time-dependent increase in ventilation occurs, which increases the HVR. This secondary increase persists after exposure to CSH and involves plasticity within the circuits in the central nervous system that control breathing. Currently these mechanisms of HVR plasticity are unknown and we hypothesized that they involve glutamatergic synapses in the nucleus tractus solitarius (NTS), where afferent endings from arterial chemoreceptors terminate. To test this, we treated rats held in normoxia (CON) or 10% O2 (CSH) for 7 days and measured ventilation in conscious, unrestrained animals before and after microinjecting glutamate receptor agonists and antagonists into the NTS. In normoxia, AMPA increased ventilation 25% and 50% in CON and CSH, respectively, while NMDA doubled ventilation in both groups (P < 0.05). Specific AMPA and NMDA receptor antagonists (NBQX and MK801, respectively) abolished these effects. MK801 significantly decreased the HVR in CON rats, and completely blocked the acute HVR in CSH rats but had no effect on ventilation in normoxia. NBQX decreased ventilation whenever it was increased relative to normoxic controls; i.e. acute hypoxia in CON and CSH, and normoxia in CSH. These results support our hypothesis that glutamate receptors in the NTS contribute to plasticity in the HVR with CSH. The mechanism underlying this synaptic plasticity is probably glutamate receptor modification, as in CSH rats the expression of phosphorylated NR1 and GluR1 proteins in the NTS increased 35% and 70%, respectively, relative to that in CON rats.

  19. Activation of AMPA receptor in the infralimbic cortex facilitates extinction and attenuates the heroin-seeking behavior in rats.

    PubMed

    Chen, Weisheng; Wang, Yiqi; Sun, Anna; Zhou, Linyi; Xu, Wenjin; Zhu, Huaqiang; Zhuang, Dingding; Lai, Miaojun; Zhang, Fuqiang; Zhou, Wenhua; Liu, Huifen

    2016-01-26

    Infralimbic cortex (IL) is proposed to suppress cocaine seeking after extinction, but whether the IL regulates the extinction and reinstatement of heroin-seeking behavior is unknown. To address this issue, the male SD rats were trained to self-administer heroin under a FR1 schedule for consecutive 14 days, then the rats underwent 7 daily 2h extinction session in the operant chamber. The activation of IL by microinjection PEPA, an allosteric AMPA receptor potentiator into IL before each of extinction session facilitated the extinction responding after heroin self-administration, but did not alter the locomotor activity in an open field testing environment. Other rats were first trained under a FR1 schedule for heroin self-administration for 14 days, followed by 14 days of extinction training, and reinstatement of heroin-seeking induced by cues was measured for 2h. Intra-IL microinjecting of PEPA at 15min prior to test inhibited the reinstatement of heroin-seeking induced by cues. Moreover, the expression of GluR1 in the IL and NAc remarkably increased after treatment with PEPA during the reinstatement. These finding suggested that activation of glutamatergic projection from IL to NAc shell may be involved in the extinction and reinstatement of heroin-seeking. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. The Plasma Membrane H+-ATPase AHA1 Plays a Major Role in Stomatal Opening in Response to Blue Light1

    PubMed Central

    Yamauchi, Shota; Takemiya, Atsushi; Sakamoto, Tomoaki; Kurata, Tetsuya; Tsutsumi, Toshifumi

    2016-01-01

    Stomata open in response to a beam of weak blue light under strong red light illumination. A blue light signal is perceived by phototropins and transmitted to the plasma membrane H+-ATPase that drives stomatal opening. To identify the components in this pathway, we screened for mutants impaired in blue light-dependent stomatal opening. We analyzed one such mutant, provisionally named blus2 (blue light signaling2), and found that stomatal opening in leaves was impaired by 65%, although the magnitude of red light-induced opening was not affected. Blue light-dependent stomatal opening in the epidermis and H+ pumping in guard cell protoplasts were inhibited by 70% in blus2. Whole-genome resequencing identified a mutation in the AHA1 gene of the mutant at Gly-602. T-DNA insertion mutants of AHA1 exhibited a similar phenotype to blus2; this phenotype was complemented by the AHA1 gene. We renamed blus2 as aha1-10. T-DNA insertion mutants of AHA2 and AHA5 did not show any impairment in stomatal response, although the transcript levels of AHA2 and AHA5 were higher than those of AHA1 in wild-type guard cells. Stomata in ost2, a constitutively active AHA1 mutant, did not respond to blue light. A decreased amount of H+-ATPase in aha1-10 accounted for the reduced stomatal blue light responses and the decrease was likely caused by proteolysis of misfolded AHA1. From these results, we conclude that AHA1 plays a major role in blue light-dependent stomatal opening in Arabidopsis and that the mutation made the AHA1 protein unstable in guard cells. PMID:27261063

  1. Glucocorticoids interact with the hippocampal endocannabinoid system in impairing retrieval of contextual fear memory

    PubMed Central

    Atsak, Piray; Hauer, Daniela; Campolongo, Patrizia; Schelling, Gustav; McGaugh, James L.; Roozendaal, Benno

    2012-01-01

    There is extensive evidence that glucocorticoid hormones impair the retrieval of memory of emotionally arousing experiences. Although it is known that glucocorticoid effects on memory retrieval impairment depend on rapid interactions with arousal-induced noradrenergic activity, the exact mechanism underlying this presumably nongenomically mediated glucocorticoid action remains to be elucidated. Here, we show that the hippocampal endocannabinoid system, a rapidly activated retrograde messenger system, is involved in mediating glucocorticoid effects on retrieval of contextual fear memory. Systemic administration of corticosterone (0.3–3 mg/kg) to male Sprague–Dawley rats 1 h before retention testing impaired the retrieval of contextual fear memory without impairing the retrieval of auditory fear memory or directly affecting the expression of freezing behavior. Importantly, a blockade of hippocampal CB1 receptors with AM251 prevented the impairing effect of corticosterone on retrieval of contextual fear memory, whereas the same impairing dose of corticosterone increased hippocampal levels of the endocannabinoid 2-arachidonoylglycerol. We also found that antagonism of hippocampal β-adrenoceptor activity with local infusions of propranolol blocked the memory retrieval impairment induced by the CB receptor agonist WIN55,212–2. Thus, these findings strongly suggest that the endocannabinoid system plays an intermediary role in regulating rapid glucocorticoid effects on noradrenergic activity in impairing memory retrieval of emotionally arousing experiences. PMID:22331883

  2. The Plasma Membrane H+-ATPase AHA1 Plays a Major Role in Stomatal Opening in Response to Blue Light.

    PubMed

    Yamauchi, Shota; Takemiya, Atsushi; Sakamoto, Tomoaki; Kurata, Tetsuya; Tsutsumi, Toshifumi; Kinoshita, Toshinori; Shimazaki, Ken-Ichiro

    2016-08-01

    Stomata open in response to a beam of weak blue light under strong red light illumination. A blue light signal is perceived by phototropins and transmitted to the plasma membrane H(+)-ATPase that drives stomatal opening. To identify the components in this pathway, we screened for mutants impaired in blue light-dependent stomatal opening. We analyzed one such mutant, provisionally named blus2 (blue light signaling2), and found that stomatal opening in leaves was impaired by 65%, although the magnitude of red light-induced opening was not affected. Blue light-dependent stomatal opening in the epidermis and H(+) pumping in guard cell protoplasts were inhibited by 70% in blus2 Whole-genome resequencing identified a mutation in the AHA1 gene of the mutant at Gly-602. T-DNA insertion mutants of AHA1 exhibited a similar phenotype to blus2; this phenotype was complemented by the AHA1 gene. We renamed blus2 as aha1-10 T-DNA insertion mutants of AHA2 and AHA5 did not show any impairment in stomatal response, although the transcript levels of AHA2 and AHA5 were higher than those of AHA1 in wild-type guard cells. Stomata in ost2, a constitutively active AHA1 mutant, did not respond to blue light. A decreased amount of H(+)-ATPase in aha1-10 accounted for the reduced stomatal blue light responses and the decrease was likely caused by proteolysis of misfolded AHA1. From these results, we conclude that AHA1 plays a major role in blue light-dependent stomatal opening in Arabidopsis and that the mutation made the AHA1 protein unstable in guard cells. © 2016 American Society of Plant Biologists. All Rights Reserved.

  3. Liver-Specific Knockdown of IGF-1 Decreases Vascular Oxidative Stress Resistance by Impairing the Nrf2-Dependent Antioxidant Response: A Novel Model of Vascular Aging

    PubMed Central

    Bailey-Downs, Lora C.; Mitschelen, Matthew; Sosnowska, Danuta; Toth, Peter; Pinto, John T.; Ballabh, Praveen; Valcarcel-Ares, M.Noa; Farley, Julie; Koller, Akos; Henthorn, Jim C.; Bass, Caroline; Sonntag, William E.; Csiszar, Anna

    2012-01-01

    Recent studies demonstrate that age-related dysfunction of NF-E2–related factor-2 (Nrf2)–driven pathways impairs cellular redox homeostasis, exacerbating age-related cellular oxidative stress and increasing sensitivity of aged vessels to oxidative stress–induced cellular damage. Circulating levels of insulin-like growth factor (IGF)-1 decline during aging, which significantly increases the risk for cardiovascular diseases in humans. To test the hypothesis that adult-onset IGF-1 deficiency impairs Nrf2-driven pathways in the vasculature, we utilized a novel mouse model with a liver-specific adeno-associated viral knockdown of the Igf1 gene using Cre-lox technology (Igf1f/f + MUP-iCre-AAV8), which exhibits a significant decrease in circulating IGF-1 levels (∼50%). In the aortas of IGF-1–deficient mice, there was a trend for decreased expression of Nrf2 and the Nrf2 target genes GCLC, NQO1 and HMOX1. In cultured aorta segments of IGF-1–deficient mice treated with oxidative stressors (high glucose, oxidized low-density lipoprotein, and H2O2), induction of Nrf2-driven genes was significantly attenuated as compared with control vessels, which was associated with an exacerbation of endothelial dysfunction, increased oxidative stress, and apoptosis, mimicking the aging phenotype. In conclusion, endocrine IGF-1 deficiency is associated with dysregulation of Nrf2-dependent antioxidant responses in the vasculature, which likely promotes an adverse vascular phenotype under pathophysiological conditions associated with oxidative stress (eg, diabetes mellitus, hypertension) and results in accelerated vascular impairments in aging. PMID:22021391

  4. HACE1-dependent protein degradation provides cardiac protection in response to haemodynamic stress

    NASA Astrophysics Data System (ADS)

    Zhang, Liyong; Chen, Xin; Sharma, Parveen; Moon, Mark; Sheftel, Alex D.; Dawood, Fayez; Nghiem, Mai P.; Wu, Jun; Li, Ren-Ke; Gramolini, Anthony O.; Sorensen, Poul H.; Penninger, Josef M.; Brumell, John H.; Liu, Peter P.

    2014-03-01

    The HECT E3 ubiquitin ligase HACE1 is a tumour suppressor known to regulate Rac1 activity under stress conditions. HACE1 is increased in the serum of patients with heart failure. Here we show that HACE1 protects the heart under pressure stress by controlling protein degradation. Hace1 deficiency in mice results in accelerated heart failure and increased mortality under haemodynamic stress. Hearts from Hace1-/- mice display abnormal cardiac hypertrophy, left ventricular dysfunction, accumulation of LC3, p62 and ubiquitinated proteins enriched for cytoskeletal species, indicating impaired autophagy. Our data suggest that HACE1 mediates p62-dependent selective autophagic turnover of ubiquitinated proteins by its ankyrin repeat domain through protein-protein interaction, which is independent of its E3 ligase activity. This would classify HACE1 as a dual-function E3 ligase. Our finding that HACE1 has a protective function in the heart in response to haemodynamic stress suggests that HACE1 may be a potential diagnostic and therapeutic target for heart disease.

  5. Gain-of-function human STAT1 mutations impair IL-17 immunity and underlie chronic mucocutaneous candidiasis.

    PubMed

    Liu, Luyan; Okada, Satoshi; Kong, Xiao-Fei; Kreins, Alexandra Y; Cypowyj, Sophie; Abhyankar, Avinash; Toubiana, Julie; Itan, Yuval; Audry, Magali; Nitschke, Patrick; Masson, Cécile; Toth, Beata; Flatot, Jérome; Migaud, Mélanie; Chrabieh, Maya; Kochetkov, Tatiana; Bolze, Alexandre; Borghesi, Alessandro; Toulon, Antoine; Hiller, Julia; Eyerich, Stefanie; Eyerich, Kilian; Gulácsy, Vera; Chernyshova, Ludmyla; Chernyshov, Viktor; Bondarenko, Anastasia; Grimaldo, Rosa María Cortés; Blancas-Galicia, Lizbeth; Beas, Ileana Maria Madrigal; Roesler, Joachim; Magdorf, Klaus; Engelhard, Dan; Thumerelle, Caroline; Burgel, Pierre-Régis; Hoernes, Miriam; Drexel, Barbara; Seger, Reinhard; Kusuma, Theresia; Jansson, Annette F; Sawalle-Belohradsky, Julie; Belohradsky, Bernd; Jouanguy, Emmanuelle; Bustamante, Jacinta; Bué, Mélanie; Karin, Nathan; Wildbaum, Gizi; Bodemer, Christine; Lortholary, Olivier; Fischer, Alain; Blanche, Stéphane; Al-Muhsen, Saleh; Reichenbach, Janine; Kobayashi, Masao; Rosales, Francisco Espinosa; Lozano, Carlos Torres; Kilic, Sara Sebnem; Oleastro, Matias; Etzioni, Amos; Traidl-Hoffmann, Claudia; Renner, Ellen D; Abel, Laurent; Picard, Capucine; Maródi, László; Boisson-Dupuis, Stéphanie; Puel, Anne; Casanova, Jean-Laurent

    2011-08-01

    Chronic mucocutaneous candidiasis disease (CMCD) may be caused by autosomal dominant (AD) IL-17F deficiency or autosomal recessive (AR) IL-17RA deficiency. Here, using whole-exome sequencing, we identified heterozygous germline mutations in STAT1 in 47 patients from 20 kindreds with AD CMCD. Previously described heterozygous STAT1 mutant alleles are loss-of-function and cause AD predisposition to mycobacterial disease caused by impaired STAT1-dependent cellular responses to IFN-γ. Other loss-of-function STAT1 alleles cause AR predisposition to intracellular bacterial and viral diseases, caused by impaired STAT1-dependent responses to IFN-α/β, IFN-γ, IFN-λ, and IL-27. In contrast, the 12 AD CMCD-inducing STAT1 mutant alleles described here are gain-of-function and increase STAT1-dependent cellular responses to these cytokines, and to cytokines that predominantly activate STAT3, such as IL-6 and IL-21. All of these mutations affect the coiled-coil domain and impair the nuclear dephosphorylation of activated STAT1, accounting for their gain-of-function and dominance. Stronger cellular responses to the STAT1-dependent IL-17 inhibitors IFN-α/β, IFN-γ, and IL-27, and stronger STAT1 activation in response to the STAT3-dependent IL-17 inducers IL-6 and IL-21, hinder the development of T cells producing IL-17A, IL-17F, and IL-22. Gain-of-function STAT1 alleles therefore cause AD CMCD by impairing IL-17 immunity.

  6. D1 Receptor Activation in the Mushroom Bodies Rescues Sleep Loss Induced Learning Impairments in Drosophila

    PubMed Central

    Seugnet, Laurent; Suzuki, Yasuko; Vine, Lucy; Gottschalk, Laura; Shaw, Paul J

    2008-01-01

    Background Extended wakefulness disrupts acquisition of short term memories in mammals. However, the underlying molecular mechanisms triggered by extended waking and restored by sleep are unknown. Moreover, the neuronal circuits that depend on sleep for optimal learning remain unidentified. Results Learning was evaluated using Aversive Phototaxic Suppression (APS). In this task, flies learn to avoid light that is paired with an aversive stimulus (quinine /humidity). We demonstrate extensive homology in sleep deprivation induced learning impairment between flies and humans. Both 6 h and 12 h of sleep deprivation are sufficient to impair learning in Canton-S (Cs) flies. Moreover, learning is impaired at the end of the normal waking-day in direct correlation with time spent awake. Mechanistic studies indicate that this task requires intact mushroom bodies (MBs) and requires the Dopamine D1-like receptor (dDA1). Importantly, sleep deprivation induced learning impairments could be rescued by targeted gene expression of the dDA1 receptor to the MBs. Conclusion These data provide direct evidence that extended wakefulness disrupts learning in Drosophila. These results demonstrate that it is possible to prevent the effects of sleep deprivation by targeting a single neuronal structure and identify cellular and molecular targets adversely affected by extended waking in a genetically tractable model organism. PMID:18674913

  7. Activating transcription factor 4 underlies the pathogenesis of arsenic trioxide-mediated impairment of macrophage innate immune functions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srivastava, Ritesh K.; Li, Changzhao

    Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here, we show that activating transcription factor 4 (ATF4), a UPR transcription factor, regulates arsenic trioxide (ATO)-mediated dysregulation of macrophage functions. In ATO-treated ATF4{sup +/+} wild-type mice, a significant down-regulation of CD11b expression was associated with the reduced phagocytic functions of peritoneal and lung macrophages. This severe immuno-toxicity phenotype was not observed in ATO-treated ATF4{sup +/−} heterozygous mice. To confirm thesemore » observations, we demonstrated in Raw 264.7 cells that ATF4 knock-down rescues ATO-mediated impairment of macrophage functions including cytokine production, bacterial engulfment and clearance of engulfed bacteria. Sustained activation of ATF4 by ATO in macrophages induces apoptosis, while diminution of ATF4 expression protects against ATO-induced apoptotic cell death. Raw 264.7 cells treated with ATO also manifest dysregulated Ca{sup ++} homeostasis. ATO induces Ca{sup ++}-dependent calpain-1 and caspase-12 expression which together regulated macrophage apoptosis. Additionally, apoptosis was also induced by mitochondria-regulated pathway. Restoring ATO-impaired Ca{sup ++} homeostasis in ER/mitochondria by treatments with the inhibitors of inositol 1,4,5-trisphosphate receptor (IP3R) and voltage-dependent anion channel (VDAC) attenuate innate immune functions of macrophages. These studies identify a novel role for ATF4 in underlying pathogenesis of macrophage dysregulation and immuno-toxicity of arsenic. - Highlights: • ATF4 regulates arsenic-mediated impairment in macrophage functions. • Arsenic-mediated alterations in pulmonary macrophage are diminished in ATF4{sup +/−} mice. • Changes in macrophage functions can be attenuated by Ca{sup ++} homeostasis regulators.« less

  8. Nefiracetam facilitates hippocampal neurotransmission by a mechanism independent of the piracetam and aniracetam action.

    PubMed

    Nomura, T; Nishizaki, T

    2000-07-07

    Nefiracetam, a nootropic (cognition-enhancing) agent, facilitated neurotransmission in the dentate gyrus of rat hippocampal slices in a dose-dependent manner at concentrations ranged from 1 nM to 1 microM, being evident at 60-min washing-out of the drug. The facilitatory action was blocked by the nicotinic acetylcholine (ACh) receptor antagonists, alpha-bungarotoxin and mecamylamine. A similar facilitation was induced by the other nootropic agents, piracetam and aniracetam, but the facilitation was not inhibited by nicotinic ACh receptor antagonists and it did not occlude the potentiation induced by nefiracetam. In the Xenopus oocyte expression systems, nefiracetam potentiated currents through a variety of neuronal nicotinic ACh receptors (alpha 3beta 2, alpha 3beta 4, alpha 4 beta 2, alpha 4 beta 4, and alpha 7) to a different extent. In contrast, neither piracetam nor aniracetam had any potentiating action on alpha 7 receptor currents. While aniracetam delayed the decay time of currents through the alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, GluR1, -2, -3, expressed in oocytes, nefiracetam or piracetam had no effect on the currents. Nefiracetam, thus, appears to facilitate hippocampal neurotransmission by functionally targeting nicotinic ACh receptors, independently of the action of piracetam and aniracetam.

  9. Inhibition of COX-2 reduces the age-dependent increase of hippocampal inflammatory markers, corticosterone secretion, and behavioral impairments in the rat.

    PubMed

    Casolini, Paola; Catalani, Assia; Zuena, Anna R; Angelucci, Luciano

    2002-05-01

    Brain aging as well as brain degenerative processes with accompanying cognitive impairments are generally associated with hyperactivity of the hypothalamus-pituitary-adrenal axis, the end product of which, the glucocorticoid hormone, has been warranted the role of cell damage primum movens ("cascade hypothesis"). However, chronic inflammatory activity occurs in the hippocampus of aged rats as well as in the brain of Alzheimer's disease patients. The concomitant increase in the secretion of the glucocorticoid hormone, the endogenous anti-inflammatory and pro-inflammatory markers, has prompted us to investigate the two phenomena in the aging rat, and to work out its meaning. This study shows that: (I) interleukin-1beta (IL-1beta), tumor necrosis factor alpha (TNFalpha), and prostaglandin E(2) (PGE(2)) increase with age in the rats hippocampus, and (II) chronic oral treatment with celecoxib, a selective cycloxygenase-2 (COX-2) inhibitor, is able to contrast the age-dependent increase in hippocampal levels of pro-inflammatory markers and circulating anti-inflammatory corticosterone, provided that it is started at an early stage of aging. Under these conditions, age-related impairments in cognitive ability may be ameliorated. Taken together, these results indicate that there is a natural tendency to offset the age-dependent increase in brain inflammatory processes via the homeostatic increase of the circulating glucocorticoid hormone. Copyright 2002 Wiley-Liss, Inc.

  10. The severity of the visual impairment and practice matter for drawing ability in children.

    PubMed

    Vinter, Annie; Bonin, Patrick; Morgan, Pascal

    2018-07-01

    Astonishing drawing capacities have been reported in children with early visual impairments. However, most of the evidence relies on single case studies. Hitherto, no study has systematically jointly investigated, in these children, the role of (1) the severity of the visual handicap, (2) age and (3) practice in drawing. The study aimed at revealing the specificities of the drawing in children deprived from vision, as compared to children with less severe visual handicap and to sighted children performing under haptic or usual visual control. 148 children aged 6-14 years had to produce 12 drawings of familiar objects. 38 had a severe visual impairment, 41 suffered from low vision, and 69 were sighted children performing either under visual condition or blindfolded under haptic control. Recognizability and other characteristics of the drawings were highly dependent on the child's degree of vision and level of drawing practice, and progressed with chronological age more clearly in the sighted children or those with low vision than in those deprived of vision. The study confirmed that all groups showed significant drawing ability, even the group totally deprived of visual experience. Furthermore, the specificities of the drawings produced by visually-impaired children appeared clearly related to their practice and the severity of their visual impairment. This should incite parents and professionals to encourage these children to practice drawing as early as possible. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Stable liquid glucagon formulations for rescue treatment and bi-hormonal closed-loop pancreas

    PubMed Central

    Jackson, Melanie A.; Caputo, Nicholas; Castle, Jessica R.; David, Larry L.; Roberts, Charles T.; Ward, W. Kenneth

    2014-01-01

    Small doses of glucagon given subcutaneously in the research setting by an automated system prevent most cases of hypoglycemia in persons with diabetes. However, glucagon is very unstable and cannot be kept in a portable pump. Glucagon rapidly forms amyloid fibrils, even within the first day after reconstitution. Aggregation eventually leads to insoluble gels, which occlude pump catheters. Fibrillation occurs rapidly at acid pH, but is absent or minimal at alkaline pH values of ~10. Glucagon also degrades over time; this problem is greater at alkaline pH. Several studies suggest that its primary degradative pathway is deamidation, which results in a conversion of asparagine to aspartic acid. A cell-based assay for glucagon bioactivity that assesses glucagon receptor (GluR) activation can screen promising glucagon formulations. However, mammalian hepatocytes are usually problematic as they can lose GluR expression during culture. Assays for cyclic AMP (cAMP) or its downstream effector, protein kinase A (PKA), in engineered cell systems, are more reliable and suitable for inexpensive, high-throughput assessment of bioactivity. PMID:22972416

  12. Effect of Renal Impairment on the Pharmacokinetics and Pharmacodynamics of Verinurad, a Selective Uric Acid Reabsorption Inhibitor.

    PubMed

    Smith, William B; Hall, Jesse; Berg, Jolene K; Kazimir, Michal; Yamamoto, Amy; Walker, Susan; Lee, Caroline A; Shen, Zancong; Wilson, David M; Zhou, Dongmei; Gillen, Michael; Marbury, Thomas C

    2018-06-11

    BACKGROUND AND OBJECTIVE: Verinurad (RDEA3170) is a high-affinity, selective URAT1 transporter inhibitor in development for treating gout and asymptomatic hyperuricemia. This Phase I, single-dose study investigated the pharmacokinetics, pharmacodynamics, and safety of verinurad in adults with renal impairment and controls with normal renal function. Males aged 18-85 years were enrolled with serum urate (sUA) 4.5-10 mg/dl and creatinine clearance 60- < 90, 30- < 60, 15- < 30, or ≥ 90 ml/min (mild, moderate, severe renal impairment and controls, respectively; n = 7/8). Verinurad 15 mg was administered orally under fasted conditions. Serial plasma/serum and urine samplings were 30 min pre-dose to 72 h post-dose. Compared to controls, verinurad maximum observed plasma concentration increased by 53, 73, and 128% and area under the concentration-time curve increased by 24, 148, and 130%, in subjects with mild, moderate, and severe renal impairment, respectively; renal clearance decreased by 5, 42, and 79%. Exposures of major verinurad metabolites also increased with increasing renal impairment. Verinurad decreased sUA in all groups, with greater maximal changes in control and mild renal impairment than moderate and severe impairment groups (- 38.3, - 36.9, - 20.5, - 12.6%, respectively). There were no adverse event-related withdrawals or clinically meaningful changes in laboratory values. Exposures of verinurad and metabolites increased with decreasing renal function. Consistent with the renal-dependent mechanism of action of verinurad, increasing severity of renal impairment was associated with decreased sUA lowering. Verinurad safety assessments were similar regardless of renal impairment. Continued investigation of verinurad is warranted in patients with gout and renal impairment. CLINICALTRIALS. NCT02219516.

  13. Developmental regulation of N-methyl-D-aspartate- and kainate-type glutamate receptor expression in the rat spinal cord

    NASA Technical Reports Server (NTRS)

    Stegenga, S. L.; Kalb, R. G.

    2001-01-01

    Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.

  14. Sirtuin signaling controls mitochondrial function in glycogen storage disease type Ia.

    PubMed

    Cho, Jun-Ho; Kim, Goo-Young; Mansfield, Brian C; Chou, Janice Y

    2018-05-08

    Glycogen storage disease type Ia (GSD-Ia) deficient in glucose-6-phosphatase-α (G6Pase-α) is a metabolic disorder characterized by impaired glucose homeostasis and a long-term complication of hepatocellular adenoma/carcinoma (HCA/HCC). Mitochondrial dysfunction has been implicated in GSD-Ia but the underlying mechanism and its contribution to HCA/HCC development remain unclear. We have shown that hepatic G6Pase-α deficiency leads to downregulation of sirtuin 1 (SIRT1) signaling that underlies defective hepatic autophagy in GSD-Ia. SIRT1 is a NAD + -dependent deacetylase that can deacetylate and activate peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α), a master regulator of mitochondrial integrity, biogenesis, and function. We hypothesized that downregulation of hepatic SIRT1 signaling in G6Pase-α-deficient livers impairs PGC-1α activity, leading to mitochondrial dysfunction. Here we show that the G6Pase-α-deficient livers display defective PGC-1α signaling, reduced numbers of functional mitochondria, and impaired oxidative phosphorylation. Overexpression of hepatic SIRT1 restores PGC-1α activity, normalizes the expression of electron transport chain components, and increases mitochondrial complex IV activity. We have previously shown that restoration of hepatic G6Pase-α expression normalized SIRT1 signaling. We now show that restoration of hepatic G6Pase-α expression also restores PGC-1α activity and mitochondrial function. Finally, we show that HCA/HCC lesions found in G6Pase-α-deficient livers contain marked mitochondrial and oxidative DNA damage. Taken together, our study shows that downregulation of hepatic SIRT1/PGC-1α signaling underlies mitochondrial dysfunction and that oxidative DNA damage incurred by damaged mitochondria may contribute to HCA/HCC development in GSD-Ia.

  15. Nitric oxide in the dorsal hippocampal area is involved on muscimol state-dependent memory in the step-down passive avoidance test.

    PubMed

    Jafari-Sabet, Majid; Khodadadnejad, Mohammad-Amin; Ghoraba, Saeed; Ataee, Ramin

    2014-02-01

    In the present study, the effects of intra-dorsal hippocampal (intra-CA1) injections of nitric oxide (NO) agents on muscimol state-dependent memory were examined in mice. A single-trial step-down passive avoidance task was used for the assessment of memory retrieval in adult male NMRI mice. Post-training intra-CA1 administration of a GABAA receptor agonist, muscimol (0.05 and 0.1 μg/mouse) dose dependently induced impairment of memory retention. Pre-test injection of muscimol (0.05 and 0.1 μg/mouse) induced state-dependent retrieval of the memory acquired under post-training muscimol (0.1 μg/mouse, intra-CA1) influence. Pre-test injection of a NO precursor, L-arginine (1 and 2 μg/mouse, intra-CA1) improved memory retention, although the low dose of the drug (0.5 μg/mouse) did not affect memory retention. Pre-test injection of an inhibitor of NO-synthase, L-NAME (0.5 and 1 μg/mouse, intra-CA1) impaired memory retention, although the low dose of the drug (0.25 μg/mouse) did not affect memory retention. In other series of experiments, pre-test intra-CA1 injection of L-arginine (0.25 and 0.5 μg/mouse) 5 min before the administration of muscimol (0.1 μg/mouse, intra-CA1) dose dependently inhibited muscimol state-dependent memory. Pre-test intra-CA1 administration of L-arginine (0.125, 0.25 and 0.5 μg/mouse) by itself cannot affect memory retention. Pre-test intra-CA1 injection of L-NAME (0.25 μg/mouse, intra-CA1) reversed the memory impairment induced by post-training administration of muscimol (0.1 μg/mouse, intra-CA1). Moreover, pre-test administration of L-NAME (0.125 and 0.25 μg/mouse, intra-CA1) with an ineffective dose of muscimol (0.025 μg/mouse, intra-CA1) significantly restored the retrieval and induced muscimol state-dependent memory. Pre-test intra-CA1 administration of L-NAME (0.0625, 0.125 and 0.25 μg/mouse) by itself cannot affect memory retention. It may be suggested that the nitric oxide in the dorsal hippocampal area play an important role in muscimol state-dependent memory. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Role of adenosine and wake-promoting basal forebrain in insomnia and associated sleep disruptions caused by ethanol dependence.

    PubMed

    Sharma, Rishi; Engemann, Samuel; Sahota, Pradeep; Thakkar, Mahesh M

    2010-11-01

    Insomnia is a severe symptom of alcohol withdrawal; however, the underlying neuronal mechanism is yet unknown. We hypothesized that chronic ethanol exposure will impair basal forebrain (BF) adenosinergic mechanism resulting in insomnia-like symptoms. We performed a series of experiments in Sprague-Dawley rats to test our hypothesis. We used Majchrowicz's chronic binge ethanol protocol to induce ethanol dependency. Our first experiment verified the effects of ethanol withdrawal on sleep-wakefulness. Significant increase in wakefulness was observed during ethanol withdrawal. Next, we examined c-Fos expression (marker of neuronal activation) in BF wake-promoting neurons during ethanol withdrawal. There was a significant increase in the number of BF wake-promoting neurons with c-Fos immunoreactivity. Our third experiment examined the effects of ethanol withdrawal on sleep deprivation induced increase in BF adenosine levels. Sleep deprivation did not increase BF adenosine levels in ethanol dependent rats. Our last experiment examined the effects of ethanol withdrawal on equilibrative nucleoside transporter 1 and A1 receptor expression in the BF. There was a significant reduction in A1 receptor and equilibrative nucleoside transporter 1 expression in the BF of ethanol dependent rats. Based on these results, we suggest that insomnia observed during ethanol withdrawal is caused because of impaired adenosinergic mechanism in the BF. © 2010 The Authors. Journal of Neurochemistry © 2010 International Society for Neurochemistry.

  17. Gain-of-function human STAT1 mutations impair IL-17 immunity and underlie chronic mucocutaneous candidiasis

    PubMed Central

    Liu, Luyan; Okada, Satoshi; Kong, Xiao-Fei; Kreins, Alexandra Y.; Cypowyj, Sophie; Abhyankar, Avinash; Toubiana, Julie; Itan, Yuval; Audry, Magali; Nitschke, Patrick; Masson, Cécile; Toth, Beata; Flatot, Jérome; Migaud, Mélanie; Chrabieh, Maya; Kochetkov, Tatiana; Bolze, Alexandre; Borghesi, Alessandro; Toulon, Antoine; Hiller, Julia; Eyerich, Stefanie; Eyerich, Kilian; Gulácsy, Vera; Chernyshova, Ludmyla; Chernyshov, Viktor; Bondarenko, Anastasia; María Cortés Grimaldo, Rosa; Blancas-Galicia, Lizbeth; Madrigal Beas, Ileana Maria; Roesler, Joachim; Magdorf, Klaus; Engelhard, Dan; Thumerelle, Caroline; Burgel, Pierre-Régis; Hoernes, Miriam; Drexel, Barbara; Seger, Reinhard; Kusuma, Theresia; Jansson, Annette F.; Sawalle-Belohradsky, Julie; Belohradsky, Bernd; Jouanguy, Emmanuelle; Bustamante, Jacinta; Bué, Mélanie; Karin, Nathan; Wildbaum, Gizi; Bodemer, Christine; Lortholary, Olivier; Fischer, Alain; Blanche, Stéphane; Al-Muhsen, Saleh; Reichenbach, Janine; Kobayashi, Masao; Rosales, Francisco Espinosa; Lozano, Carlos Torres; Kilic, Sara Sebnem; Oleastro, Matias; Etzioni, Amos; Traidl-Hoffmann, Claudia; Renner, Ellen D.; Abel, Laurent; Picard, Capucine; Maródi, László; Boisson-Dupuis, Stéphanie

    2011-01-01

    Chronic mucocutaneous candidiasis disease (CMCD) may be caused by autosomal dominant (AD) IL-17F deficiency or autosomal recessive (AR) IL-17RA deficiency. Here, using whole-exome sequencing, we identified heterozygous germline mutations in STAT1 in 47 patients from 20 kindreds with AD CMCD. Previously described heterozygous STAT1 mutant alleles are loss-of-function and cause AD predisposition to mycobacterial disease caused by impaired STAT1-dependent cellular responses to IFN-γ. Other loss-of-function STAT1 alleles cause AR predisposition to intracellular bacterial and viral diseases, caused by impaired STAT1-dependent responses to IFN-α/β, IFN-γ, IFN-λ, and IL-27. In contrast, the 12 AD CMCD-inducing STAT1 mutant alleles described here are gain-of-function and increase STAT1-dependent cellular responses to these cytokines, and to cytokines that predominantly activate STAT3, such as IL-6 and IL-21. All of these mutations affect the coiled-coil domain and impair the nuclear dephosphorylation of activated STAT1, accounting for their gain-of-function and dominance. Stronger cellular responses to the STAT1-dependent IL-17 inhibitors IFN-α/β, IFN-γ, and IL-27, and stronger STAT1 activation in response to the STAT3-dependent IL-17 inducers IL-6 and IL-21, hinder the development of T cells producing IL-17A, IL-17F, and IL-22. Gain-of-function STAT1 alleles therefore cause AD CMCD by impairing IL-17 immunity. PMID:21727188

  18. Chronic stress impairs spatial memory and motivation for reward without disrupting motor ability and motivation to explore.

    PubMed

    Kleen, Jonathan K; Sitomer, Matthew T; Killeen, Peter R; Conrad, Cheryl D

    2006-08-01

    This study uses an operant, behavioral model to assess the daily changes in the decay rate of short-term memory, motivation, and motor ability in rats exposed to chronic restraint. Restraint decreased reward-related motivation by 50% without altering memory decay rate or motor ability. Moreover, chronic restraint impaired hippocampal-dependent spatial memory on the Y maze (4-hr delay) and produced CA3 dendritic retraction without altering hippocampal-independent maze navigation (1-min delay) or locomotion. Thus, mechanisms underlying motivation for food reward differ from those underlying Y maze exploration, and neurobiological substrates of spatial memory, such as the hippocampus, differ from those that underlie short-term memory. Chronic restraint produces functional, neuromorphological, and physiological alterations that parallel symptoms of depression in humans. Copyright 2006 APA, all rights reserved.

  19. Exendin-4, a glucagon-like peptide 1 receptor agonist, protects against amyloid-β peptide-induced impairment of spatial learning and memory in rats.

    PubMed

    Jia, Xiao-Tao; Ye-Tian; Yuan-Li; Zhang, Ge-Juan; Liu, Zhi-Qin; Di, Zheng-Li; Ying, Xiao-Ping; Fang, Yan; Song, Er-Fei; Qi, Jin-Shun; Pan, Yan-Fang

    2016-05-15

    Type 2 diabetes mellitus (T2DM) and Alzheimer's disease (AD) share specific molecular mechanisms, and agents with proven efficacy in one may be useful against the other. The glucagon-like peptide-1 (GLP-1) receptor agonist exendin-4 has similar properties to GLP-1 and is currently in clinical use for T2DM treatment. Thus, this study was designed to characterize the effects of exendin-4 on the impairment of learning and memory induced by amyloid protein (Aβ) and its probable molecular underlying mechanisms. The results showed that (1) intracerebroventricular (i.c.v.) injection of Aβ1-42 resulted in a significant decline of spatial learning and memory of rats in water maze tests; (2) pretreatment with exendin-4 effectively and dose-dependently protected against the Aβ1-42-induced impairment of spatial learning and memory; (3) exendin-4 treatment significantly decreased the expression of Bax and cleaved caspase-3 and increased the expression of Bcl2 in Aβ1-42-induced Alzheimer's rats. The vision and swimming speed of the rats among all groups in the visible platform tests did not show any difference. These findings indicate that systemic pretreatment with exendin-4 can effectively prevent the behavioral impairment induced by neurotoxic Aβ1-42, and the underlying protective mechanism of exendin-4 may be involved in the Bcl2, Bax and caspase-3 pathways. Thus, the application of exendin-4 or the activation of its signaling pathways may be a promising strategy to ameliorate the degenerative processes observed in AD. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Stereochemistry of quinoxaline antagonist binding to a glutamate receptor investigated by Fourier transform infrared spectroscopy.

    PubMed

    Madden, D R; Thiran, S; Zimmermann, H; Romm, J; Jayaraman, V

    2001-10-12

    The stereochemistry of the interactions between quinoxaline antagonists and the ligand-binding domain of the glutamate receptor 4 (GluR4) have been investigated by probing their vibrational modes using Fourier transform infrared spectroscopy. In solution, the electron-withdrawing nitro groups of both compounds establish a resonance equilibrium that appears to stabilize the keto form of one of the cyclic amide carbonyl bonds. Changes in the 6,7-dinitro-2,3-dihydroxyquinoxaline vibrational spectra on binding to the glutamate receptor, interpreted within the framework of a published crystal structure, illuminate the stereochemistry of the interaction and suggest that the binding site imposes a more polarized electronic bonding configuration on this antagonist. Similar spectral changes are observed for 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline, confirming that its interactions with the binding site are highly similar to those of 6,7-dinitro-2,3-dihydroxyquinoxaline and leading to a model of the 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline-S1S2 complex, for which no crystal structure is available. Conformational changes within the GluR ligand binding domain were also monitored. Compared with the previously reported spectral changes seen on binding of the agonist glutamate, only a relatively small change is detected on antagonist binding. This correlation between the functional effects of different classes of ligand and the magnitude of the spectroscopic changes they induce suggests that the spectral data reflect physiologically relevant conformational processes.

  1. Molecular mapping of 21 features associated with partial monosomy 21: Involvement of the APP-SODI region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chettouh, Z.; Maunoury, C.; Sinet, P.M.

    1995-07-01

    We compared the phenotypes, karyotypes, and molecular data for six cases of partial monosomy 21. Regions of chromosome 21, the deletion of which corresponds to particular features of monosomy 21, were thereby defined. Five such regions were identified for 21 features. Ten of the features could be assigned to the region flanked by genes APP and SOD1: six facial features, transverse palmar crease, arthrogryposis-like symptoms, hypertonia, and contribution to mental retardation. This region, covering the interface of bands 21q21-21q22.1, is 4.7-6.4 Mb long and contains the gene encoding the glutamate receptor subunit GluR5 (GRIK1). 82 refs., 5 figs., 1 tab.

  2. Prototype learning and dissociable categorization systems in Alzheimer's disease.

    PubMed

    Heindel, William C; Festa, Elena K; Ott, Brian R; Landy, Kelly M; Salmon, David P

    2013-08-01

    Recent neuroimaging studies suggest that prototype learning may be mediated by at least two dissociable memory systems depending on the mode of acquisition, with A/Not-A prototype learning dependent upon a perceptual representation system located within posterior visual cortex and A/B prototype learning dependent upon a declarative memory system associated with medial temporal and frontal regions. The degree to which patients with Alzheimer's disease (AD) can acquire new categorical information may therefore critically depend upon the mode of acquisition. The present study examined A/Not-A and A/B prototype learning in AD patients using procedures that allowed direct comparison of learning across tasks. Despite impaired explicit recall of category features in all tasks, patients showed differential patterns of category acquisition across tasks. First, AD patients demonstrated impaired prototype induction along with intact exemplar classification under incidental A/Not-A conditions, suggesting that the loss of functional connectivity within visual cortical areas disrupted the integration processes supporting prototype induction within the perceptual representation system. Second, AD patients demonstrated intact prototype induction but impaired exemplar classification during A/B learning under observational conditions, suggesting that this form of prototype learning is dependent on a declarative memory system that is disrupted in AD. Third, the surprisingly intact classification of both prototypes and exemplars during A/B learning under trial-and-error feedback conditions suggests that AD patients shifted control from their deficient declarative memory system to a feedback-dependent procedural memory system when training conditions allowed. Taken together, these findings serve to not only increase our understanding of category learning in AD, but to also provide new insights into the ways in which different memory systems interact to support the acquisition of categorical knowledge. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Prototype Learning and Dissociable Categorization Systems in Alzheimer’s Disease

    PubMed Central

    Heindel, William C.; Festa, Elena K.; Ott, Brian R.; Landy, Kelly M.; Salmon, David P.

    2015-01-01

    Recent neuroimaging studies suggest that prototype learning may be mediated by at least two dissociable memory systems depending on the mode of acquisition, with A/Not-A prototype learning dependent upon a perceptual representation system located within posterior visual cortex and A/B prototype learning dependent upon a declarative memory system associated with medial temporal and frontal regions. The degree to which patients with Alzheimer’s disease (AD) can acquire new categorical information may therefore critically depend upon the mode of acquisition. The present study examined A/Not-A and A/B prototype learning in AD patients using procedures that allowed direct comparison of learning across tasks. Despite impaired explicit recall of category features in all tasks, patients showed differential patterns of category acquisition across tasks. First, AD patients demonstrated impaired prototype induction along with intact exemplar classification under incidental A/Not-A conditions, suggesting that the loss of functional connectivity within visual cortical areas disrupted the integration processes supporting prototype induction within the perceptual representation system. Second, AD patients demonstrated intact prototype induction but impaired exemplar classification during A/B learning under observational conditions, suggesting that this form of prototype learning is dependent on a declarative memory system that is disrupted in AD. Third, the surprisingly intact classification of both prototypes and exemplars during A/B learning under trial-and-error feedback conditions suggests that AD patients shifted control from their deficient declarative memory system to a feedback-dependent procedural memory system when training conditions allowed. Taken together, these findings serve to not only increase our understanding of category learning in AD, but to also provide new insights into the ways in which different memory systems interact to support the acquisition of categorical knowledge. PMID:23751172

  4. Kalirin, a Key Player in Synapse Formation, Is Implicated in Human Diseases

    PubMed Central

    Mandela, Prashant; Ma, Xin-Ming

    2012-01-01

    Synapse formation is considered to be crucial for learning and memory. Understanding the underlying molecular mechanisms of synapse formation is a key to understanding learning and memory. Kalirin-7, a major isoform of Kalirin in adult rodent brain, is an essential component of mature excitatory synapses. Kalirin-7 interacts with multiple PDZ-domain-containing proteins including PSD95, spinophilin, and GluR1 through its PDZ-binding motif. In cultured hippocampal/cortical neurons, overexpression of Kalirin-7 increases spine density and spine size whereas reduction of endogenous Kalirin-7 expression decreases synapse number, and spine density. In Kalirin-7 knockout mice, spine length, synapse number, and postsynaptic density (PSD) size are decreased in hippocampal CA1 pyramidal neurons; these morphological alterations are accompanied by a deficiency in long-term potentiation (LTP) and a decreased spontaneous excitatory postsynaptic current (sEPSC) frequency. Human Kalirin-7, also known as Duo or Huntingtin-associated protein-interacting protein (HAPIP), is equivalent to rat Kalirin-7. Recent studies show that Kalirin is relevant to many human diseases such as Huntington's Disease, Alzheimer's Disease, ischemic stroke, schizophrenia, depression, and cocaine addiction. This paper summarizes our recent understanding of Kalirin function. PMID:22548195

  5. Kalirin, a key player in synapse formation, is implicated in human diseases.

    PubMed

    Mandela, Prashant; Ma, Xin-Ming

    2012-01-01

    Synapse formation is considered to be crucial for learning and memory. Understanding the underlying molecular mechanisms of synapse formation is a key to understanding learning and memory. Kalirin-7, a major isoform of Kalirin in adult rodent brain, is an essential component of mature excitatory synapses. Kalirin-7 interacts with multiple PDZ-domain-containing proteins including PSD95, spinophilin, and GluR1 through its PDZ-binding motif. In cultured hippocampal/cortical neurons, overexpression of Kalirin-7 increases spine density and spine size whereas reduction of endogenous Kalirin-7 expression decreases synapse number, and spine density. In Kalirin-7 knockout mice, spine length, synapse number, and postsynaptic density (PSD) size are decreased in hippocampal CA1 pyramidal neurons; these morphological alterations are accompanied by a deficiency in long-term potentiation (LTP) and a decreased spontaneous excitatory postsynaptic current (sEPSC) frequency. Human Kalirin-7, also known as Duo or Huntingtin-associated protein-interacting protein (HAPIP), is equivalent to rat Kalirin-7. Recent studies show that Kalirin is relevant to many human diseases such as Huntington's Disease, Alzheimer's Disease, ischemic stroke, schizophrenia, depression, and cocaine addiction. This paper summarizes our recent understanding of Kalirin function.

  6. Phospholipase D-mediated hypersensitivity at central synapses is associated with abnormal behaviours and pain sensitivity in rats exposed to prenatal stress.

    PubMed

    Sun, Liting; Gooding, Hayley L; Brunton, Paula J; Russell, John A; Mitchell, Rory; Fleetwood-Walker, Sue

    2013-11-01

    Adverse events at critical stages of development can lead to lasting dysfunction in the central nervous system (CNS). To seek potential underlying changes in synaptic function, we used a newly developed protocol to measure alterations in receptor-mediated Ca(2+) fluorescence responses of synaptoneurosomes, freshly isolated from selected regions of the CNS concerned with emotionality and pain processing. We compared adult male controls and offspring of rats exposed to social stress in late pregnancy (prenatal stress, PS), which showed programmed behavioural changes indicating anxiety, anhedonia and pain hypersensitivity. We found corresponding increases, in PS rats compared with normal controls, in responsiveness of synaptoneurosomes from frontal cortex to a glutamate receptor (GluR) agonist, and from spinal cord to activators of nociceptive afferents. Through a combined pharmacological and biochemical strategy, we found evidence for a role of phospholipase D1 (PLD1)-mediated signalling, that may involve 5-HT2A receptor (5-HT2AR) activation, at both levels of the nervous system. These changes might participate in underpinning the enduring alterations in behaviour induced by PS. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. 20 CFR 30.905 - How may an impairment evaluation be obtained?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false How may an impairment evaluation be obtained... UNDER THE ENERGY EMPLOYEES OCCUPATIONAL ILLNESS COMPENSATION PROGRAM ACT OF 2000, AS AMENDED Impairment Benefits Under Part E of EEOICPA Medical Evidence of Impairment § 30.905 How may an impairment evaluation...

  8. MK-801 and amphetamine result in dissociable profiles of cognitive impairment in a rodent paired associates learning task with relevance for schizophrenia.

    PubMed

    Talpos, John; Aerts, Nancy; Waddell, Jason; Steckler, Thomas

    2015-11-01

    Paired associates learning (PAL) has been suggested to be predictive of functional outcomes in first episode psychosis and of conversion from mild cognitive impairment to Alzheimer's disease. An automated touch screen-based rodent PAL (rPAL) task has been developed and is sensitive to manipulations of the dopaminergic and glutamatergic system. Accordingly, rPAL when used with pharmacological models of schizophrenia, like NMDA receptor blockade with MK-801 or dopaminergic stimulation with amphetamine, may have utility as a translational model of cognitive impairment in schizophrenia. The purpose of this study was to determine if amphetamine- and MK-801-induced impairment represent distinct models of cognitive impairment by testing their sensitivity to common antipsychotics and determine the relative contributions of D1 versus D2 receptors on performance of PAL. Rats were trained in rPAL and were then treated with MK-801, amphetamine, risperidone, haloperidol, quinpirole, SK-82958, or SCH-23390 alone and in combination. While both amphetamine and MK-801 caused clear impairments in accuracy, MK-801 induced a profound "perseverative" type behavior that was more pronounced when compared to amphetamine. Moreover, amphetamine-induced impairments, but not the effects of MK-801, could be reversed by antipsychotics as well as the D1 receptor antagonist SCH-23390, suggesting a role for both the D1 and D2 receptor in the amphetamine impairment model. These data suggest that amphetamine and MK-801 represent dissociable models of impairment in PAL, dependent on different underlying neurobiology. The ability to distinguish dopaminergic versus glutamatergic effects on performance in rPAL makes it a unique and useful tool in the modeling of cognitive impairments in schizophrenia.

  9. Chronic treatment with ginsenoside Rg1 promotes memory and hippocampal long-term potentiation in middle-aged mice.

    PubMed

    Zhu, G; Wang, Y; Li, J; Wang, J

    2015-04-30

    Ginseng serves as a potential candidate for the treatment of aging-related memory decline or memory loss. However, the related mechanism is not fully understood. In this study, we applied an intraperitoneal injection of ginsenoside Rg1, an active compound from ginseng in middle-aged mice and detected memory improvement and the underlying mechanisms. Our results showed that a period of 30-day administration of ginsenoside Rg1 enhanced long-term memory in the middle-aged animals. Consistent with the memory improvement, ginsenoside Rg1 administration facilitated weak theta-burst stimulation (TBS)-induced long-term potentiation (LTP) in acute hippocampal slices from middle-aged animals. Ginsenoside Rg1 administration increased the dendritic apical spine numbers and area in the CA1 region. In addition, ginsenoside Rg1 administration up-regulated the expression of hippocampal p-AKT, brain-derived neurotrophic factor (BDNF), proBDNF and glutamate receptor 1 (GluR1), but not p-ERK. Interestingly, the phosphatase and tensin homolog deleted on chromosome ten (PTEN) inhibitor (bpV) mimicked the ginsenoside Rg1 effects, including increasing p-AKT expression, promoting hippocampal basal synaptic transmission, LTP and memory. Taken together, our data suggest that ginsenoside Rg1 treatment improves memory in middle-aged mice possibly through regulating the PI3K/AKT pathway, altering apical spines and facilitating hippocampal LTP. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  10. Central cannabinoid receptors modulate acquisition of eyeblink conditioning

    PubMed Central

    Steinmetz, Adam B.; Freeman, John H.

    2010-01-01

    Delay eyeblink conditioning is established by paired presentations of a conditioned stimulus (CS) such as a tone or light, and an unconditioned stimulus (US) that elicits the blink reflex. Conditioned stimulus information is projected from the basilar pontine nuclei to the cerebellar interpositus nucleus and cortex. The cerebellar cortex, particularly the molecular layer, contains a high density of cannabinoid receptors (CB1R). The CB1Rs are located on the axon terminals of parallel fibers, stellate cells, and basket cells where they inhibit neurotransmitter release. The present study examined the effects of a CB1R agonist WIN55,212-2 and antagonist SR141716A on the acquisition of delay eyeblink conditioning in rats. Rats were given subcutaneous administration of 1, 2, or 3 mg/kg of WIN55,212-2 or 1, 3, or 5 mg/kg of SR141716A before each day of acquisition training (10 sessions). Dose-dependent impairments in acquisition were found for WIN55,212-2 and SR141716A, with no effects on spontaneous or nonassociative blinking. However, the magnitude of impairment was greater for WIN55,212-2 than SR141716A. Dose-dependent impairments in conditioned blink response (CR) amplitude and timing were found with WIN55,212-2 but not with SR141716A. The findings support the hypothesis that CB1Rs in the cerebellar cortex play an important role in plasticity mechanisms underlying eyeblink conditioning. PMID:21030483

  11. Treating a novel plasticity defect rescues episodic memory in Fragile X model mice

    PubMed Central

    Wang, Weisheng; Cox, Brittney M.; Jia, Yousheng; Le, Aliza A.; Cox, Conor D.; Jung, Kwang M.; Hou, Bowen; Piomelli, Daniele; Gall, Christine M.; Lynch, Gary

    2017-01-01

    Episodic memory, a fundamental component of human cognition, is significantly impaired in autism. We report the first evidence for this problem in the Fmr1-knockout (KO) mouse model of Fragile X syndrome and describe potentially treatable underlying causes. The hippocampus is critical for the formation and use of episodes, with semantic (cue identity) information relayed to the structure via the lateral perforant path (LPP). The unusual form of synaptic plasticity expressed by the LPP (lppLTP) was profoundly impaired in Fmr1-KOs relative to wild type mice. Two factors contributed to this defect: i) reduced GluN1 subunit levels in synaptic NMDA receptors and related currents, and ii) impaired retrograde synaptic signaling by the endocannabinoid 2-archadonolglycerol (2-AG). Studies using a novel serial cue paradigm showed that episodic encoding is dependent on both the LPP and the endocannabinoid receptor CB1, and is strikingly impaired in Fmr1-KOs. Enhancing 2-AG signaling rescued both lppLTP and learning in the mutants. Thus, two consequences of the Fragile-X mutation converge on plasticity at one site in hippocampus to prevent encoding of a basic element of cognitive memory. Collectively, the results suggest a clinically plausible approach to treatment. PMID:29133950

  12. Effects of repeated withdrawal from alcohol on recovery of cognitive impairment under abstinence and rate of relapse.

    PubMed

    Loeber, Sabine; Duka, Theodora; Welzel Márquez, Helga; Nakovics, Helmut; Heinz, Andreas; Mann, Karl; Flor, Herta

    2010-01-01

    Several authors suggest that withdrawal from alcohol could cause neurotoxic lesions in the frontal lobe and thereby affect cognitive function. In line with this, previous studies have demonstrated greater cognitive impairment of alcohol-dependent patients with two or more previous detoxifications (Hi-detox) compared with patients with less than two detoxifications (Lo-detox). The aim of the present study was to investigate whether repeated withdrawal from alcohol affects recovery of cognitive function and is related to relapse. Forty-eight alcohol-dependent patients (Hi-detox: n = 31, Lo-detox: n = 17) and 36 healthy controls underwent a comprehensive neuropsychological test-battery. Patients were tested after completion of detoxification (T1) and 3 (T2, n = 35) and 6 (T3, n = 28) months after discharge. Healthy controls were tested at T1 (n = 36) and T2 (n = 16). Drinking behaviour was assessed at all times. Patients performed significantly worse than controls at T1 as well as T2 with regard to attention/executive function. Recovery of attention/executive function was observed within the second 3 months after discharge, but the Hi-detox group performed worse than the Lo-detox group. No association with relapse was observed. This study provides first evidence, that repeated withdrawal from alcohol might be associated with reduced brain plasticity as indicated by a delay of recovery from impairment of attention/executive function. However, little evidence was found for a direct influence of cognitive impairment on treatment success.

  13. Extinction learning is slower, weaker and less context specific after alcohol

    PubMed Central

    Bisby, James A.; King, John A.; Sulpizio, Valentina; Degeilh, Fanny; Valerie Curran, H.; Burgess, Neil

    2015-01-01

    Alcohol is frequently involved in psychological trauma and often used by individuals to reduce fear and anxiety. We examined the effects of alcohol on fear acquisition and extinction within a virtual environment. Healthy volunteers were administered alcohol (0.4 g/kg) or placebo and underwent acquisition and extinction from different viewpoints of a virtual courtyard, in which the conditioned stimulus, paired with a mild electric shock, was centrally located. Participants returned the following day to test fear recall from both viewpoints of the courtyard. Skin conductance responses were recorded as an index of conditioned fear. Successful fear acquisition under alcohol contrasted with impaired extinction learning evidenced by persistent conditioned responses (Experiment 1). Participants’ impairments in extinction under alcohol correlated with impairments in remembering object-locations in the courtyard seen from one viewpoint when tested from the other viewpoint. Alcohol-induced extinction impairments were overcome by increasing the number of extinction trials (Experiment 2). However, a test of fear recall the next day showed persistent fear in the alcohol group across both viewpoints. Thus, alcohol impaired extinction rather than acquisition of fear, suggesting that extinction is more dependent than acquisition on alcohol-sensitive representations of spatial context. Overall, extinction learning under alcohol was slower, weaker and less context-specific, resulting in persistent fear at test that generalized to the extinction viewpoint. The selective effect on extinction suggests an effect of alcohol on prefrontal involvement, while the reduced context-specificity implicates the hippocampus. These findings have important implications for the use of alcohol by individuals with clinical anxiety disorders. PMID:26234587

  14. Remifentanil maintains lower initial delayed nonmatching-to-sample accuracy compared to food pellets in male rhesus monkeys.

    PubMed

    Hutsell, Blake A; Banks, Matthew L

    2017-12-01

    Emerging human laboratory and preclinical drug self-administration data suggest that a history of contingent abused drug exposure impairs performance in operant discrimination procedures, such as delayed nonmatching-to-sample (DNMTS), that are hypothesized to assess components of executive function. However, these preclinical discrimination studies have exclusively used food as the reinforcer and the effects of drugs as reinforcers in these operant procedures are unknown. The present study determined effects of contingent intravenous remifentanil injections on DNMTS performance hypothesized to assess 1 aspect of executive function, working memory. Daily behavioral sessions consisted of 2 components with sequential intravenous remifentanil (0, 0.01-1.0 μg/kg/injection) or food (0, 1-10 pellets) availability in nonopioid dependent male rhesus monkeys (n = 3). Remifentanil functioned as a reinforcer in the DNMTS procedure. Similar delay-dependent DNMTS accuracy was observed under both remifentanil- and food-maintained components, such that higher accuracies were maintained at shorter (0.1-1.0 s) delays and lower accuracies approaching chance performance were maintained at longer (10-32 s) delays. Remifentanil maintained significantly lower initial DNMTS accuracy compared to food. Reinforcer magnitude was not an important determinant of DNMTS accuracy for either remifentanil or food. These results extend the range of experimental procedures under which drugs function as reinforcers. Furthermore, the selective remifentanil-induced decrease in initial DNMTS accuracy is consistent with a selective impairment of attentional, but not memorial, processes. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  15. HIV Glycoprotein Gp120 Impairs Fast Axonal Transport by Activating Tak1 Signaling Pathways

    PubMed Central

    Berth, Sarah H.; Mesnard-Hoaglin, Nichole; Wang, Bin; Kim, Hajwa; Song, Yuyu; Sapar, Maria; Morfini, Gerardo

    2016-01-01

    Sensory neuropathies are the most common neurological complication of HIV. Of these, distal sensory polyneuropathy (DSP) is directly caused by HIV infection and characterized by length-dependent axonal degeneration of dorsal root ganglion (DRG) neurons. Mechanisms for axonal degeneration in DSP remain unclear, but recent experiments revealed that the HIV glycoprotein gp120 is internalized and localized within axons of DRG neurons. Based on these findings, we investigated whether intra-axonal gp120 might impair fast axonal transport (FAT), a cellular process critical for appropriate maintenance of the axonal compartment. Significantly, we found that gp120 severely impaired both anterograde and retrograde FAT. Providing a mechanistic basis for these effects, pharmacological experiments revealed an involvement of various phosphotransferases in this toxic effect, including members of mitogen-activated protein kinase pathways (Tak-1, p38, and c-Jun N-terminal Kinase (JNK)), inhibitor of kappa-B-kinase 2 (IKK2), and PP1. Biochemical experiments and axonal outgrowth assays in cell lines and primary cultures extended these findings. Impairments in neurite outgrowth in DRG neurons by gp120 were rescued using a Tak-1 inhibitor, implicating a Tak-1 mitogen-activated protein kinase pathway in gp120 neurotoxicity. Taken together, these observations indicate that kinase-based impairments in FAT represent a novel mechanism underlying gp120 neurotoxicity consistent with the dying-back degeneration seen in DSP. Targeting gp120-based impairments in FAT with specific kinase inhibitors might provide a novel therapeutic strategy to prevent axonal degeneration in DSP. PMID:27872270

  16. Selective memory retrieval can impair and improve retrieval of other memories.

    PubMed

    Bäuml, Karl-Heinz T; Samenieh, Anuscheh

    2012-03-01

    Research from the past decades has shown that retrieval of a specific memory (e.g., retrieving part of a previous vacation) typically attenuates retrieval of other memories (e.g., memories for other details of the event), causing retrieval-induced forgetting. More recently, however, it has been shown that retrieval can both attenuate and aid recall of other memories (K.-H. T. Bäuml & A. Samenieh, 2010). To identify the circumstances under which retrieval aids recall, the authors examined retrieval dynamics in listwise directed forgetting, context-dependent forgetting, proactive interference, and in the absence of any induced memory impairment. They found beneficial effects of selective retrieval in listwise directed forgetting and context-dependent forgetting but detrimental effects in all the other conditions. Because context-dependent forgetting and listwise directed forgetting arguably reflect impaired context access, the results suggest that memory retrieval aids recall of memories that are subject to impaired context access but attenuates recall in the absence of such circumstances. The findings are consistent with a 2-factor account of memory retrieval and suggest the existence of 2 faces of memory retrieval. 2012 APA, all rights reserved

  17. Beyond Inhibition: A Dual-Process Perspective to Renew the Exploration of Binge Drinking

    PubMed Central

    Lannoy, Séverine; Billieux, Joël; Maurage, Pierre

    2014-01-01

    Binge drinking is a widespread alcohol-consumption pattern in youth and is linked to cognitive consequences, mostly for executive functions. However, other crucial factors remain less explored in binge drinking and notably the emotional-automatic processes. Dual-process model postulates that addictive disorders are not only due to impaired reflective system (involved in deliberate behaviors), but rather to an imbalance between under-activated reflective system and over-activated affective-automatic one (involved in impulsive behaviors). This proposal has been confirmed in alcohol-dependence, but has not been tested in binge drinking. The observation of comparable impairments in binge drinking and alcohol-dependence led to the “continuum hypothesis,” suggesting similar deficits across different alcohol-related disorders. In this perspective, applying the dual-process model to binge drinking might renew the understanding of this continuum hypothesis. A three-axes research agenda will be proposed, exploring: (1) the affective-automatic system in binge drinking; (2) the systems’ interactions and imbalance in binge drinking; (3) the evolution of this imbalance in the transition between binge drinking and alcohol-dependence. PMID:24926251

  18. Vitamin B1-deficient mice show impairment of hippocampus-dependent memory formation and loss of hippocampal neurons and dendritic spines: potential microendophenotypes of Wernicke–Korsakoff syndrome

    PubMed Central

    Inaba, Hiroyoshi; Kishimoto, Takuya; Oishi, Satoru; Nagata, Kan; Hasegawa, Shunsuke; Watanabe, Tamae; Kida, Satoshi

    2016-01-01

    Patients with severe Wernicke–Korsakoff syndrome (WKS) associated with vitamin B1 (thiamine) deficiency (TD) show enduring impairment of memory formation. The mechanisms of memory impairment induced by TD remain unknown. Here, we show that hippocampal degeneration is a potential microendophenotype (an endophenotype of brain disease at the cellular and synaptic levels) of WKS in pyrithiamine-induced thiamine deficiency (PTD) mice, a rodent model of WKS. PTD mice show deficits in the hippocampus-dependent memory formation, although they show normal hippocampus-independent memory. Similarly with WKS, impairments in memory formation did not recover even at 6 months after treatment with PTD. Importantly, PTD mice exhibit a decrease in neurons in the CA1, CA3, and dentate gyrus (DG) regions of the hippocampus and reduced density of wide dendritic spines in the DG. Our findings suggest that TD induces hippocampal degeneration, including the loss of neurons and spines, thereby leading to enduring impairment of hippocampus-dependent memory formation. PMID:27576603

  19. Vitamin B1-deficient mice show impairment of hippocampus-dependent memory formation and loss of hippocampal neurons and dendritic spines: potential microendophenotypes of Wernicke-Korsakoff syndrome.

    PubMed

    Inaba, Hiroyoshi; Kishimoto, Takuya; Oishi, Satoru; Nagata, Kan; Hasegawa, Shunsuke; Watanabe, Tamae; Kida, Satoshi

    2016-12-01

    Patients with severe Wernicke-Korsakoff syndrome (WKS) associated with vitamin B1 (thiamine) deficiency (TD) show enduring impairment of memory formation. The mechanisms of memory impairment induced by TD remain unknown. Here, we show that hippocampal degeneration is a potential microendophenotype (an endophenotype of brain disease at the cellular and synaptic levels) of WKS in pyrithiamine-induced thiamine deficiency (PTD) mice, a rodent model of WKS. PTD mice show deficits in the hippocampus-dependent memory formation, although they show normal hippocampus-independent memory. Similarly with WKS, impairments in memory formation did not recover even at 6 months after treatment with PTD. Importantly, PTD mice exhibit a decrease in neurons in the CA1, CA3, and dentate gyrus (DG) regions of the hippocampus and reduced density of wide dendritic spines in the DG. Our findings suggest that TD induces hippocampal degeneration, including the loss of neurons and spines, thereby leading to enduring impairment of hippocampus-dependent memory formation.

  20. A Little Goes a Long Way: Low Working Memory Load Is Associated with Optimal Distractor Inhibition and Increased Vagal Control under Anxiety.

    PubMed

    Spangler, Derek P; Friedman, Bruce H

    2017-01-01

    Anxiety impairs both inhibition of distraction and attentional focus. It is unclear whether these impairments are reduced or exacerbated when loading working memory with non-affective information. Cardiac vagal control has been related to top-down regulation of anxiety; therefore, vagal control may reflect load-related inhibition of distraction under anxiety. The present study examined whether: (1) the enhancing and impairing effects of load on inhibition exist together in a non-linear function, (2) there is a similar association between inhibition and concurrent vagal control under anxiety. During anxiogenic threat-of-noise, 116 subjects maintained a digit series of varying lengths (0, 2, 4, and 6 digits) while completing a visual flanker task. The task was broken into four blocks, with a baseline period preceding each. Electrocardiography was acquired throughout to quantify vagal control as high-frequency heart rate variability (HRV). There were significant quadratic relations of working memory load to flanker performance and to HRV, but no associations between HRV and performance. Results indicate that low load was associated with relatively better inhibition and increased HRV. These findings suggest that attentional performance under anxiety depends on the availability of working memory resources, which might be reflected by vagal control. These results have implications for treating anxiety disorders, in which regulation of anxiety can be optimized for attentional focus.

  1. A Little Goes a Long Way: Low Working Memory Load Is Associated with Optimal Distractor Inhibition and Increased Vagal Control under Anxiety

    PubMed Central

    Spangler, Derek P.; Friedman, Bruce H.

    2017-01-01

    Anxiety impairs both inhibition of distraction and attentional focus. It is unclear whether these impairments are reduced or exacerbated when loading working memory with non-affective information. Cardiac vagal control has been related to top–down regulation of anxiety; therefore, vagal control may reflect load-related inhibition of distraction under anxiety. The present study examined whether: (1) the enhancing and impairing effects of load on inhibition exist together in a non-linear function, (2) there is a similar association between inhibition and concurrent vagal control under anxiety. During anxiogenic threat-of-noise, 116 subjects maintained a digit series of varying lengths (0, 2, 4, and 6 digits) while completing a visual flanker task. The task was broken into four blocks, with a baseline period preceding each. Electrocardiography was acquired throughout to quantify vagal control as high-frequency heart rate variability (HRV). There were significant quadratic relations of working memory load to flanker performance and to HRV, but no associations between HRV and performance. Results indicate that low load was associated with relatively better inhibition and increased HRV. These findings suggest that attentional performance under anxiety depends on the availability of working memory resources, which might be reflected by vagal control. These results have implications for treating anxiety disorders, in which regulation of anxiety can be optimized for attentional focus. PMID:28217091

  2. Neutral and emotional episodic memory: global impairment after lorazepam or scopolamine.

    PubMed

    Kamboj, Sunjeev K; Curran, H Valerie

    2006-11-01

    Benzodiazepines and anticholinergic drugs have repeatedly been shown to impair episodic memory for emotionally neutral material in humans. However, their effect on memory for emotionally laden stimuli has been relatively neglected. We sought to investigate the effects of the benzodiazepine, lorazepam, and the anticholinergic, scopolamine, on incidental episodic memory for neutral and emotional components of a narrative memory task in humans. A double-blind, placebo-controlled independent group design was used with 48 healthy volunteers to examine the effects of these drugs on emotional and neutral episodic memory. As expected, the emotional memory advantage was retained for recall and recognition memory under placebo conditions. However, lorazepam and scopolamine produced anterograde recognition memory impairments on both the neutral and emotional components of the narrative, although floor effects were obtained for recall memory. Furthermore, compared with placebo, recognition memory for both central (gist) and peripheral (detail) aspects of neutral and emotional elements of the narrative was poorer after either drug. Benzodiazepine-induced GABAergic enhancement or scopolamine-induced cholinergic hypofunction results in a loss of the enhancing effect of emotional arousal on memory. Furthermore, lorazepam- and scopolamine-induced memory impairment for both gist (which is amygdala dependent) and detail raises the possibility that their effects on emotional memory do not depend only on the amygdala. We discuss the results with reference to potential clinical/forensic implications of processing emotional memories under conditions of globally impaired episodic memory.

  3. Possible relationship between the stress-induced synaptic response and metaplasticity in the hippocampal CA1 field of freely moving rats.

    PubMed

    Hirata, Riki; Matsumoto, Machiko; Judo, Chika; Yamaguchi, Taku; Izumi, Takeshi; Yoshioka, Mitsuhiro; Togashi, Hiroko

    2009-07-01

    Hippocampal long-term potentiation (LTP) is suppressed not only by stress paradigms but also by low frequency stimulation (LFS) prior to LTP-inducing high frequency stimulation (HFS; tetanus), termed metaplasticity. These synaptic responses are dependent on N-methyl-D-aspartate receptors, leading to speculations about the possible relationship between metaplasticity and stress-induced LTP impairment. However, the functional significance of metaplasticity has been unclear. The present study elucidated the electrophysiological and neurochemical profiles of metaplasticity in the hippocampal CA1 field, with a focus on the synaptic response induced by the emotional stress, contextual fear conditioning (CFC). The population spike amplitude in the CA1 field was decreased during exposure to CFC, and LTP induction was suppressed after CFC in conscious rats. The synaptic response induced by CFC was mimicked by LFS, i.e., LFS impaired the synaptic transmission and subsequent LTP. Plasma corticosterone levels were increased by both CFC and LFS. Extracellular levels of gamma-aminobutyric acid (GABA), but not glutamate, in the hippocampus increased during exposure to CFC or LFS. Furthermore, electrical stimulation of the medial prefrontal cortex (mPFC), which caused decreases in freezing behavior during exposure to CFC, counteracted the LTP impairment induced by LFS. These findings suggest that metaplasticity in the rat hippocampal CA1 field is related to the neural basis of stress experience-dependent fear memory, and that hippocampal synaptic response associated stress-related processes is under mPFC regulation.

  4. Endothelial sirtuin 1 deficiency perpetrates nephrosclerosis through downregulation of matrix metalloproteinase-14: relevance to fibrosis of vascular senescence.

    PubMed

    Vasko, Radovan; Xavier, Sandhya; Chen, Jun; Lin, Chi Hua Sarah; Ratliff, Brian; Rabadi, May; Maizel, Julien; Tanokuchi, Rina; Zhang, Frank; Cao, Jian; Goligorsky, Michael S

    2014-02-01

    Sirtuin 1 (SIRT1) depletion in vascular endothelial cells mediates endothelial dysfunction and premature senescence in diverse cardiovascular and renal diseases. However, the molecular mechanisms underlying these pathologic effects remain unclear. Here, we examined the phenotype of a mouse model of vascular senescence created by genetically ablating exon 4 of Sirt1 in endothelial cells (Sirt1(endo-/-)). Under basal conditions, Sirt1(endo-/-) mice showed impaired endothelium-dependent vasorelaxation and angiogenesis, and fibrosis occurred spontaneously at low levels at an early age. In contrast, induction of nephrotoxic stress (acute and chronic folic acid-induced nephropathy) in Sirt1(endo-/-) mice resulted in robust acute renal functional deterioration followed by an exaggerated fibrotic response compared with control animals. Additional studies identified matrix metalloproteinase-14 (MMP-14) as a target of SIRT1. In the kidneys of Sirt1(endo-/-) mice, impaired angiogenesis, reduced matrilytic activity, and retention of the profibrotic cleavage substrates tissue transglutaminase and endoglin accompanied MMP-14 suppression. Furthermore, restoration of MMP-14 expression in SIRT1-depeleted mice improved angiogenic and matrilytic functions of the endothelium, prevented renal dysfunction, and attenuated nephrosclerosis. Our findings establish a novel mechanistic molecular link between endothelial SIRT1 depletion, downregulation of MMP-14, and the development of nephrosclerosis.

  5. Cdk5 Contributes to Huntington's Disease Learning and Memory Deficits via Modulation of Brain Region-Specific Substrates.

    PubMed

    Alvarez-Periel, Elena; Puigdellívol, Mar; Brito, Verónica; Plattner, Florian; Bibb, James A; Alberch, Jordi; Ginés, Silvia

    2017-12-29

    Cognitive deficits are a major hallmark of Huntington's disease (HD) with a great impact on the quality of patient's life. Gaining a better understanding of the molecular mechanisms underlying learning and memory impairments in HD is, therefore, of critical importance. Cdk5 is a proline-directed Ser/Thr kinase involved in the regulation of synaptic plasticity and memory processes that has been associated with several neurodegenerative disorders. In this study, we aim to investigate the role of Cdk5 in learning and memory impairments in HD using a novel animal model that expresses mutant huntingtin (mHtt) and has genetically reduced Cdk5 levels. Genetic reduction of Cdk5 in mHtt knock-in mice attenuated both corticostriatal learning deficits as well as hippocampal-dependent memory decline. Moreover, the molecular mechanisms by which Cdk5 counteracts the mHtt-induced learning and memory impairments appeared to be differentially regulated in a brain region-specific manner. While the corticostriatal learning deficits are attenuated through compensatory regulation of NR2B surface levels, the rescue of hippocampal-dependent memory was likely due to restoration of hippocampal dendritic spine density along with an increase in Rac1 activity. This work identifies Cdk5 as a critical contributor to mHtt-induced learning and memory deficits. Furthermore, we show that the Cdk5 downstream targets involved in memory and learning decline differ depending on the brain region analyzed suggesting that distinct Cdk5 effectors could be involved in cognitive impairments in HD.

  6. Enhanced Long-Term and Impaired Short-Term Spatial Memory in GluA1 AMPA Receptor Subunit Knockout Mice: Evidence for a Dual-Process Memory Model

    ERIC Educational Resources Information Center

    Sanderson, David J.; Good, Mark A.; Skelton, Kathryn; Sprengel, Rolf; Seeburg, Peter H.; Rawlins, J. Nicholas P.; Bannerman, David M.

    2009-01-01

    The GluA1 AMPA receptor subunit is a key mediator of hippocampal synaptic plasticity and is especially important for a rapidly-induced, short-lasting form of potentiation. GluA1 gene deletion impairs hippocampus-dependent, spatial working memory, but spares hippocampus-dependent spatial reference memory. These findings may reflect the necessity of…

  7. Age-dependent Impairment of HIF-1α̣Expression in Diabetic Mice: Correction with Electroporation-facilitated Gene Therapy Increases Wound Healing, Angiogenesis, and Circulating Angiogenic Cells

    PubMed Central

    Liu, Lixin; Marti, Guy P.; Wei, Xiaofei; Zhang, Xianjie; Zhang, Huafeng; Liu, Ye V.; Nastai, Manuel; Semenza, Gregg L.; Harmon, John W.

    2009-01-01

    Wound healing is impaired in elderly patients with diabetes mellitus. We hypothesized that age-dependent impairment of cutaneous wound healing in db/db diabetic mice: (a) would correlate with reduced expression of the transcription factor hypoxia-inducible factor 1α (HIF-1α) as well as its downstream target genes; and (b) could be overcome by HIF-1α replacement therapy. Wound closure, angiogenesis, and mRNA expression in excisional skin wounds were analyzed and circulating angiogenic cells were quantified in db/db mice that were untreated or received electroporation-facilitated HIF-1α gene therapy. HIF-1α mRNA levels in wound tissue were significantly reduced in older (4–6 months) as compared to younger (1.5–2 months) db/db mice. Expression of mRNAs encoding the angiogenic cytokines vascular endothelial growth factor (VEGF), angiopoietin 1 (ANGPT1), ANGPT2, platelet derived growth factor B (PDGF-B), and placental growth factor (PLGF) was also impaired in wounds of older db/db mice. Intradermal injection of plasmid gWIZ-CA5, which encodes a constitutively active form of HIF-1α, followed by electroporation, induced increased levels of HIF-1α mRNA at the injection site on day 3 and increased levels of VEGF, PLGF, PDGF-B, and ANGPT2 mRNA on day 7. Circulating angiogenic cells in peripheral blood increased 10-fold in mice treated with gWIZ-CA5. Wound closure was significantly accelerated in db/db mice treated with gWIZ-CA5 as compared to mice treated with empty vector. Thus, HIF-1α gene therapy corrects the age-dependent impairment of HIF-1α expression, angiogenic cytokine expression, and circulating angiogenic cells that contribute to the age-dependent impairment of wound healing in db/db mice. PMID:18506785

  8. 47 CFR 1.764 - Discontinuance, reduction, or impairment of service.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Discontinuance, reduction, or impairment of... Applications Under Title II of Communications Act § 1.764 Discontinuance, reduction, or impairment of service... discontinuance, reduction, or impairment of service shall be made in the form and manner, with the number of...

  9. Neuroprotective effects of the amylin analogue pramlintide on Alzheimer's disease pathogenesis and cognition.

    PubMed

    Adler, Brittany L; Yarchoan, Mark; Hwang, Hae Min; Louneva, Natalia; Blair, Jeffrey A; Palm, Russell; Smith, Mark A; Lee, Hyoung-Gon; Arnold, Steven E; Casadesus, Gemma

    2014-04-01

    Amylin is a metabolic peptide hormone that is co-secreted with insulin from beta cells in the pancreas and activates many of the downstream targets of insulin. To investigate the relationship between this hormone and Alzheimer's disease (AD), we measured plasma human amylin levels in 206 subjects with AD, 64 subjects with mild cognitive impairment, and 111 subjects with no cognitive impairment and found significantly lower amylin levels among subjects with AD and mild cognitive impairment compared with the cognitively intact subjects. To investigate mechanisms underlying amylin's effects in the brain, we administered chronic infusions of the amylin analog pramlintide in the senescence-accelerated prone mouse, a mouse model of sporadic AD. Pramlintide administration improved performance in the novel object recognition task, a validated test of memory and cognition. The pramlintide-treated mice had increased expression of the synaptic marker synapsin I and the kinase cyclin-dependent kinase-5 in the hippocampus, as well as decreased oxidative stress and inflammatory markers in the hippocampus. A dose-dependent increase in cyclin-dependent kinase-5 and activation of extracellular-signal-regulated-kinases 1/2 by pramlintide treatment in vitro was also present indicating functionality of the amylin receptor in neurons. Together these results suggest that amylin analogs have neuroprotective properties and might be of therapeutic benefit in AD. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Impaired sodium-dependent adaptation of arterial stiffness in formerly preeclamptic women: the RETAP-vascular study.

    PubMed

    van der Graaf, Anne Marijn; Paauw, Nina D; Toering, Tsjitske J; Feelisch, Martin; Faas, Marijke M; Sutton, Thomas R; Minnion, Magdalena; Lefrandt, Joop D; Scherjon, Sicco A; Franx, Arie; Navis, Gerjan; Lely, A Titia

    2016-06-01

    Women with a history of preeclampsia have an increased risk for cardiovascular diseases later in life. Persistent vascular alterations in the postpartum period might contribute to this increased risk. The current study assessed arterial stiffness under low sodium (LS) and high sodium (HS) conditions in a well-characterized group of formerly early-onset preeclamptic (fPE) women and formerly pregnant (fHP) women. Eighteen fHP and 18 fPE women were studied at an average of 5 yr after pregnancy on 1 wk of LS (50 mmol Na(+)/day) and 1 wk of HS (200 mmol Na(+)/day) intake. Arterial stiffness was measured by pulse-wave analysis (aortic augmentation index, AIx) and carotid-femoral pulse-wave velocity (PWV). Circulating markers of the renin-angiotensin aldosterone system (RAAS), extracellular volume (ECV), nitric oxide (NO), and hydrogen sulfide (H2S) were measured in an effort to identify potential mechanistic elements underlying adaptation of arterial stiffness. AIx was significantly lower in fHP women on LS compared with HS while no difference in AIx was apparent in fPE women. PWV remained unchanged upon different sodium loads in either group. Comparable sodium-dependent changes in RAAS, ECV, and NO/H2S were observed in fHP and fPE women. fPE women have an impaired ability to adapt their arterial stiffness in response to changes in sodium intake, independently of blood pressure, RAAS, ECV, and NO/H2S status. The pathways involved in impaired adaptation of arterial stiffness, and its possible contribution to the increased long-term risk for cardiovascular diseases in fPE women, remain to be investigated. Copyright © 2016 the American Physiological Society.

  11. DJ-1 KNOCK-DOWN IMPAIRS ASTROCYTE MITOCHONDRIAL FUNCTION

    PubMed Central

    LARSEN, N. J.; AMBROSI, G.; MULLETT, S. J.; BERMAN, S. B.; HINKLE, D. A.

    2012-01-01

    Mitochondrial dysfunction has long been implicated in the pathogenesis of Parkinson’s disease (PD). PD brain tissues show evidence for mitochondrial respiratory chain Complex I deficiency. Pharmacological inhibitors of Complex I, such as rotenone, cause experimental parkinsonism. The cytoprotective protein DJ-1, whose deletion is sufficient to cause genetic PD, is also known to have mitochondria-stabilizing properties. We have previously shown that DJ-1 is over-expressed in PD astrocytes, and that DJ-1 deficiency impairs the capacity of astrocytes to protect co-cultured neurons against rotenone. Since DJ-1 modulated, astrocyte-mediated neuroprotection against rotenone may depend upon proper astrocytic mitochondrial functioning, we hypothesized that DJ-1 deficiency would impair astrocyte mitochondrial motility, fission/fusion dynamics, membrane potential maintenance, and respiration, both at baseline and as an enhancement of rotenone-induced mitochondrial dysfunction. In astrocyte-enriched cultures, we observed that DJ-1 knock-down reduced mitochondrial motility primarily in the cellular processes of both untreated and rotenone treated cells. In these same cultures, DJ-1 knock-down did not appreciably affect mitochondrial fission, fusion, or respiration, but did enhance rotenone-induced reductions in the mitochondrial membrane potential. In neuron–astrocyte co-cultures, astrocytic DJ-1 knock-down reduced astrocyte process mitochondrial motility in untreated cells, but this effect was not maintained in the presence of rotenone. In the same co-cultures, astrocytic DJ-1 knock-down significantly reduced mitochondrial fusion in the astrocyte cell bodies, but not the processes, under the same conditions of rotenone treatment in which DJ-1 deficiency is known to impair astrocyte-mediated neuroprotection. Our studies therefore demonstrated the following new findings: (i) DJ-1 deficiency can impair astrocyte mitochondrial physiology at multiple levels, (ii) astrocyte mitochondrial dynamics vary with sub-cellular region, and (iii) the physical presence of neurons can affect astrocyte mitochondrial behavior. PMID:21907265

  12. Impaired Voluntary Movement Control and Its Rehabilitation in Cerebral Palsy.

    PubMed

    Gordon, Andrew M

    2016-01-01

    Cerebral palsy is caused by early damage to the developing brain, as the most common pediatric neurological disorder. Hemiplegia (unilateral spastic cerebral palsy) is the most common subtype, and the resulting impairments, lateralized to one body side, especially affect the upper extremity, limiting daily function. This chapter first describes the pathophysiology and mechanisms underlying impaired upper extremity control of cerebral palsy. It will be shown that the severity of impaired hand function closely relates to the integrity of the corticospinal tract innervating the affected hand. It will also shown that the developing corticospinal tract can reorganize its connectivity depending on the timing and location of CNS injury, which also has implications for the severity of hand impairments and rehabilitation. The mechanisms underlying impaired motor function will be highlighted, including deficits in movement execution and planning and sensorimotor integration. It will be shown that despite having unimanual hand impairments, bimanual movement control deficits and mirror movements also impact function. Evidence for motor learning-based therapies including Constraint-Induced Movement Therapy and Bimanual Training, and the possible pathophysiological predictors of treatment outcome and plasticity will be described. Finally, future directions for rehabilitations will be presented.

  13. Modulation of opiate-related signaling molecules in morphine-dependent conditioned behavior: conditioned place preference to morphine induces CREB phosphorylation.

    PubMed

    Morón, José A; Gullapalli, Srinivas; Taylor, Chirisse; Gupta, Achla; Gomes, Ivone; Devi, Lakshmi A

    2010-03-01

    Opiate addiction is a chronic, relapsing behavioral disorder where learned associations that develop between the abused opiate and the environment in which it is consumed are brought about through Pavlovian (classical) conditioning processes. However, the signaling mechanisms/pathways regulating the mechanisms that underlie the responses to opiate-associated cues or the development of sensitization as a consequence of repeated context-independent administration of opiates are unknown. In this study we examined the phosphorylation levels of various classic signaling molecules in brain regions implicated in addictive behaviors after acute and repeated morphine administration. An unbiased place conditioning protocol was used to examine changes in phosphorylation that are associated with (1) the expression of the rewarding effects of morphine and (2) the sensitization that develops to this effect. We also examined the effects of a delta-receptor antagonist on morphine-induced conditioned behavior and on the phosphorylation of classic signaling molecules in view of data showing that blockade of delta-opioid receptor (deltaOR) prevents the development of sensitization to the rewarding effects of morphine. We find that CREB phosphorylation is specifically induced upon the expression of a sensitized response to morphine-induced conditioned behavior in brain areas related to memory consolidation, such as the hippocampus and cortex. A similar effect is also observed, albeit to a lesser extent, in the case of the GluR1 subunit of AMPA glutamate receptor. These increases in the phosphorylation levels of CREB and pGluR1 are significantly blocked by pretreatment with a deltaOR antagonist. These results indicate a critical role for phospho-CREB, AMPA, and deltaOR activities in mediating the expression of a sensitized response to morphine-dependent conditioned behavior.

  14. Age-dependent impairment of auditory processing under spatially focused and divided attention: an electrophysiological study.

    PubMed

    Wild-Wall, Nele; Falkenstein, Michael

    2010-01-01

    By using event-related potentials (ERPs) the present study examines if age-related differences in preparation and processing especially emerge during divided attention. Binaurally presented auditory cues called for focused (valid and invalid) or divided attention to one or both ears. Responses were required to subsequent monaurally presented valid targets (vowels), but had to be suppressed to non-target vowels or invalidly cued vowels. Middle-aged participants were more impaired under divided attention than young ones, likely due to an age-related decline in preparatory attention following cues as was reflected in a decreased CNV. Under divided attention, target processing was increased in the middle-aged, likely reflecting compensatory effort to fulfill task requirements in the difficult condition. Additionally, middle-aged participants processed invalidly cued stimuli more intensely as was reflected by stimulus ERPs. The results suggest an age-related impairment in attentional preparation after auditory cues especially under divided attention and latent difficulties to suppress irrelevant information.

  15. Chronic stimulation of farnesoid X receptor impairs nitric oxide sensitivity of vascular smooth muscle.

    PubMed

    Kida, Taiki; Murata, Takahisa; Hori, Masatoshi; Ozaki, Hiroshi

    2009-01-01

    Farnesoid X receptor (FXR), a member of the nuclear receptor superfamily that is highly expressed in enterohepatic tissue, is implicated in bile acid, lipid, and glucose metabolisms. Although recent studies showed that FXR is also expressed in vascular endothelial cells and smooth muscle cells, its physiological and/or pathological roles in vasculature tissue remain unknown. The aim of this study is to examine the chronic effect of synthetic FXR agonist GW4064 on vascular contraction and endothelium-dependent relaxation using tissue culture procedure. In cultured rabbit mesenteric arteries, the treatment with 0.1-10 microM GW4064 for 7 days did not influence vascular contractility induced by high K(+) (15-65 mM), norepinephrine (0.1-100 microM), and endothelin-1 (0.1-100 nM). However, the chronic treatment with GW4064 (1-10 microM for 7 days) dose dependently impaired endothelium-dependent relaxation induced by substance P (0.1-30 nM). In hematoxylin-eosin cross sectioning and en face immunostaining, GW4064 had no effects on the morphology of endothelial and smooth muscle cells. In endothelium-denuded arteries treated with GW4064 (1-10 microM) for 7 days, 3 nM-100 microM sodium nitroprusside-induced vasorelaxation, but not membrane-permeable cGMP analog 8-bromoguanosine-cGMP (8-Br-cGMP; 1-100 microM)-induced vasorelaxation, was significantly impaired. In these GW4064-treated arteries, 1 muM sodium nitroprusside-induced intracellular cGMP elevations were impaired. In RT-PCR, any changes were detected in mRNA expression level of alpha(1)- and beta(1)-subunit of soluble guanylyl cyclase. These results suggest that chronic stimulation of FXR impairs endothelium-dependent relaxation, which is due to decreased sensitivity of smooth muscle cells to nitric oxide.

  16. Impairment in long-term memory formation and learning-dependent synaptic plasticity in mice lacking glycogen synthase in the brain

    PubMed Central

    Duran, Jordi; Saez, Isabel; Gruart, Agnès; Guinovart, Joan J; Delgado-García, José M

    2013-01-01

    Glycogen is the only carbohydrate reserve of the brain, but its overall contribution to brain functions remains unclear. Although it has traditionally been considered as an emergency energetic reservoir, increasing evidence points to a role of glycogen in the normal activity of the brain. To address this long-standing question, we generated a brain-specific Glycogen Synthase knockout (GYS1Nestin-KO) mouse and studied the functional consequences of the lack of glycogen in the brain under alert behaving conditions. These animals showed a significant deficiency in the acquisition of an associative learning task and in the concomitant activity-dependent changes in hippocampal synaptic strength. Long-term potentiation (LTP) evoked in the hippocampal CA3-CA1 synapse was also decreased in behaving GYS1Nestin-KO mice. These results unequivocally show a key role of brain glycogen in the proper acquisition of new motor and cognitive abilities and in the underlying changes in synaptic strength. PMID:23281428

  17. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    PubMed Central

    Yang, Siming; Gu, Changping; Mandeville, Emiri T.; Dong, Yuanlin; Esposito, Elga; Zhang, Yiying; Yang, Guang; Shen, Yuan; Fu, Xiaobing; Lo, Eng H.; Xie, Zhongcong

    2017-01-01

    Blood–brain barrier (BBB) dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy) under 1.4% isoflurane anesthesia (anesthesia/surgery) for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL)-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification), and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium. PMID:28848542

  18. Thermoregulation in rats: Effects of varying duration of hypergravic fields

    NASA Technical Reports Server (NTRS)

    Horowitz, J. M.; Horwitz, B. A.

    1980-01-01

    The effects of hypergravitational fields on the thermoregulatory system of the rat are examined. The question underlying the investigation was whether the response of the rat to the one hour cold exposure depends only upon the amplitude of the hypergravic field during the period of cold exposure or whether the response is also dependent on the amplitude and duration of the hypergravic field prior to cold exposure. One hour of cold exposure applied over the last hour of either a 1, 4, 7, 13, 19, 25, or 37 hr period of 3G evoked a decrease in core temperature (T sub c) of about 3 C. However, when rats were subjected concurrently to cold and acceleration following 8 days at 3G, they exhibited a smaller fall in T sub c, suggesting partial recovery of the acceleration induced impairment of temperature regulation. In another series of experiments, the gravitational field profile was changed in amplitude in 3 different ways. Despite the different gravitational field profiles used prior to cold, the magnitude of the fall in T sub c over the 1 hr period of cold exposure was the same in all cases. These results suggest that the thermoregulatory impairment has a rapid onset, is a manifestation of an ongoing effect of hypergravity, and is not dependent upon the prior G profile.

  19. Elevation of endogenous anandamide impairs LTP, learning, and memory through CB1 receptor signaling in mice.

    PubMed

    Basavarajappa, Balapal S; Nagre, Nagaraja N; Xie, Shan; Subbanna, Shivakumar

    2014-07-01

    In rodents, many exogenous and endogenous cannabinoids, such as anandamide (AEA) and 2-arachidonyl glycerol (2-AG), have been shown to play an important role in certain hippocampal memory processes. However, the mechanisms by which endogenous AEA regulate this processes are not well understood. Here the effects of AEA on long-term potentiation (LTP), hippocampal-dependent learning and memory tasks, pERK1/2, pCaMKIV, and pCREB signaling events in both cannabinoid receptor type 1 (CB1R) wild-type (WT) and knockout (KO) mice were assessed following administration of URB597, an inhibitor of the fatty acid amide hydrolase (FAAH). Acute administration of URB597 enhanced AEA levels without affecting the levels of 2-AG or CB1R in the hippocampus and neocortex as compared to vehicle. In hippocampal slices, URB597 impaired LTP in CB1R WT but not in KO littermates. URB597 impaired object recognition, spontaneous alternation and spatial memory in the Y-maze test in CB1R WT mice but not in KO mice. Furthermore, URB597 enhanced ERK phosphorylation in WT without affecting total ERK levels in WT or KO mice. URB597 impaired CaMKIV and CREB phosphorylation in WT but not in KO mice. CB1R KO mice have a lower pCaMKIV/CaMKIV ratio and higher pCREB/CREB ratio as compared to WT littermates. Our results indicate that pharmacologically elevated AEA impair LTP, learning and memory and inhibit CaMKIV and CREB phosphorylation, via the activation of CB1Rs. Collectively, these findings also suggest that pharmacological elevation of AEA beyond normal concentrations is also detrimental for the underlying physiological responses. © 2014 Wiley Periodicals, Inc.

  20. Delay-dependent working memory impairment in young-adult and aged 5-HT1BKO mice as assessed in a radial-arm water maze.

    PubMed

    Wolff, Mathieu; Benhassine, Narimane; Costet, Pierre; Hen, Rene; Segu, Louis; Buhot, Marie-Christine

    2003-01-01

    Serotonin (5-HT) plays a modulatory role in mnemonic functions, especially by interacting with the cholinergic system. The 5-HT1B receptor is a key target of this interaction. The 5-HT1B receptor knockout mice were found previously to exhibit a facilitation in hippocampal-dependent spatial reference memory learning. In the present study, we submitted mice to a delayed spatial working memory task, allowing the introduction of various delays between an exposure trial and a test trial. The 5-HT1BKO and wild-type mice learned the task in a radial-arm water maze (returning to the most recent presented arm containing the escape platform), and exhibited a high level of performance at delays of 0 and 5 min. However, at the delay of 60 min, only 5-HT1BKO mice exhibited an impairment. At a delay of 90 min, all mice were impaired. Treatment by scopolamine (0.8 mg/kg) induced the same pattern of performance in wild type as did the mutation for short (5 min, no impairment) and long (60 min, impairment) delays. The 22-month-old wild-type and knockout mice exhibited an impairment at short delays (5 and 15 min). The effect of the mutation affected both young-adult and aged mice at delays of 15, 30, and 60 min. Neurobiological data show that stimulation of the 5-HT1B receptor inhibits the release of acetylcholine in the hippocampus, but stimulates this in the frontal cortex. This dual function might, at least in part, explain the opposite effect of the mutation on reference memory (facilitation) and delay-dependent working memory (impairment). These results support the idea that cholinergic-serotonergic interactions play an important role in memory processes.

  1. Movement-Dependent Stroke Recovery: A Systematic Review and Meta-Analysis of TMS and fMRI Evidence

    ERIC Educational Resources Information Center

    Richards, Lorie G.; Stewart, Kim C.; Woodbury, Michelle L.; Senesac, Claudia; Cauraugh, James H.

    2008-01-01

    Evidence indicates that experience-dependent cortical plasticity underlies post-stroke motor recovery of the impaired upper extremity. Motor skill learning in neurologically intact individuals is thought to involve the primary motor cortex, and the majority of studies in the animal literature have studied changes in the primary sensorimotor cortex…

  2. Urban air pollutants reduce synaptic function of CA1 neurons via an NMDA/NO• pathway in vitro

    PubMed Central

    Davis, David A.; Akopian, Garnik; Walsh, John P.; Sioutas, Constantinos; Morgan, Todd E.; Finch, Caleb E.

    2013-01-01

    Airborne particulate matter (PM) from urban vehicular aerosols altered glutamate receptor functions and induced glial inflammatory responses in rodent models after chronic exposure. Potential neurotoxic mechanisms were analyzed in vitro. In hippocampal slices, 2 h exposure to aqueous nanosized PM (nPM) selectively altered postsynaptic proteins in CA1 neurons: increased GluA1, GluN2A, and GluN2B, but not GluA2, GluN1 or mGlur5; increased PSD95 and spinophilin, but not synaptophysin, while dentate gyrus (DG) neurons were unresponsive. In hippocampal slices and neurons, MitoSOX red fluorescence was increased by nPM, implying free radical production. Specifically, NO• production by slices was increased within 15 min of exposure to nPM with dose dependence, 1–10 µg/ml. Correspondingly, CA1 neurons exhibited increased nitrosylation of the GluN2A receptor and dephosphorylation of GluN2B (S1303) and of GluA1 (S831 & S845). Again, DG neurons were unresponsive to nPM. The induction of NO• and nitrosylation were inhibited by AP5, an NMDA receptor antagonist, which also protects neurite outgrowth in vitro from inhibition by nPM. Membrane injury (EthidiumD-1 uptake) showed parallel specificity. Finally, nPM decreased evoked excitatory postsynaptic currents (EPSCs) of CA1 neurons. These findings further document the selective impact of nPM on glutamatergic functions and identify novel responses of NMDA receptor-stimulated NO• production and nitrosylation reactions during nPM-mediated neurotoxicity. PMID:23927064

  3. Genetic Disruption of the Core Circadian Clock Impairs Hippocampus-Dependent Memory

    ERIC Educational Resources Information Center

    Wardlaw, Sarah M.; Phan, Trongha X.; Saraf, Amit; Chen, Xuanmao; Storm, Daniel R.

    2014-01-01

    Perturbing the circadian system by electrolytically lesioning the suprachiasmatic nucleus (SCN) or varying the environmental light:dark schedule impairs memory, suggesting that memory depends on the circadian system. We used a genetic approach to evaluate the role of the molecular clock in memory. Bmal1[superscript -/-] mice, which are arrhythmic…

  4. Angelica Dahurica ethanolic extract improves impaired wound healing by activating angiogenesis in diabetes.

    PubMed

    Zhang, Xiao-Na; Ma, Ze-Jun; Wang, Ying; Sun, Bei; Guo, Xin; Pan, Cong-Qing; Chen, Li-Ming

    2017-01-01

    Abnormal angiogenesis plays an important role in impaired wound healing and development of chronic wounds in diabetes mellitus. Angelica dahurica radix is a common traditional Chinese medicine with wide spectrum medicinal effects. In this study, we analyzed the potential roles of Angelica dahurica ethanolic extract (ADEE) in correcting impaired angiogenesis and delayed wound healing in diabetes by using streptozotocin-induced diabetic rats. ADEE treatment accelerated diabetic wound healing through inducing angiogenesis and granulation tissue formation. The angiogenic property of ADEE was subsequently verified ex vivo using aortic ring assays. Furthermore, we investigated the in vitro angiogenic activity of ADEE and its underlying mechanisms using human umbilical vein endothelial cells. ADEE treatment induced HUVECs proliferation, migration, and tube formation, which are typical phenomena of angiogenesis, in dose-dependent manners. These effects were associated with activation of angiogenic signal modulators, including extracellular signal-regulated kinase 1/2 (ERK1/2), Akt, endothelial nitric oxide synthase (eNOS) as well as increased NO production, and independent of affecting VEGF expression. ADEE-induced angiogenic events were inhibited by the MEK inhibitor PD98059, the PI3K inhibitor Wortmannin, and the eNOS inhibitor L-NAME. Our findings highlight an angiogenic role of ADEE and its ability to protect against impaired wound healing, which may be developed as a promising therapy for impaired angiogenesis and delayed wound healing in diabetes.

  5. Distribution of protein kinase C isoforms in the cat retina.

    PubMed

    Fyk-Kolodziej, Bozena; Cai, Wenhui; Pourcho, Roberta G

    2002-01-01

    Immunocytochemical localization was carried out for five isoforms of protein kinase C (PKC) in the cat retina. In common with other mammalian species, PKCalpha was found in rod bipolar cells. Staining was also seen in a small population of cone bipolar cells with axon terminals ramifying near the middle of the inner plexiform layer (IPL). PKCbetaI was localized to rod bipolar cells, one class of cone bipolar cell, and numerous amacrine and displaced amacrine cells. Staining for PKCbetaI was seen in three types of cone bipolar cells as well as in amacrine and ganglion cells. Immunoreactivity for both PKCepsilon and PKCzeta was found in rod bipolar cells; PKCepsilon was also seen in a population of cone bipolar cells and a few amacrine and ganglion cells whereas PKCzeta was found in all ganglion cells. Double-label immunofluorescence studies showed that dendrites of the two PKCbetaII-positive OFF-cone bipolar cells exhibit immmunoreactivity for the kainate-selective glutamate receptor GluR5. The third PKCbetaII cone bipolar is an ON-type cell and did not stain for GluR5. The retinal distribution of these isoforms of PKC is consistent with a role in modulation of various aspects of neurotransmission including synaptic vesicle release and regulation of receptor molecules.

  6. Transplacental Exposure to AZT Induces Adverse Neurochemical and Behavioral Effects in a Mouse Model: Protection by L-Acetylcarnitine

    PubMed Central

    Venerosi Pesciolini, Aldina; Tramutola, Antonella; Ajmone-Cat, Maria Antonietta; Cinque, Carlo; Alemà, Giovanni Sebastiano; Giovine, Angela; Peluso, Gianfranco; Minghetti, Luisa; Nicolai, Raffaella; Calamandrei, Gemma; Casolini, Paola

    2013-01-01

    Maternal-fetal HIV-1 transmission can be prevented by administration of AZT, alone or in combination with other antiretroviral drugs to pregnant HIV-1-infected women and their newborns. In spite of the benefits deriving from this life-saving prophylactic therapy, there is still considerable uncertainty on the potential long-term adverse effects of antiretroviral drugs on exposed children. Clinical and experimental studies have consistently shown the occurrence of mitochondrial dysfunction and increased oxidative stress following prenatal treatment with antiretroviral drugs, and clinical evidence suggests that the developing brain is one of the targets of the toxic action of these compounds possibly resulting in behavioral problems. We intended to verify the effects on brain and behavior of mice exposed during gestation to AZT, the backbone of antiretroviral therapy during human pregnancy. We hypothesized that glutamate, a neurotransmitter involved in excitotoxicity and behavioral plasticity, could be one of the major actors in AZT-induced neurochemical and behavioral alterations. We also assessed the antioxidant and neuroprotective effect of L-acetylcarnitine, a compound that improves mitochondrial function and is successfully used to treat antiretroviral-induced polyneuropathy in HIV-1 patients. We found that transplacental exposure to AZT given per os to pregnant mice from day 10 of pregnancy to delivery impaired in the adult offspring spatial learning and memory, enhanced corticosterone release in response to acute stress, increased brain oxidative stress also at birth and markedly reduced expression of mGluR1 and mGluR5 subtypes and GluR1 subunit of AMPA receptors in the hippocampus. Notably, administration during the entire pregnancy of L-acetylcarnitine was effective in preventing/ameliorating the neurochemical, neuroendocrine and behavioral adverse effects induced by AZT in the offspring. The present preclinical findings provide a mechanistic hypothesis for the neurobehavioral effects of AZT and strongly suggest that preventive administration of L-acetylcarnitine might be effective in reducing the neurological side-effects of antiretroviral therapy in fetus/newborn. PMID:23409035

  7. Rescuing prefrontal cAMP-CREB pathway reverses working memory deficits during withdrawal from prolonged alcohol exposure.

    PubMed

    Dominguez, G; Dagnas, M; Decorte, L; Vandesquille, M; Belzung, C; Béracochéa, D; Mons, N

    2016-03-01

    Both human and animal studies indicate that alcohol withdrawal following chronic alcohol consumption (CAC) impairs many of the cognitive functions which rely on the prefrontal cortex (PFC). A candidate signaling cascade contributing to memory deficits during alcohol withdrawal is the protein kinase A (PKA)/cAMP-responsive element binding (CREB) cascade, although the role of PKA/CREB cascade in behavioral and molecular changes during sustained withdrawal period remains largely unknown. We demonstrated that 1 week (1W) or 6 weeks (6W) withdrawal after 6-month CAC impairs working memory (WM) in a T-maze spontaneous alternation task and reduces phosphorylated CREB (pCREB) in the PFC but not the dorsal CA1 region (dCA1) of the hippocampus compared with CAC and water conditions. In contrast, both CAC-unimpaired and withdrawn-impaired mice exhibited decreased pCREB in dCA1 as well as reduced histone H4 acetylation in PFC and dCA1, compared with water controls. Next, we showed that enhancing CREB activity through rolipram administration prior to testing improved WM performance in withdrawn mice but impaired WM function in water mice. In addition, WM improvement correlates positively with increased pCREB level selectively in the PFC of withdrawn mice. Results further indicate that direct infusion of the PKA activator (Sp-cAMPS) into the PFC significantly improves or impairs, respectively, WM performance in withdrawn and water animals. In contrast, Sp-cAMPS had no effect on WM when infused into the dCA1. Collectively, these results provide strong support that dysregulation of PKA/CREB-dependent processes in prefrontal neurons is a critical molecular signature underlying cognitive decline during alcohol withdrawal.

  8. Traumatic Brain Injury Causes Endothelial Dysfunction in the Systemic Microcirculation through Arginase-1-Dependent Uncoupling of Endothelial Nitric Oxide Synthase.

    PubMed

    Villalba, Nuria; Sackheim, Adrian M; Nunez, Ivette A; Hill-Eubanks, David C; Nelson, Mark T; Wellman, George C; Freeman, Kalev

    2017-01-01

    Endothelial dysfunction is a hallmark of many chronic diseases, including diabetes and long-term hypertension. We show that acute traumatic brain injury (TBI) leads to endothelial dysfunction in rat mesenteric arteries. Endothelial-dependent dilation was greatly diminished 24 h after TBI because of impaired nitric oxide (NO) production. The activity of arginase, which competes with endothelial NO synthase (eNOS) for the common substrate l-arginine, were also significantly increased in arteries, suggesting that arginase-mediated depletion of l-arginine underlies diminished NO production. Consistent with this, substrate restoration by exogenous application of l-arginine or inhibition of arginase recovered endothelial function. Moreover, evidence for increased reactive oxygen species production, a consequence of l-arginine starvation-dependent eNOS uncoupling, was detected in endothelium and plasma. Collectively, our findings demonstrate endothelial dysfunction in a remote vascular bed after TBI, manifesting as impaired endothelial-dependent vasodilation, with increased arginase activity, decreased generation of NO, and increased O 2 - production. We conclude that blood vessels have a "molecular memory" of neurotrauma, 24 h after injury, because of functional changes in vascular endothelial cells; these effects are pertinent to understanding the systemic inflammatory response that occurs after TBI even in the absence of polytrauma.

  9. The extracellular adherence protein (Eap) of Staphylococcus aureus inhibits wound healing by interfering with host defense and repair mechanisms.

    PubMed

    Athanasopoulos, Athanasios N; Economopoulou, Matina; Orlova, Valeria V; Sobke, Astrid; Schneider, Darius; Weber, Holger; Augustin, Hellmut G; Eming, Sabine A; Schubert, Uwe; Linn, Thomas; Nawroth, Peter P; Hussain, Muzaffar; Hammes, Hans-Peter; Herrmann, Mathias; Preissner, Klaus T; Chavakis, Triantafyllos

    2006-04-01

    Staphylococcus aureus is a major human pathogen interfering with host-cell functions. Impaired wound healing is often observed in S aureus-infected wounds, yet, the underlying mechanisms are poorly defined. Here, we identify the extracellular adherence protein (Eap) of S aureus to be responsible for impaired wound healing. In a mouse wound-healing model wound closure was inhibited in the presence of wild-type S aureus and this effect was reversible when the wounds were incubated with an isogenic Eap-deficient strain. Isolated Eap also delayed wound closure. In the presence of Eap, recruitment of inflammatory cells to the wound site as well as neovascularization of the wound were prevented. In vitro, Eap significantly reduced intercellular adhesion molecule 1 (ICAM-1)-dependent leukocyte-endothelial interactions and diminished the consequent activation of the proinflammatory transcription factor nuclear factor kappaB (NFkappaB) in leukocytes associated with a decrease in expression of tissue factor. Moreover, Eap blocked alphav-integrin-mediated endothelial-cell migration and capillary tube formation, and neovascularization in matrigels in vivo. Collectively, the potent anti-inflammatory and antiangiogenic properties of Eap provide an underlying mechanism that may explain the impaired wound healing in S aureus-infected wounds. Eap may also serve as a lead compound for new anti-inflammatory and antiangiogenic therapies in several pathologies.

  10. Elongator-dependent modification of cytoplasmic tRNALysUUU is required for mitochondrial function under stress conditions

    PubMed Central

    Tigano, Marco; Ruotolo, Roberta; Dallabona, Cristina; Fontanesi, Flavia; Barrientos, Antoni; Donnini, Claudia; Ottonello, Simone

    2015-01-01

    To gain a wider view of the pathways that regulate mitochondrial function, we combined the effect of heat stress on respiratory capacity with the discovery potential of a genome-wide screen in Saccharomyces cerevisiae. We identified 105 new genes whose deletion impairs respiratory growth at 37°C by interfering with processes such as transcriptional regulation, ubiquitination and cytosolic tRNA wobble uridine modification via 5-methoxycarbonylmethyl-2-thiouridine formation. The latter process, specifically required for efficient decoding of AA-ending codons under stress conditions, was covered by multiple genes belonging to the Elongator (e.g. ELP3) and urmylation (e.g., NCS6) pathways. ELP3 or NCS6 deletants had impaired mitochondrial protein synthesis. Their respiratory deficiency was selectively rescued by overexpression of tRNALysUUU as well by overexpression of genes (BCK1 and HFM1) with a strong bias for the AAA codon read by this tRNA. These data extend the mitochondrial regulome, demonstrate that heat stress can impair respiration by disturbing cytoplasmic translation of proteins critically involved in mitochondrial function and document, for the first time, the involvement in such process of the Elongator and urmylation pathways. Given the conservation of these pathways, the present findings may pave the way to a better understanding of the human mitochondrial regulome in health and disease. PMID:26240381

  11. Impaired vascular function after exposure to diesel exhaust generated at urban transient running conditions

    PubMed Central

    2010-01-01

    Background Traffic emissions including diesel engine exhaust are associated with increased respiratory and cardiovascular morbidity and mortality. Controlled human exposure studies have demonstrated impaired vascular function after inhalation of exhaust generated by a diesel engine under idling conditions. Objectives To assess the vascular and fibrinolytic effects of exposure to diesel exhaust generated during urban-cycle running conditions that mimic ambient 'real-world' exposures. Methods In a randomised double-blind crossover study, eighteen healthy male volunteers were exposed to diesel exhaust (approximately 250 μg/m3) or filtered air for one hour during intermittent exercise. Diesel exhaust was generated during the urban part of the standardized European Transient Cycle. Six hours post-exposure, vascular vasomotor and fibrinolytic function was assessed during venous occlusion plethysmography with intra-arterial agonist infusions. Measurements and Main Results Forearm blood flow increased in a dose-dependent manner with both endothelial-dependent (acetylcholine and bradykinin) and endothelial-independent (sodium nitroprusside and verapamil) vasodilators. Diesel exhaust exposure attenuated the vasodilatation to acetylcholine (P < 0.001), bradykinin (P < 0.05), sodium nitroprusside (P < 0.05) and verapamil (P < 0.001). In addition, the net release of tissue plasminogen activator during bradykinin infusion was impaired following diesel exhaust exposure (P < 0.05). Conclusion Exposure to diesel exhaust generated under transient running conditions, as a relevant model of urban air pollution, impairs vasomotor function and endogenous fibrinolysis in a similar way as exposure to diesel exhaust generated at idling. This indicates that adverse vascular effects of diesel exhaust inhalation occur over different running conditions with varying exhaust composition and concentrations as well as physicochemical particle properties. Importantly, exposure to diesel exhaust under ETC conditions was also associated with a novel finding of impaired of calcium channel-dependent vasomotor function. This implies that certain cardiovascular endpoints seem to be related to general diesel exhaust properties, whereas the novel calcium flux-related effect may be associated with exhaust properties more specific for the ETC condition, for example a higher content of diesel soot particles along with their adsorbed organic compounds. PMID:20653945

  12. Glucocorticoids mediate stress-induced impairment of retrieval of stimulus-response memory.

    PubMed

    Atsak, Piray; Guenzel, Friederike M; Kantar-Gok, Deniz; Zalachoras, Ioannis; Yargicoglu, Piraye; Meijer, Onno C; Quirarte, Gina L; Wolf, Oliver T; Schwabe, Lars; Roozendaal, Benno

    2016-05-01

    Acute stress and elevated glucocorticoid hormone levels are well known to impair the retrieval of hippocampus-dependent 'declarative' memory. Recent findings suggest that stress might also impair the retrieval of non-hippocampal memories. In particular, stress shortly before retention testing was shown to impair the retrieval of striatal stimulus-response associations in humans. However, the mechanism underlying this stress-induced retrieval impairment of non-hippocampal stimulus-response memory remains elusive. In the present study, we investigated whether an acute elevation in glucocorticoid levels mediates the impairing effects of stress on retrieval of stimulus-response memory. Male Sprague-Dawley rats were trained on a stimulus-response task in an eight-arm radial maze until they learned to associate a stimulus, i.e., cue, with a food reward in one of the arms. Twenty-four hours after successful acquisition, they received a systemic injection of vehicle, corticosterone (1mg/kg), the corticosterone-synthesis inhibitor metyrapone (35mg/kg) or were left untreated 1h before retention testing. We found that the corticosterone injection impaired the retrieval of stimulus-response memory. We further found that the systemic injection procedure per se was stressful as the vehicle administration also increased plasma corticosterone levels and impaired the retrieval of stimulus-response memory. However, memory retrieval was not impaired when rats were tested 2min after the systemic vehicle injection, before any stress-induced elevation in corticosterone levels had occurred. Moreover, metyrapone treatment blocked the effect of injection stress on both plasma corticosterone levels and memory retrieval impairment, indicating that the endogenous corticosterone response mediates the stress-induced memory retrieval impairment. None of the treatments affected rats' locomotor activity or motivation to search for the food reward within the maze. These findings show that stress may affect memory processes beyond the hippocampus and that these stress effects are due to the action of glucocorticoids. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain.

    PubMed

    Speranskiy, Kirill; Kurnikova, Maria

    2005-08-30

    Ionotropic glutamate receptors (GluRs) are ligand-gated membrane channel proteins found in the central neural system that mediate a fast excitatory response of neurons. In this paper, we report theoretical analysis of the ligand-protein interactions in the binding pocket of the S1S2 (ligand binding) domain of the GluR2 receptor in the closed conformation. By utilizing several theoretical methods ranging from continuum electrostatics to all-atom molecular dynamics simulations and quantum chemical calculations, we were able to characterize in detail glutamate agonist binding to the wild-type and E705D mutant proteins. A theoretical model of the protein-ligand interactions is validated via direct comparison of theoretical and Fourier transform infrared spectroscopy (FTIR) measured frequency shifts of the ligand's carboxylate group vibrations [Jayaraman et al. (2000) Biochemistry 39, 8693-8697; Cheng et al. (2002) Biochemistry 41, 1602-1608]. A detailed picture of the interactions in the binding site is inferred by analyzing contributions to vibrational frequencies produced by protein residues forming the ligand-binding pocket. The role of mobility and hydrogen-bonding network of water in the ligand-binding pocket and the contribution of protein residues exposed in the binding pocket to the binding and selectivity of the ligand are discussed. It is demonstrated that the molecular surface of the protein in the ligand-free state has mainly positive electrostatic potential attractive to the negatively charged ligand, and the potential produced by the protein in the ligand-binding pocket in the closed state is complementary to the distribution of the electrostatic potential produced by the ligand itself. Such charge complementarity ensures specificity to the unique charge distribution of the ligand.

  14. Episodic Memory and Episodic Future Thinking Impairments in High-Functioning Autism Spectrum Disorder: An Underlying Difficulty With Scene Construction or Self-Projection?

    PubMed Central

    2013-01-01

    Objective: There appears to be a common network of brain regions that underlie the ability to recall past personal experiences (episodic memory) and the ability to imagine possible future personal experiences (episodic future thinking). At the cognitive level, these abilities are thought to rely on “scene construction” (the ability to bind together multimodal elements of a scene in mind—dependent on hippocampal functioning) and temporal “self-projection” (the ability to mentally project oneself through time—dependent on prefrontal cortex functioning). Although autism spectrum disorder (ASD) is characterized by diminished episodic memory, it is unclear whether episodic future thinking is correspondingly impaired. Moreover, the underlying basis of such impairments (difficulties with scene construction, self-projection, or both) is yet to be established. The current study therefore aimed to elucidate these issues. Method: Twenty-seven intellectually high-functioning adults with ASD and 29 age- and IQ-matched neurotypical comparison adults were asked to describe (a) imagined atemporal, non-self-relevant fictitious scenes (assessing scene construction), (b) imagined plausible self-relevant future episodes (assessing episodic future thinking), and (c) recalled personally experienced past episodes (assessing episodic memory). Tests of narrative ability and theory of mind were also completed. Results: Performances of participants with ASD were significantly and equally diminished in each condition and, crucially, this diminution was independent of general narrative ability. Conclusions: Given that participants with ASD were impaired in the fictitious scene condition, which does not involve self-projection, we suggest the underlying difficulty with episodic memory/future thinking is one of scene construction. PMID:24015827

  15. Episodic memory and episodic future thinking impairments in high-functioning autism spectrum disorder: an underlying difficulty with scene construction or self-projection?

    PubMed

    Lind, Sophie E; Williams, David M; Bowler, Dermot M; Peel, Anna

    2014-01-01

    There appears to be a common network of brain regions that underlie the ability to recall past personal experiences (episodic memory) and the ability to imagine possible future personal experiences (episodic future thinking). At the cognitive level, these abilities are thought to rely on "scene construction" (the ability to bind together multimodal elements of a scene in mind--dependent on hippocampal functioning) and temporal "self-projection" (the ability to mentally project oneself through time--dependent on prefrontal cortex functioning). Although autism spectrum disorder (ASD) is characterized by diminished episodic memory, it is unclear whether episodic future thinking is correspondingly impaired. Moreover, the underlying basis of such impairments (difficulties with scene construction, self-projection, or both) is yet to be established. The current study therefore aimed to elucidate these issues. Twenty-seven intellectually high-functioning adults with ASD and 29 age- and IQ-matched neurotypical comparison adults were asked to describe (a) imagined atemporal, non-self-relevant fictitious scenes (assessing scene construction), (b) imagined plausible self-relevant future episodes (assessing episodic future thinking), and (c) recalled personally experienced past episodes (assessing episodic memory). Tests of narrative ability and theory of mind were also completed. Performances of participants with ASD were significantly and equally diminished in each condition and, crucially, this diminution was independent of general narrative ability. Given that participants with ASD were impaired in the fictitious scene condition, which does not involve self-projection, we suggest the underlying difficulty with episodic memory/future thinking is one of scene construction.

  16. A non-redundant function of cyclin E1 in hematopoietic stem cells.

    PubMed

    Campaner, Stefano; Viale, Andrea; De Fazio, Serena; Doni, Mirko; De Franco, Francesca; D'Artista, Luana; Sardella, Domenico; Pelicci, Pier Giuseppe; Amati, Bruno

    2013-12-01

    A precise balance between quiescence and proliferation is crucial for the lifelong function of hematopoietic stem cells (HSCs). Cyclins E1 and E2 regulate exit from quiescence in fibroblasts, but their role in HSCs remains unknown. Here, we report a non-redundant role for cyclin E1 in mouse HSCs. A long-term culture-initiating cell (LTC-IC) assay indicated that the loss of cyclin E1, but not E2, compromised the colony-forming activity of primitive hematopoietic progenitors. Ccne1(-/-) mice showed normal hematopoiesis in vivo under homeostatic conditions but a severe impairment following myeloablative stress induced by 5-fluorouracil (5-FU). Under these conditions, Ccne1(-/-) HSCs were less efficient in entering the cell cycle, resulting in decreased hematopoiesis and reduced survival of mutant mice upon weekly 5-FU treatment. The role of cyclin E1 in homeostatic conditions became apparent in aged mice, where HSC quiescence was increased in Ccne1(-/-) animals. On the other hand, loss of cyclin E1 provided HSCs with a competitive advantage in bone marrow serial transplantation assays, suggesting that a partial impairment of cell cycle entry may exert a protective role by preventing premature depletion of the HSC compartment. Our data support a role for cyclin E1 in controlling the exit from quiescence in HSCs. This activity, depending on the physiological context, can either jeopardize or protect the maintenance of hematopoiesis.

  17. Oxytocin receptor antagonist atosiban impairs consolidation, but not reconsolidation of contextual fear memory in rats.

    PubMed

    Abdullahi, Payman Rasise; Eskandarian, Sharaf; Ghanbari, Ali; Rashidy-Pour, Ali

    2018-05-23

    There is increasing evidence that oxytocin is involved in learning and memory process. This study investigated the effects of blockade of oxytocin receptors using the selective oxytocin receptor antagonist atosiban (ATO) on contextual fear memory consolidation and reconsolidation in male rats. Post-training injections of different doses of ATO (1, 10, 100 or 1000 µg/kg) impaired the 48 h retention performance in a dose-dependent manner. The same doses of ATO following memory reactivation did not impair subsequent expression of contextual fear memories which formed under low or high shock intensities and tested 24 h or one week following memory reactivation. Also, no effect was found when ATO was administrated in the absence of memory reactivation. Our finding is the first report that indicates endogenous oxytocin released during training play an important role in the consolidation, but not reconsolidation of contextual fear memory in rats. Copyright © 2018. Published by Elsevier B.V.

  18. Role of the ventral tegmental area in methamphetamine extinction: AMPA receptor-mediated neuroplasticity

    PubMed Central

    Chen, Han-Ting

    2015-01-01

    The molecular mechanisms underlying drug extinction remain largely unknown, although a role for medial prefrontal cortex (mPFC) glutamate neurons has been suggested. Considering that the mPFC sends glutamate efferents to the ventral tegmental area (VTA), we tested whether the VTA is involved in methamphetamine (METH) extinction via conditioned place preference (CPP). Among various METH-CPP stages, we found that the amount of phospho-GluR1/Ser845 increased in the VTA at behavioral extinction, but not the acquisition or withdrawal stage. Via surface biotinylation, we found that levels of membrane GluR1 were significantly increased during METH-CPP extinction, while no change was observed at the acquisition stage. Specifically, the number of dendritic spines in the VTA was increased at behavioral extinction, but not during acquisition. To validate the role of the mPFC in METH-CPP extinction, we lesioned the mPFC. Ibotenic acid lesioning of the mPFC did not affect METH-CPP acquisition, however, it abolished the extinction stage and reversed the enhanced phospho-GluR1/Ser845 levels as well as increases in VTA dendritic spines during METH-CPP extinction. Overall, this study demonstrates that the mPFC plays a critical role in METH-CPP extinction and identifies the VTA as an alternative target in mediating the extinction of drug conditioning. PMID:25691515

  19. Insulin resistance after a 72-h fast is associated with impaired AS160 phosphorylation and accumulation of lipid and glycogen in human skeletal muscle

    PubMed Central

    Vendelbo, M. H.; Clasen, B. F. F.; Treebak, J. T.; Møller, L.; Krusenstjerna-Hafstrøm, T.; Madsen, M.; Nielsen, T. S.; Stødkilde-Jørgensen, H.; Pedersen, S. B.; Jørgensen, J. O. L.; Goodyear, L. J.; Wojtaszewski, J. F. P.; Møller, N.

    2012-01-01

    During fasting, human skeletal muscle depends on lipid oxidation for its energy substrate metabolism. This is associated with the development of insulin resistance and a subsequent reduction of insulin-stimulated glucose uptake. The underlying mechanisms controlling insulin action on skeletal muscle under these conditions are unresolved. In a randomized design, we investigated eight healthy subjects after a 72-h fast compared with a 10-h overnight fast. Insulin action on skeletal muscle was assessed by a hyperinsulinemic euglycemic clamp and by determining insulin signaling to glucose transport. In addition, substrate oxidation, skeletal muscle lipid content, regulation of glycogen synthesis, and AMPK signaling were assessed. Skeletal muscle insulin sensitivity was reduced profoundly in response to a 72-h fast and substrate oxidation shifted to predominantly lipid oxidation. This was associated with accumulation of both lipid and glycogen in skeletal muscle. Intracellular insulin signaling to glucose transport was impaired by regulation of phosphorylation at specific sites on AS160 but not TBC1D1, both key regulators of glucose uptake. In contrast, fasting did not impact phosphorylation of AMPK or insulin regulation of Akt, both of which are established upstream kinases of AS160. These findings show that insulin resistance in muscles from healthy individuals is associated with suppression of site-specific phosphorylation of AS160, without Akt or AMPK being affected. This impairment of AS160 phosphorylation, in combination with glycogen accumulation and increased intramuscular lipid content, may provide the underlying mechanisms for resistance to insulin in skeletal muscle after a prolonged fast. PMID:22028408

  20. Regulation of skeletal muscle blood flow during exercise in ageing humans

    PubMed Central

    Hearon, Christopher M.

    2015-01-01

    Abstract The regulation of skeletal muscle blood flow and oxygen delivery to contracting skeletal muscle is complex and involves the mechanical effects of muscle contraction; local metabolic, red blood cell and endothelium‐derived substances; and the sympathetic nervous system (SNS). With advancing age in humans, skeletal muscle blood flow is typically reduced during dynamic exercise and this is due to a lower vascular conductance, which could ultimately contribute to age‐associated reductions in aerobic exercise capacity, a primary predictor of mortality in both healthy and diseased ageing populations. Recent findings have highlighted the contribution of endothelium‐derived substances to blood flow control in contracting muscle of older adults. With advancing age, impaired nitric oxide availability due to scavenging by reactive oxygen species, in conjunction with elevated vasoconstrictor signalling via endothelin‐1, reduces the local vasodilatory response to muscle contraction. Additionally, ageing impairs the ability of contracting skeletal muscle to blunt sympathetic vasoconstriction (i.e. ‘functional sympatholysis’), which is critical for the proper regulation of tissue blood flow distribution and oxygen delivery, and could further reduce skeletal muscle perfusion during high intensity and/or large muscle mass exercise in older adults. We propose that initiation of endothelium‐dependent hyperpolarization is the underlying signalling event necessary to properly modulate sympathetic vasoconstriction in contracting muscle, and that age‐associated impairments in red blood cell adenosine triphosphate release and stimulation of endothelium‐dependent vasodilatation may explain impairments in both local vasodilatation and functional sympatholysis with advancing age in humans. PMID:26332887

  1. Do alprazolam-induced changes in saccadic eye movement and psychomotor function follow the same time course?

    PubMed

    Kroboth, P D; Folan, M M; Bauer, K S; Tullock, W; Wright, C E; Sweeney, J A

    1998-04-01

    The purpose of this study was to determine whether short-term tolerance develops to GABA-agonist-induced changes in saccadic eye movements (SEMs), and whether the time course for GABA-agonist induced onset and offset of impairment is similar for SEMs and for psychomotor function. An additional goal was to determine whether there are differences in sensitivity between SEMs and psychomotor function. Six healthy volunteers participated in this balanced double-blind, three-way crossover, single-dose study of placebo and two different dosage forms of the GABA-agonist alprazolam: a rapidly absorbed oral 1.5-mg compressed tablet (CT) and a 3.0-mg sustained release (SR) tablet. Treatments were separated by a 7-day washout period. Peak concentrations did not differ between CT and SR treatments, although area under the concentration-time curve (AUC) of alprazolam was greater after administration of SR than after CT, because plateau concentrations were attained after SR. Both SEM and psychomotor tests showed time-dependent responses consistent with the development of tolerance. SEMs discriminated the differences in rate of drug input of the CT and SR formulations, with impairment evident at low concentrations during absorption. SEM impairment also persisted longer than did psychomotor impairment. Peak saccade velocity is a more sensitive indicator of pharmacologic effects mediated by the GABA-benzodiazepine receptor complex than are psychomotor responses. This is probably the result of the very high GABA dependency of SEMs, along with their limited sensitivity to motivation.

  2. Antinociceptive effects of MSVIII-19, a functional antagonist of the GluK1 kainate receptor

    PubMed Central

    Qiu, Chang-Shen; Wyhe, Leanne Lash-Van; Sasaki, Makoto; Sakai, Ryuichi; Swanson, Geoffrey T.; Gereau, Robert W.

    2011-01-01

    The ionotropic glutamate receptor subunit, GluK1 (GluR5), is expressed in many regions of nervous system related to sensory transmission. Recently, a selective ligand for the GluK1 receptor, MSVIII-19 (8,9-dideoxy-neodysiherbaine), was synthesized as a derivative of dysiherbaine, a toxin isolated from the marine sponge Lendenfeldia chodrodes. MSVIII-19 potently desensitizes GluK1 receptors without channel activation, rendering it useful as a functional antagonist. Given the high selectivity for GluK1 and the proposed role for this glutamate receptor in nociception, we sought to test the analgesic potential of MSVIII-19 in a series of models of inflammatory, neuropathic, and visceral pain in mice. MSVIII-19 delivered intrathecally (i.t.) dose-dependently reduced formalin-induced spontaneous behaviors and reduced thermal hypersensitivity 3 hours after formalin injection and 24 hours after complete freund’s adjuvant-induced inflammation, but had no effect on mechanical sensitivity in the same models. I.T. MSVIII-19 significantly reduced both thermal hyperalgesia and mechanical hypersensitivity in the chronic constriction injury model of neuropathic pain, but had no effect in the acetic acid model of visceral pain. Peripheral administration of MSVIII-19 had no analgesic efficacy in any of these models. Finally, i.t. MSVIII-19 did not alter responses in tail flick tests or performance on the accelerating RotaRod. These data suggest that spinal administration of MSVIII-19 reverses hypersensitivity in several models of pain in mice, supporting the clinical potential of GluK1 antagonists for the management of pain. PMID:21324591

  3. Roles of testosterone and amygdaloid LTP induction in determining sex differences in fear memory magnitude.

    PubMed

    Chen, Li-Shen; Tzeng, Wen-Yu; Chuang, Jia-Ying; Cherng, Chianfang G; Gean, Po-Wu; Yu, Lung

    2014-08-01

    Women are thought to form fear memory more robust than men do and testosterone is suspected to play a role in determining such a sex difference. Mouse cued fear freezing was used to study the sex-related susceptibility and the role of testosterone in fear memory in humans. A 75-dB tone was found to provoke weak freezing, while 0.15-mA and 0.20-mA footshock caused strong freezing responses. No sex differences were noticed in the tone- or footshock-induced (naïve fear) freezing. Following the conditionings, female mice exhibited greater tone (cued fear)-induced freezing than did male mice. Nonetheless, female mice demonstrated indistinctive cued fear freezing across the estrous phases and ovariectomy did not affect such freezing in female mice. Orchidectomy enhanced the cued fear freezing in male mice. Systemic testosterone administrations and an intra-lateral nucleus of amygdala (LA) testosterone infusion diminished the cued fear freezing in orchidectomized male mice, while pretreatment with flutamide (Flu) eradicated these effects. Long-term potentiation (LTP) magnitude in LA has been known to correlate with the strength of the cued fear conditioning. We found that LA LTP magnitude was indeed greater in female than male mice. Orchidectomy enhanced LTP magnitude in males' LA, while ovariectomy decreased LTP magnitude in females' LA. Testosterone decreased LTP magnitude in orchidectomized males' LA and estradiol enhanced LTP magnitude in ovariectomized females' LA. Finally, male mice had lower LA GluR1 expression than female mice and orchidectomy enhanced the GluR1 expression in male mice. These findings, taken together, suggest that testosterone plays a critical role in rendering the sex differences in the cued fear freezing and LA LTP. Testosterone is negatively associated with LA LTP and the cued fear memory in male mice. However, ovarian hormones and LA LTP are loosely associated with the cued fear memory in female mice. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Effects of Sleep Deprivation and Aging on Long-Term and Remote Memory in Mice

    ERIC Educational Resources Information Center

    Vecsey, Christopher G.; Park, Alan J.; Khatib, Nora; Abel, Ted

    2015-01-01

    Sleep deprivation (SD) following hippocampus-dependent learning in young mice impairs memory when tested the following day. Here, we examined the effects of SD on remote memory in both young and aged mice. In young mice, we found that memory is still impaired 1 mo after training. SD also impaired memory in aged mice 1 d after training, but, by a…

  5. Sex-Dependent Effects of Prenatal Stress on Social Memory in Rats: A Role for Differential Expression of Central Vasopressin-1a Receptors.

    PubMed

    Grundwald, N J; Benítez, D P; Brunton, P J

    2016-04-01

    Prenatal stress (PNS) affects a number of traits in the offspring, including stress axis regulation, emotionality and cognition; however, much less is known about the effects of PNS on social memory and the underlying central mechanisms. In the present study, we investigated social preference, social memory under basal and stress conditions and olfactory memory for social and nonsocial odours in the adult offspring of dams exposed to social stress during late pregnancy. Given the key roles that the central oxytocin and vasopressin systems play in facilitating social memory, we further investigated the effects of PNS on the central expression of mRNA for oxytocin (Oxtr) and vasopressin-1a (Avpr1a) receptors. PNS did not affect social preference in either sex; however, social memory was impaired under basal conditions in PNS females but not PNS males. Accordingly, Avpr1a mRNA expression in the lateral septum and bed nucleus of stria terminalis (BNST) was unaltered in males but was significantly lower in PNS females compared to controls. No differences in Oxtr mRNA expression were detected between control and PNS offspring in either sex in any of the brain regions examined. Social memory deficits in PNS females persisted when social odours were used; however, this does not appear to be a result of impaired olfaction because memory for nonsocial odours was similar in control and PNS females. Under acute stress conditions, deficits in social memory were observed in both male and female control offspring; however, PNS males were unaffected. Moreover, acute stress facilitated social memory in PNS females and this was associated with an up-regulation of Avpr1a mRNA in the lateral septum and BNST. Our data support a role for altered signalling via central Avpr1a in PNS-induced sex-dependent changes in social memory and may have implications for understanding the aetiology of neurodevelopmental disorders characterised by social behaviour deficits in humans. © 2015 The Authors. Journal of Neuroendocrinology published by John Wiley & Sons Ltd on behalf of British Society for Neuroendocrinology.

  6. Elevating Integrin-linked Kinase Expression has Rescued Hippocampal Neurogenesis and Memory Deficits in an AD animal Model.

    PubMed

    Xu, Xu-Feng; Wang, You-Cui; Zong, Liang; Chen, Zhe-Yu; Li, Yan

    2018-05-19

    Alterations in adult neurogenesis have been regarded as a major cause of cognitive impairment in Alzheimer's disease (AD). The underlying mechanism of neurogenesis deficiency in AD remains unclear. In this study, we reported that Integrin-linked Kinase (ILK) protein levels and phosphorylation were significantly decreased in the hippocampus of APP/PS1 mice. Increased ILK expression of dentate gyrus (DG) rescued the hippocampus-dependent neurogenesis and memory deficits in APP/PS1 mice. Moreover, we demonstrated that the effect of ILK overexpression in the hippocampus was exerted via AKT-GSK3β pathway. Finally, we found that Fluoxetine, a selective serotonin reuptake inhibitor, could improve the impaired hippocampal neurogenesis and memory by enhancing ILK-AKT-GSK3β pathway activity in APP/PS1 mice. Thus, these findings demonstrated the effects of ILK on neurogenesis and memory recovery, suggesting that ILK is an important therapeutic target for AD prevention and treatment. Copyright © 2018. Published by Elsevier B.V.

  7. Hippocampal protein kinase D1 is necessary for DHPG-induced learning and memory impairments in rats

    PubMed Central

    Groveman, Bradley R.; Carrier, Nicole; Qiao, Haifa; Fang, Xiao-Qian; Wang, Hui; Xin, Wenkuan; Jiang, Xing-Hong; Salter, Michael W.; Ding, Xin-Sheng; Kabbaj, Mohamed

    2018-01-01

    Background Understanding molecular mechanisms underlying the induction of learning and memory impairments remains a challenge. Recent investigations have shown that the activation of group I mGluRs (mGluR1 and mGluR5) in cultured hippocampal neurons by application of (S)-3,5-Dihydroxyphenylglycine (DHPG) causes the regulated internalization of N-methyl-D-aspartate receptors (NMDARs), which subsequently activates protein kinase D1 (PKD1). Through phosphorylating the C-terminals of the NMDAR GluN2 subunits, PKD1 down-regulates the activity of remaining (non-internalized) surface NMDARs. The knockdown of PKD1 does not affect the DHPG-induced inhibition of AMPA receptor-mediated miniature excitatory post-synaptic currents (mEPSCs) but prevents the DHPG-induced inhibition of NMDAR-mediated mEPSCs in vitro. Thus, we investigated the in vivo effects of bilateral infusions of DHPG into the hippocampal CA1 area of rats in the Morris water maze (MWM) and the novel object discrimination (NOD) tests. Methods A total of 300 adult male Sprague Dawley rats (250–280 g) were used for behavioral tests. One hundred ninety four were used in MWM test and the other 106 rats in the NOD test. Following one week of habituation to the vivarium, rats were bilaterally implanted under deep anesthesia with cannulas aimed at the CA1 area of the hippocampus (CA1 coordinates in mm from Bregma: AP -3.14; lateral +/-2; DV -3.0). Through implanted cannulas artificial cerebrospinal fluid (ACSF), the group1 mGluR antagonist 6-Methyl-2-(phenylethynyl)pyridine (MPEP), the dynamin-dependent internalization inhibitor Dynasore, or the PKD1 inhibitor CID755673 were infused into the bilateral hippocampal CA1 areas (2 μL per side, over 5 min). The effects of these infusions and the effects of PKD1 knockdown were examined in MWM or NOD test. Results DHPG infusion increased the latency to reach the platform in the MWM test and reduced the preference for the novel object in the NOD task. We found that the DHPG effects were dose-dependent and could be maintained for up to 2 days. Notably, these effects could be prevented by pre-infusion of the group1 mGluR antagonist MPEP, the dynamin-dependent internalization inhibitor Dynasore, the PKD1 inhibitor CID755673, or by PKD1 knockdown in the hippocampal CA1 area. Conclusion Altogether, these findings provide direct evidence that PKD1-mediated signaling may play a critical role in the induction of learning and memory impairments by DHPG infusion into the hippocampal CA1 area. PMID:29614089

  8. The basolateral amygdala dopaminergic system contributes to the improving effect of nicotine on stress-induced memory impairment in rats.

    PubMed

    Keshavarzian, Elnaz; Ghasemzadeh, Zahra; Rezayof, Ameneh

    2018-05-18

    Stress seems to be an important risk factor in the beginning and continuing stages of cigarette tobacco smoking in humans. Considering that both of nicotine administration and stress exposure affect cognitive functions including memory formation, the aim of the present study was 1) to evaluate the effect of subcutaneous (s.c.) administration of nicotine on memory formation under stress and 2) to assess the possible role of the basolateral amygdala (BLA) dopamine D1 and D2 receptors in the effect of nicotine on stress-induced memory retrieval impairment. Adult male wistar rats were bilaterally implanted in the BLA. A step-through type passive avoidance task was used to measure memory retrieval. To induce acute stress, the animals were placed on an elevated platform. The results showed that pre-test exposure to 20 and 30 min stress, but not 10 min, impaired memory retrieval. Nicotine administration (0.05 mg/kg, s.c.) improved stress-induced memory retrieval impairment. The activation of the BLA dopamine receptors via bilateral microinjection of apomorphine (0.025-0.4 μg/rat), a non-selective dopamine receptor agonist, potentiated the effect of nicotine on stress-induced memory retrieval impairment. Interestingly, intra-BLA microinjection of SCH23390 (a selective dopamine D1 receptor antagonist; 0.02-0.5 μg/rat) or sulpiride (a selective dopamine D2 receptor antagonist; 0.02-0.5 μg/rat) dose-dependently inhibited nicotine-induced improvement of the stress amnesic effect. Taken together, it can be concluded that stress-induced impairment of memory retrieval can be improved by nicotine administration. Moreover, the dopaminergic neurotransmission in the BLA through D1 and D2 receptors mediates the improving effect of nicotine on stress-induced memory retrieval impairment. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Defective synaptic transmission and structure in the dentate gyrus and selective fear memory impairment in the Rsk2 mutant mouse model of Coffin-Lowry syndrome.

    PubMed

    Morice, Elise; Farley, Séverine; Poirier, Roseline; Dallerac, Glenn; Chagneau, Carine; Pannetier, Solange; Hanauer, André; Davis, Sabrina; Vaillend, Cyrille; Laroche, Serge

    2013-10-01

    The Coffin-Lowry syndrome (CLS) is a syndromic form of intellectual disability caused by loss-of-function of the RSK2 serine/threonine kinase encoded by the rsk2 gene. Rsk2 knockout mice, a murine model of CLS, exhibit spatial learning and memory impairments, yet the underlying neural mechanisms are unknown. In the current study, we examined the performance of Rsk2 knockout mice in cued, trace and contextual fear memory paradigms and identified selective deficits in the consolidation and reconsolidation of hippocampal-dependent fear memories as task difficulty and hippocampal demand increase. Electrophysiological, biochemical and electron microscopy analyses were carried out in the dentate gyrus of the hippocampus to explore potential alterations in neuronal functions and structure. In vivo and in vitro electrophysiology revealed impaired synaptic transmission, decreased network excitability and reduced AMPA and NMDA conductance in Rsk2 knockout mice. In the absence of RSK2, standard measures of short-term and long-term potentiation (LTP) were normal, however LTP-induced CREB phosphorylation and expression of the transcription factors EGR1/ZIF268 were reduced and that of the scaffolding protein SHANK3 was blocked, indicating impaired activity-dependent gene regulation. At the structural level, the density of perforated and non-perforated synapses and of multiple spine boutons was not altered, however, a clear enlargement of spine neck width and post-synaptic densities indicates altered synapse ultrastructure. These findings show that RSK2 loss-of-function is associated in the dentate gyrus with multi-level alterations that encompass modifications of glutamate receptor channel properties, synaptic transmission, plasticity-associated gene expression and spine morphology, providing novel insights into the mechanisms contributing to cognitive impairments in CLS. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Implementation plan for combating the drug-impaired driver.

    DOT National Transportation Integrated Search

    1988-01-01

    Beginning on April 1, 1988, the Commonwealth of Virginia's revised drug-impaired driving statute went into effect. It defines the drug-impaired driver as one who is under the influence to a degree that impairs his or her ability to drive safely. The ...

  11. Cancer-associated Isocitrate Dehydrogenase Mutations Inactivate NADPH-dependent Reductive Carboxylation*

    PubMed Central

    Leonardi, Roberta; Subramanian, Chitra; Jackowski, Suzanne; Rock, Charles O.

    2012-01-01

    Isocitrate dehydrogenase (IDH) is a reversible enzyme that catalyzes the NADP+-dependent oxidative decarboxylation of isocitrate (ICT) to α-ketoglutarate (αKG) and the NADPH/CO2-dependent reductive carboxylation of αKG to ICT. Reductive carboxylation by IDH1 was potently inhibited by NADP+ and, to a lesser extent, by ICT. IDH1 and IDH2 with cancer-associated mutations at the active site arginines were unable to carry out the reductive carboxylation of αKG. These mutants were also defective in ICT decarboxylation and converted αKG to 2-hydroxyglutarate using NADPH. These mutant proteins were thus defective in both of the normal reactions of IDH. Biochemical analysis of heterodimers between wild-type and mutant IDH1 subunits showed that the mutant subunit did not inactivate reductive carboxylation by the wild-type subunit. Cells expressing the mutant IDH are thus deficient in their capacity for reductive carboxylation and may be compromised in their ability to produce acetyl-CoA under hypoxia or when mitochondrial function is otherwise impaired. PMID:22442146

  12. Antenatal ureaplasma infection impairs development of the fetal ovine gut in an IL-1-dependent manner.

    PubMed

    Wolfs, T G A M; Kallapur, S G; Knox, C L; Thuijls, G; Nitsos, I; Polglase, G R; Collins, J J P; Kroon, E; Spierings, J; Shroyer, N F; Newnham, J P; Jobe, A H; Kramer, B W

    2013-05-01

    Ureaplasma infection of the amniotic cavity is associated with adverse postnatal intestinal outcomes. We tested whether interleukin-1 (IL-1) signaling underlies intestinal pathology following ureaplasma exposure in fetal sheep. Pregnant ewes received intra-amniotic injections of ureaplasma or culture media for controls at 3, 7, and 14 d before preterm delivery at 124 d gestation (term 150 d). Intra-amniotic injections of recombinant human interleukin IL-1 receptor antagonist (rhIL-1ra) or saline for controls were given 3 h before and every 2 d after Ureaplasma injection. Ureaplasma exposure caused fetal gut inflammation within 7 d with damaged villus epithelium and gut barrier loss. Proliferation, differentiation, and maturation of enterocytes were significantly reduced after 7 d of ureaplasma exposure, leading to severe villus atrophy at 14 d. Inflammation, impaired development and villus atrophy of the fetal gut was largely prevented by intra-uterine rhIL-1ra treatment. These data form the basis for a clinical understanding of the role of ureaplasma in postnatal intestinal pathologies.

  13. [Care-Dependency in Parkinson's Disease: More Frequent than Assumed?].

    PubMed

    Riedel, O

    2015-06-01

    Parkinson's disease (PD) increases the risk of care-dependency (CDP). While motor functions worsen continuously, the assignment of patients to CDP occurs categorically. It is unknown how many patients are already sufficiently severely impaired to be categorised as CDP yet do not have an officially acknowledged level of CDP. A random sample of 1,449 PD outpatients was clinically characterised by office-based neurologists, including impairments of activities of daily living (ADL with the Unified Parkinson's Disease Rating scale (UPDRS subscale II) as well as regarding the presence of dementia according to DSM-IV criteria and the Mini-Mental State Exam (MMSE). Depression was screened for with the Montgomery-Asberg Depression Rating Scale (MADRS). For each patient the officially acknowledged level of CDP was documented; for patients without official CDP level, the clinician appraised whether the patient was care-dependent anyhow. 266 patients (18.3%) were officially acknowledged as care-dependent, while n=121 patients (8.5%) were not, yet were appraised to be care-dependent according to the clinician. Compared to non-CDP patients, they differed on every measure considered. Compared to patients with an official CDP, their PD duration was significantly shorter (6.0 vs. 8.0 years, p<0.01) and they were less severely impaired in ADL (13.3 vs. 15.5, p<0.01). They did not differ regarding the rates of dementia (52.9 vs. 44.9%, p=0.203) or depression according to the MADRS (13.1 vs. 13.1, p=0.989). ADL impairments are the most important predictor for CDP while dementia and depression are not considered despite the impairments that are additionally caused by them. © Georg Thieme Verlag KG Stuttgart · New York.

  14. Loss of CDKL5 in Glutamatergic Neurons Disrupts Hippocampal Microcircuitry and Leads to Memory Impairment in Mice

    PubMed Central

    Wang, I-Ting Judy; Yue, Cuiyong; Takano, Hajime; Terzic, Barbara

    2017-01-01

    Cyclin-dependent kinase-like 5 (CDKL5) deficiency is a neurodevelopmental disorder characterized by epileptic seizures, severe intellectual disability, and autistic features. Mice lacking CDKL5 display multiple behavioral abnormalities reminiscent of the disorder, but the cellular origins of these phenotypes remain unclear. Here, we find that ablating CDKL5 expression specifically from forebrain glutamatergic neurons impairs hippocampal-dependent memory in male conditional knock-out mice. Hippocampal pyramidal neurons lacking CDKL5 show decreased dendritic complexity but a trend toward increased spine density. This morphological change is accompanied by an increase in the frequency of spontaneous miniature EPSCs and interestingly, miniature IPSCs. Using voltage-sensitive dye imaging to interrogate the evoked response of the CA1 microcircuit, we find that CA1 pyramidal neurons lacking CDKL5 show hyperexcitability in their dendritic domain that is constrained by elevated inhibition in a spatially and temporally distinct manner. These results suggest a novel role for CDKL5 in the regulation of synaptic function and uncover an intriguing microcircuit mechanism underlying impaired learning and memory. SIGNIFICANCE STATEMENT Cyclin-dependent kinase-like 5 (CDKL5) deficiency is a severe neurodevelopmental disorder caused by mutations in the CDKL5 gene. Although Cdkl5 constitutive knock-out mice have recapitulated key aspects of human symptomatology, the cellular origins of CDKL5 deficiency-related phenotypes are unknown. Here, using conditional knock-out mice, we show that hippocampal-dependent learning and memory deficits in CDKL5 deficiency have origins in glutamatergic neurons of the forebrain and that loss of CDKL5 results in the enhancement of synaptic transmission and disruptions in neural circuit dynamics in a spatially and temporally specific manner. Our findings demonstrate that CDKL5 is an important regulator of synaptic function in glutamatergic neurons and serves a critical role in learning and memory. PMID:28674172

  15. Loss of CDKL5 in Glutamatergic Neurons Disrupts Hippocampal Microcircuitry and Leads to Memory Impairment in Mice.

    PubMed

    Tang, Sheng; Wang, I-Ting Judy; Yue, Cuiyong; Takano, Hajime; Terzic, Barbara; Pance, Katarina; Lee, Jun Y; Cui, Yue; Coulter, Douglas A; Zhou, Zhaolan

    2017-08-02

    Cyclin-dependent kinase-like 5 (CDKL5) deficiency is a neurodevelopmental disorder characterized by epileptic seizures, severe intellectual disability, and autistic features. Mice lacking CDKL5 display multiple behavioral abnormalities reminiscent of the disorder, but the cellular origins of these phenotypes remain unclear. Here, we find that ablating CDKL5 expression specifically from forebrain glutamatergic neurons impairs hippocampal-dependent memory in male conditional knock-out mice. Hippocampal pyramidal neurons lacking CDKL5 show decreased dendritic complexity but a trend toward increased spine density. This morphological change is accompanied by an increase in the frequency of spontaneous miniature EPSCs and interestingly, miniature IPSCs. Using voltage-sensitive dye imaging to interrogate the evoked response of the CA1 microcircuit, we find that CA1 pyramidal neurons lacking CDKL5 show hyperexcitability in their dendritic domain that is constrained by elevated inhibition in a spatially and temporally distinct manner. These results suggest a novel role for CDKL5 in the regulation of synaptic function and uncover an intriguing microcircuit mechanism underlying impaired learning and memory. SIGNIFICANCE STATEMENT Cyclin-dependent kinase-like 5 (CDKL5) deficiency is a severe neurodevelopmental disorder caused by mutations in the CDKL5 gene. Although Cdkl5 constitutive knock-out mice have recapitulated key aspects of human symptomatology, the cellular origins of CDKL5 deficiency-related phenotypes are unknown. Here, using conditional knock-out mice, we show that hippocampal-dependent learning and memory deficits in CDKL5 deficiency have origins in glutamatergic neurons of the forebrain and that loss of CDKL5 results in the enhancement of synaptic transmission and disruptions in neural circuit dynamics in a spatially and temporally specific manner. Our findings demonstrate that CDKL5 is an important regulator of synaptic function in glutamatergic neurons and serves a critical role in learning and memory. Copyright © 2017 the authors 0270-6474/17/377420-18$15.00/0.

  16. Alleviation of chronic pain following rat spinal cord compression injury with multimodal actions of huperzine A

    PubMed Central

    Yu, Dou; Thakor, Devang K.; Han, Inbo; Ropper, Alexander E.; Haragopal, Hariprakash; Sidman, Richard L.; Zafonte, Ross; Schachter, Steven C.; Teng, Yang D.

    2013-01-01

    Diverse mechanisms including activation of NMDA receptors, microglial activation, reactive astrogliosis, loss of descending inhibition, and spasticity are responsible for ∼40% of cases of intractable neuropathic pain after spinal cord injury (SCI). Because conventional treatments blocking individual mechanisms elicit only short-term effectiveness, a multimodal approach with simultaneous actions against major pain-related pathways may have value for clinical management of chronic pain. We hypothesize that [-]-huperzine A (HUP-A), an alkaloid isolated from the club moss Huperzia serrata, that is a potent reversible inhibitor of acetylcholinesterase and NMDA receptors, could mitigate pain without invoking drug tolerance or dependence by stimulating cholinergic interneurons to impede pain signaling, inhibiting inflammation via microglial cholinergic activation, and blocking NMDA-mediated central hypersensitization. We tested our hypothesis by administering HUP-A i.p. or intrathecally to female Sprague–Dawley rats (200–235 g body weight) after moderate static compression (35 g for 5 min) of T10 spinal cord. Compared with controls, HUP-A treatment demonstrates significant analgesic effects in both regimens. SCI rats manifested no drug tolerance following repeated bolus i.p. or chronic intrathecal HUP-A dosing. The pain-ameliorating effect of HUP-A is cholinergic dependent. Relative to vehicle treatment, HUP-A administration also reduced neural inflammation, retained higher numbers of calcium-impermeable GluR2-containing AMPA receptors, and prevented Homer1a up-regulation in dorsal horn sensory neurons. Therefore, HUP-A may provide safe and effective management for chronic postneurotrauma pain by reestablishing homeostasis of sensory circuits. PMID:23386718

  17. Alleviation of chronic pain following rat spinal cord compression injury with multimodal actions of huperzine A.

    PubMed

    Yu, Dou; Thakor, Devang K; Han, Inbo; Ropper, Alexander E; Haragopal, Hariprakash; Sidman, Richard L; Zafonte, Ross; Schachter, Steven C; Teng, Yang D

    2013-02-19

    Diverse mechanisms including activation of NMDA receptors, microglial activation, reactive astrogliosis, loss of descending inhibition, and spasticity are responsible for ∼40% of cases of intractable neuropathic pain after spinal cord injury (SCI). Because conventional treatments blocking individual mechanisms elicit only short-term effectiveness, a multimodal approach with simultaneous actions against major pain-related pathways may have value for clinical management of chronic pain. We hypothesize that [-]-huperzine A (HUP-A), an alkaloid isolated from the club moss Huperzia serrata, that is a potent reversible inhibitor of acetylcholinesterase and NMDA receptors, could mitigate pain without invoking drug tolerance or dependence by stimulating cholinergic interneurons to impede pain signaling, inhibiting inflammation via microglial cholinergic activation, and blocking NMDA-mediated central hypersensitization. We tested our hypothesis by administering HUP-A i.p. or intrathecally to female Sprague-Dawley rats (200-235 g body weight) after moderate static compression (35 g for 5 min) of T10 spinal cord. Compared with controls, HUP-A treatment demonstrates significant analgesic effects in both regimens. SCI rats manifested no drug tolerance following repeated bolus i.p. or chronic intrathecal HUP-A dosing. The pain-ameliorating effect of HUP-A is cholinergic dependent. Relative to vehicle treatment, HUP-A administration also reduced neural inflammation, retained higher numbers of calcium-impermeable GluR2-containing AMPA receptors, and prevented Homer1a up-regulation in dorsal horn sensory neurons. Therefore, HUP-A may provide safe and effective management for chronic postneurotrauma pain by reestablishing homeostasis of sensory circuits.

  18. Heme oxygenase-1-mediated apoptosis under cadmium-induced oxidative stress is regulated by autophagy, which is sensitized by tumor suppressor p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    So, Keum-Young; Oh, Seon-Hee

    Heme oxygenase-1 (HO-1) is a stress-inducible cytoprotective enzyme. It is often overexpressed in different types of cancers and promotes cell survival. However, the role of HO-1 and the underlying molecular mechanism of cadmium (Cd)-induced oxidative stress in cancer cells remain undefined. Here we show that the role of HO-1 under Cd-induced oxidative stress is dependent upon autophagy, which is sensitized by the tumor suppressor p53. The sensitivity to Cd was 3.5- and 14-fold higher in p53-expressing YD8 and H460 cells than in p53-null YD10B and H1299 cells, respectively. The levels of p53 in YD8 and H460 cells decreased in a Cd concentration-dependent manner,more » which was inhibited by pretreatment with N-acetylcysteine. In both cell lines, Cd exposure resulted in caspase-3-mediated PARP-1 cleavage and the induction of CHOP, LC3-II, and HO-1, which were limited in YD10B and H1299 cells exposed to high concentrations of Cd. Cd exposure to p53-overexpressing YD10B cells enhanced Cd-induced HO-1 and LC3-II levels, whereas genetic knockdown of p53 in YD8 cells resulted in the suppression of Cd-induced levels of HO-1 and LC3-II, indicating that p53 is required in the sensing of HO-1 and induction of autophagy. The inhibition of autophagy using small interfering RNA (siRNA) for the autophagy-related gene atg5 enhanced HO-1, CHOP, and PARP-1 cleavage induced by Cd. However, transfection with HO-1 siRNA increased Cd-induced LC3-II, and suppressed the expression of CHOP and cleavage of PARP-1. Collectively, the role of HO-1 in apoptosis could be modulated by autophagy, which is sensitized by p53 expression in human cancer cell lines. - Highlights: • Cadmium exposure decreased p53 level, and induced HO-1, apoptosis, and autophagy. • p53 sensitized Cadmium-induced HO-1 and autophagy induction. • Cadmium induced HO-1 under autophagy impairment and increased apoptosis. • Cadmium-induced autophagy was enhanced under HO-1 impaired conditions. • The role of HO-1 in Cadmium-induced apoptosis is modulated by autophagy.« less

  19. 20 CFR 30.906 - Who will pay for an impairment evaluation?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Who will pay for an impairment evaluation? 30... ENERGY EMPLOYEES OCCUPATIONAL ILLNESS COMPENSATION PROGRAM ACT OF 2000, AS AMENDED Impairment Benefits Under Part E of EEOICPA Medical Evidence of Impairment § 30.906 Who will pay for an impairment...

  20. Baclofen Toxicity in a Patient with Hemodialysis-Dependent End-Stage Renal Disease.

    PubMed

    Porter, Lauren M; Merrick, Stephanie S; Katz, Kenneth D

    2017-04-01

    Oral baclofen toxicity is extremely rare, but can affect patients with renal disease due to the drug's predominant renal clearance of approximately 69-85%. Patients with severely impaired renal function typically develop symptoms soon after initiating baclofen therapy, even at relatively low doses. A 69-year-old woman with a history of hemodialysis-dependent end-stage renal disease presented to the Emergency Department with encephalopathy, ataxia, and dystonia after the addition of a recent baclofen prescription for back pain (10 mg twice daily). She had been taking baclofen as prescribed for approximately 1 week when, the day prior to admission, she had increased her dose to a total of 40 mg. Diagnostic studies demonstrated the patient had chronic, end-stage renal disease and a supratherapeutic concentration of baclofen. Signs and symptoms resolved with hemodialysis. WHY SHOULD AN EMERGENCY PHYSICIAN BE AWARE OF THIS?: It is of critical importance for emergency physicians to appreciate impaired baclofen clearance in those with underlying renal disease to obviate the potential for significant drug toxicity. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Estradiol enhances retention but not organization of hippocampus-dependent memory in intact male mice.

    PubMed

    Al Abed, Alice Shaam; Sellami, Azza; Brayda-Bruno, Laurent; Lamothe, Valérie; Noguès, Xavier; Potier, Mylène; Bennetau-Pelissero, Catherine; Marighetto, Aline

    2016-07-01

    Because estrogens have mostly been studied in gonadectomized females, effects of chronic exposure to environmental estrogens in the general population are underestimated. Estrogens can enhance hippocampus-dependent memory through the modulation of information storage. However, declarative memory, the hippocampus-dependent memory of facts and events, demands more than abilities to retain information. Specifically, memory of repetitive events of everyday life such as "where I parked" requires abilities to organize/update memories to prevent proactive interference from similar memories of previous "parking events". Whether such organizational processes are estrogen-sensitive is unknown. We here studied, in intact young and aged adult mice, drinking-water (1μM) estradiol effects on both retention and organizational components of hippocampus-dependent memory, using a radial-maze task of everyday-like memory. Demand on retention vs organization was manipulated by varying the time-interval separating repetitions of similar events. Estradiol increased performance in young and aged mice under minimized organizational demand, but failed to improve the age-associated memory impairment and diminished performance in young mice under high organizational demand. In fact, estradiol prolonged mnemonic retention of successive events without improving organization abilities, hence resulted in more proactive interference from irrelevant memories. c-Fos imaging of testing-induced brain activations showed that the deterioration of young memory was associated with dentate gyrus dysconnectivity, reminiscent of that seen in aged mice. Our findings support the view that estradiol is promnesic but also reveal that such property can paradoxically impair memory. These findings have important outcomes regarding health issues relative to the impact of environmental estrogens in the general population. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Task- and Treatment Length–Dependent Effects of Vortioxetine on Scopolamine-Induced Cognitive Dysfunction and Hippocampal Extracellular Acetylcholine in Rats

    PubMed Central

    Pehrson, Alan L.; Hillhouse, Todd M.; Haddjeri, Nasser; Rovera, Renaud; Porter, Joseph H.; Mørk, Arne; Smagin, Gennady; Song, Dekun; Budac, David; Cajina, Manuel

    2016-01-01

    Major depressive disorder (MDD) is a common psychiatric disorder that often features impairments in cognitive function, and these cognitive symptoms can be important determinants of functional ability. Vortioxetine is a multimodal antidepressant that may improve some aspects of cognitive function in patients with MDD, including attention, processing speed, executive function, and memory. However, the cause of these effects is unclear, and there are several competing theories on the underlying mechanism, notably including regionally-selective downstream enhancement of glutamate neurotransmission and increased acetylcholine (ACh) neurotransmission. The current work sought to evaluate the ACh hypothesis by examining vortioxetine’s ability to reverse scopolamine-induced impairments in rodent tests of memory and attention. Additionally, vortioxetine’s effects on hippocampal extracellular ACh levels were examined alongside studies of vortioxetine’s pharmacokinetic profile. We found that acute vortioxetine reversed scopolamine-induced impairments in social and object recognition memory, but did not alter scopolamine-induced impairments in attention. Acute vortioxetine also induced a modest and short-lived increase in hippocampal ACh levels. However, this short-term effect is at variance with vortioxetine’s moderately long brain half life (5.1 hours). Interestingly, subchronic vortioxetine treatment failed to reverse scopolamine-induced social recognition memory deficits and had no effects on basal hippocampal ACh levels. These data suggest that vortioxetine has some effects on memory that could be mediated through cholinergic neurotransmission, however these effects are modest and only seen under acute dosing conditions. These limitations may argue against cholinergic mechanisms being the primary mediator of vortioxetine′s cognitive effects, which are observed under chronic dosing conditions in patients with MDD. PMID:27402279

  3. The proton pump inhibitor pantoprazole disrupts protein degradation systems and sensitizes cancer cells to death under various stresses.

    PubMed

    Cao, Yu; Chen, Min; Tang, Dehua; Yan, Hongli; Ding, Xiwei; Zhou, Fan; Zhang, Mingming; Xu, Guifang; Zhang, Weijie; Zhang, Shu; Zhuge, Yuzheng; Wang, Lei; Zou, Xiaoping

    2018-05-22

    Proton pump inhibitors (PPIs) play a role in antitumor activity, with studies showing specialized impacts of PPIs on cancer cell apoptosis, metastasis, and autophagy. In this study, we demonstrated that pantoprazole (PPI) increased autophagosomes formation and affected autophagic flux depending on the pH conditions. PPI specifically elevated SQSTM1 protein levels by increasing SQSTM1 transcription via NFE2L2 activation independent of the specific effect of PPI on autophagic flux. Via decreasing proteasome subunits expression, PPI significantly impaired the function of the proteasome, accompanied by the accumulation of undegraded poly-ubiquitinated proteins. Notably, PPI-induced autophagy functioned as a downstream response of proteasome inhibition by PPI, while suppressing protein synthesis abrogated autophagy. Blocking autophagic flux in neutral pH condition or further impairing proteasome function with proteasome inhibitors, significantly aggravated PPI cytotoxicity by worsening protein degradation ability. Interestingly, under conditions of mitochondrial stress, PPI showed significant synergism when combined with Bcl-2 inhibitors. Taken together, these findings provide a new understanding of the impact of PPIs on cancer cells' biological processes and highlight the potential to develop more efficient and effective combination therapies.

  4. Male Smokers' and Non-Smokers' Response Inhibition in Go/No-Go Tasks: Effect of Three Task Parameters

    PubMed Central

    Zhao, Xin; Liu, Xiaoting; Zan, Xiangyi; Jin, Ge; Maes, Joseph H. R.

    2016-01-01

    Impaired response inhibition plays a major role in many addictive behaviors. However, in studies using go/no-go tasks, findings regarding the presence of response inhibition deficits in nicotine-dependent individuals are mixed. This might be due to differences between studies on a number of task parameters. Here we aimed to identify task conditions under which go/no-go task performance deficits can be observed in smokers and to characterize the nature of such deficits. Sixty-one male students (30 smokers, 31 non-smokers) performed a go/no-go task while independently manipulating three task parameters: (1) percentage no-go trials (50% or 25%), (2) stimulus presentation time (600 ms or 200 ms), and (3) nature of no-go stimuli (cigarette related or cigarette unrelated). Three measures, reaction time on go trials and percentage correct responses on go and no-go trials, served as performance indicators. Under 200-ms but not 600-ms stimulus presentation conditions, the smokers responded faster on go trials and made more errors on both go and no-go trials than the non-smokers did. These differences occurred irrespective of the percentage of no-go trials and nature of no-go stimuli. The accuracy differences disappeared after controlling for the response time differences, suggesting a strong speed-accuracy trade-off. This study contributes to unraveling the conditions under which smokers display impaired inhibition performance and helps to characterize the nature of this impairment. Under task conditions prompting fast responding, smokers are more prone to increase response speed and to make more errors than non-smokers. PMID:27500831

  5. Keratins Regulate p38MAPK-Dependent Desmoglein Binding Properties in Pemphigus

    PubMed Central

    Vielmuth, Franziska; Walter, Elias; Fuchs, Michael; Radeva, Mariya Y.; Buechau, Fanny; Magin, Thomas M.; Spindler, Volker; Waschke, Jens

    2018-01-01

    Keratins are crucial for the anchorage of desmosomes. Severe alterations of keratin organization and detachment of filaments from the desmosomal plaque occur in the autoimmune dermatoses pemphigus vulgaris and pemphigus foliaceus (PF), which are mainly caused by autoantibodies against desmoglein (Dsg) 1 and 3. Keratin alterations are a structural hallmark in pemphigus pathogenesis and correlate with loss of intercellular adhesion. However, the significance for autoantibody-induced loss of intercellular adhesion is largely unknown. In wild-type (wt) murine keratinocytes, pemphigus autoantibodies induced keratin filament retraction. Under the same conditions, we used murine keratinocytes lacking all keratin filaments (KtyII k.o.) as a model system to dissect the role of keratins in pemphigus. KtyII k.o. cells show compromised intercellular adhesion without antibody (Ab) treatment, which was not impaired further by pathogenic pemphigus autoantibodies. Nevertheless, direct activation of p38MAPK via anisomycin further decreased intercellular adhesion indicating that cell cohesion was not completely abrogated in the absence of keratins. Direct inhibition of Dsg3, but not of Dsg1, interaction via pathogenic autoantibodies as revealed by atomic force microscopy was detectable in both cell lines demonstrating that keratins are not required for this phenomenon. However, PF-IgG shifted Dsg1-binding events from cell borders toward the free cell surface in wt cells. This led to a distribution pattern of Dsg1-binding events similar to KtyII k.o. cells under resting conditions. In keratin-deficient keratinocytes, PF-IgG impaired Dsg1-binding strength, which was not different from wt cells under resting conditions. In addition, pathogenic autoantibodies were capable of activating p38MAPK in both KtyII wt and k.o. cells, the latter of which already displayed robust p38MAPK activation under resting conditions. Since inhibition of p38MAPK blocked autoantibody-induced loss of intercellular adhesion in wt cells and restored baseline cell cohesion in keratin-deficient cells, we conclude that p38MAPK signaling is (i) critical for regulation of cell adhesion, (ii) regulated by keratins, and (iii) targets both keratin-dependent and -independent mechanisms. PMID:29616033

  6. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Yanyan; The First Affiliated Hospital, China Medical University, Shenyang 110001; Xue, Peng

    2013-12-15

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) andmore » peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis.« less

  7. Pharmacokinetics of Sublingual Buprenorphine and Naloxone in Subjects with Mild to Severe Hepatic Impairment (Child-Pugh Classes A, B, and C), in Hepatitis C Virus-Seropositive Subjects, and in Healthy Volunteers.

    PubMed

    Nasser, Azmi F; Heidbreder, Christian; Liu, Yongzhen; Fudala, Paul J

    2015-08-01

    Suboxone(®) is a sublingual tablet of buprenorphine/naloxone, approved for the treatment of opioid dependence. The objective of this study was to quantify the impact of hepatic impairment or hepatitis C virus infection on the pharmacokinetics of buprenorphine or naloxone and their major metabolites. Forty-three subjects received a single dose of a Suboxone 2.0/0.5-mg tablet. Blood samples were collected up to 168 h and pharmacokinetic parameters were calculated using non-compartmental analysis. Statistical analysis was performed using analysis of covariance. Pharmacokinetic parameters were derived from 33 subjects. Compared with healthy subjects, for patients with severe hepatic impairment, total and peak exposures increased to 281.4 % [90 % confidence interval 187.1-423.3] and 171.8 % [117.9-250.2] for buprenorphine, 1401.9 % [707.6-2777.5] and 1129.8 % [577.2-2211.4] for naloxone. For moderate hepatic impaired subjects, naloxone total and peak exposure increased to 317.6 % [164.9-611.5] and 270.0  % [141.9-513.9]. For buprenorphine, only total exposure increased to 163.9 % [110.8-242.3]. Changes in maximum observed plasma concentration, area under the plasma concentration-time curve from time zero to time of the last quantifiable concentration, and area under the plasma concentration-time curve from time zero to infinity of buprenorphine or naloxone in subjects with mild hepatic impairment or with hepatitis C virus infection were within twofold of those of healthy subjects. Serious adverse events were not observed. Severe and moderate hepatic impairment significantly increased exposure of naloxone and to a lesser extent of buprenorphine. Therefore, buprenorphine/naloxone combination products should generally be avoided in patients with severe hepatic impairment and may not be appropriate for patients with moderate hepatic impairment. However, buprenorphine/naloxone products may be used with caution for maintenance treatment in patients with moderate hepatic impairment who have initiated treatment on a buprenorphine product without naloxone [Registered at ClinicalTrials.gov as NCT01846455].

  8. Statistics on Children with Visual Impairments.

    ERIC Educational Resources Information Center

    Viisola, Michelle

    This report summarizes statistical data relating to children with visual impairments, including incidence, causes, and education. Data include: (1) prevalence estimates that indicate 1 percent of persons under the age of 18 in the United States have a visual impairment that cannot be corrected with glasses; (2) the leading cause of childhood…

  9. Antidepressant suppression of non-REM sleep spindles and REM sleep impairs hippocampus-dependent learning while augmenting striatum-dependent learning.

    PubMed

    Watts, Alain; Gritton, Howard J; Sweigart, Jamie; Poe, Gina R

    2012-09-26

    Rapid eye movement (REM) sleep enhances hippocampus-dependent associative memory, but REM deprivation has little impact on striatum-dependent procedural learning. Antidepressant medications are known to inhibit REM sleep, but it is not well understood if antidepressant treatments impact learning and memory. We explored antidepressant REM suppression effects on learning by training animals daily on a spatial task under familiar and novel conditions, followed by training on a procedural memory task. Daily treatment with the antidepressant and norepinephrine reuptake inhibitor desipramine (DMI) strongly suppressed REM sleep in rats for several hours, as has been described in humans. We also found that DMI treatment reduced the spindle-rich transition-to-REM sleep state (TR), which has not been previously reported. DMI REM suppression gradually weakened performance on a once familiar hippocampus-dependent maze (reconsolidation error). DMI also impaired learning of the novel maze (consolidation error). Unexpectedly, learning of novel reward positions and memory of familiar positions were equally and oppositely correlated with amounts of TR sleep. Conversely, DMI treatment enhanced performance on a separate striatum-dependent, procedural T-maze task that was positively correlated with the amounts of slow-wave sleep (SWS). Our results suggest that learning strategy switches in patients taking REM sleep-suppressing antidepressants might serve to offset sleep-dependent hippocampal impairments to partially preserve performance. State-performance correlations support a model wherein reconsolidation of hippocampus-dependent familiar memories occurs during REM sleep, novel information is incorporated and consolidated during TR, and dorsal striatum-dependent procedural learning is augmented during SWS.

  10. Antidepressant Suppression of Non-REM Sleep Spindles and REM Sleep Impairs Hippocampus-Dependent Learning While Augmenting Striatum-Dependent Learning

    PubMed Central

    Watts, Alain; Gritton, Howard J.; Sweigart, Jamie

    2012-01-01

    Rapid eye movement (REM) sleep enhances hippocampus-dependent associative memory, but REM deprivation has little impact on striatum-dependent procedural learning. Antidepressant medications are known to inhibit REM sleep, but it is not well understood if antidepressant treatments impact learning and memory. We explored antidepressant REM suppression effects on learning by training animals daily on a spatial task under familiar and novel conditions, followed by training on a procedural memory task. Daily treatment with the antidepressant and norepinephrine reuptake inhibitor desipramine (DMI) strongly suppressed REM sleep in rats for several hours, as has been described in humans. We also found that DMI treatment reduced the spindle-rich transition-to-REM sleep state (TR), which has not been previously reported. DMI REM suppression gradually weakened performance on a once familiar hippocampus-dependent maze (reconsolidation error). DMI also impaired learning of the novel maze (consolidation error). Unexpectedly, learning of novel reward positions and memory of familiar positions were equally and oppositely correlated with amounts of TR sleep. Conversely, DMI treatment enhanced performance on a separate striatum-dependent, procedural T-maze task that was positively correlated with the amounts of slow-wave sleep (SWS). Our results suggest that learning strategy switches in patients taking REM sleep-suppressing antidepressants might serve to offset sleep-dependent hippocampal impairments to partially preserve performance. State–performance correlations support a model wherein reconsolidation of hippocampus-dependent familiar memories occurs during REM sleep, novel information is incorporated and consolidated during TR, and dorsal striatum-dependent procedural learning is augmented during SWS. PMID:23015432

  11. Caspase-6 activity in the CA1 region of the hippocampus induces age-dependent memory impairment

    PubMed Central

    LeBlanc, A C; Ramcharitar, J; Afonso, V; Hamel, E; Bennett, D A; Pakavathkumar, P; Albrecht, S

    2014-01-01

    Active Caspase-6 is abundant in the neuropil threads, neuritic plaques and neurofibrillary tangles of Alzheimer disease brains. However, its contribution to the pathophysiology of Alzheimer disease is unclear. Here, we show that higher levels of Caspase-6 activity in the CA1 region of aged human hippocampi correlate with lower cognitive performance. To determine whether Caspase-6 activity, in the absence of plaques and tangles, is sufficient to cause memory deficits, we generated a transgenic knock-in mouse that expresses a self-activated form of human Caspase-6 in the CA1. This Caspase-6 mouse develops age-dependent spatial and episodic memory impairment. Caspase-6 induces neuronal degeneration and inflammation. We conclude that Caspase-6 activation in mouse CA1 neurons is sufficient to induce neuronal degeneration and age-dependent memory impairment. These results indicate that Caspase-6 activity in CA1 could be responsible for the lower cognitive performance of aged humans. Consequently, preventing or inhibiting Caspase-6 activity in the aged may provide an efficient novel therapeutic approach against Alzheimer disease. PMID:24413155

  12. Enhanced susceptibility of Prnp-deficient mice to kainate-induced seizures, neuronal apoptosis, and death: Role of AMPA/kainate receptors.

    PubMed

    Rangel, Alejandra; Burgaya, Ferran; Gavín, Rosalina; Soriano, Eduardo; Aguzzi, Adriano; Del Río, José A

    2007-09-01

    Normal physiologic functions of the cellular prion protein (PrPc) are still elusive. This GPI-anchored protein exerts many functions, including roles in neuron proliferation, neuroprotection or redox homeostasis. There are, however, conflicting data concerning its role in synaptic transmission. Although several studies report that PrPc participates in NMDA-mediated neurotransmission, parallel studies describe normal behavior of PrPc-mutant mice. Abnormal axon connections have been described in the dentate gyrus of the hippocampi of PrPc-deficient mice similar to those observed in epilepsy. A study indicates increased susceptibility to kainate (KA) in these mutant mice. We extend the observation of these studies by means of several histologic and biochemical analyses of KA-treated mice. PrPc-deficient mice showed increased sensitivity to KA-induced seizures in vivo and in vitro in organotypic slices. In addition, we show that this sensitivity is cell-specific because interference experiments to abolish PrPc expression increased susceptibility to KA in PrPc-expressing cells. We indicate a correlation of susceptibility to KA in cells lacking PrPc with the differential expression of GluR6 and GluR7 KA receptor subunits using real-time RT-PCR methods. These results indicate that PrPc exerts a neuroprotective role against KA-induced neurotoxicity, probably by regulating the expression of KA receptor subunits. (c) 2007 Wiley-Liss, Inc.

  13. Dietary effects on object recognition: The impact of high-fat high-sugar diets on recollection and familiarity-based memory.

    PubMed

    Tran, Dominic M D; Westbrook, R Frederick

    2018-05-31

    Exposure to a high-fat high-sugar (HFHS) diet rapidly impairs novel-place- but not novel-object-recognition memory in rats (Tran & Westbrook, 2015, 2017). Three experiments sought to investigate the generality of diet-induced cognitive deficits by examining whether there are conditions under which object-recognition memory is impaired. Experiments 1 and 3 tested the strength of short- and long-term object-memory trace, respectively, by varying the interval of time between object familiarization and subsequent novel object test. Experiment 2 tested the effect of increasing working memory load on object-recognition memory by interleaving additional object exposures between familiarization and test in an n-back style task. Experiments 1-3 failed to detect any differences in object recognition between HFHS and control rats. Experiment 4 controlled for object novelty by separately familiarizing both objects presented at test, which included one remote-familiar and one recent-familiar object. Under these conditions, when test objects differed in their relative recency, HFHS rats showed a weaker memory trace for the remote object compared to chow rats. This result suggests that the diet leaves intact recollection judgments, but impairs familiarity judgments. We speculate that the HFHS diet adversely affects "where" memories as well as the quality of "what" memories, and discuss these effects in relation to recollection and familiarity memory models, hippocampal-dependent functions, and episodic food memories. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  14. Elongator-dependent modification of cytoplasmic tRNALysUUU is required for mitochondrial function under stress conditions.

    PubMed

    Tigano, Marco; Ruotolo, Roberta; Dallabona, Cristina; Fontanesi, Flavia; Barrientos, Antoni; Donnini, Claudia; Ottonello, Simone

    2015-09-30

    To gain a wider view of the pathways that regulate mitochondrial function, we combined the effect of heat stress on respiratory capacity with the discovery potential of a genome-wide screen in Saccharomyces cerevisiae. We identified 105 new genes whose deletion impairs respiratory growth at 37°C by interfering with processes such as transcriptional regulation, ubiquitination and cytosolic tRNA wobble uridine modification via 5-methoxycarbonylmethyl-2-thiouridine formation. The latter process, specifically required for efficient decoding of AA-ending codons under stress conditions, was covered by multiple genes belonging to the Elongator (e.g. ELP3) and urmylation (e.g., NCS6) pathways. ELP3 or NCS6 deletants had impaired mitochondrial protein synthesis. Their respiratory deficiency was selectively rescued by overexpression of tRNA(Lys) UUU as well by overexpression of genes (BCK1 and HFM1) with a strong bias for the AAA codon read by this tRNA. These data extend the mitochondrial regulome, demonstrate that heat stress can impair respiration by disturbing cytoplasmic translation of proteins critically involved in mitochondrial function and document, for the first time, the involvement in such process of the Elongator and urmylation pathways. Given the conservation of these pathways, the present findings may pave the way to a better understanding of the human mitochondrial regulome in health and disease. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Protein Kinase C alpha (PKCα) dependent signaling mediates endometrial cancer cell growth and tumorigenesis

    PubMed Central

    Haughian, James M.; Reno, Elaine M.; Thorne, Alicia M.; Bradford, Andrew P.

    2009-01-01

    Endometrial cancer is the most common invasive gynecologic malignancy, yet molecular mechanisms and signaling pathways underlying its etiology and pathophysiology remain poorly characterized. We sought to define a functional role for the protein kinase C (PKC) isoform, PKCα, in an established cell model of endometrial adenocarcinoma. Ishikawa cells depleted of PKCα protein grew slower, formed fewer colonies in anchorage-independent growth assays and exhibited impaired xenograft tumor formation in nude mice. Consistent with impaired growth, PKCα knockdown increased levels of the cyclin dependent kinase (CDK) inhibitors p21Cip1/WAF1 (p21) and p27Kip1 (p27). Despite the absence of functional phosphatase and tensin homologue (PTEN) protein in Ishikawa cells, PKCα knockdown reduced Akt phosphorylation at serine 473 and concomitantly inhibited phosphorylation of the Akt target, glycogen synthase kinase-3β (GSK-3β). PKCα knockdown also resulted in decreased basal ERK phosphorylation and attenuated ERK activation following EGF stimulation. p21 and p27 expression was not increased by treatment of Ishikawa cells with ERK and Akt inhibitors, suggesting PKCα regulates CDK expression independently of Akt and ERK. Immunohistochemical analysis of grade 1 endometrioid adenocarcinoma revealed aberrant PKCα expression, with foci of elevated PKCα staining, not observed in normal endometrium. These studies demonstrate a critical role for PKCα signaling in endometrial tumorigenesis by regulating expression of CDK inhibitors p21 and p27 and activation of Akt and ERK dependent proliferative pathways. Thus, targeting PKCα may provide novel therapeutic options in endometrial tumors. PMID:19672862

  16. The Nuclear Receptor AhR Controls Bone Homeostasis by Regulating Osteoclast Differentiation via the RANK/c-Fos Signaling Axis

    PubMed Central

    Izawa, Takashi; Arakaki, Rieko; Mori, Hiroki; Tsunematsu, Takaaki; Kudo, Yasusei; Tanaka, Eiji

    2016-01-01

    The aryl hydrocarbon receptor (AhR) pathway plays a key role in receptor activator of NF-κB ligand (RANKL)–mediated osteoclastogenesis. However, the mechanism underlying the regulation of AhR expression in osteoclasts and the signaling pathway through which AhR controls osteoclastogenesis remain unclear. We found that the expression of AhR in bone marrow–derived osteoclasts was upregulated by RANKL at an earlier stage than was the expression of signature osteoclast genes such as those encoding cathepsin K and NFAT, cytoplasmic, calcineurin-dependent 1. In response to RANKL, bone marrow macrophages isolated from AhR−/− mice exhibited impaired phosphorylation of Akt and MAPK as well as NF-κB, whereas their response to M-CSF remained unchanged. Osteoclast differentiation mediated by the AhR signaling pathway was also regulated in an RANKL/c-Fos–dependent manner. Furthermore, ligand activation of AhR by the smoke toxin benzo[a]pyrene accelerated osteoclast differentiation in a receptor-dependent manner, and AhR-dependent regulation of mitochondrial biogenesis in osteoclasts was observed. Moreover, AhR−/− mice exhibited impaired bone healing with delayed endochondral ossification. Taken together, the present results suggest that the RANKL/AhR/c-Fos signaling axis plays a critical role in osteoclastogenesis, thereby identifying the potential of AhR in treating pathological, inflammatory, or metabolic disorders of the bone. PMID:27849171

  17. Cardiac Gab1 deletion leads to dilated cardiomyopathy associated with mitochondrial damage and cardiomyocyte apoptosis

    PubMed Central

    Zhao, J; Yin, M; Deng, H; Jin, F Q; Xu, S; Lu, Y; Mastrangelo, M A; Luo, H; Jin, Z G

    2016-01-01

    A vital step in the development of heart failure is the transition from compensatory cardiac hypertrophy to decompensated dilated cardiomyopathy (DCM) during cardiac remodeling under mechanical or pathological stress. However, the molecular mechanisms underlying the development of DCM and heart failure remain incompletely understood. In the present study, we investigate whether Gab1, a scaffolding adaptor protein, protects against hemodynamic stress-induced DCM and heat failure. We first observed that the protein levels of Gab1 were markedly reduced in hearts from human patients with DCM and from mice with experimental viral myocarditis in which DCM developed. Next, we generated cardiac-specific Gab1 knockout mice (Gab1-cKO) and found that Gab-cKO mice developed DCM in hemodynamic stress-dependent and age-dependent manners. Under transverse aorta constriction (TAC), Gab1-cKO mice rapidly developed decompensated DCM and heart failure, whereas Gab1 wild-type littermates exhibited adaptive left ventricular hypertrophy without changes in cardiac function. Mechanistically, we showed that Gab1-cKO mouse hearts displayed severe mitochondrial damages and increased cardiomyocyte apoptosis. Loss of cardiac Gab1 in mice impaired Gab1 downstream MAPK signaling pathways in the heart under TAC. Gene profiles further revealed that ablation of Gab1 in heart disrupts the balance of anti- and pro-apoptotic genes in cardiomyocytes. These results demonstrate that cardiomyocyte Gab1 is a critical regulator of the compensatory cardiac response to aging and hemodynamic stress. These findings may provide new mechanistic insights and potential therapeutic target for DCM and heart failure. PMID:26517531

  18. Cerebral versus Ocular Visual Impairment: The Impact on Developmental Neuroplasticity.

    PubMed

    Martín, Maria B C; Santos-Lozano, Alejandro; Martín-Hernández, Juan; López-Miguel, Alberto; Maldonado, Miguel; Baladrón, Carlos; Bauer, Corinna M; Merabet, Lotfi B

    2016-01-01

    Cortical/cerebral visual impairment (CVI) is clinically defined as significant visual dysfunction caused by injury to visual pathways and structures occurring during early perinatal development. Depending on the location and extent of damage, children with CVI often present with a myriad of visual deficits including decreased visual acuity and impaired visual field function. Most striking, however, are impairments in visual processing and attention which have a significant impact on learning, development, and independence. Within the educational arena, current evidence suggests that strategies designed for individuals with ocular visual impairment are not effective in the case of CVI. We propose that this variance may be related to differences in compensatory neuroplasticity related to the type of visual impairment, as well as underlying alterations in brain structural connectivity. We discuss the etiology and nature of visual impairments related to CVI, and how advanced neuroimaging techniques (i.e., diffusion-based imaging) may help uncover differences between ocular and cerebral causes of visual dysfunction. Revealing these differences may help in developing future strategies for the education and rehabilitation of individuals living with visual impairment.

  19. Cerebral versus Ocular Visual Impairment: The Impact on Developmental Neuroplasticity

    PubMed Central

    Martín, Maria B. C.; Santos-Lozano, Alejandro; Martín-Hernández, Juan; López-Miguel, Alberto; Maldonado, Miguel; Baladrón, Carlos; Bauer, Corinna M.; Merabet, Lotfi B.

    2016-01-01

    Cortical/cerebral visual impairment (CVI) is clinically defined as significant visual dysfunction caused by injury to visual pathways and structures occurring during early perinatal development. Depending on the location and extent of damage, children with CVI often present with a myriad of visual deficits including decreased visual acuity and impaired visual field function. Most striking, however, are impairments in visual processing and attention which have a significant impact on learning, development, and independence. Within the educational arena, current evidence suggests that strategies designed for individuals with ocular visual impairment are not effective in the case of CVI. We propose that this variance may be related to differences in compensatory neuroplasticity related to the type of visual impairment, as well as underlying alterations in brain structural connectivity. We discuss the etiology and nature of visual impairments related to CVI, and how advanced neuroimaging techniques (i.e., diffusion-based imaging) may help uncover differences between ocular and cerebral causes of visual dysfunction. Revealing these differences may help in developing future strategies for the education and rehabilitation of individuals living with visual impairment. PMID:28082927

  20. Downregulation of Endothelial Transient Receptor Potential Vanilloid Type 4 Channel and Small-Conductance of Ca2+-Activated K+ Channels Underpins Impaired Endothelium-Dependent Hyperpolarization in Hypertension.

    PubMed

    Seki, Takunori; Goto, Kenichi; Kiyohara, Kanako; Kansui, Yasuo; Murakami, Noboru; Haga, Yoshie; Ohtsubo, Toshio; Matsumura, Kiyoshi; Kitazono, Takanari

    2017-01-01

    Endothelium-dependent hyperpolarization (EDH)-mediated responses are impaired in hypertension, but the underlying mechanisms have not yet been determined. The activation of small- and intermediate-conductance of Ca 2+ -activated K + channels (SK Ca and IK Ca ) underpins EDH-mediated responses. It was recently reported that Ca 2+ influx through endothelial transient receptor potential vanilloid type 4 channel (TRPV4) is a prerequisite for the activation of SK Ca /IK Ca in endothelial cells in specific beds. Here, we attempted to determine whether the impairment of EDH in hypertension is attributable to the dysfunction of TRPV4 and S/IK Ca , using isolated superior mesenteric arteries of 20-week-old stroke-prone spontaneously hypertensive rats (SHRSP) and age-matched Wistar-Kyoto (WKY) rats. In the WKY arteries, EDH-mediated responses were reduced by a combination of SK Ca /IK Ca blockers (apamin plus TRAM-34; 1-[(2-chlorophenyl)diphenylmethl]-1H-pyrazole) and by the blockade of TRPV4 with the selective antagonist RN-1734 or HC-067047. In the SHRSP arteries, EDH-mediated hyperpolarization and relaxation were significantly impaired when compared with WKY. GSK1016790A, a selective TRPV4 activator, evoked robust hyperpolarization and relaxation in WKY arteries. In contrast, in SHRSP arteries, the GSK1016790A-evoked hyperpolarization was small and relaxation was absent. Hyperpolarization and relaxation to cyclohexyl-[2-(3,5-dimethyl-pyrazol-1-yl)-6-methyl-pyrimidin-4-yl]-amine, a selective SK Ca activator, were marginally decreased in SHRSP arteries compared with WKY arteries. The expression of endothelial TRPV4 and SK Ca protein was significantly decreased in the SHRSP mesenteric arteries compared with those of WKY, whereas function and expression of IK Ca were preserved in SHRSP arteries. These findings suggest that EDH-mediated responses are impaired in superior mesenteric arteries of SHRSP because of a reduction in both TRPV4 and SK Ca input to EDH. © 2016 American Heart Association, Inc.

  1. Alcohol and Alzheimer's Disease-Does Alcohol Dependence Contribute to Beta-Amyloid Deposition, Neuroinflammation and Neurodegeneration in Alzheimer's Disease?

    PubMed

    Venkataraman, Ashwin; Kalk, Nicola; Sewell, Gavin; Ritchie, Craig W; Lingford-Hughes, Anne

    2017-03-09

    To investigate the underlying neurobiology between alcohol use, misuse and dependence and cognitive impairment, particularly Alzheimer's disease (AD). Review of the literature using searches of Medline, Pubmed, EMBASE, PsycInfo, and meeting abstracts and presentations. The role of alcohol as a risk factor and contributor for cognitive decline associated with AD has received little attention. This is despite the high prevalence of alcohol use, the potential reversibility of a degree of cognitive impairment and the global burden of AD. Until now the focus has largely been on the toxic effects of alcohol, neuronal loss and the role of thiamine. We propose alcohol adds to the cognitive burden seen in dementia through additional mechanisms to neurodegenerative processes or may contribute at various mechanistic points in the genesis and sustenance of AD pathology via neuroinflammation. We describe the common underlying neurobiology in alcohol and AD, and examine ways alcohol likely contributes to neuroinflammation directly via stimulation of Toll-like receptors and indirectly from small bowel changes, hepatic changes, withdrawal and traumatic brain injury to the pathogenesis of AD. Alcohol use, misuse and dependence cause cognitive impairment. We propose alcohol adds to the cognitive burden seen in dementia through additional mechanisms to neurodegenerative processes or may contribute at various mechanistic points in the genesis and sustenance of AD pathology via neuroinflammation. © The Author 2016. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  2. The nuclear receptor Tlx regulates motor, cognitive and anxiety-related behaviours during adolescence and adulthood.

    PubMed

    O'Leary, James D; Kozareva, Danka A; Hueston, Cara M; O'Leary, Olivia F; Cryan, John F; Nolan, Yvonne M

    2016-06-01

    The nuclear receptor Tlx is a key regulator of embryonic and adult hippocampal neurogenesis and has been genetically linked to bipolar disorder. Mice lacking Tlx (Nr2e1(-/-)) display deficits in adult hippocampal neurogenesis and behavioural abnormalities. However, whether Tlx regulates behaviour during adolescence or in a sex-dependent manner remains unexplored. Therefore, we investigated the role of Tlx in a series of behavioural tasks in adolescent male and female mice with a spontaneous deletion of Tlx (Nr2e1(-/-) mice). Testing commenced at adolescence (postnatal day 28) and continued until adulthood (postnatal day 67). Adolescent male and female Nr2e1(-/-) mice were hyperactive in an open field, an effect that persisted in adulthood. Male but not female Nr2e1(-/-) mice exhibited reduced thigmotaxis during adolescence and adulthood. Impairments in rotarod motor performance developed in male and female Nr2e1(-/-) mice at the onset of adulthood. Spontaneous alternation in the Y-maze, a hippocampus-dependent task, was impaired in adolescent but not adult male and female Nr2e1(-/-) mice. Contextual fear conditioning was impaired in adolescent male Nr2e1(-/-) mice only, but both male and female adolescent Nr2e1(-/-) mice showed impaired cued fear conditioning, a hippocampal-amygdala dependent cognitive process. These deficits persisted into adulthood in males but not females. In conclusion, deletion of Tlx impairs motor, cognitive and anxiety-related behaviours during adolescence and adulthood in male and female mice with most effects occurring during adolescence rather than adulthood, independent of housing conditions. This suggests that Tlx has functions beyond regulation of adult hippocampal neurogenesis, and may be an important target in understanding neurobiological disorders. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Retigabine ameliorates acute stress-induced impairment of spatial memory retrieval through regulating USP2 signaling pathways in hippocampal CA1 area.

    PubMed

    Li, Cai; Zhang, Ji; Xu, Haiwei; Chang, Mujun; Lv, Chuntao; Xue, Wenhua; Song, Zhizhen; Zhang, Lizhen; Zhang, Xiaojian; Tian, Xin

    2018-06-01

    Acute stress could trigger maladaptive changes associated with stress-related cognitive and emotional deficits. Dysfunction of ion channel or receptor in the hippocampal area has been linked to the cognitive deficits induced by stress. It is known that Kv7 channel openers, including FDA-approved drug retigabine, show cognitive protective efficacy. However, the underlying molecular mechanisms remain elusive. Here we showed that exposing adult male rats to acute stress significantly impaired the spatial memory, a cognitive process controlled by the hippocampus. Concomitantly, significantly reduced AMPA receptor expression was found in hippocampal CA1 area from acute stressed rats. This effect relied on the down-regulation of deubiquitinating enzyme USP2 and its upstream regulators (PGC-1α and β-catenin), and the subsequent enhancement of mTOR-related autophagy which is regulated by USP2. These findings suggested that acute stress dampened AMPA receptor expression by controlling USP2-related signaling, which caused the detrimental effect on hippocampus-dependent cognitive processes. We also found that retigabine alleviated acute stress-induced spatial memory retrieval impairment through adjusting the aberrance of USP2, its upstream regulators (PGC-1α, E4BP4 and β-catenin) and its downstream targets (mTOR, autophagy and GluA1). Our results have identified USP2 as a key molecule that mediates stress-induced spatial memory retrieval impairment, which provides a framework for new druggable targets to conceptually treat stress-associated cognitive deficits. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Intranasally delivered small interfering RNA-mediated suppression of scavenger receptor Mac-1 attenuates microglial phenotype switching and working memory impairment following hypoxia.

    PubMed

    Das, Sudeshna; Mishra, K P; Ganju, Lilly; Singh, S B

    2018-05-05

    Brain, being the highest consumer of oxygen, is prone to increased risk of hypoxia-induced neurological insults. In response to hypoxia, microglia, the major resident immune cells of brain switches to an activated phenotype and promote inflammatory responses leading to tissue damage and loss of cognitive functions including working memory impairment. Till date, no proven clinical therapeutics is available to retard the progression of neurodegenerative memory impairment. In the present study, we investigated the therapeutic potential of intranasal small interfering RNA (siRNA) delivery in a mouse model of hypoxia-induced working memory impairment using microglial receptor, Mac-1 as a target gene. Here, we implicate Mac-1 scavenger receptor in microglial phenotype switching, neurodegeneration in prefrontal cortex, hippocampus and working memory impairment. RNA mediated silencing of Mac-1 in both in vitro and in vivo model showed significant impact of it on hypoxia induced altered expression of Mac-1 endogenous ligand, signaling cascade proteins, transcription factors and NADPH oxidase pathway. Efficient degradation of Mac-1 mRNA suppressed expression of M1 phenotypic markers, inflammatory chemokines, and cytokines, but on the other hand, it upregulated M2 phenotypic markers and anti-inflammatory cytokines. Neuronal viability and synaptic plasticity markers were also modulated significantly by this strategy. Behavioral study revealed significant downregulation in the number of working memory errors at a time-dependent manner after silencing the Mac-1 gene during continuous hypoxic exposure. The novel findings of this study for the very first time, unmasked the role of Mac-1 receptor in neurodegenerative disease progression under hypoxic condition and at the same time indicated the potential therapeutic value of this non-invasive siRNA delivery approach for treating working memory loss. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Post-event Processing Predicts Impaired Cortisol Recovery Following Social Stressor: The Moderating Role of Social Anxiety.

    PubMed

    Maeda, Shunta; Sato, Tomoya; Shimada, Hironori; Tsumura, Hideki

    2017-01-01

    There is growing evidence that individuals with social anxiety show impaired cortisol recovery after experiencing social evaluative stressors. Yet, little is known regarding the cognitive processes underlying such impaired cortisol recovery. The present study examined the effect of post-event processing (PEP), referred to as repetitive thinking about social situations, on cortisol recovery following a social stressor. Forty-two non-clinical university students (23 women, 19 men, mean age = 22.0 ± 2.0 years) completed the Trier Social Stress Test (TSST), followed by a thought sampling procedure which assessed the frequency of PEP reflecting the TSST. A growth curve model showed PEP and social anxiety interactively predicted cortisol recovery. In particular, PEP predicted impaired cortisol recovery in those with low levels of social anxiety but not in those with high levels of social anxiety, which contradicted the initial hypothesis. These findings suggest that PEP is differentially associated with cortisol recovery depending on levels of social anxiety. The possible mechanisms underlying these findings were discussed in terms of protective inhibition framework.

  6. Epigenetic Repression of Matrix Metalloproteinases in Myofibroblastic Hepatic Stellate Cells through Histone Deacetylases 4

    PubMed Central

    Qin, Lan; Han, Yuan-Ping

    2010-01-01

    Matrix metalloproteinases (MMPs), which are highly expressed in acute injury, are progressively repressed or silenced in fibrotic liver, favoring extracellular matrix accumulation, while the underlying mechanism is largely unknown. Similarly, normal/quiescent hepatic stellate cells (HSCs) express high levels of MMPs in response to injury signals, such as interleukin-1. After transdifferentiation, the myofibroblastic HSCs are incapable of expressing many MMPs; however, the major signaling pathways required for MMP expression are intact, indicating that repression is at the level of the chromatin. Indeed, both the MMP9 and MMP13 genes are inaccessible to transcription factors and RNA polymerase II, in association with impaired histone acetylation in their promoters. In accordance with impaired histone acetylation at the cellular level, histone deacetylase-4 is accumulated during HSC transdifferentiation. Furthermore, ectopic expression of histone deacetylase-4 in quiescent HSCs results in repression of MMP promoter activities as well as endogenous MMP9 protein expression. Thus, our findings suggest that a histone deacetylase-4-dependent mechanism underlies the epigenetic silencing of MMP genes during tissue fibrogenesis. PMID:20847282

  7. Ionizing radiation regulates cardiac Ca handling via increased ROS and activated CaMKII.

    PubMed

    Sag, Can M; Wolff, Hendrik A; Neumann, Kay; Opiela, Marie-Kristin; Zhang, Juqian; Steuer, Felicia; Sowa, Thomas; Gupta, Shamindra; Schirmer, Markus; Hünlich, Mark; Rave-Fränk, Margret; Hess, Clemens F; Anderson, Mark E; Shah, Ajay M; Christiansen, Hans; Maier, Lars S

    2013-11-01

    Ionizing radiation (IR) is an integral part of modern multimodal anti-cancer therapies. IR involves the formation of reactive oxygen species (ROS) in targeted tissues. This is associated with subsequent cardiac dysfunction when applied during chest radiotherapy. We hypothesized that IR (i.e., ROS)-dependently impaired cardiac myocytes' Ca handling might contribute to IR-dependent cardiocellular dysfunction. Isolated ventricular mouse myocytes and the mediastinal area of anaesthetized mice (that included the heart) were exposed to graded doses of irradiation (sham 4 and 20 Gy) and investigated acutely (after ~1 h) as well as chronically (after ~1 week). IR induced a dose-dependent effect on myocytes' systolic function with acutely increased, but chronically decreased Ca transient amplitudes, which was associated with an acutely unaltered but chronically decreased sarcoplasmic reticulum (SR) Ca load. Likewise, in vivo echocardiography of anaesthetized mice revealed acutely enhanced left ventricular contractility (strain analysis) that declined after 1 week. Irradiated myocytes showed persistently increased diastolic SR Ca leakage, which was acutely compensated by an increase in SR Ca reuptake. This was reversed in the chronic setting in the face of slowed relaxation kinetics. As underlying cause, acutely increased ROS levels were identified to activate Ca/calmodulin-dependent protein kinase II (CaMKII). Accordingly, CaMKII-, but not PKA-dependent phosphorylation sites of the SR Ca release channels (RyR2, at Ser-2814) and phospholamban (at Thr-17) were found to be hyperphosphorylated following IR. Conversely, ROS-scavenging as well as CaMKII-inhibition significantly attenuated CaMKII-activation, disturbed Ca handling, and subsequent cellular dysfunction upon irradiation. Targeted cardiac irradiation induces a biphasic effect on cardiac myocytes Ca handling that is associated with chronic cardiocellular dysfunction. This appears to be mediated by increased oxidative stress and persistently activated CaMKII. Our findings suggest impaired cardiac myocytes Ca handling as a so far unknown mediator of IR-dependent cardiac damage that might be of relevance for radiation-induced cardiac dysfunction.

  8. Association between current smoking and cognitive impairment depends on age: A cross-sectional study in Xi'an, China.

    PubMed

    Liu, Jie; Shang, Suhang; Li, Pei; Deng, Meiying; Chen, Chen; Jiang, Yu; Dang, Liangjun; Qu, Qiumin

    2017-09-08

    Cigarette smoking is a modifiable risk factor for cognitive impairment, while the relationship between current smoking and cognitive impairment is not fully understood. The objectives were to identify a possible association between current smoking and cognitive impairment depending on age in the Chinese rural population. Data for the study consisted of 1,782 participants (40 years and older) who lived in a rural village in the vicinity of Xi'an, China. Data about smoking history and cognitive function were collected. Cognitive function was scored by the Mini-Mental State Examination. The effect of age on the relationship between current smoking and cognitive impairment was analyzed with interaction and stratified analysis by logistic regression models. Interaction analysis showed that current smoking is positively related with cognitive impairment (odds ratio [OR]=9.067; 95% confidence interval [95% CI] 1.305-62.979; P=.026). However, the interaction term, age by current smoking, is negatively related with cognitive impairment (OR=0.969; 95%CI 0.939-0.999; P=.045). Stratified logistic regression showed that in the 40-65 years of age sublayer, OR of current smoking is 1.966 (P=.044), whereas in the>65 years of age sublayer, the OR is 0.470 (P=.130). This means that the association between current smoking and cognitive impairment with age might be positive (OR>1) in lower age sublayers, but no significant difference in higher age sublayers. In conclusion, current smoking might be positively associated with cognitive impairment in the middle-aged but the relationship declines with increasing age. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  9. 20 CFR 30.907 - Can an impairment evaluation obtained by OWCP be challenged prior to issuance of the recommended...

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Can an impairment evaluation obtained by OWCP... ILLNESS COMPENSATION PROGRAM ACT OF 2000, AS AMENDED Impairment Benefits Under Part E of EEOICPA Medical Evidence of Impairment § 30.907 Can an impairment evaluation obtained by OWCP be challenged prior to...

  10. IGF-1 deficiency impairs neurovascular coupling in mice: implications for cerebromicrovascular aging.

    PubMed

    Toth, Peter; Tarantini, Stefano; Ashpole, Nicole M; Tucsek, Zsuzsanna; Milne, Ginger L; Valcarcel-Ares, Noa M; Menyhart, Akos; Farkas, Eszter; Sonntag, William E; Csiszar, Anna; Ungvari, Zoltan

    2015-12-01

    Aging is associated with marked deficiency in circulating IGF-1, which has been shown to contribute to age-related cognitive decline. Impairment of moment-to-moment adjustment of cerebral blood flow (CBF) via neurovascular coupling is thought to play a critical role in the genesis of age-related cognitive impairment. To establish the link between IGF-1 deficiency and cerebromicrovascular impairment, neurovascular coupling mechanisms were studied in a novel mouse model of IGF-1 deficiency (Igf1(f/f) -TBG-Cre-AAV8) and accelerated vascular aging. We found that IGF-1-deficient mice exhibit neurovascular uncoupling and show a deficit in hippocampal-dependent spatial memory test, mimicking the aging phenotype. IGF-1 deficiency significantly impaired cerebromicrovascular endothelial function decreasing NO mediation of neurovascular coupling. IGF-1 deficiency also impaired glutamate-mediated CBF responses, likely due to dysregulation of astrocytic expression of metabotropic glutamate receptors and impairing mediation of CBF responses by eicosanoid gliotransmitters. Collectively, we demonstrate that IGF-1 deficiency promotes cerebromicrovascular dysfunction and neurovascular uncoupling mimicking the aging phenotype, which are likely to contribute to cognitive impairment. © 2015 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  11. Different effects of ionotropic and metabotropic glutamate receptor antagonists on attention and the attentional properties of nicotine.

    PubMed

    Quarta, Davide; Naylor, Christopher G; Morris, Hannah V; Patel, Swital; Genn, Rachel F; Stolerman, Ian P

    2007-09-01

    Distinct lines of evidence indicate that glutamate plays a primary role in modulating cognitive functions. Notably, competitive glutamate receptor antagonists acting at ionotropic N-methyl-d-aspartate (NMDA) or metabotropic glutamate 5 (mGlu5) receptors impair cognitive performance. Conversely, nicotine and other psychostimulants stimulate glutamatergic mechanisms and can act as cognitive enhancers. Hence we analysed the role of glutamate in performance of an attentional task and in nicotine-induced enhancement of attention by using the rodent five-choice serial reaction time task (5-CSRTT). Rats were trained to criterion performance and were then pre-dosed with either vehicle, the NMDA receptor antagonist (+)3-(2-carboxypiperazin-4-propyl)-1-propenyl-1-phosphonic acid (CPP, 0.3-2.0 mg/kg) or the mGlu5 antagonist 2-methyl-6-phenylethynyl-pyridine (MPEP, 1.0-9.0 mg/kg) and challenged with nicotine (0.2 mg/kg). Nicotine improved attentional performance, an effect that was weakened by doses of CPP that themselves had little impact on performance; importantly, CPP dose-dependently blunted the ability of nicotine to improve response accuracy, the major measure of signal detection in the paradigm. MPEP dose-dependently impaired signal detection under conditions with a high attentional load, an effect that was reversed by nicotine; thus, MPEP did not block nicotine-induced attentional enhancement. Co-administration of either CPP or MPEP with nicotine also produced a general slowing of performance characterised by increases in omission errors and response latencies and reduced anticipatory responding. It is concluded that activation of NMDA receptors may be an important determinant of the effects of nicotine in the 5-CSRTT. Stimulation of nicotinic receptors may also reverse attentional deficits associated with the impaired function of the glutamate network.

  12. 20 CFR 220.28 - How long the impairment must last.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false How long the impairment must last. 220.28 Section 220.28 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT... long the impairment must last. Unless the claimant's impairment is expected to result in death, it must...

  13. Contrasting neural effects of aging on proactive and reactive response inhibition.

    PubMed

    Bloemendaal, Mirjam; Zandbelt, Bram; Wegman, Joost; van de Rest, Ondine; Cools, Roshan; Aarts, Esther

    2016-10-01

    Two distinct forms of response inhibition may underlie observed deficits in response inhibition in aging. We assessed whether age-related neurocognitive impairments in response inhibition reflect deficient reactive inhibition (outright stopping) or also deficient proactive inhibition (anticipatory response slowing), which might be particularly evident with high information load. We used functional magnetic resonance imaging in young (n = 25, age range 18-32) and older adults (n = 23, 61-74) with a stop-signal task. Relative to young adults, older adults exhibited impaired reactive inhibition (i.e., longer stop-signal reaction time) and increased blood oxygen level-dependent (BOLD) signal for successful versus unsuccessful inhibition in the left frontal cortex and cerebellum. Furthermore, older adults also exhibited impaired proactive slowing, but only as a function of information load. This load-dependent behavioral deficit was accompanied by a failure to increase blood oxygen level-dependent (BOLD) signal under high information load in lateral frontal cortex, presupplementary motor area and striatum. Our findings suggest that inhibitory deficits in older adults are caused both by reduced stopping abilities and by diminished preparation capacity during information overload. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Functional Impairment: An Unmeasured Marker of Medicare Costs for Postacute Care of Older Adults.

    PubMed

    Greysen, S Ryan; Stijacic Cenzer, Irena; Boscardin, W John; Covinsky, Kenneth E

    2017-09-01

    To assess the effects of preadmission functional impairment on Medicare costs of postacute care up to 365 days after hospital discharge. Longitudinal cohort study. Health and Retirement Study (HRS). Nationally representative sample of 16,673 Medicare hospitalizations of 8,559 community-dwelling older adults from 2000 to 2012. The main outcome was total Medicare costs in the year after hospital discharge, assessed according to Medicare claims data. The main predictor was functional impairment (level of difficulty or dependence in activities of daily living (ADLs)), determined from HRS interview preceding hospitalization. Multivariable linear regression was performed, adjusted for age, race, sex, income, net worth, and comorbidities, with clustering at the individual level to characterize the association between functional impairment and costs of postacute care. Unadjusted mean Medicare costs for 1 year after discharge increased with severity of impairment in a dose-response fashion (P < .001 for trend); 68% had no functional impairment ($25,931), 17% had difficulty with one ADL ($32,501), 7% had dependency in one ADL ($39,928), and 8% had dependency in two or more ADLs ($45,895). The most severely impaired participants cost 77% more than those with no impairment; adjusted analyses showed attenuated effect size (33% more) but no change in trend. Considering costs attributable to comorbidities, only three conditions were more expensive than severe functional impairment (lymphoma, metastatic cancer, paralysis). Functional impairment is associated with greater Medicare costs for postacute care and may be an unmeasured but important marker of long-term costs that cuts across conditions. © 2017, Copyright the Authors Journal compilation © 2017, The American Geriatrics Society.

  15. Sex-dependent effects of developmental exposure to different pesticides on spatial learning. The role of induced neuroinflammation in the hippocampus.

    PubMed

    Gómez-Giménez, Belén; Llansola, Marta; Hernández-Rabaza, Vicente; Cabrera-Pastor, Andrea; Malaguarnera, Michele; Agusti, Ana; Felipo, Vicente

    2017-01-01

    The use of pesticides has been associated with impaired neurodevelopment in children. The aims of this work were to assess: 1) the effects on spatial learning of developmental exposure to pesticides 2) if the effects are sex-dependent and 3) if hippocampal neuroinflammation is associated with the impairment of spatial learning. We analyzed the effects of developmental exposure to four pesticides: chlorpyrifos, carbaryl, endosulfan and cypermethrin. Exposure was from gestational day 7 to post-natal day 21 and spatial learning and memory was assessed when the rats were young adults. The effects of pesticides on spatial learning were pesticide and gender-dependent. Carbaryl did not affect spatial learning in males or females. Endosulfan and chlorpyrifos impaired learning in males but not in females. Cypermethrin improved spatial learning in the Morris water maze both in males and females while impaired learning in the radial maze only in males. Spatial learning ability was lower in control female rats than in males. All pesticides induced neuroinflammation, increasing IL-1b content in the hippocampus and there is a negative correlation between IL-1b levels in the hippocampus and spatial learning. Neuroinflammation would contribute to the effects of pesticides on spatial learning. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Individual stress vulnerability is predicted by short-term memory and AMPA receptor subunit ratio in the hippocampus.

    PubMed

    Schmidt, Mathias V; Trümbach, Dietrich; Weber, Peter; Wagner, Klaus; Scharf, Sebastian H; Liebl, Claudia; Datson, Nicole; Namendorf, Christian; Gerlach, Tamara; Kühne, Claudia; Uhr, Manfred; Deussing, Jan M; Wurst, Wolfgang; Binder, Elisabeth B; Holsboer, Florian; Müller, Marianne B

    2010-12-15

    Increased vulnerability to aversive experiences is one of the main risk factors for stress-related psychiatric disorders as major depression. However, the molecular bases of vulnerability, on the one hand, and stress resilience, on the other hand, are still not understood. Increasing clinical and preclinical evidence suggests a central involvement of the glutamatergic system in the pathogenesis of major depression. Using a mouse paradigm, modeling increased stress vulnerability and depression-like symptoms in a genetically diverse outbred strain, and we tested the hypothesis that differences in AMPA receptor function may be linked to individual variations in stress vulnerability. Vulnerable and resilient animals differed significantly in their dorsal hippocampal AMPA receptor expression and AMPA receptor binding. Treatment with an AMPA receptor potentiator during the stress exposure prevented the lasting effects of chronic social stress exposure on physiological, neuroendocrine, and behavioral parameters. In addition, spatial short-term memory, an AMPA receptor-dependent behavior, was found to be predictive of individual stress vulnerability and response to AMPA potentiator treatment. Finally, we provide evidence that genetic variations in the AMPA receptor subunit GluR1 are linked to the vulnerable phenotype. Therefore, we propose genetic variations in the AMPA receptor system to shape individual stress vulnerability. Those individual differences can be predicted by the assessment of short-term memory, thereby opening up the possibility for a specific treatment by enhancing AMPA receptor function.

  17. Factors influencing deprescribing habits among geriatricians.

    PubMed

    Ní Chróinín, Danielle; Ní Chróinín, Chantelle; Beveridge, Alexander

    2015-07-01

    deprescribing habits among physicians managing older, frailer, cognitively impaired patients have not been well investigated. an anonymised electronic survey was disseminated to all members of an international geriatric society/local advanced trainee network (N = 930). This comprised a Likert-scale analysis of factors influencing desprescribing, and five case vignettes, detailing a patient with progressive cognitive impairment and dependency, on a background of ischaemic heart disease and hypertension. among 134 respondents (response rate 14.4%), 47.4% were female, 48.9% aged 36-50 years and 84.1% specialists (15.9% trainees). Respondents commonly rated limited life expectancy (96.2%) and cognitive impairment (84.1%) as very/extremely important to deprescribing practices. On multivariable analysis, older respondents less commonly rated functional dependency (odds ratio [OR] 0.22 per change in age category; P < 0.001) and limited life expectancy (OR 0.09, P = 0.04) important when deprescribing, while female participants (OR 3.03, P < 0.001) and trainees (versus specialists OR 14.29, P < 0.001) more often rated adherence to evidence-based guidelines important. As vignettes described increasing dependency and cognitive impairment, physicians were more likely to stop donepezil, aspirin, atorvastatin and antihypertensives (all P < 0.001 for trend). Aspirin (93.6%) and ramipril (94.1%) were most commonly deprescribed. Commonest reasons cited for deprescribing medications were 'dementia severity', followed by pill burden. in this exploratory analysis, geriatricians rated limited life expectancy and cognitive impairment very important in driving deprescribing practices. Geriatricians more often deprescribed multiple medications in the setting of advancing dependency and cognitive impairment, driven by dementia severity and pill burden concerns. Physician characteristics also influence deprescribing practices. Further exploration of factors influencing deprescribing patterns, and patient outcomes, is needed. © The Author 2015. Published by Oxford University Press on behalf of the British Geriatrics Society. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. LUBAC Formation Is Impaired in the Livers of Mice with MCD-Dependent Nonalcoholic Steatohepatitis.

    PubMed

    Matsunaga, Yasuka; Nakatsu, Yusuke; Fukushima, Toshiaki; Okubo, Hirofumi; Iwashita, Misaki; Sakoda, Hideyuki; Fujishiro, Midori; Yamamotoya, Takeshi; Kushiyama, Akifumi; Takahashi, Shin-Ichiro; Tsuchiya, Yoshihiro; Kamata, Hideaki; Tokunaga, Fuminori; Iwai, Kazuhiro; Asano, Tomoichiro

    2015-01-01

    Nonalcoholic steatohepatitis (NASH) is a disorder characterized by hepatic lipid accumulation followed by the inflammation-induced death of hepatocytes and fibrosis. In this process, oxidative stress contributes to the induction of several inflammatory cytokines including TNF-α andIL-1β in macrophages, while, in hepatocytes, NF-κB reportedly induces the expressions of cell survival genes for protection from apoptosis. Recently, it was reported that the new ubiquitin ligase complex termed linear ubiquitin chain assembly complex (LUBAC), composed of SHARPIN (SHANK-associated RH domain-interacting protein), HOIL-1L (longer isoform of heme-oxidized iron-regulatory protein 2 ubiquitin ligase-1), and HOIP (HOIL-1L interacting protein), forms linear ubiquitin on NF-κB essential modulator (NEMO) and thereby induces NF-κB pathway activation. In this study, we demonstrated the formation of LUBAC to be impaired in the livers of NASH rodent models produced by methionine and choline deficient (MCD) diet feeding, first by either gel filtration or Blue Native-PAGE, with subsequent confirmation by western blotting. The reduction of LUBAC is likely to be attributable to markedly reduced expression of SHARPIN, one of its components. Thus, impaired LUBAC formation, which would result in insufficient NF-κB activation, may be one of the molecular mechanisms underlying the enhanced apoptotic response of hepatocytes in MCD diet-induced NASH livers.

  19. Ethylene-dependent regulation of an α-L-arabinofuranosidase is associated to firmness loss in 'Gala' apples under long term cold storage.

    PubMed

    Storch, Tatiane Timm; Finatto, Taciane; Pegoraro, Camila; Dal Cero, Joceani; Laurens, François; Rombaldi, Cesar Valmor; Quecini, Vera; Girardi, César Luís

    2015-09-01

    Fruit texture changes impair the quality of apples submitted to long term storage, especially under cold. The changes are due to cell wall modifications during ripening and senescence and are associated to ethylene. We have investigated the activity of α-l-arabinofuranosidase, a glycosyl hydrolase acting on the side chains of pectin in the cell wall and middle lamella. The transcription of arabinofuranosidase coding sequences 1 and 3 was investigated in plant organs and in response to ethylene, employing hormone application and 1-methylcyclopropene. The transcription of arabinofuranosidase genes is not restricted to fruits, although upregulated by ripening and ethylene. Transcripts of the genes were detected under cold storage up to 180 days. Similarly, arabinofuranosidase activity increased with rising levels of ethylene and under cold storage. Levels of arabinofuranosidase3 transcripts were higher than those of arabinofuranosidase1, suggesting that the first is an important contributor to enzyme activity and texture changes during cold storage. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Negative affect impairs associative memory but not item memory.

    PubMed

    Bisby, James A; Burgess, Neil

    2013-12-17

    The formation of associations between items and their context has been proposed to rely on mechanisms distinct from those supporting memory for a single item. Although emotional experiences can profoundly affect memory, our understanding of how it interacts with different aspects of memory remains unclear. We performed three experiments to examine the effects of emotion on memory for items and their associations. By presenting neutral and negative items with background contexts, Experiment 1 demonstrated that item memory was facilitated by emotional affect, whereas memory for an associated context was reduced. In Experiment 2, arousal was manipulated independently of the memoranda, by a threat of shock, whereby encoding trials occurred under conditions of threat or safety. Memory for context was equally impaired by the presence of negative affect, whether induced by threat of shock or a negative item, relative to retrieval of the context of a neutral item in safety. In Experiment 3, participants were presented with neutral and negative items as paired associates, including all combinations of neutral and negative items. The results showed both above effects: compared to a neutral item, memory for the associate of a negative item (a second item here, context in Experiments 1 and 2) is impaired, whereas retrieval of the item itself is enhanced. Our findings suggest that negative affect impairs associative memory while recognition of a negative item is enhanced. They support dual-processing models in which negative affect or stress impairs hippocampal-dependent associative memory while the storage of negative sensory/perceptual representations is spared or even strengthened.

  1. 20 CFR 220.28 - How long the impairment must last.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 20 Employees' Benefits 1 2013-04-01 2012-04-01 true How long the impairment must last. 220.28 Section 220.28 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Disability Under the Railroad Retirement Act for Any Regular Employment § 220.28 How...

  2. Focal Scn1a knockdown induces cognitive impairment without seizures

    PubMed Central

    Bender, Alex C.; Natola, Heather; Holmes, Gregory L.; Scott, Rod C.; Lenck-Santini, Pierre-Pascal

    2013-01-01

    Cognitive impairment is a common comorbidity in pediatric epilepsy that can severely affect quality of life. In many cases, antiepileptic treatments fail to improve cognition. Therefore, a fundamental question is whether underlying brain abnormalities may contribute to cognitive impairment through mechanisms independent of seizures. Here, we examined the possible effects on cognition of Nav1.1 down-regulation, a sodium channel principally involved in Dravet syndrome but also implicated in other cognitive disorders, including autism and Alzheimer’s disease. Using an siRNA approach to knockdown Nav1.1 selectively in the basal forebrain region, we were able to target a learning and memory network while avoiding the generation of spontaneous seizures. We show that reduction of Nav1.1 expression in the medial septum and diagonal band of Broca leads to a dysregulation of hippocampal oscillations in association with a spatial memory deficit. We propose that the underlying etiology responsible for Dravet syndrome may directly contribute to cognitive impairment in a manner that is independent from seizures. PMID:23318929

  3. Schizophrenia, culture and neuropsychology: sensory deficits, language impairments and social functioning in Chinese-speaking schizophrenia patients.

    PubMed

    Yang, L; Chen, S; Chen, C-M; Khan, F; Forchelli, G; Javitt, D C

    2012-07-01

    While 20% of schizophrenia patients worldwide speak tonal languages (e.g. Mandarin), studies are limited to Western-language patients. Western-language patients show tonal deficits that are related to impaired emotional processing of speech. However, language processing is minimally affected. In contrast, in Mandarin, syllables are voiced in one of four tones, with word meaning varying accordingly. We hypothesized that Mandarin-speaking schizophrenia patients would show impairments in underlying basic auditory processing that, unlike in Western groups, would relate to deficits in word recognition and social outcomes. Altogether, 22 Mandarin-speaking schizophrenia patients and 44 matched healthy participants were recruited from New York City. The auditory tasks were: (1) tone matching; (2) distorted tunes; (3) Chinese word discrimination; (4) Chinese word identification. Social outcomes were measured by marital status, employment and most recent employment status. Patients showed deficits in tone-matching, distorted tunes, word discrimination and word identification versus controls (all p<0.0001). Impairments in tone-matching across groups correlated with both word identification (p<0.0001) and discrimination (p<0.0001). On social outcomes, tonally impaired patients had 'lower-status' jobs overall when compared with tonally intact patients (p<0.005) and controls (p<0.0001). Our study is the first to investigate an interaction between neuropsychology and language among Mandarin-speaking schizophrenia patients. As predicted, patients were highly impaired in both tone and auditory word processing, with these two measures significantly correlated. Tonally impaired patients showed significantly worse employment-status function than tonally intact patients, suggesting a link between sensory impairment and employment status outcome. While neuropsychological deficits appear similar cross-culturally, their consequences may be language- and culture-dependent.

  4. Arabidopsis nph1 and npl1: blue light receptors that mediate both phototropism and chloroplast relocation.

    PubMed

    Sakai, T; Kagawa, T; Kasahara, M; Swartz, T E; Christie, J M; Briggs, W R; Wada, M; Okada, K

    2001-06-05

    UV-A/blue light acts to regulate a number of physiological processes in higher plants. These include light-driven chloroplast movement and phototropism. The NPH1 gene of Arabidopsis encodes an autophosphorylating protein kinase that functions as a photoreceptor for phototropism in response to low-intensity blue light. However, nph1 mutants have been reported to exhibit normal phototropic curvature under high-intensity blue light, indicating the presence of an additional phototropic receptor. A likely candidate is the nph1 homologue, npl1, which has recently been shown to mediate the avoidance response of chloroplasts to high-intensity blue light in Arabidopsis. Here we demonstrate that npl1, like nph1, noncovalently binds the chromophore flavin mononucleotide (FMN) within two specialized PAS domains, termed LOV domains. Furthermore, when expressed in insect cells, npl1, like nph1, undergoes light-dependent autophosphorylation, indicating that npl1 also functions as a light receptor kinase. Consistent with this conclusion, we show that a nph1 npl1 double mutant exhibits an impaired phototropic response under both low- and high-intensity blue light. Hence, npl1 functions as a second phototropic receptor under high fluence rate conditions and is, in part, functionally redundant to nph1. We also demonstrate that both chloroplast accumulation in response to low-intensity light and chloroplast avoidance movement in response to high-intensity light are lacking in the nph1 npl1 double mutant. Our findings therefore indicate that nph1 and npl1 show partially overlapping functions in two different responses, phototropism and chloroplast relocation, in a fluence rate-dependent manner.

  5. Reduction of Cav1.3 channels in dorsal hippocampus impairs the development of dentate gyrus newborn neurons and hippocampal-dependent memory tasks.

    PubMed

    Kim, Su-Hyun; Park, Ye-Ryoung; Lee, Boyoung; Choi, Byungil; Kim, Hyun; Kim, Chong-Hyun

    2017-01-01

    Cav1.3 has been suggested to mediate hippocampal neurogenesis of adult mice and contribute to hippocampal-dependent learning and memory processes. However, the mechanism of Cav1.3 contribution in these processes is unclear. Here, roles of Cav1.3 of mouse dorsal hippocampus during newborn cell development were examined. We find that knock-out (KO) of Cav1.3 resulted in the reduction of survival of newborn neurons at 28 days old after mitosis. The retroviral eGFP expression showed that both dendritic complexity and the number and length of mossy fiber bouton (MFB) filopodia of newborn neurons at ≥ 14 days old were significantly reduced in KO mice. Both contextual fear conditioning (CFC) and object-location recognition tasks were impaired in recent (1 day) memory test while passive avoidance task was impaired only in remote (≥ 20 days) memory in KO mice. Results using adeno-associated virus (AAV)-mediated Cav1.3 knock-down (KD) or retrovirus-mediated KD in dorsal hippocampal DG area showed that the recent memory of CFC was impaired in both KD mice but the remote memory was impaired only in AAV KD mice, suggesting that Cav1.3 of mature neurons play important roles in both recent and remote CFC memory while Cav1.3 in newborn neurons is selectively involved in the recent CFC memory process. Meanwhile, AAV KD of Cav1.3 in ventral hippocampal area has no effect on the recent CFC memory. In conclusion, the results suggest that Cav1.3 in newborn neurons of dorsal hippocampus is involved in the survival of newborn neurons while mediating developments of dendritic and axonal processes of newborn cells and plays a role in the memory process differentially depending on the stage of maturation and the type of learning task.

  6. Reduction of Cav1.3 channels in dorsal hippocampus impairs the development of dentate gyrus newborn neurons and hippocampal-dependent memory tasks

    PubMed Central

    Kim, Su-Hyun; Park, Ye-Ryoung; Lee, Boyoung; Choi, Byungil; Kim, Hyun

    2017-01-01

    Cav1.3 has been suggested to mediate hippocampal neurogenesis of adult mice and contribute to hippocampal-dependent learning and memory processes. However, the mechanism of Cav1.3 contribution in these processes is unclear. Here, roles of Cav1.3 of mouse dorsal hippocampus during newborn cell development were examined. We find that knock-out (KO) of Cav1.3 resulted in the reduction of survival of newborn neurons at 28 days old after mitosis. The retroviral eGFP expression showed that both dendritic complexity and the number and length of mossy fiber bouton (MFB) filopodia of newborn neurons at ≥ 14 days old were significantly reduced in KO mice. Both contextual fear conditioning (CFC) and object-location recognition tasks were impaired in recent (1 day) memory test while passive avoidance task was impaired only in remote (≥ 20 days) memory in KO mice. Results using adeno-associated virus (AAV)-mediated Cav1.3 knock-down (KD) or retrovirus-mediated KD in dorsal hippocampal DG area showed that the recent memory of CFC was impaired in both KD mice but the remote memory was impaired only in AAV KD mice, suggesting that Cav1.3 of mature neurons play important roles in both recent and remote CFC memory while Cav1.3 in newborn neurons is selectively involved in the recent CFC memory process. Meanwhile, AAV KD of Cav1.3 in ventral hippocampal area has no effect on the recent CFC memory. In conclusion, the results suggest that Cav1.3 in newborn neurons of dorsal hippocampus is involved in the survival of newborn neurons while mediating developments of dendritic and axonal processes of newborn cells and plays a role in the memory process differentially depending on the stage of maturation and the type of learning task. PMID:28715454

  7. Impaired activity-dependent FMRP translation and enhanced mGluR-dependent LTD in Fragile X premutation mice

    PubMed Central

    Iliff, Adam J.; Renoux, Abigail J.; Krans, Amy; Usdin, Karen; Sutton, Michael A.; Todd, Peter K.

    2013-01-01

    Fragile X premutation-associated disorders, including Fragile X-associated Tremor Ataxia Syndrome, result from unmethylated CGG repeat expansions in the 5′ untranslated region (UTR) of the FMR1 gene. Premutation-sized repeats increase FMR1 transcription but impair rapid translation of the Fragile X mental retardation protein (FMRP), which is absent in Fragile X Syndrome (FXS). Normally, FMRP binds to RNA and regulates metabotropic glutamate receptor (mGluR)-mediated synaptic translation, allowing for dendritic synthesis of several proteins. FMRP itself is also synthesized at synapses in response to mGluR activation. However, the role of activity-dependent translation of FMRP in synaptic plasticity and Fragile X-premutation-associated disorders is unknown. To investigate this question, we utilized a CGG knock-in mouse model of the Fragile X premutation with 120–150 CGG repeats in the mouse Fmr1 5′ UTR. These mice exhibit increased Fmr1 mRNA production but impaired FMRP translational efficiency, leading to a modest reduction in basal FMRP expression. Cultured hippocampal neurons and synaptoneurosomes derived from CGG KI mice demonstrate impaired FMRP translation in response to the group I mGluR agonist 3,5-dihydroxyphenylglycine. Electrophysiological analysis reveals enhanced mGluR-mediated long-term depression (mGluR-LTD) at CA3–CA1 synapses in acute hippocampal slices prepared from CGG KI mice relative to wild-type littermates, similar to Fmr1 knockout mice. However, unlike mGluR-LTD in mice completely lacking FMRP, mGluR-LTD in CGG knock-in mice remains dependent on new protein synthesis. These studies demonstrate partially overlapping synaptic plasticity phenotypes in mouse models of FXS and Fragile X premutation disorders and support a role for activity-dependent synthesis of FMRP in enduring forms of synaptic plasticity. PMID:23250915

  8. Protein Kinase A Deregulation in the Medial Prefrontal Cortex Impairs Working Memory in Murine Oligophrenin-1 Deficiency.

    PubMed

    Zhang, Chun-Lei; Aime, Mattia; Laheranne, Emilie; Houbaert, Xander; El Oussini, Hajer; Martin, Christelle; Lepleux, Marilyn; Normand, Elisabeth; Chelly, Jamel; Herzog, Etienne; Billuart, Pierre; Humeau, Yann

    2017-11-15

    Classical and systems genetics have identified wide networks of genes associated with cognitive and neurodevelopmental diseases. In parallel to deciphering the role of each of these genes in neuronal or synaptic function, evaluating the response of neuronal and molecular networks to gene loss of function could reveal some pathophysiological mechanisms potentially accessible to nongenetic therapies. Loss of function of the Rho-GAP oligophrenin-1 is associated with cognitive impairments in both human and mouse. Upregulation of both PKA and ROCK has been reported in Ophn1 -/ y mice, but it remains unclear whether kinase hyperactivity contributes to the behavioral phenotypes. In this study, we thoroughly characterized a prominent perseveration phenotype displayed by Ophn1 -deficient mice using a Y-maze spatial working memory (SWM) test. We report that Ophn1 deficiency in the mouse generated severe cognitive impairments, characterized by both a high occurrence of perseverative behaviors and a lack of deliberation during the SWM test. In vivo and in vitro pharmacological experiments suggest that PKA dysregulation in the mPFC underlies cognitive dysfunction in Ophn1 -deficient mice, as assessed using a delayed spatial alternation task results. Functionally, mPFC neuronal networks appeared to be affected in a PKA-dependent manner, whereas hippocampal-PFC projections involved in SWM were not affected in Ophn1 -/y mice. Thus, we propose that discrete gene mutations in intellectual disability might generate "secondary" pathophysiological mechanisms, which are prone to become pharmacological targets for curative strategies in adult patients. SIGNIFICANCE STATEMENT Here we report that Ophn1 deficiency generates severe impairments in performance at spatial working memory tests, characterized by a high occurrence of perseverative behaviors and a lack of decision making. This cognitive deficit is consecutive to PKA deregulation in the mPFC that prevents Ophn1 KO mice to exploit a correctly acquired rule. Functionally, mPFC neuronal networks appear to be affected in a PKA-dependent manner, whereas behaviorally important hippocampal projections were preserved by the mutation. Thus, we propose that discrete gene mutations in intellectual disability can generate "secondary" pathophysiological mechanisms prone to become pharmacological targets for curative strategies in adults. Copyright © 2017 the authors 0270-6474/17/3711114-13$15.00/0.

  9. Lanthanum chloride impairs spatial memory through ERK/MSK1 signaling pathway of hippocampus in rats.

    PubMed

    Liu, Huiying; Yang, Jinghua; Liu, Qiufang; Jin, Cuihong; Wu, Shengwen; Lu, Xiaobo; Zheng, Linlin; Xi, Qi; Cai, Yuan

    2014-12-01

    Rare earth elements (REEs) are used in many fields for their diverse physical and chemical properties. Surveys have shown that REEs can impair learning and memory in children and cause neurobehavioral defects in animals. However, the mechanism underlying these impairments has not yet been completely elucidated. Lanthanum (La) is often selected to study the effects of REEs. The aim of this study was to investigate the spatial memory impairments induced by lanthanum chloride (LaCl3) and the probable underlying mechanism. Wistar rats were exposed to LaCl3 in drinking water at 0 % (control, 0 mM), 0.25 % (18 mM), 0.50 % (36 mM), and 1.00 % (72 mM) from birth to 2 months after weaning. LaCl3 considerably impaired the spatial learning and memory of rats in the Morris water maze test, damaged the synaptic ultrastructure and downregulated the expression of p-MEK1/2, p-ERK1/2, p-MSK1, p-CREB, c-FOS and BDNF in the hippocampus. These results indicate that LaCl3 exposure impairs the spatial learning and memory of rats, which may be attributed to disruption of the synaptic ultrastructure and inhibition of the ERK/MSK1 signaling pathway in the hippocampus.

  10. Oligonol improves memory and cognition under an amyloid β(25-35)-induced Alzheimer's mouse model.

    PubMed

    Choi, Yoon Young; Maeda, Takahiro; Fujii, Hajime; Yokozawa, Takako; Kim, Hyun Young; Cho, Eun Ju; Shibamoto, Takayuki

    2014-07-01

    Alzheimer's disease is an age-dependent progressive neurodegenerative disorder that results in impairments of memory and cognitive function. It is hypothesized that oligonol has ameliorative effects on memory impairment and reduced cognitive functions in mice with Alzheimer's disease induced by amyloid β(25-35) (Aβ(25-35)) injection. The protective effect of an oligonol against Aβ(25-35)-induced memory impairment was investigated in an in vivo Alzheimer's mouse model. The aggregation of Aβ25-35 was induced by incubation at 37°C for 3 days before injection into mice brains (5 nmol/mouse), and then oligonol was orally administered at 100 and 200 mg/kg of body weight for 2 weeks. Memory and cognition were observed in T-maze, object recognition, and Morris water maze tests. The group injected with Aβ(25-35) showed impairments in both recognition and memory. However, novel object recognition and new route awareness abilities were dose dependently improved by the oral administration of oligonol. In addition, the results of the Morris water maze test indicated that oligonol exerted protective activity against cognitive impairment induced by Aβ(25-35). Furthermore, nitric oxide formation and lipid peroxidation were significantly elevated by Aβ(25-35), whereas oligonol treatment significantly decreased nitric oxide formation and lipid peroxidation in the brain, liver, and kidneys. The present results suggest that oligonol improves Aβ(25-35)-induced memory deficit and cognition impairment. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Under what conditions is recognition spared relative to recall after selective hippocampal damage in humans?

    PubMed

    Holdstock, J S; Mayes, A R; Roberts, N; Cezayirli, E; Isaac, C L; O'Reilly, R C; Norman, K A

    2002-01-01

    The claim that recognition memory is spared relative to recall after focal hippocampal damage has been disputed in the literature. We examined this claim by investigating object and object-location recall and recognition memory in a patient, YR, who has adult-onset selective hippocampal damage. Our aim was to identify the conditions under which recognition was spared relative to recall in this patient. She showed unimpaired forced-choice object recognition but clearly impaired recall, even when her control subjects found the object recognition task to be numerically harder than the object recall task. However, on two other recognition tests, YR's performance was not relatively spared. First, she was clearly impaired at an equivalently difficult yes/no object recognition task, but only when targets and foils were very similar. Second, YR was clearly impaired at forced-choice recognition of object-location associations. This impairment was also unrelated to difficulty because this task was no more difficult than the forced-choice object recognition task for control subjects. The clear impairment of yes/no, but not of forced-choice, object recognition after focal hippocampal damage, when targets and foils are very similar, is predicted by the neural network-based Complementary Learning Systems model of recognition. This model postulates that recognition is mediated by hippocampally dependent recollection and cortically dependent familiarity; thus hippocampal damage should not impair item familiarity. The model postulates that familiarity is ineffective when very similar targets and foils are shown one at a time and subjects have to identify which items are old (yes/no recognition). In contrast, familiarity is effective in discriminating which of similar targets and foils, seen together, is old (forced-choice recognition). Independent evidence from the remember/know procedure also indicates that YR's familiarity is normal. The Complementary Learning Systems model can also accommodate the clear impairment of forced-choice object-location recognition memory if it incorporates the view that the most complete convergence of spatial and object information, represented in different cortical regions, occurs in the hippocampus.

  12. The Nuclear Receptor AhR Controls Bone Homeostasis by Regulating Osteoclast Differentiation via the RANK/c-Fos Signaling Axis.

    PubMed

    Izawa, Takashi; Arakaki, Rieko; Mori, Hiroki; Tsunematsu, Takaaki; Kudo, Yasusei; Tanaka, Eiji; Ishimaru, Naozumi

    2016-12-15

    The aryl hydrocarbon receptor (AhR) pathway plays a key role in receptor activator of NF-κB ligand (RANKL)-mediated osteoclastogenesis. However, the mechanism underlying the regulation of AhR expression in osteoclasts and the signaling pathway through which AhR controls osteoclastogenesis remain unclear. We found that the expression of AhR in bone marrow-derived osteoclasts was upregulated by RANKL at an earlier stage than was the expression of signature osteoclast genes such as those encoding cathepsin K and NFAT, cytoplasmic, calcineurin-dependent 1. In response to RANKL, bone marrow macrophages isolated from AhR -/- mice exhibited impaired phosphorylation of Akt and MAPK as well as NF-κB, whereas their response to M-CSF remained unchanged. Osteoclast differentiation mediated by the AhR signaling pathway was also regulated in an RANKL/c-Fos-dependent manner. Furthermore, ligand activation of AhR by the smoke toxin benzo[a]pyrene accelerated osteoclast differentiation in a receptor-dependent manner, and AhR-dependent regulation of mitochondrial biogenesis in osteoclasts was observed. Moreover, AhR -/- mice exhibited impaired bone healing with delayed endochondral ossification. Taken together, the present results suggest that the RANKL/AhR/c-Fos signaling axis plays a critical role in osteoclastogenesis, thereby identifying the potential of AhR in treating pathological, inflammatory, or metabolic disorders of the bone. Copyright © 2016 by The American Association of Immunologists, Inc.

  13. Inflammatory Pain May Induce Cognitive Impairment Through an Interlukin-6-Dependent and Postsynaptic Density-95-Associated Mechanism

    PubMed Central

    Yang, Longqiu; Xin, Xin; Zhang, Jie; Zhang, Lei; Dong, Yuanlin; Zhang, Yiying; Mao, Jianren; Xie, Zhongcong

    2014-01-01

    Background Pain might be associated with cognitive impairment in humans. However, the characterization of such effects in a preclinical model and the investigation of the underlying mechanisms remain largely to be determined. We therefore sought to establish a system to determine the effect of pain on cognitive function in mice. Methods Complete Freund's adjuvant (CFA) was injected in the hindpaw of 5–8-month-old wild-type and interleukin-6 knockout mice. Learning and memory function, and the levels of interleukin-6 and postsynaptic density (PSD)-95 in the cortex and hippocampus of mice were assessed. Results We found that the CFA injection induced pain in the mice at 3 and 7 days after injection and decreased the freezing time [30.1 (16.5) seconds versus 56.8 (28.1) seconds, P = 0.023] in the tone test, which assesses the hippocampus-independent learning and memory function, but not in a context test of Fear Conditioning System [15.8 (6.7) seconds versus 18.6 (8.8) seconds, P = 0.622], which assesses the hippocampus-dependent learning and memory function, at 3 days after injection. Consistently, the CFA injection increased interleukin-6 [248% (11.6) versus 100% (7.9), P < 0.0001] and decreased the PSD-95 [40% (10.0) versus 100% (20.3), P < 0.0001] level in the cortex, but not hippocampus [95%(8.6) versus 100%(9.3), P = 0.634], in the mice. The CFA injection induced neither reduction in the cortex PSD-95 levels nor cognitive impairment in the interleukin-6 knockout mice. Conclusion These results suggest that pain induced by CFA injection might increase interleukin-6 levels and decrease PSD-95 levels in the cortex, but not hippocampus of mice, leading to hippocampus-independent cognitive impairment in mice. These findings call for further investigation to determine the role of pain in cognitive function. PMID:24878682

  14. Inflammatory pain may induce cognitive impairment through an interlukin-6-dependent and postsynaptic density-95-associated mechanism.

    PubMed

    Yang, Longqiu; Xin, Xin; Zhang, Jie; Zhang, Lei; Dong, Yuanlin; Zhang, Yiying; Mao, Jianren; Xie, Zhongcong

    2014-08-01

    Pain might be associated with cognitive impairment in humans. However, the characterization of such effects in a preclinical model and the investigation of the underlying mechanisms remain largely to be determined. We therefore sought to establish a system to determine the effect of pain on cognitive function in mice. Complete Freund's adjuvant (CFA) was injected in the hindpaw of 5- to 8-month-old wild-type and interleukin-6 knockout mice. Learning and memory function, and the levels of interleukin-6 and postsynaptic density (PSD)-95 in the cortex and hippocampus of mice were assessed. We found that the CFA injection-induced pain in the mice at 3 and 7 days after injection and decreased the freezing time (30.1 [16.5] vs 56.8 [28.1] seconds, P =0.023) in the tone test, which assesses the hippocampus-independent learning and memory function, but not in a context test of Fear Conditioning System (15.8 [6.7] vs 18.6 [8.8] seconds, P =0.622), which assesses the hippocampus-dependent learning and memory function, at 3 days after injection. Consistently, the CFA injection increased interleukin-6 (248% [11.6] vs 100% [7.9], P < 0.0001) and decreased the PSD-95 (40% [10.0] vs 100% [20.3], P < 0.0001) level in the cortex, but not hippocampus (95% [8.6] vs 100% [9.3], P =0.634), in the mice. The CFA injection induced neither reduction in the cortex PSD-95 levels nor cognitive impairment in the interleukin-6 knockout mice. These results suggest that pain induced by CFA injection might increase interleukin-6 levels and decrease PSD-95 levels in the cortex, but not hippocampus of mice, leading to hippocampus-independent cognitive impairment in mice. These findings call for further investigation to determine the role of pain in cognitive function.

  15. Dysfunctional SEMA3E signaling underlies gonadotropin-releasing hormone neuron deficiency in Kallmann syndrome.

    PubMed

    Cariboni, Anna; André, Valentina; Chauvet, Sophie; Cassatella, Daniele; Davidson, Kathryn; Caramello, Alessia; Fantin, Alessandro; Bouloux, Pierre; Mann, Fanny; Ruhrberg, Christiana

    2015-06-01

    Individuals with an inherited deficiency in gonadotropin-releasing hormone (GnRH) have impaired sexual reproduction. Previous genetic linkage studies and sequencing of plausible gene candidates have identified mutations associated with inherited GnRH deficiency, but the small number of affected families and limited success in validating candidates have impeded genetic diagnoses for most patients. Using a combination of exome sequencing and computational modeling, we have identified a shared point mutation in semaphorin 3E (SEMA3E) in 2 brothers with Kallmann syndrome (KS), which causes inherited GnRH deficiency. Recombinant wild-type SEMA3E protected maturing GnRH neurons from cell death by triggering a plexin D1-dependent (PLXND1-dependent) activation of PI3K-mediated survival signaling. In contrast, recombinant SEMA3E carrying the KS-associated mutation did not protect GnRH neurons from death. In murine models, lack of either SEMA3E or PLXND1 increased apoptosis of GnRH neurons in the developing brain, reducing innervation of the adult median eminence by GnRH-positive neurites. GnRH neuron deficiency in male mice was accompanied by impaired testes growth, a characteristic feature of KS. Together, these results identify SEMA3E as an essential gene for GnRH neuron development, uncover a neurotrophic function for SEMA3E in the developing brain, and elucidate SEMA3E/PLXND1/PI3K signaling as a mechanism that prevents GnRH neuron deficiency.

  16. Quantitative and Qualitative Differences in Neurocognitive Impairment Induced by 1 GeV 56Fe Ions and X-Rays

    NASA Astrophysics Data System (ADS)

    Britten, R.; Mitchell, S.; Parris, B.; Johnson, A.; Singletary-Britten, S.; Lonart, G.; Drake, R.

    2008-10-01

    During the planned mission to Mars, Astronauts will be exposed to heavy charged particles (Hze). Our group has been determining the relative biological effectiveness (RBE) of Hze (1 GeV 56Fe, LET = 150 kev/um) with respect to neurocognitive impairment, specifically spatial memory, short-term working memory and attentional set shifting. Our current data suggest that Hze have RBE values of about 7 for hippocampal-dependent spatial memory tasks (Barnes Maze) and possibly even higher for certain attentional processes. We have also used MALDI-TOF serum profiling analysis to identify several proteins that are biomarkers of both the level and LET of the radiation exposure, and biomarkers of cognitive performance. Our data suggest that Hze particles have a distinctly different impact upon neurocognitive function in rats than do X-rays. From a mission perspective, attentional set shifting is the neurocognitive function most likely to be impacted by the predicted Hze exposure; unfortunately Set shifting underlies our ability to execute complex plans. The proteins identified could be used to monitor the Astronauts for radiation exposure and any associated loss of neurocognitive function, and some may actually give an insight into the complex processes that lead to radiation-induced cognitive impairment.

  17. Hippocampal chromatin-modifying enzymes are pivotal for scopolamine-induced synaptic plasticity gene expression changes and memory impairment.

    PubMed

    Singh, Padmanabh; Konar, Arpita; Kumar, Ashish; Srivas, Sweta; Thakur, Mahendra K

    2015-08-01

    The amnesic potential of scopolamine is well manifested through synaptic plasticity gene expression changes and behavioral paradigms of memory impairment. However, the underlying mechanism remains obscure and consequently ideal therapeutic target is lacking. In this context, chromatin-modifying enzymes, which regulate memory gene expression changes, deserve major attention. Therefore, we analyzed the expression of chromatin-modifying enzymes and recovery potential of enzyme modulators in scopolamine-induced amnesia. Scopolamine administration drastically up-regulated DNA methyltransferases (DNMT1) and HDAC2 expression while CREB-binding protein (CBP), DNMT3a and DNMT3b remained unaffected. HDAC inhibitor sodium butyrate and DNMT inhibitor Aza-2'deoxycytidine recovered scopolamine-impaired hippocampal-dependent memory consolidation with concomitant increase in the expression of synaptic plasticity genes Brain-derived neurotrophic factor (BDNF) and Arc and level of histone H3K9 and H3K14 acetylation and decrease in DNA methylation level. Sodium butyrate showed more pronounced effect than Aza-2'deoxycytidine and their co-administration did not exhibit synergistic effect on gene expression. Taken together, we showed for the first time that scopolamine-induced up-regulation of chromatin-modifying enzymes, HDAC2 and DNMT1, leads to gene expression changes and consequent decline in memory consolidation. Our findings on the action of scopolamine as an epigenetic modulator can pave a path for ideal therapeutic targets. We propose the following putative pathway for scopolamine-mediated memory impairment; scopolamine up-regulates hippocampal DNMT1 and HDAC2 expression, induces methylation and deacetylation of BDNF and Arc promoter, represses gene expression and eventually impairs memory consolidation. On the other hand, Aza-2 and NaB inhibit DNMT1 and HDAC2 respectively, up-regulate BDNF and Arc expression and recover memory consolidation. We elucidate the action of scopolamine as an epigenetic modulator and hope that DNMT1 and HDAC2 would be ideal therapeutic targets for memory disorders. © 2015 International Society for Neurochemistry.

  18. 20 CFR 220.27 - What is needed to show an impairment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 20 Employees' Benefits 1 2013-04-01 2012-04-01 true What is needed to show an impairment. 220.27 Section 220.27 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Disability Under the Railroad Retirement Act for Any Regular Employment § 220.27 What...

  19. Platelet Kainate Receptor Signaling Promotes Thrombosis by Stimulating Cyclooxygenase Activation

    PubMed Central

    Sun, Henry; Swaim, AnneMarie; Herrera, Jesus Enrique; Becker, Diane; Becker, Lewis; Srivastava, Kalyan; Thompson, Laura E.; Shero, Michelle R.; Perez-Tamayo, Alita; Suktitpat, Bhoom; Mathias, Rasika; Contractor, Anis; Faraday, Nauder; Morrell, Craig N.

    2009-01-01

    Rationale Glutamate is a major signaling molecule that binds to glutamate receptors including the ionotropic glutamate receptors; kainate (KA) receptor (KAR), the N-methyl-D-aspartate (NMDA) receptor (NMDAR), and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each is well characterized in the central nervous system (CNS), but glutamate has important signaling roles in peripheral tissues as well, including a role in regulating platelet function. Objective Our previous work has demonstrated that glutamate is released by platelets in high concentrations within a developing thrombus and increases platelet activation and thrombosis. We now show that platelets express a functional KAR that drives increased agonist induced platelet activation. Methods and Results KAR induced increase in platelet activation is in part the result of activation of platelet cyclooxygenase (COX) in a Mitogen Activated Protein Kinase (MAPK) dependent manner. Platelets derived from KA receptor subunit knockout mice (GluR6−/−) are resistant to KA effects and have a prolonged time to thrombosis in vivo. Importantly, we have also identified polymorphisms in KA receptor subunits that are associated with phenotypic changes in platelet function in a large group of Caucasians and African Americans. Conclusion Our data demonstrate that glutamate regulation of platelet activation is in part COX dependent, and suggest that the KA receptor is a novel anti-thrombotic target. PMID:19679838

  20. A Taz1- and Microtubule-Dependent Regulatory Relationship between Telomere and Centromere Positions in Bouquet Formation Secures Proper Meiotic Divisions

    PubMed Central

    Katsumata, Kazuhiro; Hirayasu, Ami; Miyoshi, Junpei; Nishi, Eriko; Ichikawa, Kento; Tateho, Kazuki; Wakuda, Airi; Matsuhara, Hirotada; Yamamoto, Ayumu

    2016-01-01

    During meiotic prophase, telomeres cluster, forming the bouquet chromosome arrangement, and facilitate homologous chromosome pairing. In fission yeast, bouquet formation requires switching of telomere and centromere positions. Centromeres are located at the spindle pole body (SPB) during mitotic interphase, and upon entering meiosis, telomeres cluster at the SPB, followed by centromere detachment from the SPB. Telomere clustering depends on the formation of the microtubule-organizing center at telomeres by the linker of nucleoskeleton and cytoskeleton complex (LINC), while centromere detachment depends on disassembly of kinetochores, which induces meiotic centromere formation. However, how the switching of telomere and centromere positions occurs during bouquet formation is not fully understood. Here, we show that, when impaired telomere interaction with the LINC or microtubule disruption inhibited telomere clustering, kinetochore disassembly-dependent centromere detachment and accompanying meiotic centromere formation were also inhibited. Efficient centromere detachment required telomere clustering-dependent SPB recruitment of a conserved telomere component, Taz1, and microtubules. Furthermore, when artificial SPB recruitment of Taz1 induced centromere detachment in telomere clustering-defective cells, spindle formation was impaired. Thus, detachment of centromeres from the SPB without telomere clustering causes spindle impairment. These findings establish novel regulatory mechanisms, which prevent concurrent detachment of telomeres and centromeres from the SPB during bouquet formation and secure proper meiotic divisions. PMID:27611693

  1. The spatial range of contour integration deficits in schizophrenia

    PubMed Central

    Silverstein, Steven M.; Barch, Deanna M.; Carter, Cameron S.; Gold, James M.; Kovács, Ilona; MacDonald, Angus W.; Ragland, J. Daniel; Strauss, Milton E.

    2012-01-01

    Contour integration (CI) refers to the process that represents spatially separated elements as a unified edge or closed shape. Schizophrenia is a psychiatric disorder characterized by symptoms such as hallucinations, delusions, disorganized thinking, inappropriate affect, and social withdrawal. Persons with schizophrenia are impaired at CI, but the specific mechanisms underlying the deficit are still not clear. Here, we explored the hypothesis that poor patient performance owes to reduced feedback or impaired longer-range lateral connectivity within early visual cortex—functionally similar to that found in 5- to 6-year old children. This hypothesis predicts that as target element spacing increases from .7 to 1.4° of visual angle, patient impairments will become more pronounced. As a test of the prediction, 25 healthy controls and 36 clinically stable, asymptomatic persons with schizophrenia completed a CI task that involved determining whether a subset of Gabor elements formed a leftward or rightward pointing shape. Adjacent shape elements were spaced at either .7 or 1.4° of visual angle. Difficulty in each spacing condition depended on the number of noise elements present. Patients performed worse than controls overall, both groups performed worse with the larger spacing, and the magnitude of the between-group difference was not amplified at the larger spacing. These results show that CI deficits in schizophrenia cannot be explained in terms of a reduced spatial range of integration, at least not when the shape elements are spaced within 1.5°. Later-developing, low-level integrative mechanisms of lateral connectivity and feedback appear not to be differentially impaired in the illness. PMID:22710617

  2. Impaired delay eyeblink conditioning in amnesic Korsakoff's patients and recovered alcoholics.

    PubMed

    McGlinchey-Berroth, R; Cermak, L S; Carrillo, M C; Armfield, S; Gabrieli, J D; Disterhoft, J F

    1995-10-01

    The performance of amnesic Korsakoff patients in delay eyeblink classical conditioning was compared with that of recovered chronic alcoholic subjects and healthy normal control subjects. Normal control subjects exhibited acquisition of conditioned responses (CRs) to a previously neutral, conditioned tone stimulus (CS) following repeated pairings with an unconditioned air-puff stimulus, and demonstrated extinction of CRs when the CS was subsequently presented alone. Both amnesic Korsakoff patients and recovered chronic alcoholic subjects demonstrated an impairment in their ability to acquire CRs. These results indicate that the preservation of delay eyeblink conditioning in amnesia must depend on the underlying neuropathology of the amnesic syndrome. It is known that patients with amnesia caused by medial temporal lobe pathology have preserved conditioning. We have now demonstrated that patients with amnesia caused by Korsakoff's syndrome, as well as recovered chronic alcoholic subjects, have impaired conditioning. This impairment is most likely caused by cerebellar deterioration resulting from years of alcohol abuse.

  3. Evidence of an amnesia-like cued-recall memory impairment in nondementing idiopathic Parkinson's disease.

    PubMed

    Edelstyn, Nicola M J; John, Christopher M; Shepherd, Thomas A; Drakeford, Justine L; Clark-Carter, David; Ellis, Simon J; Mayes, Andrew R

    2015-10-01

    Medicated, non-dementing mild-to-moderate Parkinson's disease (PD) patients usually show recall/recollection impairments but have only occasionally shown familiarity impairments. We aimed to assess two explanations of this pattern of impairment. Recollection typically improves when effortful planning of encoding and retrieval processing is engaged. This depends on prefrontally-dependent executive processes, which are often disrupted in PD. Relative to an unguided encoding and retrieval of words condition (C1), giving suitable guidance at encoding alone (C2) or at encoding and retrieval (C3) should, if executive processes are disrupted, improve PD recollection more than control recollection and perhaps raise it to normal levels. Familiarity, being a relatively automatic kind of memory, whether impaired or intact, should be unaffected by guidance. According to the second explanation, PD deficits are amnesia-like and caused by medial temporal lobe dysfunction and although poorer recollection, which is caused by hippocampal disruption, may be improved by guidance, it should not improve more than control recollection. Familiarity impairment will also occur if the perirhinal cortex is disrupted, but will be unimproved by guidance. Without guidance, recollection/recall was impaired in thirty PD patients relative to twenty-two healthy controls and remained relatively equally impaired when full guidance was provided (C1 vs C3), both groups improving to broadly the same extent. Although impaired, and markedly less so than recollection, familiarity was not improved by guidance in both groups. The patients showed elevated rates of subclinical depressive symptoms, which weakly correlated with recall/recollection in all three conditions. PD executive function was also deficient and correlated with unguided/C1 recollection only. Our results are consistent with a major cause of the patients' recall/recollection impairments being hippocampal disruption, probably exacerbated by subclinical depressive symptoms. However, the results do not exclude a lesser prefrontal cortex contribution because patient executive functions were impaired and correlated solely with unguided overall recollection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. GPER Mediates Functional Endothelial Aging in Renal Arteries.

    PubMed

    Meyer, Matthias R; Rosemann, Thomas; Barton, Matthias; Prossnitz, Eric R

    2017-01-01

    Aging is associated with impaired renal artery function, which is partly characterized by arterial stiffening and a reduced vasodilatory capacity due to excessive generation of reactive oxygen species by NADPH oxidases (Nox). The abundance and activity of Nox depends on basal activity of the heptahelical transmembrane receptor GPER; however, whether GPER contributes to age-dependent functional changes in renal arteries is unknown. This study investigated the effect of aging and Nox activity on renal artery tone in wild-type and GPER-deficient (Gper-/-) mice (4 and 24 months old). In wild-type mice, aging markedly impaired endothelium-dependent, nitric oxide (NO)-mediated relaxations to acetylcholine, which were largely preserved in renal arteries of aged Gper-/- mice. The Nox inhibitor gp91ds-tat abolished this difference by greatly enhancing relaxations in wild-type mice, while having no effect in Gper-/- mice. Contractions to angiotensin II and phenylephrine in wild-type mice were partly sensitive to gp91ds-tat but unaffected by aging. Again, deletion of GPER abolished effects of Nox inhibition on contractile responses. In conclusion, basal activity of GPER is required for the age-dependent impairment of endothelium-dependent, NO-mediated relaxation in the renal artery. Restoration of relaxation by a Nox inhibitor in aged wild-type but not Gper-/- mice strongly supports a role for Nox-derived reactive oxygen species as the underlying cause. Pharmacological blockers of GPER signaling may thus be suitable to inhibit functional endothelial aging of renal arteries by reducing Nox-derived oxidative stress and, possibly, the associated age-dependent deterioration of kidney function. © 2017 S. Karger AG, Basel.

  5. Zinc transporter ZnT-3 regulates presynaptic Erk1/2 signaling and hippocampus-dependent memory.

    PubMed

    Sindreu, Carlos; Palmiter, Richard D; Storm, Daniel R

    2011-02-22

    The physiological role of vesicular zinc at central glutamatergic synapses remains poorly understood. Here we show that mice lacking the synapse-specific vesicular zinc transporter ZnT3 (ZnT3KO mice) have reduced activation of the Erk1/2 MAPK in hippocampal mossy fiber terminals, disinhibition of zinc-sensitive MAPK tyrosine phosphatase activity, and impaired MAPK signaling during hippocampus-dependent learning. Activity-dependent exocytosis is required for the effect of zinc on presynaptic MAPK and phosphatase activity. ZnT3KO mice have complete deficits in contextual discrimination and spatial working memory. Local blockade of zinc or MAPK in the mossy fiber pathway of wild-type mice impairs contextual discrimination. We conclude that ZnT3 is important for zinc homeostasis modulating presynaptic MAPK signaling and is required for hippocampus-dependent memory.

  6. Zinc transporter ZnT-3 regulates presynaptic Erk1/2 signaling and hippocampus-dependent memory

    PubMed Central

    Sindreu, Carlos; Palmiter, Richard D.; Storm, Daniel R.

    2011-01-01

    The physiological role of vesicular zinc at central glutamatergic synapses remains poorly understood. Here we show that mice lacking the synapse-specific vesicular zinc transporter ZnT3 (ZnT3KO mice) have reduced activation of the Erk1/2 MAPK in hippocampal mossy fiber terminals, disinhibition of zinc-sensitive MAPK tyrosine phosphatase activity, and impaired MAPK signaling during hippocampus-dependent learning. Activity-dependent exocytosis is required for the effect of zinc on presynaptic MAPK and phosphatase activity. ZnT3KO mice have complete deficits in contextual discrimination and spatial working memory. Local blockade of zinc or MAPK in the mossy fiber pathway of wild-type mice impairs contextual discrimination. We conclude that ZnT3 is important for zinc homeostasis modulating presynaptic MAPK signaling and is required for hippocampus-dependent memory. PMID:21245308

  7. Supplemental Carbon Dioxide Stabilizes the Upper Airway in Volunteers Anesthetized with Propofol.

    PubMed

    Ruscic, Katarina Jennifer; Bøgh Stokholm, Janne; Patlak, Johann; Deng, Hao; Simons, Jeroen Cedric Peter; Houle, Timothy; Peters, Jürgen; Eikermann, Matthias

    2018-05-10

    Propofol impairs upper airway dilator muscle tone and increases upper airway collapsibility. Preclinical studies show that carbon dioxide decreases propofol-mediated respiratory depression. We studied whether elevation of end-tidal carbon dioxide (PETCO2) via carbon dioxide insufflation reverses the airway collapsibility (primary hypothesis) and impaired genioglossus muscle electromyogram that accompany propofol anesthesia. We present a prespecified, secondary analysis of previously published experiments in 12 volunteers breathing via a high-flow respiratory circuit used to control upper airway pressure under propofol anesthesia at two levels, with the deep level titrated to suppression of motor response. Ventilation, mask pressure, negative pharyngeal pressure, upper airway closing pressure, genioglossus electromyogram, bispectral index, and change in end-expiratory lung volume were measured as a function of elevation of PETCO2 above baseline and depth of propofol anesthesia. PETCO2 augmentation dose-dependently lowered upper airway closing pressure with a decrease of 3.1 cm H2O (95% CI, 2.2 to 3.9; P < 0.001) under deep anesthesia, indicating improved upper airway stability. In parallel, the phasic genioglossus electromyogram increased by 28% (23 to 34; P < 0.001). We found that genioglossus electromyogram activity was a significant modifier of the effect of PETCO2 elevation on closing pressure (P = 0.005 for interaction term). Upper airway collapsibility induced by propofol anesthesia can be reversed in a dose-dependent manner by insufflation of supplemental carbon dioxide. This effect is at least partly mediated by increased genioglossus muscle activity.

  8. Self-imagining enhances recognition memory in memory-impaired individuals with neurological damage.

    PubMed

    Grilli, Matthew D; Glisky, Elizabeth L

    2010-11-01

    The ability to imagine an elaborative event from a personal perspective relies on several cognitive processes that may potentially enhance subsequent memory for the event, including visual imagery, semantic elaboration, emotional processing, and self-referential processing. In an effort to find a novel strategy for enhancing memory in memory-impaired individuals with neurological damage, we investigated the mnemonic benefit of a method we refer to as self-imagining-the imagining of an event from a realistic, personal perspective. Fourteen individuals with neurologically based memory deficits and 14 healthy control participants intentionally encoded neutral and emotional sentences under three instructions: structural-baseline processing, semantic processing, and self-imagining. Findings revealed a robust "self-imagination effect (SIE)," as self-imagination enhanced recognition memory relative to deep semantic elaboration in both memory-impaired individuals, F(1, 13) = 32.11, p < .001, η2 = .71; and healthy controls, F(1, 13) = 5.57, p < .05, η2 = .30. In addition, results indicated that mnemonic benefits of self-imagination were not limited by severity of the memory disorder nor were they related to self-reported vividness of visual imagery, semantic processing, or emotional content of the materials. The findings suggest that the SIE may depend on unique mnemonic mechanisms possibly related to self-referential processing and that imagining an event from a personal perspective makes that event particularly memorable even for those individuals with severe memory deficits. Self-imagining may thus provide an effective rehabilitation strategy for individuals with memory impairment.

  9. The Cytoskeleton and the Peroxisomal-Targeted SNOWY COTYLEDON3 Protein Are Required for Chloroplast Development in Arabidopsis[W

    PubMed Central

    Albrecht, Verónica; Šimková, Klára; Carrie, Chris; Delannoy, Etienne; Giraud, Estelle; Whelan, Jim; Small, Ian David; Apel, Klaus; Badger, Murray R.; Pogson, Barry James

    2010-01-01

    Here, we describe the snowy cotyledon3 (sco3-1) mutation, which impairs chloroplast and etioplast development in Arabidopsis thaliana seedlings. SCO3 is a member of a largely uncharacterized protein family unique to the plant kingdom. The sco3-1 mutation alters chloroplast morphology and development, reduces chlorophyll accumulation, impairs thylakoid formation and photosynthesis in seedlings, and results in photoinhibition under extreme CO2 concentrations in mature leaves. There are no readily apparent changes to chloroplast biology, such as transcription or assembly that explain the disruption to chloroplast biogenesis. Indeed, SCO3 is actually targeted to another organelle, specifically to the periphery of peroxisomes. However, impaired chloroplast development cannot be attributed to perturbed peroxisomal metabolic processes involving germination, fatty acid β-oxidation or photorespiration, though there are so far undescribed changes in low and high CO2 sensitivity in seedlings and young true leaves. Many of the chloroplasts are bilobed, and some have persistent membranous extensions that encircle other cellular components. Significantly, there are changes to the cytoskeleton in sco3-1, and microtubule inhibitors have similar effects on chloroplast biogenesis as sco3-1 does. The localization of SCO3 to the periphery of the peroxisomes was shown to be dependent on a functional microtubule cytoskeleton. Therefore, the microtubule and peroxisome-associated SCO3 protein is required for chloroplast development, and sco3-1, along with microtubule inhibitors, demonstrates an unexpected role for the cytoskeleton and peroxisomes in chloroplast biogenesis. PMID:20978221

  10. The Pseudomonas fluorescens Siderophore Pyoverdine Weakens Arabidopsis thaliana Defense in Favor of Growth in Iron-Deficient Conditions1

    PubMed Central

    Trapet, Pauline; Avoscan, Laure; Klinguer, Agnès; Pateyron, Stéphanie; Chervin, Christian; Mazurier, Sylvie; Lemanceau, Philippe; Wendehenne, David; Besson-Bard, Angélique

    2016-01-01

    Pyoverdines are siderophores synthesized by fluorescent Pseudomonas spp. Under iron-limiting conditions, these high-affinity ferric iron chelators are excreted by bacteria in the soil to acquire iron. Pyoverdines produced by beneficial Pseudomonas spp. ameliorate plant growth. Here, we investigate the physiological incidence and mode of action of pyoverdine from Pseudomonas fluorescens C7R12 on Arabidopsis (Arabidopsis thaliana) plants grown under iron-sufficient or iron-deficient conditions. Pyoverdine was provided to the medium in its iron-free structure (apo-pyoverdine), thus mimicking a situation in which it is produced by bacteria. Remarkably, apo-pyoverdine abolished the iron-deficiency phenotype and restored the growth of plants maintained in the iron-deprived medium. In contrast to a P. fluorescens C7R12 strain impaired in apo-pyoverdine production, the wild-type C7R12 reduced the accumulation of anthocyanins in plants grown in iron-deficient conditions. Under this condition, apo-pyoverdine modulated the expression of around 2,000 genes. Notably, apo-pyoverdine positively regulated the expression of genes related to development and iron acquisition/redistribution while it repressed the expression of defense-related genes. Accordingly, the growth-promoting effect of apo-pyoverdine in plants grown under iron-deficient conditions was impaired in iron-regulated transporter1 and ferric chelate reductase2 knockout mutants and was prioritized over immunity, as highlighted by an increased susceptibility to Botrytis cinerea. This process was accompanied by an overexpression of the transcription factor HBI1, a key node for the cross talk between growth and immunity. This study reveals an unprecedented mode of action of pyoverdine in Arabidopsis and demonstrates that its incidence on physiological traits depends on the plant iron status. PMID:26956666

  11. Thyroid Hormone-Dependent Formation of a Subcortical Band Heterotopia (SBH) in the Neonatal Brain is not Exacerbated Under Conditions of Low Dietary Iron (FeD)

    EPA Science Inventory

    Although the critical role of thyroid hormone (TH) in brain development is well established - severe deficiency producing significant neurological dysfunction - there is a paucity of data on neurological impairments that accompany modest degrees of TH disruption. Quantitative m...

  12. Low-oxygen tensions found in Salmonella-infected gut tissue boost Salmonella replication in macrophages by impairing antimicrobial activity and augmenting Salmonella virulence.

    PubMed

    Jennewein, Jonas; Matuszak, Jasmin; Walter, Steffi; Felmy, Boas; Gendera, Kathrin; Schatz, Valentin; Nowottny, Monika; Liebsch, Gregor; Hensel, Michael; Hardt, Wolf-Dietrich; Gerlach, Roman G; Jantsch, Jonathan

    2015-12-01

    In Salmonella infection, the Salmonella pathogenicity island-2 (SPI-2)-encoded type three secretion system (T3SS2) is of key importance for systemic disease and survival in host cells. For instance, in the streptomycin-pretreated mouse model SPI-2-dependent Salmonella replication in lamina propria CD11c(-)CXCR1(-) monocytic phagocytes/macrophages (MΦ) is required for the development of colitis. In addition, containment of intracellular Salmonella in the gut critically depends on the antimicrobial effects of the phagocyte NADPH oxidase (PHOX), and possibly type 2 nitric oxide synthase (NOS2). For both antimicrobial enzyme complexes, oxygen is an essential substrate. However, the amount of available oxygen upon enteroinvasive Salmonella infection in the gut tissue and its impact on Salmonella-MΦ interactions was unknown. Therefore, we measured the gut tissue oxygen levels in a model of Salmonella enterocolitis using luminescence two-dimensional in vivo oxygen imaging. We found that gut tissue oxygen levels dropped from ∼78 Torr (∼11% O2) to values of ∼16 Torr (∼2% O2) during infection. Because in vivo virulence of Salmonella depends on the Salmonella survival in MΦ, Salmonella-MΦ interaction was analysed under such low oxygen values. These experiments revealed an increased intracellular replication and survival of wild-type and t3ss2 non-expressing Salmonella. These findings were paralleled by blunted nitric oxide and reactive oxygen species (ROS) production and reduced Salmonella ROS perception. In addition, hypoxia enhanced SPI-2 transcription and translocation of SPI-2-encoded virulence protein. Neither pharmacological blockade of PHOX and NOS2 nor impairment of T3SS2 virulence function alone mimicked the effect of hypoxia on Salmonella replication under normoxic conditions. However, if t3ss2 non-expressing Salmonella were used, hypoxia did not further enhance Salmonella recovery in a PHOX and NOS2-deficient situation. Hence, these data suggest that hypoxia-induced impairment of antimicrobial activity and Salmonella virulence cooperate to allow for enhanced Salmonella replication in MΦ. © 2015 John Wiley & Sons Ltd.

  13. Impaired angiogenesis in aminopeptidase N-null mice

    PubMed Central

    Rangel, Roberto; Sun, Yan; Guzman-Rojas, Liliana; Ozawa, Michael G.; Sun, Jessica; Giordano, Ricardo J.; Van Pelt, Carolyn S.; Tinkey, Peggy T.; Behringer, Richard R.; Sidman, Richard L.; Arap, Wadih; Pasqualini, Renata

    2007-01-01

    Aminopeptidase N (APN, CD13; EC 3.4.11.2) is a transmembrane metalloprotease with several functions, depending on the cell type and tissue environment. In tumor vasculature, APN is overexpressed in the endothelium and promotes angiogenesis. However, there have been no reports of in vivo inactivation of the APN gene to validate these findings. Here we evaluated, by targeted disruption of the APN gene, whether APN participates in blood vessel formation and function under normal conditions. Surprisingly, APN-null mice developed with no gross or histological abnormalities. Standard neurological, cardiovascular, metabolic, locomotor, and hematological studies revealed no alterations. Nonetheless, in oxygen-induced retinopathy experiments, APN-deficient mice had a marked and dose-dependent deficiency of the expected retinal neovascularization. Moreover, gelfoams embedded with growth factors failed to induce functional blood vessel formation in APN-null mice. These findings establish that APN-null mice develop normally without physiological alterations and can undergo physiological angiogenesis but show a severely impaired angiogenic response under pathological conditions. Finally, in addition to vascular biology research, APN-null mice may be useful reagents in other medical fields such as malignant, cardiovascular, immunological, or infectious diseases. PMID:17360568

  14. R-Ras Contributes to LTP and Contextual Discrimination

    PubMed Central

    Darcy, Michael J.; Jin, Shan-Xue; Feig, Larry A.

    2014-01-01

    The ability to discriminate between closely related contexts is a specific form of hippocampal-dependent learning that may be impaired in certain neurodegenerative disorders such as Alzheimer's and Down Syndrome. However, signaling pathways regulating this form of learning are poorly understood. Previous studies have shown that the calcium-dependent exchange factor Ras-GRF1, an activator of Rac, Ras and R-Ras GTPases, is important for this form of learning and memory. Moreover, the ability to discriminate contexts was linked to the ability of Ras-GRF1 to promote high-frequency stimulation (HFS)-LTP via the activation of p38 Map kinase. Here, we show that R-Ras is involved in this form of learning by using virally-delivered miRNAs targeting R-Ras into the CA1 region of dorsal hippocampus and observing impaired contextual discrimination. Like the loss of GRF1, knockdown of R-Ras in the CA1 also impairs the induction of HFS-LTP and p38 Map kinase. Nevertheless, experiments indicate that this involvement of R-Ras in HFS-LTP that is required for contextual discrimination is independent of Ras-GRF1. Thus, R-Ras is a novel regulator of a form of hippocampal-dependent LTP as well as learning and memory that is affected in certain forms of neurodegenerative diseases. PMID:25043327

  15. Antibacterial Activity of Polyphenols: Structure-Activity Relationship and Influence of Hyperglycemic Condition.

    PubMed

    Xie, Yixi; Chen, Jing; Xiao, Aiping; Liu, Liangliang

    2017-11-06

    Polyphenols are plant-derived natural products with well-documented health benefits to human beings, such as antibacterial activities. However, the antibacterial activities of polyphenols under hyperglycemic conditions have been rarely studied, which could be relevant to their antibacterial efficacy in disease conditions, such as in diabetic patients. Herein, the antibacterial activities of 38 polyphenols under mimicked hyperglycemic conditions were evaluated. The structure-antibacterial activity relationships of polyphenols were also tested and analyzed. The presence of glucose apparently promoted the growth of the bacterial strains tested in this study. The OD600 values of tested bacteria strains increased from 1.09-fold to 1.49-fold by adding 800 mg/dL glucose. The polyphenols showed structurally dependent antibacterial activities, which were significantly impaired under the hyperglycemic conditions. The results from this study indicated that high blood glucose might promote bacterial infection, and the hyperglycemic conditions resulting from diabetes were likely to suppress the antibacterial benefits of polyphenols.

  16. Impaired spatial processing in a mouse model of fragile X syndrome.

    PubMed

    Ghilan, Mohamed; Bettio, Luis E B; Noonan, Athena; Brocardo, Patricia S; Gil-Mohapel, Joana; Christie, Brian R

    2018-05-17

    Fragile X syndrome (FXS) is the most common form of inherited intellectual impairment. The Fmr1 -/y mouse model has been previously shown to have deficits in context discrimination tasks but not in the elevated plus-maze. To further characterize this FXS mouse model and determine whether hippocampal-mediated behaviours are affected in these mice, dentate gyrus (DG)-dependent spatial processing and Cornu ammonis 1 (CA1)-dependent temporal order discrimination tasks were evaluated. In agreement with previous findings of long-term potentiation deficits in the DG of this transgenic model of FXS, the results reported here demonstrate that Fmr1 -/y mice perform poorly in the DG-dependent metric change spatial processing task. However, Fmr1 -/y mice did not present deficits in the CA1-dependent temporal order discrimination task, and were able to remember the order in which objects were presented to them to the same extent as their wild-type littermate controls. These data suggest that the previously reported subregional-specific differences in hippocampal synaptic plasticity observed in the Fmr1 -/y mouse model may manifest as selective behavioural deficits in hippocampal-dependent tasks. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  17. Altered expression of genes involved in GABAergic transmission and neuromodulation of granule cell activity in the cerebellum of schizophrenia patients.

    PubMed

    Bullock, W Michael; Cardon, Karen; Bustillo, Juan; Roberts, Rosalinda C; Perrone-Bizzozero, Nora I

    2008-12-01

    Deficits in gamma-aminobutyric acid (GABA) signaling have been described in the prefrontal cortex, limbic system, and cerebellum in individuals with schizophrenia. The purpose of the present study was to further investigate cerebellar gene expression alterations as they relate to decreases in GABAergic transmission by examining the expression of GABAergic markers, N-methyl-d-aspartic-acid (NMDA) receptor subunits, and cerebellum neuromodulators in individuals with schizophrenia. Subjects were postmortem men with a diagnosis of schizophrenia (N=13) and a postmortem interval-matched non-psychiatric male comparison group (N=13). The authors utilized real-time-quantitative polymerase chain reaction (PCR) to measure mRNA levels of the following GABAergic markers: glutamic acid decarboxylase (GAD) 65 and 67; GABA plasma membrane transporter-1 (GAT-1); GABA type A (GABA(A)) receptor subunits alpha(6), beta(3), and delta; and parvalbumin. In addition, real-time-quantitative PCR was utilized to assess mRNA levels of the NMDA receptor (NR) subunits NR1, NR2-A, NR2-B, NR2-C, and NR2-D as well as the cerebellar neuromodulators glutamate receptor (GluR)-6, kainate-preferring glutamate receptor subunit-2 (KA2), metabotropic glutamate receptor (mGluR)-2 and mGluR3, and neuronal nitric oxide synthase. Measurements for mRNA levels were determined using lateral cerebellar hemisphere tissue from both schizophrenia and comparison subjects. Schizophrenia subjects showed significant decreases in mRNA levels of GAD(67), GAD(65), GAT-1, mGluR2, and neuronal nitric oxide synthase. Increases in GABA(A)-alpha(6 )and GABA(A)-delta as well as GluR6 and KA2 were also observed. Medication effects on the expression of the same genes were examined in rats treated with either haloperidol (Sprague-Dawley rats [N=16]) or clozapine (Long-Evans rats [N=20]). Both haloperidol and clozapine increased the levels of GAD(67) in the cerebellum and altered the expression of other cerebellar mRNAs. These findings suggest that GABA transmission is decreased in the cerebellar cortices in individuals with schizophrenia and additional gene expression changes may reflect an attempt to increase GABA neurotransmission at the cerebellar glomerulus.

  18. Intact renewal after extinction of conditioned suppression with lesions of either the retrosplenial cortex or dorsal hippocampus.

    PubMed

    Todd, Travis P; Jiang, Matthew Y; DeAngeli, Nicole E; Bucci, David J

    2017-03-01

    Extinction of fear to a Pavlovian conditioned stimulus (CS) is known to be context-specific. When the CS is tested outside the context of extinction, fear returns, or renews. Several studies have demonstrated that renewal depends upon the hippocampus, although there are also studies where renewal was not impacted by hippocampal damage, suggesting that under some conditions context encoding and/or retrieval of extinction depends upon other regions. One candidate region is the retrosplenial cortex (RSC), which is known to contribute to contextual and spatial learning and memory. Using a conditioned-suppression paradigm, Experiment 1 tested the impact of pre-training RSC lesions on renewal of extinguished fear. Consistent with previous studies, lesions of the RSC did not impact acquisition or extinction of conditioned fear to the CS. Further, there was no evidence that RSC lesions impaired renewal, indicating that contextual encoding and/or retrieval of extinction does not depend upon the RSC. In Experiment 2, post-extinction lesions of either the RSC or dorsal hippocampus (DH) also had no impact on renewal. However, in Experiment 3, both RSC and DH lesions did impair performance in an object-in-place procedure, an index of place memory. RSC and DH contributions to extinction and renewal are discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Thalamic reticular impairment underlies attention deficit in Ptchd1(Y/-) mice.

    PubMed

    Wells, Michael F; Wimmer, Ralf D; Schmitt, L Ian; Feng, Guoping; Halassa, Michael M

    2016-04-07

    Developmental disabilities, including attention-deficit hyperactivity disorder (ADHD), intellectual disability (ID), and autism spectrum disorders (ASD), affect one in six children in the USA. Recently, gene mutations in patched domain containing 1 (PTCHD1) have been found in ~1% of patients with ID and ASD. Individuals with PTCHD1 deletion show symptoms of ADHD, sleep disruption, hypotonia, aggression, ASD, and ID. Although PTCHD1 is probably critical for normal development, the connection between its deletion and the ensuing behavioural defects is poorly understood. Here we report that during early post-natal development, mouse Ptchd1 is selectively expressed in the thalamic reticular nucleus (TRN), a group of GABAergic neurons that regulate thalamocortical transmission, sleep rhythms, and attention. Ptchd1 deletion attenuates TRN activity through mechanisms involving small conductance calcium-dependent potassium currents (SK). TRN-restricted deletion of Ptchd1 leads to attention deficits and hyperactivity, both of which are rescued by pharmacological augmentation of SK channel activity. Global Ptchd1 deletion recapitulates learning impairment, hyper-aggression, and motor defects, all of which are insensitive to SK pharmacological targeting and not found in the TRN-restricted deletion mouse. This study maps clinically relevant behavioural phenotypes onto TRN dysfunction in a human disease model, while also identifying molecular and circuit targets for intervention.

  20. The contribution of chronic diseases to the prevalence of dependence among older people in Latin America, China and India: a 10/66 Dementia Research Group population-based survey.

    PubMed

    Sousa, Renata M; Ferri, Cleusa P; Acosta, Daisy; Guerra, Mariella; Huang, Yueqin; Jacob, Ks; Jotheeswaran, At; Hernandez, Milagros A Guerra; Liu, Zhaorui; Pichardo, Guillermina Rodriguez; Rodriguez, Juan J Llibre; Salas, Aquiles; Sosa, Ana Luisa; Williams, Joseph; Zuniga, Tirso; Prince, Martin

    2010-08-06

    The number of older people is set to increase dramatically worldwide. Demographic changes are likely to result in the rise of age-related chronic diseases which largely contribute to years lived with a disability and future dependence. However dependence is much less studied although intrinsically linked to disability. We investigated the prevalence and correlates of dependence among older people from middle income countries. A one-phase cross-sectional survey was carried out at 11 sites in seven countries (urban sites in Cuba, Venezuela, and Dominican Republic, urban and rural sites in Peru, Mexico, China and India). All those aged 65 years and over living in geographically defined catchment areas were eligible. In all, 15,022 interviews were completed with an informant interview for each participant. The full 10/66 Dementia Research Group survey protocol was applied, including ascertainment of depression, dementia, physical impairments and self-reported diagnoses. Dependence was interviewer-rated based on a key informant's responses to a set of open-ended questions on the participant's needs for care. We estimated the prevalence of dependence and the independent contribution of underlying health conditions. Site-specific prevalence ratios were meta-analysed, and population attributable prevalence fractions (PAPF) calculated. The prevalence of dependence increased with age at all sites, with a tendency for the prevalence to be lower in men than in women. Age-standardised prevalence was lower in all sites than in the USA. Other than in rural China, dementia made the largest independent contribution to dependence, with a median PAPF of 34% (range 23%-59%). Other substantial contributors were limb impairment (9%, 1%-46%), stroke (8%, 2%-17%), and depression (8%, 1%-27%). The demographic and health transitions will lead to large and rapid increases in the numbers of dependent older people particularly in middle income countries (MIC). The prevention and control of chronic neurological and neuropsychiatric diseases and the development of long-term care policies and plans should be urgent priorities.

  1. "The contribution of chronic diseases to the prevalence of dependence among older people in Latin America, China and India: a 10/66 Dementia Research Group population-based survey"

    PubMed Central

    2010-01-01

    Background The number of older people is set to increase dramatically worldwide. Demographic changes are likely to result in the rise of age-related chronic diseases which largely contribute to years lived with a disability and future dependence. However dependence is much less studied although intrinsically linked to disability. We investigated the prevalence and correlates of dependence among older people from middle income countries. Methods A one-phase cross-sectional survey was carried out at 11 sites in seven countries (urban sites in Cuba, Venezuela, and Dominican Republic, urban and rural sites in Peru, Mexico, China and India). All those aged 65 years and over living in geographically defined catchment areas were eligible. In all, 15,022 interviews were completed with an informant interview for each participant. The full 10/66 Dementia Research Group survey protocol was applied, including ascertainment of depression, dementia, physical impairments and self-reported diagnoses. Dependence was interviewer-rated based on a key informant's responses to a set of open-ended questions on the participant's needs for care. We estimated the prevalence of dependence and the independent contribution of underlying health conditions. Site-specific prevalence ratios were meta-analysed, and population attributable prevalence fractions (PAPF) calculated. Results The prevalence of dependence increased with age at all sites, with a tendency for the prevalence to be lower in men than in women. Age-standardised prevalence was lower in all sites than in the USA. Other than in rural China, dementia made the largest independent contribution to dependence, with a median PAPF of 34% (range 23%-59%). Other substantial contributors were limb impairment (9%, 1%-46%), stroke (8%, 2%-17%), and depression (8%, 1%-27%). Conclusion The demographic and health transitions will lead to large and rapid increases in the numbers of dependent older people particularly in middle income countries (MIC). The prevention and control of chronic neurological and neuropsychiatric diseases and the development of long-term care policies and plans should be urgent priorities. PMID:20691064

  2. Clinical Pharmacokinetics and Pharmacodynamics of Saxagliptin, a Dipeptidyl Peptidase-4 Inhibitor.

    PubMed

    Boulton, David W

    2017-01-01

    Saxagliptin is an orally active, highly potent, selective and competitive dipeptidyl peptidase (DPP)-4 inhibitor used in the treatment of type 2 diabetes mellitus at doses of 2.5 or 5 mg once daily. DPP-4 is responsible for degrading the intestinally derived hormones glucagon-like peptide (GLP)-1 and glucose-dependent insulinotropic polypeptide (GIP). Inhibition of DPP-4 increases intact plasma GLP-1 and GIP concentrations, augmenting glucose-dependent insulin secretion. Both saxagliptin and its major active metabolite, 5-hydroxy saxagliptin, demonstrate high degrees of selectivity for DPP-4 compared with other DPP enzymes. Saxagliptin is orally absorbed and can be administered with or without food. The half-life of plasma DPP-4 inhibition with saxagliptin 5 mg is ~27 h, which supports a once-daily dosing regimen. Saxagliptin is metabolized by cytochrome P450 (CYP) 3A4/5 and is eliminated by a combination of renal and hepatic clearance. No clinically meaningful differences in saxagliptin or 5-hydroxy saxagliptin pharmacokinetics have been detected in patients with hepatic impairment. No clinically meaningful differences in saxagliptin or 5-hydroxy saxagliptin pharmacokinetics have been detected in patients with mild renal impairment, whereas dose reduction is recommended in patients with moderate or severe renal impairment because of greater systemic exposure [the area under the plasma concentration-time curve (AUC)] to saxagliptin total active moieties. Clinically relevant drug-drug interactions have not been detected; however, limiting the dose to 2.5 mg once daily is recommended in the USA when saxagliptin is coadministered with strong CYP inhibitors, because of increased saxagliptin exposure. In summary, saxagliptin has a predictable pharmacokinetic and pharmacodynamic profile.

  3. The Age-Dependent Relationship between Blood Pressure and Cognitive Impairment: A Cross-Sectional Study in a Rural Area of Xi'an, China.

    PubMed

    Shang, Suhang; Li, Pei; Deng, Meiying; Jiang, Yu; Chen, Chen; Qu, Qiumin

    2016-01-01

    Hypertension is a modifiable risk factor for cognitive impairment, although the relationship between hypertension and cognitive impairment is not fully understood. The objective of this study was to investigate the effect of age on the relationship between blood pressure and cognitive impairment. Blood pressure and global cognitive function information was collected from 1799 participants (age 40-85) who lived in a village in the suburbs of Xi'an, China, during in-person interviews. Cognitive impairment was defined as a Mini-Mental State Examination (MMSE) score lower than the cutoff value. The effect of age on the relationship between blood pressure parameters [systolic blood pressure (SBP), diastolic blood pressure (DBP), mean arterial blood pressure (MABP), and high blood pressure (HBP, SBP≥140 mm Hg and/or DBP≥90 mm Hg)] and cognitive impairment was analyzed by logistic regression models using interaction and stratified analysis. Blood pressure and age were regarded as both continuous and categorical data. A total of 231 participants were diagnosed as having cognitive impairment based on our criteria. Interaction analysis for the total population showed that SBP (when regarded as continuous data) was positively correlated with cognitive impairment (OR = 1.130 [95% CI, 1.028-1.242] per 10mmHg, P = 0.011); however, the age by SBP interaction term was negatively correlated with cognitive impairment (OR = 0.989 [95% CI, 0.982-0.997] per 10mmHg×year, P = 0.006), indicating that the relationship between SBP and cognitive impairment was age-dependent (OR = 1.130×0.989(age-55.5) per 10mmHg,40 ≤age≤85). When the blood pressure and age were considered as binary data, the results were similar to those obtained when they were considered as continuous variables. Stratified multivariate analysis revealed that the relationship between SBP (when regarded as continuous data) and cognitive impairment was positive for patients aged 40-49 years (OR = 1.349 [95% CI: 1.039-1.753] per 10mmHg, P = 0.025) and 50-59 years (OR = 1.185 [95% CI: 1.028-1.366] per 10mmHg, P = 0.019), whereas it tended to be negative for patients aged 60-69 years (OR = 0.878 [95% CI: 0.729-1.058] per 10mmHg, P = 0.171) and ≥70 years (OR = 0.927 [95% CI: 0.772-1.113] per 10mmHg, P = 0.416). Results similar to those for SBP were obtained for DBP, MABP and HBP as well. Subsequently, SBP, DBP and MABP were transformed into categorical data (SBP<140mmHg, 140mmHg≤SBP<160mmHg, and SBP≥160mmHg; DBP<90mmHg, 90mmHg≤DBP<100mmHg, and DBP≥100mmHg; MABP<100mmHg, 100mmHg≤MABP<110mmHg, and MABP≥110mmHg), and the stratified multivariate analysis was repeated. This analysis showed that the age-dependent association continued to exist and was especially prominent in the SBP≥160 mmHg, DBP≥90 mmHg and MABP≥110 mmHg groups. Elevated blood pressure is positively correlated with cognitive impairment in the middle-aged, but this positive association declines with increasing age. These results indicated that specific blood pressure management strategies for various age groups may be crucial for maintaining cognitive vitality.

  4. The Age-Dependent Relationship between Blood Pressure and Cognitive Impairment: A Cross-Sectional Study in a Rural Area of Xi'an, China

    PubMed Central

    Shang, Suhang; Li, Pei; Deng, Meiying; Jiang, Yu; Chen, Chen; Qu, Qiumin

    2016-01-01

    Background Hypertension is a modifiable risk factor for cognitive impairment, although the relationship between hypertension and cognitive impairment is not fully understood. The objective of this study was to investigate the effect of age on the relationship between blood pressure and cognitive impairment. Methods Blood pressure and global cognitive function information was collected from 1799 participants (age 40–85) who lived in a village in the suburbs of Xi'an, China, during in-person interviews. Cognitive impairment was defined as a Mini-Mental State Examination (MMSE) score lower than the cutoff value. The effect of age on the relationship between blood pressure parameters [systolic blood pressure (SBP), diastolic blood pressure (DBP), mean arterial blood pressure (MABP), and high blood pressure (HBP, SBP≥140 mm Hg and/or DBP≥90 mm Hg)] and cognitive impairment was analyzed by logistic regression models using interaction and stratified analysis. Blood pressure and age were regarded as both continuous and categorical data. Results A total of 231 participants were diagnosed as having cognitive impairment based on our criteria. Interaction analysis for the total population showed that SBP (when regarded as continuous data) was positively correlated with cognitive impairment (OR = 1.130 [95% CI, 1.028–1.242] per 10mmHg, P = 0.011); however, the age by SBP interaction term was negatively correlated with cognitive impairment (OR = 0.989 [95% CI, 0.982–0.997] per 10mmHg×year, P = 0.006), indicating that the relationship between SBP and cognitive impairment was age-dependent (OR = 1.130×0.989(age-55.5) per 10mmHg,40 ≤age≤85). When the blood pressure and age were considered as binary data, the results were similar to those obtained when they were considered as continuous variables. Stratified multivariate analysis revealed that the relationship between SBP (when regarded as continuous data) and cognitive impairment was positive for patients aged 40–49 years (OR = 1.349 [95% CI: 1.039–1.753] per 10mmHg, P = 0.025) and 50–59 years (OR = 1.185 [95% CI: 1.028–1.366] per 10mmHg, P = 0.019), whereas it tended to be negative for patients aged 60–69 years (OR = 0.878 [95% CI: 0.729–1.058] per 10mmHg, P = 0.171) and ≥70 years (OR = 0.927 [95% CI: 0.772–1.113] per 10mmHg, P = 0.416). Results similar to those for SBP were obtained for DBP, MABP and HBP as well. Subsequently, SBP, DBP and MABP were transformed into categorical data (SBP<140mmHg, 140mmHg≤SBP<160mmHg, and SBP≥160mmHg; DBP<90mmHg, 90mmHg≤DBP<100mmHg, and DBP≥100mmHg; MABP<100mmHg, 100mmHg≤MABP<110mmHg, and MABP≥110mmHg), and the stratified multivariate analysis was repeated. This analysis showed that the age-dependent association continued to exist and was especially prominent in the SBP≥160 mmHg, DBP≥90 mmHg and MABP≥110 mmHg groups. Conclusions Elevated blood pressure is positively correlated with cognitive impairment in the middle-aged, but this positive association declines with increasing age. These results indicated that specific blood pressure management strategies for various age groups may be crucial for maintaining cognitive vitality. PMID:27438476

  5. Atrogin-1 affects muscle protein synthesis and degradation when energy metabolism is impaired by the antidiabetes drug berberine.

    PubMed

    Wang, Huiling; Liu, Dajun; Cao, Peirang; Lecker, Stewart; Hu, Zhaoyong

    2010-08-01

    Defects in insulin/IGF-1 signaling stimulate muscle protein loss by suppressing protein synthesis and increasing protein degradation. Since an herbal compound, berberine, lowers blood levels of glucose and lipids, we proposed that it would improve insulin/IGF-1 signaling, blocking muscle protein losses. We evaluated whether berberine ameliorates muscle atrophy in db/db mice, a model of type 2 diabetes, by measuring protein synthesis and degradation in muscles of normal and db/db mice treated with or without berberine. We also examined mechanisms for berberine-induced changes in muscle protein metabolism. Berberine administration decreased protein synthesis and increased degradation in muscles of normal and db/db mice. The protein catabolic mechanism depended on berberine-stimulated expression of the E3 ubiquitin ligase, atrogin-1. Atrogin-1 not only increased proteolysis but also reduced protein synthesis by mechanisms that were independent of decreased phosphorylation of Akt or forkhead transcription factors. Impaired protein synthesis was dependent on a reduction in eIF3-f, an essential regulator of protein synthesis. Berberine impaired energy metabolism, activating AMP-activated protein kinase and providing an alternative mechanism for the stimulation of atrogin-1 expression. When we increased mitochondrial biogenesis by expressing peroxisome proliferator-activated receptor gamma coactivator-1alpha, berberine-induced changes in muscle protein metabolism were prevented. Berberine impairs muscle metabolism by two novel mechanisms. It impairs mitochonidrial function stimulating the expression of atrogin-1 without affecting phosphorylation of forkhead transcription factors. The increase in atrogin-1 not only stimulated protein degradation but also suppressed protein synthesis, causing muscle atrophy.

  6. A Multi-Compartment 3-D Finite Element Model of Rectocele and Its Interaction with Cystocele

    PubMed Central

    Luo, Jiajia; Chen, Luyun; Fenner, Dee E.; Ashton-Miller, James A.; DeLancey, John O. L.

    2015-01-01

    We developed a subject-specific 3-D finite element model to understand the mechanics underlying formation of female pelvic organ prolapse, specifically a rectocele and its interaction with a cystocele. The model was created from MRI 3-D geometry of a healthy 45 year-old multiparous woman. It included anterior and posterior vaginal walls, levator ani muscle, cardinal and uterosacral ligaments, anterior and posterior arcus tendineus fascia pelvis, arcus tendineus levator ani, perineal body, perineal membrane and anal sphincter. Material properties were mostly from the literature. Tissue impairment was modeled as decreased tissue stiffness based on previous clinical studies. Model equations were solved using Abaqus v 6.11. The sensitivity of anterior and posterior vaginal wall geometry was calculated for different combinations tissue impairments under increasing intraabdominal pressure. Prolapse size was reported as POP-Q point at point Bp for rectocele and point Ba for cystocele. Results show that a rectocele resulted from impairments of the levator ani and posterior compartment support. For 20% levator and 85% posterior support impairments, simulated rectocele size (at POP-Q point: Bp) increased 0.29 mm/cm H2O without apical impairment and 0.36 mm/cm H2O with 60% apical impairment, as intraabdominal pressures increased from 0 to 150 cm H2O. Apical support impairment could result in the development of either a cystocele or rectocele. Simulated repair of posterior compartment support decreased rectocele but increased a preexisting cystocele. We conclude that development of rectocele and cystocele depend on the presence of anterior, posterior, levator and/or or apical support impairments, as well as the interaction of the prolapse with the opposing compartment. PMID:25757664

  7. Incorporating green infrastructure into water resources management plans to address water quality impairments

    EPA Science Inventory

    Managers of urban watersheds with excessive nutrient loads are more frequently turning to green infrastructure (GI) to manage their water quality impairments. The effectiveness of GI is dependent on a number of factors, including (1) the type and placement of GI within the waters...

  8. KCNH2-3.1 expression impairs cognition and alters neuronal function in a model of molecular pathology associated with schizophrenia.

    PubMed

    Carr, Gregory V; Chen, Jingshan; Yang, Feng; Ren, Ming; Yuan, Peixiong; Tian, Qingjun; Bebensee, Audrey; Zhang, Grace Y; Du, Jing; Glineburg, Paul; Xun, Randy; Akhile, Omoye; Akuma, Daniel; Pickel, James; Barrow, James C; Papaleo, Francesco; Weinberger, Daniel R

    2016-11-01

    Overexpression in humans of KCNH2-3.1, which encodes a primate-specific and brain-selective isoform of the human ether-a-go-go-related potassium channel, is associated with impaired cognition, inefficient neural processing and schizophrenia. Here, we describe a new mouse model that incorporates the KCNH2-3.1 molecular phenotype. KCNH2-3.1 transgenic mice are viable and display normal sensorimotor behaviors. However, they show alterations in neuronal structure and microcircuit function in the hippocampus and prefrontal cortex, areas affected in schizophrenia. Specifically, in slice preparations from the CA1 region of the hippocampus, KCNH2-3.1 transgenic mice have fewer mature dendrites and impaired theta burst stimulation long-term potentiation. Abnormal neuronal firing patterns characteristic of the fast deactivation kinetics of the KCNH2-3.1 isoform were also observed in prefrontal cortex. Transgenic mice showed significant deficits in a hippocampal-dependent object location task and a prefrontal cortex-dependent T-maze working memory task. Interestingly, the hippocampal-dependent alterations were not present in juvenile transgenic mice, suggesting a developmental trajectory to the phenotype. Suppressing KCNH2-3.1 expression in adult mice rescues both the behavioral and physiological phenotypes. These data provide insight into the mechanism of association of KCNH2-3.1 with variation in human cognition and neuronal physiology and may explain its role in schizophrenia.

  9. Cytoprotective signaling by activated protein C requires protease-activated receptor-3 in podocytes

    PubMed Central

    Madhusudhan, Thati; Wang, Hongjie; Straub, Beate K.; Gröne, Elisabeth; Zhou, Qianxing; Shahzad, Khurrum; Müller-Krebs, Sandra; Schwenger, Vedat; Gerlitz, Bruce; Grinnell, Brian W.; Griffin, John H.; Reiser, Jochen; Gröne, Hermann-Josef; Esmon, Charles T.; Nawroth, Peter P.

    2012-01-01

    The cytoprotective effects of activated protein C (aPC) are well established. In contrast, the receptors and signaling mechanism through which aPC conveys cytoprotection in various cell types remain incompletely defined. Thus, within the renal glomeruli, aPC preserves endothelial cells via a protease-activated receptor-1 (PAR-1) and endothelial protein C receptor-dependent mechanism. Conversely, the signaling mechanism through which aPC protects podocytes remains unknown. While exploring the latter, we identified a novel aPC/PAR-dependent cytoprotective signaling mechanism. In podocytes, aPC inhibits apoptosis through proteolytic activation of PAR-3 independent of endothelial protein C receptor. PAR-3 is not signaling competent itself as it requires aPCinduced heterodimerization with PAR-2 (human podocytes) or PAR-1 (mouse podocytes). This cytoprotective signaling mechanism depends on caveolin-1 dephosphorylation. In vivo aPC protects against lipopolysaccharide-induced podocyte injury and proteinuria. Genetic deletion of PAR-3 impairs the nephroprotective effect of aPC, demonstrating the crucial role of PAR-3 for aPC-dependent podocyte protection. This novel, aPC-mediated interaction of PARs demonstrates the plasticity and cell-specificity of cytoprotective aPC signaling. The evidence of specific, dynamic signaling complexes underlying aPC-mediated cytoprotection may allow the design of cell type specific targeted therapies. PMID:22117049

  10. Sub-inhibitory tigecycline concentrations induce extracellular matrix binding protein Embp dependent Staphylococcus epidermidis biofilm formation and immune evasion.

    PubMed

    Weiser, Julian; Henke, Hanae A; Hector, Nina; Both, Anna; Christner, Martin; Büttner, Henning; Kaplan, Jeffery B; Rohde, Holger

    2016-09-01

    Biofilm-associated Staphylococcus epidermidis implant infections are notoriously reluctant to antibiotic treatment. Here we studied the effect of sub-inhibitory concentrations of penicillin, oxacillin, vancomycin, daptomycin, linezolid and tigecycline on S. epidermidis 1585 biofilm formation, expression of extracellular matrix binding protein (Embp) and potential implications for S. epidermidis - macrophage interactions. Penicillin, vancomycin, daptomycin, and linezolid had no biofilm augmenting effect at any of the concentrations tested. In contrast, at sub-inhibitory concentrations tigecycline and oxacillin exhibited significant biofilm inducing activity. In S. epidermidis 1585, SarA is a negative regulator of giant 1 MDa Embp, and down regulation of sarA induces Embp-dependent assembly of a multi-layered biofilm architecture. Dot blot immune assays, confocal laser scanning microscopy, and qPCR showed that under biofilm inducing conditions, tigecycline augmented embp expression compared to the control grown without antibiotics. Conversely, expression of regulator sarA was suppressed, suggesting that tigecycline exerts its effects on embp expression through SarA. Tigecycline failed to induce biofilm formation in embp transposon mutant 1585-M135, proving that under these conditions Embp up-regulation is necessary for biofilm accumulation. As a functional consequence, tigecycline induced biofilm formation significantly impaired the up-take of S. epidermidis by mouse macrophage-like cell line J774A.1. Our data provide novel evidence for the molecular basis of antibiotic induced biofilm formation, a phenotype associated with inherently increased antimicrobial tolerance. While this could explain failure of antimicrobial therapies, persistence of S. epidermidis infections in the presence of sub-inhibitory antimicrobials is additionally propelled by biofilm-related impairment of macrophage-mediated pathogen eradication. Copyright © 2016 Elsevier GmbH. All rights reserved.

  11. Prevalence of cognitive impairment in major depression and bipolar disorder.

    PubMed

    Douglas, Katie M; Gallagher, Peter; Robinson, Lucy J; Carter, Janet D; McIntosh, Virginia Vw; Frampton, Christopher Ma; Watson, Stuart; Young, Allan H; Ferrier, I Nicol; Porter, Richard J

    2018-05-01

    The current study examines prevalence of cognitive impairment in four mood disorder samples, using four definitions of impairment. The impact of premorbid IQ on prevalence was examined, and the influence of treatment response. Samples were: (i) 58 inpatients in a current severe depressive episode (unipolar or bipolar), (ii) 69 unmedicated outpatients in a mild to moderate depressive episode (unipolar or bipolar), (iii) 56 outpatients with bipolar disorder, in a depressive episode, and (iv) 63 outpatients with bipolar disorder, currently euthymic. Cognitive assessment was conducted after treatment in Studies 1 (6 weeks of antidepressant treatment commenced on admission) and 2 (16-week course of cognitive behaviour therapy or schema therapy), allowing the impact of treatment response to be assessed. All mood disorder samples were compared with healthy control groups. The prevalence of cognitive impairment was highest for the inpatient depression sample (Study 1), and lowest for the outpatient depression sample (Study 2). Substantial variability in rates was observed depending on the definition of impairment used. Correcting cognitive performance for premorbid IQ had a significant impact on the prevalence of cognitive impairment in the inpatient depression sample. There was minimal evidence that treatment response impacted on prevalence of cognitive impairment, except in the domain of psychomotor speed in inpatients. As interventions aiming to improve cognitive outcomes in mood disorders receive increasing research focus, the issue of setting a cut-off level of cognitive impairment for screening purposes becomes a priority. This analysis demonstrates important differences in samples likely to be recruited depending on the definition of cognitive impairment and begins to examine the importance of premorbid IQ in determining who is impaired. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Spatial Memory Performance of Socially Mature Wistar Rats is Impaired after Exposure to Low (5 cGy) Doses of 1 GeV/n 48Ti Particles.

    PubMed

    Britten, Richard A; Jewell, Jessica S; Duncan, Vania D; Davis, Leslie K; Hadley, Melissa M; Wyrobek, Andrew J

    2017-01-01

    Prolonged deep space missions to planets and asteroids will expose astronauts to galactic cosmic radiation (GCR), a mixture of low-LET ionizing radiations, high-energy protons and high-Z and energy (HZE) particles. Ground-based experiments are used to determine whether this radiation environment will have an effect on the long-term health of astronauts and their ability to complete various tasks during their mission. Emerging data suggest that mission-relevant HZE doses impair several hippocampus-dependent neurocognitive processes in rodents, but that there is substantial interindividual variation in the severity of neurocognitive impairment, ranging from no observable effects to severe impairment. While the majority of studies have established the effect that the most abundant HZE species ( 56 Fe) has on neurocognition, some studies suggest that the lighter 48 Ti HZE particles may be equally, if not more, potent at impairing neurocognition. In this study, we assessed the effect that exposure to 5-20 cGy 1 GeV/n 48 Ti had on the spatial memory performance of socially mature male Wistar rats. Acute exposures to mission-relevant doses (≤5 cGy) of 1 GeV/n 48 Ti significantly (P < 0.05) reduced the mean spatial memory performance of the rats at three months after exposure, and significantly (P < 0.015) increased the percentage of rats that have severe (Z score ≥ 2) impairment, i.e., poor performers. Collectively, these data further support the notion that the LET dependency of neurocognitive impairment may differ from that of cell killing.

  13. Inactivation of JAK2/STAT3 Signaling Axis and Downregulation of M1 mAChR Cause Cognitive Impairment in klotho Mutant Mice, a Genetic Model of Aging

    PubMed Central

    Park, Seok-Joo; Shin, Eun-Joo; Min, Sun Seek; An, Jihua; Li, Zhengyi; Hee Chung, Yoon; Hoon Jeong, Ji; Bach, Jae-Hyung; Nah, Seung-Yeol; Kim, Won-Ki; Jang, Choon-Gon; Kim, Yong-Sun; Nabeshima, Yo-ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

    2013-01-01

    We previously reported cognitive dysfunction in klotho mutant mice. In the present study, we further examined novel mechanisms involved in cognitive impairment in these mice. Significantly decreased janus kinase 2 (JAK2) and signal transducer and activator of transcription3 (STAT3) phosphorylation were observed in the hippocampus of klotho mutant mice. A selective decrease in protein expression and binding density of the M1 muscarinic cholinergic receptor (M1 mAChR) was observed in these mice. Cholinergic parameters (ie, acetylcholine (ACh), choline acetyltransferase (ChAT), and acetylcholinesterase (AChE)) and NMDAR-dependent long-term potentiation (LTP) were significantly impaired in klotho mutant mice. McN-A-343 (McN), an M1 mAChR agonist, significantly attenuated these impairments. AG490 (AG), a JAK2 inhibitor, counteracted the attenuating effects of McN, although AG did not significantly alter the McN-induced effect on AChE. Furthermore, AG significantly inhibited the attenuating effects of McN on decreased NMDAR-dependent LTP, protein kinase C βII, p-ERK, p-CREB, BDNF, and p-JAK2/p-STAT3-expression in klotho mutant mice. In addition, k252a, a BDNF receptor tyrosine kinase B (TrkB) inhibitor, significantly counteracted McN effects on decreased ChAT, ACh, and M1 mAChR and p-JAK2/p-STAT3 expression. McN-induced effects on cognitive impairment in klotho mutant mice were consistently counteracted by either AG or k252a. Our results suggest that inactivation of the JAK2/STAT3 signaling axis and M1 mAChR downregulation play a critical role in cognitive impairment observed in klotho mutant mice. PMID:23389690

  14. Age-dependent postoperative cognitive impairment and Alzheimer-related neuropathology in mice

    NASA Astrophysics Data System (ADS)

    Xu, Zhipeng; Dong, Yuanlin; Wang, Hui; Culley, Deborah J.; Marcantonio, Edward R.; Crosby, Gregory; Tanzi, Rudolph E.; Zhang, Yiying; Xie, Zhongcong

    2014-01-01

    Post-operative cognitive dysfunction (POCD) is associated with increased cost of care, morbidity, and mortality. However, its pathogenesis remains largely to be determined. Specifically, it is unknown why elderly patients are more likely to develop POCD and whether POCD is dependent on general anesthesia. We therefore set out to investigate the effects of peripheral surgery on the cognition and Alzheimer-related neuropathology in mice with different ages. Abdominal surgery under local anesthesia was established in the mice. The surgery induced post-operative elevation in brain β-amyloid (Aβ) levels and cognitive impairment in the 18 month-old wild-type and 9 month-old Alzheimer's disease transgenic mice, but not the 9 month-old wild-type mice. The Aβ accumulation likely resulted from elevation of beta-site amyloid precursor protein cleaving enzyme and phosphorylated eukaryotic translation initiation factor 2α. γ-Secretase inhibitor compound E ameliorated the surgery-induced brain Aβ accumulation and cognitive impairment in the 18 month-old mice. These data suggested that the peripheral surgery was able to induce cognitive impairment independent of general anesthesia, and that the combination of peripheral surgery with aging- or Alzheimer gene mutation-associated Aβ accumulation was needed for the POCD to occur. These findings would likely promote more research to investigate the pathogenesis of POCD.

  15. Spatial working memory impairment in primary onset middle-age type 2 diabetes mellitus: An ethology and BOLD-fMRI study.

    PubMed

    Huang, Ran-Ran; Jia, Bao-Hui; Xie, Lei; Ma, Shu-Hua; Yin, Jing-Jing; Sun, Zong-Bo; Le, Hong-Bo; Xu, Wen-Can; Huang, Jin-Zhuang; Luo, Dong-Xue

    2016-01-01

    To explore mild cognitive dysfunction and/or spatial working memory impairment in patients with primary onset middle-age type 2 diabetes mellitus (T2DM] using ethology (behavior tests) and blood oxygen level-dependent functional magnetic resonance imaging (BOLD-fMRI). Eighteen primary onset T2DM patients and 18 matched subjects with normal blood glucose levels were all tested using the Montreal cognitive assessment scale test, the Wechsler Memory Scale Chinese-revised test, and scanned using BOLD-fMRI (1.5T, EPI sequence) while performing the n-back task to find the activation intensity of some cognition-related areas. The ethology results showed that T2DM patients had a mild cognitive impairment and memory dysfunction (P < 0.05). The fMRI scan identified a neural network consisting of bilateral dorsolateral prefrontal cortex (DLPFC), bilateral premotor area (PreMA), bilateral parietal lobe (PA), and anterior cingulate cortex (ACC) / supplementary motor area (SMA) that was activated during the n-back task, with right hemisphere dominance. However, only the right PA and ACC/SMA showed a load effect via quantitative analysis in the T2DM group; the activation intensity of most working memory-related brain areas for the T2DM group were lower than for the control group under three memory loads. Furthermore, we found that the activation intensity of some cognition-related areas, including the right insular lobe, left caudate nucleus, and bilateral hippocampus/parahippocampal gyrus were lower than the control group under the memory loads. Diabetes-related brain damage of primary onset middle-age T2DM patients with right DLPFC-posterior parietal lobe and parahippocampal gyrus default network causes impairment of spatial working memory and mild cognitive dysfunction. © 2015 Wiley Periodicals, Inc.

  16. Peripheral surgical wounding may induce cognitive impairment through interlukin-6-dependent mechanisms in aged mice.

    PubMed

    Dong, Yuanlin; Xu, Zhipeng; Huang, Lining; Zhang, Yiying; Xie, Zhongcong

    2016-01-01

    Post-operative cognitive dysfunction (POCD) is associated with morbidity, mortality and increased cost of medical care. However, the neuropathogenesis and targeted interventions of POCD remain largely to be determined. We have found that the peripheral surgical wounding induces an age-dependent Aβ accumulation, neuroinflammation and cognitive impairment in aged mice. Pro-inflammatory cytokine interlukin-6 (IL-6) has been reported to be associated with cognitive impairment in rodents and humans. However, the role of IL-6 in the neuropathogenesis of POCD is unknown. We therefore employed pharmacological (IL-6 antibody) and genetic (knockout of IL-6) approach to investigate whether IL-6 contributed to the peripheral surgical wounding-induced cognitive impairment in aged mice. Abdominal surgery under local anesthesia (peripheral surgical wounding) was established in 18-month-old wild-type and IL-6 knockout mice ( n = 6 to 10 in each group). Brain level of IL-6 and cognitive function in the mice were determined by western blot, ELISA at the end of procedure, and Fear Conditioning System at 7 days after the procedure. The peripheral surgical wounding increased the level of IL-6 in the hippocampus of aged wild-type, but not IL-6 knockout mice. IL-6 antibody ameliorated the peripheral surgical wounding-induced cognitive impairment in the aged wild-type mice. Finally, the peripheral surgical wounding did not induce cognitive impairment in the aged IL-6 knockout mice. These data suggested that IL-6 would be a required pro-inflammatory cytokine for the peripheral surgical wounding-induced cognitive impairment. Given this, further studies are warranted to investigate the role of IL-6 in the neuropathogenesis and targeted interventions of POCD.

  17. Peripheral surgical wounding may induce cognitive impairment through interlukin-6-dependent mechanisms in aged mice

    PubMed Central

    Dong, Yuanlin; Xu, Zhipeng; Huang, Lining; Zhang, Yiying; Xie, Zhongcong

    2016-01-01

    Post-operative cognitive dysfunction (POCD) is associated with morbidity, mortality and increased cost of medical care. However, the neuropathogenesis and targeted interventions of POCD remain largely to be determined. We have found that the peripheral surgical wounding induces an age-dependent Aβ accumulation, neuroinflammation and cognitive impairment in aged mice. Pro-inflammatory cytokine interlukin-6 (IL-6) has been reported to be associated with cognitive impairment in rodents and humans. However, the role of IL-6 in the neuropathogenesis of POCD is unknown. We therefore employed pharmacological (IL-6 antibody) and genetic (knockout of IL-6) approach to investigate whether IL-6 contributed to the peripheral surgical wounding-induced cognitive impairment in aged mice. Abdominal surgery under local anesthesia (peripheral surgical wounding) was established in 18-month-old wild-type and IL-6 knockout mice (n = 6 to 10 in each group). Brain level of IL-6 and cognitive function in the mice were determined by western blot, ELISA at the end of procedure, and Fear Conditioning System at 7 days after the procedure. The peripheral surgical wounding increased the level of IL-6 in the hippocampus of aged wild-type, but not IL-6 knockout mice. IL-6 antibody ameliorated the peripheral surgical wounding-induced cognitive impairment in the aged wild-type mice. Finally, the peripheral surgical wounding did not induce cognitive impairment in the aged IL-6 knockout mice. These data suggested that IL-6 would be a required pro-inflammatory cytokine for the peripheral surgical wounding-induced cognitive impairment. Given this, further studies are warranted to investigate the role of IL-6 in the neuropathogenesis and targeted interventions of POCD. PMID:28217289

  18. Motor impairments, striatal degeneration, and altered dopamine-glutamate interplay in mice lacking PSD-95.

    PubMed

    Zhang, Jingping; Saur, Taixiang; Duke, Angela N; Grant, Seth G N; Platt, Donna M; Rowlett, James K; Isacson, Ole; Yao, Wei-Dong

    2014-01-01

    Excessive activation of the N-methyl-d-aspartate (NMDA) receptor and the neurotransmitter dopamine (DA) mediate neurotoxicity and neurodegeneration under many neurological conditions, including Huntington's disease (HD), an autosomal dominant neurodegenerative disease characterized by the preferential loss of medium spiny projection neurons (MSNs) in the striatum. PSD-95 is a major scaffolding protein in the postsynaptic density (PSD) of dendritic spines, where a classical role for PSD-95 is to stabilize glutamate receptors at sites of synaptic transmission. Our recent studies indicate that PSD-95 also interacts with the D1 DA receptor localized in spines and negatively regulates spine D1 signaling. Moreover, PSD-95 forms ternary protein complexes with D1 and NMDA receptors, and plays a role in limiting the reciprocal potentiation between both receptors from being escalated. These studies suggest a neuroprotective role for PSD-95. Here we show that mice lacking PSD-95, resulting from genetic deletion of the GK domain of PSD-95 (PSD-95-ΔGK mice), sporadically develop progressive neurological impairments characterized by hypolocomotion, limb clasping, and loss of DARPP-32-positive MSNs. Electrophysiological experiments indicated that NMDA receptors in mutant MSNs were overactive, suggested by larger, NMDA receptor-mediated miniature excitatory postsynaptic currents (EPSCs) and higher ratios of NMDA- to AMPA-mediated corticostriatal synaptic transmission. In addition, NMDA receptor currents in mutant cortical neurons were more sensitive to potentiation by the D1 receptor agonist SKF81297. Finally, repeated administration of the psychostimulant cocaine at a dose regimen not producing overt toxicity-related phenotypes in normal mice reliably converted asymptomatic mutant mice to clasping symptomatic mice. These results support the hypothesis that deletion of PSD-95 in mutant mice produces concomitant overactivation of both D1 and NMDA receptors that makes neurons more susceptible to NMDA excitotoxicity, causing neuronal damage and neurological impairments. Understanding PSD-95-dependent neuroprotective mechanisms may help elucidate processes underlying neurodegeneration in HD and other neurological disorders.

  19. Methylglyoxal induces oxidative stress-dependent cell injury and up-regulation of interleukin-1beta and nerve growth factor in cultured hippocampal neuronal cells.

    PubMed

    Di Loreto, Silvia; Caracciolo, Valentina; Colafarina, Sabrina; Sebastiani, Pierluigi; Gasbarri, Antonella; Amicarelli, Fernanda

    2004-05-01

    Methylglyoxal (MG) is one of the most powerful glycating agents of proteins and other important cellular components and has been shown to be toxic to cultured cells. Under hyperglycaemic conditions, an increase in the concentration of MG has been observed in human body fluids and tissues that seems to be responsible for diabetic complications. Recent data suggest that diabetes may cause impairment of cognitive processes, according to a mechanism involving both oxidative stress and advanced glycation end product (AGE) formation. In this work, we explored the molecular mechanism underlying MG toxicity in neural cells, by investigating the effect of MG on both the interleukin-1beta (IL-1beta), as the major inducer of the acute phase response, and the nervous growth factor (NGF) expression. Experiments were performed on cultured neural cells from rat hippocampus, being this brain region mostly involved in cognitive processes and, therefore, possible target of diabetes-mediated impairment of cognitive abilities. Results show that MG treatment causes in hippocampal neural cells extensive, oxidative stress-mediated cell death, in consequence of a strong catalase enzymatic activity and protein inhibition. MG also causes a very significant increase in both transcript and protein expression of the NGF as well as of the pro-inflammatory cytokine IL-1beta. MG co-treatment with the antioxidant N-acetylcysteine (NAC) completely abrogates the observed effects. Taken together, these data demonstrate that hippocampal neurons are strongly susceptible to MG-mediated oxidative stress.

  20. Cellular mechanisms underlying behavioral state-dependent bidirectional modulation of motor cortex output.

    PubMed

    Schiemann, Julia; Puggioni, Paolo; Dacre, Joshua; Pelko, Miha; Domanski, Aleksander; van Rossum, Mark C W; Duguid, Ian

    2015-05-26

    Neuronal activity in primary motor cortex (M1) correlates with behavioral state, but the cellular mechanisms underpinning behavioral state-dependent modulation of M1 output remain largely unresolved. Here, we performed in vivo patch-clamp recordings from layer 5B (L5B) pyramidal neurons in awake mice during quiet wakefulness and self-paced, voluntary movement. We show that L5B output neurons display bidirectional (i.e., enhanced or suppressed) firing rate changes during movement, mediated via two opposing subthreshold mechanisms: (1) a global decrease in membrane potential variability that reduced L5B firing rates (L5Bsuppressed neurons), and (2) a coincident noradrenaline-mediated increase in excitatory drive to a subpopulation of L5B neurons (L5Benhanced neurons) that elevated firing rates. Blocking noradrenergic receptors in forelimb M1 abolished the bidirectional modulation of M1 output during movement and selectively impaired contralateral forelimb motor coordination. Together, our results provide a mechanism for how noradrenergic neuromodulation and network-driven input changes bidirectionally modulate M1 output during motor behavior. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Arabidopsis nph1 and npl1: Blue light receptors that mediate both phototropism and chloroplast relocation

    PubMed Central

    Sakai, Tatsuya; Kagawa, Takatoshi; Kasahara, Masahiro; Swartz, Trevor E.; Christie, John M.; Briggs, Winslow R.; Wada, Masamitsu; Okada, Kiyotaka

    2001-01-01

    UV-A/blue light acts to regulate a number of physiological processes in higher plants. These include light-driven chloroplast movement and phototropism. The NPH1 gene of Arabidopsis encodes an autophosphorylating protein kinase that functions as a photoreceptor for phototropism in response to low-intensity blue light. However, nph1 mutants have been reported to exhibit normal phototropic curvature under high-intensity blue light, indicating the presence of an additional phototropic receptor. A likely candidate is the nph1 homologue, npl1, which has recently been shown to mediate the avoidance response of chloroplasts to high-intensity blue light in Arabidopsis. Here we demonstrate that npl1, like nph1, noncovalently binds the chromophore flavin mononucleotide (FMN) within two specialized PAS domains, termed LOV domains. Furthermore, when expressed in insect cells, npl1, like nph1, undergoes light-dependent autophosphorylation, indicating that npl1 also functions as a light receptor kinase. Consistent with this conclusion, we show that a nph1npl1 double mutant exhibits an impaired phototropic response under both low- and high-intensity blue light. Hence, npl1 functions as a second phototropic receptor under high fluence rate conditions and is, in part, functionally redundant to nph1. We also demonstrate that both chloroplast accumulation in response to low-intensity light and chloroplast avoidance movement in response to high-intensity light are lacking in the nph1npl1 double mutant. Our findings therefore indicate that nph1 and npl1 show partially overlapping functions in two different responses, phototropism and chloroplast relocation, in a fluence rate-dependent manner. PMID:11371609

  2. Word-Finding Abilities in Language-Impaired Children: ASHA Monographs Number 25.

    ERIC Educational Resources Information Center

    Kail, Robert; Leonard, Laurence B.

    Four samples of language-impaired and control children (N=233, ages from 4 to 14) participated in seven experiments to determine the specific conditions under which retrieval deficits play a role in language-impaired children's word finding problems. Experiments 1-5 dealt with recall, retrieval, and similarity judgments of words presented…

  3. PERSISTENT IMPAIRMENTS IN SHORT-TERM BUT ENHANCED LONG-TERM SYNAPTIC PLASTICITY IN HIPPOCAMPAL AREA CA1 FOLLOWING DEVELOPMENTAL HYPOTHYROIDISM.

    EPA Science Inventory

    Thyroid hormones (TH) are critical for nervous system development. Deficiency of TH during development impair performance on tasks of learning and memory that rely upon the hippocampus, but the mechanism underlying this impairment is not well understood. The present study was ...

  4. Icariside II-induced mitochondrion and lysosome mediated apoptosis is counterbalanced by an autophagic salvage response in hepatoblastoma.

    PubMed

    Geng, Ya-di; Zhang, Chao; Shi, Ya-Min; Xia, Yuan-Zheng; Guo, Chao; Yang, Lei; Kong, Ling-Yi

    2015-09-28

    In this study, the anti-cancer effect of Icariside II (IS), a natural plant flavonoid, against hepatoblastoma cells and the underlying mechanisms were investigated. The in vitro and in vivo studies show that IS decreased the viability of human hepatoblastoma HepG2 cells in a concentration- and time-dependent manner and inhibited tumor growth in mice transplanted with H22 liver carcinomas. IS impaired mitochondria and lysosomes as evidenced by signs of induced mitochondrial and lysosomal membrane permeabilization, resulting in caspase activation and apoptosis. SQSTM1 up-regulation and autophagic flux measurements demonstrated that IS exposure also impaired autophagosome degradation which resulted in autophagosome accumulation, which plays a pro-survival role as the genetic knockdown of LC3B further sensitized the IS-treated cells. Electron microscopy images showed that autophagosome engulfs IS-impaired mitochondria and lysosomes, thus blocking cytotoxicity induced by further leakage of the hydrolases from lysosomes and pro-apoptosis members from mitochondria. In conclusion, these data suggest that IS plays multiple roles as a promising chemotherapeutic agent that induces cell apoptosis involving both mitochondrial and lysosomal damage. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Human G109E-inhibitor-1 impairs cardiac function and promotes arrhythmias.

    PubMed

    Haghighi, Kobra; Pritchard, Tracy J; Liu, Guan-Sheng; Singh, Vivek P; Bidwell, Philip; Lam, Chi Keung; Vafiadaki, Elizabeth; Das, Parthib; Ma, Jianyong; Kunduri, Swati; Sanoudou, Despina; Florea, Stela; Vanderbilt, Erica; Wang, Hong-Shang; Rubinstein, Jack; Hajjar, Roger J; Kranias, Evangelia G

    2015-12-01

    A hallmark of human and experimental heart failure is deficient sarcoplasmic reticulum (SR) Ca-uptake reflecting impaired contractile function. This is at least partially attributed to dephosphorylation of phospholamban by increased protein phosphatase 1 (PP1) activity. Indeed inhibition of PP1 by transgenic overexpression or gene-transfer of constitutively active inhibitor-1 improved Ca-cycling, preserved function and decreased fibrosis in small and large animal models of heart failure, suggesting that inhibitor-1 may represent a potential therapeutic target. We recently identified a novel human polymorphism (G109E) in the inhibitor-1 gene with a frequency of 7% in either normal or heart failure patients. Transgenic mice, harboring cardiac-specific expression of G109E inhibitor-1, exhibited decreases in contractility, Ca-kinetics and SR Ca-load. These depressive effects were relieved by isoproterenol stimulation. Furthermore, stress conditions (2Hz +/- Iso) induced increases in Ca-sparks, Ca-waves (60% of G109E versus 20% in wild types) and after-contractions (76% of G109E versus 23% of wild types) in mutant cardiomyocytes. Similar findings were obtained by acute expression of the G109E variant in adult cardiomyocytes in the absence or presence of endogenous inhibitor-1. The underlying mechanisms included reduced binding of mutant inhibitor-1 to PP1, increased PP1 activity, and dephosphorylation of phospholamban at Ser16 and Thr17. However, phosphorylation of the ryanodine receptor at Ser2808 was not altered while phosphorylation at Ser2814 was increased, consistent with increased activation of Ca/calmodulin-dependent protein kinase II (CaMKII), promoting aberrant SR Ca-release. Parallel in vivo studies revealed that mutant mice developed ventricular ectopy and complex ventricular arrhythmias (including bigeminy, trigeminy and ventricular tachycardia), when challenged with isoproterenol. Inhibition of CaMKII activity by KN-93 prevented the increased propensity to arrhythmias. These findings suggest that the human G109E inhibitor-1 variant impairs SR Ca-cycling and promotes arrhythmogenesis under stress conditions, which may present an additional insult in the compromised function of heart failure carriers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Human G109E-Inhibitor-1 Impairs Cardiac Function and Promotes Arrhythmias

    PubMed Central

    Haghighi, Kobra; Pritchard, Tracy J.; Liu, Guan-Sheng; Singh, Vivek P.; Bidwell, Philip; Lam, Chi Keung; Vafiadaki, Elizabeth; Das, Parthib; Ma, Jianyong; Kunduri, Swati; Sanoudou, Despina; Florea, Stela; Vanderbilt, Erica; Wang, Hong-Shang; Rubinstein, Jack; Hajjar, Roger J.; Kranias, Evangelia G.

    2015-01-01

    A hallmark of human and experimental heart failure is deficient sarcoplasmic reticulum (SR) Ca-uptake reflecting impaired contractile function. This is at least partially attributed to dephosphorylation of phospholamban by increased protein phosphatase 1 (PP1) activity. Indeed inhibition of PP1 by transgenic overexpression or gene-transfer of constitutively active inhibitor-1 improved Ca-cycling, preserved function and decreased fibrosis in small and large animal models of heart failure, suggesting that inhibitor-1 may represent a potential therapeutic target. We recently identified a novel human polymorphism (G109E) in the inhibitor-1 gene with a frequency of 7% in either normal or heart failure patients. Transgenic mice, harboring cardiac-specific expression of G109E inhibitor-1, exhibited decreases in contractility, Ca-kinetics and SR Ca-load. These depressive effects were relieved by isoproterenol stimulation. Furthermore, stress conditions (2 Hz +/− Iso) induced increases in Ca-sparks, Ca-waves (60% of G109E versus 20% in wild types) and after-contractions (76% of G109E versus 23% of wild types) in mutant cardiomyocytes. Similar findings were obtained by acute expression of the G109E variant in adult cardiomyocytes in the absence or presence of endogenous inhibitor-1. The underlying mechanisms included reduced binding of mutant inhibitor-1 to PP1, increased PP1 activity, and dephosphorylation of phospholamban at Ser16 and Thr17. However, phosphorylation of the ryanodine receptor at Ser2808 was not altered while phosphorylation at Ser2814 was increased, consistent with increased activation of Ca/calmodulin-dependent protein kinase II (CaMKII), promoting aberrant SR Ca-release. Parallel in vivo studies revealed that mutant mice developed ventricular ectopy and complex ventricular arrhythmias (including bigeminy, trigeminy and ventricular tachycardia), when challenged with isoproterenol. Inhibition of CaMKII activity by KN-93 prevented the increased propensity to arrhythmias. These findings suggest that the human G109E inhibitor-1 variant impairs SR Ca-cycling and promotes arrhythmogenesis under stress conditions, which may present an additional insult in the compromised function of heart failure carriers. PMID:26455482

  7. Human TRAF3 adaptor molecule deficiency leads to impaired Toll-like receptor 3 response and susceptibility to herpes simplex encephalitis

    PubMed Central

    de Diego, Rebeca Pérez; Sancho-Shimizu, Vanessa; Lorenzo, Lazaro; Puel, Anne; Plancoulaine, Sabine; Picard, Capucine; Herman, Melina; Cardon, Annabelle; Durandy, Anne; Bustamante, Jacinta; Vallabhapurapu, Sivakumar; Bravo, Jerónimo; Warnatz, Klaus; Chaix, Yves; Cascarrigny, Françoise; Lebon, Pierre; Rozenberg, Flore; Karin, Michael; Tardieu, Marc; Al-Muhsen, Saleh; Jouanguy, Emmanuelle; Zhang, Shen-Ying; Abel, Laurent; Casanova, Jean-Laurent

    2010-01-01

    Tumor necrosis factor (TNF) receptor-associated factor 3 (TRAF3) functions downstream of multiple receptors that induce interferon-α (IFN-α), IFN–β and IFN-λ production, including Toll-like receptor 3 (TLR3), which is deficient in some patients with herpes simplex virus-1 encephalitis (HSE). Mice lacking TRAF3 die in the neonatal period, preventing direct investigation of the role of TRAF3 in immune responses and host defenses in vivo. Here we reported the autosomal dominant, human TRAF3 deficiency in a young adult with a history of HSE in childhood. The TRAF3 mutant allele was a loss-of-expression, loss-of-function, dominant-negative phenotype, and was associated with impaired, but not abolished TRAF3-dependent responses upon stimulation of both TNF receptors and receptors that induce IFN production. TRAF3 deficiency was associated with a clinical phenotype limited to HSE resulting from the impairment of TLR3-dependent induction of IFN. Thus, TLR3-mediated immunity against primary infection by HSV-1 in the central nervous system is critically dependent on TRAF3. Highlight sentence Autosomal dominant TRAF3 deficiency is a genetic etiology of herpes simplex encephalitis. Highlight sentence R118W TRAF3 allele is loss-of-function, loss-of-expression, and dominant-negative. Highlight sentence Human TRAF3 deficiency impairs the TLR3-dependent induction of anti-viral interferons. PMID:20832341

  8. CD4 T cells play important roles in maintaining IL-17-producing γδ T-cell subsets in naive animals.

    PubMed

    Do, Jeong-Su; Visperas, Anabelle; O'Brien, Rebecca L; Min, Booki

    2012-04-01

    A proportional balance between αβ and γδ T-cell subsets in the periphery is exceedingly well maintained by a homeostatic mechanism. However, a cellular mechanism underlying the regulation remains undefined. We recently reported that a subset of developing γδ T cells spontaneously acquires interleukin (IL)-17-producing capacity even within naive animals through a transforming growth factor (TGF)β1-dependent mechanism, thus considered 'innate' IL-17-producing cells. Here, we report that γδ T cells generated within αβ T cell (or CD4 T cell)-deficient environments displayed altered cytokine profiles; particularly, 'innate' IL-17 expression was significantly impaired compared with those in wild-type mice. Impaired IL-17 production in γδ T cells was directly related to CD4 T-cell deficiency, because depletion of CD4 T cells in wild-type mice diminished and adoptive CD4 T-cell transfer into T-cell receptor β-/- mice restored IL-17 expression in γδ T cells. CD4 T cell-mediated IL-17 expression required TGFβ1. Moreover, Th17 but not Th1 or Th2 effector CD4 T cells were highly efficient in enhancing γδ T-cell IL-17 expression. Taken together, our results highlight a novel CD4 T cell-dependent mechanism that shapes the generation of IL-17+ γδ T cells in naive settings.

  9. The heterogeneity of verbal short-term memory impairment in aphasia.

    PubMed

    Majerus, Steve; Attout, Lucie; Artielle, Marie-Amélie; Van der Kaa, Marie-Anne

    2015-10-01

    Verbal short-term memory (STM) impairment represents a frequent and long-lasting deficit in aphasia, and it will prevent patients from recovering fully functional language abilities. The aim of this study was to obtain a more precise understanding of the nature of verbal STM impairment in aphasia, by determining whether verbal STM impairment is merely a consequence of underlying language impairment, as suggested by linguistic accounts of verbal STM, or whether verbal STM impairment reflects an additional, specific deficit. We investigated this question by contrasting item-based STM measures, supposed to depend strongly upon language activation, and order-based STM measures, supposed to reflect the operation of specific, serial order maintenance mechanisms, in a sample of patients with single-word processing deficits at the phonological and/or lexical level. A group-level analysis showed robust impairment for both item and serial order STM aspects in the aphasic group relative to an age-matched control group. An analysis of individual profiles revealed an important heterogeneity of verbal STM profiles, with patients presenting either selective item STM deficits, selective order STM deficits, generalized item and serial order STM deficits or no significant STM impairment. Item but not serial order STM impairment correlated with the severity of phonological impairment. These results disconfirm a strong version of the linguistic account of verbal STM impairment in aphasia, by showing variable impairment to both item and serial order processing aspects of verbal STM. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. XBP1 (X-Box-Binding Protein-1)-Dependent O-GlcNAcylation Is Neuroprotective in Ischemic Stroke in Young Mice and Its Impairment in Aged Mice Is Rescued by Thiamet-G.

    PubMed

    Jiang, Meng; Yu, Shu; Yu, Zhui; Sheng, Huaxin; Li, Ying; Liu, Shuai; Warner, David S; Paschen, Wulf; Yang, Wei

    2017-06-01

    Impaired protein homeostasis induced by endoplasmic reticulum dysfunction is a key feature of a variety of age-related brain diseases including stroke. To restore endoplasmic reticulum function impaired by stress, the unfolded protein response is activated. A key unfolded protein response prosurvival pathway is controlled by the endoplasmic reticulum stress sensor (inositol-requiring enzyme-1), XBP1 (downstream X-box-binding protein-1), and O-GlcNAc (O-linked β-N-acetylglucosamine) modification of proteins (O-GlcNAcylation). Stroke impairs endoplasmic reticulum function, which activates unfolded protein response. The rationale of this study was to explore the potentials of the IRE1/XBP1/O-GlcNAc axis as a target for neuroprotection in ischemic stroke. Mice with Xbp1 loss and gain of function in neurons were generated. Stroke was induced by transient or permanent occlusion of the middle cerebral artery in young and aged mice. Thiamet-G was used to increase O-GlcNAcylation. Deletion of Xbp1 worsened outcome after transient and permanent middle cerebral artery occlusion. After stroke, O-GlcNAcylation was activated in neurons of the stroke penumbra in young mice, which was largely Xbp1 dependent. This activation of O-GlcNAcylation was impaired in aged mice. Pharmacological increase of O-GlcNAcylation before or after stroke improved outcome in both young and aged mice. Our study indicates a critical role for the IRE1/XBP1 unfolded protein response branch in stroke outcome. O-GlcNAcylation is a prosurvival pathway that is activated in the stroke penumbra in young mice but impaired in aged mice. Boosting prosurvival pathways to counterbalance the age-related decline in the brain's self-healing capacity could be a promising strategy to improve ischemic stroke outcome in aged brains. © 2017 American Heart Association, Inc.

  11. Epac2-Rap1 Signaling Regulates Reactive Oxygen Species Production and Susceptibility to Cardiac Arrhythmias

    PubMed Central

    Yang, Zhaokang; Kirton, Hannah M.; Al-Owais, Moza; Thireau, Jérôme; Richard, Sylvain; Peers, Chris

    2017-01-01

    Abstract Aims: In the heart, β1-adrenergic signaling involves cyclic adenosine monophosphate (cAMP) acting via both protein kinase-A (PKA) and exchange protein directly activated by cAMP (Epac): a guanine nucleotide exchange factor for the small GTPase Rap1. Inhibition of Epac-Rap1 signaling has been proposed as a therapeutic strategy for both cancer and cardiovascular disease. However, previous work suggests that impaired Rap1 signaling may have detrimental effects on cardiac function. The aim of the present study was to investigate the influence of Epac2-Rap1 signaling on the heart using both in vivo and in vitro approaches. Results: Inhibition of Epac2 signaling induced early afterdepolarization arrhythmias in ventricular myocytes. The underlying mechanism involved an increase in mitochondrial reactive oxygen species (ROS) and activation of the late sodium current (INalate). Arrhythmias were blocked by inhibition of INalate or the mitochondria-targeted antioxidant, mitoTEMPO. In vivo, inhibition of Epac2 caused ventricular tachycardia, torsades de pointes, and sudden death. The in vitro and in vivo effects of Epac2 inhibition were mimicked by inhibition of geranylgeranyltransferase-1, which blocks interaction of Rap1 with downstream targets. Innovation: Our findings show for the first time that Rap1 acts as a negative regulator of mitochondrial ROS production in the heart and that impaired Epac2-Rap1 signaling causes arrhythmias due to ROS-dependent activation of INalate. This has implications for the use of chemotherapeutics that target Epac2-Rap1 signaling. However, selective inhibition of INalate provides a promising strategy to prevent arrhythmias caused by impaired Epac2-Rap1 signaling. Conclusion: Epac2-Rap1 signaling attenuates mitochondrial ROS production and reduces myocardial arrhythmia susceptibility. Antioxid. Redox Signal. 27, 117–132. PMID:27649969

  12. Modulation of cannabinoid signaling by hippocampal 5-HT4 serotonergic system in fear conditioning.

    PubMed

    Nasehi, Mohammad; Farrahizadeh, Maryam; Ebrahimi-Ghiri, Mohaddeseh; Zarrindast, Mohammad-Reza

    2016-09-01

    Behavioral studies have suggested a key role for the cannabinoid system in the modulation of conditioned fear memory. Likewise, much of the literature has revealed that the serotonergic system affects Pavlovian fear conditioning and extinction. A high level of functional overlap between the serotonin and cannabinoid systems has also been reported. To clarify the interaction between the hippocampal serotonin (5-HT4) receptor and the cannabinoid CB1 receptor in the acquisition of fear memory, the effects of 5-HT4 agents, arachidonylcyclopropylamide (ACPA; CB1 receptor agonist), and the combined use of these drugs on fear learning were studied in a fear conditioning task in adult male NMRI mice. Pre-training intraperitoneal administration of ACPA (0.1 mg/kg) decreased the percentage of freezing time in both context- and tone-dependent fear conditions, suggesting impairment of the acquisition of fear memory. Pre-training, intra-hippocampal (CA1) microinjection of RS67333, a 5-HT4 receptor agonist, at doses of 0.1 and 0.2 or 0.2 µg/mouse impaired contextual and tone fear memory, respectively. A subthreshold dose of RS67333 (0.005 µg/mouse) did not alter the ACPA response in either condition. Moreover, intra-CA1 microinjection of RS23597 as a 5-HT4 receptor antagonist did not alter context-dependent fear memory acquisition, but it did impair tone-dependent fear memory acquisition. However, a subthreshold dose of the RS23597 (0.01 µg/mouse) potentiated ACPA-induced fear memory impairment in both conditions. Therefore, we suggest that the blockade of hippocampal 5-HT4 serotonergic system modulates cannabinoid signaling induced by the activation of CB1 receptors in conditioned fear. © The Author(s) 2016.

  13. Glutamatergic Receptor Activation in the Commisural Nucleus Tractus Solitarii (cNTS) Mediates Brain Glucose Retention (BGR) Response to Anoxic Carotid Chemoreceptor (CChr) Stimulation in Rats.

    PubMed

    Cuéllar, R; Montero, S; Luquín, S; García-Estrada, J; Dobrovinskaya, O; Melnikov, V; Lemus, M; de Álvarez-Buylla, E Roces

    2015-01-01

    Glutamate, released from central terminals of glossopharyngeal nerve, is a major excitatory neurotransmitter of commissural nucleus tractus solitarii (cNTS) afferent terminals, and brain derived neurotrophic factor (BDNF) has been shown to attenuate glutamatergic AMPA currents in NTS neurons. To test the hypothesis that AMPA contributes to glucose regulation in vivo modulating the hyperglycemic reflex with brain glucose retention (BGR), we microinjected AMPA and NBQX (AMPA antagonist) into the cNTS before carotid chemoreceptor stimulation in anesthetized normal Wistar rats, while hyperglycemic reflex an brain glucose retention (BGR) were analyzed. To investigate the underlying mechanisms, GluR2/3 receptor and c-Fos protein expressions in cNTS neurons were determined. We showed that AMPA in the cNTS before CChr stimulation inhibited BGR observed in aCSF group. In contrast, NBQX in similar conditions, did not modify the effects on glucose variables observed in aCSF control group. These experiments suggest that glutamatergic pathways, via AMPA receptors, in the cNTS may play a role in glucose homeostasis.

  14. Sleep deprivation during a specific 3-hour time window post-training impairs hippocampal synaptic plasticity and memory

    PubMed Central

    Prince, Toni-Moi; Wimmer, Mathieu; Choi, Jennifer; Havekes, Robbert; Aton, Sara; Abel, Ted

    2014-01-01

    Sleep deprivation disrupts hippocampal function and plasticity. In particular, long-term memory consolidation is impaired by sleep deprivation, suggesting that a specific critical period exists following learning during which sleep is necessary. To elucidate the impact of sleep deprivation on long-term memory consolidation and synaptic plasticity, long-term memory was assessed when mice were sleep deprived following training in the hippocampus-dependent object place recognition task. We found that 3 hours of sleep deprivation significantly impaired memory when deprivation began 1 hour after training. In contrast, 3 hours of deprivation beginning immediately post-training did not impair spatial memory. Furthermore, a 3-hour sleep deprivation beginning 1 hour after training impaired hippocampal long-term potentiation (LTP), whereas sleep deprivation immediately after training did not affect LTP. Together, our findings define a specific 3-hour critical period, extending from 1 to 4 hours after training, during which sleep deprivation impairs hippocampal function. PMID:24380868

  15. β-amyloid disrupts human NREM slow waves and related hippocampus-dependent memory consolidation

    PubMed Central

    Mander, Bryce A.; Marks, Shawn M.; Vogel, Jacob W.; Rao, Vikram; Lu, Brandon; Saletin, Jared M.; Ancoli-Israel, Sonia; Jagust, William J.; Walker, Matthew P.

    2015-01-01

    Independent evidence associates β-amyloid pathology with both NREM sleep disruption and memory impairment in older adults. However, whether the influence of β-amyloid pathology on hippocampus-dependent memory is, in part, driven by impairments of NREM slow wave activity (SWA) and associated overnight memory consolidation is unknown. Here, we show that β-amyloid burden within medial prefrontal cortex (mPFC) is significantly correlated with the severity of impairment in NREM SWA generation. Moreover, reduced NREM SWA generation was further associated with impaired overnight memory consolidation and impoverished hippocampal-neocortical memory transformation. Furthermore, structural equation models revealed that the association between mPFC β-amyloid pathology and impaired hippocampus-dependent memory consolidation is not direct, but instead, statistically depends on the intermediary factor of diminished NREM SWA. By linking β-amyloid pathology with impaired NREM SWA, these data implicate sleep disruption as a novel mechanistic pathway through which β-amyloid pathology may contribute to hippocampus-dependent cognitive decline in the elderly. PMID:26030850

  16. The dietary flavonoid kaempferol effectively inhibits HIF-1 activity and hepatoma cancer cell viability under hypoxic conditions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mylonis, Ilias; Lakka, Achillia; Tsakalof, Andreas

    Research highlights: {yields} Kaempferol inhibits HIF-1 activity in hepatocarcinoma cells; {yields} Kaempferol causes cytoplasmic mislocalization of HIF-1{alpha} by impairing the MAPK pathway. {yields} Viability of hepatocarcinoma cells under hypoxia is reduced by kaempferol. -- Abstract: Hepatocellular carcinoma (HCC) is characterized by high mortality rates and resistance to conventional treatment. HCC tumors usually develop local hypoxia, which stimulates proliferation of cancer cells and renders them resilient to chemotherapy. Adaptation of tumor cells to the hypoxic conditions depends on the hypoxia-inducible factor 1 (HIF-1). Over-expression of its regulated HIF-1{alpha} subunit, an important target of anti-cancer therapy, is observed in many cancers includingmore » HCC and is associated with severity of tumor growth and poor patient prognosis. In this report we investigate the effect of the dietary flavonoid kaempferol on activity, expression levels and localization of HIF-1{alpha} as well as viability of human hepatoma (Huh7) cancer cells. Treatment of Huh7 cells with kaempferol under hypoxic conditions (1% oxygen) effectively inhibited HIF-1 activity in a dose-dependent manner (IC{sub 50} = 5.16 {mu}M). The mechanism of this inhibition did not involve suppression of HIF-1{alpha} protein levels but rather its mislocalization into the cytoplasm due to inactivation of p44/42 MAPK by kaempferol (IC{sub 50} = 4.75 {mu}M). Exposure of Huh7 cells to 10 {mu}{Mu} kaempferol caused significant reduction of their viability, which was remarkably more evident under hypoxic conditions. In conclusion, kaempferol, a non-toxic natural food component, inhibits both MAPK and HIF-1 activity at physiologically relevant concentrations (5-10 {mu}M) and suppresses hepatocarcinoma cell survival more efficiently under hypoxia. It has, therefore, potential as a therapeutic or chemopreventive anti-HCC agent.« less

  17. Chronic Obstructive Pulmonary Disease, Cognitive Impairment, and Development of Disability: The Health and Retirement Study

    PubMed Central

    Richardson, Caroline R.; Han, MeiLan K.; Cigolle, Christine T.

    2014-01-01

    Rationale: The relationship between chronic obstructive pulmonary disease (COPD) and cognitive impairment in leading to disability has not been characterized. Objectives: We aimed to investigate the prevalence and cumulative incidence of disability among adults with and without COPD and the association of COPD and cognitive impairment with disability. Methods: We analyzed 2006–2008 waves of the Health and Retirement Study, a nationally representative longitudinal health survey. COPD was self-reported. Prevalent disability was defined as baseline dependency in one or more activities of daily living (ADLs) and incident disability as one or more additional ADL dependencies. We used a validated performance-based measure of cognition to identify dementia and mild cognitive impairment. Covariates included seven chronic diseases, four geriatric syndromes, and sociodemographics. We used logistic regression to test associations between COPD, cognitive status, and prevalent/incident disability. Measurements and Main Results: Of 17,535 participants at least 53 years of age in wave 2006 (representing 77.7 million Americans), 9.5% reported COPD and 13.5% mild cognitive impairment; 17.5% of those with COPD had mild cognitive impairment. Prevalent disability for COPD was 12.8% (5.2% for no-COPD, P < 0.001). An additional 9.2% with COPD developed incident disability at 2 years (4.0% for no-COPD, P < 0.001). In adjusted models, COPD was associated with baseline (odds ratio, 2.0) and incident disability (odds ratio, 2.1; adjusted for baseline disability). Cognitive impairment had an additive effect to COPD. The COPD–disability association, prevalent/incident, was of similar or greater magnitude than that of other chronic diseases (e.g., stroke, diabetes). The associations were maintained in sensitivity analyses using alternative definitions of disability (dependency in two or more ADLs, dependency in instrumental ADLs), and in analysis excluding respondents with dementia. Conclusions: Both COPD and mild cognitive impairment increase the risk of disability. The risk conferred by COPD is significant and similar or higher than other chronic diseases. PMID:25285360

  18. Dependent and paranoid personality patterns in myotonic dystrophy type 1.

    PubMed

    Peric, S; Sreckov, M; Basta, I; Lavrnic, D; Vujnic, M; Marjanovic, I; Rakocevic Stojanovic, V

    2014-04-01

    To analyze frequency and type of personality pattern in patients with myotonic dystrophy type 1 (DM1), to correlate these findings with clinical data, and to assess its possible influence on quality of life (QoL). This cross-sectional study comprised 62 patients with DM1. Following measures were used: Muscular Impairment Rating Scale, Raven's Standard Progressive Matrices (RSPM), Millon Multiaxial Clinical Inventory I (MMCI), SF-36, and Individualized Neuromuscular Quality of Life (INQoL) questionnaires. The presence of at least one pathological personality trait with score above 85 on MMCI was found in 47 (75.8%) patients. After clinical interview, 36 (58.1%) subjects had significant personality impairment. The most common personality trait in our cohort of patients was dependent found in 51.6% of patients, followed by paranoid (38.7%). Higher score on dependent personality scale correlated with lower education (rho = -0.251, P = 0.049). Dependent personality scores significantly differed between patients with physical and intellectual work (93.1 ± 8.9 vs 66.9 ± 31.7, P = 0.011). Paranoid score was higher in patients with lower education (rho = -0.293, P = 0.021), lower score on RSPM test (rho = -0.398, P = 0.004) and larger number of CTG repeats (rho = 0.254, P = 0.046). Presence of dependent personality was not in association with QoL scores (P > 0.05). On the other hand, patients with paranoid personality trait had worse QoL than those without it (P < 0.05). Almost 60% of our patients with DM1 had clinically significant personality impairment, with dependent and paranoid personality patterns being the most common. Paranoid personality may decrease QoL in these patients, which gives us new opportunities for symptomatic therapy in DM1. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Constitutively Active Akt Induces Ectodermal Defects and Impaired Bone Morphogenetic Protein Signaling

    PubMed Central

    Segrelles, Carmen; Moral, Marta; Lorz, Corina; Santos, Mirentxu; Lu, Jerry; Cascallana, José Luis; Lara, M. Fernanda; Carbajal, Steve; Martínez-Cruz, Ana Belén; García-Escudero, Ramón; Beltran, Linda; Segovia, José C.; Bravo, Ana

    2008-01-01

    Aberrant activation of the Akt pathway has been implicated in several human pathologies including cancer. However, current knowledge on the involvement of Akt signaling in development is limited. Previous data have suggested that Akt-mediated signaling may be an essential mediator of epidermal homeostasis through cell autonomous and noncell autonomous mechanisms. Here we report the developmental consequences of deregulated Akt activity in the basal layer of stratified epithelia, mediated by the expression of a constitutively active Akt1 (myrAkt) in transgenic mice. Contrary to mice overexpressing wild-type Akt1 (Aktwt), these myrAkt mice display, in a dose-dependent manner, altered development of ectodermally derived organs such as hair, teeth, nails, and epidermal glands. To identify the possible molecular mechanisms underlying these alterations, gene profiling approaches were used. We demonstrate that constitutive Akt activity disturbs the bone morphogenetic protein-dependent signaling pathway. In addition, these mice also display alterations in adult epidermal stem cells. Collectively, we show that epithelial tissue development and homeostasis is dependent on proper regulation of Akt expression and activity. PMID:17959825

  20. Does the 'P300' speller depend on eye gaze?

    NASA Astrophysics Data System (ADS)

    Brunner, P.; Joshi, S.; Briskin, S.; Wolpaw, J. R.; Bischof, H.; Schalk, G.

    2010-10-01

    Many people affected by debilitating neuromuscular disorders such as amyotrophic lateral sclerosis, brainstem stroke or spinal cord injury are impaired in their ability to, or are even unable to, communicate. A brain-computer interface (BCI) uses brain signals, rather than muscles, to re-establish communication with the outside world. One particular BCI approach is the so-called 'P300 matrix speller' that was first described by Farwell and Donchin (1988 Electroencephalogr. Clin. Neurophysiol. 70 510-23). It has been widely assumed that this method does not depend on the ability to focus on the desired character, because it was thought that it relies primarily on the P300-evoked potential and minimally, if at all, on other EEG features such as the visual-evoked potential (VEP). This issue is highly relevant for the clinical application of this BCI method, because eye movements may be impaired or lost in the relevant user population. This study investigated the extent to which the performance in a 'P300' speller BCI depends on eye gaze. We evaluated the performance of 17 healthy subjects using a 'P300' matrix speller under two conditions. Under one condition ('letter'), the subjects focused their eye gaze on the intended letter, while under the second condition ('center'), the subjects focused their eye gaze on a fixation cross that was located in the center of the matrix. The results show that the performance of the 'P300' matrix speller in normal subjects depends in considerable measure on gaze direction. They thereby disprove a widespread assumption in BCI research, and suggest that this BCI might function more effectively for people who retain some eye-movement control. The applicability of these findings to people with severe neuromuscular disabilities (particularly in eye-movements) remains to be determined.

  1. Eltrombopag, a thrombopoietin mimetic, crosses the blood-brain-barrier and impairs iron-dependent hippocampal neuron dendrite development

    PubMed Central

    Bastian, Thomas W.; Duck, Kari A.; Michalopoulos, George C.; Chen, Michael J.; Liu, Zhi-Jian; Connor, James R.; Lanier, Lorene M.; Sola-Visner, Martha C.; Georgieff, Michael K.

    2017-01-01

    Background Thrombocytopenia is common in sick neonates. Thrombopoietin mimetics (e.g., eltrombopag (ELT)) might provide an alternative therapy for selected neonates with severe and prolonged thrombocytopenia, and for infants and young children with different varieties of thrombocytopenia. However, ELT chelates intracellular iron, which may adversely affect developing organs with high metabolic requirements. Iron deficiency (ID) is particularly deleterious during brain development, impairing neuronal myelination, dopamine signaling, and dendritic maturation and ultimately impairing long-term neurological function (e.g. hippocampal-dependent learning and memory). Objective Determine whether ELT crosses the blood-brain barrier (BBB), causes neuronal ID and impairs hippocampal neuron dendrite maturation. Methods ELT transport across the BBB was assessed using primary bovine brain microvascular endothelial cells. Embryonic mouse primary hippocampal neuron cultures were treated with ELT or deferoxamine (DFO, an iron chelator) from 7 days in vitro (DIV) through 14DIV and assessed for gene expression and neuronal dendrite complexity. Results ELT crossed the BBB in a time-dependent manner. 2 and 6 μM ELT increased Tfr1 and Slc11a2 (iron-responsive genes involved in neuronal iron uptake) mRNA levels, indicating neuronal ID. 6 μM ELT, but not 2 μM ELT, decreased BdnfVI, Camk2a, and Vamp1 mRNA levels, suggesting impaired neuronal development and synaptic function. Dendrite branch number and length was reduced in 6 μM ELT-treated neurons, resulting in blunted dendritic arbor complexity that was similar to DFO-treated neurons. Conclusions ELT treatment during development may impair neuronal structure due to neuronal ID. Pre-clinical in vivo studies are warranted to assess ELT safety during periods of rapid brain development. PMID:28005311

  2. Knockdown of the partner protein OsNAR2.1 for high-affinity nitrate transport represses lateral root formation in a nitrate-dependent manner

    PubMed Central

    Huang, Shuangjie; Chen, Si; Liang, Zhihao; Zhang, Chenming; Yan, Ming; Chen, Jingguang; Xu, Guohua; Fan, Xiaorong; Zhang, Yali

    2015-01-01

    The morphological plasticity of root systems is critical for plant survival, and understanding the mechanisms underlying root adaptation to nitrogen (N) fluctuation is critical for sustainable agriculture; however, the molecular mechanism of N-dependent root growth in rice remains unclear. This study aimed to identify the role of the complementary high-affinity NO3− transport protein OsNAR2.1 in NO3−-regulated rice root growth. Comparisons with wild-type (WT) plants showed that knockdown of OsNAR2.1 inhibited lateral root (LR) formation under low NO3− concentrations, but not under low NH4+ concentrations. 15N-labelling NO3− supplies (provided at concentrations of 0–10 mM) demonstrated that (i) defects in LR formation in mutants subjected to low external NO3− concentrations resulted from impaired NO3− uptake, and (ii) the mutants had significantly fewer LRs than the WT plants when root N contents were similar between genotypes. LR formation in osnar2.1 mutants was less sensitive to localised NO3− supply than LR formation in WT plants, suggesting that OsNAR2.1 may be involved in a NO3−-signalling pathway that controls LR formation. Knockdown of OsNAR2.1 inhibited LR formation by decreasing auxin transport from shoots to roots. Thus, OsNAR2.1 probably functions in both NO3− uptake and NO3−-signalling. PMID:26644084

  3. The role of social frailty in explaining the association between hearing problems and mild cognitive impairment in older adults.

    PubMed

    Bae, Seongryu; Lee, Sangyoon; Lee, Sungchul; Jung, Songee; Makino, Keitaro; Park, Hyuntae; Shimada, Hiroyuki

    2018-06-01

    We examined the role of social frailty in the association between hearing problems and mild cognitive impairment (MCI), and investigated which cognitive impairment domains are most strongly involved. Participants were 4251 older adults (mean age 72.5 ± 5.2 years, 46.1% male) who met the study inclusion criteria. Hearing problems were measured using the Hearing Handicap Inventory for the Elderly. Social frailty was identified using responses to five questions. Participants were divided into four groups depending on the presence of social frailty and hearing problems: control, social frailty, hearing problem, and co-occurrence. We assessed memory, attention, executive function, and processing speed using the National Center for Geriatrics and Gerontology-Functional Assessment Tool. Participants were categorized into normal cognition, single- and multiple-domain MCI, depending on the number of impaired cognitive domains. Participants with multiple-domain MCI exhibited the highest odds ratios (OR) of the co-occurrence group (OR: 3.89, 95% confidence intervals [CI]: 1.96-7.72), followed by the social frailty (OR: 2.65, 95% CI: 1.49-4.67), and hearing problem (OR: 1.90, 95% CI: 1.08-3.34) groups, compared with the control group. However, single-domain MCI was not significantly associated with any group. Cognitive domain analysis revealed that impaired executive function and processing speed were associated with the co-occurrence, hearing problem, and social frailty groups, respectively. Social frailty and hearing problems were independently associated with multiple-domain MCI. Comorbid conditions were more strongly associated with multiple-domain MCI. Longitudinal studies are needed to elucidate the causal role of social frailty in the association between hearing impairment and MCI. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. β cell membrane remodelling and procoagulant events occur in inflammation-driven insulin impairment: a GLP-1 receptor dependent and independent control.

    PubMed

    Gleizes, Céline; Kreutter, Guillaume; Abbas, Malak; Kassem, Mohamad; Constantinescu, Andrei Alexandru; Boisramé-Helms, Julie; Yver, Blandine; Toti, Florence; Kessler, Laurence

    2016-02-01

    Inflammation and hyperglycaemia are associated with a prothrombotic state. Cell-derived microparticles (MPs) are the conveyors of active procoagulant tissue factor (TF) and circulate at high concentration in diabetic patients. Liraglutide, a glucagon-like peptide (GLP)-1 analogue, is known to promote insulin secretion and β-cell preservation. In this in vitro study, we examined the link between insulin impairment, procoagulant activity and plasma membrane remodelling, under inflammatory conditions. Rin-m5f β-cell function, TF activity mediated by MPs and their modulation by 1 μM liraglutide were examined in a cell cross-talk model. Methyl-β-cyclodextrine (MCD), a cholesterol depletor, was used to evaluate the involvement of raft on TF activity, MP shedding and insulin secretion as well as Soluble N-éthylmaleimide-sensitive-factor Attachment protein Receptor (SNARE)-dependent exocytosis. Cytokines induced a two-fold increase in TF activity at MP surface that was counteracted by liraglutide. Microparticles prompted TF activity on the target cells and a two-fold decrease in insulin secretion via protein kinase A (PKA) and p38 signalling, that was also abolished by liraglutide. Large lipid raft clusters were formed in response to cytokines and liraglutide or MCD-treated cells showed similar patterns. Cells pre-treated by saturating concentration of the GLP-1r antagonist exendin (9-39), showed a partial abolishment of the liraglutide-driven insulin secretion and liraglutide-decreased TF activity. Measurement of caspase 3 cleavage and MP shedding confirmed the contribution of GLP-1r-dependent and -independent pathways. Our results confirm an integrative β-cell response to GLP-1 that targets receptor-mediated signalling and membrane remodelling pointing at the coupling of insulin secretion and inflammation-driven procoagulant events. © 2015 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  5. Is the frontal dysexecutive syndrome due to a working memory deficit? Evidence from patients with stroke.

    PubMed

    Roussel, Martine; Dujardin, Kathy; Hénon, Hilde; Godefroy, Olivier

    2012-07-01

    Although frontal dysexecutive disorders are frequently considered to be due to working memory deficit, this has not been systematically examined and very little evidence is available for impairment of working memory in frontal damage. The objective of this study was to examine the components of working memory, their anatomy and the relations with executive functions in patients with stroke involving the frontal or posterior cortex. The study population consisted of 29 patients (frontal: n=17; posterior: n=12) and 29 matched controls. Phonological loop (letter and word spans, phonological store; rehearsal process), visuospatial sketchpad (visuospatial span) and the central executive (working memory span, dual task and updating process) were examined. The group comparison analysis showed impairment in the frontal group of: (i) verbal spans (P<0.03); (ii) with a deficit of the rehearsal process (P=0.006); (iii) visuospatial span (P=0.04); (iv) working memory span (P=0.001) that disappeared after controlling for verbal span and (v) running memory (P=0.05) unrelated to updating conditions. The clinical anatomical correlation study showed that impairment of the central executive depended on frontal and posterior lesion. Cognitive dysexecutive disorders were observed in 11/20 patients with central executive deficit and an inverse dissociation was observed in two patients. Receiver operating characteristic curve analysis indicated that cognitive dysexecutive disorders had the highest ability to discriminate frontal lesions (area under curve=0.844, 95% confidence interval: 0.74-0.95; P=0.0001; central executive impairment: area under curve=0.732, 95% confidence interval: 0.57-0.82; P=0.006). This study reveals that frontal lesions induce mild impairment of short-term memory associated with a deficit of the rehearsal process supporting the role of the frontal lobe in this process; the central executive depends on lesions in the frontal lobe and posterior regions accounting for its low frequency and the negative results of group studies. Finally, the frontal dysexecutive syndrome cannot be attributed to central executive impairment, although it may contribute to some dysexecutive disorders.

  6. Managing money matters: Managing finances is associated with functional independence in MCI.

    PubMed

    Berezuk, Courtney; Ramirez, Joel; Black, Sandra E; Zakzanis, Konstantine K

    2018-03-01

    Previous research suggests that overall experience participating in instrumental activities of daily living (IADLs) is associated with reduced IADL impairment in individuals with mild cognitive impairment, possibly because of an increased functional reserve. Given that difficulties managing finances tend to occur with mild cognitive impairment, this study explores whether experience managing one's finances is associated with independence across various IADLs. Participants with a screen or baseline diagnosis of mild cognitive impairment (n = 862) were taken from the Alzheimer's Disease Neuroimaging Initiative study. Functional dependence and experience were quantified from the Functional Activities Questionnaire. No group differences between those with and without financial management experience existed in Mini-Mental State Examination scores, age, and years of education, although women were more likely to have experience managing finances (P < .001). Final chi-square analyses suggest that financial management experience is significantly associated with greater independence in the ability to follow TV, books, or magazines (P = .009) and remember appointments and important dates (P = .002). Individuals who are rated as having experience in managing their finances were also rated as being less dependent in their ability to follow and understand TV and books and in their ability to remember appointments and important dates. Neither causation nor the mechanisms underlying this relationship can be discerned from these analyses. Therefore, further research is needed to investigate whether engaging in financial tasks protects against early financial impairment, potentially through an increased functional reserve. Copyright © 2017 John Wiley & Sons, Ltd.

  7. The brain-tumor related protein podoplanin regulates synaptic plasticity and hippocampus-dependent learning and memory.

    PubMed

    Cicvaric, Ana; Yang, Jiaye; Krieger, Sigurd; Khan, Deeba; Kim, Eun-Jung; Dominguez-Rodriguez, Manuel; Cabatic, Maureen; Molz, Barbara; Acevedo Aguilar, Juan Pablo; Milicevic, Radoslav; Smani, Tarik; Breuss, Johannes M; Kerjaschki, Dontscho; Pollak, Daniela D; Uhrin, Pavel; Monje, Francisco J

    2016-12-01

    Podoplanin is a cell-surface glycoprotein constitutively expressed in the brain and implicated in human brain tumorigenesis. The intrinsic function of podoplanin in brain neurons remains however uncharacterized. Using an established podoplanin-knockout mouse model and electrophysiological, biochemical, and behavioral approaches, we investigated the brain neuronal role of podoplanin. Ex-vivo electrophysiology showed that podoplanin deletion impairs dentate gyrus synaptic strengthening. In vivo, podoplanin deletion selectively impaired hippocampus-dependent spatial learning and memory without affecting amygdala-dependent cued fear conditioning. In vitro, neuronal overexpression of podoplanin promoted synaptic activity and neuritic outgrowth whereas podoplanin-deficient neurons exhibited stunted outgrowth and lower levels of p-Ezrin, TrkA, and CREB in response to nerve growth factor (NGF). Surface Plasmon Resonance data further indicated a physical interaction between podoplanin and NGF. This work proposes podoplanin as a novel component of the neuronal machinery underlying neuritogenesis, synaptic plasticity, and hippocampus-dependent memory functions. The existence of a relevant cross-talk between podoplanin and the NGF/TrkA signaling pathway is also for the first time proposed here, thus providing a novel molecular complex as a target for future multidisciplinary studies of the brain function in the physiology and the pathology. Key messages Podoplanin, a protein linked to the promotion of human brain tumors, is required in vivo for proper hippocampus-dependent learning and memory functions. Deletion of podoplanin selectively impairs activity-dependent synaptic strengthening at the neurogenic dentate-gyrus and hampers neuritogenesis and phospho Ezrin, TrkA and CREB protein levels upon NGF stimulation. Surface plasmon resonance data indicates a physical interaction between podoplanin and NGF. On these grounds, a relevant cross-talk between podoplanin and NGF as well as a role for podoplanin in plasticity-related brain neuronal functions is here proposed.

  8. Effects of emotionally charged auditory stimulation on gait performance in the elderly: a preliminary study.

    PubMed

    Rizzo, John-Ross; Raghavan, Preeti; McCrery, J R; Oh-Park, Mooyeon; Verghese, Joe

    2015-04-01

    To evaluate the effect of a novel divided attention task-walking under auditory constraints-on gait performance in older adults and to determine whether this effect was moderated by cognitive status. Validation cohort. General community. Ambulatory older adults without dementia (N=104). Not applicable. In this pilot study, we evaluated walking under auditory constraints in 104 older adults who completed 3 pairs of walking trials on a gait mat under 1 of 3 randomly assigned conditions: 1 pair without auditory stimulation and 2 pairs with emotionally charged auditory stimulation with happy or sad sounds. The mean age of subjects was 80.6±4.9 years, and 63% (n=66) were women. The mean velocity during normal walking was 97.9±20.6cm/s, and the mean cadence was 105.1±9.9 steps/min. The effect of walking under auditory constraints on gait characteristics was analyzed using a 2-factorial analysis of variance with a 1-between factor (cognitively intact and minimal cognitive impairment groups) and a 1-within factor (type of auditory stimuli). In both happy and sad auditory stimulation trials, cognitively intact older adults (n=96) showed an average increase of 2.68cm/s in gait velocity (F1.86,191.71=3.99; P=.02) and an average increase of 2.41 steps/min in cadence (F1.75,180.42=10.12; P<.001) as compared with trials without auditory stimulation. In contrast, older adults with minimal cognitive impairment (Blessed test score, 5-10; n=8) showed an average reduction of 5.45cm/s in gait velocity (F1.87,190.83=5.62; P=.005) and an average reduction of 3.88 steps/min in cadence (F1.79,183.10=8.21; P=.001) under both auditory stimulation conditions. Neither baseline fall history nor performance of activities of daily living accounted for these differences. Our results provide preliminary evidence of the differentiating effect of emotionally charged auditory stimuli on gait performance in older individuals with minimal cognitive impairment compared with those without minimal cognitive impairment. A divided attention task using emotionally charged auditory stimuli might be able to elicit compensatory improvement in gait performance in cognitively intact older individuals, but lead to decompensation in those with minimal cognitive impairment. Further investigation is needed to compare gait performance under this task to gait on other dual-task paradigms and to separately examine the effect of physiological aging versus cognitive impairment on gait during walking under auditory constraints. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  9. Responsiveness of Coronary Arteries to Nitroglycerin under Hypoxia: The Importance of the Endothelium.

    PubMed

    Tawa, Masashi; Shimosato, Takashi; Sakonjo, Hiroshi; Okamura, Tomio

    2017-01-01

    Nitroglycerin is widely used as a coronary vasodilator in the treatment of ischemic heart diseases. This study investigated the influence of hypoxia on nitroglycerin-induced relaxation in endothelium-intact and -denuded rabbit, monkey, and porcine coronary arteries. Helically cut strips of coronary arteries were suspended in organ chambers, and isometric tension was recorded. Nitroglycerin concentration dependently relaxed endothelium-intact rabbit coronary arteries, which were not different under normoxic and hypoxic conditions. On the other hand, nitroglycerin-induced relaxation of endothelium-denuded arteries was significantly attenuated by hypoxia. Similarly, the relaxant response of endothelium-intact monkey coronary arteries to nitroglycerin was not affected by hypoxia, whereas that of endothelium-denuded arteries was impaired. As is the case with rabbit and monkey coronary arteries, exposure to hypoxia resulted in impaired relaxation by nitroglycerin in endothelium-denuded but not endothelium-intact porcine coronary arteries. These findings suggest that coronary endothelium plays a pivotal role in preventing the hypoxia-induced impairment of nitroglycerin responsiveness, regardless of the animal species. © 2017 S. Karger AG, Basel.

  10. Influence of hepatic impairment on the pharmacokinetics of the dopamine agonist rotigotine.

    PubMed

    Cawello, Willi; Fichtner, Andreas; Boekens, Hilmar; Braun, Marina

    2014-09-01

    The transdermally applied dopamine receptor agonist rotigotine is extensively metabolized in the liver. An open-label, parallel-group study was conducted to evaluate the effects of moderate hepatic impairment on the pharmacokinetics, safety and tolerability of rotigotine. Eight subjects with normal hepatic function and nine with moderate hepatic impairment (Child-Pugh class B) received one rotigotine transdermal patch (providing a dose of 2 mg/24 h) daily for 3 days with a 24-h patch-on period. Blood and urine samples were collected to evaluate pharmacokinetic parameters characterizing drug bioavailability and elimination. Primary variables included plasma and urine concentrations of unconjugated rotigotine (active parent compound) and total rotigotine (unconjugated rotigotine plus sulfate and glucuronide conjugates) under steady-state (SS) conditions. For unconjugated rotigotine, point estimates for the ratios of AUC(0-24)SS and C max,SS between the two groups (normal vs. impaired hepatic function) were near 1: AUC(0-24)SS, 0.90 (90 % CI 0.59, 1.38) and C max,SS, 0.94 (90 % CI 0.66, 1.35); t max,SS and t 1/2 were lower in subjects with hepatic impairment, while renal clearance was unaffected and overall clearance was higher. For total rotigotine, C max,SS was higher in subjects with hepatic impairment compared with those with normal hepatic function (P = 0.0239, ANOVA). A tendency to reduced non-renal clearance was observed in subjects with hepatic impairment, consistent with their higher plasma concentrations of total rotigotine. Thus, moderate hepatic impairment did not influence the pharmacokinetics of unconjugated rotigotine under steady-state conditions suggesting that dose adjustment will not be required for patients with mild or moderate hepatic insufficiency. In addition, the rotigotine patch was well tolerated in subjects with moderate hepatic impairment.

  11. R-Ras contributes to LTP and contextual discrimination.

    PubMed

    Darcy, M J; Jin, S-X; Feig, L A

    2014-09-26

    The ability to discriminate between closely related contexts is a specific form of hippocampal-dependent learning that may be impaired in certain neurodegenerative disorders such as Alzheimer's and Down Syndrome. However, signaling pathways regulating this form of learning are poorly understood. Previous studies have shown that the calcium-dependent exchange factor Ras-GRF1, an activator of Rac, Ras and R-Ras GTPases, is important for this form of learning and memory. Moreover, the ability to discriminate contexts was linked to the ability of Ras-GRF1 to promote high-frequency stimulation long-term potentiation (HFS-LTP) via the activation of p38 Map kinase. Here, we show that R-Ras is involved in this form of learning by using virally-delivered miRNAs targeting R-Ras into the CA1 region of the dorsal hippocampus and observing impaired contextual discrimination. Like the loss of GRF1, knockdown of R-Ras in the CA1 also impairs the induction of HFS-LTP and p38 Map kinase. Nevertheless, experiments indicate that this involvement of R-Ras in HFS-LTP that is required for contextual discrimination is independent of Ras-GRF1. Thus, R-Ras is a novel regulator of a form of hippocampal-dependent LTP as well as learning and memory that is affected in certain forms of neurodegenerative diseases. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  12. Cognitive Impairment Induced by Delta9-tetrahydrocannabinol Occurs through Heteromers between Cannabinoid CB1 and Serotonin 5-HT2A Receptors

    PubMed Central

    Lanfumey, Laurence; Cordomí, Arnau; Pastor, Antoni; de La Torre, Rafael; Gasperini, Paola; Navarro, Gemma; Howell, Lesley A.; Pardo, Leonardo; Lluís, Carmen; Canela, Enric I.; McCormick, Peter J.; Maldonado, Rafael; Robledo, Patricia

    2015-01-01

    Activation of cannabinoid CB1 receptors (CB1R) by delta9-tetrahydrocannabinol (THC) produces a variety of negative effects with major consequences in cannabis users that constitute important drawbacks for the use of cannabinoids as therapeutic agents. For this reason, there is a tremendous medical interest in harnessing the beneficial effects of THC. Behavioral studies carried out in mice lacking 5-HT2A receptors (5-HT2AR) revealed a remarkable 5-HT2AR-dependent dissociation in the beneficial antinociceptive effects of THC and its detrimental amnesic properties. We found that specific effects of THC such as memory deficits, anxiolytic-like effects, and social interaction are under the control of 5-HT2AR, but its acute hypolocomotor, hypothermic, anxiogenic, and antinociceptive effects are not. In biochemical studies, we show that CB1R and 5-HT2AR form heteromers that are expressed and functionally active in specific brain regions involved in memory impairment. Remarkably, our functional data shows that costimulation of both receptors by agonists reduces cell signaling, antagonist binding to one receptor blocks signaling of the interacting receptor, and heteromer formation leads to a switch in G-protein coupling for 5-HT2AR from Gq to Gi proteins. Synthetic peptides with the sequence of transmembrane helices 5 and 6 of CB1R, fused to a cell-penetrating peptide, were able to disrupt receptor heteromerization in vivo, leading to a selective abrogation of memory impairments caused by exposure to THC. These data reveal a novel molecular mechanism for the functional interaction between CB1R and 5-HT2AR mediating cognitive impairment. CB1R-5-HT2AR heteromers are thus good targets to dissociate the cognitive deficits induced by THC from its beneficial antinociceptive properties. PMID:26158621

  13. Cognitive Impairment Induced by Delta9-tetrahydrocannabinol Occurs through Heteromers between Cannabinoid CB1 and Serotonin 5-HT2A Receptors.

    PubMed

    Viñals, Xavier; Moreno, Estefanía; Lanfumey, Laurence; Cordomí, Arnau; Pastor, Antoni; de La Torre, Rafael; Gasperini, Paola; Navarro, Gemma; Howell, Lesley A; Pardo, Leonardo; Lluís, Carmen; Canela, Enric I; McCormick, Peter J; Maldonado, Rafael; Robledo, Patricia

    2015-07-01

    Activation of cannabinoid CB1 receptors (CB1R) by delta9-tetrahydrocannabinol (THC) produces a variety of negative effects with major consequences in cannabis users that constitute important drawbacks for the use of cannabinoids as therapeutic agents. For this reason, there is a tremendous medical interest in harnessing the beneficial effects of THC. Behavioral studies carried out in mice lacking 5-HT2A receptors (5-HT2AR) revealed a remarkable 5-HT2AR-dependent dissociation in the beneficial antinociceptive effects of THC and its detrimental amnesic properties. We found that specific effects of THC such as memory deficits, anxiolytic-like effects, and social interaction are under the control of 5-HT2AR, but its acute hypolocomotor, hypothermic, anxiogenic, and antinociceptive effects are not. In biochemical studies, we show that CB1R and 5-HT2AR form heteromers that are expressed and functionally active in specific brain regions involved in memory impairment. Remarkably, our functional data shows that costimulation of both receptors by agonists reduces cell signaling, antagonist binding to one receptor blocks signaling of the interacting receptor, and heteromer formation leads to a switch in G-protein coupling for 5-HT2AR from Gq to Gi proteins. Synthetic peptides with the sequence of transmembrane helices 5 and 6 of CB1R, fused to a cell-penetrating peptide, were able to disrupt receptor heteromerization in vivo, leading to a selective abrogation of memory impairments caused by exposure to THC. These data reveal a novel molecular mechanism for the functional interaction between CB1R and 5-HT2AR mediating cognitive impairment. CB1R-5-HT2AR heteromers are thus good targets to dissociate the cognitive deficits induced by THC from its beneficial antinociceptive properties.

  14. Endothelial Antioxidant-1: A key mediator of Copper-dependent wound healing in vivo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Das, Archita; Sudhahar, Varadarajan; Chen, Gin -Fu

    Here, Copper (Cu), an essential nutrient, promotes wound healing, however, target of Cu action and underlying mechanisms remains elusive. Cu chaperone Antioxidant-1 (Atox1) in the cytosol supplies Cu to the secretory enzymes such as lysyl oxidase (LOX) while Atox1 in the nucleus functions as a Cu-dependent transcription factor. Using cutaneous wound healing model, here we show that Cu content (by X-ray Fluorescence Microscopy) and nuclear Atox1 are increased after wounding, and that wound healing with and without Cu treatment is impaired in Atox1 -/ - mice. Experiments using endothelial cell (EC)-specific Atox1 -/ - mice and gene transfer of nuclear-targetmore » Atox1 in Atox1 -/ - mice reveal that Atox1 in ECs as well as transcription factor function of Atox1 are required for wound healing. Mechanistically, Atox1 -/ - mice show reduced Atox1 target proteins such as p47phox NADPH oxidase and cyclin D1 as well as extracellular matrix Cu enzyme LOX activity in wound tissues. This in turn results in reducing O 2 - production in ECs, NFkB activity, cell proliferation and collagen formation, thereby inhibiting angiogenesis, macrophage recruitment and extracellular matrix maturation. Our findings suggest that Cu-dependent transcription factor/Cu chaperone Atox1 in ECs plays an essential role to sense Cu to accelerate wound angiogenesis and healing.« less

  15. Endothelial Antioxidant-1: A key mediator of Copper-dependent wound healing in vivo

    DOE PAGES

    Das, Archita; Sudhahar, Varadarajan; Chen, Gin -Fu; ...

    2016-09-26

    Here, Copper (Cu), an essential nutrient, promotes wound healing, however, target of Cu action and underlying mechanisms remains elusive. Cu chaperone Antioxidant-1 (Atox1) in the cytosol supplies Cu to the secretory enzymes such as lysyl oxidase (LOX) while Atox1 in the nucleus functions as a Cu-dependent transcription factor. Using cutaneous wound healing model, here we show that Cu content (by X-ray Fluorescence Microscopy) and nuclear Atox1 are increased after wounding, and that wound healing with and without Cu treatment is impaired in Atox1 -/ - mice. Experiments using endothelial cell (EC)-specific Atox1 -/ - mice and gene transfer of nuclear-targetmore » Atox1 in Atox1 -/ - mice reveal that Atox1 in ECs as well as transcription factor function of Atox1 are required for wound healing. Mechanistically, Atox1 -/ - mice show reduced Atox1 target proteins such as p47phox NADPH oxidase and cyclin D1 as well as extracellular matrix Cu enzyme LOX activity in wound tissues. This in turn results in reducing O 2 - production in ECs, NFkB activity, cell proliferation and collagen formation, thereby inhibiting angiogenesis, macrophage recruitment and extracellular matrix maturation. Our findings suggest that Cu-dependent transcription factor/Cu chaperone Atox1 in ECs plays an essential role to sense Cu to accelerate wound angiogenesis and healing.« less

  16. Structure of an archaeal non-discriminating glutamyl-tRNA synthetase: a missing link in the evolution of Gln-tRNAGln formation.

    PubMed

    Nureki, Osamu; O'Donoghue, Patrick; Watanabe, Nobuhisa; Ohmori, Atsuhiko; Oshikane, Hiroyuki; Araiso, Yuhei; Sheppard, Kelly; Söll, Dieter; Ishitani, Ryuichiro

    2010-11-01

    The molecular basis of the genetic code relies on the specific ligation of amino acids to their cognate tRNA molecules. However, two pathways exist for the formation of Gln-tRNA(Gln). The evolutionarily older indirect route utilizes a non-discriminating glutamyl-tRNA synthetase (ND-GluRS) that can form both Glu-tRNA(Glu) and Glu-tRNA(Gln). The Glu-tRNA(Gln) is then converted to Gln-tRNA(Gln) by an amidotransferase. Since the well-characterized bacterial ND-GluRS enzymes recognize tRNA(Glu) and tRNA(Gln) with an unrelated α-helical cage domain in contrast to the β-barrel anticodon-binding domain in archaeal and eukaryotic GluRSs, the mode of tRNA(Glu)/tRNA(Gln) discrimination in archaea and eukaryotes was unknown. Here, we present the crystal structure of the Methanothermobacter thermautotrophicus ND-GluRS, which is the evolutionary predecessor of both the glutaminyl-tRNA synthetase (GlnRS) and the eukaryotic discriminating GluRS. Comparison with the previously solved structure of the Escherichia coli GlnRS-tRNA(Gln) complex reveals the structural determinants responsible for specific tRNA(Gln) recognition by GlnRS compared to promiscuous recognition of both tRNAs by the ND-GluRS. The structure also shows the amino acid recognition pocket of GluRS is more variable than that found in GlnRS. Phylogenetic analysis is used to reconstruct the key events in the evolution from indirect to direct genetic encoding of glutamine.

  17. Different Functional and Microstructural Changes Depending on Duration of Mild Cognitive Impairment in Parkinson Disease.

    PubMed

    Shin, N-Y; Shin, Y S; Lee, P H; Yoon, U; Han, S; Kim, D J; Lee, S-K

    2016-05-01

    The higher cortical burden of Lewy body and Alzheimer disease-type pathology has been reported to be associated with a faster onset of cognitive impairment of Parkinson disease. So far, there has been a few studies only about the changes of gray matter volume depending on duration of cognitive impairment in Parkinson disease. Therefore, our aim was to evaluate the different patterns of structural and functional changes in Parkinson disease with mild cognitive impairment according to the duration of parkinsonism before mild cognitive impairment. Fifty-nine patients with Parkinson disease with mild cognitive impairment were classified into 2 groups on the basis of shorter (<1 year, n = 16) and longer (≥1 year, n = 43) durations of parkinsonism before mild cognitive impairment. Fifteen drug-naïve patients with de novo Parkinson disease with intact cognition were included for comparison. Cortical thickness, Tract-Based Spatial Statistics, and seed-based resting-state functional connectivity analyses were performed. Age, sex, years of education, age at onset of parkinsonism, and levodopa-equivalent dose were included as covariates. The group with shorter duration of parkinsonism before mild cognitive impairment showed decreased fractional anisotropy and increased mean and radial diffusivity values in the frontal areas compared with the group with longer duration of parkinsonism before mild cognitive impairment (corrected P < .05). The group with shorter duration of parkinsonism before mild cognitive impairment showed decreased resting-state functional connectivity in the default mode network area when the left or right posterior cingulate was used as a seed, and in the dorsolateral prefrontal areas when the left or right caudate was used as a seed (corrected P < .05). The group with longer duration of parkinsonism before mild cognitive impairment showed decreased resting-state functional connectivity mainly in the medial prefrontal cortex when the left or right posterior cingulate was used as a seed, and in the parieto-occipital areas when the left or right caudate was used as a seed (corrected P < .05). No differences in cortical thickness were found in all group contrasts. Resting-state functional connectivity and WM alterations might be useful imaging biomarkers for identifying changes in patients with Parkinson disease with mild cognitive impairment according to the duration of parkinsonism before mild cognitive impairment. The functional and microstructural substrates may topographically differ depending on the rate of cognitive decline in these patients. © 2016 by American Journal of Neuroradiology.

  18. Effect of ablated hippocampal neurogenesis on the formation and extinction of contextual fear memory

    PubMed Central

    Ko, Hyoung-Gon; Jang, Deok-Jin; Son, Junehee; Kwak, Chuljung; Choi, Jun-Hyeok; Ji, Young-Hoon; Lee, Yun-Sil; Son, Hyeon; Kaang, Bong-Kiun

    2009-01-01

    Newborn neurons in the subgranular zone (SGZ) of the hippocampus incorporate into the dentate gyrus and mature. Numerous studies have focused on hippocampal neurogenesis because of its importance in learning and memory. However, it is largely unknown whether hippocampal neurogenesis is involved in memory extinction per se. Here, we sought to examine the possibility that hippocampal neurogenesis may play a critical role in the formation and extinction of hippocampus-dependent contextual fear memory. By methylazoxymethanol acetate (MAM) or gamma-ray irradiation, hippocampal neurogenesis was impaired in adult mice. Under our experimental conditions, only a severe impairment of hippocampal neurogenesis inhibited the formation of contextual fear memory. However, the extinction of contextual fear memory was not affected. These results suggest that although adult newborn neurons contribute to contextual fear memory, they may not be involved in the extinction or erasure of hippocampus-dependent contextual fear memory. PMID:19138433

  19. Differential Binding of Human ApoE Isoforms to Insulin Receptor is Associated with Aberrant Insulin Signaling in AD Brain Samples.

    PubMed

    Chan, Elizabeth S; Chen, Christopher; Soong, Tuck Wah; Wong, Boon-Seng

    2018-03-01

    Apolipoprotein E4 (ApoE4) is the strongest genetic risk factor for sporadic Alzheimer's disease (AD), where inheritance of this isoform predisposes development of AD in a gene dose-dependent manner. Although the mode of action of ApoE4 on AD onset and progression remains unknown, we have previously shown that ApoE4, and not ApoE3 expression, resulted in insulin signaling deficits in the presence of amyloid beta (Aβ). However, these reports were not conducted with clinical samples that more accurately reflect human disease. In this study, we investigated the effect of ApoE genotype on the insulin signaling pathway in control and AD human brain samples. We found that targets of the insulin signaling pathway were attenuated in AD cases, regardless of ApoE isoform. We also found a decrease in GluR1 subunit expression, and an increase NR2B subunit expression in AD cases, regardless of ApoE isoform. Lastly, we observed that more insulin receptor (IR) was immunoprecipitated in control cases, and more Aβ was immunoprecipitated with AD cases. But, when comparing among AD cases, we found that more IR was immunoprecipitated with ApoE3 than ApoE4, and more Aβ was immunoprecipitated with ApoE4 than ApoE3. Our results suggest that the difference in IR binding and effect on protein expression downstream of the IR may affect onset and progression of AD.

  20. Impulsivity and opioid drugs: differential effects of heroin, methadone and prescribed analgesic medication.

    PubMed

    Baldacchino, A; Balfour, D J K; Matthews, K

    2015-04-01

    Previous studies have provided inconsistent evidence that chronic exposure to opioid drugs, including heroin and methadone, may be associated with impairments in executive neuropsychological functioning, specifically cognitive impulsivity. Further, it remains unclear how such impairments may relate of the nature, level and extent of opioid exposure, the presence and severity of opioid dependence, and hazardous behaviours such as injecting. Participants with histories of illicit heroin use (n = 24), former heroin users stabilized on prescribed methadone (methadone maintenance treatment; MMT) (n = 29), licit opioid prescriptions for chronic pain without history of abuse or dependence (n = 28) and healthy controls (n = 28) were recruited and tested on a task battery that included measures of cognitive impulsivity (Cambridge Gambling Task, CGT), motor impulsivity (Affective Go/NoGo, AGN) and non-planning impulsivity (Stockings of Cambridge, SOC). Illicit heroin users showed increased motor impulsivity and impaired strategic planning. Additionally, they placed higher bets earlier and risked more on the CGT. Stable MMT participants deliberated longer and placed higher bets earlier on the CGT, but did not risk more. Chronic opioid exposed pain participants did not differ from healthy controls on any measures on any tasks. The identified impairments did not appear to be associated specifically with histories of intravenous drug use, nor with estimates of total opioid exposure. These data support the hypothesis that different aspects of neuropsychological measures of impulsivity appear to be associated with exposure to different opioids. This could reflect either a neurobehavioural consequence of opioid exposure, or may represent an underlying trait vulnerability to opioid dependence.

  1. C-peptide and Central Nervous System Complications in Diabetes

    PubMed Central

    Li, Zhen-guo

    2004-01-01

    Substantial evidence collected from clinical data and experimental studies has indicated that CNS is not spared from diabetes complications. Impairments in CNS function are well documented in both type 1 and type 2 diabetic patients as well as in various animal models of diabetes, in terms of alterations in cognition, neuropsychology, neurobehavior, electrophysiology, structure, neurochemistry and apoptotic activities. These data suggest that primary diabetic encephalopathy exists as a definable diabetic complication. The mechanisms underlying this CNS complication are not clear. Experimental studies have suggested that neuronal apoptosis may play an important role in neuronal loss and impaired cognitive function. In diabetes multiple factors are responsible for neuronal apoptosis, such as a perturbed IGF system, hyperglycemia and the aging process itself. Recent data suggest that insulin/C-peptide deficiency may exert an eminent role. Administration of C-peptide partially corrects the perturbed IGF system in the brain and prevents neuronal apoptosis in hippocampus of type 1 diabetes. In neuroblastoma SH-SY5Y cells C-peptide provides a dose-dependent stimulation on cell proliferation and an anti-apoptotic effect as well. These studies provide a basis for administration of C-peptide as a potentially effective therapy for type 1 diabetes. PMID:15198373

  2. TRPV2 is critical for the maintenance of cardiac structure and function in mice

    PubMed Central

    Katanosaka, Yuki; Iwasaki, Keiichiro; Ujihara, Yoshihiro; Takatsu, Satomi; Nishitsuji, Koki; Kanagawa, Motoi; Sudo, Atsushi; Toda, Tatsushi; Katanosaka, Kimiaki; Mohri, Satoshi; Naruse, Keiji

    2014-01-01

    The heart has a dynamic compensatory mechanism for haemodynamic stress. However, the molecular details of how mechanical forces are transduced in the heart are unclear. Here we show that the transient receptor potential, vanilloid family type 2 (TRPV2) cation channel is critical for the maintenance of cardiac structure and function. Within 4 days of eliminating TRPV2 from hearts of the adult mice, cardiac function declines severely, with disorganization of the intercalated discs that support mechanical coupling with neighbouring myocytes and myocardial conduction defects. After 9 days, cell shortening and Ca2+ handling by single myocytes are impaired in TRPV2-deficient hearts. TRPV2-deficient neonatal cardiomyocytes form no intercalated discs and show no extracellular Ca2+-dependent intracellular Ca2+ increase and insulin-like growth factor (IGF-1) secretion in response to stretch stimulation. We further demonstrate that IGF-1 receptor/PI3K/Akt pathway signalling is significantly downregulated in TRPV2-deficient hearts, and that IGF-1 administration partially prevents chamber dilation and impairment in cardiac pump function in these hearts. Our results improve our understanding of the molecular processes underlying the maintenance of cardiac structure and function. PMID:24874017

  3. TRPV2 is critical for the maintenance of cardiac structure and function in mice.

    PubMed

    Katanosaka, Yuki; Iwasaki, Keiichiro; Ujihara, Yoshihiro; Takatsu, Satomi; Nishitsuji, Koki; Kanagawa, Motoi; Sudo, Atsushi; Toda, Tatsushi; Katanosaka, Kimiaki; Mohri, Satoshi; Naruse, Keiji

    2014-05-29

    The heart has a dynamic compensatory mechanism for haemodynamic stress. However, the molecular details of how mechanical forces are transduced in the heart are unclear. Here we show that the transient receptor potential, vanilloid family type 2 (TRPV2) cation channel is critical for the maintenance of cardiac structure and function. Within 4 days of eliminating TRPV2 from hearts of the adult mice, cardiac function declines severely, with disorganization of the intercalated discs that support mechanical coupling with neighbouring myocytes and myocardial conduction defects. After 9 days, cell shortening and Ca(2+) handling by single myocytes are impaired in TRPV2-deficient hearts. TRPV2-deficient neonatal cardiomyocytes form no intercalated discs and show no extracellular Ca(2+)-dependent intracellular Ca(2+) increase and insulin-like growth factor (IGF-1) secretion in response to stretch stimulation. We further demonstrate that IGF-1 receptor/PI3K/Akt pathway signalling is significantly downregulated in TRPV2-deficient hearts, and that IGF-1 administration partially prevents chamber dilation and impairment in cardiac pump function in these hearts. Our results improve our understanding of the molecular processes underlying the maintenance of cardiac structure and function.

  4. Constitutive and ghrelin-dependent GHSR1a activation impairs CaV2.1 and CaV2.2 currents in hypothalamic neurons

    PubMed Central

    López Soto, Eduardo Javier; Agosti, Francina; Cabral, Agustina; Mustafa, Emilio Roman; Damonte, Valentina Martínez; Gandini, Maria Alejandra; Rodríguez, Silvia; Castrogiovanni, Daniel; Felix, Ricardo; Perelló, Mario

    2015-01-01

    The growth hormone secretagogue receptor type 1a (GHSR1a) has the highest known constitutive activity of any G protein–coupled receptor (GPCR). GHSR1a mediates the action of the hormone ghrelin, and its activation increases transcriptional and electrical activity in hypothalamic neurons. Although GHSR1a is present at GABAergic presynaptic terminals, its effect on neurotransmitter release remains unclear. The activities of the voltage-gated calcium channels, CaV2.1 and CaV2.2, which mediate neurotransmitter release at presynaptic terminals, are modulated by many GPCRs. Here, we show that both constitutive and agonist-dependent GHSR1a activity elicit a strong impairment of CaV2.1 and CaV2.2 currents in rat and mouse hypothalamic neurons and in a heterologous expression system. Constitutive GHSR1a activity reduces CaV2 currents by a Gi/o-dependent mechanism that involves persistent reduction in channel density at the plasma membrane, whereas ghrelin-dependent GHSR1a inhibition is reversible and involves altered CaV2 gating via a Gq-dependent pathway. Thus, GHSR1a differentially inhibits CaV2 channels by Gi/o or Gq protein pathways depending on its mode of activation. Moreover, we present evidence suggesting that GHSR1a-mediated inhibition of CaV2 attenuates GABA release in hypothalamic neurons, a mechanism that could contribute to neuronal activation through the disinhibition of postsynaptic neurons. PMID:26283199

  5. Estrogen-related receptor α decreases RHOA stability to induce orientated cell migration

    PubMed Central

    Sailland, Juliette; Tribollet, Violaine; Forcet, Christelle; Billon, Cyrielle; Barenton, Bruno; Carnesecchi, Julie; Bachmann, Alice; Gauthier, Karine Cécile; Yu, Shan; Giguère, Vincent; Chan, Franky L.; Vanacker, Jean-Marc

    2014-01-01

    Several physiopathological processes require orientated cellular migration. This phenomenon highly depends on members of the RHO family of GTPases. Both excessive and deficient RHO activity impair directional migration. A tight control is thus exerted on these proteins through the regulation of their activation and of their stability. Here we show that the estrogen-related receptor α (ERRα) directly activates the expression of TNFAIP1, the product of which [BTB/POZ domain-containing adapter for Cullin3-mediated RhoA degradation 2 (BACURD2)] regulates RHOA protein turnover. Inactivation of the receptor leads to enhanced RHOA stability and activation. This results in cell disorientation, increased actin network, and inability to form a lamellipodium at the migration edge. As a consequence, directional migration, but not cell motility per se, is impaired in the absence of the receptor, under pathological as well as physiological conditions. Altogether, our results show that the control exerted by ERRα on RHOA stability is required for directional migration. PMID:25288732

  6. Estrogen-related receptor α decreases RHOA stability to induce orientated cell migration.

    PubMed

    Sailland, Juliette; Tribollet, Violaine; Forcet, Christelle; Billon, Cyrielle; Barenton, Bruno; Carnesecchi, Julie; Bachmann, Alice; Gauthier, Karine Cécile; Yu, Shan; Giguère, Vincent; Chan, Franky L; Vanacker, Jean-Marc

    2014-10-21

    Several physiopathological processes require orientated cellular migration. This phenomenon highly depends on members of the RHO family of GTPases. Both excessive and deficient RHO activity impair directional migration. A tight control is thus exerted on these proteins through the regulation of their activation and of their stability. Here we show that the estrogen-related receptor α (ERRα) directly activates the expression of TNFAIP1, the product of which [BTB/POZ domain-containing adapter for Cullin3-mediated RhoA degradation 2 (BACURD2)] regulates RHOA protein turnover. Inactivation of the receptor leads to enhanced RHOA stability and activation. This results in cell disorientation, increased actin network, and inability to form a lamellipodium at the migration edge. As a consequence, directional migration, but not cell motility per se, is impaired in the absence of the receptor, under pathological as well as physiological conditions. Altogether, our results show that the control exerted by ERRα on RHOA stability is required for directional migration.

  7. KCNQ Channels Regulate Age-Related Memory Impairment

    PubMed Central

    Cavaliere, Sonia; Malik, Bilal R.; Hodge, James J. L.

    2013-01-01

    In humans KCNQ2/3 heteromeric channels form an M-current that acts as a brake on neuronal excitability, with mutations causing a form of epilepsy. The M-current has been shown to be a key regulator of neuronal plasticity underlying associative memory and ethanol response in mammals. Previous work has shown that many of the molecules and plasticity mechanisms underlying changes in alcohol behaviour and addiction are shared with those of memory. We show that the single KCNQ channel in Drosophila (dKCNQ) when mutated show decrements in associative short- and long-term memory, with KCNQ function in the mushroom body α/βneurons being required for short-term memory. Ethanol disrupts memory in wildtype flies, but not in a KCNQ null mutant background suggesting KCNQ maybe a direct target of ethanol, the blockade of which interferes with the plasticity machinery required for memory formation. We show that as in humans, Drosophila display age-related memory impairment with the KCNQ mutant memory defect mimicking the effect of age on memory. Expression of KCNQ normally decreases in aging brains and KCNQ overexpression in the mushroom body neurons of KCNQ mutants restores age-related memory impairment. Therefore KCNQ is a central plasticity molecule that regulates age dependent memory impairment. PMID:23638087

  8. To die or not to die SGK1-sensitive ORAI/STIM in cell survival.

    PubMed

    Lang, Florian; Pelzl, Lisann; Hauser, Stefan; Hermann, Andreas; Stournaras, Christos; Schöls, Ludger

    2018-05-03

    The pore forming Ca 2+ release activated Ca 2+ channel (CRAC) isoforms ORAI1-3 and their regulators STIM1,2 accomplish store operated Ca 2+ entry (SOCE). Activation of SOCE may lead to cytosolic Ca 2+ oscillations, which in turn support cell proliferation and cell survival. ORAI/STIM and thus SOCE are upregulated by the serum and glucocorticoid inducible kinase SGK1, a kinase under powerful genomic regulation and activated by phosphorylation via the phosphoinositol-3-phosphate pathway. SGK1 enhances ORAI1 abundance partially by phosphorylation of Nedd4-2, an ubiquitin ligase priming the channel protein for degradation. The SGK1-phosphorylated Nedd4-2 binds to the protein 14-3-3 and is thus unable to ubiquinate ORAI1. SGK1 further increases the ORAI1 and STIM1 protein abundance by activating nuclear factor kappa B (NF-κB), a transcription factor upregulating the expression of STIM1 and ORAI1. SGK1-sensitive upregulation of ORAI/STIM and thus SOCE is triggered by a wide variety of hormones and growth factors, as well as several cell stressors including ischemia, radiation, and cell shrinkage. SGK1 dependent upregulation of ORAI/STIM confers survival of tumor cells and thus impacts on growth and therapy resistance of cancer. On the other hand, SGK1-dependent upregulation of ORAI1 and STIM1 may support survival of neurons and impairment of SGK1-dependent ORAI/STIM activity may foster neurodegeneration. Clearly, further experimental effort is needed to define the mechanisms linking SGK1-dependent upregulation of ORAI1 and STIM1 to cell survival and to define the impact of SGK1-dependent upregulation of ORAI1 and STIM1 on malignancy and neurodegenerative disease. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Hydralazine and Organic Nitrates Restore Impaired Excitation-Contraction Coupling by Reducing Calcium Leak Associated with Nitroso-Redox Imbalance*

    PubMed Central

    Dulce, Raul A.; Yiginer, Omer; Gonzalez, Daniel R.; Goss, Garrett; Feng, Ning; Zheng, Meizi; Hare, Joshua M.

    2013-01-01

    Although the combined use of hydralazine and isosorbide dinitrate confers important clinical benefits in patients with heart failure, the underlying mechanism of action is still controversial. We used two models of nitroso-redox imbalance, neuronal NO synthase-deficient (NOS1−/−) mice and spontaneously hypertensive heart failure rats, to test the hypothesis that hydralazine (HYD) alone or in combination with nitroglycerin (NTG) or isosorbide dinitrate restores Ca2+ cycling and contractile performance and controls superoxide production in isolated cardiomyocytes. The response to increased pacing frequency was depressed in NOS1−/− compared with wild type myocytes. Both sarcomere length shortening and intracellular Ca2+ transient (Δ[Ca2+]i) responses in NOS1−/− cardiomyocytes were augmented by HYD in a dose-dependent manner. NTG alone did not affect myocyte shortening but reduced Δ[Ca2+]i across the range of pacing frequencies and increased myofilament Ca2+ sensitivity thereby enhancing contractile efficiency. Similar results were seen in failing myocytes from the heart failure rat model. HYD alone or in combination with NTG reduced sarcoplasmic reticulum (SR) leak, improved SR Ca2+ reuptake, and restored SR Ca2+ content. HYD and NTG at low concentrations (1 μm), scavenged superoxide in isolated cardiomyocytes, whereas in cardiac homogenates, NTG inhibited xanthine oxidoreductase activity and scavenged NADPH oxidase-dependent superoxide more efficiently than HYD. Together, these results revealed that by reducing SR Ca2+ leak, HYD improves Ca2+ cycling and contractility impaired by nitroso-redox imbalance, and NTG enhanced contractile efficiency, restoring cardiac excitation-contraction coupling. PMID:23319593

  10. Care mapping in clinical neuroscience settings: Cognitive impairment and dependency.

    PubMed

    Leigh, Andrew James; O'Hanlon, Katie; Sheldrick, Russell; Surr, Claire; Hare, Dougal Julian

    2015-01-01

    Person-centred care can improve the well-being of patients and is therefore a key driver in healthcare developments in the UK. The current study aims to investigate the complex relationship between cognitive impairment, dependency and well-being in people with a wide range of acquired brain and spinal injuries. Sixty-five participants, with varied acquired brain and spinal injuries, were selected by convenience sampling from six inpatient clinical neuroscience settings. Participants were observed using Dementia Care Mapping - Neurorehabilitation (DCM-NR) and categorised based on severity of cognitive impairment. A significant difference in the behaviours participants engaged in, their well-being and dependency was found between the severe cognitive impairment group and the mild, moderate or no cognitive impairment groups. Dependency and cognitive impairment accounted for 23.9% of the variance in well-ill-being scores and 17.2% of the variance in potential for positive engagement. The current study highlights the impact of severe cognitive impairment and dependency on the behaviours patients engaged in and their well-being. It also affirms the utility of DCM-NR in providing insights into patient experience. Consideration is given to developing DCM-NR as a process that may improve person-centred care in neuroscience settings.

  11. Impaired translocation of GLUT4 results in insulin resistance of atrophic soleus muscle.

    PubMed

    Xu, Peng-Tao; Song, Zhen; Zhang, Wen-Cheng; Jiao, Bo; Yu, Zhi-Bin

    2015-01-01

    Whether or not the atrophic skeletal muscle induces insulin resistance and its mechanisms are not resolved now. The antigravity soleus muscle showed a progressive atrophy in 1-week, 2-week, and 4-week tail-suspended rats. Hyperinsulinemic-euglycemic clamp showed that the steady-state glucose infusion rate was lower in 4-week tail-suspended rats than that in the control rats. The glucose uptake rates under insulin- or contraction-stimulation were significantly decreased in 4-week unloaded soleus muscle. The key protein expressions of IRS-1, PI3K, and Akt on the insulin-dependent pathway and of AMPK, ERK, and p38 on the insulin-independent pathway were unchanged in unloaded soleus muscle. The unchanged phosphorylation of Akt and p38 suggested that the activity of two signal pathways was not altered in unloaded soleus muscle. The AS160 and GLUT4 expression on the common downstream pathway also was not changed in unloaded soleus muscle. But the GLUT4 translocation to sarcolemma was inhibited during insulin stimulation in unloaded soleus muscle. The above results suggest that hindlimb unloading in tail-suspended rat induces atrophy in antigravity soleus muscle. The impaired GLUT4 translocation to sarcolemma under insulin stimulation may mediate insulin resistance in unloaded soleus muscle and further affect the insulin sensitivity of whole body in tail-suspended rats.

  12. Impaired Translocation of GLUT4 Results in Insulin Resistance of Atrophic Soleus Muscle

    PubMed Central

    Xu, Peng-Tao; Song, Zhen; Zhang, Wen-Cheng; Jiao, Bo; Yu, Zhi-Bin

    2015-01-01

    Whether or not the atrophic skeletal muscle induces insulin resistance and its mechanisms are not resolved now. The antigravity soleus muscle showed a progressive atrophy in 1-week, 2-week, and 4-week tail-suspended rats. Hyperinsulinemic-euglycemic clamp showed that the steady-state glucose infusion rate was lower in 4-week tail-suspended rats than that in the control rats. The glucose uptake rates under insulin- or contraction-stimulation were significantly decreased in 4-week unloaded soleus muscle. The key protein expressions of IRS-1, PI3K, and Akt on the insulin-dependent pathway and of AMPK, ERK, and p38 on the insulin-independent pathway were unchanged in unloaded soleus muscle. The unchanged phosphorylation of Akt and p38 suggested that the activity of two signal pathways was not altered in unloaded soleus muscle. The AS160 and GLUT4 expression on the common downstream pathway also was not changed in unloaded soleus muscle. But the GLUT4 translocation to sarcolemma was inhibited during insulin stimulation in unloaded soleus muscle. The above results suggest that hindlimb unloading in tail-suspended rat induces atrophy in antigravity soleus muscle. The impaired GLUT4 translocation to sarcolemma under insulin stimulation may mediate insulin resistance in unloaded soleus muscle and further affect the insulin sensitivity of whole body in tail-suspended rats. PMID:25713812

  13. Imitation and matching of meaningless gestures: distinct involvement from motor and visual imagery.

    PubMed

    Lesourd, Mathieu; Navarro, Jordan; Baumard, Josselin; Jarry, Christophe; Le Gall, Didier; Osiurak, François

    2017-05-01

    The aim of the present study was to understand the underlying cognitive processes of imitation and matching of meaningless gestures. Neuropsychological evidence obtained in brain damaged patients, has shown that distinct cognitive processes supported imitation and matching of meaningless gestures. Left-brain damaged (LBD) patients failed to imitate while right-brain damaged (RBD) patients failed to match meaningless gestures. Moreover, other studies with brain damaged patients showed that LBD patients were impaired in motor imagery while RBD patients were impaired in visual imagery. Thus, we hypothesize that imitation of meaningless gestures might rely on motor imagery, whereas matching of meaningless gestures might be based on visual imagery. In a first experiment, using a correlational design, we demonstrated that posture imitation relies on motor imagery but not on visual imagery (Experiment 1a) and that posture matching relies on visual imagery but not on motor imagery (Experiment 1b). In a second experiment, by manipulating directly the body posture of the participants, we demonstrated that such manipulation evokes a difference only in imitation task but not in matching task. In conclusion, the present study provides direct evidence that the way we imitate or we have to compare postures depends on motor imagery or visual imagery, respectively. Our results are discussed in the light of recent findings about underlying mechanisms of meaningful and meaningless gestures.

  14. Neuropsychological mechanisms of Digit Symbol Substitution Test impairment in Asperger Disorder.

    PubMed

    Yoran-Hegesh, Roni; Kertzman, Semion; Vishne, Tali; Weizman, Abraham; Kotler, Moshe

    2009-03-31

    Our aim was to investigate the neurocognitive mechanisms recruited by adolescents with Asperger Disorder (AD), in comparison to controls, and to detect the underlying mechanisms during the complex information processing required for the performance of the Digit Symbol Substitution Test (DSST). Male adolescents (n=23; mean age 15.1+/-3.6 years) with a DSM-IV diagnosis of AD were compared with a normal male control group with similar demographic characteristics (n=43; mean age: 15.1+/-3.6 years). A computerized neurocognitive battery was administered and included: Inspection Time (IT), Finger Tapping Test (FTT), Simple Reaction Time (SRT), Choice Reaction Time (CRT), Digit Running task (DRT), Stroop test and Digit Symbol Substitution Test (DSST). Adolescents with AD performed significantly worse than controls on the DSST. This impaired DSST performance was related to cognitive mechanisms different from those employed by normal controls. Motor slowness and inability to deal with increased amounts of information affected the performance of the AD group, while shifting of attention was the limiting factor in the controls. Both groups were similarly dependent on response selection. This study demonstrated differences in performance in complex cognitive tasks between adolescents with AD and normal controls that may be related to differences in neurocognitive mechanisms underlying information processing. Future neuroimaging studies are needed to clarify the neural network involved in the differences in cognitive performance between AD subjects and normal controls.

  15. Tributyltin impairs dentin mineralization and enamel formation in cultured mouse embryonic molar teeth.

    PubMed

    Salmela, Eija; Sahlberg, Carin; Alaluusua, Satu; Lukinmaa, Pirjo-Liisa

    2008-11-01

    Tributyltin (TBT), earlier used as an antifouling agent in marine paints, causes damage to the aquatic ecosystem, for example, impaired shell calcification in oysters. TBT affects hard tissue mineralization even in mammals: delayed bone mineralization has been observed in rodents exposed to TBT in utero. To see if TBT interferes with tooth development, especially dental hard tissue formation, we exposed mouse E18 mandibular first and second molars to 0.1, 0.5, 1.0, and 2.0 microM TBT chloride in organ culture for 7-12 days. The amount of enamel was assessed and the sizes of the first molars were measured from photographs taken after the culture. TBT concentration dependently impaired enamel formation (p < 0.001) and reduced tooth size (p < 0.001). Histological analysis showed slight arrest of dentin mineralization and enamel formation in first molars exposed to 0.1 microM TBT. At the concentration of 1.0 microM the effect was overt. The differentiation of ameloblasts in the mesial cusps was retarded but TBT had no effect on odontoblast morphology. The dental epithelium showed enhanced apoptosis. The failure of ameloblasts to form enamel was likely to be secondary to the effect of TBT on dentin mineralization. In the second molars, where predentin deposition had not started, ameloblasts and odontoblasts were nonpolarized and proliferative. The results showed that TBT concentration dependently impairs dental hard tissue formation and reduces tooth size in cultured mouse embryonic molars. The effects depend on the stage of tooth development at the start of exposure and may involve epithelial-mesenchymal interactions.

  16. Binaural speech discrimination under noise in hearing-impaired listeners

    NASA Technical Reports Server (NTRS)

    Kumar, K. V.; Rao, A. B.

    1988-01-01

    This paper presents the results of an assessment of speech discrimination by hearing-impaired listeners (sensori-neural, conductive, and mixed groups) under binaural free-field listening in the presence of background noise. Subjects with pure-tone thresholds greater than 20 dB in 0.5, 1.0 and 2.0 kHz were presented with a version of the W-22 list of phonetically balanced words under three conditions: (1) 'quiet', with the chamber noise below 28 dB and speech at 60 dB; (2) at a constant S/N ratio of +10 dB, and with a background white noise at 70 dB; and (3) same as condition (2), but with the background noise at 80 dB. The mean speech discrimination scores decreased significantly with noise in all groups. However, the decrease in binaural speech discrimination scores with an increase in hearing impairment was less for material presented under the noise conditions than for the material presented in quiet.

  17. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

    PubMed

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

    2006-03-01

    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  18. Self-Imagining Enhances Recognition Memory in Memory-Impaired Individuals with Neurological Damage

    PubMed Central

    Grilli, Matthew D.; Glisky, Elizabeth L.

    2010-01-01

    Objective The ability to imagine an elaborative event from a personal perspective relies on a number of cognitive processes that may potentially enhance subsequent memory for the event, including visual imagery, semantic elaboration, emotional processing, and self-referential processing. In an effort to find a novel strategy for enhancing memory in memory-impaired individuals with neurological damage, the present study investigated the mnemonic benefit of a method we refer to as “self-imagining” – or the imagining of an event from a realistic, personal perspective. Method Fourteen individuals with neurologically-based memory deficits and fourteen healthy control participants intentionally encoded neutral and emotional sentences under three instructions: structural-baseline processing, semantic processing, and self-imagining. Results Findings revealed a robust “self-imagination effect” as self-imagination enhanced recognition memory relative to deep semantic elaboration in both memory-impaired individuals, F (1, 13) = 32.11, p < .001, η2 = .71, and healthy controls, F (1, 13) = 5.57, p < .05, η2 = .30. In addition, results indicated that mnemonic benefits of self-imagination were not limited by severity of the memory disorder nor were they related to self-reported vividness of visual imagery, semantic processing, or emotional content of the materials. Conclusions The findings suggest that the self-imagination effect may depend on unique mnemonic mechanisms possibly related to self-referential processing, and that imagining an event from a personal perspective makes that event particularly memorable even for those individuals with severe memory deficits. Self-imagining may thus provide an effective rehabilitation strategy for individuals with memory impairment. PMID:20873930

  19. Impaired spatial memory and enhanced long-term potentiation in mice with forebrain-specific ablation of the Stim genes

    PubMed Central

    Garcia-Alvarez, Gisela; Shetty, Mahesh S.; Lu, Bo; Yap, Kenrick An Fu; Oh-Hora, Masatsugu; Sajikumar, Sreedharan; Bichler, Zoë; Fivaz, Marc

    2015-01-01

    Recent findings point to a central role of the endoplasmic reticulum-resident STIM (Stromal Interaction Molecule) proteins in shaping the structure and function of excitatory synapses in the mammalian brain. The impact of the Stim genes on cognitive functions remains, however, poorly understood. To explore the function of the Stim genes in learning and memory, we generated three mouse strains with conditional deletion (cKO) of Stim1 and/or Stim2 in the forebrain. Stim1, Stim2, and double Stim1/Stim2 cKO mice show no obvious brain structural defects or locomotor impairment. Analysis of spatial reference memory in the Morris water maze revealed a mild learning delay in Stim1 cKO mice, while learning and memory in Stim2 cKO mice was indistinguishable from their control littermates. Deletion of both Stim genes in the forebrain resulted, however, in a pronounced impairment in spatial learning and memory reflecting a synergistic effect of the Stim genes on the underlying neural circuits. Notably, long-term potentiation (LTP) at CA3-CA1 hippocampal synapses was markedly enhanced in Stim1/Stim2 cKO mice and was associated with increased phosphorylation of the AMPA receptor subunit GluA1, the transcriptional regulator CREB and the L-type Voltage-dependent Ca2+ channel Cav1.2 on protein kinase A (PKA) sites. We conclude that STIM1 and STIM2 are key regulators of PKA signaling and synaptic plasticity in neural circuits encoding spatial memory. Our findings also reveal an inverse correlation between LTP and spatial learning/memory and suggest that abnormal enhancement of cAMP/PKA signaling and synaptic efficacy disrupts the formation of new memories. PMID:26236206

  20. Dysregulation of Specialized Delay/Interference-Dependent Working Memory Following Loss of Dysbindin-1A in Schizophrenia-Related Phenotypes

    PubMed Central

    Petit, Emilie I; Michalak, Zuzanna; Cox, Rachel; O'Tuathaigh, Colm M P; Clarke, Niamh; Tighe, Orna; Talbot, Konrad; Blake, Derek; Joel, Josephine; Shaw, Alexander; Sheardown, Steven A; Morrison, Alastair D; Wilson, Stephen; Shapland, Ellen M; Henshall, David C; Kew, James N; Kirby, Brian P; Waddington, John L

    2017-01-01

    Dysbindin-1, a protein that regulates aspects of early and late brain development, has been implicated in the pathobiology of schizophrenia. As the functional roles of the three major isoforms of dysbindin-1, (A, B, and C) remain unknown, we generated a novel mutant mouse, dys-1A−/−, with selective loss of dysbindin-1A and investigated schizophrenia-related phenotypes in both males and females. Loss of dysbindin-1A resulted in heightened initial exploration and disruption in subsequent habituation to a novel environment, together with heightened anxiety-related behavior in a stressful environment. Loss of dysbindin-1A was not associated with disruption of either long-term (olfactory) memory or spontaneous alternation behavior. However, dys-1A−/− showed enhancement in delay-dependent working memory under high levels of interference relative to controls, ie, impairment in sensitivity to the disruptive effect of such interference. These findings in dys-1A−/− provide the first evidence for differential functional roles for dysbindin-1A vs dysbindin-1C isoforms among phenotypes relevant to the pathobiology of schizophrenia. Future studies should investigate putative sex differences in these phenotypic effects. PMID:27986973

Top