Nie, Hongyi; Liu, Chun; Zhang, Yinxia; Zhou, Mengting; Huang, Xiaofeng; Peng, Li; Xia, Qingyou
2014-01-01
The ability to respond quickly and efficiently to transient extreme environmental conditions is an important property of all biota. However, the physiological basis of thermotolerance in different species is still unclear. Here, we found that the cot mutant showed a seizure phenotype including contraction of the body, rolling, vomiting gut juice and a momentary cessation of movement, and the heartbeat rhythm of the dorsal vessel significantly increases after hyperthermia. To comprehensively understand this process at the molecular level, the transcriptomic profile of cot mutant, which is a behavior mutant that exhibits a seizure phenotype, was investigated after hyperthermia (42°C) that was induced for 5 min. By digital gene expression profiling, we determined the gene expression profile of three strains (cot/cot ok/ok, +/+ ok/ok and +/+ +/+) under hyperthermia (42°C) and normal (25°C) conditions. A Venn diagram showed that the most common differentially expressed genes (DEGs, FDR<0.01 and log2 Ratio≥1) were up-regulated and annotated with the heat shock proteins (HSPs) in 3 strains after treatment with hyperthermia, suggesting that HSPs rapidly increased in response to high temperature; 110 unique DEGs, could be identified in the cot mutant after inducing hyperthermia when compared to the control strains. Of these 110 unique DEGs, 98.18% (108 genes) were up-regulated and 1.82% (two genes) were down-regulated in the cot mutant. KEGG pathways analysis of these unique DEGs suggested that the top three KEGG pathways were “Biotin metabolism,” “Fatty acid biosynthesis” and “Purine metabolism,” implying that diverse metabolic processes are active in cot mutant induced-hyperthermia. Unique DEGs of interest were mainly involved in the ubiquitin system, nicotinic acetylcholine receptor genes, cardiac excitation–contraction coupling or the Notch signaling pathway. Insights into hyperthermia-induced alterations in gene expression and related pathways could yield hints for understanding the relationship between behaviors and environmental stimuli (hyperthermia) in insects. PMID:25423472
Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W
2012-05-03
Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.
Pham, Anh-Tung; Shannon, J Grover; Bilyeu, Kristin D
2012-08-01
High oleic acid soybeans were produced by combining mutant FAD2-1A and FAD2-1B genes. Despite having a high oleic acid content, the linolenic acid content of these soybeans was in the range of 4-6 %, which may be high enough to cause oxidative instability of the oil. Therefore, a study was conducted to incorporate one or two mutant FAD3 genes into the high oleic acid background to further reduce the linolenic acid content. As a result, soybean lines with high oleic acid and low linolenic acid (HOLL) content were produced using different sources of mutant FAD2-1A genes. While oleic acid content of these HOLL lines was stable across two testing environments, the reduction of linolenic acid content varied depending on the number of mutant FAD3 genes combined with mutant FAD2-1 genes, on the severity of mutation in the FAD2-1A gene, and on the testing environment. Combination of two mutant FAD2-1 genes and one mutant FAD3 gene resulted in less than 2 % linolenic acid content in Portageville, Missouri (MO) while four mutant genes were needed to achieve the same linolenic acid in Columbia, MO. This study generated non-transgenic soybeans with the highest oleic acid content and lowest linolenic acid content reported to date, offering a unique alternative to produce a fatty acid profile similar to olive oil.
2012-01-01
Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201
Shin, Sung Jae; Wu, Chia-wei; Steinberg, Howard; Talaat, Adel M.
2006-01-01
Johne's disease, caused by Mycobacterium paratuberculosis infection, is a worldwide problem for the dairy industry and has a possible involvement in Crohn's disease in humans. To identify virulence determinants of this economically important pathogen, a library of 5,060 transposon mutants was constructed using Tn5367 insertion mutagenesis, followed by large-scale sequencing to identify disrupted genes. In this report, 1,150 mutants were analyzed and 970 unique insertion sites were identified. Sequence analysis of the disrupted genes indicated that the insertion of Tn5367 was more prevalent in genomic regions with G+C content (50.5 to 60.5%) lower than the average G+C content (69.3%) of the rest of the genome. Phenotypic screening of the library identified disruptions of genes involved in iron, tryptophan, or mycolic acid metabolic pathways that displayed unique growth characteristics. Bioinformatic analysis of disrupted genes identified a list of potential virulence determinants for further testing with animals. Mouse infection studies showed a significant decrease in tissue colonization by mutants with a disruption in the gcpE, pstA, kdpC, papA2, impA, umaA1, or fabG2_2 gene. Attenuation phenotypes were tissue specific (e.g., for the umaA1 mutant) as well as time specific (e.g., for the impA mutant), suggesting that those genes may be involved in different virulence mechanisms. The identified potential virulence determinants represent novel functional classes that could be necessary for mycobacterial survival during infection and could provide suitable targets for vaccine and drug development against Johne's and Crohn's diseases. PMID:16790754
Bahreini, Amir; Li, Zheqi; Wang, Peilu; Levine, Kevin M; Tasdemir, Nilgun; Cao, Lan; Weir, Hazel M; Puhalla, Shannon L; Davidson, Nancy E; Stern, Andrew M; Chu, David; Park, Ben Ho; Lee, Adrian V; Oesterreich, Steffi
2017-05-23
Mutations in the estrogen receptor alpha (ERα) 1 gene (ESR1) are frequently detected in ER+ metastatic breast cancer, and there is increasing evidence that these mutations confer endocrine resistance in breast cancer patients with advanced disease. However, their functional role is not well-understood, at least in part due to a lack of ESR1 mutant models. Here, we describe the generation and characterization of genome-edited T47D and MCF7 breast cancer cell lines with the two most common ESR1 mutations, Y537S and D538G. Genome editing was performed using CRISPR and adeno-associated virus (AAV) technologies to knock-in ESR1 mutations into T47D and MCF7 cell lines, respectively. Various techniques were utilized to assess the activity of mutant ER, including transactivation, growth and chromatin-immunoprecipitation (ChIP) assays. The level of endocrine resistance was tested in mutant cells using a number of selective estrogen receptor modulators (SERMs) and degraders (SERDs). RNA sequencing (RNA-seq) was employed to study gene targets of mutant ER. Cells with ESR1 mutations displayed ligand-independent ER activity, and were resistant to several SERMs and SERDs, with cell line and mutation-specific differences with respect to magnitude of effect. The SERD AZ9496 showed increased efficacy compared to other drugs tested. Wild-type and mutant cell co-cultures demonstrated a unique evolution of mutant cells under estrogen deprivation and tamoxifen treatment. Transcriptome analysis confirmed ligand-independent regulation of ERα target genes by mutant ERα, but also identified novel target genes, some of which are involved in metastasis-associated phenotypes. Despite significant overlap in the ligand-independent genes between Y537S and D538G, the number of mutant ERα-target genes shared between the two cell lines was limited, suggesting context-dependent activity of the mutant receptor. Some genes and phenotypes were unique to one mutation within a given cell line, suggesting a mutation-specific effect. Taken together, ESR1 mutations in genome-edited breast cancer cell lines confer ligand-independent growth and endocrine resistance. These biologically relevant models can be used for further mechanistic and translational studies, including context-specific and mutation site-specific analysis of the ESR1 mutations.
de Marcos, Alberto; Triviño, Magdalena; Pérez-Bueno, María Luisa; Ballesteros, Isabel; Barón, Matilde; Mena, Montaña; Fenoll, Carmen
2015-01-01
Loss of function of the positive stomata development regulators SPCH or MUTE in Arabidopsis thaliana renders stomataless plants; spch-3 and mute-3 mutants are extreme dwarfs, but produce cotyledons and tiny leaves, providing a system to interrogate plant life in the absence of stomata. To this end, we compared their cotyledon transcriptomes with that of wild-type plants. K-means clustering of differentially expressed genes generated four clusters: clusters 1 and 2 grouped genes commonly regulated in the mutants, while clusters 3 and 4 contained genes distinctively regulated in mute-3. Classification in functional categories and metabolic pathways of genes in clusters 1 and 2 suggested that both mutants had depressed secondary, nitrogen and sulfur metabolisms, while only a few photosynthesis-related genes were down-regulated. In situ quenching analysis of chlorophyll fluorescence revealed limited inhibition of photosynthesis. This and other fluorescence measurements matched the mutant transcriptomic features. Differential transcriptomes of both mutants were enriched in growth-related genes, including known stomata development regulators, which paralleled their epidermal phenotypes. Analysis of cluster 3 was not informative for developmental aspects of mute-3. Cluster 4 comprised genes differentially up−regulated in mute−3, 35% of which were direct targets for SPCH and may relate to the unique cell types of mute−3. A screen of T-DNA insertion lines in genes differentially expressed in the mutants identified a gene putatively involved in stomata development. A collection of lines for conditional overexpression of transcription factors differentially expressed in the mutants rendered distinct epidermal phenotypes, suggesting that these proteins may be novel stomatal development regulators. Thus, our transcriptome analysis represents a useful source of new genes for the study of stomata development and for characterizing physiology and growth in the absence of stomata. PMID:26157447
Arabidopsis ECERIFERUM9 involvement in cuticle formation and maintenance of plant water status
USDA-ARS?s Scientific Manuscript database
A unique set of allelic Arabidopsis mutants are described that exhibit either suppressed or completely inhibited expression of a gene designated ECERIFERUM9 (CER9). These mutants exhibit a dramatic elevation in the total amount of leaf cutin monomers, and a dramatic shift in the leaf cuticular wax p...
Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡
Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu
2009-01-01
Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402
Genome-wide transposon mutagenesis in pathogenic Leptospira species.
Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu
2009-02-01
Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.
Modeling Rett Syndrome Using TALEN-Edited MECP2 Mutant Cynomolgus Monkeys.
Chen, Yongchang; Yu, Juehua; Niu, Yuyu; Qin, Dongdong; Liu, Hailiang; Li, Gang; Hu, Yingzhou; Wang, Jiaojian; Lu, Yi; Kang, Yu; Jiang, Yong; Wu, Kunhua; Li, Siguang; Wei, Jingkuan; He, Jing; Wang, Junbang; Liu, Xiaojing; Luo, Yuping; Si, Chenyang; Bai, Raoxian; Zhang, Kunshan; Liu, Jie; Huang, Shaoyong; Chen, Zhenzhen; Wang, Shuang; Chen, Xiaoying; Bao, Xinhua; Zhang, Qingping; Li, Fuxing; Geng, Rui; Liang, Aibin; Shen, Dinggang; Jiang, Tianzi; Hu, Xintian; Ma, Yuanye; Ji, Weizhi; Sun, Yi Eve
2017-05-18
Gene-editing technologies have made it feasible to create nonhuman primate models for human genetic disorders. Here, we report detailed genotypes and phenotypes of TALEN-edited MECP2 mutant cynomolgus monkeys serving as a model for a neurodevelopmental disorder, Rett syndrome (RTT), which is caused by loss-of-function mutations in the human MECP2 gene. Male mutant monkeys were embryonic lethal, reiterating that RTT is a disease of females. Through a battery of behavioral analyses, including primate-unique eye-tracking tests, in combination with brain imaging via MRI, we found a series of physiological, behavioral, and structural abnormalities resembling clinical manifestations of RTT. Moreover, blood transcriptome profiling revealed that mutant monkeys resembled RTT patients in immune gene dysregulation. Taken together, the stark similarity in phenotype and/or endophenotype between monkeys and patients suggested that gene-edited RTT founder monkeys would be of value for disease mechanistic studies as well as development of potential therapeutic interventions for RTT. Copyright © 2017 Elsevier Inc. All rights reserved.
Systems Biology-Based Identification of Mycobacterium tuberculosis Persistence Genes in Mouse Lungs
Dutta, Noton K.; Bandyopadhyay, Nirmalya; Veeramani, Balaji; Lamichhane, Gyanu; Karakousis, Petros C.; Bader, Joel S.
2014-01-01
ABSTRACT Identifying Mycobacterium tuberculosis persistence genes is important for developing novel drugs to shorten the duration of tuberculosis (TB) treatment. We developed computational algorithms that predict M. tuberculosis genes required for long-term survival in mouse lungs. As the input, we used high-throughput M. tuberculosis mutant library screen data, mycobacterial global transcriptional profiles in mice and macrophages, and functional interaction networks. We selected 57 unique, genetically defined mutants (18 previously tested and 39 untested) to assess the predictive power of this approach in the murine model of TB infection. We observed a 6-fold enrichment in the predicted set of M. tuberculosis genes required for persistence in mouse lungs relative to randomly selected mutant pools. Our results also allowed us to reclassify several genes as required for M. tuberculosis persistence in vivo. Finally, the new results implicated additional high-priority candidate genes for testing. Experimental validation of computational predictions demonstrates the power of this systems biology approach for elucidating M. tuberculosis persistence genes. PMID:24549847
Orndorff, P E; Falkow, S
1984-01-01
The recombinant plasmid pSH2 confers type 1 piliation (Pil+) on a nonpiliated (Pil-) strain of Escherichia coli K-12. At least four plasmid-encoded gene products are involved in pilus biosynthesis and expression. We present evidence which indicates that one gene encodes an inhibitor of piliation. Hyperpiliated (Hyp) mutants were isolated after Tn5 insertion mutagenesis of pSH2 and introduction of the plasmid DNA into a Pil- strain of E. coli as unique small, compact colonies. Also, Hyp mutants clumped during growth in static broth and were piliated under several cultural conditions that normally suppressed piliation. Electron microscopic examination of Hyp mutants associated an observed 40-fold increase in pilin antigen with an increase in the number and length of pili per cell. All Hyp mutants examined failed to produce a 23-kilodalton protein that was encoded by a gene adjacent to the structural (pilin) gene for type 1 pili, and all Tn5 insertion mutations that produced the Hyp phenotype mapped in this region (hyp). Piliation in Hyp mutants could be reduced to near parental levels by introducing a second plasmid containing a parental hyp gene. Thus the 23-kilodalton (hyp) protein appears to act in trans to regulate the level of piliation. Images PMID:6148338
Rose, Sasha J.
2016-01-01
ABSTRACT Extracellular DNA (eDNA) is an integral biofilm matrix component of numerous pathogens, including nontuberculous mycobacteria (NTM). Cell lysis is the source of eDNA in certain bacteria, but the source of eDNA remains unidentified for NTM, as well as for other eDNA-containing bacterial species. In this study, conditions affecting eDNA export were examined, and genes involved with the eDNA export mechanism were identified. After a method for monitoring eDNA in real time in undisturbed biofilms was established, different conditions affecting eDNA were investigated. Bicarbonate positively influenced eDNA export in a pH-independent manner in Mycobacterium avium, M. abscessus, and M. chelonae. The surface-exposed proteome of M. avium in eDNA-containing biofilms revealed abundant carbonic anhydrases. Chemical inhibition of carbonic anhydrases with ethoxzolamide significantly reduced eDNA export. An unbiased transposon mutant library screen for eDNA export in M. avium identified many severely eDNA-attenuated mutants, including one not expressing a unique FtsK/SpoIIIE-like DNA-transporting pore, two with inactivation of carbonic anhydrases, and nine with inactivation of genes belonging to a unique genomic region, as well as numerous mutants involved in metabolism and energy production. Complementation of nine mutants that included the FtsK/SpoIIIE and carbonic anhydrase significantly restored eDNA export. Interestingly, several attenuated eDNA mutants have mutations in genes encoding proteins that were found with the surface proteomics, and many more mutations are localized in operons potentially encoding surface proteins. Collectively, our data strengthen the evidence of eDNA export being an active mechanism that is activated by the bacterium responding to bicarbonate. PMID:27923918
Cohen, Oded; Borovsky, Yelena; David-Schwartz, Rakefet; Paran, Ilan
2014-05-01
The genetic control of the transition to flowering has mainly been studied in model species, while few data are available in crop species such as pepper (Capsicum spp.). To elucidate the genetic control of the transition to flowering in pepper, mutants that lack flowers were isolated and characterized. Genetic mapping and sequencing allowed the identification of the gene disrupted in the mutants. Double mutants and expression analyses were used to characterize the relationships between the mutated gene and other genes controlling the transition to flowering and flower differentiation. The mutants were characterized by a delay in the initiation of sympodial growth, a delay in the termination of sympodial meristems and complete inhibition of flower formation. Capsicum annuum S (CaS), the pepper (Capsicum annuum) ortholog of tomato (Solanum lycopersicum) COMPOUND INFLORESCENCE and petunia (Petunia hybrida) EVERGREEN, was found to govern the mutant phenotype. CaS is required for the activity of the flower meristem identity gene Ca-ANANTHA and does not affect the expression of CaLEAFY. CaS is epistatic over other genes controlling the transition to flowering with respect to flower formation. Comparative homologous mutants in the Solanaceae indicate that CaS has uniquely evolved to have a critical role in flower formation, while its role in meristem maturation is conserved in pepper, tomato and petunia. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Kawakami-Schulz, Sharolyn V.; Verdoni, Angela M.; Sattler, Shannon G.; Jessen, Erik; Kao, Winston W.-Y.; Ikeda, Akihiro
2014-01-01
Increased angiogenesis, inflammation, and proliferation are hallmarks of diseased tissues, and in vivo models of these disease phenotypes can provide insight into disease pathology. Dstncorn1 mice, deficient for the actin depolymerizing factor destrin (DSTN), display an increase of serum response factor (SRF) that results in epithelial hyperproliferation, inflammation, and neovascularization in the cornea. Previous work demonstrated that conditional ablation of Srf from the corneal epithelium of Dstncorn1 mice returns the cornea to a wild-type (WT) like state. This result implicated SRF as a major regulator of genes that contributes to abnormal phenotypes in Dstncorn1 cornea. The purpose of this study is to identify gene networks that are affected by increased expression of Srf in the Dstncorn1 cornea. Microarray analysis led to characterization of gene expression changes that occur when conditional knockout of Srf rescues mutant phenotypes in the cornea of Dstncorn1 mice. Comparison of gene expression values from WT, Dstncorn1 mutant, and Dstncorn1 rescued cornea identified >400 differentially expressed genes that are downstream from SRF. Srf ablation had a significant effect on genes associated with epithelial cell-cell junctions and regulation of actin dynamics. The majority of genes affected by SRF are downregulated in the Dstncorn1 mutant cornea, suggesting that increased SRF negatively affects transcription of SRF gene targets. ChIP-seq analysis on Dstncorn1 mutant and WT tissue revealed that, despite being present in higher abundance, SRF binding is significantly decreased in the Dstncorn1 mutant cornea. This study uses a unique model combining genetic and genomic approaches to identify genes that are regulated by SRF. These findings expand current understanding of the role of SRF in both normal and abnormal tissue homeostasis. PMID:24550211
Seedless fruits and the disruption of a conserved genetic pathway in angiosperm ovule development
Lora, Jorge; Hormaza, José I.; Herrero, María; Gasser, Charles S.
2011-01-01
Although the biological function of fruiting is the production and dissemination of seeds, humans have developed seedless fruits in a number of plant species to facilitate consumption. Here we describe a unique spontaneous seedless mutant (Thai seedless; Ts) of Annona squamosa (sugar apple), a member of the early-divergent magnoliid angiosperm clade. Ovules (seed precursors) of the mutant lack the outer of two normal integuments, a phenocopy of the inner no outer (ino) mutant of Arabidopsis thaliana. Cloning of the INO ortholog from A. squamosa confirmed conservation of the outer integument-specific expression pattern of this gene between the two species. All regions of the gene were detectable in wild-type A. squamosa and in other members of this genus. However, no region of the INO gene could be detected in Ts plants, indicating apparent deletion of the INO locus. These results provide a case of a candidate gene approach revealing the apparent molecular basis of a useful agronomic trait (seedless fruit) in a crop species, and indicate conservation of the role of a critical regulator of ovule development between eudicots and more ancient lineages of angiosperms. The outer integument is one synapomorphy of angiosperms separating them from other extant seed plants, and the results suggest that the evolution of this structure was contemporaneous with the derivation of INO from ancestral YABBY genes. Thus, a unique lateral structure appears to have coevolved with a novel gene family member essential for the structure's formation. PMID:21402944
Defining the ABC of gene essentiality in streptococci.
Charbonneau, Amelia R L; Forman, Oliver P; Cain, Amy K; Newland, Graham; Robinson, Carl; Boursnell, Mike; Parkhill, Julian; Leigh, James A; Maskell, Duncan J; Waller, Andrew S
2017-05-31
Utilising next generation sequencing to interrogate saturated bacterial mutant libraries provides unprecedented information for the assignment of genome-wide gene essentiality. Exposure of saturated mutant libraries to specific conditions and subsequent sequencing can be exploited to uncover gene essentiality relevant to the condition. Here we present a barcoded transposon directed insertion-site sequencing (TraDIS) system to define an essential gene list for Streptococcus equi subsp. equi, the causative agent of strangles in horses, for the first time. The gene essentiality data for this group C Streptococcus was compared to that of group A and B streptococci. Six barcoded variants of pGh9:ISS1 were designed and used to generate mutant libraries containing between 33,000-66,000 unique mutants. TraDIS was performed on DNA extracted from each library and data were analysed separately and as a combined master pool. Gene essentiality determined that 19.5% of the S. equi genome was essential. Gene essentialities were compared to those of group A and group B streptococci, identifying concordances of 90.2% and 89.4%, respectively and an overall concordance of 83.7% between the three species. The use of barcoded pGh9:ISS1 to generate mutant libraries provides a highly useful tool for the assignment of gene function in S. equi and other streptococci. The shared essential gene set of group A, B and C streptococci provides further evidence of the close genetic relationships between these important pathogenic bacteria. Therefore, the ABC of gene essentiality reported here provides a solid foundation towards reporting the functional genome of streptococci.
ketu mutant mice uncover an essential meiotic function for the ancient RNA helicase YTHDC2
Jain, Devanshi; Puno, M Rhyan; Meydan, Cem; Lailler, Nathalie; Mason, Christopher E; Lima, Christopher D; Anderson, Kathryn V
2018-01-01
Mechanisms regulating mammalian meiotic progression are poorly understood. Here we identify mouse YTHDC2 as a critical component. A screen yielded a sterile mutant, ‘ketu’, caused by a Ythdc2 missense mutation. Mutant germ cells enter meiosis but proceed prematurely to aberrant metaphase and apoptosis, and display defects in transitioning from spermatogonial to meiotic gene expression programs. ketu phenocopies mutants lacking MEIOC, a YTHDC2 partner. Consistent with roles in post-transcriptional regulation, YTHDC2 is cytoplasmic, has 3′→5′ RNA helicase activity in vitro, and has similarity within its YTH domain to an N6-methyladenosine recognition pocket. Orthologs are present throughout metazoans, but are diverged in nematodes and, more dramatically, Drosophilidae, where Bgcn is descended from a Ythdc2 gene duplication. We also uncover similarity between MEIOC and Bam, a Bgcn partner unique to schizophoran flies. We propose that regulation of gene expression by YTHDC2-MEIOC is an evolutionarily ancient strategy for controlling the germline transition into meiosis. PMID:29360036
Directed mutagenesis of the Rickettsia prowazekii pld gene encoding phospholipase D.
Driskell, Lonnie O; Yu, Xue-jie; Zhang, Lihong; Liu, Yan; Popov, Vsevolod L; Walker, David H; Tucker, Aimee M; Wood, David O
2009-08-01
Rickettsia prowazekii, the causative agent of epidemic typhus, is an obligately intracytoplasmic bacterium, a lifestyle that imposes significant barriers to genetic manipulation. The key to understanding how this unique bacterium evades host immunity is the mutagenesis of selected genes hypothesized to be involved in virulence. The R. prowazekii pld gene, encoding a protein with phospholipase D activity, has been associated with phagosomal escape. To demonstrate the feasibility of site-directed knockout mutagenesis of rickettsial genes and to generate a nonrevertible vaccine strain, we utilized homologous recombination to generate a pld mutant of the virulent R. prowazekii strain Madrid Evir. Using linear DNA for transformation, a double-crossover event resulted in the replacement of the rickettsial wild-type gene with a partially deleted pld gene. Linear DNA was used to prevent potentially revertible single-crossover events resulting in plasmid insertion. Southern blot and PCR analyses were used to confirm the presence of the desired mutation and to demonstrate clonality. While no phenotypic differences were observed between the mutant and wild-type strains when grown in tissue culture, the pld mutant exhibited attenuated virulence in the guinea pig model. In addition, animals immunized with the mutant strain were protected against subsequent challenge with the virulent Breinl strain, suggesting that this transformant could serve as a nonrevertible, attenuated vaccine strain. This study demonstrates the feasibility of generating site-directed rickettsial gene mutants, providing a new tool for understanding rickettsial biology and furthering advances in the prevention of epidemic typhus.
Barbaro, Vanessa; Nasti, Annamaria Assunta; Raffa, Paolo; Migliorati, Angelo; Nespeca, Patrizia; Ferrari, Stefano; Palumbo, Elisa; Bertolin, Marina; Breda, Claudia; Miceli, Francesco; Russo, Antonella; Caenazzo, Luciana; Ponzin, Diego; Palù, Giorgio; Parolin, Cristina; Di Iorio, Enzo
2016-08-01
: Ectrodactyly-ectodermal dysplasia-clefting (EEC) syndrome is a rare autosomal dominant disease caused by mutations in the p63 gene. To date, approximately 40 different p63 mutations have been identified, all heterozygous. No definitive treatments are available to counteract and resolve the progressive corneal degeneration due to a premature aging of limbal epithelial stem cells. Here, we describe a unique case of a young female patient, aged 18 years, with EEC and corneal dysfunction, who was, surprisingly, homozygous for a novel and de novo R311K missense mutation in the p63 gene. A detailed analysis of the degree of somatic mosaicism in leukocytes from peripheral blood and oral mucosal epithelial stem cells (OMESCs) from biopsies of buccal mucosa showed that approximately 80% were homozygous mutant cells and 20% were heterozygous. Cytogenetic and molecular analyses excluded genomic alterations, thus suggesting a de novo mutation followed by an allelic gene conversion of the wild-type allele by de novo mutant allele as a possible mechanism to explain the homozygous condition. R311K-p63 OMESCs were expanded in vitro and heterozygous holoclones selected following clonal analysis. These R311K-p63 OMESCs were able to generate well-organized and stratified epithelia in vitro, resembling the features of healthy tissues. This study supports the rationale for the development of cultured autologous oral mucosal epithelial stem cell sheets obtained by selected heterozygous R311K-p63 stem cells, as an effective and personalized therapy for reconstructing the ocular surface of this unique case of EEC syndrome, thus bypassing gene therapy approaches. This case demonstrates that in a somatic mosaicism context, a novel homozygous mutation in the p63 gene can arise as a consequence of an allelic gene conversion event, subsequent to a de novo mutation. The heterozygous mutant R311K-p63 stem cells can be isolated by means of clonal analysis and given their good regenerative capacity, they may be used to successfully correct the corneal defects present in this unique case of ectrodactyly-ectodermal dysplasia-clefting syndrome. ©AlphaMed Press.
Positive selection of Caenorhabditis elegans mutants with increased stress resistance and longevity.
Muñoz, Manuel J; Riddle, Donald L
2003-01-01
We developed selective conditions for long-lived mutants of the nematode Caenorhabditis elegans by subjecting the first larval stage (L1) to thermal stress at 30 degrees for 7 days. The surviving larvae developed to fertile adults after the temperature was shifted to 15 degrees. A total of one million F(2) progeny and a half million F(3) progeny of ethyl-methanesulfonate-mutagenized animals were treated in three separate experiments. Among the 81 putative mutants that recovered and matured to the reproductive adult, 63 retested as thermotolerant and 49 (80%) exhibited a >15% increase in mean life span. All the known classes of dauer formation (Daf) mutant that affect longevity were found, including six new alleles of daf-2, and a unique temperature-sensitive, dauer-constitutive allele of age-1. Alleles of dyf-2 and unc-13 were isolated, and mutants of unc-18, a gene that interacts with unc-13, were also found to be long lived. Thirteen additional mutations define at least four new genes. PMID:12586705
Taketa, Shin; Yuo, Takahisa; Tonooka, Takuji; Tsumuraya, Yoichi; Inagaki, Yoshiaki; Haruyama, Naoto; Larroque, Oscar; Jobling, Stephen A.
2012-01-01
(1,3;1,4)-β-D-glucans (mixed-linkage glucans) are found in tissues of members of the Poaceae (grasses), and are particularly high in barley (Hordeum vulgare) grains. The present study describes the isolation of three independent (1,3;1,4)-β-D-glucanless (betaglucanless; bgl) mutants of barley which completely lack (1,3;1,4)-β-D-glucan in all the tissues tested. The bgl phenotype cosegregates with the cellulose synthase like HvCslF6 gene on chromosome arm 7HL. Each of the bgl mutants has a single nucleotide substitution in the coding region of the HvCslF6 gene resulting in a change of a highly conserved amino acid residue of the HvCslF6 protein. Microsomal membranes isolated from developing endosperm of the bgl mutants lack detectable (1,3;1,4)-β-D-glucan synthase activity indicating that the HvCslF6 protein is inactive. This was confirmed by transient expression of the HvCslF6 cDNAs in Nicotiana benthamiana leaves. The wild-type HvCslF6 gene directed the synthesis of high levels of (1,3;1,4)-β-D-glucans, whereas the mutant HvCslF6 proteins completely lack the ability to synthesize (1,3;1,4)-β-D-glucans. The fine structure of the (1,3;1,4)-β-D-glucan produced in the tobacco leaf was also very different from that found in cereals having an extremely low DP3/DP4 ratio. These results demonstrate that, among the seven CslF and one CslH genes present in the barley genome, HvCslF6 has a unique role and is the key determinant controlling the biosynthesis of (1,3;1,4)-β-D-glucans. Natural allelic variation in the HvCslF6 gene was found predominantly within introns among 29 barley accessions studied. Genetic manipulation of the HvCslF6 gene could enable control of (1,3;1,4)-β-D-glucans in accordance with the purposes of use. PMID:21940720
Mutant power: using mutant allele collections for yeast functional genomics.
Norman, Kaitlyn L; Kumar, Anuj
2016-03-01
The budding yeast has long served as a model eukaryote for the functional genomic analysis of highly conserved signaling pathways, cellular processes and mechanisms underlying human disease. The collection of reagents available for genomics in yeast is extensive, encompassing a growing diversity of mutant collections beyond gene deletion sets in the standard wild-type S288C genetic background. We review here three main types of mutant allele collections: transposon mutagen collections, essential gene collections and overexpression libraries. Each collection provides unique and identifiable alleles that can be utilized in genome-wide, high-throughput studies. These genomic reagents are particularly informative in identifying synthetic phenotypes and functions associated with essential genes, including those modeled most effectively in complex genetic backgrounds. Several examples of genomic studies in filamentous/pseudohyphal backgrounds are provided here to illustrate this point. Additionally, the limitations of each approach are examined. Collectively, these mutant allele collections in Saccharomyces cerevisiae and the related pathogenic yeast Candida albicans promise insights toward an advanced understanding of eukaryotic molecular and cellular biology. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
McCarthy, Samuel; Ai, Chenbing; Wheaton, Garrett; Tevatia, Rahul; Eckrich, Valerie; Kelly, Robert; Blum, Paul
2014-10-01
Thermoacidophilic archaea, such as Metallosphaera sedula, are lithoautotrophs that occupy metal-rich environments. In previous studies, an M. sedula mutant lacking the primary copper efflux transporter, CopA, became copper sensitive. In contrast, the basis for supranormal copper resistance remained unclear in the spontaneous M. sedula mutant, CuR1. Here, transcriptomic analysis of copper-shocked cultures indicated that CuR1 had a unique regulatory response to metal challenge corresponding to the upregulation of 55 genes. Genome resequencing identified 17 confirmed mutations unique to CuR1 that were likely to change gene function. Of these, 12 mapped to genes with annotated function associated with transcription, metabolism, or transport. These mutations included 7 nonsynonymous substitutions, 4 insertions, and 1 deletion. One of the insertion mutations mapped to pseudogene Msed_1517 and extended its reading frame an additional 209 amino acids. The extended mutant allele was identified as a homolog of Pho4, a family of phosphate symporters that includes the bacterial PitA proteins. Orthologs of this allele were apparent in related extremely thermoacidophilic species, suggesting M. sedula naturally lacked this gene. Phosphate transport studies combined with physiologic analysis demonstrated M. sedula PitA was a low-affinity, high-velocity secondary transporter implicated in copper resistance and arsenate sensitivity. Genetic analysis demonstrated that spontaneous arsenate-resistant mutants derived from CuR1 all underwent mutation in pitA and nonselectively became copper sensitive. Taken together, these results point to archaeal PitA as a key requirement for the increased metal resistance of strain CuR1 and its accelerated capacity for copper bioleaching. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
McCarthy, Samuel; Ai, Chenbing; Wheaton, Garrett; Tevatia, Rahul; Eckrich, Valerie; Kelly, Robert
2014-01-01
Thermoacidophilic archaea, such as Metallosphaera sedula, are lithoautotrophs that occupy metal-rich environments. In previous studies, an M. sedula mutant lacking the primary copper efflux transporter, CopA, became copper sensitive. In contrast, the basis for supranormal copper resistance remained unclear in the spontaneous M. sedula mutant, CuR1. Here, transcriptomic analysis of copper-shocked cultures indicated that CuR1 had a unique regulatory response to metal challenge corresponding to the upregulation of 55 genes. Genome resequencing identified 17 confirmed mutations unique to CuR1 that were likely to change gene function. Of these, 12 mapped to genes with annotated function associated with transcription, metabolism, or transport. These mutations included 7 nonsynonymous substitutions, 4 insertions, and 1 deletion. One of the insertion mutations mapped to pseudogene Msed_1517 and extended its reading frame an additional 209 amino acids. The extended mutant allele was identified as a homolog of Pho4, a family of phosphate symporters that includes the bacterial PitA proteins. Orthologs of this allele were apparent in related extremely thermoacidophilic species, suggesting M. sedula naturally lacked this gene. Phosphate transport studies combined with physiologic analysis demonstrated M. sedula PitA was a low-affinity, high-velocity secondary transporter implicated in copper resistance and arsenate sensitivity. Genetic analysis demonstrated that spontaneous arsenate-resistant mutants derived from CuR1 all underwent mutation in pitA and nonselectively became copper sensitive. Taken together, these results point to archaeal PitA as a key requirement for the increased metal resistance of strain CuR1 and its accelerated capacity for copper bioleaching. PMID:25092032
Coffee, R. Lane; Tessier, Charles R.; Woodruff, Elvin A.; Broadie, Kendal
2010-01-01
SUMMARY Fragile X syndrome (FXS), resulting solely from the loss of function of the human fragile X mental retardation 1 (hFMR1) gene, is the most common heritable cause of mental retardation and autism disorders, with syndromic defects also in non-neuronal tissues. In addition, the human genome encodes two closely related hFMR1 paralogs: hFXR1 and hFXR2. The Drosophila genome, by contrast, encodes a single dFMR1 gene with close sequence homology to all three human genes. Drosophila that lack the dFMR1 gene (dfmr1 null mutants) recapitulate FXS-associated molecular, cellular and behavioral phenotypes, suggesting that FMR1 function has been conserved, albeit with specific functions possibly sub-served by the expanded human gene family. To test evolutionary conservation, we used tissue-targeted transgenic expression of all three human genes in the Drosophila disease model to investigate function at (1) molecular, (2) neuronal and (3) non-neuronal levels. In neurons, dfmr1 null mutants exhibit elevated protein levels that alter the central brain and neuromuscular junction (NMJ) synaptic architecture, including an increase in synapse area, branching and bouton numbers. Importantly, hFMR1 can, comparably to dFMR1, fully rescue both the molecular and cellular defects in neurons, whereas hFXR1 and hFXR2 provide absolutely no rescue. For non-neuronal requirements, we assayed male fecundity and testes function. dfmr1 null mutants are effectively sterile owing to disruption of the 9+2 microtubule organization in the sperm tail. Importantly, all three human genes fully and equally rescue mutant fecundity and spermatogenesis defects. These results indicate that FMR1 gene function is evolutionarily conserved in neural mechanisms and cannot be compensated by either FXR1 or FXR2, but that all three proteins can substitute for each other in non-neuronal requirements. We conclude that FMR1 has a neural-specific function that is distinct from its paralogs, and that the unique FMR1 function is responsible for regulating neuronal protein expression and synaptic connectivity. PMID:20442204
Genome-Wide Mutagenesis in Borrelia burgdorferi.
Lin, Tao; Gao, Lihui
2018-01-01
Signature-tagged mutagenesis (STM) is a functional genomics approach to identify bacterial virulence determinants and virulence factors by simultaneously screening multiple mutants in a single host animal, and has been utilized extensively for the study of bacterial pathogenesis, host-pathogen interactions, and spirochete and tick biology. The signature-tagged transposon mutagenesis has been developed to investigate virulence determinants and pathogenesis of Borrelia burgdorferi. Mutants in genes important in virulence are identified by negative selection in which the mutants fail to colonize or disseminate in the animal host and tick vector. STM procedure combined with Luminex Flex ® Map™ technology and next-generation sequencing (e.g., Tn-seq) are the powerful high-throughput tools for the determination of Borrelia burgdorferi virulence determinants. The assessment of multiple tissue sites and two DNA resources at two different time points using Luminex Flex ® Map™ technology provides a robust data set. B. burgdorferi transposon mutant screening indicates that a high proportion of genes are the novel virulence determinants that are required for mouse and tick infection. In this protocol, an effective signature-tagged Himar1-based transposon suicide vector was developed and used to generate a sequence-defined library of nearly 4800 mutants in the infectious B. burgdorferi B31 clone. In STM, signature-tagged suicide vectors are constructed by inserting unique DNA sequences (tags) into the transposable elements. The signature-tagged transposon mutants are generated when transposon suicide vectors are transformed into an infectious B. burgdorferi clone, and the transposable element is transposed into the 5'-TA-3' sequence in the B. burgdorferi genome with the signature tag. The transposon library is created and consists of many sub-libraries, each sub-library has several hundreds of mutants with same tags. A group of mice or ticks are infected with a mixed population of mutants with different tags, after recovered from different tissues of infected mice and ticks, mutants from output pool and input pool are detected using high-throughput, semi-quantitative Luminex ® FLEXMAP™ or next-generation sequencing (Tn-seq) technologies. Thus far, we have created a high-density, sequence-defined transposon library of over 6600 STM mutants for the efficient genome-wide investigation of genes and gene products required for wild-type pathogenesis, host-pathogen interactions, in vitro growth, in vivo survival, physiology, morphology, chemotaxis, motility, structure, metabolism, gene regulation, plasmid maintenance and replication, etc. The insertion sites of 4480 transposon mutants have been determined. About 800 predicted protein-encoding genes in the genome were disrupted in the STM transposon library. The infectivity and some functions of 800 mutants in 500 genes have been determined. Analysis of these transposon mutants has yielded valuable information regarding the genes and gene products important in the pathogenesis and biology of B. burgdorferi and its tick vectors.
Krizek, Beth A.
2015-01-01
AINTEGUMENTA (ANT) is an important regulator of Arabidopsis flower development that has overlapping functions with the related AINTEGUMENTA-LIKE6 (AIL6) gene in floral organ initiation, identity specification, growth, and patterning. Two other AINTEGUMENTA-LIKE (AIL) genes, AIL5 and AIL7, are expressed in developing flowers in spatial domains that partly overlap with those of ANT. Here, it is shown that AIL5 and AIL7 also act in a partially redundant manner with ANT. The results demonstrate that AIL genes exhibit unequal genetic redundancy with roles for AIL5, AIL6, and AIL7 only revealed in the absence of ANT function. ant ail5 and ant ail7 double mutant flowers show alterations in floral organ positioning and growth, sepal fusion, and reductions in petal number. In ant ail5, petals are often replaced by filaments or dramatically reduced in size. ant ail7 double mutants produce increased numbers of carpels, which have defects in valve fusion and a loss of apical tissues. The distinct phenotypes of ant ail5, ant ail7 and the previously characterized ant ail6 indicate that AIL5, AIL6, and AIL7 make unique contributions to flower development. These distinct roles are also supported by genetic analyses of ant ail triple mutants. While ant ail5 ail6 triple mutants closely resemble ant ail6 double mutants, ant ail5 ail7 triple mutants exhibit more severe deviations from the wild type than either ant ail5 or ant ail7 double mutants. Furthermore, it is shown that AIL5, AIL6, and AIL7 act in a dose dependent manners in ant and other mutant backgrounds. PMID:25956884
Characterization of Escherichia coli Type 1 Pilus Mutants with Altered Binding Specificities
Harris, Sandra L.; Spears, Patricia A.; Havell, Edward A.; Hamrick, Terri S.; Horton, John R.; Orndorff, Paul E.
2001-01-01
PCR mutagenesis and a unique enrichment scheme were used to obtain two mutants, each with a single lesion in fimH, the chromosomal gene that encodes the adhesin protein (FimH) of Escherichia coli type 1 pili. These mutants were noteworthy in part because both were altered in the normal range of cell types bound by FimH. One mutation altered an amino acid at a site previously shown to be involved in temperature-dependent binding, and the other altered an amino acid lining the predicted FimH binding pocket. PMID:11395476
Early zebrafish development: It’s in the maternal genes
Abrams, Elliott W.; Mullins, Mary C.
2009-01-01
Summary The earliest stages of embryonic development in all animals examined rely on maternal gene products that are generated during oogenesis and supplied to the egg. The period of maternal control of embryonic development varies among animals according to the onset of zygotic transcription and the persistence of maternal gene products. This maternal regulation has been little studied in vertebrates, due to the difficulty in manipulating maternal gene function and lack of basic molecular information. However, recent maternal-effect screens in the zebrafish have generated more than 40 unique mutants that are providing new molecular entry points to the maternal control of early vertebrate development. Here we discuss recent studies of 12 zebrafish mutant genes that illuminate the maternal molecular controls on embryonic development, including advances in the regulation of animal-vegetal polarity, egg activation, cleavage development, body plan formation, tissue morphogenesis, microRNA function and germ cell development. PMID:19608405
Adams, David J; Adams, Niels C; Adler, Thure; Aguilar-Pimentel, Antonio; Ali-Hadji, Dalila; Amann, Gregory; André, Philippe; Atkins, Sarah; Auburtin, Aurelie; Ayadi, Abdel; Becker, Julien; Becker, Lore; Bedu, Elodie; Bekeredjian, Raffi; Birling, Marie-Christine; Blake, Andrew; Bottomley, Joanna; Bowl, Mike; Brault, Véronique; Busch, Dirk H; Bussell, James N; Calzada-Wack, Julia; Cater, Heather; Champy, Marie-France; Charles, Philippe; Chevalier, Claire; Chiani, Francesco; Codner, Gemma F; Combe, Roy; Cox, Roger; Dalloneau, Emilie; Dierich, André; Di Fenza, Armida; Doe, Brendan; Duchon, Arnaud; Eickelberg, Oliver; Esapa, Chris T; El Fertak, Lahcen; Feigel, Tanja; Emelyanova, Irina; Estabel, Jeanne; Favor, Jack; Flenniken, Ann; Gambadoro, Alessia; Garrett, Lilian; Gates, Hilary; Gerdin, Anna-Karin; Gkoutos, George; Greenaway, Simon; Glasl, Lisa; Goetz, Patrice; Da Cruz, Isabelle Goncalves; Götz, Alexander; Graw, Jochen; Guimond, Alain; Hans, Wolfgang; Hicks, Geoff; Hölter, Sabine M; Höfler, Heinz; Hancock, John M; Hoehndorf, Robert; Hough, Tertius; Houghton, Richard; Hurt, Anja; Ivandic, Boris; Jacobs, Hughes; Jacquot, Sylvie; Jones, Nora; Karp, Natasha A; Katus, Hugo A; Kitchen, Sharon; Klein-Rodewald, Tanja; Klingenspor, Martin; Klopstock, Thomas; Lalanne, Valerie; Leblanc, Sophie; Lengger, Christoph; le Marchand, Elise; Ludwig, Tonia; Lux, Aline; McKerlie, Colin; Maier, Holger; Mandel, Jean-Louis; Marschall, Susan; Mark, Manuel; Melvin, David G; Meziane, Hamid; Micklich, Kateryna; Mittelhauser, Christophe; Monassier, Laurent; Moulaert, David; Muller, Stéphanie; Naton, Beatrix; Neff, Frauke; Nolan, Patrick M; Nutter, Lauryl MJ; Ollert, Markus; Pavlovic, Guillaume; Pellegata, Natalia S; Peter, Emilie; Petit-Demoulière, Benoit; Pickard, Amanda; Podrini, Christine; Potter, Paul; Pouilly, Laurent; Puk, Oliver; Richardson, David; Rousseau, Stephane; Quintanilla-Fend, Leticia; Quwailid, Mohamed M; Racz, Ildiko; Rathkolb, Birgit; Riet, Fabrice; Rossant, Janet; Roux, Michel; Rozman, Jan; Ryder, Ed; Salisbury, Jennifer; Santos, Luis; Schäble, Karl-Heinz; Schiller, Evelyn; Schrewe, Anja; Schulz, Holger; Steinkamp, Ralf; Simon, Michelle; Stewart, Michelle; Stöger, Claudia; Stöger, Tobias; Sun, Minxuan; Sunter, David; Teboul, Lydia; Tilly, Isabelle; Tocchini-Valentini, Glauco P; Tost, Monica; Treise, Irina; Vasseur, Laurent; Velot, Emilie; Vogt-Weisenhorn, Daniela; Wagner, Christelle; Walling, Alison; Weber, Bruno; Wendling, Olivia; Westerberg, Henrik; Willershäuser, Monja; Wolf, Eckhard; Wolter, Anne; Wood, Joe; Wurst, Wolfgang; Yildirim, Ali Önder; Zeh, Ramona; Zimmer, Andreas; Zimprich, Annemarie
2015-01-01
The function of the majority of genes in the mouse and human genomes remains unknown. The mouse ES cell knockout resource provides a basis for characterisation of relationships between gene and phenotype. The EUMODIC consortium developed and validated robust methodologies for broad-based phenotyping of knockouts through a pipeline comprising 20 disease-orientated platforms. We developed novel statistical methods for pipeline design and data analysis aimed at detecting reproducible phenotypes with high power. We acquired phenotype data from 449 mutant alleles, representing 320 unique genes, of which half had no prior functional annotation. We captured data from over 27,000 mice finding that 83% of the mutant lines are phenodeviant, with 65% demonstrating pleiotropy. Surprisingly, we found significant differences in phenotype annotation according to zygosity. Novel phenotypes were uncovered for many genes with unknown function providing a powerful basis for hypothesis generation and further investigation in diverse systems. PMID:26214591
Hasona, Adnan; Ray, Ramesh M.; Shanmugam, K. T.
1998-01-01
A unique class of chlorate-resistant mutants of Escherichia coli which produced formate hydrogenlyase and nitrate reductase activities only when grown in medium with limiting amounts of sulfur compounds was isolated. These mutants failed to produce the two molybdoenzyme activities when cultured in rich medium or glucose-minimal medium. The mutations in these mutants were localized in the moeA gene. Mutant strains with polar mutations in moeA which are also moeB did not produce active molybdoenzymes in any of the media tested. moeA mutants with a second mutation in either cysDNCJI or cysH gene lost the ability to produce active molybdoenzyme even when grown in medium limiting in sulfur compounds. The CysDNCJIH proteins along with CysG catalyze the conversion of sulfate to sulfide. Addition of sulfide to the growth medium of moeA cys double mutants suppressed the MoeA− phenotype. These results suggest that in the absence of MoeA protein, the sulfide produced by the sulfate activation/reduction pathway combines with molybdate in the production of activated molybdenum. Since hydrogen sulfide is known to interact with molybdate in the production of thiomolybdate, it is possible that the MoeA-catalyzed activated molybdenum is a form of thiomolybdenum species which is used in the synthesis of molybdenum cofactor from Mo-free molybdopterin. PMID:9515915
Synthetic Lethality Reveals Mechanisms of Mycobacterium tuberculosis Resistance to β-Lactams
Lun, Shichun; Miranda, David; Kubler, Andre; Guo, Haidan; Maiga, Mariama C.; Winglee, Kathryn; Pelly, Shaaretha
2014-01-01
ABSTRACT Most β-lactam antibiotics are ineffective against Mycobacterium tuberculosis due to the microbe’s innate resistance. The emergence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) strains has prompted interest to repurpose this class of drugs. To identify the genetic determinants of innate β-lactam resistance, we carried out a synthetic lethality screen on a transposon mutant library for susceptibility to imipenem, a carbapenem β-lactam antibiotic. Mutations in 74 unique genes demonstrated synthetic lethality. The majority of mutations were in genes associated with cell wall biosynthesis. A second quantitative real-time PCR (qPCR)-based synthetic lethality screen of randomly selected mutants confirmed the role of cell wall biosynthesis in β-lactam resistance. The global transcriptional response of the bacterium to β-lactams was investigated, and changes in levels of expression of cell wall biosynthetic genes were identified. Finally, we validated these screens in vivo using the MT1616 transposon mutant, which lacks a functional acyl-transferase gene. Mice infected with the mutant responded to β-lactam treatment with a 100-fold decrease in bacillary lung burden over 4 weeks, while the numbers of organisms in the lungs of mice infected with wild-type bacilli proliferated. These findings reveal a road map of genes required for β-lactam resistance and validate synthetic lethality screening as a promising tool for repurposing existing classes of licensed, safe, well-characterized antimicrobials against tuberculosis. PMID:25227469
Zhu, Qiang; Dugardeyn, Jasper; Zhang, Chunyi; Mühlenbock, Per; Eastmond, Peter J; Valcke, Roland; De Coninck, Barbara; Oden, Sevgi; Karampelias, Michael; Cammue, Bruno P A; Prinsen, Els; Van Der Straeten, Dominique
2014-02-01
Recently, we reported that the novel mitochondrial RNA editing factor SLO2 is essential for mitochondrial electron transport, and vital for plant growth through regulation of carbon and energy metabolism. Here, we show that mutation in SLO2 causes hypersensitivity to ABA and insensitivity to ethylene, suggesting a link with stress responses. Indeed, slo2 mutants are hypersensitive to salt and osmotic stress during the germination stage, while adult plants show increased drought and salt tolerance. Moreover, slo2 mutants are more susceptible to Botrytis cinerea infection. An increased expression of nuclear-encoded stress-responsive genes, as well as mitochondrial-encoded NAD genes of complex I and genes of the alternative respiratory pathway, was observed in slo2 mutants, further enhanced by ABA treatment. In addition, H2O2 accumulation and altered amino acid levels were recorded in slo2 mutants. We conclude that SLO2 is required for plant sensitivity to ABA, ethylene, biotic, and abiotic stress. Although two stress-related RNA editing factors were reported very recently, this study demonstrates a unique role of SLO2, and further supports a link between mitochondrial RNA editing events and stress response.
The purple cauliflower arises from activation of a myb transcription factor
USDA-ARS?s Scientific Manuscript database
Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple colo...
Pulungan, Sri Imriani; Yano, Ryoichi; Okabe, Yoshihiro; Ichino, Takuji; Kojima, Mikiko; Takebayashi, Yumiko; Sakakibara, Hitoshi; Ariizumi, Tohru; Ezura, Hiroshi
2018-06-01
Leaves are the major plant organs with a primary function for photosynthesis. Auxin controls various aspects of plant growth and development, including leaf initiation, expansion and differentiation. Unique and intriguing auxin features include its polar transport, which is mainly controlled by the AUX1/LAX and PIN gene families as influx and efflux carriers, respectively. The role of AUX1/LAX genes in root development is well documented, but the role of these genes in leaf morphogenesis remains unclear. Moreover, most studies have been conducted in the plant model Arabidopsis thaliana, while studies in tomato are still scarce. In this study, we isolated six lines of the allelic curly leaf phenotype 'curl' mutants from a γ-ray and EMS (ethyl methanesulfonate) mutagenized population. Using a map-based cloning strategy combined with exome sequencing, we observed that a mutation occurred in the SlLAX1 gene (Solyc09g014380), which is homologous to an Arabidopsis auxin influx carrier gene, AUX1 (AtAUX1). Characterization of six alleles of single curl mutants revealed the pivotal role of SlLAX1 in controlling tomato leaf flatness by balancing adaxial and abaxial pavement cell growth, which has not been reported in tomato. Using TILLING (Targeting Induced Local Lesions IN Genome) technology, we isolated an additional mutant allele of the SlLAX1 gene and this mutant showed a curled leaf phenotype similar to other curl mutants, suggesting that Solyc09g014380 is responsible for the curl phenotype. These results showed that SlLAX1 is required for normal leaf development mediated by balanced adaxial and abaxial pavement cell growth in tomato.
Minimal Phenotype of Mice Homozygous for a Null Mutation in the Forkhead/Winged Helix Gene, Mf2
Kume, Tsutomu; Deng, Keyu; Hogan, Brigid L. M.
2000-01-01
Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2lacZ) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes. PMID:10648626
Minimal phenotype of mice homozygous for a null mutation in the forkhead/winged helix gene, Mf2.
Kume, T; Deng, K; Hogan, B L
2000-02-01
Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2(lacZ)) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes.
Partial Functional Diversification of Drosophila melanogaster Septin Genes Sep2 and Sep5.
O'Neill, Ryan S; Clark, Denise V
2016-07-07
The septin family of hetero-oligomeric complex-forming proteins can be divided into subgroups, and subgroup members are interchangeable at specific positions in the septin complex. Drosophila melanogaster has five septin genes, including the two SEPT6 subgroup members Sep2 and Sep5 We previously found that Sep2 has a unique function in oogenesis, which is not performed by Sep5 Here, we find that Sep2 is uniquely required for follicle cell encapsulation of female germline cysts, and that Sep2 and Sep5 are redundant for follicle cell proliferation. The five D. melanogaster septins localize similarly in oogenesis, including as rings flanking the germline ring canals. Pnut fails to localize in Sep5; Sep2 double mutant follicle cells, indicating that septin complexes fail to form in the absence of both Sep2 and Sep5. We also find that mutations in septins enhance the mutant phenotype of bazooka, a key component in the establishment of cell polarity, suggesting a link between septin function and cell polarity. Overall, this work suggests that Sep5 has undergone partial loss of ancestral protein function, and demonstrates redundant and unique functions of septins. Copyright © 2016 O'Neill and Clark.
Eising, Else; Shyti, Reinald; 't Hoen, Peter A C; Vijfhuizen, Lisanne S; Huisman, Sjoerd M H; Broos, Ludo A M; Mahfouz, Ahmed; Reinders, Marcel J T; Ferrari, Michel D; Tolner, Else A; de Vries, Boukje; van den Maagdenberg, Arn M J M
2017-05-01
Familial hemiplegic migraine type 1 (FHM1) is a rare monogenic subtype of migraine with aura caused by mutations in CACNA1A that encodes the α 1A subunit of voltage-gated Ca V 2.1 calcium channels. Transgenic knock-in mice that carry the human FHM1 R192Q missense mutation ('FHM1 R192Q mice') exhibit an increased susceptibility to cortical spreading depression (CSD), the mechanism underlying migraine aura. Here, we analysed gene expression profiles from isolated cortical tissue of FHM1 R192Q mice 24 h after experimentally induced CSD in order to identify molecular pathways affected by CSD. Gene expression profiles were generated using deep serial analysis of gene expression sequencing. Our data reveal a signature of inflammatory signalling upon CSD in the cortex of both mutant and wild-type mice. However, only in the brains of FHM1 R192Q mice specific genes are up-regulated in response to CSD that are implicated in interferon-related inflammatory signalling. Our findings show that CSD modulates inflammatory processes in both wild-type and mutant brains, but that an additional unique inflammatory signature becomes expressed after CSD in a relevant mouse model of migraine.
Shox2-deficiency leads to dysplasia and ankylosis of the temporomandibular joint in Mice
Gu, Shuping; Wei, Na; Yu, Ling; Fei, Jian; Chen, YiPing
2010-01-01
The temporomandibular joint (TMJ) is a unique synovial joint whose development differs from the formation of other synovial joints. Mutations have been associated with the developmental defects of the TMJ only in a few genes. In this study, we report the expression of the homeobox gene Shox2 in the cranial neural crest derived mesenchymal cells of the maxilla-mandibular junction and later in the progenitor cells and undifferentiated chondrocytes of the condyle as well as the glenoid fossa of the developing TMJ. A conditional inactivation of Shox2 in the cranial neural crest-derived cells causes developmental abnormalities in the TMJ, including dysplasia of the condyle and glenoid fossa. The articulating disc forms but fuses with the fibrous layers of the condyle and glenoid fossa, clinically known as TMJ ankylosis. Histological examination indicates a delay in development in the mutant TMJ, accompanied by a significantly reduced rate of cell proliferation. In situ hybridization further demonstrates an altered expression of several key osteogenic genes and a delayed expression of the osteogenic differentiation markers. Shox2 appears to regulate the expression of osteogenic genes and is essential for the development and function of the TMJ. The Shox2 conditional mutant thus provides a unique animal model of TMJ ankylosis. PMID:18514492
TANG1, Encoding a Symplekin_C Domain-Contained Protein, Influences Sugar Responses in Arabidopsis1
Shang, Li; Chen, Xing; Zhang, Limin; Smith, Caroline; Jing, Hai-Chun
2015-01-01
Sugars not only serve as energy and cellular carbon skeleton but also function as signaling molecules regulating growth and development in plants. Understanding the molecular mechanisms in sugar signaling pathways will provide more information for improving plant growth and development. Here, we describe a sugar-hypersensitive recessive mutant, tang1. Light-grown tang1 mutants have short roots and increased starch and anthocyanin contents when grown on high-sugar concentration medium. Dark-grown tang1 plants exhibit sugar-hypersensitive hypocotyl elongation and enhanced dark development. The tang1 mutants also show an enhanced response to abscisic acid but reduced response to ethylene. Thus, tang1 displays a range of alterations in sugar signaling-related responses. The TANG1 gene was isolated by a map-based cloning approach and encodes a previously uncharacterized unique protein with a predicted Symplekin tight-junction protein C terminus. Expression analysis indicates that TANG1 is ubiquitously expressed at moderate levels in different organs and throughout the Arabidopsis (Arabidopsis thaliana) life cycle; however, its expression is not affected by high-sugar treatment. Genetic analysis shows that PRL1 and TANG1 have additive effects on sugar-related responses. Furthermore, the mutation of TANG1 does not affect the expression of genes involved in known sugar signaling pathways. Taken together, these results suggest that TANG1, a unique gene, plays an important role in sugar responses in Arabidopsis. PMID:26002908
Book, Adam J; Smalle, Jan; Lee, Kwang-Hee; Yang, Peizhen; Walker, Joseph M; Casper, Sarah; Holmes, James H; Russo, Laura A; Buzzinotti, Zachri W; Jenik, Pablo D; Vierstra, Richard D
2009-02-01
The 26S proteasome is an essential multicatalytic protease complex that degrades a wide range of intracellular proteins, especially those modified with ubiquitin. Arabidopsis thaliana and other plants use pairs of genes to encode most of the core subunits, with both of the isoforms often incorporated into the mature complex. Here, we show that the gene pair encoding the regulatory particle non-ATPase subunit (RPN5) has a unique role in proteasome function and Arabidopsis development. Homozygous rpn5a rpn5b mutants could not be generated due to a defect in male gametogenesis. While single rpn5b mutants appear wild-type, single rpn5a mutants display a host of morphogenic defects, including abnormal embryogenesis, partially deetiolated development in the dark, a severely dwarfed phenotype when grown in the light, and infertility. Proteasome complexes missing RPN5a are less stable in vitro, suggesting that some of the rpn5a defects are caused by altered complex integrity. The rpn5a phenotype could be rescued by expression of either RPN5a or RPN5b, indicating functional redundancy. However, abnormal phenotypes generated by overexpression implied that paralog-specific functions also exist. Collectively, the data point to a specific role for RPN5 in the plant 26S proteasome and suggest that its two paralogous genes in Arabidopsis have both redundant and unique roles in development.
Sasado, Takao; Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi
2017-01-01
Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.
Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi
2017-01-01
Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3’UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3’UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3’UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo. PMID:28253363
Harkness, Justine M; Kader, Muhamuda; DeLuca, Neal A
2014-06-01
Herpes simplex virus 1 (HSV-1) can undergo a productive infection in nonneuronal and neuronal cells such that the genes of the virus are transcribed in an ordered cascade. HSV-1 can also establish a more quiescent or latent infection in peripheral neurons, where gene expression is substantially reduced relative to that in productive infection. HSV mutants defective in multiple immediate early (IE) gene functions are highly defective for later gene expression and model some aspects of latency in vivo. We compared the expression of wild-type (wt) virus and IE gene mutants in nonneuronal cells (MRC5) and adult murine trigeminal ganglion (TG) neurons using the Illumina platform for cDNA sequencing (RNA-seq). RNA-seq analysis of wild-type virus revealed that expression of the genome mostly followed the previously established kinetics, validating the method, while highlighting variations in gene expression within individual kinetic classes. The accumulation of immediate early transcripts differed between MRC5 cells and neurons, with a greater abundance in neurons. Analysis of a mutant defective in all five IE genes (d109) showed dysregulated genome-wide low-level transcription that was more highly attenuated in MRC5 cells than in TG neurons. Furthermore, a subset of genes in d109 was more abundantly expressed over time in neurons. While the majority of the viral genome became relatively quiescent, the latency-associated transcript was specifically upregulated. Unexpectedly, other genes within repeat regions of the genome, as well as the unique genes just adjacent the repeat regions, also remained relatively active in neurons. The relative permissiveness of TG neurons to viral gene expression near the joint region is likely significant during the establishment and reactivation of latency. During productive infection, the genes of HSV-1 are transcribed in an ordered cascade. HSV can also establish a more quiescent or latent infection in peripheral neurons. HSV mutants defective in multiple immediate early (IE) genes establish a quiescent infection that models aspects of latency in vivo. We simultaneously quantified the expression of all the HSV genes in nonneuronal and neuronal cells by RNA-seq analysis. The results for productive infection shed further light on the nature of genes and promoters of different kinetic classes. In quiescent infection, there was greater transcription across the genome in neurons than in nonneuronal cells. In particular, the transcription of the latency-associated transcript (LAT), IE genes, and genes in the unique regions adjacent to the repeats persisted in neurons. The relative activity of this region of the genome in the absence of viral activators suggests a more dynamic state for quiescent genomes persisting in neurons. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
NASA Astrophysics Data System (ADS)
Bartell, Jennifer A.; Blazier, Anna S.; Yen, Phillip; Thøgersen, Juliane C.; Jelsbak, Lars; Goldberg, Joanna B.; Papin, Jason A.
2017-03-01
Virulence-linked pathways in opportunistic pathogens are putative therapeutic targets that may be associated with less potential for resistance than targets in growth-essential pathways. However, efficacy of virulence-linked targets may be affected by the contribution of virulence-related genes to metabolism. We evaluate the complex interrelationships between growth and virulence-linked pathways using a genome-scale metabolic network reconstruction of Pseudomonas aeruginosa strain PA14 and an updated, expanded reconstruction of P. aeruginosa strain PAO1. The PA14 reconstruction accounts for the activity of 112 virulence-linked genes and virulence factor synthesis pathways that produce 17 unique compounds. We integrate eight published genome-scale mutant screens to validate gene essentiality predictions in rich media, contextualize intra-screen discrepancies and evaluate virulence-linked gene distribution across essentiality datasets. Computational screening further elucidates interconnectivity between inhibition of virulence factor synthesis and growth. Successful validation of selected gene perturbations using PA14 transposon mutants demonstrates the utility of model-driven screening of therapeutic targets.
de Angelis, Martin Hrabě; Nicholson, George; Selloum, Mohammed; White, Jacqui; Morgan, Hugh; Ramirez-Solis, Ramiro; Sorg, Tania; Wells, Sara; Fuchs, Helmut; Fray, Martin; Adams, David J; Adams, Niels C; Adler, Thure; Aguilar-Pimentel, Antonio; Ali-Hadji, Dalila; Amann, Gregory; André, Philippe; Atkins, Sarah; Auburtin, Aurelie; Ayadi, Abdel; Becker, Julien; Becker, Lore; Bedu, Elodie; Bekeredjian, Raffi; Birling, Marie-Christine; Blake, Andrew; Bottomley, Joanna; Bowl, Mike; Brault, Véronique; Busch, Dirk H; Bussell, James N; Calzada-Wack, Julia; Cater, Heather; Champy, Marie-France; Charles, Philippe; Chevalier, Claire; Chiani, Francesco; Codner, Gemma F; Combe, Roy; Cox, Roger; Dalloneau, Emilie; Dierich, André; Di Fenza, Armida; Doe, Brendan; Duchon, Arnaud; Eickelberg, Oliver; Esapa, Chris T; El Fertak, Lahcen; Feigel, Tanja; Emelyanova, Irina; Estabel, Jeanne; Favor, Jack; Flenniken, Ann; Gambadoro, Alessia; Garrett, Lilian; Gates, Hilary; Gerdin, Anna-Karin; Gkoutos, George; Greenaway, Simon; Glasl, Lisa; Goetz, Patrice; Da Cruz, Isabelle Goncalves; Götz, Alexander; Graw, Jochen; Guimond, Alain; Hans, Wolfgang; Hicks, Geoff; Hölter, Sabine M; Höfler, Heinz; Hancock, John M; Hoehndorf, Robert; Hough, Tertius; Houghton, Richard; Hurt, Anja; Ivandic, Boris; Jacobs, Hughes; Jacquot, Sylvie; Jones, Nora; Karp, Natasha A; Katus, Hugo A; Kitchen, Sharon; Klein-Rodewald, Tanja; Klingenspor, Martin; Klopstock, Thomas; Lalanne, Valerie; Leblanc, Sophie; Lengger, Christoph; le Marchand, Elise; Ludwig, Tonia; Lux, Aline; McKerlie, Colin; Maier, Holger; Mandel, Jean-Louis; Marschall, Susan; Mark, Manuel; Melvin, David G; Meziane, Hamid; Micklich, Kateryna; Mittelhauser, Christophe; Monassier, Laurent; Moulaert, David; Muller, Stéphanie; Naton, Beatrix; Neff, Frauke; Nolan, Patrick M; Nutter, Lauryl Mj; Ollert, Markus; Pavlovic, Guillaume; Pellegata, Natalia S; Peter, Emilie; Petit-Demoulière, Benoit; Pickard, Amanda; Podrini, Christine; Potter, Paul; Pouilly, Laurent; Puk, Oliver; Richardson, David; Rousseau, Stephane; Quintanilla-Fend, Leticia; Quwailid, Mohamed M; Racz, Ildiko; Rathkolb, Birgit; Riet, Fabrice; Rossant, Janet; Roux, Michel; Rozman, Jan; Ryder, Ed; Salisbury, Jennifer; Santos, Luis; Schäble, Karl-Heinz; Schiller, Evelyn; Schrewe, Anja; Schulz, Holger; Steinkamp, Ralf; Simon, Michelle; Stewart, Michelle; Stöger, Claudia; Stöger, Tobias; Sun, Minxuan; Sunter, David; Teboul, Lydia; Tilly, Isabelle; Tocchini-Valentini, Glauco P; Tost, Monica; Treise, Irina; Vasseur, Laurent; Velot, Emilie; Vogt-Weisenhorn, Daniela; Wagner, Christelle; Walling, Alison; Weber, Bruno; Wendling, Olivia; Westerberg, Henrik; Willershäuser, Monja; Wolf, Eckhard; Wolter, Anne; Wood, Joe; Wurst, Wolfgang; Yildirim, Ali Önder; Zeh, Ramona; Zimmer, Andreas; Zimprich, Annemarie; Holmes, Chris; Steel, Karen P; Herault, Yann; Gailus-Durner, Valérie; Mallon, Ann-Marie; Brown, Steve Dm
2015-09-01
The function of the majority of genes in the mouse and human genomes remains unknown. The mouse embryonic stem cell knockout resource provides a basis for the characterization of relationships between genes and phenotypes. The EUMODIC consortium developed and validated robust methodologies for the broad-based phenotyping of knockouts through a pipeline comprising 20 disease-oriented platforms. We developed new statistical methods for pipeline design and data analysis aimed at detecting reproducible phenotypes with high power. We acquired phenotype data from 449 mutant alleles, representing 320 unique genes, of which half had no previous functional annotation. We captured data from over 27,000 mice, finding that 83% of the mutant lines are phenodeviant, with 65% demonstrating pleiotropy. Surprisingly, we found significant differences in phenotype annotation according to zygosity. New phenotypes were uncovered for many genes with previously unknown function, providing a powerful basis for hypothesis generation and further investigation in diverse systems.
Choudhary, S B; Chowdhury, I; Singh, R K; Pandey, S P; Sharma, H K; Anil Kumar, A; Karmakar, P G; Kumari, N; Souframanien, J; Jambhulkar, S J
2017-11-01
Lignin is a versatile plant metabolite challenging high-end industrial applications of several plant products including jute. Application of developmental mutant in regulation of lignification in jute may open up door for much awaited jute based diversified products. In the present study, a novel dark jute (Corchorus olitorius L.) mutant with low lignin (7.23%) in phloem fibre being compared to wild-type JRO 204 (13.7%) was identified and characterised. Unique morphological features including undulated stem, petiole and leaf vein distinguished the mutant in gamma ray irradiated mutant population. Histological and biochemical analysis revealed reduced lignification of phloem fibre cells of the plant. RT-PCR analysis demonstrated temporal transcriptional regulation of CCoAMT1 gene in the mutant. The mutant was found an extremely useful model to study phloem fibre developmental biology in the crop besides acting as a donor genetic stock for low lignin containing jute fibre in dark jute improvement programme.
The purple cauliflower arises from activation of a MYB transcription factor
USDA-ARS?s Scientific Manuscript database
Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissue...
Benitez, Cecil M.; Qu, Kun; Sugiyama, Takuya; Pauerstein, Philip T.; Liu, Yinghua; Tsai, Jennifer; Gu, Xueying; Ghodasara, Amar; Arda, H. Efsun; Zhang, Jiajing; Dekker, Joseph D.; Tucker, Haley O.; Chang, Howard Y.; Kim, Seung K.
2014-01-01
The regulatory logic underlying global transcriptional programs controlling development of visceral organs like the pancreas remains undiscovered. Here, we profiled gene expression in 12 purified populations of fetal and adult pancreatic epithelial cells representing crucial progenitor cell subsets, and their endocrine or exocrine progeny. Using probabilistic models to decode the general programs organizing gene expression, we identified co-expressed gene sets in cell subsets that revealed patterns and processes governing progenitor cell development, lineage specification, and endocrine cell maturation. Purification of Neurog3 mutant cells and module network analysis linked established regulators such as Neurog3 to unrecognized gene targets and roles in pancreas development. Iterative module network analysis nominated and prioritized transcriptional regulators, including diabetes risk genes. Functional validation of a subset of candidate regulators with corresponding mutant mice revealed that the transcription factors Etv1, Prdm16, Runx1t1 and Bcl11a are essential for pancreas development. Our integrated approach provides a unique framework for identifying regulatory genes and functional gene sets underlying pancreas development and associated diseases such as diabetes mellitus. PMID:25330008
Bahrani-Mougeot, Farah K; Buckles, Eric L; Lockatell, C V; Hebel, J R; Johnson, D E; Tang, C M; Donnenberg, M S
2002-08-01
Escherichia coli is the leading cause of urinary tract infections (UTIs). Despite the association of numerous bacterial factors with uropathogenic E. coli (UPEC), few such factors have been proved to be required for UTI in animal models. Previous investigations of urovirulence factors have relied on prior identification of phenotypic characteristics. We used signature-tagged mutagenesis (STM) in an unbiased effort to identify genes that are essential for UPEC survival within the murine urinary tract. A library of 2049 transposon mutants of the prototypic UPEC strain CFT073 was constructed using mini-Tn5km2 carrying 92 unique tags and screened in a murine model of ascending UTI. After initial screening followed by confirmation in co-infection experiments, 19 survival-defective mutants were identified. These mutants were recovered in numbers 101- to 106-fold less than the wild type in the bladder, kidneys or urine or at more than one site. The transposon junctions from each attenuated mutant were sequenced and analysed. Mutations were found in: (i) the type 1 fimbrial operon; (ii) genes involved in the biosyn-thesis of extracellular polysaccharides including group I capsule, group II capsule and enterobacterial common antigen; (iii) genes involved in metabolic pathways; and (iv) genes with unknown function. Five of the genes identified are absent from the genome of the E. coli K-12 strain. Mutations in type 1 fimbrial genes resulted in severely attenuated colonization, even in the case of a mutant with an insertion upstream of the fim operon that affected the rate of fimbrial switching from the 'off' to the 'on' phase. Three mutants had insertions in a new type II capsule biosynthesis locus on a pathogenicity island and were impaired in the production of capsule in vivo. An additional mutant with an insertion in wecE was unable to synthesize enterobacterial common antigen. These results confirm the pre-eminence of type 1 fimbriae, establish the importance of extracellular polysaccharides in the pathogenesis of UTI and identify new urovirulence determinants.
Defining Genetic Fitness Determinants and Creating Genomic Resources for an Oral Pathogen
Narayanan, Ajay M.; Ramsey, Matthew M.
2017-01-01
ABSTRACT Periodontitis is a microbial infection that destroys the structures that support the teeth. Although it is typically a chronic condition, rapidly progressing, aggressive forms are associated with the oral pathogen Aggregatibacter actinomycetemcomitans. One of this bacterium's key virulence traits is its ability to attach to surfaces and form robust biofilms that resist killing by the host and antibiotics. Though much has been learned about A. actinomycetemcomitans since its initial discovery, we lack insight into a fundamental aspect of its basic biology, as we do not know the full set of genes that it requires for viability (the essential genome). Furthermore, research on A. actinomycetemcomitans is hampered by the field's lack of a mutant collection. To address these gaps, we used rapid transposon mutant sequencing (Tn-seq) to define the essential genomes of two strains of A. actinomycetemcomitans, revealing a core set of 319 genes. We then generated an arrayed mutant library comprising >1,500 unique insertions and used a sequencing-based approach to define each mutant's position (well and plate) in the library. To demonstrate its utility, we screened the library for mutants with weakened resistance to subinhibitory erythromycin, revealing the multidrug efflux pump AcrAB as a critical resistance factor. During the screen, we discovered that erythromycin induces A. actinomycetemcomitans to form biofilms. We therefore devised a novel Tn-seq-based screen to identify specific factors that mediate this phenotype and in follow-up experiments confirmed 4 mutants. Together, these studies present new insights and resources for investigating the basic biology and disease mechanisms of a human pathogen. IMPORTANCE Millions suffer from gum disease, which often is caused by Aggregatibacter actinomycetemcomitans, a bacterium that forms antibiotic-resistant biofilms. To fully understand any organism, we should be able to answer: what genes does it require for life? Here, we address this question for A. actinomycetemcomitans by determining the genes in its genome that cannot be mutated. As for the genes that can be mutated, we archived these mutants into a library, which we used to find genes that contribute to antibiotic resistance, leading us to discover that antibiotics cause A. actinomycetemcomitans to form biofilms. We then devised an approach to find genes that mediate this process and confirmed 4 genes. These results illuminate new fundamental traits of a human pathogen. PMID:28476775
Yoshiyama, Kaoru; Conklin, Phillip A.; Huefner, Neil D.; Britt, Anne B.
2009-01-01
The Arabidopsis sog1-1 (suppressor of gamma response) mutant was originally isolated as a second-site suppressor of the radiosensitive phenotype of seeds defective in the repair endonuclease XPF. Here, we report that SOG1 encodes a putative transcription factor. This gene is a member of the NAC domain [petunia NAM (no apical meristem) and Arabidopsis ATAF1, 2 and CUC2] family (a family of proteins unique to land plants). Hundreds of genes are normally up-regulated in Arabidopsis within an hour of treatment with ionizing radiation; the induction of these genes requires the damage response protein kinase ATM, but not the related kinase ATR. Here, we find that SOG1 is also required for this transcriptional up-regulation. In contrast, the SOG1-dependent checkpoint response observed in xpf mutant seeds requires ATR, but does not require ATM. Thus, phenotype of the sog1-1 mutant mimics aspects of the phenotypes of both atr and atm mutants in Arabidopsis, suggesting that SOG1 participates in pathways governed by both of these sensor kinases. We propose that, in plants, signals related to genomic stress are processed through a single, central transcription factor, SOG1. PMID:19549833
CRISPR-Cas9 and CRISPR-Cpf1 mediated targeting of a stomatal developmental gene EPFL9 in rice.
Yin, Xiaojia; Biswal, Akshaya K; Dionora, Jacqueline; Perdigon, Kristel M; Balahadia, Christian P; Mazumdar, Shamik; Chater, Caspar; Lin, Hsiang-Chun; Coe, Robert A; Kretzschmar, Tobias; Gray, Julie E; Quick, Paul W; Bandyopadhyay, Anindya
2017-05-01
CRISPR-Cas9/Cpf1 system with its unique gene targeting efficiency, could be an important tool for functional study of early developmental genes through the generation of successful knockout plants. The introduction and utilization of systems biology approaches have identified several genes that are involved in early development of a plant and with such knowledge a robust tool is required for the functional validation of putative candidate genes thus obtained. The development of the CRISPR-Cas9/Cpf1 genome editing system has provided a convenient tool for creating loss of function mutants for genes of interest. The present study utilized CRISPR/Cas9 and CRISPR-Cpf1 technology to knock out an early developmental gene EPFL9 (Epidermal Patterning Factor like-9, a positive regulator of stomatal development in Arabidopsis) orthologue in rice. Germ-line mutants that were generated showed edits that were carried forward into the T2 generation when Cas9-free homozygous mutants were obtained. The homozygous mutant plants showed more than an eightfold reduction in stomatal density on the abaxial leaf surface of the edited rice plants. Potential off-target analysis showed no significant off-target effects. This study also utilized the CRISPR-LbCpf1 (Lachnospiracae bacterium Cpf1) to target the same OsEPFL9 gene to test the activity of this class-2 CRISPR system in rice and found that Cpf1 is also capable of genome editing and edits get transmitted through generations with similar phenotypic changes seen with CRISPR-Cas9. This study demonstrates the application of CRISPR-Cas9/Cpf1 to precisely target genomic locations and develop transgene-free homozygous heritable gene edits and confirms that the loss of function analysis of the candidate genes emerging from different systems biology based approaches, could be performed, and therefore, this system adds value in the validation of gene function studies.
Fujimitsu, Kazuyuki; Su'etsugu, Masayuki; Yamaguchi, Yoko; Mazda, Kensaku; Fu, Nisi; Kawakami, Hironori; Katayama, Tsutomu
2008-01-01
The chromosomal replication cycle is strictly coordinated with cell cycle progression in Escherichia coli. ATP-DnaA initiates replication, leading to loading of the DNA polymerase III holoenzyme. The DNA-loaded form of the β clamp subunit of the polymerase binds the Hda protein, which promotes ATP-DnaA hydrolysis, yielding inactive ADP-DnaA. This regulation is required to repress overinitiation. In this study, we have isolated a novel cold-sensitive hda mutant, the hda-185 mutant. The hda-185 mutant caused overinitiation of chromosomal replication at 25°C, which most likely led to blockage of replication fork progress. Consistently, the inhibition of colony formation at 25°C was suppressed by disruption of the diaA gene, an initiation stimulator. Disruption of the seqA gene, an initiation inhibitor, showed synthetic lethality with hda-185 even at 42°C. The cellular ATP-DnaA level was increased in an hda-185-dependent manner. The cellular concentrations of DnaA protein and dnaA mRNA were comparable at 25°C to those in a wild-type hda strain. We also found that multiple copies of the ribonucleotide reductase genes (nrdAB or nrdEF) or dnaB gene repressed overinitiation. The cellular levels of dATP and dCTP were elevated in cells bearing multiple copies of nrdAB. The catalytic site within NrdA was required for multicopy suppression, suggesting the importance of an active form of NrdA or elevated levels of deoxyribonucleotides in inhibition of overinitiation in the hda-185 cells. Cell division in the hda-185 mutant was inhibited at 25°C in a LexA regulon-independent manner, suggesting that overinitiation in the hda-185 mutant induced a unique division inhibition pathway. PMID:18502852
Fujimitsu, Kazuyuki; Su'etsugu, Masayuki; Yamaguchi, Yoko; Mazda, Kensaku; Fu, Nisi; Kawakami, Hironori; Katayama, Tsutomu
2008-08-01
The chromosomal replication cycle is strictly coordinated with cell cycle progression in Escherichia coli. ATP-DnaA initiates replication, leading to loading of the DNA polymerase III holoenzyme. The DNA-loaded form of the beta clamp subunit of the polymerase binds the Hda protein, which promotes ATP-DnaA hydrolysis, yielding inactive ADP-DnaA. This regulation is required to repress overinitiation. In this study, we have isolated a novel cold-sensitive hda mutant, the hda-185 mutant. The hda-185 mutant caused overinitiation of chromosomal replication at 25 degrees C, which most likely led to blockage of replication fork progress. Consistently, the inhibition of colony formation at 25 degrees C was suppressed by disruption of the diaA gene, an initiation stimulator. Disruption of the seqA gene, an initiation inhibitor, showed synthetic lethality with hda-185 even at 42 degrees C. The cellular ATP-DnaA level was increased in an hda-185-dependent manner. The cellular concentrations of DnaA protein and dnaA mRNA were comparable at 25 degrees C to those in a wild-type hda strain. We also found that multiple copies of the ribonucleotide reductase genes (nrdAB or nrdEF) or dnaB gene repressed overinitiation. The cellular levels of dATP and dCTP were elevated in cells bearing multiple copies of nrdAB. The catalytic site within NrdA was required for multicopy suppression, suggesting the importance of an active form of NrdA or elevated levels of deoxyribonucleotides in inhibition of overinitiation in the hda-185 cells. Cell division in the hda-185 mutant was inhibited at 25 degrees C in a LexA regulon-independent manner, suggesting that overinitiation in the hda-185 mutant induced a unique division inhibition pathway.
Saunders, Neil F. W.; Hornberg, Jorrit J.; Reijnders, Willem N. M.; Westerhoff, Hans V.; de Vries, Simon; van Spanning, Rob J. M.
2000-01-01
The nos (nitrous oxide reductase) operon of Paracoccus denitrificans contains a nosX gene homologous to those found in the nos operons of other denitrifiers. NosX is also homologous to NirX, which is so far unique to P. denitrificans. Single mutations of these genes did not result in any apparent phenotype, but a double nosX nirX mutant was unable to reduce nitrous oxide. Promoter-lacZ assays and immunoblotting against nitrous oxide reductase showed that the defect was not due to failure of expression of nosZ, the structural gene for nitrous oxide reductase. Electron paramagnetic resonance spectroscopy showed that nitrous oxide reductase in cells of the double mutant lacked the CuA center. A twin-arginine motif in both NosX and NirX suggests that the NosX proteins are exported to the periplasm via the TAT translocon. PMID:10960107
Lin, K; Dorman, J B; Rodan, A; Kenyon, C
1997-11-14
The wild-type Caenorhabditis elegans nematode ages rapidly, undergoing development, senescence, and death in less than 3 weeks. In contrast, mutants with reduced activity of the gene daf-2, a homolog of the insulin and insulin-like growth factor receptors, age more slowly than normal and live more than twice as long. These mutants are active and fully fertile and have normal metabolic rates. The life-span extension caused by daf-2 mutations requires the activity of the gene daf-16. daf-16 appears to play a unique role in life-span regulation and encodes a member of the hepatocyte nuclear factor 3 (HNF-3)/forkhead family of transcriptional regulators. In humans, insulin down-regulates the expression of certain genes by antagonizing the activity of HNF-3, raising the possibility that aspects of this regulatory system have been conserved.
Slavicek, J M; Mercer, M J; Pohlman, D; Kelly, M E; Bischoff, D S
1998-07-01
In previous studies on the formation of Lymantria dispar nuclear polyhedrosis virus (LdMNPV) few polyhedra (FP) mutants, several polyhedron formation mutants (PFM) were identified that appeared to be unique. These viral mutants are being characterized to investigate the processes of polyhedron formation and virion occlusion. LdMNPV isolate PFM-1 is one of these mutants, and is described in this report. Genetic techniques were used to determine if isolate PFM-1 contained a mutation in the polyhedrin or 25K FP gene. Wild-type viruses were recovered after coinfection of Ld652Y cells with isolate PFM-1 and a FP mutant, and with isolates PFM-1 and PFM-C (isolate PFM-C contains a mutation in the polyhedrin gene). These viruses were analyzed by genomic restriction endonuclease digestion and found to be chimeras of the original PFMs used in the coinfections. Marker rescue studies mapped the mutation in isolate PFM-1 to a genomic region that does not include the polyhedrin or 25K FP genes. Isolate PFM-1 produced approximately 14-fold fewer polyhedra than LdMNPV isolate A21-MPV, an isolate that produces wild-type levels of polyhedra, and approximately 2-fold more polyhedra compared to the FP isolate 122-2. Polyhedra generated by isolate PFM-1 were normal in size and shape but contained very few viral nucleocapsids. The same amount of budded virus (BV) was released from cells infected with isolates PFM-1 and A21-MPV. In contrast, isolate 122-2 yielded significantly more BV than isolates PFM-1 and A21-MPV.
Multi-source and ontology-based retrieval engine for maize mutant phenotypes
Green, Jason M.; Harnsomburana, Jaturon; Schaeffer, Mary L.; Lawrence, Carolyn J.; Shyu, Chi-Ren
2011-01-01
Model Organism Databases, including the various plant genome databases, collect and enable access to massive amounts of heterogeneous information, including sequence data, gene product information, images of mutant phenotypes, etc, as well as textual descriptions of many of these entities. While a variety of basic browsing and search capabilities are available to allow researchers to query and peruse the names and attributes of phenotypic data, next-generation search mechanisms that allow querying and ranking of text descriptions are much less common. In addition, the plant community needs an innovative way to leverage the existing links in these databases to search groups of text descriptions simultaneously. Furthermore, though much time and effort have been afforded to the development of plant-related ontologies, the knowledge embedded in these ontologies remains largely unused in available plant search mechanisms. Addressing these issues, we have developed a unique search engine for mutant phenotypes from MaizeGDB. This advanced search mechanism integrates various text description sources in MaizeGDB to aid a user in retrieving desired mutant phenotype information. Currently, descriptions of mutant phenotypes, loci and gene products are utilized collectively for each search, though expansion of the search mechanism to include other sources is straightforward. The retrieval engine, to our knowledge, is the first engine to exploit the content and structure of available domain ontologies, currently the Plant and Gene Ontologies, to expand and enrich retrieval results in major plant genomic databases. Database URL: http:www.PhenomicsWorld.org/QBTA.php PMID:21558151
Selective gene dosage by CRISPR-Cas9 genome editing in hexaploid Camelina sativa.
Morineau, Céline; Bellec, Yannick; Tellier, Frédérique; Gissot, Lionel; Kelemen, Zsolt; Nogué, Fabien; Faure, Jean-Denis
2017-06-01
In many plant species, gene dosage is an important cause of phenotype variation. Engineering gene dosage, particularly in polyploid genomes, would provide an efficient tool for plant breeding. The hexaploid oilseed crop Camelina sativa, which has three closely related expressed subgenomes, is an ideal species for investigation of the possibility of creating a large collection of combinatorial mutants. Selective, targeted mutagenesis of the three delta-12-desaturase (FAD2) genes was achieved by CRISPR-Cas9 gene editing, leading to reduced levels of polyunsaturated fatty acids and increased accumulation of oleic acid in the oil. Analysis of mutations over four generations demonstrated the presence of a large variety of heritable mutations in the three isologous CsFAD2 genes. The different combinations of single, double and triple mutants in the T3 generation were isolated, and the complete loss-of-function mutants revealed the importance of delta-12-desaturation for Camelina development. Combinatorial association of different alleles for the three FAD2 loci provided a large diversity of Camelina lines with various lipid profiles, ranging from 10% to 62% oleic acid accumulation in the oil. The different allelic combinations allowed an unbiased analysis of gene dosage and function in this hexaploid species, but also provided a unique source of genetic variability for plant breeding. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Flahaut, Sigrid; Vinogradov, Evgeny; Kelley, Kathryn A.; Brennan, Shannon; Hiramatsu, Keiichi; Lee, Jean C.
2008-01-01
The DNA sequence of the genome of Staphylococcus haemolyticus JCSC1435 revealed a putative capsule operon composed of 13 genes in tandem. The first seven genes (capABCDEFGSh) showed ≥57% similarity with the Staphylococcus aureus cap5 or cap8 locus. However, the capHIJKLMSh genes are unique to S. haemolyticus and include genes encoding a putative flippase, an aminotransferase, two glycosyltransferases, and a transcriptional regulator. Capsule-like material was readily apparent by immunoelectron microscopy on bacteria harvested in the postexponential phase of growth. Electron micrographs of a JCSC1435 mutant with a deleted cap region lacked the capsule-like material. Both strains produced small amounts of surface-associated material that reacted with antibodies to polyglutamic acid. S. haemolyticus cap genes were amplified from four of seven clinical isolates of S. haemolyticus from humans, and three of these strains produced a serologically cross-reactive capsular polysaccharide. In vitro assays demonstrated that the acapsular mutant strain showed greater biofilm formation but was more susceptible to complement-mediated opsonophagocytic killing than the parent strain. Structural characterization of capsule purified from S. haemolyticus strain JCSC1435 showed a trisaccharide repeating unit: −3-α-l-FucNAc-3-(2-NAc-4-N-Asp-2,4,6-trideoxy-β-d-Glc)-4-α-d-GlcNAc-. This structure is unique among staphylococcal polysaccharides in that its composition includes a trideoxy sugar residue with aspartic acid as an N-acyl substituent. PMID:18165309
Flahaut, Sigrid; Vinogradov, Evgeny; Kelley, Kathryn A; Brennan, Shannon; Hiramatsu, Keiichi; Lee, Jean C
2008-03-01
The DNA sequence of the genome of Staphylococcus haemolyticus JCSC1435 revealed a putative capsule operon composed of 13 genes in tandem. The first seven genes (capABCDEFG(Sh)) showed > or = 57% similarity with the Staphylococcus aureus cap5 or cap8 locus. However, the capHIJKLM(Sh) genes are unique to S. haemolyticus and include genes encoding a putative flippase, an aminotransferase, two glycosyltransferases, and a transcriptional regulator. Capsule-like material was readily apparent by immunoelectron microscopy on bacteria harvested in the postexponential phase of growth. Electron micrographs of a JCSC1435 mutant with a deleted cap region lacked the capsule-like material. Both strains produced small amounts of surface-associated material that reacted with antibodies to polyglutamic acid. S. haemolyticus cap genes were amplified from four of seven clinical isolates of S. haemolyticus from humans, and three of these strains produced a serologically cross-reactive capsular polysaccharide. In vitro assays demonstrated that the acapsular mutant strain showed greater biofilm formation but was more susceptible to complement-mediated opsonophagocytic killing than the parent strain. Structural characterization of capsule purified from S. haemolyticus strain JCSC1435 showed a trisaccharide repeating unit: -3-alpha-L-FucNAc-3-(2-NAc-4-N-Asp-2,4,6-trideoxy-beta-D-Glc)-4-alpha-D-GlcNAc-. This structure is unique among staphylococcal polysaccharides in that its composition includes a trideoxy sugar residue with aspartic acid as an N-acyl substituent.
Ye, Ping; Peyser, Brian D; Spencer, Forrest A; Bader, Joel S
2005-01-01
Background In a genetic interaction, the phenotype of a double mutant differs from the combined phenotypes of the underlying single mutants. When the single mutants have no growth defect, but the double mutant is lethal or exhibits slow growth, the interaction is termed synthetic lethality or synthetic fitness. These genetic interactions reveal gene redundancy and compensating pathways. Recently available large-scale data sets of genetic interactions and protein interactions in Saccharomyces cerevisiae provide a unique opportunity to elucidate the topological structure of biological pathways and how genes function in these pathways. Results We have defined congruent genes as pairs of genes with similar sets of genetic interaction partners and constructed a genetic congruence network by linking congruent genes. By comparing path lengths in three types of networks (genetic interaction, genetic congruence, and protein interaction), we discovered that high genetic congruence not only exhibits correlation with direct protein interaction linkage but also exhibits commensurate distance with the protein interaction network. However, consistent distances were not observed between genetic and protein interaction networks. We also demonstrated that congruence and protein networks are enriched with motifs that indicate network transitivity, while the genetic network has both transitive (triangle) and intransitive (square) types of motifs. These results suggest that robustness of yeast cells to gene deletions is due in part to two complementary pathways (square motif) or three complementary pathways, any two of which are required for viability (triangle motif). Conclusion Genetic congruence is superior to genetic interaction in prediction of protein interactions and function associations. Genetically interacting pairs usually belong to parallel compensatory pathways, which can generate transitive motifs (any two of three pathways needed) or intransitive motifs (either of two pathways needed). PMID:16283923
Iida, Aya; Ohnishi, Yasuo; Horinouchi, Sueharu
2008-07-01
Via N-acylhomoserine lactones, the GinI/GinR quorum-sensing system in Gluconacetobacter intermedius NCI1051, a gram-negative acetic acid bacterium, represses acetic acid and gluconic acid fermentation. Two-dimensional polyacrylamide gel electrophoretic analysis of protein profiles of strain NCI1051 and ginI and ginR mutants identified a protein that was produced in response to the GinI/GinR regulatory system. Cloning and nucleotide sequencing of the gene encoding this protein revealed that it encoded an OmpA family protein, named GmpA. gmpA was a member of the gene cluster containing three adjacent homologous genes, gmpA to gmpC, the organization of which appeared to be unique to vinegar producers, including "Gluconacetobacter polyoxogenes." In addition, GmpA was unique among the OmpA family proteins in that its N-terminal membrane domain forming eight antiparallel transmembrane beta-strands contained an extra sequence in one of the surface-exposed loops. Transcriptional analysis showed that only gmpA of the three adjacent gmp genes was activated by the GinI/GinR quorum-sensing system. However, gmpA was not controlled directly by GinR but was controlled by an 89-amino-acid protein, GinA, a target of this quorum-sensing system. A gmpA mutant grew more rapidly in the presence of 2% (vol/vol) ethanol and accumulated acetic acid and gluconic acid in greater final yields than strain NCI1051. Thus, GmpA plays a role in repressing oxidative fermentation, including acetic acid fermentation, which is unique to acetic acid bacteria and allows ATP synthesis via ethanol oxidation. Consistent with the involvement of gmpA in oxidative fermentation, its transcription was also enhanced by ethanol and acetic acid.
Genetic Dissection of Midbrain Dopamine Neuron Development in vivo
Ellisor, Debra; Rieser, Caroline; Voelcker, Bettina; Machan, Jason T.; Zervas, Mark
2012-01-01
Midbrain dopamine (MbDA) neurons are partitioned into medial and lateral cohorts that control complex functions. However, the genetic underpinnings of MbDA neuron heterogeneity are unclear. While it is known that Wnt1-expressing progenitors contribute to MbDA neurons, the role of Wnt1 in MbDA neuron development in vivo is unresolved. We show that mice with a spontaneous point mutation in Wnt1 have a unique phenotype characterized by the loss of medial MbDA neurons concomitant with a severe depletion of Wnt1-expressing progenitors and diminished LMX1a-expressing progenitors. Wnt1 mutant embryos also have alterations in a hierarchical gene regulatory loop suggesting multiple gene involvement in the Wnt1 mutant MbDA neuron phenotype. To investigate this possibility, we conditionally deleted Gbx2, Fgf8, and En1/2 after their early role in patterning and asked whether these genetic manipulations phenocopied the depletion of MbDA neurons in Wnt1 mutants. The conditional deletion of Gbx2 did not result in re-positioning or distribution of MbDA neurons. The temporal deletion of Fgf8 did not result in the loss of either LMX1a-expressing progenitors nor the initial population of differentiated MbDA neurons, but did result in a complete loss of MbDA neurons at later stages. The temporal deletion and species specific manipulation of En1/2 demonstrated a continued and species specific role of Engrailed genes in MbDA neuron development. Notably, our conditional deletion experiments revealed phenotypes dissimilar to Wnt1 mutants indicating the unique role of Wnt1 in MbDA neuron development. By placing Wnt1, Fgf8, and En1/2 in the context of their temporal requirement for MbDA neuron development, we further deciphered the developmental program underpinning MbDA neuron progenitors. PMID:23041116
Ponnusamy, Duraisamy; Fitts, Eric C.; Erova, Tatiana E.; Kozlova, Elena V.; Kirtley, Michelle L.; Tiner, Bethany L.; Andersson, Jourdan A.
2015-01-01
The identification of new virulence factors in Yersinia pestis and understanding their molecular mechanisms during an infection process are necessary in designing a better vaccine or to formulate an appropriate therapeutic intervention. By using a high-throughput, signature-tagged mutagenic approach, we created 5,088 mutants of Y. pestis strain CO92 and screened them in a mouse model of pneumonic plague at a dose equivalent to 5 50% lethal doses (LD50) of wild-type (WT) CO92. From this screen, we obtained 118 clones showing impairment in disseminating to the spleen, based on hybridization of input versus output DNA from mutant pools with 53 unique signature tags. In the subsequent screen, 20/118 mutants exhibited attenuation at 8 LD50 when tested in a mouse model of bubonic plague, with infection by 10/20 of the aforementioned mutants resulting in 40% or higher survival rates at an infectious dose of 40 LD50. Upon sequencing, six of the attenuated mutants were found to carry interruptions in genes encoding hypothetical proteins or proteins with putative functions. Mutants with in-frame deletion mutations of two of the genes identified from the screen, namely, rbsA, which codes for a putative sugar transport system ATP-binding protein, and vasK, a component of the type VI secretion system, were also found to exhibit some attenuation at 11 or 12 LD50 in a mouse model of pneumonic plague. Likewise, among the remaining 18 signature-tagged mutants, 9 were also attenuated (40 to 100%) at 12 LD50 in a pneumonic plague mouse model. Previously, we found that deleting genes encoding Braun lipoprotein (Lpp) and acyltransferase (MsbB), the latter of which modifies lipopolysaccharide function, reduced the virulence of Y. pestis CO92 in mouse models of bubonic and pneumonic plague. Deletion of rbsA and vasK genes from either the Δlpp single or the Δlpp ΔmsbB double mutant augmented the attenuation to provide 90 to 100% survivability to mice in a pneumonic plague model at 20 to 50 LD50. The mice infected with the Δlpp ΔmsbB ΔrbsA triple mutant at 50 LD50 were 90% protected upon subsequent challenge with 12 LD50 of WT CO92, suggesting that this mutant or others carrying combinational deletions of genes identified through our screen could potentially be further tested and developed into a live attenuated plague vaccine(s). PMID:25754198
Ponnusamy, Duraisamy; Fitts, Eric C; Sha, Jian; Erova, Tatiana E; Kozlova, Elena V; Kirtley, Michelle L; Tiner, Bethany L; Andersson, Jourdan A; Chopra, Ashok K
2015-05-01
The identification of new virulence factors in Yersinia pestis and understanding their molecular mechanisms during an infection process are necessary in designing a better vaccine or to formulate an appropriate therapeutic intervention. By using a high-throughput, signature-tagged mutagenic approach, we created 5,088 mutants of Y. pestis strain CO92 and screened them in a mouse model of pneumonic plague at a dose equivalent to 5 50% lethal doses (LD50) of wild-type (WT) CO92. From this screen, we obtained 118 clones showing impairment in disseminating to the spleen, based on hybridization of input versus output DNA from mutant pools with 53 unique signature tags. In the subsequent screen, 20/118 mutants exhibited attenuation at 8 LD50 when tested in a mouse model of bubonic plague, with infection by 10/20 of the aforementioned mutants resulting in 40% or higher survival rates at an infectious dose of 40 LD50. Upon sequencing, six of the attenuated mutants were found to carry interruptions in genes encoding hypothetical proteins or proteins with putative functions. Mutants with in-frame deletion mutations of two of the genes identified from the screen, namely, rbsA, which codes for a putative sugar transport system ATP-binding protein, and vasK, a component of the type VI secretion system, were also found to exhibit some attenuation at 11 or 12 LD50 in a mouse model of pneumonic plague. Likewise, among the remaining 18 signature-tagged mutants, 9 were also attenuated (40 to 100%) at 12 LD50 in a pneumonic plague mouse model. Previously, we found that deleting genes encoding Braun lipoprotein (Lpp) and acyltransferase (MsbB), the latter of which modifies lipopolysaccharide function, reduced the virulence of Y. pestis CO92 in mouse models of bubonic and pneumonic plague. Deletion of rbsA and vasK genes from either the Δlpp single or the Δlpp ΔmsbB double mutant augmented the attenuation to provide 90 to 100% survivability to mice in a pneumonic plague model at 20 to 50 LD50. The mice infected with the Δlpp ΔmsbB ΔrbsA triple mutant at 50 LD50 were 90% protected upon subsequent challenge with 12 LD50 of WT CO92, suggesting that this mutant or others carrying combinational deletions of genes identified through our screen could potentially be further tested and developed into a live attenuated plague vaccine(s). Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Sujino, Mitsugu; Asakawa, Takeshi; Nagano, Mamoru; Koinuma, Satoshi; Masumoto, Koh-Hei; Shigeyoshi, Yasufumi
2018-01-16
In mammals, the principal circadian oscillator exists in the hypothalamic suprachiasmatic nucleus (SCN). In the SCN, CLOCK works as an essential component of molecular circadian oscillation, and ClockΔ19 mutant mice show unique characteristics of circadian rhythms such as extended free running periods, amplitude attenuation, and high-magnitude phase-resetting responses. Here we investigated what modifications occur in the spatiotemporal organization of clock gene expression in the SCN of ClockΔ19 mutants. The cultured SCN, sampled from neonatal homozygous ClockΔ19 mice on an ICR strain comprising PERIOD2::LUCIFERASE, demonstrated that the Clock gene mutation not only extends the circadian period, but also affects the spatial phase and period distribution of circadian oscillations in the SCN. In addition, disruption of the synchronization among neurons markedly attenuated the amplitude of the circadian rhythm of individual oscillating neurons in the mutant SCN. Further, with numerical simulations based on the present studies, the findings suggested that, in the SCN of the ClockΔ19 mutant mice, stable oscillation was preserved by the interaction among oscillating neurons, and that the orderly phase and period distribution that makes a phase wave are dependent on the functionality of CLOCK.
The purple cauliflower arises from activation of a MYB transcription factor.
Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L; Li, Li
2010-11-01
Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3'-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal.
The Purple Cauliflower Arises from Activation of a MYB Transcription Factor1[W][OA
Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L.; Li, Li
2010-01-01
Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3’-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal. PMID:20855520
Wu, S W; De Lencastre, H
1999-01-01
Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.
Aziz, Ramy K.; Kansal, Rita; Aronow, Bruce J.; Taylor, William L.; Rowe, Sarah L.; Kubal, Michael; Chhatwal, Gursharan S.; Walker, Mark J.; Kotb, Malak
2010-01-01
The onset of infection and the switch from primary to secondary niches are dramatic environmental changes that not only alter bacterial transcriptional programs, but also perturb their sociomicrobiology, often driving minor subpopulations with mutant phenotypes to prevail in specific niches. Having previously reported that M1T1 Streptococcus pyogenes become hypervirulent in mice due to selection of mutants in the covRS regulatory genes, we set out to dissect the impact of these mutations in vitro and in vivo from the impact of other adaptive events. Using a murine subcutaneous chamber model to sample the bacteria prior to selection or expansion of mutants, we compared gene expression dynamics of wild type (WT) and previously isolated animal-passaged (AP) covS mutant bacteria both in vitro and in vivo, and we found extensive transcriptional alterations of pathoadaptive and metabolic gene sets associated with invasion, immune evasion, tissue-dissemination, and metabolic reprogramming. In contrast to the virulence-associated differences between WT and AP bacteria, Phenotype Microarray analysis showed minor in vitro phenotypic differences between the two isogenic variants. Additionally, our results reflect that WT bacteria's rapid host-adaptive transcriptional reprogramming was not sufficient for their survival, and they were outnumbered by hypervirulent covS mutants with SpeB−/Sdahigh phenotype, which survived up to 14 days in mice chambers. Our findings demonstrate the engagement of unique regulatory modules in niche adaptation, implicate a critical role for bacterial genetic heterogeneity that surpasses transcriptional in vivo adaptation, and portray the dynamics underlying the selection of hypervirulent covS mutants over their parental WT cells. PMID:20418946
Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.
Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin
2017-12-15
TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.
Hiller, Ekkehard; Istel, Fabian; Tscherner, Michael; Brunke, Sascha; Ames, Lauren; Firon, Arnaud; Green, Brian; Cabral, Vitor; Marcet-Houben, Marina; Jacobsen, Ilse D.; Quintin, Jessica; Seider, Katja; Frohner, Ingrid; Glaser, Walter; Jungwirth, Helmut; Bachellier-Bassi, Sophie; Chauvel, Murielle; Zeidler, Ute; Ferrandon, Dominique; Gabaldón, Toni; Hube, Bernhard; d'Enfert, Christophe; Rupp, Steffen; Cormack, Brendan; Haynes, Ken; Kuchler, Karl
2014-01-01
The opportunistic fungal pathogen Candida glabrata is a frequent cause of candidiasis, causing infections ranging from superficial to life-threatening disseminated disease. The inherent tolerance of C. glabrata to azole drugs makes this pathogen a serious clinical threat. To identify novel genes implicated in antifungal drug tolerance, we have constructed a large-scale C. glabrata deletion library consisting of 619 unique, individually bar-coded mutant strains, each lacking one specific gene, all together representing almost 12% of the genome. Functional analysis of this library in a series of phenotypic and fitness assays identified numerous genes required for growth of C. glabrata under normal or specific stress conditions, as well as a number of novel genes involved in tolerance to clinically important antifungal drugs such as azoles and echinocandins. We identified 38 deletion strains displaying strongly increased susceptibility to caspofungin, 28 of which encoding proteins that have not previously been linked to echinocandin tolerance. Our results demonstrate the potential of the C. glabrata mutant collection as a valuable resource in functional genomics studies of this important fungal pathogen of humans, and to facilitate the identification of putative novel antifungal drug target and virulence genes. PMID:24945925
Ivanova, Kira A; Tsyganova, Anna V; Brewin, Nicholas J; Tikhonovich, Igor A; Tsyganov, Viktor E
2015-11-01
Rhizobia are able to establish a beneficial interaction with legumes by forming a new organ, called the symbiotic root nodule, which is a unique ecological niche for rhizobial nitrogen fixation. Rhizobial infection has many similarities with pathogenic infection and induction of defence responses accompanies both interactions, but defence responses are induced to a lesser extent during rhizobial infection. However, strong defence responses may result from incompatible interactions between legumes and rhizobia due to a mutation in either macro- or microsymbiont. The aim of this research was to analyse different plant defence reactions in response to Rhizobium infection for several pea (Pisum sativum) mutants that result in ineffective symbiosis. Pea mutants were examined by histochemical and immunocytochemical analyses, light, fluorescence and transmission electron microscopy and quantitative real-time PCR gene expression analysis. It was observed that mutations in pea symbiotic genes sym33 (PsIPD3/PsCYCLOPS encoding a transcriptional factor) and sym40 (PsEFD encoding a putative negative regulator of the cytokinin response) led to suberin depositions in ineffective nodules, and in the sym42 there were callose depositions in infection thread (IT) and host cell walls. The increase in deposition of unesterified pectin in IT walls was observed for mutants in the sym33 and sym42; for mutant in the sym42, unesterified pectin was also found around degrading bacteroids. In mutants in the genes sym33 and sym40, an increase in the expression level of a gene encoding peroxidase was observed. In the genes sym40 and sym42, an increase in the expression levels of genes encoding a marker of hypersensitive reaction and PR10 protein was demonstrated. Thus, a range of plant defence responses like suberisation, callose and unesterified pectin deposition as well as activation of defence genes can be triggered by different pea single mutations that cause perception of an otherwise beneficial strain of Rhizobium as a pathogen.
ISHIKAWA, Akira; SUGIYAMA, Makoto; HONDO, Eiichi; KINOSHITA, Keiji; YAMAGISHI, Yuki
2015-01-01
Oca2p-cas (oculocutaneous albinism II; pink-eyed dilution castaneus) is a coat color mutant gene on mouse chromosome 7 that arose spontaneously in wild Mus musculus castaneus mice. Mice homozygous for Oca2p-cas usually exhibit pink eyes and gray coat hair on the non-agouti genetic background, and this ordinary phenotype remains unchanged throughout life. During breeding of a mixed strain carrying this gene on the C57BL/6J background, we discovered a novel spontaneous mutation that causes darkening of the eyes and coat hair with aging. In this study, we developed a novel mouse model showing this unique phenotype. Gross observations revealed that the pink eyes and gray coat hair of the novel mutant young mice became progressively darker in color by approximately 3 months after birth. Light and transmission-electron microscopic observations revealed a marked increase in melanin pigmentation of coat hair shafts and choroid of the eye in the novel mice compared to that in the ordinary mice. Sequence analysis of Oca2p-cas revealed a 4.1-kb deletion involving exons 15 and 16 of its wild-type gene. However, there was no sequence difference between the two types of mutant mice. Mating experiments suggested that the novel mutant phenotype was not inherited in a simple fashion, due to incomplete penetrance. The novel spontaneous mutant mouse is the first example of progressive hair darkening animals and is an essential animal model for understanding of the regulation mechanisms of melanin biosynthesis with aging. PMID:25739360
Ishikawa, Akira; Sugiyama, Makoto; Hondo, Eiichi; Kinoshita, Keiji; Yamagishi, Yuki
2015-01-01
Oca2(p-cas) (oculocutaneous albinism II; pink-eyed dilution castaneus) is a coat color mutant gene on mouse chromosome 7 that arose spontaneously in wild Mus musculus castaneus mice. Mice homozygous for Oca2(p-cas) usually exhibit pink eyes and gray coat hair on the non-agouti genetic background, and this ordinary phenotype remains unchanged throughout life. During breeding of a mixed strain carrying this gene on the C57BL/6J background, we discovered a novel spontaneous mutation that causes darkening of the eyes and coat hair with aging. In this study, we developed a novel mouse model showing this unique phenotype. Gross observations revealed that the pink eyes and gray coat hair of the novel mutant young mice became progressively darker in color by approximately 3 months after birth. Light and transmission-electron microscopic observations revealed a marked increase in melanin pigmentation of coat hair shafts and choroid of the eye in the novel mice compared to that in the ordinary mice. Sequence analysis of Oca2(p-cas) revealed a 4.1-kb deletion involving exons 15 and 16 of its wild-type gene. However, there was no sequence difference between the two types of mutant mice. Mating experiments suggested that the novel mutant phenotype was not inherited in a simple fashion, due to incomplete penetrance. The novel spontaneous mutant mouse is the first example of progressive hair darkening animals and is an essential animal model for understanding of the regulation mechanisms of melanin biosynthesis with aging.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta
2013-05-24
Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states.more » The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level.« less
Kasuya, Junko; Ueda, Atsushi; Iyengar, Atulya; Wu, Chun-Fang
2016-01-01
Abstract Shudderer (Shu) is an X-linked dominant mutation in Drosophila melanogaster identified more than 40 years ago. A previous study showed that Shu caused spontaneous tremors and defects in reactive climbing behavior, and that these phenotypes were significantly suppressed when mutants were fed food containing lithium, a mood stabilizer used in the treatment of bipolar disorder (Williamson, 1982). This unique observation suggested that the Shu mutation affects genes involved in lithium-responsive neurobiological processes. In the present study, we identified Shu as a novel mutant allele of the voltage-gated sodium (Nav) channel gene paralytic (para). Given that hypomorphic para alleles and RNA interference–mediated para knockdown reduced the severity of Shu phenotypes, Shu was classified as a para hypermorphic allele. We also demonstrated that lithium could improve the behavioral abnormalities displayed by other Nav mutants, including a fly model of the human generalized epilepsy with febrile seizures plus. Our electrophysiological analysis of Shu showed that lithium treatment did not acutely suppress Nav channel activity, indicating that the rescue effect of lithium resulted from chronic physiological adjustments to this drug. Microarray analysis revealed that lithium significantly alters the expression of various genes in Shu, including those involved in innate immune responses, amino acid metabolism, and oxidation-reduction processes, raising the interesting possibility that lithium-induced modulation of these biological pathways may contribute to such adjustments. Overall, our findings demonstrate that Nav channel mutants in Drosophila are valuable genetic tools for elucidating the effects of lithium on the nervous system in the context of neurophysiology and behavior. PMID:27844061
Films of Bacteria at Interfaces (FBI): Remodeling of Fluid Interfaces by Pseudomonas aeruginosa.
Niepa, Tagbo H R; Vaccari, Liana; Leheny, Robert L; Goulian, Mark; Lee, Daeyeon; Stebe, Kathleen J
2017-12-19
Bacteria at fluid interfaces endure physical and chemical stresses unique to these highly asymmetric environments. The responses of Pseudomonas aeruginosa PAO1 and PA14 to a hexadecane-water interface are compared. PAO1 cells form elastic films of bacteria, excreted polysaccharides and proteins, whereas PA14 cells move actively without forming an elastic film. Studies of PAO1 mutants show that, unlike solid-supported biofilms, elastic interfacial film formation occurs in the absence of flagella, pili, or certain polysaccharides. Highly induced genes identified in transcriptional profiling include those for putative enzymes and a carbohydrate metabolism enzyme, alkB2; this latter gene is not upregulated in PA14 cells. Notably, PAO1 mutants lacking the alkB2 gene fail to form an elastic layer. Rather, they form an active film like that formed by PA14. These findings demonstrate that genetic expression is altered by interfacial confinement, and suggest that the ability to metabolize alkanes may play a role in elastic film formation at oil-water interfaces.
Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.
2008-01-01
Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558
Fofana, Bourlaye; Ghose, Kaushik; Somalraju, Ashok; McCallum, Jason; Main, David; Deyholos, Michael K; Rowland, Gordon G; Cloutier, Sylvie
2017-01-01
Flax secoisolariciresinol (SECO) diglucoside (SDG) lignan is an emerging natural product purported to prevent chronic diseases in humans. SECO, the aglycone form of SDG, has shown higher intestinal cell absorption but it is not accumulated naturally in planta . Recently, we have identified and characterized a UDP-glucosyltransferase gene, UGT74S1 , that glucosylates SECO into its monoglucoside (SMG) and SDG forms when expressed in yeast. However, whether this gene is unique in controlling SECO glucosylation into SDG in planta is unclear. Here, we report on the use of UGT74S1 in reverse and forward genetics to characterize an ethyl methane sulfonate (EMS) mutagenized flax population from cultivar CDC Bethune and consisting of 1996 M2 families. EMS mutagenesis generated 73 SNP variants causing 79 mutational events in the UGT74S1 exonic regions of 93 M2 families. The mutation frequency in the exonic regions was determined to be one per 28 Kb. Of these mutations, 13 homozygous missense mutations and two homozygous nonsense mutations were observed and all were transmitted into the M3 and M4 generations. Forward genetics screening of the population showed homozygous nonsense mutants completely lacking SDG biosynthesis while the production of SMG was observed only in a subset of the M4 lines. Heterozygous or homozygous M4 missense mutants displayed a wide range of SDG levels, some being greater than those of CDC Bethune. No additional deleterious mutations were detected in these mutant lines using a panel of 10 other genes potentially involved in the lignan biosynthesis. This study provides further evidence that UGT74S1 is unique in controlling SDG formation from SECO and this is the first report of non-transgenic flax germplasm with simultaneous knockout of SDG and presence of SMG in planta .
Fofana, Bourlaye; Ghose, Kaushik; Somalraju, Ashok; McCallum, Jason; Main, David; Deyholos, Michael K.; Rowland, Gordon G.; Cloutier, Sylvie
2017-01-01
Flax secoisolariciresinol (SECO) diglucoside (SDG) lignan is an emerging natural product purported to prevent chronic diseases in humans. SECO, the aglycone form of SDG, has shown higher intestinal cell absorption but it is not accumulated naturally in planta. Recently, we have identified and characterized a UDP-glucosyltransferase gene, UGT74S1, that glucosylates SECO into its monoglucoside (SMG) and SDG forms when expressed in yeast. However, whether this gene is unique in controlling SECO glucosylation into SDG in planta is unclear. Here, we report on the use of UGT74S1 in reverse and forward genetics to characterize an ethyl methane sulfonate (EMS) mutagenized flax population from cultivar CDC Bethune and consisting of 1996 M2 families. EMS mutagenesis generated 73 SNP variants causing 79 mutational events in the UGT74S1 exonic regions of 93 M2 families. The mutation frequency in the exonic regions was determined to be one per 28 Kb. Of these mutations, 13 homozygous missense mutations and two homozygous nonsense mutations were observed and all were transmitted into the M3 and M4 generations. Forward genetics screening of the population showed homozygous nonsense mutants completely lacking SDG biosynthesis while the production of SMG was observed only in a subset of the M4 lines. Heterozygous or homozygous M4 missense mutants displayed a wide range of SDG levels, some being greater than those of CDC Bethune. No additional deleterious mutations were detected in these mutant lines using a panel of 10 other genes potentially involved in the lignan biosynthesis. This study provides further evidence that UGT74S1 is unique in controlling SDG formation from SECO and this is the first report of non-transgenic flax germplasm with simultaneous knockout of SDG and presence of SMG in planta. PMID:28983308
Choe, Sunghwa; Schmitz, Robert J.; Fujioka, Shozo; Takatsuto, Suguru; Lee, Mi-Ok; Yoshida, Shigeo; Feldmann, Kenneth A.; Tax, Frans E.
2002-01-01
Mutants defective in the biosynthesis or signaling of brassinosteroids (BRs), plant steroid hormones, display dwarfism. Loss-of-function mutants for the gene encoding the plasma membrane-located BR receptor BRI1 are resistant to exogenous application of BRs, and characterization of this protein has contributed significantly to the understanding of BR signaling. We have isolated two new BR-insensitive mutants (dwarf12-1D and dwf12-2D) after screening Arabidopsis ethyl methanesulfonate mutant populations. dwf12 mutants displayed the characteristic morphology of previously reported BR dwarfs including short stature, short round leaves, infertility, and abnormal de-etiolation. In addition, dwf12 mutants exhibited several unique phenotypes, including severe downward curling of the leaves. Genetic analysis indicates that the two mutations are semidominant in that heterozygous plants show a semidwarf phenotype whose height is intermediate between wild-type and homozygous mutant plants. Unlike BR biosynthetic mutants, dwf12 plants were not rescued by high doses of exogenously applied BRs. Like bri1 mutants, dwf12 plants accumulated castasterone and brassinolide, 43- and 15-fold higher, respectively, providing further evidence that DWF12 is a component of the BR signaling pathway that includes BRI1. Map-based cloning of the DWF12 gene revealed that DWF12 belongs to a member of the glycogen synthase kinase 3β family. Unlike human glycogen synthase kinase 3β, DWF12 lacks the conserved serine-9 residue in the auto-inhibitory N terminus. In addition, dwf12-1D and dwf12-2D encode changes in consecutive glutamate residues in a highly conserved TREE domain. Together with previous reports that both bin2 and ucu1 mutants contain mutations in this TREE domain, this provides evidence that the TREE domain is of critical importance for proper function of DWF12/BIN2/UCU1 in BR signal transduction pathways. PMID:12428015
Discovery of nitrate-CPK-NLP signalling in central nutrient-growth networks.
Liu, Kun-Hsiang; Niu, Yajie; Konishi, Mineko; Wu, Yue; Du, Hao; Sun Chung, Hoo; Li, Lei; Boudsocq, Marie; McCormack, Matthew; Maekawa, Shugo; Ishida, Tetsuya; Zhang, Chao; Shokat, Kevan; Yanagisawa, Shuichi; Sheen, Jen
2017-05-18
Nutrient signalling integrates and coordinates gene expression, metabolism and growth. However, its primary molecular mechanisms remain incompletely understood in plants and animals. Here we report unique Ca 2+ signalling triggered by nitrate with live imaging of an ultrasensitive biosensor in Arabidopsis leaves and roots. A nitrate-sensitized and targeted functional genomic screen identifies subgroup III Ca 2+ -sensor protein kinases (CPKs) as master regulators that orchestrate primary nitrate responses. A chemical switch with the engineered mutant CPK10(M141G) circumvents embryo lethality and enables conditional analyses of cpk10 cpk30 cpk32 triple mutants to define comprehensive nitrate-associated regulatory and developmental programs. Nitrate-coupled CPK signalling phosphorylates conserved NIN-LIKE PROTEIN (NLP) transcription factors to specify the reprogramming of gene sets for downstream transcription factors, transporters, nitrogen assimilation, carbon/nitrogen metabolism, redox, signalling, hormones and proliferation. Conditional cpk10 cpk30 cpk32 and nlp7 mutants similarly impair nitrate-stimulated system-wide shoot growth and root establishment. The nutrient-coupled Ca 2+ signalling network integrates transcriptome and cellular metabolism with shoot-root coordination and developmental plasticity in shaping organ biomass and architecture.
Peng, Min; Jarett, Leonard; Meade, Ray; Madaio, Michael P.; Hancock, Wayne W.; George, Alfred L.; Neilson, Eric G.; Gasser, David L.
2008-01-01
Background Mice that are homozygous for the kidney disease (kd) mutation are apparently healthy for the first 8 weeks of life, but spontaneously develop a severe form of interstitial nephritis that progresses to end-stage renal disease (ESRD) by 4 to 8 months of age. By testing for linkage to microsatellite markers, we previously localized the kd gene to a YAC/BAC contig. Methods The sequence of the entire critical region was examined, and candidate genes were identified. These candidate genes were sequenced in both mutant (kd/kd) mice and normal controls. The phenotype was further characterized by immunohistochemistry and electron microscopy. Transgenic mice were constructed that carried the wild-type allele of the prime candidate gene, and this transgene was transferred to a kd/kd background by breeding. Results We have obtained evidence that kd is a mutant allele of a novel gene for a prenyltransferase-like mitochondrial protein (PLMP). This gene is alternatively spliced, with the larger gene product having one domain that resembles transprenyltransferase and another that is similar to geranylgeranyl pyrophosphate synthase. The smaller gene product includes only the first domain. An antiserum to PLMP localizes to mitochondria, and ultrastructural defects are present in the mitochondria of renal tubular epithelial cells, and to a lesser extent, hepatocytes and heart cells from kd/kd mice. In a line of kd/kd mice that carried the wild-type PLMP allele as a transgene, only 1 out of 13 animals expressed the disease by 120 days of age. Conclusion The kd allele codes for a novel protein that localizes to the mitochondria, and the kd/kd mouse has dysmorphic mitochondria in the renal tubular epithelial cells. This mouse is therefore a unique animal model for studying mechanisms that lead to tubulointerstitial nephritis. PMID:15200409
Drummond, Revel S. M.; Sheehan, Hester; Simons, Joanne L.; Martínez-Sánchez, N. Marcela; Turner, Rebecca M.; Putterill, Joanna; Snowden, Kimberley C.
2012-01-01
Analysis of mutants with increased branching has revealed the strigolactone synthesis/perception pathway which regulates branching in plants. However, whether variation in this well conserved developmental signaling system contributes to the unique plant architectures of different species is yet to be determined. We examined petunia orthologs of the Arabidopsis MAX1 and MAX2 genes to characterize their role in petunia architecture. A single ortholog of MAX1, PhMAX1 which encodes a cytochrome P450, was identified and was able to complement the max1 mutant of Arabidopsis. Petunia has two copies of the MAX2 gene, PhMAX2A and PhMAX2B which encode F-Box proteins. Differences in the transcript levels of these two MAX2-like genes suggest diverging functions. Unlike PhMAX2B, PhMAX2A mRNA levels change in leaves of differing age/position on the plant. Nonetheless, this gene functionally complements the Arabidopsis max2 mutant indicating that the biochemical activity of the PhMAX2A protein is not significantly different from MAX2. The expression of the petunia strigolactone pathway genes (PhCCD7, PhCCD8, PhMAX1, PhMAX2A, and PhMAX2B) was then further investigated throughout the development of wild-type petunia plants. Three of these genes showed changes in mRNA levels over a development series. Alterations to the expression patterns of these genes may influence the branching growth habit of plants by changing strigolactone production and/or sensitivity. These changes could allow both subtle and dramatic changes to branching within and between species. PMID:22645562
Porwollik, Steffen; Santiviago, Carlos A; Cheng, Pui; Long, Fred; Desai, Prerak; Fredlund, Jennifer; Srikumar, Shabarinath; Silva, Cecilia A; Chu, Weiping; Chen, Xin; Canals, Rocío; Reynolds, M Megan; Bogomolnaya, Lydia; Shields, Christine; Cui, Ping; Guo, Jinbai; Zheng, Yi; Endicott-Yazdani, Tiana; Yang, Hee-Jeong; Maple, Aimee; Ragoza, Yury; Blondel, Carlos J; Valenzuela, Camila; Andrews-Polymenis, Helene; McClelland, Michael
2014-01-01
We constructed two collections of targeted single gene deletion (SGD) mutants and two collections of targeted multi-gene deletion (MGD) mutants in Salmonella enterica sv Typhimurium 14028s. The SGD mutant collections contain (1), 3517 mutants in which a single gene is replaced by a cassette containing a kanamycin resistance (KanR) gene oriented in the sense direction (SGD-K), and (2), 3376 mutants with a chloramphenicol resistance gene (CamR) oriented in the antisense direction (SGD-C). A combined total of 3773 individual genes were deleted across these SGD collections. The MGD collections contain mutants bearing deletions of contiguous regions of three or more genes and include (3), 198 mutants spanning 2543 genes replaced by a KanR cassette (MGD-K), and (4), 251 mutants spanning 2799 genes replaced by a CamR cassette (MGD-C). Overall, 3476 genes were deleted in at least one MGD collection. The collections with different antibiotic markers permit construction of all viable combinations of mutants in the same background. Together, the libraries allow hierarchical screening of MGDs for different phenotypic followed by screening of SGDs within the target MGD regions. The mutants of these collections are stored at BEI Resources (www.beiresources.org) and publicly available.
A transcriptome analysis of two grapevine populations segregating for tendril phyllotaxy
Arro, Jie; Cuenca, Jose; Yang, Yingzhen; Liang, Zhenchang; Cousins, Peter; Zhong, Gan-Yuan
2017-01-01
The shoot structure of cultivated grapevine Vitis vinifera L. typically exhibits a three-node modular repetitive pattern, two sequential leaf-opposed tendrils followed by a tendril-free node. In this study, we investigated the molecular basis of this pattern by characterizing differentially expressed genes in 10 bulk samples of young tendril tissue from two grapevine populations showing segregation of mutant or wild-type shoot/tendril phyllotaxy. One population was the selfed progeny and the other one, an outcrossed progeny of a Vitis hybrid, ‘Roger’s Red’. We analyzed 13 375 expressed genes and carried out in-depth analyses of 324 of them, which were differentially expressed with a minimum of 1.5-fold changes between the mutant and wild-type bulk samples in both selfed and cross populations. A significant portion of these genes were direct cis-binding targets of 14 transcription factor families that were themselves differentially expressed. Network-based dependency analysis further revealed that most of the significantly rewired connections among the 10 most connected hub genes involved at least one transcription factor. TCP3 and MYB12, which were known important for plant-form development, were among these transcription factors. More importantly, TCP3 and MYB12 were found in this study to be involved in regulating the lignin gene PRX52, which is important to plant-form development. A further support evidence for the roles of TCP3-MYB12-PRX52 in contributing to tendril phyllotaxy was the findings of two other lignin-related genes uniquely expressed in the mutant phyllotaxy background. PMID:28713572
Genetic and Functional Diversification of Small RNA Pathways in Plants
Gustafson, Adam M; Kasschau, Kristin D; Lellis, Andrew D; Zilberman, Daniel; Jacobsen, Steven E
2004-01-01
Multicellular eukaryotes produce small RNA molecules (approximately 21–24 nucleotides) of two general types, microRNA (miRNA) and short interfering RNA (siRNA). They collectively function as sequence-specific guides to silence or regulate genes, transposons, and viruses and to modify chromatin and genome structure. Formation or activity of small RNAs requires factors belonging to gene families that encode DICER (or DICER-LIKE [DCL]) and ARGONAUTE proteins and, in the case of some siRNAs, RNA-dependent RNA polymerase (RDR) proteins. Unlike many animals, plants encode multiple DCL and RDR proteins. Using a series of insertion mutants of Arabidopsis thaliana, unique functions for three DCL proteins in miRNA (DCL1), endogenous siRNA (DCL3), and viral siRNA (DCL2) biogenesis were identified. One RDR protein (RDR2) was required for all endogenous siRNAs analyzed. The loss of endogenous siRNA in dcl3 and rdr2 mutants was associated with loss of heterochromatic marks and increased transcript accumulation at some loci. Defects in siRNA-generation activity in response to turnip crinkle virus in dcl2 mutant plants correlated with increased virus susceptibility. We conclude that proliferation and diversification of DCL and RDR genes during evolution of plants contributed to specialization of small RNA-directed pathways for development, chromatin structure, and defense. PMID:15024409
Sall1-dependent signals affect Wnt signaling and ureter tip fate to initiate kidney development.
Kiefer, Susan M; Robbins, Lynn; Stumpff, Kelly M; Lin, Congxing; Ma, Liang; Rauchman, Michael
2010-09-01
Development of the metanephric kidney depends on precise control of branching of the ureteric bud. Branching events represent terminal bifurcations that are thought to depend on unique patterns of gene expression in the tip compared with the stalk and are influenced by mesenchymal signals. The metanephric mesenchyme-derived signals that control gene expression at the ureteric bud tip are not well understood. In mouse Sall1 mutants, the ureteric bud grows out and invades the metanephric mesenchyme, but it fails to initiate branching despite tip-specific expression of Ret and Wnt11. The stalk-specific marker Wnt9b and the beta-catenin downstream target Axin2 are ectopically expressed in the mutant ureteric bud tips, suggesting that upregulated canonical Wnt signaling disrupts ureter branching in this mutant. In support of this hypothesis, ureter arrest is rescued by lowering beta-catenin levels in the Sall1 mutant and is phenocopied by ectopic expression of a stabilized beta-catenin in the ureteric bud. Furthermore, transgenic overexpression of Wnt9b in the ureteric bud causes reduced branching in multiple founder lines. These studies indicate that Sall1-dependent signals from the metanephric mesenchyme are required to modulate ureteric bud tip Wnt patterning in order to initiate branching.
Novel numerical and graphical representation of DNA sequences and proteins.
Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D
2006-12-01
We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.
The Barley Magnesium Chelatase 150-kD Subunit Is Not an Abscisic Acid Receptor1[OA
Müller, André H.; Hansson, Mats
2009-01-01
Magnesium chelatase is the first unique enzyme of the chlorophyll biosynthetic pathway. It is composed of three gene products of which the largest is 150 kD. This protein was recently identified as an abscisic acid receptor in Arabidopsis (Arabidopsis thaliana). We have evaluated whether the barley (Hordeum vulgare) magnesium chelatase large subunit, XanF, could be a receptor for the phytohormone. The study involved analysis of recombinant magnesium chelatase protein as well as several induced chlorophyll-deficient magnesium chelatase mutants with defects identified at the gene and protein levels. Abscisic acid had no effect on magnesium chelatase activity and binding to the barley 150-kD protein could not be shown. Magnesium chelatase mutants showed a wild-type response in respect to postgermination growth and stomatal aperture. Our results question the function of the large magnesium chelatase subunit as an abscisic acid receptor. PMID:19176716
Evans, Jessica J; Gygli, Patrick E; McCaskill, Julienne; DeVeaux, Linda C
2018-04-20
The haloarchaea are unusual in possessing genes for multiple homologs to the ubiquitous single-stranded DNA binding protein (SSB or replication protein A, RPA) found in all three domains of life. Halobacterium salinarum contains five homologs: two are eukaryotic in organization, two are prokaryotic and are encoded on the minichromosomes, and one is uniquely euryarchaeal. Radiation-resistant mutants previously isolated show upregulation of one of the eukaryotic-type RPA genes. Here, we have created deletions in the five RPA operons. These deletion mutants were exposed to DNA-damaging conditions: ionizing radiation, UV radiation, and mitomycin C. Deletion of the euryarchaeal homolog, although not lethal as in Haloferax volcanii , causes severe sensitivity to all of these agents. Deletion of the other RPA/SSB homologs imparts a variable sensitivity to these DNA-damaging agents, suggesting that the different RPA homologs have specialized roles depending on the type of genomic insult encountered.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ueno, Kazuma; Saito, Mayu; Nagashima, Makiko
Highlights: •A targeted genome screen identified 5 gene groups affecting Wsc1p recycling. •V-ATPase-dependent luminal acidification is required for Wsc1p recycling. •Activity of V-ATPase might be required for cargo recognition by the retromer complex. -- Abstract: Wsc1p is a major cell wall sensor protein localized at the polarized cell surface. The localization of Wsc1p is maintained by endocytosis and recycling from endosomes back to the cell surface, but changes to the vacuole when cells are subjected to heat stress. Exploiting this unique property of Wsc1p, we screened for yeast single-gene deletion mutants exhibiting defects in Wsc1p trafficking. By expressing 3GFP-tagged Wsc1pmore » in mutants with deleted genes whose function is related to intracellular trafficking, we identified 5 gene groups affecting Wsc1p trafficking, impaired respectively in endocytic internalization, multivesicular body sorting, the GARP complex, endosomal maturation/vacuolar fusion, and V-ATPase. Interestingly, deletion of the VPH1 gene, encoding the V{sub o} subunit of vacuolar-type H{sup +}-ATPase (V-ATPase), led to mis-localization of Wsc1p from the plasma membrane to the vacuole. In addition, disruption of other V-ATPase subunits (vma mutants) also caused defects of Wsc1p trafficking and vacuolar acidification similar to those seen in the vph1Δ mutant. Moreover, we found that deletion of the VPS26 gene, encoding a subunit of the retromer complex, also caused a defect in Wsc1p recycling and mis-localization of Wsc1p to the vacuole. These findings clarified the previously unidentified Wsc1p recycling pathway and requirement of V-ATPase-dependent luminal acidification for Wsc1p recycling.« less
Simon, Marissa; Bruex, Angela; Kainkaryam, Raghunandan M.; Zheng, Xiaohua; Huang, Ling; Woolf, Peter J.; Schiefelbein, John
2013-01-01
Traditional genetic analysis relies on mutants with observable phenotypes. Mutants lacking visible abnormalities may nevertheless exhibit molecular differences useful for defining gene function. To examine this, we analyzed tissue-specific transcript profiles from Arabidopsis thaliana transcription factor gene mutants with known roles in root epidermis development, but lacking a single-gene mutant phenotype due to genetic redundancy. We discovered substantial transcriptional changes in each mutant, preferentially affecting root epidermal genes in a manner consistent with the known double mutant effects. Furthermore, comparing transcript profiles of single and double mutants, we observed remarkable variation in the sensitivity of target genes to the loss of one or both paralogous genes, including preferential effects on specific branches of the epidermal gene network, likely reflecting the pathways of paralog subfunctionalization during evolution. In addition, we analyzed the root epidermal transcriptome of the transparent testa glabra2 mutant to clarify its role in the network. These findings provide insight into the molecular basis of genetic redundancy and duplicate gene diversification at the level of a specific gene regulatory network, and they demonstrate the usefulness of tissue-specific transcript profiling to define gene function in mutants lacking informative visible changes in phenotype. PMID:24014549
Cleyrat, Cédric; Girard, Romain; Choi, Eun H; Jeziorski, Éric; Lavabre-Bertrand, Thierry; Hermouet, Sylvie; Carillo, Serge; Wilson, Bridget S
2017-09-26
Thrombopoietin (Tpo) and its receptor (Mpl) are the principal regulators of early and late thrombopoiesis and hematopoietic stem cell maintenance. Mutations in MPL can drastically impair its function and be a contributing factor in multiple hematologic malignancies, including congenital amegakaryocytic thrombocytopenia (CAMT). CAMT is characterized by severe thrombocytopenia at birth, which progresses to bone marrow failure and pancytopenia. Here we report unique familial cases of CAMT that presented with a previously unreported MPL mutation: T814C (W272R) in the background of the activating MPL G117T (K39N or Baltimore) mutation. Confocal microscopy, proliferation and surface biotinylation assays, co-immunoprecipitation, and western blotting analysis were used to elucidate the function and trafficking of Mpl mutants. Results showed that Mpl protein bearing the W272R mutation, alone or together with the K39N mutation, lacks detectable surface expression while being strongly colocalized with the endoplasmic reticulum (ER) marker calreticulin. Both WT and K39N-mutated Mpl were found to be signaling competent, but single or double mutants bearing W272R were unresponsive to Tpo. Function of the deficient Mpl receptor could be rescued by using 2 separate approaches: (1) GRASP55 overexpression, which partially restored Tpo-induced signaling of mutant Mpl by activating an autophagy-dependent secretory pathway and thus forcing ER-trapped immature receptors to traffic to the cell surface; and (2) CRISPR-Cas9 gene editing used to repair MPL T814C mutation in transfected cell lines and primary umbilical cord blood-derived CD34 + cells. We demonstrate proof of principle for rescue of mutant Mpl function by using gene editing of primary hematopoietic stem cells, which indicates direct therapeutic applications for CAMT patients.
Girard, Romain; Choi, Eun H.; Jeziorski, Éric; Lavabre-Bertrand, Thierry; Hermouet, Sylvie; Carillo, Serge; Wilson, Bridget S.
2017-01-01
Thrombopoietin (Tpo) and its receptor (Mpl) are the principal regulators of early and late thrombopoiesis and hematopoietic stem cell maintenance. Mutations in MPL can drastically impair its function and be a contributing factor in multiple hematologic malignancies, including congenital amegakaryocytic thrombocytopenia (CAMT). CAMT is characterized by severe thrombocytopenia at birth, which progresses to bone marrow failure and pancytopenia. Here we report unique familial cases of CAMT that presented with a previously unreported MPL mutation: T814C (W272R) in the background of the activating MPL G117T (K39N or Baltimore) mutation. Confocal microscopy, proliferation and surface biotinylation assays, co-immunoprecipitation, and western blotting analysis were used to elucidate the function and trafficking of Mpl mutants. Results showed that Mpl protein bearing the W272R mutation, alone or together with the K39N mutation, lacks detectable surface expression while being strongly colocalized with the endoplasmic reticulum (ER) marker calreticulin. Both WT and K39N-mutated Mpl were found to be signaling competent, but single or double mutants bearing W272R were unresponsive to Tpo. Function of the deficient Mpl receptor could be rescued by using 2 separate approaches: (1) GRASP55 overexpression, which partially restored Tpo-induced signaling of mutant Mpl by activating an autophagy-dependent secretory pathway and thus forcing ER-trapped immature receptors to traffic to the cell surface; and (2) CRISPR-Cas9 gene editing used to repair MPL T814C mutation in transfected cell lines and primary umbilical cord blood–derived CD34+ cells. We demonstrate proof of principle for rescue of mutant Mpl function by using gene editing of primary hematopoietic stem cells, which indicates direct therapeutic applications for CAMT patients. PMID:29296828
Allele-Specific Chromatin Recruitment and Therapeutic Vulnerabilities of ESR1 Activating Mutations.
Jeselsohn, Rinath; Bergholz, Johann S; Pun, Matthew; Cornwell, MacIntosh; Liu, Weihan; Nardone, Agostina; Xiao, Tengfei; Li, Wei; Qiu, Xintao; Buchwalter, Gilles; Feiglin, Ariel; Abell-Hart, Kayley; Fei, Teng; Rao, Prakash; Long, Henry; Kwiatkowski, Nicholas; Zhang, Tinghu; Gray, Nathanael; Melchers, Diane; Houtman, Rene; Liu, X Shirley; Cohen, Ofir; Wagle, Nikhil; Winer, Eric P; Zhao, Jean; Brown, Myles
2018-02-12
Estrogen receptor α (ER) ligand-binding domain (LBD) mutations are found in a substantial number of endocrine treatment-resistant metastatic ER-positive (ER + ) breast cancers. We investigated the chromatin recruitment, transcriptional network, and genetic vulnerabilities in breast cancer models harboring the clinically relevant ER mutations. These mutants exhibit both ligand-independent functions that mimic estradiol-bound wild-type ER as well as allele-specific neomorphic properties that promote a pro-metastatic phenotype. Analysis of the genome-wide ER binding sites identified mutant ER unique recruitment mediating the allele-specific transcriptional program. Genetic screens identified genes that are essential for the ligand-independent growth driven by the mutants. These studies provide insights into the mechanism of endocrine therapy resistance engendered by ER mutations and potential therapeutic targets. Copyright © 2018 Elsevier Inc. All rights reserved.
Allelic variation of soybean flower color gene W4 encoding dihydroflavonol 4-reductase 2.
Yan, Fan; Di, Shaokang; Rojas Rodas, Felipe; Rodriguez Torrico, Tito; Murai, Yoshinori; Iwashina, Tsukasa; Anai, Toyoaki; Takahashi, Ryoji
2014-03-06
Flower color of soybean is primarily controlled by six genes, viz., W1, W2, W3, W4, Wm and Wp. This study was conducted to investigate the genetic and chemical basis of newly-identified flower color variants including two soybean mutant lines, 222-A-3 (near white flower) and E30-D-1 (light purple flower), a near-isogenic line (Clark-w4), flower color variants (T321 and T369) descended from the w4-mutable line and kw4 (near white flower, Glycine soja). Complementation tests revealed that the flower color of 222-A-3 and kw4 was controlled by the recessive allele (w4) of the W4 locus encoding dihydroflavonol 4-reductase 2 (DFR2). In 222-A-3, a single base was deleted in the first exon resulting in a truncated polypeptide consisting of 24 amino acids. In Clark-w4, base substitution of the first nucleotide of the fourth intron abolished the 5' splice site, resulting in the retention of the intron. The DFR2 gene of kw4 was not expressed. The above results suggest that complete loss-of-function of DFR2 gene leads to near white flowers. Light purple flower of E30-D-1 was controlled by a new allele at the W4 locus, w4-lp. The gene symbol was approved by the Soybean Genetics Committee. In E30-D-1, a single-base substitution changed an amino acid at position 39 from arginine to histidine. Pale flowers of T369 had higher expression levels of the DFR2 gene. These flower petals contained unique dihydroflavonols that have not yet been reported to occur in soybean and G. soja. Complete loss-of-function of DFR2 gene leads to near white flowers. A new allele of the W4 locus, w4-lp regulates light purple flowers. Single amino acid substitution was associated with light purple flowers. Flower petals of T369 had higher levels of DFR2 gene expression and contained unique dihydroflavonols that are absent in soybean and G. soja. Thus, mutants of the DFR2 gene have unique flavonoid compositions and display a wide variety of flower color patterns in soybean, from near white, light purple, dilute purple to pale.
Matsuo, Miki; Cui, Longzhu; Kim, Jeeyoung; Hiramatsu, Keiichi
2013-12-01
Heterogeneous vancomycin-intermediate Staphylococcus aureus (hVISA) spontaneously produces VISA cells within its cell population at a frequency of 10(-6) or greater. We established a total of 45 VISA mutant strains independently obtained from hVISA Mu3 and its related strains by one-step vancomycin selection. We then performed high-throughput whole-genome sequencing of the 45 strains and their parent strains to identify the genes involved in the hVISA-to-VISA phenotypic conversion. A comparative genome study showed that all the VISA strains tested carried a unique set of mutations. All of the 45 VISA strains carried 1 to 4 mutations possibly affecting the expression of a total of 48 genes. Among them, 32 VISA strains carried only one gene affected by a single mutation. As many as 20 genes in more than eight functional categories were affected in the 32 VISA strains, which explained the extremely high rates of the hVISA-to-VISA phenotypic conversion. Five genes, rpoB, rpoC, walK, pbp4, and pp2c, were previously reported as being involved in vancomycin resistance. Fifteen remaining genes were newly identified as associated with vancomycin resistance in this study. The gene most frequently affected (6 out of 32 strains) was cmk, which encodes cytidylate kinase, followed closely by rpoB (5 out of 32), encoding the β subunit of RNA polymerase. A mutation prevalence study also revealed a sizable number of cmk mutants among clinical VISA strains (7 out of 38 [18%]). Reduced cytidylate kinase activity in cmk mutant strains is proposed to contribute to the hVISA-to-VISA phenotype conversion by thickening the cell wall and reducing the cell growth rate.
Pedersen, Niels C; Liu, Hongwei; Dodd, Kimberly A; Pesavento, Patricia A
2009-09-01
The internal FECV→FIPV mutation theory and three of its correlates were tested in four sibs/half-sib kittens, a healthy contact cat, and in four unrelated cats that died of FIP at geographically disparate regions. Coronavirus from feces and extraintestinal FIP lesions from the same cat were always >99% related in accessory and structural gene sequences. SNPs and deletions causing a truncation of the 3c gene product were found in almost all isolates from the diseased tissues of the eight cats suffering from FIP, whereas most, but not all fecal isolates from these same cats had intact 3c genes. Other accessory and structural genes appeared normal in both fecal and lesional viruses. Deliterious mutations in the 3c gene were unique to each cat, indicating that they did not originate in one cat and were subsequently passed horizontally to the others. Compartmentalization of the parental and mutant forms was not absolute; virus of lesional type was sometimes found in feces of affected cats and virus identical to fecal type was occasionally identified in diseased tissues. Although 3c gene mutants in this study were not horizontally transmitted, the parental fecal virus was readily transmitted by contact from a cat that died of FIP to its housemate. There was a high rate of mutability in all structural and accessory genes both within and between cats, leading to minor genetic variants. More than one variant could be identified in both diseased tissues and feces of the same cat. Laboratory cats inoculated with a mixture of two closely related variants from the same FIP cat developed disease from one or the other variant, but not both. Significant genetic drift existed between isolates from geographically distinct regions of the Western US.
Pedersen, Niels C.; Liu, Hongwei; Dodd, Kimberly A.; Pesavento, Patricia A.
2009-01-01
The internal FECV→FIPV mutation theory and three of its correlates were tested in four sibs/half-sib kittens, a healthy contact cat, and in four unrelated cats that died of FIP at geographically disparate regions. Coronavirus from feces and extraintestinal FIP lesions from the same cat were always >99% related in accessory and structural gene sequences. SNPs and deletions causing a truncation of the 3c gene product were found in almost all isolates from the diseased tissues of the eight cats suffering from FIP, whereas most, but not all fecal isolates from these same cats had intact 3c genes. Other accessory and structural genes appeared normal in both fecal and lesional viruses. Deliterious mutations in the 3c gene were unique to each cat, indicating that they did not originate in one cat and were subsequently passed horizontally to the others. Compartmentalization of the parental and mutant forms was not absolute; virus of lesional type was sometimes found in feces of affected cats and virus identical to fecal type was occasionally identified in diseased tissues. Although 3c gene mutants in this study were not horizontally transmitted, the parental fecal virus was readily transmitted by contact from a cat that died of FIP to its housemate. There was a high rate of mutability in all structural and accessory genes both within and between cats, leading to minor genetic variants. More than one variant could be identified in both diseased tissues and feces of the same cat. Laboratory cats inoculated with a mixture of two closely related variants from the same FIP cat developed disease from one or the other variant, but not both. Significant genetic drift existed between isolates from geographically distinct regions of the Western US. PMID:21994544
Rose, Sasha J; Bermudez, Luiz E
2016-12-06
Extracellular DNA (eDNA) is an integral biofilm matrix component of numerous pathogens, including nontuberculous mycobacteria (NTM). Cell lysis is the source of eDNA in certain bacteria, but the source of eDNA remains unidentified for NTM, as well as for other eDNA-containing bacterial species. In this study, conditions affecting eDNA export were examined, and genes involved with the eDNA export mechanism were identified. After a method for monitoring eDNA in real time in undisturbed biofilms was established, different conditions affecting eDNA were investigated. Bicarbonate positively influenced eDNA export in a pH-independent manner in Mycobacterium avium, M. abscessus, and M. chelonae The surface-exposed proteome of M. avium in eDNA-containing biofilms revealed abundant carbonic anhydrases. Chemical inhibition of carbonic anhydrases with ethoxzolamide significantly reduced eDNA export. An unbiased transposon mutant library screen for eDNA export in M. avium identified many severely eDNA-attenuated mutants, including one not expressing a unique FtsK/SpoIIIE-like DNA-transporting pore, two with inactivation of carbonic anhydrases, and nine with inactivation of genes belonging to a unique genomic region, as well as numerous mutants involved in metabolism and energy production. Complementation of nine mutants that included the FtsK/SpoIIIE and carbonic anhydrase significantly restored eDNA export. Interestingly, several attenuated eDNA mutants have mutations in genes encoding proteins that were found with the surface proteomics, and many more mutations are localized in operons potentially encoding surface proteins. Collectively, our data strengthen the evidence of eDNA export being an active mechanism that is activated by the bacterium responding to bicarbonate. Many bacteria contain extracellular DNA (eDNA) in their biofilm matrix, as it has various biological and physical functions. We recently reported that nontuberculous mycobacteria (NTM) can contain significant quantities of eDNA in their biofilms. In some bacteria, eDNA is derived from dead cells, but that does not appear to be the case for all eDNA-containing organisms, including NTM. In this study, we found that eDNA export in NTM is conditionally dependent on the molecules to which the bacteria are exposed and that bicarbonate positively influences eDNA export. We also identified genes and proteins important for eDNA export, which begins to piece together a description of a mechanism for eDNA. Better understanding of eDNA export can give new targets for the development of antivirulence drugs, which are attractive because resistance to classical antibiotics is currently a significant problem. Copyright © 2016 Rose and Bermudez.
Sanchez, Belkys C.; Chang, Chungyu; Wu, Chenggang; Tran, Bryan
2017-01-01
ABSTRACT The Gram-positive actinobacteria Actinomyces spp. are key colonizers in the development of oral biofilms due to the inherent ability of Actinomyces to adhere to receptor polysaccharides on the surface of oral streptococci and host cells. This receptor-dependent bacterial interaction, or coaggregation, requires a unique sortase-catalyzed pilus consisting of the pilus shaft FimA and the coaggregation factor CafA forming the pilus tip. While the essential role of the sortase machine SrtC2 in pilus assembly, biofilm formation, and coaggregation has been established, little is known about trans-acting factors contributing to these processes. We report here a large-scale Tn5 transposon screen for mutants defective in Actinomyces oris coaggregation with Streptococcus oralis. We obtained 33 independent clones, 13 of which completely failed to aggregate with S. oralis, and the remainder of which exhibited a range of phenotypes from severely to weakly defective coaggregation. The former had Tn5 insertions in fimA, cafA, or srtC2, as expected; the latter were mapped to genes coding for uncharacterized proteins and various nuo genes encoding the NADH dehydrogenase subunits. Electron microscopy and biochemical analyses of mutants with nonpolar deletions of nuo genes and ubiE, a menaquinone C-methyltransferase-encoding gene downstream of the nuo locus, confirmed the pilus and coaggregation defects. Both nuoA and ubiE mutants were defective in oxidation of MdbA, the major oxidoreductase required for oxidative folding of pilus proteins. Furthermore, supplementation of the ubiE mutant with exogenous menaquinone-4 rescued the cell growth and pilus defects. Altogether, we propose that the A. oris electron transport chain is biochemically linked to pilus assembly via oxidative protein folding. PMID:28634238
Vassilara, Foula; Galani, Irene; Souli, Maria; Papanikolaou, Konstantinos; Giamarellou, Helen; Papadopoulos, Antonios
2017-07-01
The aim of this study was to determine the propensities of imipenem to select for resistant Pseudomonas aeruginosa mutants by determining the mutant prevention concentrations (MPCs) for 9 unrelated clinical isolates and the accession of any relationship with mechanisms of resistance development. The MPC/MIC ratios ranged from 4 to 16. Detection of resistance mechanisms in the mutant derivatives of the nine isolates mainly revealed inactivating mutations in the gene coding for outer membrane protein OprD. Point mutations leading to premature stop codons or amino acid substitution S278P, ≥1bp deletion leading to frameshift mutations and interruption of the oprD by an insertion sequence, were observed. MPC and mutant selection window (MSW) are unique parameters that may guide the implementation of antimicrobial treatment, providing useful information about the necessary imipenem concentration needed in the infection area, in order to avoid the emergence of resistance, especially in clinical situations with high bacterial load. Copyright © 2017 Elsevier Inc. All rights reserved.
Surface gene variants of hepatitis B Virus in Saudi Patients.
Al-Qudari, Ahmed Y; Amer, Haitham M; Abdo, Ayman A; Hussain, Zahid; Al-Hamoudi, Waleed; Alswat, Khalid; Almajhdi, Fahad N
2016-01-01
Hepatitis B virus (HBV) continues to be one of the most important viral pathogens in humans. Surface (S) protein is the major HBV antigen that mediates virus attachment and entry and determines the virus subtype. Mutations in S gene, particularly in the "a" determinant, can influence virus detection by ELISA and may generate escape mutants. Since no records have documented the S gene mutations in HBV strains circulating in Saudi Arabia, the current study was designed to study sequence variation of S gene in strains circulating in Saudi Arabia and its correlation with clinical and risk factors. A total of 123 HBV-infected patients were recruited for this study. Clinical and biochemical parameters, serological markers, and viral load were determined in all patients. The entire S gene sequence of samples with viral load exceeding 2000 IU/mL was retrieved and exploited in sequence and phylogenetic analysis. A total of 48 mutations (21 unique) were recorded in viral strains in Saudi Arabia, among which 24 (11 unique) changed their respective amino acids. Two amino acid changes were recorded in "a" determinant, including F130L and S135F with no evidence of the vaccine escape mutant G145R in any of the samples. No specific relationship was recognized between the mutation/amino acid change record of HBsAg in strains in Saudi Arabia and clinical or laboratory data. Phylogenetic analysis categorized HBV viral strains in Saudi Arabia as members of subgenotypes D1 and D3. The present report is the first that describes mutation analysis of HBsAg in strains in Saudi Arabia on both nucleotide and amino acid levels. Different substitutions, particularly in major hydrophilic region, may have a potential influence on disease diagnosis, vaccination strategy, and antiviral chemotherapy.
Genome-wide mutant profiling predicts the mechanism of a Lipid II binding antibiotic.
Santiago, Marina; Lee, Wonsik; Fayad, Antoine Abou; Coe, Kathryn A; Rajagopal, Mithila; Do, Truc; Hennessen, Fabienne; Srisuknimit, Veerasak; Müller, Rolf; Meredith, Timothy C; Walker, Suzanne
2018-06-01
Identifying targets of antibacterial compounds remains a challenging step in the development of antibiotics. We have developed a two-pronged functional genomics approach to predict mechanism of action that uses mutant fitness data from antibiotic-treated transposon libraries containing both upregulation and inactivation mutants. We treated a Staphylococcus aureus transposon library containing 690,000 unique insertions with 32 antibiotics. Upregulation signatures identified from directional biases in insertions revealed known molecular targets and resistance mechanisms for the majority of these. Because single-gene upregulation does not always confer resistance, we used a complementary machine-learning approach to predict the mechanism from inactivation mutant fitness profiles. This approach suggested the cell wall precursor Lipid II as the molecular target of the lysocins, a mechanism we have confirmed. We conclude that docking to membrane-anchored Lipid II precedes the selective bacteriolysis that distinguishes these lytic natural products, showing the utility of our approach for nominating the antibiotic mechanism of action.
Two apparent glucose-6-phosphate dehydrogenase variants in normal XY males: G6PD Alabama.
Prchal, J T; Hall, K; Csepreghy, M; Lilly, M; Berkow, R; Scott, C W
1988-03-01
A six-year-old black boy who had transient hemolysis after a viral infection was found to have mildly decreased red cell glucose-6-phosphate dehydrogenase (G6PD) activity (1.25 IU/g hemoglobin). Two G6PD bands, both slightly faster than normal G6PD B, were seen on electrophoresis in both the propositus as well as in his maternal grandfather. This is an unexpected finding, since the G6PD gene is located on the long arm of the X chromosome that is subject to X-chromosome inactivation, and available evidence indicates that it is present as a single functional copy in the human genome. The obvious possibility of duplication of the X chromosome was eliminated by cytogenetic analysis with G-banding. G6PD duplication is unlikely, since peripheral blood granulocytes, platelets, and lymphocytes; cultured skin and bone marrow fibroblasts; and Epstein-Barr virus-stimulated lymphocytes yielded only a single electrophoretic band with mobility identical to the slower band seen in crude red blood cell hemolysate. Study of partially purified red blood cell hemolysate G6PD also yielded a single band with identical mobility. Kinetic studies of the enzyme in the propositus and in three generations of his family identified a unique, previously unpublished G6PD mutant that is herein designated G6PD Alabama. Red blood cells were separated by density gradient into a reticulocyte-enriched, an intermediate, and a dense, older portion. Two distinct enzyme bands were identified on electrophoresis of hemolysate from the reticulocyte-enriched portion, but not from the other two portions. It is postulated that two transcriptional products of the mutant G6PD gene exist; one with a short half-life and detectable only in young red blood cells, and another with a longer half-life present in all cells. The existence of two distinct mutant genes in the genome or a unique post-translational form of the mutant G6PD detected only in reticulocytes cannot be excluded.
Response of Desulfovibrio vulgaris to Alkaline Stress▿ †
Stolyar, Sergey; He, Qiang; Joachimiak, Marcin P.; He, Zhili; Yang, Zamin Koo; Borglin, Sharon E.; Joyner, Dominique C.; Huang, Katherine; Alm, Eric; Hazen, Terry C.; Zhou, Jizhong; Wall, Judy D.; Arkin, Adam P.; Stahl, David A.
2007-01-01
The response of exponentially growing Desulfovibrio vulgaris Hildenborough to pH 10 stress was studied using oligonucleotide microarrays and a study set of mutants with genes suggested by microarray data to be involved in the alkaline stress response deleted. The data showed that the response of D. vulgaris to increased pH is generally similar to that of Escherichia coli but is apparently controlled by unique regulatory circuits since the alternative sigma factors (sigma S and sigma E) contributing to this stress response in E. coli appear to be absent in D. vulgaris. Genes previously reported to be up-regulated in E. coli were up-regulated in D. vulgaris; these genes included three ATPase genes and a tryptophan synthase gene. Transcription of chaperone and protease genes (encoding ATP-dependent Clp and La proteases and DnaK) was also elevated in D. vulgaris. As in E. coli, genes involved in flagellum synthesis were down-regulated. The transcriptional data also identified regulators, distinct from sigma S and sigma E, that are likely part of a D. vulgaris Hildenborough-specific stress response system. Characterization of a study set of mutants with genes implicated in alkaline stress response deleted confirmed that there was protective involvement of the sodium/proton antiporter NhaC-2, tryptophanase A, and two putative regulators/histidine kinases (DVU0331 and DVU2580). PMID:17921288
Iida, Aya; Ohnishi, Yasuo; Horinouchi, Sueharu
2008-01-01
Via N-acylhomoserine lactones, the GinI/GinR quorum-sensing system in Gluconacetobacter intermedius NCI1051, a gram-negative acetic acid bacterium, represses acetic acid and gluconic acid fermentation. Two-dimensional polyacrylamide gel electrophoretic analysis of protein profiles of strain NCI1051 and ginI and ginR mutants identified a protein that was produced in response to the GinI/GinR regulatory system. Cloning and nucleotide sequencing of the gene encoding this protein revealed that it encoded an OmpA family protein, named GmpA. gmpA was a member of the gene cluster containing three adjacent homologous genes, gmpA to gmpC, the organization of which appeared to be unique to vinegar producers, including “Gluconacetobacter polyoxogenes.” In addition, GmpA was unique among the OmpA family proteins in that its N-terminal membrane domain forming eight antiparallel transmembrane β-strands contained an extra sequence in one of the surface-exposed loops. Transcriptional analysis showed that only gmpA of the three adjacent gmp genes was activated by the GinI/GinR quorum-sensing system. However, gmpA was not controlled directly by GinR but was controlled by an 89-amino-acid protein, GinA, a target of this quorum-sensing system. A gmpA mutant grew more rapidly in the presence of 2% (vol/vol) ethanol and accumulated acetic acid and gluconic acid in greater final yields than strain NCI1051. Thus, GmpA plays a role in repressing oxidative fermentation, including acetic acid fermentation, which is unique to acetic acid bacteria and allows ATP synthesis via ethanol oxidation. Consistent with the involvement of gmpA in oxidative fermentation, its transcription was also enhanced by ethanol and acetic acid. PMID:18487322
Bambach, Adrienne; Fernandes, Mariana P.; Ghosh, Anup; Kruppa, Michael; Alex, Deepu; Li, Dongmei; Fonzi, William A.; Chauhan, Neeraj; Sun, Nuo; Agrellos, Orlando A.; Vercesi, Anibal E.; Rolfes, Ronda J.; Calderone, Richard
2009-01-01
Using a Tn7 transposon library of Candida albicans, we have identified a mutant that exhibited sensitivity in drop plate assays to oxidants such as menadione and hydrogen peroxide. To verify the role of the mutated gene in stress adaptation, null mutants were constructed and phenotypically characterized. Because of its apparent functions in growth and oxidant adaptation, we have named the gene GOA1. Goa1p appears to be unique to the CTG subclade of the Saccharomycotina, including C. albicans. Mutants of C. albicans lacking goa1 (strain GOA31) were more sensitive to 6 mM H2O2 and 0.125 mM menadione than the wild type (wt) or a gene-reconstituted (GOA32) strain. The sensitivity to oxidants correlated with reduced survival of the GOA31 mutant in human neutrophils and avirulence compared to control strains. Other phenotypes of GOA31 include reduced growth and filamentation in 10% serum, Spider, and SLAD agar media and an inability to form chlamydospores. Since Goa1p has an N-terminal mitochondrion localization site, we also show that green fluorescent protein-tagged Goa1p shows a mitochondrionlike distribution during oxidant or osmotic stress. Further, the inability of GOA31 to grow in medium containing lactate, ethanol, or glycerol as the sole carbon source indicates that the mitochondria are defective in the mutant. To determine how Goa1p contributes to mitochondrial function, we compared the wt, GOA32, and GOA31 strains for mitochondrial electrical membrane potential, respiration, and oxidative phosphorylation. We now show that GOA31, but not the wt or GOA32, had decreased respiration and mitochondrial membrane potential such that mutant cells are unable to drive oxidative phosphorylation. This is the first report in C. albicans of a respiratory defect caused by a loss of mitochondrial membrane potential. PMID:19717740
High-throughput discovery of novel developmental phenotypes.
Dickinson, Mary E; Flenniken, Ann M; Ji, Xiao; Teboul, Lydia; Wong, Michael D; White, Jacqueline K; Meehan, Terrence F; Weninger, Wolfgang J; Westerberg, Henrik; Adissu, Hibret; Baker, Candice N; Bower, Lynette; Brown, James M; Caddle, L Brianna; Chiani, Francesco; Clary, Dave; Cleak, James; Daly, Mark J; Denegre, James M; Doe, Brendan; Dolan, Mary E; Edie, Sarah M; Fuchs, Helmut; Gailus-Durner, Valerie; Galli, Antonella; Gambadoro, Alessia; Gallegos, Juan; Guo, Shiying; Horner, Neil R; Hsu, Chih-Wei; Johnson, Sara J; Kalaga, Sowmya; Keith, Lance C; Lanoue, Louise; Lawson, Thomas N; Lek, Monkol; Mark, Manuel; Marschall, Susan; Mason, Jeremy; McElwee, Melissa L; Newbigging, Susan; Nutter, Lauryl M J; Peterson, Kevin A; Ramirez-Solis, Ramiro; Rowland, Douglas J; Ryder, Edward; Samocha, Kaitlin E; Seavitt, John R; Selloum, Mohammed; Szoke-Kovacs, Zsombor; Tamura, Masaru; Trainor, Amanda G; Tudose, Ilinca; Wakana, Shigeharu; Warren, Jonathan; Wendling, Olivia; West, David B; Wong, Leeyean; Yoshiki, Atsushi; MacArthur, Daniel G; Tocchini-Valentini, Glauco P; Gao, Xiang; Flicek, Paul; Bradley, Allan; Skarnes, William C; Justice, Monica J; Parkinson, Helen E; Moore, Mark; Wells, Sara; Braun, Robert E; Svenson, Karen L; de Angelis, Martin Hrabe; Herault, Yann; Mohun, Tim; Mallon, Ann-Marie; Henkelman, R Mark; Brown, Steve D M; Adams, David J; Lloyd, K C Kent; McKerlie, Colin; Beaudet, Arthur L; Bućan, Maja; Murray, Stephen A
2016-09-22
Approximately one-third of all mammalian genes are essential for life. Phenotypes resulting from knockouts of these genes in mice have provided tremendous insight into gene function and congenital disorders. As part of the International Mouse Phenotyping Consortium effort to generate and phenotypically characterize 5,000 knockout mouse lines, here we identify 410 lethal genes during the production of the first 1,751 unique gene knockouts. Using a standardized phenotyping platform that incorporates high-resolution 3D imaging, we identify phenotypes at multiple time points for previously uncharacterized genes and additional phenotypes for genes with previously reported mutant phenotypes. Unexpectedly, our analysis reveals that incomplete penetrance and variable expressivity are common even on a defined genetic background. In addition, we show that human disease genes are enriched for essential genes, thus providing a dataset that facilitates the prioritization and validation of mutations identified in clinical sequencing efforts.
High-throughput discovery of novel developmental phenotypes
Dickinson, Mary E.; Flenniken, Ann M.; Ji, Xiao; Teboul, Lydia; Wong, Michael D.; White, Jacqueline K.; Meehan, Terrence F.; Weninger, Wolfgang J.; Westerberg, Henrik; Adissu, Hibret; Baker, Candice N.; Bower, Lynette; Brown, James M.; Caddle, L. Brianna; Chiani, Francesco; Clary, Dave; Cleak, James; Daly, Mark J.; Denegre, James M.; Doe, Brendan; Dolan, Mary E.; Edie, Sarah M.; Fuchs, Helmut; Gailus-Durner, Valerie; Galli, Antonella; Gambadoro, Alessia; Gallegos, Juan; Guo, Shiying; Horner, Neil R.; Hsu, Chih-wei; Johnson, Sara J.; Kalaga, Sowmya; Keith, Lance C.; Lanoue, Louise; Lawson, Thomas N.; Lek, Monkol; Mark, Manuel; Marschall, Susan; Mason, Jeremy; McElwee, Melissa L.; Newbigging, Susan; Nutter, Lauryl M.J.; Peterson, Kevin A.; Ramirez-Solis, Ramiro; Rowland, Douglas J.; Ryder, Edward; Samocha, Kaitlin E.; Seavitt, John R.; Selloum, Mohammed; Szoke-Kovacs, Zsombor; Tamura, Masaru; Trainor, Amanda G; Tudose, Ilinca; Wakana, Shigeharu; Warren, Jonathan; Wendling, Olivia; West, David B.; Wong, Leeyean; Yoshiki, Atsushi; MacArthur, Daniel G.; Tocchini-Valentini, Glauco P.; Gao, Xiang; Flicek, Paul; Bradley, Allan; Skarnes, William C.; Justice, Monica J.; Parkinson, Helen E.; Moore, Mark; Wells, Sara; Braun, Robert E.; Svenson, Karen L.; de Angelis, Martin Hrabe; Herault, Yann; Mohun, Tim; Mallon, Ann-Marie; Henkelman, R. Mark; Brown, Steve D.M.; Adams, David J.; Lloyd, K.C. Kent; McKerlie, Colin; Beaudet, Arthur L.; Bucan, Maja; Murray, Stephen A.
2016-01-01
Approximately one third of all mammalian genes are essential for life. Phenotypes resulting from mouse knockouts of these genes have provided tremendous insight into gene function and congenital disorders. As part of the International Mouse Phenotyping Consortium effort to generate and phenotypically characterize 5000 knockout mouse lines, we have identified 410 lethal genes during the production of the first 1751 unique gene knockouts. Using a standardised phenotyping platform that incorporates high-resolution 3D imaging, we identified novel phenotypes at multiple time points for previously uncharacterized genes and additional phenotypes for genes with previously reported mutant phenotypes. Unexpectedly, our analysis reveals that incomplete penetrance and variable expressivity are common even on a defined genetic background. In addition, we show that human disease genes are enriched for essential genes identified in our screen, thus providing a novel dataset that facilitates prioritization and validation of mutations identified in clinical sequencing efforts. PMID:27626380
Yoshihara, Takeshi; Iino, Moritoshi
2007-05-01
We identified the gene responsible for three allelic lazy1 mutations of Japonica rice (Oryza sativa L.) by map-based cloning, complementation and RNA interference. Sequence analysis and database searches indicated that the wild-type gene (LAZY1) encodes a novel and unique protein (LAZY1) and that rice has no homologous gene. Two lazy1 mutants were LAZY1 null. Confirming and advancing the previously reported results on lazy1 mutants, we found the following. (i) Gravitropism is impaired, but only partially, in lazy1 coleoptiles. (ii) Circumnutation, observed in dark-grown coleoptiles, is totally absent from lazy1 coleoptiles. (iii) Primary roots of lazy1 mutants show normal gravitropism and circumnutation. (iv) LAZY1 is expressed in a tissue-specific manner in gravity-sensitive shoot tissues (i.e. coleoptiles, leaf sheath pulvini and lamina joints) and is little expressed in roots. (v) The gravitropic response of lazy1 coleoptiles is kinetically separable from that absent from lazy1 coleoptiles. (vi) Gravity-induced lateral translocation of auxin, found in wild-type coleoptiles, does not occur in lazy1 coleoptiles. Based on the genetic and physiological evidence obtained, it is concluded that LAZY1 is specifically involved in shoot gravitropism and that LAZY1-dependent and -independent signaling pathways occur in coleoptiles. It is further concluded that, in coleoptiles, only the LAZY1-dependent gravity signaling involves asymmetric distribution of auxin between the two lateral halves and is required for circumnutation.
McDowell, Stephen C; Akmakjian, Garo; Sladek, Chris; Mendoza-Cozatl, David; Morrissey, Joe B; Saini, Nick; Mittler, Ron; Baxter, Ivan; Salt, David E; Ward, John M; Schroeder, Julian I; Guerinot, Mary Lou; Harper, Jeffrey F
2013-01-01
The concentrations of mineral nutrients in seeds are critical to both the life cycle of plants as well as human nutrition. These concentrations are strongly influenced by soil conditions, as shown here by quantifying the concentration of 14 elements in seeds from Arabidopsis thaliana plants grown under four different soil conditions: standard, or modified with NaCl, heavy metals, or alkali. Each of the modified soils resulted in a unique change to the seed ionome (the mineral nutrient content of the seeds). To help identify the genetic networks regulating the seed ionome, changes in elemental concentrations were evaluated using mutants corresponding to 760 genes as well as 10 naturally occurring accessions. The frequency of ionomic phenotypes supports an estimate that as much as 11% of the A. thaliana genome encodes proteins of functional relevance to ion homeostasis in seeds. A subset of mutants were analyzed with two independent alleles, providing five examples of genes important for regulation of the seed ionome: SOS2, ABH1, CCC, At3g14280 and CNGC2. In a comparison of nine different accessions to a Col-0 reference, eight accessions were observed to have reproducible differences in elemental concentrations, seven of which were dependent on specific soil conditions. These results indicate that the A. thaliana seed ionome is distinct from the vegetative ionome, and that elemental analysis is a sensitive approach to identify genes controlling ion homeostasis, including those that regulate gene expression, phospho-regulation, and ion transport.
Minato, Yusuke; Halang, Petra; Quinn, Matthew J.; Faulkner, Wyatt J.; Aagesen, Alisha M.; Steuber, Julia; Stevens, Jan F.; Häse, Claudia C.
2014-01-01
The Na+ translocating NADH:quinone oxidoreductase (Na+-NQR) is a unique respiratory enzyme catalyzing the electron transfer from NADH to quinone coupled with the translocation of sodium ions across the membrane. Typically, Vibrio spp., including Vibrio cholerae, have this enzyme but lack the proton-pumping NADH:ubiquinone oxidoreductase (Complex I). Thus, Na+-NQR should significantly contribute to multiple aspects of V. cholerae physiology; however, no detailed characterization of this aspect has been reported so far. In this study, we broadly investigated the effects of loss of Na+-NQR on V. cholerae physiology by using Phenotype Microarray (Biolog), transcriptome and metabolomics analyses. We found that the V. cholerae ΔnqrA-F mutant showed multiple defects in metabolism detected by Phenotype Microarray. Transcriptome analysis revealed that the V. cholerae ΔnqrA-F mutant up-regulates 31 genes and down-regulates 55 genes in both early and mid-growth phases. The most up-regulated genes included the cadA and cadB genes, encoding a lysine decarboxylase and a lysine/cadaverine antiporter, respectively. Increased CadAB activity was further suggested by the metabolomics analysis. The down-regulated genes include sialic acid catabolism genes. Metabolomic analysis also suggested increased reductive pathway of TCA cycle and decreased purine metabolism in the V. cholerae ΔnqrA-F mutant. Lack of Na+-NQR did not affect any of the Na+ pumping-related phenotypes of V. cholerae suggesting that other secondary Na+ pump(s) can compensate for Na+ pumping activity of Na+-NQR. Overall, our study provides important insights into the contribution of Na+-NQR to V. cholerae physiology. PMID:24811312
Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants
Shis, David L.; Bennett, Matthew R.
2013-01-01
The construction of synthetic gene circuits relies on our ability to engineer regulatory architectures that are orthogonal to the host’s native regulatory pathways. However, as synthetic gene circuits become larger and more complicated, we are limited by the small number of parts, especially transcription factors, that work well in the context of the circuit. The current repertoire of transcription factors consists of a limited selection of activators and repressors, making the implementation of transcriptional logic a complicated and component-intensive process. To address this, we modified bacteriophage T7 RNA polymerase (T7 RNAP) to create a library of transcriptional AND gates for use in Escherichia coli by first splitting the protein and then mutating the DNA recognition domain of the C-terminal fragment to alter its promoter specificity. We first demonstrate that split T7 RNAP is active in vivo and compare it with full-length enzyme. We then create a library of mutant split T7 RNAPs that have a range of activities when used in combination with a complimentary set of altered T7-specific promoters. Finally, we assay the two-input function of both wild-type and mutant split T7 RNAPs and find that regulated expression of the N- and C-terminal fragments of the split T7 RNAPs creates AND logic in each case. This work demonstrates that mutant split T7 RNAP can be used as a transcriptional AND gate and introduces a unique library of components for use in synthetic gene circuits. PMID:23479654
Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants.
Shis, David L; Bennett, Matthew R
2013-03-26
The construction of synthetic gene circuits relies on our ability to engineer regulatory architectures that are orthogonal to the host's native regulatory pathways. However, as synthetic gene circuits become larger and more complicated, we are limited by the small number of parts, especially transcription factors, that work well in the context of the circuit. The current repertoire of transcription factors consists of a limited selection of activators and repressors, making the implementation of transcriptional logic a complicated and component-intensive process. To address this, we modified bacteriophage T7 RNA polymerase (T7 RNAP) to create a library of transcriptional AND gates for use in Escherichia coli by first splitting the protein and then mutating the DNA recognition domain of the C-terminal fragment to alter its promoter specificity. We first demonstrate that split T7 RNAP is active in vivo and compare it with full-length enzyme. We then create a library of mutant split T7 RNAPs that have a range of activities when used in combination with a complimentary set of altered T7-specific promoters. Finally, we assay the two-input function of both wild-type and mutant split T7 RNAPs and find that regulated expression of the N- and C-terminal fragments of the split T7 RNAPs creates AND logic in each case. This work demonstrates that mutant split T7 RNAP can be used as a transcriptional AND gate and introduces a unique library of components for use in synthetic gene circuits.
Voz, Marianne L.; Coppieters, Wouter; Manfroid, Isabelle; Baudhuin, Ariane; Von Berg, Virginie; Charlier, Carole; Meyer, Dirk; Driever, Wolfgang; Martial, Joseph A.; Peers, Bernard
2012-01-01
Forward genetics using zebrafish is a powerful tool for studying vertebrate development through large-scale mutagenesis. Nonetheless, the identification of the molecular lesion is still laborious and involves time-consuming genetic mapping. Here, we show that high-throughput sequencing of the whole zebrafish genome can directly locate the interval carrying the causative mutation and at the same time pinpoint the molecular lesion. The feasibility of this approach was validated by sequencing the m1045 mutant line that displays a severe hypoplasia of the exocrine pancreas. We generated 13 Gb of sequence, equivalent to an eightfold genomic coverage, from a pool of 50 mutant embryos obtained from a map-cross between the AB mutant carrier and the WIK polymorphic strain. The chromosomal region carrying the causal mutation was localized based on its unique property to display high levels of homozygosity among sequence reads as it derives exclusively from the initial AB mutated allele. We developed an algorithm identifying such a region by calculating a homozygosity score along all chromosomes. This highlighted an 8-Mb window on chromosome 5 with a score close to 1 in the m1045 mutants. The sequence analysis of all genes within this interval revealed a nonsense mutation in the snapc4 gene. Knockdown experiments confirmed the assertion that snapc4 is the gene whose mutation leads to exocrine pancreas hypoplasia. In conclusion, this study constitutes a proof-of-concept that whole-genome sequencing is a fast and effective alternative to the classical positional cloning strategies in zebrafish. PMID:22496837
Gillmor, C. Stewart; Roeder, Adrienne H. K.; Sieber, Patrick; ...
2016-01-08
Cytokinesis in plants involves the formation of unique cellular structures such as the phragmoplast and the cell plate, both of which are required to divide the cell after nuclear division. In order to isolate genes that are involved in de novo cell wall formation, we performed a large-scale, microscope-based screen for Arabidopsis mutants that severely impair cytokinesis in the embryo. We recovered 35 mutations that form abnormally enlarged cells with multiple, often polyploid nuclei and incomplete cell walls. These mutants represent seven genes, four of which have previously been implicated in phragmoplast or cell plate function. Mutations in two locimore » show strongly reduced transmission through the haploid gametophytic generation. Molecular cloning of both corresponding genes reveals that one is represented by hypomorphic alleles of the kinesin-5 gene RADIALLY SWOLLEN 7 (homologous to tobacco kinesin-related protein TKRP125), and that the other gene corresponds to the Arabidopsis FUSED ortholog TWO-IN-ONE (originally identified based on its function in pollen development). No mutations that completely abolish the formation of cross walls in diploid cells were found. Lastly, our results support the idea that cytokinesis in the diploid and haploid generations involve similar mechanisms.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gillmor, C. Stewart; Roeder, Adrienne H. K.; Sieber, Patrick
Cytokinesis in plants involves the formation of unique cellular structures such as the phragmoplast and the cell plate, both of which are required to divide the cell after nuclear division. In order to isolate genes that are involved in de novo cell wall formation, we performed a large-scale, microscope-based screen for Arabidopsis mutants that severely impair cytokinesis in the embryo. We recovered 35 mutations that form abnormally enlarged cells with multiple, often polyploid nuclei and incomplete cell walls. These mutants represent seven genes, four of which have previously been implicated in phragmoplast or cell plate function. Mutations in two locimore » show strongly reduced transmission through the haploid gametophytic generation. Molecular cloning of both corresponding genes reveals that one is represented by hypomorphic alleles of the kinesin-5 gene RADIALLY SWOLLEN 7 (homologous to tobacco kinesin-related protein TKRP125), and that the other gene corresponds to the Arabidopsis FUSED ortholog TWO-IN-ONE (originally identified based on its function in pollen development). No mutations that completely abolish the formation of cross walls in diploid cells were found. Lastly, our results support the idea that cytokinesis in the diploid and haploid generations involve similar mechanisms.« less
Le Bras, Stéphanie; Cohen-Tannoudji, Michel; Guyot, Valérie; Vandormael-Pournin, Sandrine; Coumailleau, Franck; Babinet, Charles; Baldacci, Patricia
2002-08-21
The DDK syndrome is defined as the embryonic lethality of F1 mouse embryos from crosses between DDK females and males from other strains (named hereafter as non-DDK strains). Genetically controlled by the Ovum mutant (Om) locus, it is due to a deleterious interaction between a maternal factor present in DDK oocytes and the non-DDK paternal pronucleus. Therefore, the DDK syndrome constitutes a unique genetic tool to study the crucial interactions that take place between the parental genomes and the egg cytoplasm during mammalian development. In this paper, we present an extensive analysis performed by exon trapping on the Om region. Twenty-seven trapped sequences were from genes in the databases: beta-adaptin, CCT zeta2, DNA LigaseIII, Notchless, Rad51l3 and Scya1. Twenty-eight other sequences presented similarities with expressed sequence tags and genomic sequences whereas 57 did not. The pattern of expression of 37 of these markers was established. Importantly, five of them are expressed in DDK oocytes and are candidate genes for the maternal factor, and 20 are candidate genes for the paternal factor since they are expressed in testis. This data is an important step towards identifying the genes responsible for the DDK syndrome.
Gunderson, Felizza F.; Cianciotto, Nicholas P.
2013-01-01
ABSTRACT Recent studies have shown that the clustered regularly interspaced palindromic repeats (CRISPR) array and its associated (cas) genes can play a key role in bacterial immunity against phage and plasmids. Upon analysis of the Legionella pneumophila strain 130b chromosome, we detected a subtype II-B CRISPR-Cas locus that contains cas9, cas1, cas2, cas4, and an array with 60 repeats and 58 unique spacers. Reverse transcription (RT)-PCR analysis demonstrated that the entire CRISPR-Cas locus is expressed during 130b extracellular growth in both rich and minimal media as well as during intracellular infection of macrophages and aquatic amoebae. Quantitative reverse transcription-PCR (RT-PCR) further showed that the levels of cas transcripts, especially those of cas1 and cas2, are elevated during intracellular growth relative to exponential-phase growth in broth. Mutants lacking components of the CRISPR-Cas locus were made and found to grow normally in broth and on agar media. cas9, cas1, cas4, and CRISPR array mutants also grew normally in macrophages and amoebae. However, cas2 mutants, although they grew typically in macrophages, were significantly impaired for infection of both Hartmannella and Acanthamoeba species. A complemented cas2 mutant infected the amoebae at wild-type levels, confirming that cas2 is required for intracellular infection of these host cells. PMID:23481601
Smith, Robert A.; Remington, Kathryn M.; Preston, Bradley D.; Schinazi, Raymond F.; North, Thomas W.
1998-01-01
Mutants of feline immunodeficiency virus (FIV) resistant to (−)-β-2′,3′-dideoxy-3′-thiacytidine (3TC) were selected by culturing virus in the presence of increasing stepwise concentrations of 3TC. Two plaque-purified variants were isolated from the original mutant population, and both of these mutants were resistant to 3TC. Surprisingly, these mutants were also phenotypically resistant to 3′-azido-3′-deoxythymidine (AZT) and to the combination of 3TC and AZT. Purified reverse transcriptase (RT) from one of these plaque-purified mutants was resistant to the 5′-triphosphates of 3TC and AZT. DNA sequence analysis of the RT-encoding region of the pol gene amplified from the plaque-purified mutants revealed a Pro-to-Ser mutation at position 156 of RT. A site-directed mutant of FIV engineered to contain this Pro-156-Ser mutation was resistant to 3TC, AZT, and the combination of 3TC and AZT, confirming the role of the Pro-156-Ser mutation in the resistance of FIV to these two nucleoside analogs. This represents the first report of a lentiviral mutant resistant to the combination of AZT and 3TC due to a single, unique point mutation. PMID:9499094
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-02-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-01-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404
Characterization and fine mapping of a light-dependent leaf lesion mimic mutant 1 in rice.
Wang, Jing; Ye, Bangquan; Yin, Junjie; Yuan, Can; Zhou, Xiaogang; Li, Weitao; He, Min; Wang, Jichun; Chen, Weilan; Qin, Peng; Ma, Bintian; Wang, Yuping; Li, Shigui; Chen, Xuewei
2015-12-01
Plants that spontaneously produce lesion mimics or spots, without any signs of obvious adversity, such as pesticide and mechanical damage, or pathogen infection, are so-called lesion mimic mutants (lmms). In rice, many lmms exhibit enhanced resistance to pathogens, which provides a unique opportunity to uncover the molecular mechanism underlying lmms. We isolated a rice light-dependent leaf lesion mimic mutant 1 (llm1). Lesion spots appeared in the leaves of the llm1 mutant at the tillering stage. Furthermore, the mutant llm1 had similar agronomic traits to wild type rice. Trypan blue and diamiobenzidine staining analyses revealed that the lesion spot formation on the llm1 mutant was due to programmed cell death and reactive oxygen species. The chloroplasts were severely damaged in the llm1 mutant, suggesting that chloroplast damage was associated with the formation of lesion spots in llm1. More importantly, llm1 exhibited enhanced resistance to bacterial blight pathogens within increased expression of pathogenesis related genes (PRs). Using a map-based cloning approach, we delimited the LLM1 locus to a 121-kb interval between two simple sequence repeat markers, RM17470 and RM17473, on chromosome 4. We sequenced the candidate genes on the interval and found that a base mutation had substituted adenine phosphate for thymine in the last exon of LOC_Os04g52130, which led to an amino acid change (Asp(388) to Val) in the llm1 mutant. Our investigation showed that the putative coproporphyrinogen III oxidase (CPOX) encoded by LOC_Os04g52130 was produced by LLM1 and that amino acid Asp(388) was essential for CPOX function. Our study provides the basis for further investigations into the mechanism underlying lesion mimic initiation associated with LLM1. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Suppression of calbindin-D28k expression exacerbates SCA1 phenotype in a disease mouse model.
Vig, Parminder J S; Wei, Jinrong; Shao, Qingmei; Lopez, Maripar E; Halperin, Rebecca; Gerber, Jill
2012-09-01
Spinocerebellar ataxia type 1 (SCA1) is an autosomal dominant neurological disorder caused by the expansion of a polyglutamine tract in the mutant protein ataxin-1. The cerebellar Purkinje cells (PCs) are the major targets of mutant ataxin-1. The mechanism of PC death in SCA1 is not known; however, previous work indicates that downregulation of specific proteins involved in calcium homeostasis and signaling by mutant ataxin-1 is the probable cause of PC degeneration in SCA1. In this study, we explored if targeted deprivation of PC specific calcium-binding protein calbindin-D28k (CaB) exacerbates ataxin-1 mediated toxicity in SCA1 transgenic (Tg) mice. Using behavioral tests, we found that though both SCA1/+ and SCA1/+: CaB null (-/+) double mutants exhibited progressive impaired performance on the rotating rod, a simultaneous enhancement of exploratory activity, and absence of deficits in coordination, the double mutants were more severely impaired than SCA1/+ mice. With increasing age, SCA1/+ mice showed a progressive loss in the expression and localization of CaB and other PC specific calcium-binding and signaling proteins. In double mutants, these changes were more pronounced and had an earlier onset. Gene expression profiling of young mice exhibiting no behavior or biochemical deficits revealed a differential expression of many genes common to SCA1/+ and CaB-/+ lines, and unique to SCA1/+: CaB-/+ phenotype. Our study provides further evidence for a critical role of CaB in SCA1 pathogenesis, which may help identify new therapeutic targets to treat SCA1 or other cerebellar ataxias.
Small Subunits of Serine Palmitoyltransferase (ssSPTs) and Their Physiological Roles
2014-02-12
showing that organisms also have unique sphingoid base chain lengths. In insects, such as Drosophila melanogaster , the predominant chain lengths of the ... Drosophila melanogaster mutant defective in male meiotic cytokinesis (‘Ghiberti’) has a mutation in a gene with low homology to the ssSPT subunits of...INTRODUCTION: Sphingolipid metabolism in Drosophila melanogaster (fly) is an active area of research. It is a good model system to study the roles of
Rosconi, Federico; de Vries, Stefan P. W.; Baig, Abiyad; Fabiano, Elena
2016-01-01
ABSTRACT The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. IMPORTANCE A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. PMID:27590816
An annotated database of Arabidopsis mutants of acyl lipid metabolism
McGlew, Kathleen; Shaw, Vincent; Zhang, Meng; ...
2014-12-10
Mutants have played a fundamental role in gene discovery and in understanding the function of genes involved in plant acyl lipid metabolism. The first mutant in Arabidopsis lipid metabolism ( fad4) was described in 1985. Since that time, characterization of mutants in more than 280 genes associated with acyl lipid metabolism has been reported. This review provides a brief background and history on identification of mutants in acyl lipid metabolism, an analysis of the distribution of mutants in different areas of acyl lipid metabolism and presents an annotated database (ARALIPmutantDB) of these mutants. The database provides information on the phenotypesmore » of mutants, pathways and enzymes/proteins associated with the mutants, and allows rapid access via hyperlinks to summaries of information about each mutant and to literature that provides information on the lipid composition of the mutants. Mutants for at least 30 % of the genes in the database have multiple names, which have been compiled here to reduce ambiguities in searches for information. Furthermore, the database should also provide a tool for exploring the relationships between mutants in acyl lipid-related genes and their lipid phenotypes and point to opportunities for further research.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meeks, John C.
Heterocysts are specialized cells that establish a physiologically low oxygen concentration; they function as the sites of oxygen-sensitive nitrogen fixation and hydrogen metabolism in certain filamentous cyanobacteria. They are present at a frequency of less than 10% of the cells and singly in a nonrandom spacing pattern in the filaments. The extent of differential gene expression during heterocyst differentiation was defined by DNA microarray analysis in wild type and mutant cultures of Nostoc punctiforme. The results in wild-type cultures identified two groups of genes; approximately 440 that are unique to heterocyst formation and function, and 500 that respond positively andmore » negatively to the transient stress of nitrogen starvation. Nitrogen fixation is initiated within 24 h after induction, but the cultures require another 24 h before growth is reinitiated. Microarray analyses were conducted on strains with altered expression of three genes that regulate the presence and spacing of heterocysts in the filaments; loss of function or over expression of these genes increases the heterocyst frequency 2 to 3 fold compared to the wild-type. Mutations in the genes hetR and hetF result in the inability to differentiate heterocysts, whereas over expression of each gene individually yields multiple contiguous heterocysts at sites in the filaments; they are positive regulatory elements. Mutation of the gene patN results in an increase in heterocysts frequency, but, in this case, the heterocysts are singly spaced in the filaments with a decrease in the number of vegetative cells in the interval between heterocysts; this is a negative regulatory element. However, over expression of patN resulted in the wild-type heterocyst frequency and spacing pattern. Microarray results indicated HetR and HetF influence the transcription of a common set of about 395 genes, as well as about 350 genes unique to each protein. HetR is known to be a transcriptional regulator and HetF is predicted to be a protease, perhaps operating thorough stability of HetR; thus, the influence of HetF on transcription of a unique set of genes was unanticipated. These two proteins are also found in non-heterocyst-forming filamentous cyanobacteria and the results have implications on their other physiological role(s). The PatN protein is unique to heterocyst-forming cyanobacteria. Cytological analysis indicated PatN is present in only one of the two daughter cells following division, but is present in both cell less than 8 h after division. Microarray analysis indicated only five genes were differentially transcribed in the patN mutant compared to the wild type; three up-regulated genes that are known to influence heterocyst differentiation and two down-regulated genes that have an unassigned function. Mutational analyses indicted the two down-regulated genes do not have a distinct role in heterocyst differentiation. Thus, PatN only indirectly impacts transcription. These databases provide lists of differentially transcribed genes involved in nitrogen starvation and cellular differentiation that can be mined for detailed genetic analysis of the regulation of heterocyst formation and function for subsequent photo-biohydrogen production.« less
A new type of gene-disruption cassette with a rescue gene for Pichia pastoris.
Shibui, Tatsuro; Hara, Hiroyoshi
2017-09-01
Pichia pastoris has been used for the production of many recombinant proteins, and many useful mutant strains have been created. However, the efficiency of mutant isolation by gene-targeting is usually low and the procedure is difficult for those inexperienced in yeast genetics. In order to overcome these issues, we developed a new gene-disruption system with a rescue gene using an inducible Cre/mutant-loxP system. With only short homology regions, the gene-disruption cassette of the system replaces its target-gene locus containing a mutation with a compensatory rescue gene. As the cassette contains the AOX1 promoter-driven Cre gene, when targeted strains are grown on media containing methanol, the DNA fragment, i.e., the marker, rescue and Cre genes, between the mutant-loxP sequences in the cassette is excised, leaving only the remaining mutant-loxP sequence in the genome, and consequently a target gene-disrupted mutant can be isolated. The system was initially validated on ADE2 gene disruption, where the disruption can easily be detected by color-change of the colonies. Then, the system was applied for knocking-out URA3 and OCH1 genes, reported to be difficult to accomplish by conventional gene-targeting methods. All three gene-disruption cassettes with their rescue genes replaced their target genes, and the Cre/mutant-loxP system worked well to successfully isolate their knock-out mutants. This study identified a new gene-disruption system that could be used to effectively and strategically knock out genes of interest, especially whose deletion is detrimental to growth, without using special strains, e.g., deficient in nonhomologous end-joining, in P. pastoris. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1201-1208, 2017. © 2017 American Institute of Chemical Engineers.
Spehner, D; De Carlo, S; Drillien, R; Weiland, F; Mildner, K; Hanau, D; Rziha, H-J
2004-08-01
Parapoxviruses can be morphologically distinguished from other poxviruses in conventional negative staining electron microscopy (EM) by their ovoid appearance and the spiral tubule surrounding the virion's surface. However, this technique may introduce artifacts. We have examined Orf virus (ORFV; the prototype species of the Parapoxvirus genus) by cryoelectron microscopy (cryo-EM) and cryo-negative staining EM. From these studies we suggest that the shape and unique spiral tubule are authentic features of the parapoxviruses. We also constructed an ORFV mutant deleted of a gene encoding a 10-kDa protein, which is an orthologue of the vaccinia virus (VACV) 14-kDa fusion protein, and investigated its ultrastructure. This mutant virus multiplied slowly in permissive cells and produced infectious but morphologically aberrant particles. Mutant virions lacked the spiral tubule but displayed short disorganized tubules similar to those observed on the surface of VACV. In addition, thin extensions or loop-like structures were appended to the ORFV mutant particles. We suggest that these appended structures arise from a failure of the mutant virus particles to properly seal and that the sealing activity is dependent on the 10-kDa protein.
Fujii, Tsuguru; Yamamoto, Kimiko; Banno, Yutaka
2016-06-01
Uric acid accumulates in the epidermis of Bombyx mori larvae and renders the larval integument opaque and white. Yamamoto translucent (oya) is a novel spontaneous mutant with a translucent larval integument and unique phenotypic characteristics, such as male-biased lethality and flaccid larval paralysis. Xanthine dehydrogenase (XDH) that requires a molybdenum cofactor (MoCo) for its activity is a key enzyme for uric acid synthesis. It has been observed that injection of a bovine xanthine oxidase, which corresponds functionally to XDH and contains its own MoCo activity, changes the integuments of oya mutants from translucent to opaque and white. This finding suggests that XDH/MoCo activity might be defective in oya mutants. Our linkage analysis identified an association between the oya locus and chromosome 23. Because XDH is not linked to chromosome 23 in B. mori, MoCo appears to be defective in oya mutants. In eukaryotes, MoCo is synthesized by a conserved biosynthesis pathway governed by four loci (MOCS1, MOCS2, MOCS3, and GEPH). Through a candidate gene approach followed by sequence analysis, a 6-bp deletion was detected in an exon of the B. mori molybdenum cofactor synthesis-step 1 gene (BmMOCS1) in the oya strain. Moreover, recombination was not observed between the oya and BmMOCS1 loci. These results indicate that the BmMOCS1 locus is responsible for the oya locus. Finally, we discuss the potential cause of male-biased lethality and flaccid paralysis observed in the oya mutants. Copyright © 2016 Elsevier Ltd. All rights reserved.
Expression of non-toxic mutant of Escherichia coli heat-labile enterotoxin in tobacco chloroplasts.
Kang, Tae-Jin; Han, So-Chon; Kim, Mi-Young; Kim, Young-Sook; Yang, Moon-Sik
2004-11-01
Chloroplast transformation systems offer unique advantages in biotechnology, including high level of foreign gene expression, maternal inheritance, and polycistronic expression. We studied chloroplast expression of LTK63 (change Ser-->Lys at position 63 in the A subunit) which is the mutant of Escherichia coli heat-labile toxin. LTK63 is devoid of any toxic activity, but still retains its mucosal adjuvanticity. The LTK63 was cloned into chloroplast targeting vector and transformed to tobacco chloroplasts by particle bombardment. PCR and Southern blot analyses confirmed stable homologous recombination of the LTK63 gene into the chloroplast genome. The amount of LTK63 protein detected in tobacco chloroplasts was approximately 3.7% of the total soluble protein. The GM1-ganglioside binding assay confirmed that chloroplast-synthesized LTB of LTK63 binds to the intestinal membrane GM1-ganglioside receptor. Thus, the expression of LTK63 in chloroplasts provides a potential route toward the development of a plant-based edible vaccine for high expression system and environmentally friendly approach.
Palace, Samantha G.; Proulx, Megan K.; Lu, Shan; Baker, Richard E.
2014-01-01
ABSTRACT Rapid growth in deep tissue is essential to the high virulence of Yersinia pestis, causative agent of plague. To better understand the mechanisms underlying this unusual ability, we used transposon mutagenesis and high-throughput sequencing (Tn-seq) to systematically probe the Y. pestis genome for elements contributing to fitness during infection. More than a million independent insertion mutants representing nearly 200,000 unique genotypes were generated in fully virulent Y. pestis. Each mutant in the library was assayed for its ability to proliferate in vitro on rich medium and in mice following intravenous injection. Virtually all genes previously established to contribute to virulence following intravenous infection showed significant fitness defects, with the exception of genes for yersiniabactin biosynthesis, which were masked by strong intercellular complementation effects. We also identified more than 30 genes with roles in nutrient acquisition and metabolism as experiencing strong selection during infection. Many of these genes had not previously been implicated in Y. pestis virulence. We further examined the fitness defects of strains carrying mutations in two such genes—encoding a branched-chain amino acid importer (brnQ) and a glucose importer (ptsG)—both in vivo and in a novel defined synthetic growth medium with nutrient concentrations matching those in serum. Our findings suggest that diverse nutrient limitations in deep tissue play a more important role in controlling bacterial infection than has heretofore been appreciated. Because much is known about Y. pestis pathogenesis, this study also serves as a test case that assesses the ability of Tn-seq to detect virulence genes. PMID:25139902
Gao, Peng; Chen, An-Li; Zhao, Qiao-Ling; Shen, Xing-Jia; Qiu, Zhi-Yong; Xia, Ding-Guo; Tang, Shun-Ming; Zhang, Guo-Zheng
2013-09-15
The "Ming" lethal egg mutant (l-em) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-em mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-em mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-em mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-em mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-em mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-em mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-em mutant and Lepidopteran oogenesis in general. Copyright © 2013 Elsevier B.V. All rights reserved.
Krzyżanowska, Dorota M.; Ossowicki, Adam; Rajewska, Magdalena; Maciąg, Tomasz; Jabłońska, Magdalena; Obuchowski, Michał; Heeb, Stephan; Jafra, Sylwia
2016-01-01
Dickeya solani and Pectobacterium carotovorum subsp. brasiliense are recently established species of bacterial plant pathogens causing black leg and soft rot of many vegetables and ornamental plants. Pseudomonas sp. strain P482 inhibits the growth of these pathogens, a desired trait considering the limited measures to combat these diseases. In this study, we determined the genetic background of the antibacterial activity of P482, and established the phylogenetic position of this strain. Pseudomonas sp. P482 was classified as Pseudomonas donghuensis. Genome mining revealed that the P482 genome does not contain genes determining the synthesis of known antimicrobials. However, the ClusterFinder algorithm, designed to detect atypical or novel classes of secondary metabolite gene clusters, predicted 18 such clusters in the genome. Screening of a Tn5 mutant library yielded an antimicrobial negative transposon mutant. The transposon insertion was located in a gene encoding an HpcH/HpaI aldolase/citrate lyase family protein. This gene is located in a hypothetical cluster predicted by the ClusterFinder, together with the downstream homologs of four nfs genes, that confer production of a non-fluorescent siderophore by P. donghuensis HYST. Site-directed inactivation of the HpcH/HpaI aldolase gene, the adjacent short chain dehydrogenase gene, as well as a homolog of an essential nfs cluster gene, all abolished the antimicrobial activity of the P482, suggesting their involvement in a common biosynthesis pathway. However, none of the mutants showed a decreased siderophore yield, neither was the antimicrobial activity of the wild type P482 compromised by high iron bioavailability. A genomic region comprising the nfs cluster and three upstream genes is involved in the antibacterial activity of P. donghuensis P482 against D. solani and P. carotovorum subsp. brasiliense. The genes studied are unique to the two known P. donghuensis strains. This study illustrates that mining of microbial genomes is a powerful approach for predictingthe presence of novel secondary-metabolite encoding genes especially when coupled with transposon mutagenesis. PMID:27303376
Dissection of Ire1 Functions Reveals Stress Response Mechanisms Uniquely Evolved in Candida glabrata
Miyazaki, Taiga; Nakayama, Hironobu; Nagayoshi, Yohsuke; Kakeya, Hiroshi; Kohno, Shigeru
2013-01-01
Proper protein folding in the endoplasmic reticulum (ER) is vital in all eukaryotes. When misfolded proteins accumulate in the ER lumen, the transmembrane kinase/endoribonuclease Ire1 initiates splicing of HAC1 mRNA to generate the bZIP transcription factor Hac1, which subsequently activates its target genes to increase the protein-folding capacity of the ER. This cellular machinery, called the unfolded protein response (UPR), is believed to be an evolutionarily conserved mechanism in eukaryotes. In this study, we comprehensively characterized mutant phenotypes of IRE1 and other related genes in the human fungal pathogen Candida glabrata. Unexpectedly, Ire1 was required for the ER stress response independently of Hac1 in this fungus. C. glabrata Ire1 did not cleave mRNAs encoding Hac1 and other bZIP transcription factors identified in the C. glabrata genome. Microarray analysis revealed that the transcriptional response to ER stress is not mediated by Ire1, but instead is dependent largely on calcineurin signaling and partially on the Slt2 MAPK pathway. The loss of Ire1 alone did not confer increased antifungal susceptibility in C. glabrata contrary to UPR-defective mutants in other fungi. Taken together, our results suggest that the canonical Ire1-Hac1 UPR is not conserved in C. glabrata. It is known in metazoans that active Ire1 nonspecifically cleaves and degrades a subset of ER-localized mRNAs to reduce the ER load. Intriguingly, this cellular response could occur in an Ire1 nuclease-dependent fashion in C. glabrata. We also uncovered the attenuated virulence of the C. glabrata Δire1 mutant in a mouse model of disseminated candidiasis. This study has unveiled the unique evolution of ER stress response mechanisms in C. glabrata. PMID:23382685
Ye, Xiangcang; Han, Sang Jun; Tsai, Sophia Y.; DeMayo, Francesco J.; Xu, Jianming; Tsai, Ming-Jer; O'Malley, Bert W.
2005-01-01
Genetic disruption of the steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF)2/SRC-2 in mouse resulted in distinctive mutant phenotypes. To quantify their roles in the function of androgen receptor (AR) transcriptional activity in vivo, we generated a unique transgenic AR-reporter mouse and analyzed the cell-specific contributions of SRC-1 and TIF2 to the activity of AR in mouse testis. Transgenic AR-luciferase and transgenic AR-lacZ mice harbor a recombinant mouse AR gene, ARGAL4DBD, which is functionally coupled with a upstream activation sequence-mediated reporter gene (AR activity indicator). After characterization of these mice in terms of AR function, we further derived bigenic mice by crossing AR activity indicator mice with the SRC-1-/- or TIF2+/- mutant mice. Analyses of the resultant bigenic mice by in vivo imaging and luciferase assays showed that testicular AR activity was decreased significantly in those with the TIF2+/- mutation but not in the SRC-1+/- background, suggesting that TIF2 serves as the preferential coactivator for AR in testis. Immunohistological analysis confirmed that AR and TIF2 coexist in mouse testicular Sertoli cell nuclei under normal conditions. Although SRC-1 concentrates in Sertoli cell nuclei in the absence of TIF2, nuclear SRC-1 is not able to rescue AR activity in the TIF2 mutant background. Interestingly, SRC-1 appears to negatively influence AR activity, thereby counterbalancing the TIF2-stimulated AR activity. Our results provide unique in vivo insights to the multidimensional cell-type-specific interactions between AR and coregulators. PMID:15983373
Ye, Xiangcang; Han, Sang Jun; Tsai, Sophia Y; DeMayo, Francesco J; Xu, Jianming; Tsai, Ming-Jer; O'Malley, Bert W
2005-07-05
Genetic disruption of the steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF)2/SRC-2 in mouse resulted in distinctive mutant phenotypes. To quantify their roles in the function of androgen receptor (AR) transcriptional activity in vivo, we generated a unique transgenic AR-reporter mouse and analyzed the cell-specific contributions of SRC-1 and TIF2 to the activity of AR in mouse testis. Transgenic AR-luciferase and transgenic AR-lacZ mice harbor a recombinant mouse AR gene, AR(GAL4DBD), which is functionally coupled with a upstream activation sequence-mediated reporter gene (AR activity indicator). After characterization of these mice in terms of AR function, we further derived bigenic mice by crossing AR activity indicator mice with the SRC-1-/- or TIF2+/- mutant mice. Analyses of the resultant bigenic mice by in vivo imaging and luciferase assays showed that testicular AR activity was decreased significantly in those with the TIF2+/- mutation but not in the SRC-1+/- background, suggesting that TIF2 serves as the preferential coactivator for AR in testis. Immunohistological analysis confirmed that AR and TIF2 coexist in mouse testicular Sertoli cell nuclei under normal conditions. Although SRC-1 concentrates in Sertoli cell nuclei in the absence of TIF2, nuclear SRC-1 is not able to rescue AR activity in the TIF2 mutant background. Interestingly, SRC-1 appears to negatively influence AR activity, thereby counterbalancing the TIF2-stimulated AR activity. Our results provide unique in vivo insights to the multidimensional cell-type-specific interactions between AR and coregulators.
The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.
Ren, Jun; Prescott, John F
2004-11-15
An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.
McDowell, Stephen C.; Akmakjian, Garo; Sladek, Chris; Mendoza-Cozatl, David; Morrissey, Joe B.; Saini, Nick; Mittler, Ron; Baxter, Ivan; Salt, David E.; Ward, John M.; Schroeder, Julian I.; Guerinot, Mary Lou; Harper, Jeffrey F.
2013-01-01
The concentrations of mineral nutrients in seeds are critical to both the life cycle of plants as well as human nutrition. These concentrations are strongly influenced by soil conditions, as shown here by quantifying the concentration of 14 elements in seeds from Arabidopsis thaliana plants grown under four different soil conditions: standard, or modified with NaCl, heavy metals, or alkali. Each of the modified soils resulted in a unique change to the seed ionome (the mineral nutrient content of the seeds). To help identify the genetic networks regulating the seed ionome, changes in elemental concentrations were evaluated using mutants corresponding to 760 genes as well as 10 naturally occurring accessions. The frequency of ionomic phenotypes supports an estimate that as much as 11% of the A. thaliana genome encodes proteins of functional relevance to ion homeostasis in seeds. A subset of mutants were analyzed with two independent alleles, providing five examples of genes important for regulation of the seed ionome: SOS2, ABH1, CCC, At3g14280 and CNGC2. In a comparison of nine different accessions to a Col-0 reference, eight accessions were observed to have reproducible differences in elemental concentrations, seven of which were dependent on specific soil conditions. These results indicate that the A. thaliana seed ionome is distinct from the vegetative ionome, and that elemental analysis is a sensitive approach to identify genes controlling ion homeostasis, including those that regulate gene expression, phospho-regulation, and ion transport. PMID:23671651
Smith, R A; Remington, K M; Lloyd, R M; Schinazi, R F; North, T W
1997-01-01
Variants of feline immunodeficiency virus (FIV) that possess a unique methionine-to-threonine mutation within the YMDD motif of reverse transcriptase (RT) were selected by culturing virus in the presence of inhibitory concentrations of (-)-beta-L-2',3'-dideoxy-5-fluoro-3'-thiacytidine [(-)-FTC]. The mutants were resistant to (-)-FTC and (-)-beta-L-2',3'-dideoxy-3'-thiacytidine (3TC) and additionally exhibited low-level resistance to 2',3'-dideoxycytidine (ddC). DNA sequence analysis of the RT-encoding region of the pol gene amplified from resistant viruses consistently identified a Met-to-Thr mutation in the YMDD motif. Purified RT from the mutants was also resistant to the 5'-triphosphate forms of 3TC, (-)-FTC, and ddC. Site-directed mutants of FIV were engineered which contain either the novel Met-to-Thr mutation or the Met-to-Val mutation seen in oxathiolane nucleoside-resistant HIV-1. Both site-directed mutants displayed resistance to 3TC, thus confirming the role of these mutations in the resistance of FIV to beta-L-3'-thianucleosides. PMID:9032372
Defective Fast Inactivation Recovery of Nav1.4 in Congenital Myasthenic Syndrome
Arnold, W. David; Feldman, Daniel H.; Ramirez, Sandra; He, Liuyuan; Kassar, Darine; Quick, Adam; Klassen, Tara L.; Lara, Marian; Nguyen, Joanna; Kissel, John T.; Lossin, Christoph; Maselli, Ricardo A.
2015-01-01
Objective To describe the unique phenotype and genetic findings in a 57-year-old female with a rare form of congenital myasthenic syndrome (CMS) associated with longstanding muscle fatigability, and to investigate the underlying pathophysiology. Methods We used whole-cell voltage clamping to compare the biophysical parameters of wild-type and Arg1457His-mutant Nav1.4. Results Clinical and neurophysiological evaluation revealed features consistent with CMS. Sequencing of candidate genes indicated no abnormalities. However, analysis of SCN4A, the gene encoding the skeletal muscle sodium channel Nav1.4, revealed a homozygous mutation predicting an arginine-to-histidine substitution at position 1457 (Arg1457His), which maps to the channel’s voltage sensor, specifically D4/S4. Whole-cell patch clamp studies revealed that the mutant required longer hyperpolarization to recover from fast inactivation, which produced a profound use-dependent current attenuation not seen in the wild type. The mutant channel also had a marked hyperpolarizing shift in its voltage dependence of inactivation as well as slowed inactivation kinetics. Interpretation We conclude that Arg1457His compromises muscle fiber excitability. The mutant fast-inactivates with significantly less depolarization, and it recovers only after extended hyperpolarization. The resulting enhancement in its use dependence reduces channel availability, which explains the patient’s muscle fatigability. Arg1457His offers molecular insight into a rare form of CMS precipitated by sodium channel inactivation defects. Given this channel’s involvement in other muscle disorders such as paramyotonia congenita and hyperkalemic periodic paralysis, our study exemplifies how variations within the same gene can give rise to multiple distinct dysfunctions and phenotypes, revealing residues important in basic channel function. PMID:25707578
Matsuo, Miki; Cui, Longzhu; Kim, Jeeyoung
2013-01-01
Heterogeneous vancomycin-intermediate Staphylococcus aureus (hVISA) spontaneously produces VISA cells within its cell population at a frequency of 10−6 or greater. We established a total of 45 VISA mutant strains independently obtained from hVISA Mu3 and its related strains by one-step vancomycin selection. We then performed high-throughput whole-genome sequencing of the 45 strains and their parent strains to identify the genes involved in the hVISA-to-VISA phenotypic conversion. A comparative genome study showed that all the VISA strains tested carried a unique set of mutations. All of the 45 VISA strains carried 1 to 4 mutations possibly affecting the expression of a total of 48 genes. Among them, 32 VISA strains carried only one gene affected by a single mutation. As many as 20 genes in more than eight functional categories were affected in the 32 VISA strains, which explained the extremely high rates of the hVISA-to-VISA phenotypic conversion. Five genes, rpoB, rpoC, walK, pbp4, and pp2c, were previously reported as being involved in vancomycin resistance. Fifteen remaining genes were newly identified as associated with vancomycin resistance in this study. The gene most frequently affected (6 out of 32 strains) was cmk, which encodes cytidylate kinase, followed closely by rpoB (5 out of 32), encoding the β subunit of RNA polymerase. A mutation prevalence study also revealed a sizable number of cmk mutants among clinical VISA strains (7 out of 38 [18%]). Reduced cytidylate kinase activity in cmk mutant strains is proposed to contribute to the hVISA-to-VISA phenotype conversion by thickening the cell wall and reducing the cell growth rate. PMID:24018261
Wu, J R; Yeh, Y C
1975-05-01
Suppressors of gene 59-defective mutants were isolated by screening spontaneous, temperature-sensitive (ts) revertants of the amber mutant, amC5, in gene 59. Six ts revertants were isolated. No gene 59-defective ts recombinant was obtained by crossing each ts revertant with the wild type, T4D. However, suppressors of gene 59-defective mutants were obtained from two of these ts revertants. These suppressor mutants are referred to as dar (DNA arrested restoration). dar mutants specifically restored the abnormalities, both in DNA synthesis and burst size, caused by gene 59-defective mutants to normal levels. It is unlikely that dar mutants are nonsense suppressors since theý failed to suppress amber mutations in 11 other genes investigated. The genetic expression of dar is controlled by gene 55; therefore, dar is a late gene. The genetic location of dar has been mapped between genes 24 and 25, a region contiguous to late genes. dar appears to be another nonessential gene of T4 since burst sizes of dar were almost identical to those of the wild type. Mutations in dar did not affect genetic recombination and repair of UV-damaged DNA, but caused a sensitivity to hydroxyurea in progeny formation. The effect of the dar mutation on host DNA degradation cannot account for its hydroxyurea sensitivity. dar mutant alleles were recessive to the wild-type allele as judged by restoration of arrested DNA synthesis. The possible mechanisms for the suppression of defects in gene 59 are discussed.
Martins-Silva, Cristina; De Jaeger, Xavier; Guzman, Monica S; Lima, Ricardo D F; Santos, Magda S; Kushmerick, Christopher; Gomez, Marcus V; Caron, Marc G; Prado, Marco A M; Prado, Vania F
2011-03-10
Defining the contribution of acetylcholine to specific behaviors has been challenging, mainly because of the difficulty in generating suitable animal models of cholinergic dysfunction. We have recently shown that, by targeting the vesicular acetylcholine transporter (VAChT) gene, it is possible to generate genetically modified mice with cholinergic deficiency. Here we describe novel VAChT mutant lines. VAChT gene is embedded within the first intron of the choline acetyltransferase (ChAT) gene, which provides a unique arrangement and regulation for these two genes. We generated a VAChT allele that is flanked by loxP sequences and carries the resistance cassette placed in a ChAT intronic region (FloxNeo allele). We show that mice with the FloxNeo allele exhibit differential VAChT expression in distinct neuronal populations. These mice show relatively intact VAChT expression in somatomotor cholinergic neurons, but pronounced decrease in other cholinergic neurons in the brain. VAChT mutant mice present preserved neuromuscular function, but altered brain cholinergic function and are hyperactive. Genetic removal of the resistance cassette rescues VAChT expression and the hyperactivity phenotype. These results suggest that release of ACh in the brain is normally required to "turn down" neuronal circuits controlling locomotion.
Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun
2016-10-01
The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.
Li, J; Kasper, D L; Ausubel, F M; Rosner, B; Michel, J L
1997-11-25
The alpha C protein of group B Streptococcus (GBS) is a major surface-associated antigen. Although its role in the biology and virulence of GBS has not been defined, it is opsonic and capable of eliciting protective immunity. The alpha C protein is widely distributed among clinical isolates and is a potential protein carrier and antigen in conjugate vaccines to prevent GBS infections. The structural gene for the alpha C protein, bca, has been cloned and sequenced. The protein encoded by bca is related to a class of surface-associated proteins of gram-positive cocci involved in virulence and immunity. To investigate the potential roles of the alpha C protein, bca null mutants were generated in which the bca gene was replaced with a kanamycin resistance cassette via homologous recombination using a novel shuttle/suicide vector. Studies of lethality in neonatal mice showed that the virulence of the bca null mutants was attenuated 5- to 7-fold when compared with the isogenic wild-type strain A909. Significant differences in mortality occurred in the first 24 h, suggesting that the role of the alpha antigen is important in the initial stages of the infection. In contrast to A909, bca mutants were no longer killed by polymorphonuclear leukocytes in the presence of alpha-specific antibodies in an in vitro opsonophagocytic assay. In contrast to previous studies, alpha antigen expression does not appear to play a role in resistance to opsonophagocytosis in the absence of alpha-specific antibodies. In addition, antibodies to the alpha C protein did not passively protect neonatal mice from lethal challenge with bca mutants, suggesting that these epitopes are uniquely present within the alpha antigen as expressed from the bca gene. Therefore, the alpha C protein is important in the pathogenesis of GBS infection and is a target for protective immunity in the development of GBS vaccines.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gu Ning; Laboratory of Neurochemistry, Graduate School of Human and Environmental Studies, Kyoto University, Kyoto; Adachi, Tetsuya
2006-08-04
Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2more » mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.« less
Russell, P W; Orndorff, P E
1992-01-01
We describe the characterization of two genes, fimF and fimG (also called pilD), that encode two minor components of type 1 pili in Escherichia coli. Defined, in-frame deletion mutations were generated in vitro in each of these two genes. A double mutation that had deletions identical to both single lesions was also constructed. Examination of minicell transcription and translation products of parental and mutant plasmids revealed that, as predicted from the nucleotide sequence and previous reports, the fimF gene product was a protein of ca. 16 kDa and that the fimG gene product was a protein of ca. 14 kDa. Each of the constructions was introduced, via homologous recombination, into the E. coli chromosome. All three of the resulting mutants produced type 1 pili and exhibited hemagglutination of guinea pig erythrocytes. The latter property was also exhibited by partially purified pili isolated from each of the mutants. Electron microscopic examination revealed that the fimF mutant had markedly reduced numbers of pili per cell, whereas the fimG mutant had very long pili. The double mutant displayed the characteristics of both single mutants. However, pili in the double mutant were even longer than those seen in the fimG mutant, and the numbers of pili were even fewer than those displayed by the fimF mutant. All three mutants could be complemented in trans with a single-copy-number plasmid bearing the appropriate parental gene or genes to give near-normal parental piliation. On the basis of the phenotypes exhibited by the single and double mutants, we believe that the fimF gene product may aid in initiating pilus assembly and that the fimG product may act as an inhibitor of pilus polymerization. In contrast to previous studies, we found that neither gene product was required for type 1 pilus receptor binding. Images PMID:1355769
Regulatory link between DNA methylation and active demethylation in Arabidopsis
Lei, Mingguang; Zhang, Huiming; Julian, Russell; Tang, Kai; Xie, Shaojun; Zhu, Jian-Kang
2015-01-01
De novo DNA methylation through the RNA-directed DNA methylation (RdDM) pathway and active DNA demethylation play important roles in controlling genome-wide DNA methylation patterns in plants. Little is known about how cells manage the balance between DNA methylation and active demethylation activities. Here, we report the identification of a unique RdDM target sequence, where DNA methylation is required for maintaining proper active DNA demethylation of the Arabidopsis genome. In a genetic screen for cellular antisilencing factors, we isolated several REPRESSOR OF SILENCING 1 (ros1) mutant alleles, as well as many RdDM mutants, which showed drastically reduced ROS1 gene expression and, consequently, transcriptional silencing of two reporter genes. A helitron transposon element (TE) in the ROS1 gene promoter negatively controls ROS1 expression, whereas DNA methylation of an RdDM target sequence between ROS1 5′ UTR and the promoter TE region antagonizes this helitron TE in regulating ROS1 expression. This RdDM target sequence is also targeted by ROS1, and defective DNA demethylation in loss-of-function ros1 mutant alleles causes DNA hypermethylation of this sequence and concomitantly causes increased ROS1 expression. Our results suggest that this sequence in the ROS1 promoter region serves as a DNA methylation monitoring sequence (MEMS) that senses DNA methylation and active DNA demethylation activities. Therefore, the ROS1 promoter functions like a thermostat (i.e., methylstat) to sense DNA methylation levels and regulates DNA methylation by controlling ROS1 expression. PMID:25733903
Mao, Chanjuan; Xie, Hongjie; Chen, Shiguo; Valverde, Bernal E; Qiang, Sheng
2017-09-01
Liriope spicata (Thunb.) Lour has a unique LsEPSPS structure contributing to the highest-ever-recognized natural glyphosate tolerance. The transformed LsEPSPS confers increased glyphosate resistance to E. coli and A. thaliana. However, the increased glyphosate-resistance level is not high enough to be of commercial value. Therefore, LsEPSPS was subjected to error-prone PCR to screen mutant EPSPS genes capable of endowing higher resistance levels. A mutant designated as ELs-EPSPS having five mutated amino acids (37Val, 67Asn, 277Ser, 351Gly and 422Gly) was selected for its ability to confer improved resistance to glyphosate. Expression of ELs-EPSPS in recombinant E. coli BL21 (DE3) strains enhanced resistance to glyphosate in comparison to both the LsEPSPS-transformed and -untransformed controls. Furthermore, transgenic ELs-EPSPS A. thaliana was about 5.4 fold and 2-fold resistance to glyphosate compared with the wild-type and the Ls-EPSPS-transgenic plants, respectively. Therefore, the mutated ELs-EPSPS gene has potential value for has potential for the development of glyphosate-resistant crops. Copyright © 2016 Elsevier Inc. All rights reserved.
Control of non-apoptotic nurse cell death by engulfment genes in Drosophila.
Timmons, Allison K; Mondragon, Albert A; Meehan, Tracy L; McCall, Kimberly
2017-04-03
Programmed cell death occurs as a normal part of oocyte development in Drosophila. For each egg that is formed, 15 germline-derived nurse cells transfer their cytoplasmic contents into the oocyte and die. Disruption of apoptosis or autophagy only partially inhibits the death of the nurse cells, indicating that other mechanisms significantly contribute to nurse cell death. Recently, we demonstrated that the surrounding stretch follicle cells non-autonomously promote nurse cell death during late oogenesis and that phagocytosis genes including draper, ced-12, and the JNK pathway are crucial for this process. When phagocytosis genes are inhibited in the follicle cells, events specifically associated with death of the nurse cells are impaired. Death of the nurse cells is not completely blocked in draper mutants, suggesting that other engulfment receptors are involved. Indeed, we found that the integrin subunit, αPS3, is enriched on stretch follicle cells during late oogenesis and is required for elimination of the nurse cells. Moreover, double mutant analysis revealed that integrins act in parallel to draper. Death of nurse cells in the Drosophila ovary is a unique example of programmed cell death that is both non-apoptotic and non-cell autonomously controlled.
Wang, Zhen-Yu; Gehring, Chris; Zhu, Jianhua; Li, Feng-Min; Zhu, Jian-Kang; Xiong, Liming
2015-01-01
Osmotic stress activates the biosynthesis of the phytohormone abscisic acid (ABA) through a pathway that is rate limited by the carotenoid cleavage enzyme 9-cis-epoxycarotenoid dioxygenase (NCED). To understand the signal transduction mechanism underlying the activation of ABA biosynthesis, we performed a forward genetic screen to isolate mutants defective in osmotic stress regulation of the NCED3 gene. Here, we identified the Arabidopsis (Arabidopsis thaliana) Vacuolar Sorting Receptor1 (VSR1) as a unique regulator of ABA biosynthesis. The vsr1 mutant not only shows increased sensitivity to osmotic stress, but also is defective in the feedback regulation of ABA biosynthesis by ABA. Further analysis revealed that vacuolar trafficking mediated by VSR1 is required for osmotic stress-responsive ABA biosynthesis and osmotic stress tolerance. Moreover, under osmotic stress conditions, the membrane potential, calcium flux, and vacuolar pH changes in the vsr1 mutant differ from those in the wild type. Given that manipulation of the intracellular pH is sufficient to modulate the expression of ABA biosynthesis genes, including NCED3, and ABA accumulation, we propose that intracellular pH changes caused by osmotic stress may play a signaling role in regulating ABA biosynthesis and that this regulation is dependent on functional VSR1. PMID:25416474
Wu, Chia-wei; Schmoller, Shelly K.; Bannantine, John P.; Eckstein, Torsten M.; Inamine, Julie M.; Livesey, Michael; Albrecht, Ralph; Talaat, Adel M.
2009-01-01
Biofilm formation by pathogenic bacteria plays a key role in their pathogenesis. Previously, the pstA gene was shown to be involved in the virulence of Mycobacterium avium subspecies paratuberculosis (M. ap), the causative agent of Johne's disease in cattle and a potential risk factor for Crohn's disease. Scanning electron microscopy and colonization levels of the M. ap mutant indicated that the pstA gene significantly contributes to the ability of M. ap to form biofilms. Digital measurements taken during electron microscopy identified a unique morphology for the ΔpstA mutant, which consisted of significantly shorter bacilli than the wild type. Analysis of the lipid profiles of the mycobacterial strains identified a novel lipopeptide that was present in the cell wall extracts of wild-type M. ap, but missing from the ΔpstA mutant. Interestingly, the calf infection model suggested that pstA contributes to intestinal invasion of M. ap. Furthermore, immunoblot analysis of peptides encoded by pstA identified a specific and significant level of immunogenicity. Taken together, our analysis revealed a novel cell wall component that could contribute to biofilm formation and to the virulence and immunogenicity of M. ap. Molecular tools to better control M. ap infections could be developed utilizing the presented findings. PMID:19490829
ARID1B is a specific vulnerability in ARID1A-mutant cancers.
Helming, Katherine C; Wang, Xiaofeng; Wilson, Boris G; Vazquez, Francisca; Haswell, Jeffrey R; Manchester, Haley E; Kim, Youngha; Kryukov, Gregory V; Ghandi, Mahmoud; Aguirre, Andrew J; Jagani, Zainab; Wang, Zhong; Garraway, Levi A; Hahn, William C; Roberts, Charles W M
2014-03-01
Recent studies have revealed that ARID1A, encoding AT-rich interactive domain 1A (SWI-like), is frequently mutated across a variety of human cancers and also has bona fide tumor suppressor properties. Consequently, identification of vulnerabilities conferred by ARID1A mutation would have major relevance for human cancer. Here, using a broad screening approach, we identify ARID1B, an ARID1A homolog whose gene product is mutually exclusive with ARID1A in SWI/SNF complexes, as the number 1 gene preferentially required for the survival of ARID1A-mutant cancer cell lines. We show that loss of ARID1B in ARID1A-deficient backgrounds destabilizes SWI/SNF and impairs proliferation in both cancer cells and primary cells. We also find that ARID1A and ARID1B are frequently co-mutated in cancer but that ARID1A-deficient cancers retain at least one functional ARID1B allele. These results suggest that loss of ARID1A and ARID1B alleles cooperatively promotes cancer formation but also results in a unique functional dependence. The results further identify ARID1B as a potential therapeutic target for ARID1A-mutant cancers.
Novel Two-Step Hierarchical Screening of Mutant Pools Reveals Mutants under Selection in Chicks
Yang, Hee-Jeong; Bogomolnaya, Lydia M.; Elfenbein, Johanna R.; Endicott-Yazdani, Tiana; Reynolds, M. Megan; Porwollik, Steffen; Cheng, Pui; Xia, Xiao-Qin
2016-01-01
Contaminated chicken/egg products are major sources of human salmonellosis, yet the strategies used by Salmonella to colonize chickens are poorly understood. We applied a novel two-step hierarchical procedure to identify new genes important for colonization and persistence of Salmonella enterica serotype Typhimurium in chickens. A library of 182 S. Typhimurium mutants each containing a targeted deletion of a group of contiguous genes (for a total of 2,069 genes deleted) was used to identify regions under selection at 1, 3, and 9 days postinfection in chicks. Mutants in 11 regions were under selection at all assayed times (colonization mutants), and mutants in 15 regions were under selection only at day 9 (persistence mutants). We assembled a pool of 92 mutants, each deleted for a single gene, representing nearly all genes in nine regions under selection. Twelve single gene deletion mutants were under selection in this assay, and we confirmed 6 of 9 of these candidate mutants via competitive infections and complementation analysis in chicks. STM0580, STM1295, STM1297, STM3612, STM3615, and STM3734 are needed for Salmonella to colonize and persist in chicks and were not previously associated with this ability. One of these key genes, STM1297 (selD), is required for anaerobic growth and supports the ability to utilize formate under these conditions, suggesting that metabolism of formate is important during infection. We report a hierarchical screening strategy to interrogate large portions of the genome during infection of animals using pools of mutants of low complexity. Using this strategy, we identified six genes not previously known to be needed during infection in chicks, and one of these (STM1297) suggests an important role for formate metabolism during infection. PMID:26857572
Himeno, Misako; Neriya, Yutaro; Minato, Nami; Miura, Chihiro; Sugawara, Kyoko; Ishii, Yoshiko; Yamaji, Yasuyuki; Kakizawa, Shigeyuki; Oshima, Kenro; Namba, Shigetou
2011-09-01
Abnormal flowers are often induced by infection of certain plant pathogens, e.g. phytoplasma, but the molecular mechanisms underlying these malformations have remained poorly understood. Here, we show that infection with OY-W phytoplasma (Candidatus Phytoplasma asteris, onion yellows phytoplasma strain, line OY-W) affects the expression of the floral homeotic genes of petunia plants in an organ-specific manner. Upon infection with OY-W phytoplasma, floral morphological changes, including conversion to leaf-like structures, were observed in sepals, petals and pistils, but not in stamens. As the expression levels of homeotic genes differ greatly between floral organs, we examined the expression levels of homeotic genes in each floral organ infected by OY-W phytoplasma, compared with healthy plants. The expression levels of several homeotic genes required for organ development, such as PFG, PhGLO1 and FBP7, were significantly downregulated by the phytoplasma infection in floral organs, except the stamens, suggesting that the unique morphological changes caused by the phytoplasma infection might result from the significant decrease in expression of some crucial homeotic genes. Moreover, the expression levels of TER, ALF and DOT genes, which are known to participate in floral meristem identity, were significantly downregulated in the phytoplasma-infected petunia meristems, implying that phytoplasma would affect an upstream signaling pathway of floral meristem identity. Our results suggest that phytoplasma infection may have complex effects on floral development, resulting in the unique phenotypes that were clearly distinct from the mutant flower phenotypes produced by the knock-out or the overexpression of certain homeotic genes. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.
Hara, Toshifumi; Jones, Matthew F.; Subramanian, Murugan; Li, Xiao Ling; Ou, Oliver; Zhu, Yuelin; Yang, Yuan; Wakefield, Lalage M.; Hussain, S. Perwez; Gaedcke, Jochen; Ried, Thomas; Luo, Ji; Caplen, Natasha J.; Lal, Ashish
2014-01-01
MicroRNAs (miRNAs) regulate the expression of hundreds of genes. However, identifying the critical targets within a miRNA-regulated gene network is challenging. One approach is to identify miRNAs that exert a context-dependent effect, followed by expression profiling to determine how specific targets contribute to this selective effect. In this study, we performed miRNA mimic screens in isogenic KRAS-Wild-type (WT) and KRAS-Mutant colorectal cancer (CRC) cell lines to identify miRNAs selectively targeting KRAS-Mutant cells. One of the miRNAs we identified as a selective inhibitor of the survival of multiple KRAS-Mutant CRC lines was miR-126. In KRAS-Mutant cells, miR-126 over-expression increased the G1 compartment, inhibited clonogenicity and tumorigenicity, while exerting no effect on KRAS-WT cells. Unexpectedly, the miR-126-regulated transcriptome of KRAS-WT and KRAS-Mutant cells showed no significant differences. However, by analyzing the overlap between miR-126 targets with the synthetic lethal genes identified by RNAi in KRAS-Mutant cells, we identified and validated a subset of miR-126-regulated genes selectively required for the survival and clonogenicity of KRAS-Mutant cells. Our strategy therefore identified critical target genes within the miR-126-regulated gene network. We propose that the selective effect of miR-126 on KRAS-Mutant cells could be utilized for the development of targeted therapy for KRAS mutant tumors. PMID:25245095
Henkes, Luiz E; Davis, John S; Rueda, Bo R
2003-11-10
The corpus luteum is a unique organ, which is transitory in nature. The development, maintenance and regression of the corpus luteum are regulated by endocrine, paracrine and autocrine signaling events. Defining the specific mediators of luteal development, maintenance and regression has been difficult and often perplexing due to the complexity that stems from the variety of cell types that make up the luteal tissue. Moreover, some regulators may serve dual functions as a luteotropic and luteolytic agent depending on the temporal and spatial environment in which they are expressed. As a result, some confusion is present in the interpretation of in vitro and in vivo studies. More recently investigators have utilized mutant mouse models to define the functional significance of specific gene products. The goal of this mini-review is to identify and discuss mutant mouse models that have luteal anomalies, which may provide some clues as to the significance of specific regulators of corpus luteum function.
Candidate genes for panhypopituitarism identified by gene expression profiling
Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis
2011-01-01
Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248
Xiang, Longkuan; Moore, Bradley S.
2003-01-01
The novel benzoyl coenzyme A (benzoyl-CoA) biosynthesis pathway in “Streptomyces maritimus” was investigated through a series of target-directed mutations. Genes involved in benzoyl-CoA formation were disrupted through single-crossover homologous recombination, and the resulting mutants were analyzed for their ability to biosynthesize the benzoyl-CoA-primed polyketide antibiotic enterocin. Inactivation of the unique phenylalanine ammonia-lyase-encoding gene encP was previously shown to be absolutely required for benzoyl-CoA formation in “S. maritimus”. The fatty acid β-oxidation-related genes encH, -I, and -J, on the other hand, are necessary but not required. In each case, the yield of benzoyl-CoA-primed enterocin dropped below wild-type levels. We attribute the reduced benzoyl-CoA formation in these specific mutants to functional substitution and cross-talk between the products of genes encH, -I, and -J and the enzyme homologues of primary metabolism. Disruption of the benzoate-CoA ligase encN gene did not perturb enterocin production, however, demonstrating that encN is extraneous and that benzoic acid is not a pathway intermediate. EncN rather serves as a substitute pathway for utilizing exogenous benzoic acid. These experiments provide further support that benzoyl-CoA is formed in a novel bacterial pathway that resembles the eukaryotic assembly of benzoyl-CoA from phenylalanine via a β-oxidative path. PMID:12511484
Lundgren, Benjamin R; Connolly, Morgan P; Choudhary, Pratibha; Brookins-Little, Tiffany S; Chatterjee, Snigdha; Raina, Ramesh; Nomura, Christopher T
2015-01-01
The alternative sigma factor RpoN is a unique regulator found among bacteria. It controls numerous processes that range from basic metabolism to more complex functions such as motility and nitrogen fixation. Our current understanding of RpoN function is largely derived from studies on prototypical bacteria such as Escherichia coli. Bacillus subtilis and Pseudomonas putida. Although the extent and necessity of RpoN-dependent functions differ radically between these model organisms, each bacterium depends on a single chromosomal rpoN gene to meet the cellular demands of RpoN regulation. The bacterium Ralstonia solanacearum is often recognized for being the causative agent of wilt disease in crops, including banana, peanut and potato. However, this plant pathogen is also one of the few bacterial species whose genome possesses dual rpoN genes. To determine if the rpoN genes in this bacterium are genetically redundant and interchangeable, we constructed and characterized ΔrpoN1, ΔrpoN2 and ΔrpoN1 ΔrpoN2 mutants of R. solanacearum GMI1000. It was found that growth on a small range of metabolites, including dicarboxylates, ethanol, nitrate, ornithine, proline and xanthine, were dependent on only the rpoN1 gene. Furthermore, the rpoN1 gene was required for wilt disease on tomato whereas rpoN2 had no observable role in virulence or metabolism in R. solanacearum GMI1000. Interestingly, plasmid-based expression of rpoN2 did not fully rescue the metabolic deficiencies of the ΔrpoN1 mutants; full recovery was specific to rpoN1. In comparison, only rpoN2 was able to genetically complement a ΔrpoN E. coli mutant. These results demonstrate that the RpoN1 and RpoN2 proteins are not functionally equivalent or interchangeable in R. solanacearum GMI1000.
Park, Jin-Ah; Kim, Jung-Mi; Park, Seung-Moon; Kim, Dae-Hyuk
2012-04-01
The gene CpSte11 of Cryphonectria parasitica, which encodes a yeast Ste11 homologue, was cloned and characterized. Gene replacement analysis revealed a high frequency of CpSte11 null mutants. When compared with the wild-type parent strain, CpSte11 null mutants showed no difference in terms of growth rate or pigmentation. However, CpSte11 null mutants showed a marked decrease in both the number and size of stromal pustules on chestnut twigs. The virulence test showed that, in comparison with those of the wild-type and virus-infected hypovirulent strains, CpSte11 null mutants produced necrotic areas of intermediate size. Disruption of the CpSte11 gene also resulted in defects in female fertility. Down-regulation of transcripts for the mating pheromone precursor gene, Mf2/2, and mating response transcription factors, such as cpst12 and pro1, was observed in CpSte11 null mutants. The down-regulation of Mf2/2, cpst12 and pro1 was also observed in the mutant phenotype of Cpmk2, a mating response Fus3-like mitogen-activated protein kinase (MAPK) gene, but not in the mutant of Cpmk1, a high-osmolarity glycerol Hog1-like MAPK gene. These results indicate that the cloned CpSte11 gene is functionally involved in the mating response pathway and acts through downstream targets, including Cpmk2, cpst12, pro1 and Mf2/2. However, the characteristics of the CpSte11 null mutant were fully phenocopied only in the cpst12 null mutant, but not in other studied null mutants of components of the putative mating response pathway. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.
Wang, Yingjun; Spalding, Martin H
2006-06-27
Many photosynthetic microorganisms acclimate to CO(2) limited environments by induction and operation of CO(2)-concentrating mechanisms (CCMs). Despite their central role in CCM function, inorganic carbon (Ci) transport systems never have been identified in eukaryotic photosynthetic organisms. In the green alga Chlamydomonas reinhardtii, a mutant, pmp1, was described in 1983 with deficiencies in Ci transport, and a Pmp1 protein-associated Ci uptake system has been proposed to be responsible for Ci uptake in low CO(2) (air level)-acclimated cells. However, even though pmp1 represents the only clear genetic link to Ci transport in microalgae and is one of only a very few mutants directly affecting the CCM itself, the identity of Pmp1 has remained unknown. Physiological analyses indicate that C. reinhardtii possesses multiple Ci transport systems responsible for acclimation to different levels of limiting CO(2) and that the Pmp1-associated transport system is required specifically for low (air level) CO(2) acclimation. In the current study, we identified and characterized a pmp1 allelic mutant, air dier 1 (ad1) that, like pmp1, cannot grow in low CO(2) (350 ppm) but can grow either in high CO(2) (5% CO(2)) or in very low CO(2) (<200 ppm). Molecular analyses revealed that the Ad1/Pmp1 protein is encoded by LciB, a gene previously identified as a CO(2)-responsive gene. LciB and three related genes in C. reinhardtii compose a unique gene family that encode four closely related, apparently soluble plastid proteins with no clearly identifiable conserved motifs.
Chan, Kamfai; Alter, Laura; Barthold, Stephen W.; Parveen, Nikhat
2015-01-01
Lyme disease is the most prevalent tick-borne disease in North America and Europe. The causative agent, Borrelia burgdorferi persists in the white-footed mouse. Infection with B. burgdorferi can cause acute to persistent multisystemic Lyme disease in humans. Some disease manifestations are also exhibited in the mouse model of Lyme disease. Genetic manipulation of B. burgdorferi remains difficult. First, B. burgdorferi contains a large number of endogenous plasmids with unique sequences encoding unknown functions. The presence of these plasmids needs to be confirmed after each genetic manipulation. Second, the restriction modification defense systems, including that encoded by bbe02 gene lead to low transformation efficiency in B. burgdorferi. Therefore, studying the molecular basis of Lyme pathogenesis is a challenge. Furthermore, investigation of the role of a specific B. burgdorferi protein throughout infection requires a large number of mice, making it labor intensive and expensive. To overcome the problems associated with low transformation efficiency and to reduce the number of mice needed for experiments, we disrupted the bbe02 gene of a highly infectious and pathogenic B. burgdorferi strain, N40 D10/E9 through insertion of a firefly luciferase gene. The bbe02 mutant shows higher transformation efficiency and maintains luciferase activity throughout infection as detected by live imaging of mice. Infectivity and pathogenesis of this mutant were comparable to the wild-type N40 strain. This mutant will serve as an ideal parental strain to examine the roles of various B. burgdorferi proteins in Lyme pathogenesis in the mouse model in the future. PMID:26069970
Furuya, Toshiki; Hirose, Satomi; Osanai, Hisashi; Semba, Hisashi; Kino, Kuniki
2011-01-01
Mycobacterium goodii strain 12523 is an actinomycete that is able to oxidize phenol regioselectively at the para position to produce hydroquinone. In this study, we investigated the genes responsible for this unique regioselective oxidation. On the basis of the fact that the oxidation activity of M. goodii strain 12523 toward phenol is induced in the presence of acetone, we first identified acetone-induced proteins in this microorganism by two-dimensional electrophoretic analysis. The N-terminal amino acid sequence of one of these acetone-induced proteins shares 100% identity with that of the protein encoded by the open reading frame Msmeg_1971 in Mycobacterium smegmatis strain mc2155, whose genome sequence has been determined. Since Msmeg_1971, Msmeg_1972, Msmeg_1973, and Msmeg_1974 constitute a putative binuclear iron monooxygenase gene cluster, we cloned this gene cluster of M. smegmatis strain mc2155 and its homologous gene cluster found in M. goodii strain 12523. Sequence analysis of these binuclear iron monooxygenase gene clusters revealed the presence of four genes designated mimABCD, which encode an oxygenase large subunit, a reductase, an oxygenase small subunit, and a coupling protein, respectively. When the mimA gene (Msmeg_1971) of M. smegmatis strain mc2155, which was also found to be able to oxidize phenol to hydroquinone, was deleted, this mutant lost the oxidation ability. This ability was restored by introduction of the mimA gene of M. smegmatis strain mc2155 or of M. goodii strain 12523 into this mutant. Interestingly, we found that these gene clusters also play essential roles in propane and acetone metabolism in these mycobacteria. PMID:21183637
Zhang, Minlu; Zhu, Cheng; Jacomy, Alexis; Lu, Long J.; Jegga, Anil G.
2011-01-01
The low prevalence rate of orphan diseases (OD) requires special combined efforts to improve diagnosis, prevention, and discovery of novel therapeutic strategies. To identify and investigate relationships based on shared genes or shared functional features, we have conducted a bioinformatic-based global analysis of all orphan diseases with known disease-causing mutant genes. Starting with a bipartite network of known OD and OD-causing mutant genes and using the human protein interactome, we first construct and topologically analyze three networks: the orphan disease network, the orphan disease-causing mutant gene network, and the orphan disease-causing mutant gene interactome. Our results demonstrate that in contrast to the common disease-causing mutant genes that are predominantly nonessential, a majority of orphan disease-causing mutant genes are essential. In confirmation of this finding, we found that OD-causing mutant genes are topologically important in the protein interactome and are ubiquitously expressed. Additionally, functional enrichment analysis of those genes in which mutations cause ODs shows that a majority result in premature death or are lethal in the orthologous mouse gene knockout models. To address the limitations of traditional gene-based disease networks, we also construct and analyze OD networks on the basis of shared enriched features (biological processes, cellular components, pathways, phenotypes, and literature citations). Analyzing these functionally-linked OD networks, we identified several additional OD-OD relations that are both phenotypically similar and phenotypically diverse. Surprisingly, we observed that the wiring of the gene-based and other feature-based OD networks are largely different; this suggests that the relationship between ODs cannot be fully captured by the gene-based network alone. PMID:21664998
Allen, Jonathan P; Neely, Melody N
2011-11-01
The ability of a pathogen to metabolically adapt to the local environment for optimal expression of virulence determinants is a continued area of research. Orthologs of the Streptococcus iniae LysR family regulator CpsY have been shown to regulate methionine biosynthesis and uptake pathways but appear to influence expression of several virulence genes as well. An S. iniae mutant with an in-frame deletion of cpsY (ΔcpsY mutant) is highly attenuated in a zebrafish infection model. The ΔcpsY mutant displays a methionine-independent growth defect in serum, which differs from the methionine-dependent defect observed for orthologous mutants of Streptococcus mutans and Streptococcus agalactiae. On the contrary, the ΔcpsY mutant can grow in excess of the wild type (WT) when supplemented with proteose peptone, suggesting an inability to properly regulate growth. CpsY is critical for protection of S. iniae from clearance by neutrophils in whole blood but is dispensable for intracellular survival in macrophages. Susceptibility of the ΔcpsY mutant to killing in whole blood is not due to a growth defect, because inhibition of neutrophil phagocytosis rescues the mutant to WT levels. Thus, CpsY appears to have a pleiotropic regulatory role for S. iniae, integrating metabolism and virulence. Furthermore, S. iniae provides a unique model to investigate the paradigm of CpsY-dependent regulation during systemic streptococcal infection.
Allen, Jonathan P.; Neely, Melody N.
2011-01-01
The ability of a pathogen to metabolically adapt to the local environment for optimal expression of virulence determinants is a continued area of research. Orthologs of the Streptococcus iniae LysR family regulator CpsY have been shown to regulate methionine biosynthesis and uptake pathways but appear to influence expression of several virulence genes as well. An S. iniae mutant with an in-frame deletion of cpsY (ΔcpsY mutant) is highly attenuated in a zebrafish infection model. The ΔcpsY mutant displays a methionine-independent growth defect in serum, which differs from the methionine-dependent defect observed for orthologous mutants of Streptococcus mutans and Streptococcus agalactiae. On the contrary, the ΔcpsY mutant can grow in excess of the wild type (WT) when supplemented with proteose peptone, suggesting an inability to properly regulate growth. CpsY is critical for protection of S. iniae from clearance by neutrophils in whole blood but is dispensable for intracellular survival in macrophages. Susceptibility of the ΔcpsY mutant to killing in whole blood is not due to a growth defect, because inhibition of neutrophil phagocytosis rescues the mutant to WT levels. Thus, CpsY appears to have a pleiotropic regulatory role for S. iniae, integrating metabolism and virulence. Furthermore, S. iniae provides a unique model to investigate the paradigm of CpsY-dependent regulation during systemic streptococcal infection. PMID:21911465
Towards an informative mutant phenotype for every bacterial gene
Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.; ...
2014-08-11
Mutant phenotypes provide strong clues to the functions of the underlying genes and could allow annotation of the millions of sequenced yet uncharacterized bacterial genes. However, it is not known how many genes have a phenotype under laboratory conditions, how many phenotypes are biologically interpretable for predicting gene function, and what experimental conditions are optimal to maximize the number of genes with a phenotype. To address these issues, we measured the mutant fitness of 1,586 genes of the ethanol-producing bacterium Zymomonas mobilis ZM4 across 492 diverse experiments and found statistically significant phenotypes for 89% of all assayed genes. Thus, inmore » Z. mobilis, most genes have a functional consequence under laboratory conditions. We demonstrate that 41% of Z. mobilis genes have both a strong phenotype and a similar fitness pattern (cofitness) to another gene, and are therefore good candidates for functional annotation using mutant fitness. Among 502 poorly characterized Z. mobilis genes, we identified a significant cofitness relationship for 174. For 57 of these genes without a specific functional annotation, we found additional evidence to support the biological significance of these gene-gene associations, and in 33 instances, we were able to predict specific physiological or biochemical roles for the poorly characterized genes. Last, we identified a set of 79 diverse mutant fitness experiments in Z. mobilis that are nearly as biologically informative as the entire set of 492 experiments. Therefore, our work provides a blueprint for the functional annotation of diverse bacteria using mutant fitness.« less
Sabbagh, Sébastien C.; Lepage, Christine; McClelland, Michael; Daigle, France
2012-01-01
The human-adapted Salmonella enterica serovar Typhi (S. Typhi) causes a systemic infection known as typhoid fever. This disease relies on the ability of the bacterium to survive within macrophages. In order to identify genes involved during interaction with macrophages, a pool of approximately 105 transposon mutants of S. Typhi was subjected to three serial passages of 24 hours through human macrophages. Mutants recovered from infected macrophages (output) were compared to the initial pool (input) and those significantly underrepresented resulted in the identification of 130 genes encoding for cell membrane components, fimbriae, flagella, regulatory processes, pathogenesis, and many genes of unknown function. Defined deletions in 28 genes or gene clusters were created and mutants were evaluated in competitive and individual infection assays for uptake and intracellular survival during interaction with human macrophages. Overall, 26 mutants had defects in the competitive assay and 14 mutants had defects in the individual assay. Twelve mutants had defects in both assays, including acrA, exbDB, flhCD, fliC, gppA, mlc, pgtE, typA, waaQGP, SPI-4, STY1867-68, and STY2346. The complementation of several mutants by expression of plasmid-borne wild-type genes or gene clusters reversed defects, confirming that the phenotypic impairments within macrophages were gene-specific. In this study, 35 novel phenotypes of either uptake or intracellular survival in macrophages were associated with Salmonella genes. Moreover, these results reveal several genes encoding molecular mechanisms not previously known to be involved in systemic infection by human-adapted typhoidal Salmonella that will need to be elucidated. PMID:22574205
Ma, Xiaozhi; Sun, Xiaoqiu; Li, Chunmei; Huan, Rui; Sun, Changhui; Wang, Yang; Xiao, Fuliang; Wang, Qian; Chen, Purui; Ma, Furong; Zhang, Kuan; Wang, Pingrong; Deng, Xiaojian
2017-02-01
Leaf-color mutants have been extensively studied in rice, and many corresponding genes have been identified up to now. However, leaf-color mutation mechanisms are diverse and still need further research through identification of novel genes. In the present paper, we isolated a leaf-color mutant, ys83, in rice (Oryza sativa). The mutant displayed a yellow-green leaf phenotype at seedling stage, and then slowly turned into light-green leaf from late tillering stage. In its yellow leaves, photosynthetic pigment contents significantly decreased and the chloroplast development was retarded. The mutant phenotype was controlled by a recessive mutation in a nuclear gene on the short arm of rice chromosome 2. Map-based cloning and sequencing analysis suggested that the candidate gene was YS83 (LOC_Os02g05890) encoding a protein containing 165 amino acid residues. Gene YS83 was expressed in a wide range of tissues, and its encoded protein was targeted to the chloroplast. In the mutant, a T-to-A substitution occurred in coding sequence of gene YS83, which caused a premature translation of its encoded product. By introduction of the wild-type gene, the ys83 mutant recovered to normal green-leaf phenotype. Taken together, we successfully identified a novel yellow-green leaf gene YS83. In addition, number of productive panicles per plant and number of spikelets per panicle only reduced by 6.7% and 7.6%, respectively, meanwhile its seed setting rate and 1000-grain weight (seed size) were not significantly affected in the mutant, so leaf-color mutant gene ys83 could be used as a trait marker gene in commercial hybrid rice production. Copyright © 2016. Published by Elsevier Masson SAS.
Bastien, C.; Machlin, S.; Zhang, Y.; Donaldson, K.; Hanson, R. S.
1989-01-01
Restriction maps of genes required for the synthesis of active methanol dehydrogenase in Methylobacterium organophilum XX and Methylobacterium sp. strain AM1 have been completed and compared. In these two species of pink-pigmented, type II methylotrophs, 15 genes were identified that were required for the expression of methanol dehydrogenase activity. None of these genes were required for the synthesis of the prosthetic group of methanol dehydrogenase, pyrroloquinoline quinone. The structural gene required for the synthesis of cytochrome cL, an electron acceptor uniquely required for methanol dehydrogenase, and the genes encoding small basic peptides that copurified with methanol dehydrogenases were closely linked to the methanol dehydrogenase structural genes. A cloned 22-kilobase DNA insert from Methylsporovibrio methanica 81Z, an obligate type II methanotroph, complemented mutants that contained lesions in four genes closely linked to the methanol dehydrogenase structural genes. The methanol dehydrogenase and cytochrome cL structural genes were found to be transcribed independently in M. organophilum XX. Only two of the genes required for methanol dehydrogenase synthesis in this bacterium were found to be cotranscribed. PMID:16348074
Mutants in the mouse NuRD/Mi2 component P66alpha are embryonic lethal.
Marino, Susan; Nusse, Roel
2007-06-13
The NuRD/Mi2 chromatin complex is involved in histone modifications and contains a large number of subunits, including the p66 protein. There are two mouse and human p66 paralogs, p66alpha and p66beta. The functions of these genes are not clear, in part because there are no mutants available, except in invertebrate model systems. We made loss of function mutants in the mouse p66alpha gene (mp66alpha, official name Gatad2a, MGI:2384585). We found that mp66alpha is essential for development, as mutant embryos die around day 10 of embryogenesis. The gene is not required for normal blastocyst development or for implantation. The phenotype of mutant embryos and the pattern of gene expression in mutants are consistent with a role of mp66alpha in gene silencing. mp66alpha is an essential gene, required for early mouse development. The lethal phenotype supports a role in execution of methylated DNA silencing.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cho, Yangrae; Srivastava, Akhil; Ohm, Robin A.
2012-05-01
Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. Several A. brassicicola genes have been characterized as affecting pathogenesis of Brassica species. To study regulatory mechanisms of pathogenesis, we mined 421 genes in silico encoding putative transcription factors in a machine-annotated, draft genome sequence of A. brassicicola. In this study, targeted gene disruption mutants for 117 of the transcription factor genes were produced and screened. Three of these genes were associated with pathogenesis. Disruption mutants of one gene (AbPacC) were nonpathogenic and another gene (AbVf8) caused lesions less than half the diameter of wild-type lesions. Unexpectedly, mutants of themore » third gene, Amr1, caused lesions with a two-fold larger diameter than the wild type and complementation mutants. Amr1 is a homolog of Cmr1, a transcription factor that regulates melanin biosynthesis in several fungi. We created gene deletion mutants of ?amr1 and characterized their phenotypes. The ?amr1 mutants used pectin as a carbon source more efficiently than the wild type, were melanin-deficient, and more sensitive to UV light and glucanase digestion. The AMR1 protein was localized in the nuclei of hyphae and in highly melanized conidia during the late stage of plant pathogenesis. RNA-seq analysis revealed that three genes in the melanin biosynthesis pathway, along with the deleted Amr1 gene, were expressed at low levels in the mutants. In contrast, many hydrolytic enzyme-coding genes were expressed at higher levels in the mutants than in the wild type during pathogenesis. The results of this study suggested that a gene important for survival in nature negatively affected virulence, probably by a less efficient use of plant cell-wall materials. We speculate that the functions of the Amr1 gene are important to the success of A. brassicicola as a competitive saprophyte and plant parasite.« less
Ducasse, D A; Mushegian, A R; Shepherd, R J
1995-01-01
Gene I of peanut chlorotic streak virus (PCISV), a caulimovirus, is homologous to gene I of other caulimoviruses and may encode a protein for virus movement. To evaluate the function of gene I, several mutations were created in this gene of an infectious, partially redundant clone of PCISV. Constructs with an in-frame deletion and a single amino acid substitution in gene I were not infectious. To test for replication of these mutants in primarily infected cells, an immunosorbent PCR technique was devised. Virus particles formed by mutants in plants were recovered by binding to antivirus antibodies on a solid matrix and DNase treated to discriminate against residual inoculum, and DNA of trapped virions was subjected to PCR amplification. Gene I mutants were shown to direct formation of encapsidated DNA as revealed by a PCR product. Control gene V mutants (reverse transcriptase essential for replication) did not yield a PCR product. Quantitative PCR allowed estimation of the proportion of cells initially infected by gene I mutants and the amount of extractable virus per cell. It is concluded that PCISV gene I encodes a movement protein and that the immunoselection-PCR technique is useful in studying subliminal virus infection in plants. PMID:7543587
Comprehensive mutational profiling of core binding factor acute myeloid leukemia
Duployez, Nicolas; Marceau-Renaut, Alice; Boissel, Nicolas; Petit, Arnaud; Bucci, Maxime; Geffroy, Sandrine; Lapillonne, Hélène; Renneville, Aline; Ragu, Christine; Figeac, Martin; Celli-Lebras, Karine; Lacombe, Catherine; Micol, Jean-Baptiste; Abdel-Wahab, Omar; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric
2016-01-01
Acute myeloid leukemia (AML) with t(8;21) or inv(16) have been recognized as unique entities within AML and are usually reported together as core binding factor AML (CBF-AML). However, there is considerable clinical and biological heterogeneity within this group of diseases, and relapse incidence reaches up to 40%. Moreover, translocations involving CBFs are not sufficient to induce AML on its own and the full spectrum of mutations coexisting with CBF translocations has not been elucidated. To address these issues, we performed extensive mutational analysis by high-throughput sequencing in 215 patients with CBF-AML enrolled in the Phase 3 Trial of Systematic Versus Response-adapted Timed-Sequential Induction in Patients With Core Binding Factor Acute Myeloid Leukemia and Treating Patients with Childhood Acute Myeloid Leukemia with Interleukin-2 trials (age, 1-60 years). Mutations in genes activating tyrosine kinase signaling (including KIT, N/KRAS, and FLT3) were frequent in both subtypes of CBF-AML. In contrast, mutations in genes that regulate chromatin conformation or encode members of the cohesin complex were observed with high frequencies in t(8;21) AML (42% and 18%, respectively), whereas they were nearly absent in inv(16) AML. High KIT mutant allele ratios defined a group of t(8;21) AML patients with poor prognosis, whereas high N/KRAS mutant allele ratios were associated with the lack of KIT or FLT3 mutations and a favorable outcome. In addition, mutations in epigenetic modifying or cohesin genes were associated with a poor prognosis in patients with tyrosine kinase pathway mutations, suggesting synergic cooperation between these events. These data suggest that diverse cooperating mutations may influence CBF-AML pathophysiology as well as clinical behavior and point to potential unique pathogenesis of t(8;21) vs inv(16) AML. PMID:26980726
Rosconi, Federico; de Vries, Stefan P W; Baig, Abiyad; Fabiano, Elena; Grant, Andrew J
2016-11-15
The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. Copyright © 2016 Rosconi et al.
Miyazaki, C; Kuroda, M; Ohta, A; Shibuya, I
1985-01-01
Unique mutants of Escherichia coli K-12, defective in phosphatidylglycerol synthesis, have been isolated from a temperature-sensitive strain incubated at its nonpermissive temperature. The parent strain had excess phosphatidylglycerol by harboring both the pss-1 allele [coding for a temperature-sensitive phosphatidylserine synthase (EC 2.7.8.8)] and the cls- allele (responsible for a defective cardiolipin synthase). The newly acquired mutations caused better growth at higher temperatures. One of the mutations (pgsA3) has been identified in the structural gene for phosphatidylglycerophosphate synthase [glycerophosphate phosphatidyltransferase (EC 2.7.8.5)]. Phospholipid compositions of these mutants were remarkable; phosphatidylethanolamine was the sole major lipid. In media with low osmotic pressures, these cells grew more slowly than the wild-type cells. They grew normally without recovering from the phospholipid abnormality in media appropriately supplemented with sucrose and MgCl2. Formation of cardiolipin and phosphoglycerol derivatives of membrane-derived oligosaccharides was reduced in a pgsA3 mutant. E. coli strains having the pgsA3, pss-1, and cls- mutations, either individually or in combination, constitute an empirical system in which the molar ratio of three major membrane phospholipids can be variously altered. Images PMID:2999767
Nanolock-Nanopore Facilitated Digital Diagnostics of Cancer Driver Mutation in Tumor Tissue.
Wang, Yong; Tian, Kai; Shi, Ruicheng; Gu, Amy; Pennella, Michael; Alberts, Lindsey; Gates, Kent S; Li, Guangfu; Fan, Hongxin; Wang, Michael X; Gu, Li-Qun
2017-07-28
Cancer driver mutations are clinically significant biomarkers. In precision medicine, accurate detection of these oncogenic changes in patients would enable early diagnostics of cancer, individually tailored targeted therapy, and precise monitoring of treatment response. Here we investigated a novel nanolock-nanopore method for single-molecule detection of a serine/threonine protein kinase gene BRAF V600E mutation in tumor tissues of thyroid cancer patients. The method lies in a noncovalent, mutation sequence-specific nanolock. We found that the nanolock formed on the mutant allele/probe duplex can separate the duplex dehybridization procedure into two sequential steps in the nanopore. Remarkably, this stepwise unzipping kinetics can produce a unique nanopore electric marker, with which a single DNA molecule of the cancer mutant allele can be unmistakably identified in various backgrounds of the normal wild-type allele. The single-molecule sensitivity for mutant allele enables both binary diagnostics and quantitative analysis of mutation occurrence. In the current configuration, the method can detect the BRAF V600E mutant DNA lower than 1% in the tumor tissues. The nanolock-nanopore method can be adapted to detect a broad spectrum of both transversion and transition DNA mutations, with applications from diagnostics to targeted therapy.
In vivo gene expression and the adaptive response: from pathogenesis to vaccines and antimicrobials.
Heithoff, D M; Sinsheimer, R L; Low, D A; Mahan, M J
2000-01-01
Microbial pathogens possess a repertoire of virulence determinants that each make unique contributions to fitness during infection. Analysis of these in vivo-expressed functions reveals the biology of the infection process, encompassing the bacterial infection strategies and the host ecological and environmental retaliatory strategies designed to combat them (e.g. thermal, osmotic, oxygen, nutrient and acid stress). Many of the bacterial virulence functions that contribute to a successful infection are normally only expressed during infection. A genetic approach was used to isolate mutants that ectopically expressed many of these functions in a laboratory setting. Lack of DNA adenine methylase (Dam) in Salmonella typhimurium abolishes the preferential expression of many bacterial virulence genes in host tissues. Dam- Salmonella were proficient in colonization of mucosal sites but were defective in colonization of deeper tissue sites. Additionally, Dam- mutants were totally avirulent and effective as live vaccines against murine typhoid fever. Since dam is highly conserved in many pathogenic bacteria that cause significant morbidity and mortality worldwide, Dams are potentially excellent targets for both vaccines and antimicrobials. PMID:10874736
Bao, Shaopan; Lu, Qicong; Dai, Heping; Zhang, Chao
2015-01-01
To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067
Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich
2005-04-01
The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.
Mutants of Neurospora crassa that alter gene expression and conidia development.
Madi, L; Ebbole, D J; White, B T; Yanofsky, C
1994-01-01
Several genes have been identified that are highly expressed during conidiation. Inactivation of these genes has no observable phenotypic effect. Transcripts of two such genes, con-6 and con-10, are normally absent from vegetative mycelia. To identify regulatory genes that affect con-6 and/or con-10 expression, strains were prepared in which the regulatory regions for these genes were fused to a gene conferring hygromycin resistance. Mutants were then selected that were resistant to the drug during mycelial growth. Mutations in several of the isolates had trans effects; they activated transcription of the corresponding intact gene and, in most isolates, one or more of the other con genes. Most interestingly, resistant mutants were obtained that were defective at different stages of conidiation. One mutant conidiated under conditions that do not permit conidiation in wild type. Images PMID:8016143
Knight, K L; Becker, R S
1990-03-23
Rabbits are unique in that their immunoglobulin VH regions bear allotypic markers encoded by allelic genes. The presence of these markers on most serum immunoglobulins is difficult to explain, as the germline contains several hundred VH genes. We cloned VH genes from normal rabbits of the VHa allotypes a1, a2, and a3 and from a mutant a2 rabbit, Alicia, which expresses almost no a2 allotype. The D-proximal VH gene VH1 of normal rabbits encoded prototype a1, a2, or a3 allotype VH regions in a1, a2, or a3 rabbits, respectively; VH1 was shown to be preferentially utilized in leukemic rabbit B cells. This VH1 gene was deleted from the germline of the Alicia rabbit. These data suggest that the allelic inheritance of a allotypes results from preferential utilization of VH1 in VDJ rearrangements. We suggest that antibody diversity in rabbit primarily results from somatic hypermutation and gene conversion.
Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.
2012-01-01
A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222
Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K
2012-08-01
A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.
Leptin gene promoter DNA methylation in WNIN obese mutant rats
2014-01-01
Background Obesity has become an epidemic in worldwide population. Leptin gene defect could be one of the causes for obesity. Two mutant obese rats WNIN/Ob and WNIN/GROb, isolated at National Centre for Laboratory Animal Sciences (NCLAS), Hyderabad, India, were found to be leptin resistant. The present study aims to understand the regulatory mechanisms underlying the resistance by promoter DNA methylation of leptin gene in these mutant obese rats. Methods Male obese mutant homozygous, carrier and heterozygous rats of WNIN/Ob and WNIN/GROb strain of 6 months old were studied to check the leptin gene expression (RT-PCR) and promoter DNA methylation (MassARRAY Compact system, SEQUENOM) of leptin gene by invivo and insilico approach. Results Homozygous WNIN/Ob and WNIN/GROb showed significantly higher leptin gene expression compared to carrier and lean counterparts. Leptin gene promoter DNA sequence region was analyzed ranging from transcription start site (TSS) to-550 bp length and found four CpGs in this sequence among them only three CpG loci (-309, -481, -502) were methylated in these WNIN mutant rat phenotypes. Conclusion The increased percentage of methylation in WNIN mutant lean and carrier phenotypes is positively correlated with transcription levels. Thus genetic variation may have effect on methylation percentages and subsequently on the regulation of leptin gene expression which may lead to obesity in these obese mutant rat strains. PMID:24495350
Stevenson, Sean Ross; Kamisugi, Yasuko; Trinh, Chi H.; ...
2016-05-18
The anatomically simple plants that first colonized land must have acquired molecular and biochemical adaptations to drought stress. Abscisic acid (ABA) coordinates responses leading to desiccation tolerance in all land plants. We identified ABA nonresponsive mutants in the model bryophyte Physcomitrella patens and genotyped a segregating population to map and identify the ABA NON-RESPONSIVE (ANR) gene encoding a modular protein kinase comprising an N-terminal PAS domain, a central EDR domain, and a C-terminal MAPKKK-like domain. anr mutants fail to accumulate dehydration tolerance-associated gene products in response to drought, ABA, or osmotic stress and do not acquire ABA-dependent desiccation tolerance. Themore » crystal structure of the PAS domain, determined to 1.7-Å resolution, shows a conserved PAS-fold that dimerizes through a weak dimerization interface. Targeted mutagenesis of a conserved tryptophan residue within the PAS domain generates plants with ABA nonresponsive growth and strongly attenuated ABA-responsive gene expression, whereas deleting this domain retains a fully ABA-responsive phenotype. ANR orthologs are found in early-diverging land plant lineages and aquatic algae but are absent from more recently diverged vascular plants. Lastly, we propose that ANR genes represent an ancestral adaptation that enabled drought stress survival of the first terrestrial colonizers but were lost during land plant evolution.« less
Limited number of immunoglobulin VH regions expressed in the mutant rabbit "Alicia".
DiPietro, L A; Short, J A; Zhai, S K; Kelus, A S; Meier, D; Knight, K L
1990-06-01
A unique feature of rabbit Ig is the presence of VH region allotypic specificities. In normal rabbits, more than 80% of circulating immunoglobulin molecules bear the VHa allotypic specificities, al, a2 or a3; the remaining 10% to 20% of immunoglobulin molecules lack VHa allotypic specificities and are designated VHa-. A mutant rabbit designated Alicia, in contrast, has predominantly serum immunoglobulin molecules that lack the VHa allotypic specificities (Kelus and Weiss, Proc. Natl. Acad. Sci. USA 1986. 83: 4883). To study the nature and molecular complexity of VHa- molecules, we cloned and determined the nucleotide sequence of seven cDNA prepared from splenic RNA of an Alicia rabbit. Six of the clones appeared to encode VHa- molecules; the framework regions encoded by these clones were remarkably similar to each other, each having an unusual insertion of four amino acids at position 10. This insertion of four amino acids has been seen in only 2 of 54 sequenced rabbit VH genes. The similarity of the sequences of the six VHa- clones to each other and their dissimilarity to most other VH genes leads us to suggest that the VHa- molecules in Alicia rabbits are derived predominantly from one or a small number of very similar VH genes. Such preferential utilization of a small number of VH genes may explain the allelic inheritance of VH allotypes.
Lynn, K; Fernandez, A; Aida, M; Sedbrook, J; Tasaka, M; Masson, P; Barton, M K
1999-02-01
Several lines of evidence indicate that the adaxial leaf domain possesses a unique competence to form shoot apical meristems. Factors required for this competence are expected to cause a defect in shoot apical meristem formation when inactivated and to be expressed or active preferentially in the adaxial leaf domain. PINHEAD, a member of a family of proteins that includes the translation factor eIF2C, is required for reliable formation of primary and axillary shoot apical meristems. In addition to high-level expression in the vasculature, we find that low-level PINHEAD expression defines a novel domain of positional identity in the plant. This domain consists of adaxial leaf primordia and the meristem. These findings suggest that the PINHEAD gene product may be a component of a hypothetical meristem forming competence factor. We also describe defects in floral organ number and shape, as well as aberrant embryo and ovule development associated with pinhead mutants, thus elaborating on the role of PINHEAD in Arabidopsis development. In addition, we find that embryos doubly mutant for PINHEAD and ARGONAUTE1, a related, ubiquitously expressed family member, fail to progress to bilateral symmetry and do not accumulate the SHOOT MERISTEMLESS protein. Therefore PINHEAD and ARGONAUTE1 together act to allow wild-type growth and gene expression patterns during embryogenesis.
Fitzgibbon, J E; Howell, R M; Haberzettl, C A; Sperber, S J; Gocke, D J; Dubin, D T
1992-01-01
To investigate whether human immunodeficiency virus type 1 pol gene mutations are selected during prolonged 2',3'-dideoxycytidine (ddC) therapy, we used the polymerase chain reaction to amplify a portion of the reverse transcriptase segment of the pol gene from the peripheral blood mononuclear cell DNA of a patient with AIDS before and after an 80-week course of ddC therapy. The consensus sequence from the second sample contained a unique double mutation (ACT to GAT) in the codon for reverse transcriptase amino acid 69, causing substitution of aspartic acid (Asp) for the wild-type threonine (Thr). A mutation (ACA to ATA) also occurred in the codon for position 165, causing substitution of isoleucine (Ile) for Thr. The GAT (Asp) codon was introduced into the pol gene of a molecular clone of human immunodeficiency virus via site-directed mutagenesis. Following transfection, mutant and wild-type viruses were tested for susceptibility to ddC by a plaque reduction assay. The mutant virus was fivefold less susceptible to ddC than the wild type; cross-resistance to 3'-azido-3'-deoxythymidine or 2'3'-dideoxyinosine was not found. The Ile-165 mutation did not confer additional ddC resistance. The Asp-69 substitution may have contributed to the generation of resistant virus in this patient. Images PMID:1317143
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stevenson, Sean Ross; Kamisugi, Yasuko; Trinh, Chi H.
The anatomically simple plants that first colonized land must have acquired molecular and biochemical adaptations to drought stress. Abscisic acid (ABA) coordinates responses leading to desiccation tolerance in all land plants. We identified ABA nonresponsive mutants in the model bryophyte Physcomitrella patens and genotyped a segregating population to map and identify the ABA NON-RESPONSIVE (ANR) gene encoding a modular protein kinase comprising an N-terminal PAS domain, a central EDR domain, and a C-terminal MAPKKK-like domain. anr mutants fail to accumulate dehydration tolerance-associated gene products in response to drought, ABA, or osmotic stress and do not acquire ABA-dependent desiccation tolerance. Themore » crystal structure of the PAS domain, determined to 1.7-Å resolution, shows a conserved PAS-fold that dimerizes through a weak dimerization interface. Targeted mutagenesis of a conserved tryptophan residue within the PAS domain generates plants with ABA nonresponsive growth and strongly attenuated ABA-responsive gene expression, whereas deleting this domain retains a fully ABA-responsive phenotype. ANR orthologs are found in early-diverging land plant lineages and aquatic algae but are absent from more recently diverged vascular plants. Lastly, we propose that ANR genes represent an ancestral adaptation that enabled drought stress survival of the first terrestrial colonizers but were lost during land plant evolution.« less
MRE11 and RAD50, but not NBS1, are essential for gene targeting in the moss Physcomitrella patens.
Kamisugi, Yasuko; Schaefer, Didier G; Kozak, Jaroslav; Charlot, Florence; Vrielynck, Nathalie; Holá, Marcela; Angelis, Karel J; Cuming, Andrew C; Nogué, Fabien
2012-04-01
The moss Physcomitrella patens is unique among plant models for the high frequency with which targeted transgene insertion occurs via homologous recombination. Transgene integration is believed to utilize existing machinery for the detection and repair of DNA double-strand breaks (DSBs). We undertook targeted knockout of the Physcomitrella genes encoding components of the principal sensor of DNA DSBs, the MRN complex. Loss of function of PpMRE11 or PpRAD50 strongly and specifically inhibited gene targeting, whilst rates of untargeted transgene integration were relatively unaffected. In contrast, disruption of the PpNBS1 gene retained the wild-type capacity to integrate transforming DNA efficiently at homologous loci. Analysis of the kinetics of DNA-DSB repair in wild-type and mutant plants by single-nucleus agarose gel electrophoresis revealed that bleomycin-induced fragmentation of genomic DNA was repaired at approximately equal rates in each genotype, although both the Ppmre11 and Pprad50 mutants exhibited severely restricted growth and development and enhanced sensitivity to UV-B and bleomycin-induced DNA damage, compared with wild-type and Ppnbs1 plants. This implies that while extensive DNA repair can occur in the absence of a functional MRN complex; this is unsupervised in nature and results in the accumulation of deleterious mutations incompatible with normal growth and development.
MRE11 and RAD50, but not NBS1, are essential for gene targeting in the moss Physcomitrella patens
Kamisugi, Yasuko; Schaefer, Didier G.; Kozak, Jaroslav; Charlot, Florence; Vrielynck, Nathalie; Holá, Marcela; Angelis, Karel J.; Cuming, Andrew C.; Nogué, Fabien
2012-01-01
The moss Physcomitrella patens is unique among plant models for the high frequency with which targeted transgene insertion occurs via homologous recombination. Transgene integration is believed to utilize existing machinery for the detection and repair of DNA double-strand breaks (DSBs). We undertook targeted knockout of the Physcomitrella genes encoding components of the principal sensor of DNA DSBs, the MRN complex. Loss of function of PpMRE11 or PpRAD50 strongly and specifically inhibited gene targeting, whilst rates of untargeted transgene integration were relatively unaffected. In contrast, disruption of the PpNBS1 gene retained the wild-type capacity to integrate transforming DNA efficiently at homologous loci. Analysis of the kinetics of DNA-DSB repair in wild-type and mutant plants by single-nucleus agarose gel electrophoresis revealed that bleomycin-induced fragmentation of genomic DNA was repaired at approximately equal rates in each genotype, although both the Ppmre11 and Pprad50 mutants exhibited severely restricted growth and development and enhanced sensitivity to UV-B and bleomycin-induced DNA damage, compared with wild-type and Ppnbs1 plants. This implies that while extensive DNA repair can occur in the absence of a functional MRN complex; this is unsupervised in nature and results in the accumulation of deleterious mutations incompatible with normal growth and development. PMID:22210882
Metz, Sebastian; Hendriks, Johnny; Jäger, Andreas; Hellingwerf, Klaas; Klug, Gabriele
2010-01-01
The Rhodobacter sphaeroides protein AppA has the unique quality of sensing and transmitting light and redox signals. By acting as antirepressor to the PpsR protein, it acts as a major regulator in photosynthesis gene expression. In this study, we show that by introducing amino acid exchanges into the AppA protein, the in vivo activity as an antirepressor can be greatly altered. The tryptophan 104 to phenylalanine (W104F) base exchange greatly diminished blue-light sensitivity of the BLUF domain. From the obtained in vivo data, the difference in thermal recovery rate of the signaling state of the BLUF domain between the wild type and mutated protein was calculated, predicting an about 10-fold faster recovery in the mutant, which is consistent with in vitro data. Introduction of a tyrosine 21 to phenylalanine (Y21F) or to cysteine (Y21C) mutation led to a complete loss of AppA antirepressor activity, while additionally leading to an increase of photosynthesis gene expression after illumination with high blue-light quantities. Interestingly, this effect is not visible in a W104F/Y21F double mutant that again shows a wild-type-like behavior of the BLUF domain after blue-light illumination, thus restoring the activity of AppA.
The secondary resistome of multidrug-resistant Klebsiella pneumoniae.
Jana, Bimal; Cain, Amy K; Doerrler, William T; Boinett, Christine J; Fookes, Maria C; Parkhill, Julian; Guardabassi, Luca
2017-02-15
Klebsiella pneumoniae causes severe lung and bloodstream infections that are difficult to treat due to multidrug resistance. We hypothesized that antimicrobial resistance can be reversed by targeting chromosomal non-essential genes that are not responsible for acquired resistance but essential for resistant bacteria under therapeutic concentrations of antimicrobials. Conditional essentiality of individual genes to antimicrobial resistance was evaluated in an epidemic multidrug-resistant clone of K. pneumoniae (ST258). We constructed a high-density transposon mutant library of >430,000 unique Tn5 insertions and measured mutant depletion upon exposure to three clinically relevant antimicrobials (colistin, imipenem or ciprofloxacin) by Transposon Directed Insertion-site Sequencing (TraDIS). Using this high-throughput approach, we defined three sets of chromosomal non-essential genes essential for growth during exposure to colistin (n = 35), imipenem (n = 1) or ciprofloxacin (n = 1) in addition to known resistance determinants, collectively termed the "secondary resistome". As proof of principle, we demonstrated that inactivation of a non-essential gene not previously found linked to colistin resistance (dedA) restored colistin susceptibility by reducing the minimum inhibitory concentration from 8 to 0.5 μg/ml, 4-fold below the susceptibility breakpoint (S ≤ 2 μg/ml). This finding suggests that the secondary resistome is a potential target for developing antimicrobial "helper" drugs that restore the efficacy of existing antimicrobials.
Izquierdo, Luis; Coderch, Núria; Piqué, Nuria; Bedini, Emiliano; Michela Corsaro, Maria; Merino, Susana; Fresno, Sandra; Tomás, Juan M.; Regué, Miguel
2003-01-01
To determine the function of the wabG gene in the biosynthesis of the core lipopolysaccharide (LPS) of Klebsiella pneumoniae, we constructed wabG nonpolar mutants. Data obtained from the comparative chemical and structural analysis of LPS samples obtained from the wild type, the mutant strain, and the complemented mutant demonstrated that the wabG gene is involved in attachment to α-l-glycero-d-manno-heptopyranose II (l,d-HeppII) at the O-3 position of an α-d-galactopyranosyluronic acid (α-d-GalAp) residue. K. pneumoniae nonpolar wabG mutants were devoid of the cell-attached capsular polysaccharide but were still able to produce capsular polysaccharide. Similar results were obtained with K. pneumoniae nonpolar waaC and waaF mutants, which produce shorter LPS core molecules than do wabG mutants. Other outer core K. pneumoniae nonpolar mutants in the waa gene cluster were encapsulated. K. pneumoniae waaC, waaF, and wabG mutants were avirulent when tested in different animal models. Furthermore, these mutants were more sensitive to some hydrophobic compounds than the wild-type strains. All these characteristics were rescued by reintroduction of the waaC, waaF, and wabG genes from K. pneumoniae. PMID:14645282
Liu, Wanlu; Duttke, Sascha H; Hetzel, Jonathan; Groth, Martin; Feng, Suhua; Gallego-Bartolome, Javier; Zhong, Zhenhui; Kuo, Hsuan Yu; Wang, Zonghua; Zhai, Jixian; Chory, Joanne; Jacobsen, Steven E
2018-03-01
Small RNAs regulate chromatin modifications such as DNA methylation and gene silencing across eukaryotic genomes. In plants, RNA-directed DNA methylation (RdDM) requires 24-nucleotide small interfering RNAs (siRNAs) that bind to ARGONAUTE 4 (AGO4) and target genomic regions for silencing. RdDM also requires non-coding RNAs transcribed by RNA polymerase V (Pol V) that probably serve as scaffolds for binding of AGO4-siRNA complexes. Here, we used a modified global nuclear run-on protocol followed by deep sequencing to capture Pol V nascent transcripts genome-wide. We uncovered unique characteristics of Pol V RNAs, including a uracil (U) common at position 10. This uracil was complementary to the 5' adenine found in many AGO4-bound 24-nucleotide siRNAs and was eliminated in a siRNA-deficient mutant as well as in the ago4/6/9 triple mutant, suggesting that the +10 U signature is due to siRNA-mediated co-transcriptional slicing of Pol V transcripts. Expression of wild-type AGO4 in ago4/6/9 mutants was able to restore slicing of Pol V transcripts, but a catalytically inactive AGO4 mutant did not correct the slicing defect. We also found that Pol V transcript slicing required SUPPRESSOR OF TY INSERTION 5-LIKE (SPT5L), an elongation factor whose function is not well understood. These results highlight the importance of Pol V transcript slicing in RNA-mediated transcriptional gene silencing, which is a conserved process in many eukaryotes.
Bowman, Shaun M; Piwowar, Amy; Ciocca, Maria; Free, Stephen J
2005-01-01
Two Neurospora mutants with a phenotype that includes a tight colonial growth pattern, an inability to form conidia and an inability to form protoperithecia have been isolated and characterized. The relevant mutations were mapped to the same locus on the sequenced Neurospora genome. The mutations responsible for the mutant phenotype then were identified by examining likely candidate genes from the mutant genomes at the mapped locus with PCR amplification and a sequencing assay. The results demonstrate that a map and sequence strategy is a feasible way to identify mutant genes in Neurospora. The gene responsible for the phenotype is a putative alpha-1,2-mannosyltransferase gene. The mutant cell wall has an altered composition demonstrating that the gene functions in cell wall biosynthesis. The results demonstrate that the mnt-1 gene is required for normal cell wall biosynthesis, morphology and for the regulation of asexual development.
Ban, Jun-Gyu; Woo, Min-Woo; Lee, Bo-Ram; Lee, Mi-Jin; Choi, Si-Sun; Kim, Eung-Soo
2014-05-01
The regio-specific hydroxylation at the 4th N-methyl leucine of the immunosuppressive agent cyclosporin A (CsA) was previously proposed to be mediated by a unique cytochrome P450 hydroxylase (CYP), CYP-sb21 from the rare actinomycetes Sebekia benihana. Interestingly, a different rare actinomycetes species, Pseudonocardia autotrophica, was found to possess a different regio-selectivity, the preferential hydroxylation at the 9th N-methyl leucine of CsA. Through an in silico analysis of the whole genome of P. autotrophica, we describe here the classification of 31 total CYPs in P. autotrophica. Three putative CsA CYP genes, showing the highest sequence homologies with CYPsb21, were successfully inactivated using PCR-targeted gene disruption. Only one knock-out mutant, ΔCYP-pa1, failed to convert CsA to its hydroxylated forms. The hydroxylation activity of CsA by CYP-pa1 was confirmed by CYP-pa1 gene complementation as well as heterologous expression in the CsA non-hydroxylating Streptomyces coelicolor. Moreover, the cyclosporine regio-selectivity of CYP-pa1 expressed in the ΔCYP-sb21 S. benihana mutant strain was also confirmed unchanged through cross complementation. These results show that preferential regio-specific hydroxylation at the 9th N-methyl leucine of CsA is carried out by a specific P450 hydroxylase gene in P. autotrophica, CYP-pa1, setting the stage for the biotechnological application of CsA regioselective hydroxylation.
Zhao, Feng; Meng, Songsong; Zhou, Deqing
2016-02-04
To construct heptyl glycosyltransferase gene II (waaF) gene deletion mutant of Vibrio parahaemolyticus, and explore the function of the waaF gene in Vibrio parahaemolyticus. The waaF gene deletion mutant was constructed by chitin-based transformation technology using clinical isolates, and then the growth rate, morphology and serotypes were identified. The different sources (O3, O5 and O10) waaF gene complementations were constructed through E. coli S17λpir strains conjugative transferring with Vibrio parahaemolyticus, and the function of the waaF gene was further verified by serotypes. The waaF gene deletion mutant strain was successfully constructed and it grew normally. The growth rate and morphology of mutant were similar with the wild type strains (WT), but the mutant could not occurred agglutination reaction with O antisera. The O3 and O5 sources waaF gene complementations occurred agglutination reaction with O antisera, but the O10 sources waaF gene complementations was not. The waaF gene was related with O-antigen synthesis and it was the key gene of O-antigen synthesis pathway in Vibrio parahaemolyticus. The function of different sources waaF gene were not the same.
Elsheimer-Matulova, Marta; Varmuzova, Karolina; Kyrova, Kamila; Havlickova, Hana; Sisak, Frantisek; Rahman, Masudur; Rychlik, Ivan
2015-09-17
Poultry is the most frequent reservoir of non-typhoid Salmonella enterica for humans. Understanding the interactions between chickens and S. enterica is therefore important for vaccine design and subsequent decrease in the incidence of human salmonellosis. In this study we therefore characterized the interactions between chickens and phoP, aroA, SPI1 and SPI2 mutants of S. Enteritidis. First we tested the response of HD11 chicken macrophage-like cell line to S. Enteritidis infection monitoring the transcription of 36 genes related to immune response. All the mutants and the wild type strain induced inflammatory signaling in the HD11 cell line though the response to SPI1 mutant infection was different from the rest of the mutants. When newly hatched chickens were inoculated, the phoP as well as the SPI1 mutant did not induce an expression of any of the tested genes in the cecum. Despite this, such chickens were protected against challenge with wild-type S. Enteritidis. On the other hand, inoculation of chickens with the aroA or SPI2 mutant induced expression of 27 and 18 genes, respectively, including genes encoding immunoglobulins. Challenge of chickens inoculated with these two mutants resulted in repeated induction of 11 and 13 tested genes, respectively, including the genes encoding immunoglobulins. In conclusion, SPI1 and phoP mutants induced protective immunity without inducing an inflammatory response and antibody production. Inoculation of chickens with the SPI2 and aroA mutants also led to protective immunity but was associated with inflammation and antibody production. The differences in interaction between the mutants and chicken host can be used for a more detailed understanding of the chicken immune system.
Wang, Shu'an; Wang, Peng; Gao, Lulu; Yang, Rutong; Li, Linfang; Zhang, Enliang; Wang, Qing; Li, Ya; Yin, Zengfang
2017-05-01
Crape myrtle (Lagerstroemia indica) is a woody ornamental plant popularly grown because of its long-lasting, midsummer blooms and beautiful colors. The GL1 dominant mutant is the first chlorophyll-less mutant identified in crape myrtle. It was obtained from a natural yellow leaf bud mutation. We previously revealed that leaf color of the GL1 mutant is affected by light intensity. However, the mechanism of the GL1 mutant on light response remained unclear. The acclimation response of mutant and wild-type (WT) plants was assessed in a time series after transferring from low light (LL) to high light (HL) by analyzing chlorophyll synthesis precursor content, photosynthetic performance, and gene expression. In LL conditions, coproporphyrinogen III (Coprogen III) content had the greatest amount of accumulation in the mutant compared with WT, increasing by 100%. This suggested that the yellow leaf phenotype of the GL1 dominant mutant might be caused by disruption of coproporphyrinogen III oxidase (CPO) biosynthesis. Furthermore, the candidate gene, oxygen-independent CPO (HEMN), might only affect expression of upstream genes involved in chlorophyll metabolism in the mutant. Moreover, two genes, photosystem II (PSII) 10 kDa protein (psbR) and chlorophyll a/b binding protein gene (CAB1), had decreased mRNA levels in the GL1 mutant within the first 96 h following LL/HL transfer compared with the WT. Hierarchical clustering revealed that these two genes shared a similar expression trend as the oxygen-dependent CPO (HEMF). These findings provide evidence that GL1 is highly coordinated with PSII stability and chloroplast biogenesis.
Whippo, Craig W; Hangarter, Roger P
2005-09-01
The phototropic response of Arabidopsis (Arabidopsis thaliana) is induced by the phototropin photoreceptors and modulated by the cryptochrome and phytochrome photoreceptors. Downstream of these photoreceptors, asymmetric lateral redistribution of auxin underlies the differential growth, which results in phototropism. Historical physiological evidence and recent analysis of hormone-induced gene expression demonstrate that auxin and brassinosteroid signaling function interdependently. Similarly, in this study we report evidence that interactions between brassinosteroids and auxin signaling modulate phototropic responsiveness. We found that elongated, a previously identified photomorphogenesis mutant, enhances high-light phototropism and represents a unique allele of BAK1/SERK3, a receptor kinase implicated in brassinosteroid perception. Altogether, our results support the hypothesis that phototropic responsiveness is modulated by inputs that influence control of auxin response factor-mediated transcription.
Whippo, Craig W.; Hangarter, Roger P.
2005-01-01
The phototropic response of Arabidopsis (Arabidopsis thaliana) is induced by the phototropin photoreceptors and modulated by the cryptochrome and phytochrome photoreceptors. Downstream of these photoreceptors, asymmetric lateral redistribution of auxin underlies the differential growth, which results in phototropism. Historical physiological evidence and recent analysis of hormone-induced gene expression demonstrate that auxin and brassinosteroid signaling function interdependently. Similarly, in this study we report evidence that interactions between brassinosteroids and auxin signaling modulate phototropic responsiveness. We found that elongated, a previously identified photomorphogenesis mutant, enhances high-light phototropism and represents a unique allele of BAK1/SERK3, a receptor kinase implicated in brassinosteroid perception. Altogether, our results support the hypothesis that phototropic responsiveness is modulated by inputs that influence control of auxin response factor-mediated transcription. PMID:16126860
The Impact of ESR1 Mutations on the Treatment of Metastatic Breast Cancer.
Pejerrey, Sasha M; Dustin, Derek; Kim, Jin-Ah; Gu, Guowei; Rechoum, Yassine; Fuqua, Suzanne A W
2018-05-07
After nearly 20 years of research, it is now established that mutations within the estrogen receptor (ER) gene, ESR1, frequently occur in metastatic breast cancer and influence response to hormone therapy. Though early studies presented differing results, sensitive sequencing techniques now show that ESR1 mutations occur at a frequency between 20 and 40% depending on the assay method. Recent studies have focused on several "hot spot mutations," a cluster of mutations found in the hormone-binding domain of the ESR1 gene. Throughout the course of treatment, tumor evolution can occur, and ESR1 mutations emerge and become enriched in the metastatic setting. Sensitive techniques to continually monitor mutant burden in vivo are needed to effectively treat patients with mutant ESR1. The full impact of these mutations on tumor response to different therapies remains to be determined. However, recent studies indicate that mutant-bearing tumors may be less responsive to specific hormonal therapies, and suggest that aromatase inhibitor (AI) therapy may select for the emergence of ESR1 mutations. Additionally, different mutations may respond discretely to targeted therapies. The need for more preclinical mechanistic studies on ESR1 mutations and the development of better agents to target these mutations are urgently needed. In the future, sequential monitoring of ESR1 mutational status will likely direct personalized therapeutic regimens appropriate to each tumor's unique mutational landscape.
Yang, Jin Kuk; Park, Min S; Waldo, Geoffrey S; Suh, Se Won
2003-01-21
One of the serious bottlenecks in structural genomics projects is overexpression of the target proteins in soluble form. We have applied the directed evolution technique and prepared soluble mutants of the Mycobacterium tuberculosis Rv2002 gene product, the wild type of which had been expressed as inclusion bodies in Escherichia coli. A triple mutant I6TV47MT69K (Rv2002-M3) was chosen for structural and functional characterizations. Enzymatic assays indicate that the Rv2002-M3 protein has a high catalytic activity as a NADH-dependent 3alpha, 20beta-hydroxysteroid dehydrogenase. We have determined the crystal structures of a binary complex with NAD(+) and a ternary complex with androsterone and NADH. The structure reveals that Asp-38 determines the cofactor specificity. The catalytic site includes the triad Ser-140Tyr-153Lys-157. Additionally, it has an unusual feature, Glu-142. Enzymatic assays of the E142A mutant of Rv2002-M3 indicate that Glu-142 reverses the effect of Lys-157 in influencing the pKa of Tyr-153. This study suggests that the Rv2002 gene product is a unique member of the SDR family and is likely to be involved in steroid metabolism in M. tuberculosis. Our work demonstrates the power of the directed evolution technique as a general way of overcoming the difficulties in overexpressing the target proteins in soluble form.
Peer, Wendy Ann; Hosein, Fazeeda N.; Bandyopadhyay, Anindita; Makam, Srinivas N.; Otegui, Marisa S.; Lee, Gil-Je; Blakeslee, Joshua J.; Cheng, Yan; Titapiwatanakun, Boosaree; Yakubov, Bahktiyor; Bangari, Bharat; Murphy, Angus S.
2009-01-01
Aminopeptidase M1 (APM1), a single copy gene in Arabidopsis thaliana, encodes a metallopeptidase originally identified via its affinity for, and hydrolysis of, the auxin transport inhibitor 1-naphthylphthalamic acid (NPA). Mutations in this gene result in haploinsufficiency. Loss-of-function mutants show irregular, uncoordinated cell divisions throughout embryogenesis, affecting the shape and number of cotyledons and the hypophysis, and is seedling lethal at 5 d after germination due to root growth arrest. Quiescent center and cell cycle markers show no signals in apm1-1 knockdown mutants, and the ground tissue specifiers SHORTROOT and SCARECROW are misexpressed or mislocalized. apm1 mutants have multiple, fused cotyledons and hypocotyls with enlarged epidermal cells with cell adhesion defects. apm1 alleles show defects in gravitropism and auxin transport. Gravistimulation decreases APM1 expression in auxin-accumulating root epidermal cells, and auxin treatment increases expression in the stele. On sucrose gradients, APM1 occurs in unique light membrane fractions. APM1 localizes at the margins of Golgi cisternae, plasma membrane, select multivesicular bodies, tonoplast, dense intravacuolar bodies, and maturing metaxylem cells. APM1 associates with brefeldin A–sensitive endomembrane structures and the plasma membrane in cortical and epidermal cells. The auxin-related phenotypes and mislocalization of auxin efflux proteins in apm1 are consistent with biochemical interactions between APM1 and NPA. PMID:19531600
Gresham, David; Boer, Viktor M; Caudy, Amy; Ziv, Naomi; Brandt, Nathan J; Storey, John D; Botstein, David
2011-01-01
An essential property of all cells is the ability to exit from active cell division and persist in a quiescent state. For single-celled microbes this primarily occurs in response to nutrient deprivation. We studied the genetic requirements for survival of Saccharomyces cerevisiae when starved for either of two nutrients: phosphate or leucine. We measured the survival of nearly all nonessential haploid null yeast mutants in mixed populations using a quantitative sequencing method that estimates the abundance of each mutant on the basis of frequency of unique molecular barcodes. Starvation for phosphate results in a population half-life of 337 hr whereas starvation for leucine results in a half-life of 27.7 hr. To measure survival of individual mutants in each population we developed a statistical framework that accounts for the multiple sources of experimental variation. From the identities of the genes in which mutations strongly affect survival, we identify genetic evidence for several cellular processes affecting survival during nutrient starvation, including autophagy, chromatin remodeling, mRNA processing, and cytoskeleton function. In addition, we found evidence that mitochondrial and peroxisome function is required for survival. Our experimental and analytical methods represent an efficient and quantitative approach to characterizing genetic functions and networks with unprecedented resolution and identified genotype-by-environment interactions that have important implications for interpretation of studies of aging and quiescence in yeast.
Zhu, Jufen; Yu, Xinxu; Xie, Baogui; Gu, Xiaokui; Zhang, Zhenying; Li, Shaojie
2013-06-01
To gain insight into the regulatory mechanisms of oxidative stress responses in filamentous fungi, the genome-wide transcriptional response of Neurospora crassa to menadione was analysed by digital gene expression (DGE) profiling, which identified 779 upregulated genes and 576 downregulated genes. Knockout mutants affecting 130 highly-upregulated genes were tested for menadione sensitivity, which revealed that loss of the transcription factor siderophore regulation (SRE) (a transcriptional repressor for siderophore biosynthesis), catatase-3, cytochrome c peroxidase or superoxide dismutase 1 copper chaperone causes hypersensitivity to menadione. Deletion of sre dramatically increased transcription of the siderophore biosynthesis gene ono and the siderophore iron transporter gene sit during menadione stress, suggesting that SRE is required for repression of iron uptake under oxidative stress conditions. Contrary to its phenotype, the sre deletion mutant showed higher transcriptional levels of genes encoding reactive oxygen species (ROS) scavengers than wild type during menadione stress, which implies that the mutant suffers a higher level of oxidative stress than wild type. Uncontrolled iron uptake in the sre mutant might exacerbate cellular oxidative stress. This is the first report of a negative regulator of iron assimilation participating in the fungal oxidative stress response. In addition to SRE, eight other transcription factor genes were also menadione-responsive but their single gene knockout mutants showed wild-type menadione sensitivity. Two of them, named as mit-2 (menadione induced transcription factor-2) and mit-4 (menadione induced transcription factor-4), were selected for double mutant analysis. The double mutant was hypersensitive to menadione. Similarly, the double mutation of mit-2 and sre also had additive effects on menadione sensitivity, suggesting multiple transcription factors mediate oxidative stress resistance in an additive manner. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Mutants in the Mouse NuRD/Mi2 Component P66α Are Embryonic Lethal
Marino, Susan; Nusse, Roel
2007-01-01
Background The NuRD/Mi2 chromatin complex is involved in histone modifications and contains a large number of subunits, including the p66 protein. There are two mouse and human p66 paralogs, p66α and p66β. The functions of these genes are not clear, in part because there are no mutants available, except in invertebrate model systems. Methodology We made loss of function mutants in the mouse p66α gene (mp66α, official name Gatad2a, MGI:2384585). We found that mp66α is essential for development, as mutant embryos die around day 10 of embryogenesis. The gene is not required for normal blastocyst development or for implantation. The phenotype of mutant embryos and the pattern of gene expression in mutants are consistent with a role of mp66α in gene silencing. Conclusion mp66α is an essential gene, required for early mouse development. The lethal phenotype supports a role in execution of methylated DNA silencing. PMID:17565372
Yang, B; Qi, H; Gu, Z; Zhang, H; Chen, W; Chen, H; Chen, Y Q
2017-11-01
To assess the mechanism for conjugated linoleic acid (CLA) production in Lactobacillus plantarum ZS2058. CLA has attracted great interests for decades due to its health-associated benefits including anticancer, anti-atherogenic, anti-obesity and modulation of the immune system. A number of microbial CLA producers were widely reported including lactic acid bacteria. Lactobacillus plantarum ZS2058, an isolate from Chinese traditional fermented food, could convert LA to CLA with various intermediates. To characterize the genetic determinants for generating CLA, a cre-lox-based system was utilized to delete the genes encoding myosin cross-reactive antigen (MCRA), short-chain dehydrogenase/oxidoreductase (DH) and acetoacetate decarboxylase (DC) in Lact. plantarum ZS2058, respectively. Neither intermediate was detected in the corresponding gene deletion mutant. Meanwhile all those mutants could recover the ability to convert linoleic acid to CLA when the corresponding gene was completed. The results indicated that CLA production was a multiple-step reaction catalysed by triple-component linoleate isomerase system encoded by mcra, dh and dc. Multicomponent linoleic acid isomerase provided important results for illustration unique mechanism for CLA production in Lact. plantarum ZS2058. Lactobacilli with CLA production ability offer novel opportunities for functional food development. © 2017 The Society for Applied Microbiology.
Nguyen, Kieu T H; Adamkiewicz, Marta A; Hebert, Lauren E; Zygiel, Emily M; Boyle, Holly R; Martone, Christina M; Meléndez-Ríos, Carola B; Noren, Karen A; Noren, Christopher J; Hall, Marilena Fitzsimons
2014-10-01
A target-unrelated peptide (TUP) can arise in phage display selection experiments as a result of a propagation advantage exhibited by the phage clone displaying the peptide. We previously characterized HAIYPRH, from the M13-based Ph.D.-7 phage display library, as a propagation-related TUP resulting from a G→A mutation in the Shine-Dalgarno sequence of gene II. This mutant was shown to propagate in Escherichia coli at a dramatically faster rate than phage bearing the wild-type Shine-Dalgarno sequence. We now report 27 additional fast-propagating clones displaying 24 different peptides and carrying 14 unique mutations. Most of these mutations are found either in or upstream of the gene II Shine-Dalgarno sequence, but still within the mRNA transcript of gene II. All 27 clones propagate at significantly higher rates than normal library phage, most within experimental error of wild-type M13 propagation, suggesting that mutations arise to compensate for the reduced virulence caused by the insertion of a lacZα cassette proximal to the replication origin of the phage used to construct the library. We also describe an efficient and convenient assay to diagnose propagation-related TUPS among peptide sequences selected by phage display. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Finkelstein, Ruth; Gampala, Srinivas S L; Lynch, Tim J; Thomas, Terry L; Rock, Christopher D
2005-09-01
Abscisic acid-responsive gene expression is regulated by numerous transcription factors, including a subgroup of basic leucine zipper factors that bind to the conserved cis-acting sequences known as ABA-responsive elements. Although one of these factors, ABA-insensitive 5 (ABI5), was identified genetically, the paucity of genetic data for the other family members has left it unclear whether they perform unique functions or act redundantly to ABI5 or each other. To test for potential redundancy with ABI5, we identified the family members with most similar effects and interactions in transient expression systems (ABF3 and ABF1), then characterized loss-of-function lines for those loci. The abf1 and abf3 monogenic mutant lines had at most minimal effects on germination or seed-specific gene expression, but the enhanced ABA- and stress-resistance of abf3 abi5 double mutants revealed redundant action of these genes in multiple stress responses of seeds and seedlings. Although ABI5, ABF3, and ABF1 have some overlapping effects, they appear to antagonistically regulate each other's expression at specific stages. Consequently, loss of any one factor may be partially compensated by increased expression of other family members.
A neurotransmitter transporter encoded by the Drosophila inebriated gene
Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael
1996-01-01
Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579
Myxobacterium-Produced Antibiotic TA (Myxovirescin) Inhibits Type II Signal Peptidase
Xiao, Yao; Gerth, Klaus; Müller, Rolf
2012-01-01
Antibiotic TA is a macrocyclic secondary metabolite produced by myxobacteria that has broad-spectrum bactericidal activity. The structure of TA is unique, and its molecular target is unknown. Here, we sought to elucidate TA's mode of action (MOA) through two parallel genetic approaches. First, chromosomal Escherichia coli TA-resistant mutants were isolated. One mutant that showed specific resistance toward TA was mapped and resulted from an IS4 insertion in the lpp gene, which encodes an abundant outer membrane (Braun's) lipoprotein. In a second approach, the comprehensive E. coli ASKA plasmid library was screened for overexpressing clones that conferred TAr. This effort resulted in the isolation of the lspA gene, which encodes the type II signal peptidase that cleaves signal sequences from prolipoproteins. In whole cells, TA was shown to inhibit Lpp prolipoprotein processing, similar to the known LspA inhibitor globomycin. Based on genetic evidence and prior globomycin studies, a block in Lpp expression or prevention of Lpp covalent cell wall attachment confers TAr by alleviating a toxic buildup of mislocalized pro-Lpp. Taken together, these data argue that LspA is the molecular target of TA. Strikingly, the giant ta biosynthetic gene cluster encodes two lspA paralogs that we hypothesize play a role in producer strain resistance. PMID:22232277
Chi, Myoung-Hwan; Park, Sook-Young; Kim, Soonok; Lee, Yong-Hwan
2009-04-01
For successful colonization and further reproduction in host plants, pathogens need to overcome the innate defenses of the plant. We demonstrate that a novel pathogenicity gene, DES1, in Magnaporthe oryzae regulates counter-defenses against host basal resistance. The DES1 gene was identified by screening for pathogenicity-defective mutants in a T-DNA insertional mutant library. Bioinformatic analysis revealed that this gene encodes a serine-rich protein that has unknown biochemical properties, and its homologs are strictly conserved in filamentous Ascomycetes. Targeted gene deletion of DES1 had no apparent effect on developmental morphogenesis, including vegetative growth, conidial germination, appressorium formation, and appressorium-mediated penetration. Conidial size of the mutant became smaller than that of the wild type, but the mutant displayed no defects on cell wall integrity. The Deltades1 mutant was hypersensitive to exogenous oxidative stress and the activity and transcription level of extracellular enzymes including peroxidases and laccases were severely decreased in the mutant. In addition, ferrous ion leakage was observed in the Deltades1 mutant. In the interaction with a susceptible rice cultivar, rice cells inoculated with the Deltades1 mutant exhibited strong defense responses accompanied by brown granules in primary infected cells, the accumulation of reactive oxygen species (ROS), the generation of autofluorescent materials, and PR gene induction in neighboring tissues. The Deltades1 mutant displayed a significant reduction in infectious hyphal extension, which caused a decrease in pathogenicity. Notably, the suppression of ROS generation by treatment with diphenyleneiodonium (DPI), an inhibitor of NADPH oxidases, resulted in a significant reduction in the defense responses in plant tissues challenged with the Deltades1 mutant. Furthermore, the Deltades1 mutant recovered its normal infectious growth in DPI-treated plant tissues. These results suggest that DES1 functions as a novel pathogenicity gene that regulates the activity of fungal proteins, compromising ROS-mediated plant defense.
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Zhang, Zhengjing; Li, Yuanya
2016-01-01
The three tandemly arranged CBF genes, CBF1, CBF2, and CBF3, are involved in cold acclimation. Due to the lack of stable loss-of-function Arabidopsis (Arabidopsis thaliana) mutants deficient in all three CBF genes, it is still unclear whether the CBF genes are essential for freezing tolerance and whether they may have other functions besides cold acclimation. In this study, we used the CRISPR/Cas9 system to generate cbf single, double, and triple mutants. Compared to the wild type, the cbf triple mutants are extremely sensitive to freezing after cold acclimation, demonstrating that the three CBF genes are essential for cold acclimation. Our results show that the three CBF genes also contribute to basal freezing tolerance. Unexpectedly, we found that the cbf triple mutants are defective in seedling development and salt stress tolerance. Transcript profiling revealed that the CBF genes regulate 414 cold-responsive (COR) genes, of which 346 are CBF-activated genes and 68 are CBF-repressed genes. The analysis suggested that CBF proteins are extensively involved in the regulation of carbohydrate and lipid metabolism, cell wall modification, and gene transcription. Interestingly, like the triple mutants, cbf2 cbf3 double mutants are more sensitive to freezing after cold acclimation compared to the wild type, but cbf1 cbf3 double mutants are more resistant, suggesting that CBF2 is more important than CBF1 and CBF3 in cold acclimation-dependent freezing tolerance. Our results not only demonstrate that the three CBF genes together are required for cold acclimation and freezing tolerance, but also reveal that they are important for salt tolerance and seedling development. PMID:27252305
Ruan, Banpu; Kang, Shujing; He, Lei; Zhang, Sen; Dong, Guojun; Hu, Jiang; Zeng, Dali; Zhang, Guangheng; Gao, Zhenyu; Ren, Deyong; Hu, Xingming; Chen, Guang; Guo, Longbiao; Qian, Qian; Zhu, Li
2015-01-01
Ferredoxin (Fd) protein as unique electron acceptor, involved in a variety of fundamental metabolic and signaling processes, which is indispensable for plant growth. The molecular mechanisms of Fd such as regulation of electron partitioning, impact of photosynthetic rate and involvement in the carbon fixing remain elusive in rice. Here we reported a heading date delay and yellowish leaf 1 (hdy1) mutant derived from Japonica rice cultivar “Nipponbare” subjected to EMS treatment. In the paddy field, the hdy1 mutant appeared at a significantly late heading date and had yellow-green leaves during the whole growth stage. Further investigation indicated that the abnormal phenotype of hdy1 was connected with depressed pigment content and photosynthetic rate. Genetic analysis results showed that the hdy1 mutant phenotype was caused by a single recessive nuclear gene mutation. Map-based cloning revealed that OsHDY1 is located on chromosome 3 and encodes an ortholog of the AtFdC2 gene. Complementation and overexpression, transgenic plants exhibited the mutant phenotype including head date, leaf color and the transcription levels of the FdC2 were completely rescued by transformation with OsHDY1. Real-time PCR revealed that the expression product of OsHDY1 was detected in almost all of the organs except root, whereas highest expression levels were observed in seeding new leaves. The lower expression levels of HDY1 and content of iron were detected in hdy1 than WT’s. The FdC2::GFP was detected in the chloroplasts of rice. Real-time PCR results showed that the expression of many photosynthetic electron transfer related genes in hdy1 were higher than WT. Our results suggest that OsFdC2 plays an important role in photosynthetic rate and development of heading date by regulating electron transfer and chlorophyll content in rice. PMID:26598971
Gao, Chenfei; Gao, Zhanguo; Greenway, Frank L.; Burton, Jeffrey H.; Johnson, William D.; Keenan, Michael J.; Enright, Frederick M.; Martin, Roy J.; Chu, YiFang; Zheng, Jolene
2015-01-01
In addition to their fermentable dietary fiber and the soluble β-glucan fiber, oats have unique avenanthramides that have anti-inflammatory and antioxidant properties that reduce coronary heart disease in human clinical trials. We hypothesized that oat consumption will increase insulin sensitivity, reduce body fat, and improve health span in Caenorhabditis elegans through a mechanism involving the daf-2 gene, which codes for the insulin/insulin-like growth factor-1–like receptor, and that hyperglycemia will attenuate these changes. Caenorhabditis elegans wild type (N2) and the null strains sir-2.1, daf-16, and daf-16/daf-2 were fed Escherichia coli (OP50) and oat flakes (0.5%, 1.0%, or 3%) with and without 2% glucose. Oat feeding decreased intestinal fat deposition in N2, daf-16, or daf-16/daf-2 strains (P < .05); and glucose did not affect intestinal fat deposition response. The N2, daf-16, or sir-2.1 mutant increased the pharyngeal pumping rate (P < .05), a surrogate marker of life span, following oat consumption. Oat consumption increased ckr-1, gcy-8, cpt-1, and cpt-2 mRNA expression in both the N2 and the sir-2.1 mutant, with significantly higher expression in sir-2.1 than in N2 (P < .01). Additional glucose further increased expression 1.5-fold of the 4 genes in N2 (P < .01), decreased the expression of all except cpt-1 in the daf-16 mutant, and reduced mRNA expression of the 4 genes in the daf-16/daf-2 mutant (P < .01). These data suggest that oat consumption reduced fat storage and increased ckr-1, gcy-8, cpt-1, or cpt-2 through the sir-2.1 genetic pathway. Oat consumption may be a beneficial dietary intervention for reducing fat accumulation, augmenting health span, and improving hyperglycemia-impaired lipid metabolism. PMID:26253816
Al-Kaff, Nadia; Knight, Emilie; Bertin, Isabelle; Foote, Tracie; Hart, Nicola; Griffiths, Simon; Moore, Graham
2008-04-01
Understanding Ph1, a dominant homoeologous chromosome pairing suppressor locus on the long arm of chromosome 5B in wheat Triticum aestivum L., is the core of the investigation in this article. The Ph1 locus restricts chromosome pairing and recombination at meiosis to true homologues. The importance of wheat as a crop and the need to exploit its wild relatives as donors for economically important traits in wheat breeding programmes is the main drive to uncover the mechanism of the Ph1 locus and regulate its activity. Following the molecular genetic characterization of the Ph1 locus, five additional deletion mutants covering the region have been identified. In addition, more bacterial artificial chromosomes (BACs) were sequenced and analysed to elucidate the complexity of this locus. A semi-quantitative RT-PCR was used to compare the expression profiles of different genes in the 5B region containing the Ph1 locus with their homoeologues on 5A and 5D. PCR products were cloned and sequenced to identify the gene from which they were derived. Deletion mutants and expression profiling of genes in the region containing the Ph1 locus on 5B has further restricted Ph1 to a cluster of cdk-like genes. Bioinformatic analysis of the cdk-like genes revealed their close homology to the checkpoint kinase Cdk2 from humans. Cdk2 is involved in the initiation of replication and is required in early meiosis. Expression profiling has revealed that the cdk-like gene cluster is unique within the region analysed on 5B in that these genes are transcribed. Deletion of the cdk-like locus on 5B results in activation of transcription of functional cdk-like copies on 5A and 5D. Thus the cdk locus on 5B is dominant to those on 5A and 5D in determining the overall activity, which will be dependent on a complex interplay between transcription from non-functional and functional cdk-like genes. The Ph1 locus has been defined to a cdk-like gene cluster related to Cdk2 in humans, a master checkpoint gene involved in the initiation of replication and required for early meiosis.
Wang, Pingyang; Qiu, Zhiyong; Xia, Dingguo; Tang, Shunming; Shen, Xingjia; Zhao, Qiaoling
2017-01-01
A new purple quail-like (q-lp) mutant found from the plain silkworm strain 932VR has pigment dots on the epidermis similar to the pigment mutant quail (q). In addition, q-lp mutant larvae are inactive, consume little and grow slowly, with a high death rate and other developmental abnormalities. Pigmentation of the silkworm epidermis consists of melanin, ommochrome and pteridine. Silkworm development is regulated by ecdysone and juvenile hormone. In this study, we performed RNA-Seq on the epidermis of the q-lp mutant in the 4th instar during molting, with 932VR serving as the control. The results showed 515 differentially expressed genes, of which 234 were upregulated and 281 downregulated in q-lp. BLASTGO analysis indicated that the downregulated genes mainly encode protein-binding proteins, membrane components, oxidation/reduction enzymes, and proteolytic enzymes, whereas the upregulated genes largely encode cuticle structural constituents, membrane components, transport related proteins, and protein-binding proteins. Quantitative reverse transcription PCR was used to verify the accuracy of the RNA-Seq data, focusing on key genes for biosynthesis of the three pigments and chitin as well as genes encoding cuticular proteins and several related nuclear receptors, which are thought to play key roles in the q-lp mutant. We drew three conclusions based on the results: 1) melanin, ommochrome and pteridine pigments are all increased in the q-lp mutant; 2) more cuticle proteins are expressed in q-lp than in 932VR, and the number of upregulated cuticular genes is significantly greater than downregulated genes; 3) the downstream pathway regulated by ecdysone is blocked in the q-lp mutant. Our research findings lay the foundation for further research on the developmental changes responsible for the q-lp mutant.
Li, M; Zhang, H Y; Liang, B
2013-01-01
Twelve-low resistant (LR) mutants of Trichoderma harzianum with the capability of grow fast at 0.8 μg/mL methyl benzimidazol-2-yl carbamate (MBC) were obtained using UV mutagenesis. MR and HR mutants which could grow fast at 10 and 100 μg/mL MBC, respectively, were isolated by step-up selection protocols in which UV-treated mutants were induced and mycelial sector screening was made in plates with growth medium. Subsequently, β-tubulin genes of 14 mutants were cloned to describe-the molecular lesion likely to be responsible-for MBC resistance. Comparison of the β-tubulin sequences of the mutant and sensitive strains of T. harzianum revealed 2 new MBC-binding sites differed from those in other plant pathogens. A single mutation at-amino acid 168, having Phe (TTC) instead of Ser (TCC)', was demonstrated for the HR mutant; a double mutation in amino acid 13 resulting in the substitution of Gly (GGC) by Val (GTG) was observed in β-tubulin gene of MR mutant. On the other hand, no substitutions were identified in the β-tubulin gene and its 5'-flanking regions in 12 LR mutants of T. harzianum.
Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang
2014-02-10
Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.
Polarity-defective mutants of Aspergillus nidulans.
Osherov, N; Mathew, J; May, G S
2000-12-01
We have identified two polarity-defective (pod) mutants in Aspergillus nidulans from a collection of heat-sensitive lethal mutants. At restrictive temperature, these mutants are capable of nuclear division but are unable to establish polar hyphal growth. We cloned the two pod genes by complementation of their heat-sensitive lethal phenotypes. The libraries used to clone the pod genes are under the control of the bidirectional niaD and niiA promoters. Complementation of the pod mutants is dependent on growth on inducing medium. We show that rescue of the heat-sensitive phenotype on inducing media is independent of the orientation of the gene relative to the niaD or niiA promoters, demonstrating that the intergenic region between the niaD and the niiA genes functions as an orientation-independent enhancer and repressor that is capable of functioning over long distances. The products of the podG and the podH genes were identified as homologues of the alpha subunit of yeast mitochondrial phenylalanyl--tRNA synthetase and transcription factor IIF interacting component of the CTD phosphatase. Neither of these gene products would have been predicted to produce a pod mutant phenotype based on studies of cellular polarity mutants in other organisms. The implications of these results are discussed. Copyright 2000 Academic Press.
Bidard, Frédérique; Coppin, Evelyne; Silar, Philippe
2012-08-01
Transcription pattern during mycelium growth of Podospora anserina was assayed by microarray analysis in wild type and in mutants affected in the MAP kinase genes PaMpk1 and PaMpk2 and in the NADPH oxidase gene PaNox1. 15% of the genes have their expression modified by a factor two or more as growth proceeds in wild type. The genes whose expression is modified during growth in P. anserina are either not conserved or differently regulated in Neurospora crassa and Aspergillus niger, two fungi for which transcriptome data during growth are available. The P. anserina mutants display a similar alteration of their transcriptome profile, with nearly 1000 genes affected similarly in the three mutants, accounting for their similar growth phenotypes. Yet, each mutant has its specific set of modified transcripts, in line with particular phenotypes exhibited by each mutant. Again, there is limited conservation during evolution of the genes regulated at the transcription level by MAP kinases, as indicated by the comparison the P. anserina data, with those of Aspergillus fumigatus and N. crassa, two fungi for which gene expression data are available for mutants of the MAPK pathways. Among the genes regulated in wild type and affected in the mutants, those involved in carbohydrate and secondary metabolisms appear prominent. The vast majority of the genes differentially expressed are of unknown function. Availability of their transcription profile at various stages of development should help to decipher their role in fungal physiology and development. Copyright © 2012 Elsevier Inc. All rights reserved.
Nair, Aswathy; Bhargava, Sujata
2012-01-01
Comparison of the expression of 13 genes involved in arbuscular mycorrhizal (AM) symbiosis was performed in a wild type tomato (Solanum lycopersicum cv 76R) and its reduced mycorrhizal colonization mutant rmc in response to colonization with Glomus fasiculatum. Four defense-related genes were induced to a similar extent in the mutant and wild type AM colonized plants, indicating a systemic response to AM colonization. Genes related to nutrient exchange between the symbiont partners showed higher expression in the AM roots of wild type plants than the mutant plants, which correlated with their arbuscular frequency. A symbiosis receptor kinase that is involved in both nodulation and AM symbiosis was not expressed in the rmc mutant. The fact that some colonization was observed in rmc was suggestive of the existence of an alternate colonization signaling pathway for AM symbiosis in this mutant. PMID:23221680
Gene Signature in Sessile Serrated Polyps Identifies Colon Cancer Subtype
Kanth, Priyanka; Bronner, Mary P.; Boucher, Kenneth M.; Burt, Randall W.; Neklason, Deborah W.; Hagedorn, Curt H.; Delker, Don A.
2016-01-01
Sessile serrated colon adenoma/polyps (SSA/Ps) are found during routine screening colonoscopy and may account for 20–30% of colon cancers. However, differentiating SSA/Ps from hyperplastic polyps (HP) with little risk of cancer is challenging and complementary molecular markers are needed. Additionally, the molecular mechanisms of colon cancer development from SSA/Ps are poorly understood. RNA sequencing was performed on 21 SSA/Ps, 10 HPs, 10 adenomas, 21 uninvolved colon and 20 control colon specimens. Differential expression and leave-one-out cross validation methods were used to define a unique gene signature of SSA/Ps. Our SSA/P gene signature was evaluated in colon cancer RNA-Seq data from The Cancer Genome Atlas (TCGA) to identify a subtype of colon cancers that may develop from SSA/Ps. A total of 1422 differentially expressed genes were found in SSA/Ps relative to controls. Serrated polyposis syndrome (n=12) and sporadic SSA/Ps (n=9) exhibited almost complete (96%) gene overlap. A 51-gene panel in SSA/P showed similar expression in a subset of TCGA colon cancers with high microsatellite instability (MSI-H). A smaller seven-gene panel showed high sensitivity and specificity in identifying BRAF mutant, CpG island methylator phenotype high (CIMP-H) and MLH1 silenced colon cancers. We describe a unique gene signature in SSA/Ps that identifies a subset of colon cancers likely to develop through the serrated pathway. These gene panels may be utilized for improved differentiation of SSA/Ps from HPs and provide insights into novel molecular pathways altered in colon cancer arising from the serrated pathway. PMID:27026680
Huai, Zexun; Peng, Lishun; Wang, Sheliang; Zhao, Hua; Shi, Lei; Xu, Fangsen
2018-01-01
Boron (B) is an essential micronutrient of plants. In the present study, we characterized an Arabidopsis mutant lbt with significant low-boron tolerance that was identified based on our previous mapping of QTL for B efficiency in Arabidopsis. Multiple nutrient-deficiency analyses point out that lbt mutant is insensitive to only B-limitation stress. Compared with wild-type Col-0, the fresh weight, leaf area, root length and root elongation rate of lbt mutant were significantly improved under B deficiency during vegetative growth. lbt mutant also showed the improvements in plant height, branches and inflorescences compared with Col-0 during the reproductive stage under B limitation. Ultrastructure analysis of the leaves showed that starch accumulation in lbt mutant was significantly diminished compared with Col-0. Furthermore, there were no significant differences in the expression of transporter-related genes and B concentrations between Col-0 and lbt mutant under both normal B and low-B conditions. These results suggest that lbt mutant has a lower B demand than Col-0. Genetic analysis suggests that the low-B tolerant phenotype of lbt mutant is under the control of a monogenic recessive gene. Based on the high-density SNP linkage genetic map, only one QTL for low-B tolerance was mapped on chromosome 4 between 10.4 and 14.8 Mb. No any reported B-relative genes exist in the QTL interval, suggesting that a gene with unknown function controls the tolerance of lbt to B limitation. Taken together, lbt is a low-B tolerant mutant that does not depend on the uptake or transport of B and is controlled by a monogenic recessive gene mapped on chromosome 4, and cloning and functional analysis of LBT gene are expected to reveal novel mechanisms for plant resistance to B deficiency.
Falcone, D L; Tabita, F R
1991-01-01
A Rhodobacter sphaeroides ribulose 1,5-bisphosphate carboxylase-oxygenase (RubisCO) deletion strain was constructed that was complemented by plasmids containing either the form I or form II CO2 fixation gene cluster. This strain was also complemented by genes encoding foreign RubisCO enzymes expressed from a Rhodospirillum rubrum RubisCO promoter. In R. sphaeroides, the R. rubrum promoter was regulated, resulting in variable levels of disparate RubisCO molecules under different growth conditions. Photosynthetic growth of the R. sphaeroides deletion strain complemented with cyanobacterial RubisCO revealed physiological properties reflective of the unique cellular environment of the cyanobacterial enzyme. The R. sphaeroides RubisCO deletion strain and R. rubrum promoter system may be used to assess the properties of mutagenized proteins in vivo, as well as provide a potential means to select for altered RubisCO molecules after random mutagenesis of entire genes or gene regions encoding RubisCO enzymes. Images PMID:1900508
Evolution of a mass spectrometry-grade protease with PTM-directed specificity.
Tran, Duc T; Cavett, Valerie J; Dang, Vuong Q; Torres, Héctor L; Paegel, Brian M
2016-12-20
Mapping posttranslational modifications (PTMs), which diversely modulate biological functions, represents a significant analytical challenge. The centerpiece technology for PTM site identification, mass spectrometry (MS), requires proteolytic cleavage in the vicinity of a PTM to yield peptides for sequencing. This requirement catalyzed our efforts to evolve MS-grade mutant PTM-directed proteases. Citrulline, a PTM implicated in epigenetic and immunological function, made an ideal first target, because citrullination eliminates arginyl tryptic sites. Bead-displayed trypsin mutant genes were translated in droplets, the mutant proteases were challenged to cleave bead-bound fluorogenic probes of citrulline-dependent proteolysis, and the resultant beads (1.3 million) were screened. The most promising mutant efficiently catalyzed citrulline-dependent peptide bond cleavage (k cat /K M = 6.9 × 10 5 M -1 ⋅s -1 ). The resulting C-terminally citrullinated peptides generated characteristic isotopic patterns in MALDI-TOF MS, and both a fragmentation product y 1 ion corresponding to citrulline (176.1030 m/z) and diagnostic peak pairs in the extracted ion chromatograms of LC-MS/MS analysis. Using these signatures, we identified citrullination sites in protein arginine deiminase 4 (12 sites) and in fibrinogen (25 sites, two previously unknown). The unique mass spectral features of PTM-dependent proteolytic digest products promise a generalized PTM site-mapping strategy based on a toolbox of such mutant proteases, which are now accessible by laboratory evolution.
Engineering disease resistance with pectate lyase-like genes
Vogel, John; Somerville, Shauna
2005-03-08
A mutant gene coding for pectate lyase and homologs thereof is provided, which when incorporated in transgenic plants effect an increased level disease resistance in such plants. Also is provided the polypeptide sequence for the pectate lyase of the present invention. Methods of obtaining the mutant gene, producing transgenic plants which include the nucleotide sequence for the mutant gene and producing improved disease resistance in a crop of such transgenic plants are also provided.
Electron microscopy of lamin and the nuclear lamina in Caenorhabditis elegans.
Cohen, Merav; Santarella, Rachel; Wiesel, Naama; Mattaj, Iain; Gruenbaum, Yosef
2008-01-01
The nuclear lamina is found between the inner nuclear membrane and the peripheral chromatin. Lamins are the main components of the nuclear lamina, where they form protein complexes with integral proteins of the inner nuclear membrane, transcriptional regulators, histones and chromatin modifiers. Lamins are required for mechanical stability, chromatin organization, Pol II transcription, DNA replication, nuclear assembly, and nuclear positioning. Mutations in human lamins cause at least 13 distinct human diseases, collectively termed laminopathies, affecting muscle, adipose, bone, nerve and skin cells, and range from muscular dystrophies to accelerated aging. Caenorhabditis elegans has unique advantages in studying lamins and nuclear lamina genes including low complexity of lamina genes and the unique ability of bacterially expressed C. elegans lamin protein to form stable 10 nm fibers. In addition, transgenic techniques, simple application of RNA interference, sophisticated genetic analyses, and the production of a large collection of mutant lines, all make C. elegans especially attractive for studying the functions of its nuclear lamina genes. In this chapter we will include a short review of our current knowledge of nuclear lamina in C. elegans and will describe electron microscopy techniques used for their analyses.
Jobe, Timothy O.; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A.; Mendoza-Cózatl, David G.; Schroeder, Julian I.
2015-01-01
Summary Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M2 seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. PMID:22283708
Bialek-Davenet, Suzanne; Marcon, Estelle; Leflon-Guibout, Véronique; Lavigne, Jean-Philippe; Bert, Frédéric; Moreau, Richard; Nicolas-Chanoine, Marie-Hélène
2011-01-01
The relationship between efflux system overexpression and cross-resistance to cefoxitin, quinolones, and chloramphenicol has recently been reported in Klebsiella pneumoniae. In 3 previously published clinical isolates and 17 in vitro mutants selected with cefoxitin or fluoroquinolones, mutations in the potential regulator genes of the AcrAB efflux pump (acrR, ramR, ramA, marR, marA, soxR, soxS, and rob) were searched, and their impacts on efflux-related antibiotic cross-resistance were assessed. All mutants but 1, and 2 clinical isolates, overexpressed acrB. No mutation was detected in the regulator genes studied among the clinical isolates and 8 of the mutants. For the 9 remaining mutants, a mutation was found in the ramR gene in 8 of them and in the soxR gene in the last one, resulting in overexpression of ramA and soxS, respectively. Transformation of the ramR mutants and the soxR mutant with the wild-type ramR and soxR genes, respectively, abolished overexpression of acrB and ramA in the ramR mutants and of soxS in the soxR mutant, as well as antibiotic cross-resistance. Resistance due to efflux system overexpression was demonstrated for 4 new antibiotics: cefuroxime, cefotaxime, ceftazidime, and ertapenem. This study shows that the ramR and soxR genes control the expression of efflux systems in K. pneumoniae and suggests the existence of efflux pumps other than AcrAB and of other loci involved in the regulation of AcrAB expression. PMID:21464248
Banu, Liliana Danusia; Conrads, Georg; Rehrauer, Hubert; Hussain, Haitham; Allan, Elaine; van der Ploeg, Jan R.
2010-01-01
Bacteria can detect, transmit, and react to signals from the outside world by using two-component systems (TCS) and serine-threonine kinases and phosphatases. Streptococcus mutans contains one serine-threonine kinase, encoded by pknB. A gene encoding a serine-threonine phosphatase, pppL, is located upstream of pknB. In this study, the phenotypes of pknB and pppL single mutants and a pknB pppL double mutant were characterized. All mutants exhibited a reduction in genetic transformability and biofilm formation, showed abnormal cell shapes, grew slower than the wild-type strain in several complex media, and exhibited reduced acid tolerance. The mutants had reduced cariogenic capacity but no significant defects in colonization in a rat caries model. Whole-genome transcriptome analysis revealed that a pknB mutant showed reduced expression of genes involved in bacteriocin production and genetic competence. Among the genes that were differentially regulated in the pknB mutant, several were likely to be involved in cell wall metabolism. One such gene, SMU.2146c, and two genes encoding bacteriocins were shown to also be downregulated in a vicK mutant, which encodes a sensor kinase involved in the response to oxidative stress. Collectively, the results lead us to speculate that PknB may modulate the activity of the two-component signal transduction systems VicKR and ComDE. Real-time reverse transcriptase PCR (RT-PCR) showed that genes downregulated in the pknB mutant were upregulated in the pppL mutant, indicating that PppL serves to counteract PknB. PMID:20231406
Banu, Liliana Danusia; Conrads, Georg; Rehrauer, Hubert; Hussain, Haitham; Allan, Elaine; van der Ploeg, Jan R
2010-05-01
Bacteria can detect, transmit, and react to signals from the outside world by using two-component systems (TCS) and serine-threonine kinases and phosphatases. Streptococcus mutans contains one serine-threonine kinase, encoded by pknB. A gene encoding a serine-threonine phosphatase, pppL, is located upstream of pknB. In this study, the phenotypes of pknB and pppL single mutants and a pknB pppL double mutant were characterized. All mutants exhibited a reduction in genetic transformability and biofilm formation, showed abnormal cell shapes, grew slower than the wild-type strain in several complex media, and exhibited reduced acid tolerance. The mutants had reduced cariogenic capacity but no significant defects in colonization in a rat caries model. Whole-genome transcriptome analysis revealed that a pknB mutant showed reduced expression of genes involved in bacteriocin production and genetic competence. Among the genes that were differentially regulated in the pknB mutant, several were likely to be involved in cell wall metabolism. One such gene, SMU.2146c, and two genes encoding bacteriocins were shown to also be downregulated in a vicK mutant, which encodes a sensor kinase involved in the response to oxidative stress. Collectively, the results lead us to speculate that PknB may modulate the activity of the two-component signal transduction systems VicKR and ComDE. Real-time reverse transcriptase PCR (RT-PCR) showed that genes downregulated in the pknB mutant were upregulated in the pppL mutant, indicating that PppL serves to counteract PknB.
Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.
Wang, Limei; Beer, Steven V
2006-12-01
To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.
Toyama, H; Anthony, C; Lidstrom, M E
1998-09-01
Methylobacterium extorquens AM1 is a pink-pigmented facultative methylotroph which is widely used for analyzing pathways of C1 metabolism with biochemical and molecular biological techniques. To facilitate this approach, we have applied a new method to construct insertion or disruption mutants with drug resistance genes by electroporation. By using this method, mutants were obtained in four genes present in the mxa methylotrophy gene cluster for which the functions were unknown, mxaR, mxaS, mxaC and mxaD. These mutants were unable to grow on methanol except the mutant of mxaD, which showed reduced growth on methanol.
NASA Astrophysics Data System (ADS)
Zhou, Yuping; Zhang, Qi
2018-04-01
In the information environment, digital and information processing to Li brocade patterns reveals an important means of Li ethnic style and inheriting the national culture. Adobe Illustrator CS3 and Java language were used in the paper to make "variation" processing to Li brocade patterns, and generate "Li brocade pattern mutant genes". The generation of pattern mutant genes includes color mutation, shape mutation, adding and missing transform, and twisted transform, etc. Research shows that Li brocade pattern mutant genes can be generated by using the Adobe Illustrator CS3 and the image processing tools of Java language edit, etc.
Metts, J; West, J; Doares, S H; Matthysse, A G
1991-02-01
Three Agrobacterium tumefaciens mutants with chromosomal mutations that affect bacterial virulence were isolated by transposon mutagenesis. Two of the mutants were avirulent on all hosts tested. The third mutant, Ivr-211, was a host range mutant which was avirulent on Bryophyllum diagremontiana, Nicotiana tabacum, N. debneyi, N. glauca, and Daucus carota but was virulent on Zinnia elegans and Lycopersicon esculentum (tomato). That the mutant phenotype was due to the transposon insertion was determined by cloning the DNA containing the transposon insertion and using the cloned DNA to replace the wild-type DNA in the parent bacterial strain by marker exchange. The transposon insertions in the three mutants mapped at three widely separated locations on the bacterial chromosome. The effects of the mutations on various steps in tumor formation were examined. All three mutants showed no alteration in binding to carrot cells. However, none of the mutants showed any induction of vir genes by acetosyringone under conditions in which the parent strain showed vir gene induction. When the mutant bacteria were examined for changes in surface components, it was found that all three of the mutants showed a similar alteration in lipopolysaccharide (LPS). LPS from the mutants was larger in size and more heavily saccharide substituted than LPS from the parent strain. Two of the mutants showed no detectable alteration in outer membrane and periplasmic space proteins. The third mutant, Ivr-225, was missing a 79-kDa surface peptide. The reason(s) for the failure of vir gene induction in these mutants and its relationship, if any, to the observed alteration in LPS are unknown.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bastien, C.; Machlin, S.; Zhang, Y.
Restriction maps of genes required for the synthesis of active methanol dehydrogenase in Methylobacterium organophilum XX and Methylobacterium sp. strain AM1 have been completed and compared. In these two species of pink-pigmented, type II methylotrophs, 15 genes were identified that were required for the expression of methanol dehydrogenase activity. None of these genes were required for the synthesis of the prosthetic group of methanol dehydrogenase, pyrroloquinoline quinone. The structural gene required for the synthesis of cytochrome c{sub L}, an electron acceptor uniquely required for methanol dehydrogenase, and the genes encoding small basic peptides that copurified with methanol dehydrogenases were closelymore » linked to the methanol dehydrogenase structural genes. A cloned 22-kilobase DNA insert from Methylsporovibrio methanica 81Z, an obligate type II methanotroph, complemented mutants that contained lesions in four genes closely linked to the methanol dehydrogenase structural genes. The methanol dehydrogenase and cytochrome c{sub L} structural genes were found to be transcribed independently in M. organophilum XX. Only two of the genes required for methanol dehydrogenase synthesis in this bacterium were found to be cotranscribed.« less
2012-01-01
Background As many invertebrate species have multipotent cells that undergo cell growth and differentiation during regeneration and budding, many unique and interesting homeostatic factors are expected to exist in those animals. However, our understanding of such factors and global mechanisms remains very poor. Single zooids of the tunicate, Polyandrocarpa misakiensis, can give off as many as 40 buds during the life span. Bud development proceeds by means of transdifferentiation of very limited number of cells and tissues. TC14-3 is one of several different but closely related polypeptides isolated from P. misakiensis. It acts as a cytostatic factor that regulates proliferation, adhesion, and differentiation of multipotent cells, although the molecular mechanism remains uncertain. The Polycomb group (PcG) genes are involved in epigenetic control of genomic activity in mammals. In invertebrates except Drosophila, PcG and histone methylation have not been studied so extensively, and genome-wide gene regulation is poorly understood. Results When Phe65 of TC14-3 was mutated to an acidic amino acid, the resultant mutant protein failed to dimerize. The replacement of Thr69 with Arg69 made dimers unstable. When Glu106 was changed to Gly106, the resultant mutant protein completely lost Ca2+ binding. All these mutant proteins lacked cytostatic activity, indicating the requirement of protein dimerization and calcium for the activity. Polyandrocarpa Eed, a component of PcG, is highly expressed during budding, like TC14-3. When wild-type and mutant TC14-3s were applied in vivo and in vitro to Polyandrocarpa cells, only wild-type TC14-3 could induce Eed without affecting histone methyltransferase gene expression. Eed-expressing cells underwent trimethylation of histone H3 lysine27. PmEed knockdown by RNA interference rescued cultured cells from the growth-inhibitory effects of TC14-3. Conclusion These results show that in P. misakiensis, the cytostatic activity of TC14-3 is mediated by PmEed and resultant histone modification, and that the gene expression requires both the protein dimerization and Ca2+-binding of TC14-3. This system consisting of a humoral factor, PcG, and histone methylation would contribute to the homeostatic regulation of cell growth and terminal differentiation of invertebrate multipotent cells. PMID:22296827
White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M
2018-03-28
A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.
Mutant phenotypes for thousands of bacterial genes of unknown function
Price, Morgan N.; Wetmore, Kelly M.; Waters, R. Jordan; ...
2018-05-16
One-third of all protein-coding genes from bacterial genomes cannot be annotated with a function. Here, to investigate the functions of these genes, we present genome-wide mutant fitness data from 32 diverse bacteria across dozens of growth conditions. We identified mutant phenotypes for 11,779 protein-coding genes that had not been annotated with a specific function. Many genes could be associated with a specific condition because the gene affected fitness only in that condition, or with another gene in the same bacterium because they had similar mutant phenotypes. Of the poorly annotated genes, 2,316 had associations that have high confidence because theymore » are conserved in other bacteria. By combining these conserved associations with comparative genomics, we identified putative DNA repair proteins; in addition, we propose specific functions for poorly annotated enzymes and transporters and for uncharacterized protein families. Lastly, our study demonstrates the scalability of microbial genetics and its utility for improving gene annotations.« less
Mutant phenotypes for thousands of bacterial genes of unknown function
DOE Office of Scientific and Technical Information (OSTI.GOV)
Price, Morgan N.; Wetmore, Kelly M.; Waters, R. Jordan
One-third of all protein-coding genes from bacterial genomes cannot be annotated with a function. Here, to investigate the functions of these genes, we present genome-wide mutant fitness data from 32 diverse bacteria across dozens of growth conditions. We identified mutant phenotypes for 11,779 protein-coding genes that had not been annotated with a specific function. Many genes could be associated with a specific condition because the gene affected fitness only in that condition, or with another gene in the same bacterium because they had similar mutant phenotypes. Of the poorly annotated genes, 2,316 had associations that have high confidence because theymore » are conserved in other bacteria. By combining these conserved associations with comparative genomics, we identified putative DNA repair proteins; in addition, we propose specific functions for poorly annotated enzymes and transporters and for uncharacterized protein families. Lastly, our study demonstrates the scalability of microbial genetics and its utility for improving gene annotations.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.
Mutant phenotypes provide strong clues to the functions of the underlying genes and could allow annotation of the millions of sequenced yet uncharacterized bacterial genes. However, it is not known how many genes have a phenotype under laboratory conditions, how many phenotypes are biologically interpretable for predicting gene function, and what experimental conditions are optimal to maximize the number of genes with a phenotype. To address these issues, we measured the mutant fitness of 1,586 genes of the ethanol-producing bacterium Zymomonas mobilis ZM4 across 492 diverse experiments and found statistically significant phenotypes for 89% of all assayed genes. Thus, inmore » Z. mobilis, most genes have a functional consequence under laboratory conditions. We demonstrate that 41% of Z. mobilis genes have both a strong phenotype and a similar fitness pattern (cofitness) to another gene, and are therefore good candidates for functional annotation using mutant fitness. Among 502 poorly characterized Z. mobilis genes, we identified a significant cofitness relationship for 174. For 57 of these genes without a specific functional annotation, we found additional evidence to support the biological significance of these gene-gene associations, and in 33 instances, we were able to predict specific physiological or biochemical roles for the poorly characterized genes. Last, we identified a set of 79 diverse mutant fitness experiments in Z. mobilis that are nearly as biologically informative as the entire set of 492 experiments. Therefore, our work provides a blueprint for the functional annotation of diverse bacteria using mutant fitness.« less
van Winden, Vincent J. C.; Sparrius, Marion; van de Weerd, Robert; Speer, Alexander; Ummels, Roy; Sherman, David R.
2017-01-01
The cell envelope of mycobacteria is a highly unique and complex structure that is functionally equivalent to that of Gram-negative bacteria to protect the bacterial cell. Defects in the integrity or assembly of this cell envelope must be sensed to allow the induction of stress response systems. The promoter that is specifically and most strongly induced upon exposure to ethambutol and isoniazid, first line drugs that affect cell envelope biogenesis, is the iniBAC promoter. In this study, we set out to identify the regulator of the iniBAC operon in Mycobacterium marinum using an unbiased transposon mutagenesis screen in a constitutively iniBAC-expressing mutant background. We obtained multiple mutants in the mce1 locus as well as mutants in an uncharacterized putative transcriptional regulator (MMAR_0612). This latter gene was shown to function as the iniBAC regulator, as overexpression resulted in constitutive iniBAC induction, whereas a knockout mutant was unable to respond to the presence of ethambutol and isoniazid. Experiments with the M. tuberculosis homologue (Rv0339c) showed identical results. RNAseq experiments showed that this regulatory gene was exclusively involved in the regulation of the iniBAC operon. We therefore propose to name this dedicated regulator iniBAC Regulator (IniR). IniR belongs to the family of signal transduction ATPases with numerous domains, including a putative sugar-binding domain. Upon testing different sugars, we identified trehalose as an activator and metabolic cue for iniBAC activation, which could also explain the effect of the mce1 mutations. In conclusion, cell envelope stress in mycobacteria is regulated by IniR in a cascade that includes trehalose. PMID:29281637
Sampels, Vera; Hartmann, Anne; Dietrich, Isabelle; Coppens, Isabelle; Sheiner, Lilach; Striepen, Boris; Herrmann, Andreas; Lucius, Richard; Gupta, Nishith
2012-01-01
The obligate intracellular and promiscuous protozoan parasite Toxoplasma gondii needs an extensive membrane biogenesis that must be satisfied irrespective of its host-cell milieu. We show that the synthesis of the major lipid in T. gondii, phosphatidylcholine (PtdCho), is initiated by a novel choline kinase (TgCK). Full-length (∼70-kDa) TgCK displayed a low affinity for choline (Km ∼0.77 mm) and harbors a unique N-terminal hydrophobic peptide that is required for the formation of enzyme oligomers in the parasite cytosol but not for activity. Conditional mutagenesis of the TgCK gene in T. gondii attenuated the protein level by ∼60%, which was abolished in the off state of the mutant (Δtgcki). Unexpectedly, the mutant was not impaired in its growth and exhibited a normal PtdCho biogenesis. The parasite compensated for the loss of full-length TgCK by two potential 53- and 44-kDa isoforms expressed through a cryptic promoter identified within exon 1. TgCK-Exon1 alone was sufficient in driving the expression of GFP in E. coli. The presence of a cryptic promoter correlated with the persistent enzyme activity, PtdCho synthesis, and susceptibility of T. gondii to a choline analog, dimethylethanolamine. Quite notably, the mutant displayed a regular growth in the off state despite a 35% decline in PtdCho content and lipid synthesis, suggesting a compositional flexibility in the membranes of the parasite. The observed plasticity of gene expression and membrane biogenesis can ensure a faithful replication and adaptation of T. gondii in disparate host or nutrient environments. PMID:22451671
Sampels, Vera; Hartmann, Anne; Dietrich, Isabelle; Coppens, Isabelle; Sheiner, Lilach; Striepen, Boris; Herrmann, Andreas; Lucius, Richard; Gupta, Nishith
2012-05-11
The obligate intracellular and promiscuous protozoan parasite Toxoplasma gondii needs an extensive membrane biogenesis that must be satisfied irrespective of its host-cell milieu. We show that the synthesis of the major lipid in T. gondii, phosphatidylcholine (PtdCho), is initiated by a novel choline kinase (TgCK). Full-length (∼70-kDa) TgCK displayed a low affinity for choline (K(m) ∼0.77 mM) and harbors a unique N-terminal hydrophobic peptide that is required for the formation of enzyme oligomers in the parasite cytosol but not for activity. Conditional mutagenesis of the TgCK gene in T. gondii attenuated the protein level by ∼60%, which was abolished in the off state of the mutant (Δtgck(i)). Unexpectedly, the mutant was not impaired in its growth and exhibited a normal PtdCho biogenesis. The parasite compensated for the loss of full-length TgCK by two potential 53- and 44-kDa isoforms expressed through a cryptic promoter identified within exon 1. TgCK-Exon1 alone was sufficient in driving the expression of GFP in E. coli. The presence of a cryptic promoter correlated with the persistent enzyme activity, PtdCho synthesis, and susceptibility of T. gondii to a choline analog, dimethylethanolamine. Quite notably, the mutant displayed a regular growth in the off state despite a 35% decline in PtdCho content and lipid synthesis, suggesting a compositional flexibility in the membranes of the parasite. The observed plasticity of gene expression and membrane biogenesis can ensure a faithful replication and adaptation of T. gondii in disparate host or nutrient environments.
King, Amy M; Bartpho, Thanatchaporn; Sermswan, Rasana W; Bulach, Dieter M; Eshghi, Azad; Picardeau, Mathieu; Adler, Ben; Murray, Gerald L
2013-08-01
Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.
Ishizaki, Kimitsune; Schauer, Nicolas; Larson, Tony R; Graham, Ian A; Fernie, Alisdair R; Leaver, Christopher J
2006-09-01
In mammals, the electron transfer flavoprotein (ETF) is a heterodimeric protein composed of two subunits, alpha and beta, that is responsible for the oxidation of at least nine mitochondrial matrix flavoprotein dehydrogenases. Electrons accepted by ETF are further transferred to the main respiratory chain via the ETF ubiquinone oxide reductase (ETFQO). Sequence analysis of the unique Arabidopsis homologues of two subunits of ETF revealed their high similarity to both subunits of the mammalian ETF. Yeast two-hybrid experiments showed that the Arabidopsis ETFalpha and ETFbeta can form a heteromeric protein. Isolation and characterization of two independent T-DNA insertional Arabidopsis mutants of the ETFbeta gene revealed accelerated senescence and early death compared to wild-type during extended darkness. Furthermore in contrast to wild-type, the etfb mutants demonstrated a significant accumulation of several amino acids, isovaleryl CoA and phytanoyl CoA during dark-induced carbohydrate deprivation. These phenotypic characteristics of etfb mutants are broadly similar to those that we observed previously in Arabidopsis etfqo mutants, suggesting functional association between ETF and ETFQO in Arabidopsis, and confirming the essential roles of the ETF/ETFQO electron transfer complex in the catabolism of leucine and involvement in the chlorophyll degradation pathway activated during dark-induced carbohydrate deprivation.
Inna Golubovskaya: The Life of a Geneticist Studying Meiosis
Cande, W. Zacheus; Freeling, Michael
2011-01-01
Maize, with its excellent forward genetics and male sterility screens, was used to identify >50 meiotic mutants representing at least 35 genes that affect key prophase processes such as pairing, synapsis, and homologous recombination. Most of these mutants were found by Inna Golubovskaya during the course of her remarkable career as a cytogeneticist. In addition to undertaking general cytological surveys to classify mutant phenotypes, Golubovskaya focused her efforts on characterizing several key regulatory mutants: ameiotic1 (am1), required to establish the meiotic cell cycle in maize; absence of first division (afd1), required for proper prophase chromosome morphology and for meiotic sister-chromatid cohesion leading to a reductive chromosome segregation at the first meiotic division; and plural abnormalities of meiosis (pam1), required for the clustering of telomeres on the nuclear envelope needed for pairing and synapsis. Her dramatic childhood in Leningrad during its siege in World War II, her fortuitous education in genetics at Leningrad State University, her continued research at the forward-looking Institute of Cytology and Genetics of the USSR Academy of Science Siberian branch, her plight at the fall of the Soviet Union, and her work in America helped engender a unique and valuable plant geneticist. Inna Golubovskaya related this personal history to the authors in conversation. PMID:21742729
Veits, Jutta; Mettenleiter, Thomas C; Fuchs, Walter
2003-06-01
The chicken alphaherpesvirus infectious laryngotracheitis virus (ILTV) exhibits several unique genetic features including an internal inversion of a conserved part of the unique long genome region. At one end, this inversion is preceded by a cluster of five open reading frames (ORFs) of 335-411 codons, designated ORF A to ORF E, that are not present in any other known herpesvirus genome. In this report we analysed expression of these genes and identified the corresponding viral RNA and protein products. Northern blot analyses showed 3'-coterminal transcripts of ORFs A and B, and monocistronic mRNAs of ORFs C and D. ORF E is part of a 3'-coterminal transcription unit that includes the conserved glycoprotein H and thymidine kinase genes. Monospecific antisera obtained after immunization of rabbits with bacterial fusion proteins allowed detection of the protein products of ORF A (40 kDa), ORF B (34 kDa), ORF C (38 and 30 kDa), ORF D (41 kDa) and ORF E (44 kDa) in ILTV-infected cells. For functional analyses, five virus recombinants possessing deletions within the individual ORFs and concomitant insertions of a reporter gene cassette encoding green fluorescent protein were generated. All virus mutants were replication competent in cell culture, but exhibited reduced virus titres or plaque sizes when compared to wild-type ILTV. These findings indicate that the ILTV-specific ORF A to ORF E genes might be important for virus replication in the natural host organism.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Yin, Xiangling; Manczak, Maria; Reddy, P. Hemachandra
2016-01-01
The objective of this study was to determine the protective effects of the mitochondria-targeted molecules MitoQ and SS31 in striatal neurons that stably express mutant huntingtin (Htt) (STHDhQ111/Q111) in Huntington's disease (HD). We studied mitochondrial and synaptic activities by measuring mRNA and the protein levels of mitochondrial and synaptic genes, mitochondrial function, and ultra-structural changes in MitoQ- and SS31-treated mutant Htt neurons relative to untreated mutant Htt neurons. We used gene expression analysis, biochemical methods, transmission electron microscopy (TEM) and confocal microscopy methods. In the MitoQ- and SS31-treated mutant Htt neurons, fission genes Drp1 and Fis1 were down-regulated, and fusion genes Mfn1, Mfn2 and Opa1 were up-regulated relative to untreated neurons, suggesting that mitochondria-targeted molecules reduce fission activity. Interestingly, the mitochondrial biogenesis genes PGC1α, PGC1β, Nrf1, Nrf2 and TFAM were up-regulated in MitoQ- and SS31-treated mutant Htt neurons. The synaptic genes synaptophysin and PSD95 were up-regulated, and mitochondrial function was normal in the MitoQ- and SS31-treated mutant Htt neurons. Immunoblotting findings of mitochondrial and synaptic proteins agreed with the mRNA findings. TEM studies revealed decreased numbers of structurally intact mitochondria in MitoQ- and SS31-treated mutant Htt neurons. These findings suggest that mitochondria-targeted molecules MitoQ and SS31 are protective against mutant Htt-induced mitochondrial and synaptic damage in HD neurons, and these mitochondria-targeted molecules are potential therapeutic molecules for the treatment of HD neurons. PMID:26908605
Yin, Xiangling; Manczak, Maria; Reddy, P Hemachandra
2016-05-01
The objective of this study was to determine the protective effects of the mitochondria-targeted molecules MitoQ and SS31 in striatal neurons that stably express mutant huntingtin (Htt) (STHDhQ111/Q111) in Huntington's disease (HD). We studied mitochondrial and synaptic activities by measuring mRNA and the protein levels of mitochondrial and synaptic genes, mitochondrial function, and ultra-structural changes in MitoQ- and SS31-treated mutant Htt neurons relative to untreated mutant Htt neurons. We used gene expression analysis, biochemical methods, transmission electron microscopy (TEM) and confocal microscopy methods. In the MitoQ- and SS31-treated mutant Htt neurons, fission genes Drp1 and Fis1 were down-regulated, and fusion genes Mfn1, Mfn2 and Opa1 were up-regulated relative to untreated neurons, suggesting that mitochondria-targeted molecules reduce fission activity. Interestingly, the mitochondrial biogenesis genes PGC1α, PGC1β, Nrf1, Nrf2 and TFAM were up-regulated in MitoQ- and SS31-treated mutant Htt neurons. The synaptic genes synaptophysin and PSD95 were up-regulated, and mitochondrial function was normal in the MitoQ- and SS31-treated mutant Htt neurons. Immunoblotting findings of mitochondrial and synaptic proteins agreed with the mRNA findings. TEM studies revealed decreased numbers of structurally intact mitochondria in MitoQ- and SS31-treated mutant Htt neurons. These findings suggest that mitochondria-targeted molecules MitoQ and SS31 are protective against mutant Htt-induced mitochondrial and synaptic damage in HD neurons, and these mitochondria-targeted molecules are potential therapeutic molecules for the treatment of HD neurons. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Isolation and characterization of gallium resistant Pseudomonas aeruginosa mutants.
García-Contreras, Rodolfo; Lira-Silva, Elizabeth; Jasso-Chávez, Ricardo; Hernández-González, Ismael L; Maeda, Toshinari; Hashimoto, Takahiro; Boogerd, Fred C; Sheng, Lili; Wood, Thomas K; Moreno-Sánchez, Rafael
2013-12-01
Pseudomonas aeruginosa PA14 cells resistant to the novel antimicrobial gallium nitrate (Ga) were developed using transposon mutagenesis and by selecting spontaneous mutants. The mutants showing the highest growth in the presence of Ga were selected for further characterization. These mutants showed 4- to 12-fold higher Ga minimal inhibitory growth concentrations and a greater than 8-fold increase in the minimum biofilm eliminating Ga concentration. Both types of mutants produced Ga resistant biofilms whereas the formation of wild-type biofilms was strongly inhibited by Ga. The gene interrupted in the transposon mutant was hitA, which encodes a periplasmic iron binding protein that delivers Fe³⁺ to the HitB iron permease; complementation of the mutant with the hitA gene restored the Ga sensitivity. This hitA mutant showed a 14-fold decrease in Ga internalization versus the wild-type strain, indicating that the HitAB system is also involved in the Ga uptake. Ga uptake in the spontaneous mutant was also lower, although no mutations were found in the hitAB genes. Instead, this mutant harbored 64 non-silent mutations in several genes including those of the phenazine pyocyanin biosynthesis. The spontaneous mutant produced 2-fold higher pyocyanin basal levels than the wild-type; the addition of this phenazine to wild-type cultures protected them from the Ga bacteriostatic effect. The present data indicate that mutations affecting Ga transport and probably pyocyanin biosynthesis enable cells to develop resistance to Ga. Copyright © 2013 Elsevier GmbH. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bonda M.; Miller L.; Perrin V.
Huntington's disease (HD), caused by a mutation of the corresponding gene encoding the protein huntingtin (htt), is characterized by progressive deterioration of cognitive and motor functions, paralleled by extensive loss of striatal neurons. At the cellular level, pathogenesis involves an early and prolonged period of neuronal dysfunction followed by neuronal death. Understanding the molecular events driving these deleterious processes is critical to the successful development of therapies to slow down or halt the progression of the disease. Here, we examined biochemical processes in a HD ex vivo rat model, as well as in a HD model for cultured neurons usingmore » synchrotron-assisted Fourier transform infrared microspectroscopy (S-FTIRM). The model, based on lentiviral-mediated delivery of a fragment of the HD gene, expresses a mutant htt fragment in one brain hemisphere and a wild-type htt fragment in the control hemisphere. S-FTIRM allowed for high spatial resolution and distinction between spectral features occurring in gray and white matter. We measured a higher content of {beta}-sheet protein in the striatal gray matter exposed to mutant htt as early as 4 weeks following the initiation of mutant htt exposure. In contrast, white matter tracts did not exhibit any changes in protein structure but surprisingly showed reduced content of unsaturated lipids and a significant increase in spectral features associated with phosphorylation. The former is reminiscent of changes consistent with a myelination deficiency, while the latter is characteristic of early pro-apoptotic events. These findings point to the utility of the label-free FTIRM method to follow mutant htt's {beta}-sheet-rich transformation in striatal neurons ex vivo, provide further evidence for mutant htt amyloidogenesis in vivo, and demonstrate novel chemical features indicative of white matter changes in HD. Parallel studies in cultured neurons expressing the same htt fragments showed similar changes.« less
Mutations in sit B and sit D genes affect manganese-growth requirements in Sinorhizobium meliloti.
Platero, Raúl A; Jaureguy, Melina; Battistoni, Federico J; Fabiano, Elena R
2003-01-21
Two transposon-induced mutants of Sinorhizobium meliloti 242 were isolated based on their inability to grow on rich medium supplemented with the metal chelator ethylenediamine di-o-hydroxyphenylacetic acid (EDDHA) and either heme-compounds or siderophores as iron sources. Tagged loci of these mutants were identified as sit B and sit D genes. These genes encode components of an ABC (ATP-binding cassette) metal-type permease in several Gram-negative bacteria. In this work, the phenotypes of these two mutants were compared with those of two siderophore-mediated iron transport mutants. The results strongly implicate a role of the sit genes in manganese acquisition when this metal is limiting in S. meliloti.
Harris, S L; Elliott, D A; Blake, M C; Must, L M; Messenger, M; Orndorff, P E
1990-01-01
The product of the pilE (also called fimH) gene is a minor component of type 1 pili in Escherichia coli. Mutants that have insertions in the pilE gene are fully piliated but unable to bind to and agglutinate guinea pig erythrocytes, a characteristic of wild-type type 1 piliated E. coli. In this paper we describe the isolation of 48 mutants with point lesions that map to the pilE gene. Such mutants were isolated by using mutT mutagenesis and an enrichment procedure devised to favor the growth of individuals that could form a pellicle in static broth containing alpha-methylmannoside, an inhibitor of erythrocyte binding and pellicle formation. Results indicated that the enrichment favored mutants expressing pilE gene products that were defective in mediating erythrocyte binding. Characterization of 12 of the mutants in greater detail revealed that certain lesions affected pilus number and length. In addition, a mutant that was temperature sensitive for erythrocyte binding was isolated and used to provide evidence that pellicle formation relies on the intercellular interaction of pilE gene products. Our results suggest a molecular explanation for the old and paradoxical observations connecting pellicle formation and erythrocyte agglutination by type 1 piliated E. coli. Images PMID:1977736
A Nodal-independent and tissue-intrinsic mechanism controls heart-looping chirality
NASA Astrophysics Data System (ADS)
Noël, Emily S.; Verhoeven, Manon; Lagendijk, Anne Karine; Tessadori, Federico; Smith, Kelly; Choorapoikayil, Suma; den Hertog, Jeroen; Bakkers, Jeroen
2013-11-01
Breaking left-right symmetry in bilateria is a major event during embryo development that is required for asymmetric organ position, directional organ looping and lateralized organ function in the adult. Asymmetric expression of Nodal-related genes is hypothesized to be the driving force behind regulation of organ laterality. Here we identify a Nodal-independent mechanism that drives asymmetric heart looping in zebrafish embryos. In a unique mutant defective for the Nodal-related southpaw gene, preferential dextral looping in the heart is maintained, whereas gut and brain asymmetries are randomized. As genetic and pharmacological inhibition of Nodal signalling does not abolish heart asymmetry, a yet undiscovered mechanism controls heart chirality. This mechanism is tissue intrinsic, as explanted hearts maintain ex vivo retain chiral looping behaviour and require actin polymerization and myosin II activity. We find that Nodal signalling regulates actin gene expression, supporting a model in which Nodal signalling amplifies this tissue-intrinsic mechanism of heart looping.
High-resolution mapping and genetic characterization of the Lazy-2 gravitropic mutant of tomato
NASA Technical Reports Server (NTRS)
Behringer, F. J.; Lomax, T. L.
1999-01-01
Mutation of the Lazy-2 (Lz-2) gene in tomato (Lycopersicon esculentum mill.) produces a phytochrome-dependent reversal of shoot gravitropism, providing a unique genetic resource for investigating how signals from light modulate gravitropism. We mapped the Lz-2 gene using RFLPs and a PCR-based technique to assess the feasibility of positional cloning. Analysis of a 1338 plant backcross population between L. esculentum and L. pennellii placed Lz-2 within a 1.2 cM interval on chromosome 5, 0.4 cM from TG504-CT201A interval. The inabililty to resolve these markers indicates that Lz-2 resides in a centromeric region in which recombination is highly suppressed. Lazy-2 is tightly linked to but does not encode the gene for ACC4, an enzyme involved in ethylene biosynthesis. We also observed that Lz-2 is partially dominant under certain conditions and stages of development.
A natural plasmid uniquely encodes two biosynthetic pathways creating a potent anti-MRSA antibiotic.
Fukuda, Daisuke; Haines, Anthony S; Song, Zhongshu; Murphy, Annabel C; Hothersall, Joanne; Stephens, Elton R; Gurney, Rachel; Cox, Russell J; Crosby, John; Willis, Christine L; Simpson, Thomas J; Thomas, Christopher M
2011-03-31
Understanding how complex antibiotics are synthesised by their producer bacteria is essential for creation of new families of bioactive compounds. Thiomarinols, produced by marine bacteria belonging to the genus Pseudoalteromonas, are hybrids of two independently active species: the pseudomonic acid mixture, mupirocin, which is used clinically against MRSA, and the pyrrothine core of holomycin. High throughput DNA sequencing of the complete genome of the producer bacterium revealed a novel 97 kb plasmid, pTML1, consisting almost entirely of two distinct gene clusters. Targeted gene knockouts confirmed the role of these clusters in biosynthesis of the two separate components, pseudomonic acid and the pyrrothine, and identified a putative amide synthetase that joins them together. Feeding mupirocin to a mutant unable to make the endogenous pseudomonic acid created a novel hybrid with the pyrrothine via "mutasynthesis" that allows inhibition of mupirocin-resistant isoleucyl-tRNA synthetase, the mupirocin target. A mutant defective in pyrrothine biosynthesis was also able to incorporate alternative amine substrates. Plasmid pTML1 provides a paradigm for combining independent antibiotic biosynthetic pathways or using mutasynthesis to develop a new family of hybrid derivatives that may extend the effective use of mupirocin against MRSA.
Sohn, Eun Ju; Rojas-Pierce, Marcela; Pan, Songqin; Carter, Clay; Serrano-Mislata, Antonio; Madueño, Francisco; Rojo, Enrique; Surpin, Marci; Raikhel, Natasha V.
2007-01-01
Plants are unique in their ability to store proteins in specialized protein storage vacuoles (PSVs) within seeds and vegetative tissues. Although plants use PSV proteins during germination, before photosynthesis is fully functional, the roles of PSVs in adult vegetative tissues are not understood. Trafficking pathways to PSVs and lytic vacuoles appear to be distinct. Lytic vacuoles are analogous evolutionarily to yeast and mammalian lysosomes. However, it is unclear whether trafficking to PSVs has any analogy to pathways in yeast or mammals, nor is PSV ultrastructure known in Arabidopsis vegetative tissue. Therefore, alternative approaches are required to identify components of this pathway. Here, we show that an Arabidopsis thaliana mutant that disrupts PSV trafficking identified TERMINAL FLOWER 1 (TFL1), a shoot meristem identity gene. The tfl1-19/mtv5 (for “modified traffic to the vacuole”) mutant is specifically defective in trafficking of proteins to the PSV. TFL1 localizes to endomembrane compartments and colocalizes with the putative δ-subunit of the AP-3 adapter complex. Our results suggest a developmental role for the PSV in vegetative tissues. PMID:18003908
A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1
de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean
2008-01-01
We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726
[Construction and characterization of a gspL mutant of avian pathogenic Escherichia coli].
Fan, Guobo; Han, Yue; Zhang, Yuxi; Han, Xiangan; Wang, Shaohui; Bai, Hao; Meng, Qingmei; Qi, Kezong; Ding, Chan; Yu, Shengqing
2015-01-04
To study the role of gspL gene in avian pathogenic Escherichia coli. The gspL mutant of Avian pathogenic Escherichia coli (APEC) was constructed by homologous recombination assay. The growth characteristics, the ability of adhesion and invasion to DF1 cells, the virulence genes transcription level and median lethal dose (LD50) were analyzed between the gspL mutant strain and the wild strain. Compared with the wild strain, the mutant strain had no significant difference in the growth status. However, its ability of adhesion and invasion was significantly lower. The transcription of genes pfs, fyuA, iss and vat increased obviously, the tsh decreased and the transcription level of luxS, ibeA, stx2f and ompA had no significant change. LD50 showed that the gspL mutant strain had 12-fold increase in virulence. The deletion of gspL gene could abate the ability of adhesion and invasion, regulate and control some virulence gene transcription level, enhance the virulence of APEC. The results show that the gspL gene play roles in pathogenicity of APEC.
Maize Opaque Endosperm Mutations Create Extensive Changes in Patterns of Gene ExpressionW⃞
Hunter, Brenda G.; Beatty, Mary K.; Singletary, George W.; Hamaker, Bruce R.; Dilkes, Brian P.; Larkins, Brian A.; Jung, Rudolf
2002-01-01
Maize starchy endosperm mutants have kernel phenotypes that include a brittle texture, susceptibility to insect pests, and inferior functional characteristics of products made from their flour. At least 18 such mutants have been identified, but only in the cases of opaque2 (o2) and floury2 (fl2), which affect different aspects of storage protein synthesis, is the molecular basis of the mutation known. To better understand the relationship between the phenotypes of these mutants and their biochemical bases, we characterized the protein and amino acid composition, as well as the mRNA transcript profiles, of nearly isogenic inbred lines of W64A o1, o2, o5, o9, o11, Mucuronate (Mc), Defective endosperm B30 (DeB30), and fl2. The largest reductions in zein protein synthesis occur in the W64A o2, DeB30, and fl2 mutants, which have ∼35 to 55% of the wild-type level of storage proteins. Zeins in W64A o5, o9, o11, and Mc are within 80 to 90% of the amount found in the wild type. Only in the cases of o5 and Mc were significant qualitative changes in zein synthesis observed. The pattern of gene expression in normal and mutant genotypes was assayed by profiling endosperm mRNA transcripts at 18 days after pollination with an Affymetrix GeneChip containing >1400 selected maize gene sequences. Compared with W64A sugary1, a mutant defective in starch synthesis, alterations in the gene expression patterns of the opaque mutants are very pleiotropic. Increased expression of genes associated with physiological stress, and the unfolded protein response, are common features of the opaque mutants. Based on global patterns of gene expression, these mutants were categorized in four phenotypic groups as follows: W64A+ and o1; o2; o5/o9/o11; and Mc and fl2. PMID:12368507
Genetic and physical analyses of Methylobacterium organophilum XX genes encoding methanol oxidation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Machlin, S.M.; Tam, P.E.; Bastien, C.A.
When allyl alcohol was used as a suicide substrate, spontaneous mutants and UV light- and nitrous acid-generated mutants of Methylobacterium organophilum XX were selected which grew on methylamine but not on methanol. There was no detectable methanol dehydrogenase (MDH) activity in crude extracts of these mutants, yet Western blots revealed that some mutants still produced MDH protein. Complementation of 50 mutants by a cosmid gene bank of M. organophilum XX demonstrated that three major regions of the genome, each of which was separated by a minimum of 40 kilobases, were required for expression of active MDH. By subcloning and Tn5more » insertion mutagenesis of subcloned fragments, at least 11 genes clustered within these three regions were subsequently identified. The identity of the MDH structural gene, which was initially determined by hybridization to the structural gene of Methylobacterium sp. strain AM1, was confirmed by Western blot analysis of an MDH-..beta..-galactosidase fusion protein.« less
James M. Slavicek; Melissa J. Mercer; Dana Pohlman; Mary Ellen Kelly; David S. Bischoff
1998-01-01
In previous studies on the formation of Lymantria dispar nuclear polyhedrosis virus (LdMNPV) few polyhedra (FP) mutants, several polyhedron formation mutants (PFM) were identified that appeared to be unique. These viral mutants are being characterized to investigate the processes of polyhedron formation and virion occlusion. Ld
Pesaresi, Paolo; Masiero, Simona; Eubel, Holger; Braun, Hans-Peter; Bhushan, Shashi; Glaser, Elzbieta; Salamini, Francesco; Leister, Dario
2006-01-01
Arabidopsis thaliana mutants prors1-1 and -2 were identified on the basis of a decrease in effective photosystem II quantum yield. Mutations were localized to the 5′-untranslated region of the nuclear gene PROLYL-tRNA SYNTHETASE1 (PRORS1), which acts in both plastids and mitochondria. In prors1-1 and -2, PRORS1 expression is reduced, along with protein synthesis in both organelles. PRORS1 null alleles (prors1-3 and -4) result in embryo sac and embryo development arrest. In mutants with the leaky prors1-1 and -2 alleles, transcription of nuclear genes for proteins involved in photosynthetic light reactions is downregulated, whereas genes for other chloroplast proteins are upregulated. Downregulation of nuclear photosynthetic genes is not associated with a marked increase in the level of reactive oxygen species in leaves and persists in the dark, suggesting that the transcriptional response is light and photooxidative stress independent. The mrpl11 and prpl11 mutants are impaired in the mitochondrial and plastid ribosomal L11 proteins, respectively. The prpl11 mrpl11 double mutant, but neither of the single mutants, resulted in strong downregulation of nuclear photosynthetic genes, like that seen in leaky mutants for PRORS1, implying that, when organellar translation is perturbed, signals derived from both types of organelles cooperate in the regulation of nuclear photosynthetic gene expression. PMID:16517761
Jin, Liang; Jiang, Qiujie; Wu, Zhengsheng; Shao, Changxia; Zhou, Yong; Yang, Luting; Uitto, Jouni; Wang, Gang
2015-05-01
Pseudoxanthoma elasticum (PXE), an autosomal recessive disorder characterized by ectopic mineralization, is caused by mutations in the ABCC6 gene. We examined clinically 29 Chinese PXE patients from unrelated families, so far the largest cohort of Asian PXE patients. In a subset of 22 patients, we sequenced ABCC6 and another candidate gene, ENPP1, and conducted pathogenicity analyses for each variant. We identified a total of 17 distinct mutations in ABCC6, 15 of them being, to our knowledge, previously unreported, including 5 frameshift and 10 missense variants. In addition, a missense mutation in combination with a recurrent nonsense mutation in ENPP1 was discovered in a pediatric PXE case. No cases with p.R1141X or del23-29 mutations, common in Caucasian patient populations, were identified. The 10 missense mutations in ABCC6 were expressed in the mouse liver via hydrodynamic tail-vein injections. One mutant protein showed cytoplasmic accumulation indicating abnormal subcellular trafficking, while the other nine mutants showed correct plasma membrane location. These nine mutations were further investigated for their pathogenicity using a recently developed zebrafish mRNA rescue assay. Minimal rescue of the morpholino-induced phenotype was achieved with eight of the nine mutant human ABCC6 mRNAs tested, implying pathogenicity. This study demonstrates that the Chinese PXE population harbors unique ABCC6 mutations. These genetic data have implications for allele-specific therapy currently being developed for PXE.
Gu, Wenyu; Farhan Ul Haque, Muhammad; Semrau, Jeremy D
2017-05-01
Methanotrophs or methane-oxidizing bacteria exhibit a unique 'copper-switch' where expression of two forms of methane monooxygenase (MMO) is controlled by the availability of copper. In the absence of copper, a cytoplasmic or soluble methane monooxygenase (sMMO) is expressed. In the presence of copper, a membrane-bound or particulate methane monooxygenase (pMMO) is expressed. These two forms of MMO have very different properties, and elucidation of the basis of the copper-switch is of significant interest as methanotrophs are becoming increasingly popular for the valorization of methane. Recently, it was suggested via characterization of a mutant of Methylosinus trichosporium OB3b that expresses sMMO in the presence of copper (smmoC mutant) that the copper-switch may be based on copCD. These genes encode for a periplasmic copper-binding protein and an inner membrane protein, respectively, and are used by other bacteria for copper uptake. Specific knockouts of copCD in M. trichosporium OB3b wild type, however, show that these genes are not part of the copper-switch in methanotrophs, nor do they appear to be critical for copper uptake. Rather, it appears that the constitutive expression of sMMO in the smmoC mutant of M. trichosporium OB3b may be due to multiple lesions as smmoC was generated via random chemical mutagenesis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Rhinn, Muriel; Schuhbaur, Brigitte; Niederreither, Karen; Dollé, Pascal
2011-01-01
Retinoic acid (RA), an active vitamin A metabolite, is a key signaling molecule in vertebrate embryos. Morphogenetic RA gradients are thought to be set up by tissue-specific actions of retinaldehyde dehydrogenases (RALDHs) and catabolizing enzymes. According to the species, two enzymatic pathways (β-carotene cleavage and retinol oxidation) generate retinaldehyde, the substrate of RALDHs. Placental species depend on maternal retinol transferred to the embryo. The retinol-to-retinaldehyde conversion was thought to be achieved by several redundant enzymes; however, a random mutagenesis screen identified retinol dehydrogenase 10 [Rdh10Trex allele; Sandell LL, et al. (2007) Genes Dev 21:1113–1124] as responsible for a homozygous lethal phenotype with features of RA deficiency. We report here the production and characterization of unique murine Rdh10 loss-of-function alleles generated by gene targeting. We show that although Rdh10−/− mutants die at an earlier stage than Rdh10Trex mutants, their molecular patterning defects do not reflect a complete state of RA deficiency. Furthermore, we were able to correct most developmental abnormalities by administering retinaldehyde to pregnant mothers, thereby obtaining viable Rdh10−/− mutants. This demonstrates the rescue of an embryonic lethal phenotype by simple maternal administration of the missing retinoid compound. These results underscore the importance of maternal retinoids in preventing congenital birth defects, and lead to a revised model of the importance of RDH10 and RALDHs in controlling embryonic RA distribution. PMID:21930923
Meng, Fanhong; Babujee, Lavanya; Jacobs, Jonathan M; Allen, Caitilyn
2015-01-01
While most strains of the plant pathogenic bacterium Ralstonia solanacearum are tropical, the race 3 biovar 2 (R3bv2) subgroup attacks plants in cooler climates. To identify mechanisms underlying this trait, we compared the transcriptional profiles of R. solanacearum R3bv2 strain UW551 and tropical strain GMI1000 at 20°C and 28°C, both in culture and during tomato pathogenesis. 4.2% of the ORFs in the UW551 genome and 7.9% of the GMI1000 ORFs were differentially expressed by temperature in planta. The two strains had distinct transcriptional responses to temperature change. GMI1000 up-regulated several stress response genes at 20°C, apparently struggling to cope with plant defenses. At the cooler temperature, R3bv2 strain UW551 up-regulated a cluster encoding a mannose-fucose binding lectin, LecM; a quorum sensing-dependent protein, AidA; and a related hypothetical protein, AidC. The last two genes are absent from the GMI1000 genome. In UW551, all three genes were positively regulated by the adjacent SolI/R quorum sensing system. These temperature-responsive genes were required for full virulence in R3bv2. Mutants lacking lecM, aidA, or aidC were each significantly more reduced in virulence on tomato at 20°C than at 28°C in both a naturalistic soil soak inoculation assay and when they were inoculated directly into tomato stems. The lecM and aidC mutants also survived poorly in potato tubers at the seed tuber storage temperature of 4°C, and the lecM mutant was defective in biofilm formation in vitro. Together, these results suggest novel mechanisms, including a lectin, are involved in the unique temperate epidemiology of R3bv2.
Miyazaki, Sho; Toyoshima, Hikaru; Natsume, Masahiro; Nakajima, Masatoshi; Kawaide, Hiroshi
2014-07-01
We report a novel physiological response to blue light in the moss Physcomitrella patens . Blue light regulates ent -kaurene biosynthesis and avoidance response to protonemal growth. Gibberellins (GAs) are a group of diterpene-type plant hormones biosynthesized from ent-kaurenoic acid via ent-kaurene. While the moss Physcomitrella patens has part of the GA biosynthetic pathway, from geranylgeranyl diphosphate to ent-kaurenoic acid, no GA is found in this species. Caulonemal differentiation in a P. patens mutant with a disrupted bifunctional ent-copalyl diphosphate synthase/ent-kaurene synthase (PpCPS/KS) gene is suppressed under red light, and is recovered by application of ent-kaurene and ent-kaurenoic acid. This indicates that derivatives of ent-kaurenoic acid, not GAs, might act as endogenous developmental regulators. Here, we found unique responses in the protonemal growth of P. patens under unilateral blue light, and these regulators were involved in the responses. When protonemata of the wild type were incubated under blue light, the chloronemal filaments grew in the opposite direction to the light source. Although this avoidance was not observed in the ent-kaurene deficient mutant, chloronemal growth toward a blue-light source in the mutant was suppressed by application of ent-kaurenoic acid, and the growth was rescued to that in the wild type. Expression analysis of the PpCPS/KS gene showed that the mRNA level under blue light was rapidly increased and was five times higher than under red light. These results suggest that regulators derived from ent-kaurenoic acid are strongly involved not only in the growth regulation of caulonemal differentiation under red light, but also in the light avoidance response of chloronemal growth under blue light. In particular, growth under blue light is regulated via the PpCPS/KS gene.
Genetic variation of six desaturase genes in flax and their impact on fatty acid composition.
Thambugala, Dinushika; Duguid, Scott; Loewen, Evelyn; Rowland, Gordon; Booker, Helen; You, Frank M; Cloutier, Sylvie
2013-10-01
Flax (Linum usitatissimum L.) is one of the richest plant sources of omega-3 fatty acids praised for their health benefits. In this study, the extent of the genetic variability of genes encoding stearoyl-ACP desaturase (SAD), and fatty acid desaturase 2 (FAD2) and 3 (FAD3) was determined by sequencing the six paralogous genes from 120 flax accessions representing a broad range of germplasm including some EMS mutant lines. A total of 6 alleles for sad1 and sad2, 21 for fad2a, 5 for fad2b, 15 for fad3a and 18 for fad3b were identified. Deduced amino acid sequences of the alleles predicted 4, 2, 3, 4, 6 and 7 isoforms, respectively. Allele frequencies varied greatly across genes. Fad3a, with 110 SNPs and 19 indels, and fad3b, with 50 SNPs and 5 indels, showed the highest levels of genetic variations. While most of the SNPs and all the indels were silent mutations, both genes carried nonsense SNP mutations resulting in premature stop codons, a feature not observed in sad and fad2 genes. Some alleles and isoforms discovered in induced mutant lines were absent in the natural germplasm. Correlation of these genotypic data with fatty acid composition data of 120 flax accessions phenotyped in six field experiments revealed statistically significant effects of some of the SAD and FAD isoforms on fatty acid composition, oil content and iodine value. The novel allelic variants and isoforms identified for the six desaturases will be a resource for the development of oilseed flax with unique and useful fatty acid profiles.
Levillain, Florence; Poquet, Yannick; Mallet, Ludovic; Mazères, Serge; Marceau, Michael; Brosch, Roland; Bange, Franz-Christoph; Supply, Philip; Magalon, Axel; Neyrolles, Olivier
2017-11-01
The unique ability of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, to persist for long periods of time in lung hypoxic lesions chiefly contributes to the global burden of latent TB. We and others previously reported that the M. tuberculosis ancestor underwent massive episodes of horizontal gene transfer (HGT), mostly from environmental species. Here, we sought to explore whether such ancient HGT played a part in M. tuberculosis evolution towards pathogenicity. We were interested by a HGT-acquired M. tuberculosis-specific gene set, namely moaA1-D1, which is involved in the biosynthesis of the molybdenum cofactor. Horizontal acquisition of this gene set was striking because homologues of these moa genes are present all across the Mycobacterium genus, including in M. tuberculosis. Here, we discovered that, unlike their paralogues, the moaA1-D1 genes are strongly induced under hypoxia. In vitro, a M. tuberculosis moaA1-D1-null mutant has an impaired ability to respire nitrate, to enter dormancy and to survive in oxygen-limiting conditions. Conversely, heterologous expression of moaA1-D1 in the phylogenetically closest non-TB mycobacterium, Mycobacterium kansasii, which lacks these genes, improves its capacity to respire nitrate and grants it with a marked ability to survive oxygen depletion. In vivo, the M. tuberculosis moaA1-D1-null mutant shows impaired survival in hypoxic granulomas in C3HeB/FeJ mice, but not in normoxic lesions in C57BL/6 animals. Collectively, our results identify a novel pathway required for M. tuberculosis resistance to host-imposed stress, namely hypoxia, and provide evidence that ancient HGT bolstered M. tuberculosis evolution from an environmental species towards a pervasive human-adapted pathogen.
Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto
2012-01-01
In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4–OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants. PMID:22764280
Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto
2012-09-01
In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4-OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants.
Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103
Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M.; Prescott, John F.
2007-01-01
Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genes furA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes. PMID:17193875
Bacterio-opsin mutants of Halobacterium halobium
Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.
1983-01-01
The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291
Jobe, Timothy O; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A; Mendoza-Cózatl, David G; Schroeder, Julian I
2012-06-01
Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M(2) seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Reassessing the Dlx code: the genetic regulation of branchial arch skeletal pattern and development
Depew, Michael J; Simpson, Carol A; Morasso, Maria; Rubenstein, John LR
2005-01-01
The branchial arches are meristic vertebrate structures, being metameric both between each other within the rostrocaudal series along the ventrocephalic surface of the embryonic head and within each individual arch: thus, just as each branchial arch must acquire a unique identity along the rostrocaudal axis, each structure within the proximodistal axis of an arch must also acquire a unique identity. It is believed that regional specification of metameric structures is controlled by the nested expression of related genes resulting in a regional code, a principal that is though to be demonstrated by the regulation of rostrocaudal axis development in animals exerted by the nested HOM-C/Hox homeobox genes. The nested expression pattern of the Dlx genes within the murine branchial arch ectomesenchyme has more recently led to the proposal of a Dlx code for the regional specification along the proximodistal axis of the branchial arches (i.e. it establishes intra-arch identity). This review re-examines this hypothesis, and presents new work on an allelic series of Dlx loss-of-function mouse mutants that includes various combinations of Dlx1, Dlx2, Dlx3, Dlx5 and Dlx6. Although we confirm fundamental aspects of the hypothesis, we further report a number of novel findings. First, contrary to initial reports, Dlx1, Dlx2 and Dlx1/2 heterozygotes exhibit alterations of branchial arch structures and Dlx2−/− and Dlx1/2−/− mutants have slight alterations of structures derived from the distal portions of their branchial arches. Second, we present evidence for a role for murine Dlx3 in the development of the branchial arches. Third, analysis of compound Dlx mutants reveals four grades of mandibular arch transformations and that the genetic interactions of cis first-order (e.g. Dlx5 and Dlx6), trans second-order (e.g. Dlx5 and Dlx2) and trans third-order paralogues (e.g. Dlx5 and Dlx1) result in significant and distinct morphological differences in mandibular arch development. We conclude by integrating functions of the Dlx genes within the context of a hypothesized general mechanism for the establishment of pattern and polarity in the first branchial arch of gnathostomes that includes regionally secreted growth factors such as Fgf8 and Bmp and other transcription factors such as Msx1, and is consistent both with the structure of the conserved gnathostome jaw bauplan and the elaboration of this bauplan to meet organismal end-point designs. PMID:16313391
Ruan, Yong-Ling; Chourey, Prem S.
1998-01-01
Fiber cell initiation in the epidermal cells of cotton (Gossypium hirsutum L.) ovules represents a unique example of trichome development in higher plants. Little is known about the molecular and metabolic mechanisms controlling this process. Here we report a comparative analysis of a fiberless seed (fls) mutant (lacking fibers) and a normal (FLS) mutant to better understand the initial cytological events in fiber development and to analyze the metabolic changes that are associated with the loss of a major sink for sucrose during cellulose biosynthesis in the mutant seeds. On the day of anthesis (0 DAA), the mutant ovular epidermal cells lacked the typical bud-like projections that are seen in FLS ovules and are required for commitment to the fiber development pathway. Cell-specific gene expression analyses at 0 DAA showed that sucrose synthase (SuSy) RNA and protein were undetectable in fls ovules but were in abundant, steady-state levels in initiating fiber cells of the FLS ovules. Tissue-level analyses of developing seeds 15 to 35 DAA revealed an altered temporal pattern of SuSy expression in the mutant relative to the normal genotype. Whether the altered programming of SuSy expression is the cause or the result of the mutation is unknown. The developing seeds of the fls mutant have also shown several correlated changes that represent altered carbon partitioning in seed coats and cotyledons as compared with the FLS genotype. PMID:9765525
Ruan; Chourey
1998-10-01
Fiber cell initiation in the epidermal cells of cotton (Gossypium hirsutum L.) ovules represents a unique example of trichome development in higher plants. Little is known about the molecular and metabolic mechanisms controlling this process. Here we report a comparative analysis of a fiberless seed (fls) mutant (lacking fibers) and a normal (FLS) mutant to better understand the initial cytological events in fiber development and to analyze the metabolic changes that are associated with the loss of a major sink for sucrose during cellulose biosynthesis in the mutant seeds. On the day of anthesis (0 DAA), the mutant ovular epidermal cells lacked the typical bud-like projections that are seen in FLS ovules and are required for commitment to the fiber development pathway. Cell-specific gene expression analyses at 0 DAA showed that sucrose synthase (SuSy) RNA and protein were undetectable in fls ovules but were in abundant, steady-state levels in initiating fiber cells of the FLS ovules. Tissue-level analyses of developing seeds 15 to 35 DAA revealed an altered temporal pattern of SuSy expression in the mutant relative to the normal genotype. Whether the altered programming of SuSy expression is the cause or the result of the mutation is unknown. The developing seeds of the fls mutant have also shown several correlated changes that represent altered carbon partitioning in seed coats and cotyledons as compared with the FLS genotype.
An allele of the crm gene blocks cyanobacterial circadian rhythms.
Boyd, Joseph S; Bordowitz, Juliana R; Bree, Anna C; Golden, Susan S
2013-08-20
The SasA-RpaA two-component system constitutes a key output pathway of the cyanobacterial Kai circadian oscillator. To date, rhythm of phycobilisome associated (rpaA) is the only gene other than kaiA, kaiB, and kaiC, which encode the oscillator itself, whose mutation causes completely arrhythmic gene expression. Here we report a unique transposon insertion allele in a small ORF located immediately upstream of rpaA in Synechococcus elongatus PCC 7942 termed crm (for circadian rhythmicity modulator), which results in arrhythmic promoter activity but does not affect steady-state levels of RpaA. The crm ORF complements the defect when expressed in trans, but only if it can be translated, suggesting that crm encodes a small protein. The crm1 insertion allele phenotypes are distinct from those of an rpaA null; crm1 mutants are able to grow in a light:dark cycle and have no detectable oscillations of KaiC phosphorylation, whereas low-amplitude KaiC phosphorylation rhythms persist in the absence of RpaA. Levels of phosphorylated RpaA in vivo measured over time are significantly altered compared with WT in the crm1 mutant as well as in the absence of KaiC. Taken together, these results are consistent with the hypothesis that the Crm polypeptide modulates a circadian-specific activity of RpaA.
Dowd, Carola D; Chronis, Demosthenis; Radakovic, Zoran S; Siddique, Shahid; Schmülling, Thomas; Werner, Tomáš; Kakimoto, Tatsuo; Grundler, Florian M W; Mitchum, Melissa G
2017-10-01
Cyst and root-knot nematodes are obligate parasites of economic importance with a remarkable ability to reprogram root cells into unique metabolically active feeding sites. Previous studies have suggested a role for cytokinin in feeding site formation induced by these two types of nematodes, but the mechanistic details have not yet been described. Using Arabidopsis as a host plant species, we conducted a comparative analysis of cytokinin genes in response to the beet cyst nematode (BCN), Heterodera schachtii, and the root-knot nematode (RKN), Meloidogyne incognita. We identified distinct differences in the expression of cytokinin biosynthesis, catabolism and signaling genes in response to infection by BCN and RKN, suggesting differential manipulation of the cytokinin pathway by these two nematode species. Furthermore, we evaluated Arabidopsis histidine kinase receptor mutant lines ahk2/3, ahk2/4 and ahk3/4 in response to RKN infection. Similar to our previous studies with BCN, these lines were significantly less susceptible to RKN without compromising nematode penetration, suggesting a requirement of cytokinin signaling in RKN feeding site formation. Moreover, an analysis of ahk double mutants using CycB1;1:GUS/ahk introgressed lines revealed contrasting differences in the cytokinin receptors mediating cell cycle activation in feeding sites induced by BCN and RKN. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
2017-01-01
Neural cultures derived from Huntington’s disease (HD) patient-derived induced pluripotent stem cells were used for ‘omics’ analyses to identify mechanisms underlying neurodegeneration. RNA-seq analysis identified genes in glutamate and GABA signaling, axonal guidance and calcium influx whose expression was decreased in HD cultures. One-third of gene changes were in pathways regulating neuronal development and maturation. When mapped to stages of mouse striatal development, the profiles aligned with earlier embryonic stages of neuronal differentiation. We observed a strong correlation between HD-related histone marks, gene expression and unique peak profiles associated with dysregulated genes, suggesting a coordinated epigenetic program. Treatment with isoxazole-9, which targets key dysregulated pathways, led to amelioration of expanded polyglutamine repeat-associated phenotypes in neural cells and of cognitive impairment and synaptic pathology in HD model R6/2 mice. These data suggest that mutant huntingtin impairs neurodevelopmental pathways that could disrupt synaptic homeostasis and increase vulnerability to the pathologic consequence of expanded polyglutamine repeats over time. PMID:28319609
Kumagai, Katsuyoshi; Takanashi, Masakatsu; Ohno, Shin-Ichiro; Kuroda, Masahiko; Sudo, Katsuko
2017-05-03
Targeted mutant mice generated on a C57BL/6 background are powerful tools for analysis of the biological functions of genes, and gene targeting technologies using mouse embryonic stem (ES) cells have been used to generate such mice. Recently, a bacterial artificial chromosome (BAC) recombineering system was established for the construction of targeting vectors. However, gene retrieval from BACs for the generation of gene targeting vectors using this system remains difficult. Even when construction of a gene targeting vector is successful, the efficiency of production of targeted mutant mice from ES cells derived from C57BL/6 mice are poor. Therefore, in this study, we first improved the strategy for the retrieval of genes from BACs and their transfer into a DT-A plasmid, for the generation of gene targeting vectors using the BAC recombineering system. Then, we attempted to generate targeted mutant mice from ES cell lines derived from C57BL/6 mice, by culturing in serum-free medium. In conclusion, we established an improved strategy for the efficient generation of targeted mutant mice on a C57BL/6 background, which are useful for the in vivo analysis of gene functions and regulation.
Waters, Brian M.; McInturf, Samuel A.; Amundsen, Keenan
2014-01-01
Summary Iron (Fe) and copper (Cu) homeostasis are tightly linked across biology. In previous work, Fe deficiency interacted with Cu regulated genes and stimulated Cu accumulation. The C940-fe (fefe) Fe uptake mutant of melon (Cucumis melo) was characterized, and the fefe mutant was used to test whether Cu deficiency could stimulate Fe uptake. Wild type and fefe mutant transcriptomes were determined by RNA-seq under Fe and Cu deficiency. FeFe regulated genes included core Fe uptake, metal homeostasis, and transcription factor genes. Numerous genes were regulated by both Fe and Cu. The fefe mutant was rescued by high Fe or by Cu deficiency, which stimulated ferric-chelate reductase activity, FRO2 expression, and Fe accumulation. Accumulation of Fe in Cu deficient plants was independent of the normal Fe uptake system. One of the four FRO genes in the melon and cucumber (Cucumis sativus) genomes was Fe regulated, and one was Cu regulated. Simultaneous Fe and Cu deficiency synergistically upregulated Fe uptake gene expression. Overlap in Fe and Cu deficiency transcriptomes highlights the importance of Fe– Cu crosstalk in metal homeostasis. The fefe gene is not orthologous to FIT, thus identification of this gene will provide clues to help understand regulation of Fe uptake in plants. PMID:24975482
Ramón-Carbonell, Marta de; Sánchez-Torres, Paloma
2017-10-01
A putative sucrose transporter PdSUT1 included in the same clade that Sut1p from Schizosaccharomyces pombe was identified in Penicillium digitatum, the major citrus postharvest pathogen. PdSUT1 gene was characterized using target gene disruption and gene overexpression. The ΔPdSUT1 mutants generated by gene elimination showed reduction in fungal virulence during citrus fruit infection assayed in mature fruit at 20°C. However, the overexpression mutants did not increased disease severity neither in the mutants coming from a high virulent nor from a low virulent P. digitatum progenitor strains. Moreover, fungicide sensitivity was affected in the deletant mutants but not in the overexpression transformants. The expression analysis of several genes involved in fungicide resistance showed an intensification of MFS transporters and a decrease of sterol demethylases transcriptional abundance in the ΔPdSUT1 mutants compare to the parental wild type strain. PdSUT1 appear not to be directly involved in fungicide resistance although can affect the gene expression of fungicide related genes. These results indicate that PdSUT1 contribute to P. digitatum fungal virulence and influence fungicide sensitivity through carbohydrate uptake and MFS transporters gene activation. Copyright © 2017 Elsevier GmbH. All rights reserved.
Lestrate, P.; Dricot, A.; Delrue, R.-M.; Lambert, C.; Martinelli, V.; De Bolle, X.; Letesson, J.-J.; Tibor, A.
2003-01-01
For this study, we screened 1,152 signature-tagged mutagenesis mutants of Brucella melitensis 16M in a mouse model of infection and found 36 of them to be attenuated in vivo. Molecular characterization of transposon insertion sites showed that for four mutants, the affected genes were only present in Rhizobiaceae. Another mutant contained a disruption in a gene homologous to mosA, which is involved in rhizopine biosynthesis in some strains of Rhizobium, suggesting that this sugar may be involved in Brucella pathogenicity. A mutant was disrupted in a gene homologous to fliF, a gene potentially coding for the MS ring, a basal component of the flagellar system. Surprisingly, a mutant was affected in the rpoA gene, coding for the essential α-subunit of the RNA polymerase. This disruption leaves a partially functional protein, impaired for the activation of virB transcription, as demonstrated by the absence of induction of the virB promoter in the Tn5::rpoA background. The results presented here highlight the fact that the ability of Brucella to induce pathogenesis shares similarities with the molecular mechanisms used by both Rhizobium and Agrobacterium to colonize their hosts. PMID:14638795
Inagaki, Soichi; Nakamura, Kenzo; Morikami, Atsushi
2009-08-01
Spatio-temporal regulation of gene expression during development depends on many factors. Mutations in Arabidopsis thaliana TEBICHI (TEB) gene encoding putative helicase and DNA polymerase domains-containing protein result in defects in meristem maintenance and correct organ formation, as well as constitutive DNA damage response and a defect in cell cycle progression; but the molecular link between these phenotypes of teb mutants is unknown. Here, we show that mutations in the DNA replication checkpoint pathway gene, ATR, but not in ATM gene, enhance developmental phenotypes of teb mutants, although atr suppresses cell cycle defect of teb mutants. Developmental phenotypes of teb mutants are also enhanced by mutations in RAD51D and XRCC2 gene, which are involved in homologous recombination. teb and teb atr double mutants exhibit defects in adaxial-abaxial polarity of leaves, which is caused in part by the upregulation of ETTIN (ETT)/AUXIN RESPONSIVE FACTOR 3 (ARF3) and ARF4 genes. The Helitron transposon in the upstream of ETT/ARF3 gene is likely to be involved in the upregulation of ETT/ARF3 in teb. Microarray analysis indicated that teb and teb atr causes preferential upregulation of genes nearby the Helitron transposons. Furthermore, interestingly, duplicated genes, especially tandemly arrayed homologous genes, are highly upregulated in teb or teb atr. We conclude that TEB is required for normal progression of DNA replication and for correct expression of genes during development. Interplay between these two functions and possible mechanism leading to altered expression of specific genes will be discussed.
Gibberellin regulates pollen viability and pollen tube growth in rice.
Chhun, Tory; Aya, Koichiro; Asano, Kenji; Yamamoto, Eiji; Morinaka, Yoichi; Watanabe, Masao; Kitano, Hidemi; Ashikari, Motoyuki; Matsuoka, Makoto; Ueguchi-Tanaka, Miyako
2007-12-01
Gibberellins (GAs) play many biological roles in higher plants. We collected and performed genetic analysis on rice (Oryza sativa) GA-related mutants, including GA-deficient and GA-insensitive mutants. Genetic analysis of the mutants revealed that rice GA-deficient mutations are not transmitted as Mendelian traits to the next generation following self-pollination of F1 heterozygous plants, although GA-insensitive mutations are transmitted normally. To understand these differences in transmission, we examined the effect of GA on microsporogenesis and pollen tube elongation in rice using new GA-deficient and GA-insensitive mutants that produce semifertile flowers. Phenotypic analysis revealed that the GA-deficient mutant reduced pollen elongation1 is defective in pollen tube elongation, resulting in a low fertilization frequency, whereas the GA-insensitive semidominant mutant Slr1-d3 is mainly defective in viable pollen production. Quantitative RT-PCR revealed that GA biosynthesis genes tested whose mutations are transmitted to the next generation at a lower frequency are preferentially expressed after meiosis during pollen development, but expression is absent or very low before the meiosis stage, whereas GA signal-related genes are actively expressed before meiosis. Based on these observations, we predict that the transmission of GA-signaling genes occurs in a sporophytic manner, since the protein products and/or mRNA transcripts of these genes may be introduced into pollen-carrying mutant alleles, whereas GA synthesis genes are transmitted in a gametophytic manner, since these genes are preferentially expressed after meiosis.
Methods of producing protoporphyrin IX and bacterial mutants therefor
Zhou, Jizhong; Qiu, Dongru; He, Zhili; Xie, Ming
2016-03-01
The presently disclosed inventive concepts are directed in certain embodiments to a method of producing protoporphyrin IX by (1) cultivating a strain of Shewanella bacteria in a culture medium under conditions suitable for growth thereof, and (2) recovering the protoporphyrin IX from the culture medium. The strain of Shewanella bacteria comprises at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX. In certain embodiments of the method, the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or of shew_1140. In other embodiments, the presently disclosed inventive concepts are directed to mutant strains of Shewanella bacteria having at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX during cultivation of the bacteria. In certain embodiments the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or shew_1140.
Serova, Tatiana A; Tsyganova, Anna V; Tsyganov, Viktor E
2018-04-03
Plant symbiotic mutants are useful tool to uncover the molecular-genetic mechanisms of nodule senescence. The pea (Pisum sativum L.) mutants SGEFix - -1 (sym40), SGEFix - -3 (sym26), and SGEFix - -7 (sym27) display an early nodule senescence phenotype, whereas the mutant SGEFix - -2 (sym33) does not show premature degradation of symbiotic structures, but its nodules show an enhanced immune response. The nodules of these mutants were compared with each other and with those of the wild-type SGE line using seven marker genes that are known to be activated during nodule senescence. In wild-type SGE nodules, transcript levels of all of the senescence-associated genes were highest at 6 weeks after inoculation (WAI). The senescence-associated genes showed higher transcript abundance in mutant nodules than in wild-type nodules at 2 WAI and attained maximum levels in the mutant nodules at 4 WAI. Immunolocalization analyses showed that the ethylene precursor 1-aminocyclopropane-1-carboxylate accumulated earlier in the mutant nodules than in wild-type nodules. Together, these results showed that nodule senescence was activated in ineffective nodules blocked at different developmental stages in pea lines that harbor mutations in four symbiotic genes.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630
Vega-Palas, M A; Madueño, F; Herrero, A; Flores, E
1990-01-01
Twenty-seven mutants that were unable to assimilate nitrate were isolated from Synechococcus sp. strain PCC 7942. In addition to mutants that lacked nitrate reductase or nitrite reductase, seven pleiotropic mutants impaired in both reductases, glutamine synthetase, and methylammonium transport were also isolated. One of the pleiotropic mutants was complemented by transformation with a cosmid gene bank from wild-type strain PCC 7942. Three complementing cosmids were isolated, and a 3.1-kilobase-pair DNA fragment that was still able to complement the mutant was identified. The regulatory gene that was cloned (ntcA) appeared to be required for full expression of proteins subject to ammonium repression in Synechococcus sp. PMID:1967601
Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto
2015-01-01
Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. PMID:25511432
Zhang, Huimin; Wang, Qingjing; Fisher, Derek J.; Cai, Mingzhu; Chakravartty, Vandana; Ye, Huiyan; Li, Ping; Solbiati, Jose O.; Feng, Youjun
2016-01-01
Biotin protein ligase (BPL) is widespread in the three domains of the life. The paradigm BPL is the Escherichia coli BirA protein, which also functions as a repressor for the biotin biosynthesis pathway. Here we report that Lactococcus lactis possesses two different orthologues of birA (birA1_LL and birA2_LL). Unlike the scenario in E. coli, L. lactis appears to be auxotrophic for biotin in that it lacks a full biotin biosynthesis pathway. In contrast, it retains two biotin transporter-encoding genes (bioY1_LL and bioY2_LL), suggesting the use of a scavenging strategy to obtain biotin from the environment. The in vivo function of the two L. lactis birA genes was judged by their abilities to complement the conditional lethal E. coli birA mutant. Thin-layer chromatography and mass spectroscopy assays demonstrated that these two recombinant BirA proteins catalyze the biotinylation reaction of the acceptor biotin carboxyl carrier protein (BCCP), through the expected biotinoyl-AMP intermediate. Gel shift assays were used to characterize bioY1_LL and BirA1_LL. We also determined the ability to uptake 3H-biotin by L. lactis. Taken together, our results deciphered a unique biotin scavenging pathway with redundant genes present in the probiotic bacterium L. lactis. PMID:27161258
Zhang, Huimin; Wang, Qingjing; Fisher, Derek J; Cai, Mingzhu; Chakravartty, Vandana; Ye, Huiyan; Li, Ping; Solbiati, Jose O; Feng, Youjun
2016-05-10
Biotin protein ligase (BPL) is widespread in the three domains of the life. The paradigm BPL is the Escherichia coli BirA protein, which also functions as a repressor for the biotin biosynthesis pathway. Here we report that Lactococcus lactis possesses two different orthologues of birA (birA1_LL and birA2_LL). Unlike the scenario in E. coli, L. lactis appears to be auxotrophic for biotin in that it lacks a full biotin biosynthesis pathway. In contrast, it retains two biotin transporter-encoding genes (bioY1_LL and bioY2_LL), suggesting the use of a scavenging strategy to obtain biotin from the environment. The in vivo function of the two L. lactis birA genes was judged by their abilities to complement the conditional lethal E. coli birA mutant. Thin-layer chromatography and mass spectroscopy assays demonstrated that these two recombinant BirA proteins catalyze the biotinylation reaction of the acceptor biotin carboxyl carrier protein (BCCP), through the expected biotinoyl-AMP intermediate. Gel shift assays were used to characterize bioY1_LL and BirA1_LL. We also determined the ability to uptake (3)H-biotin by L. lactis. Taken together, our results deciphered a unique biotin scavenging pathway with redundant genes present in the probiotic bacterium L. lactis.
Roycewicz, Peter S; Malamy, Jocelyn E
2014-05-01
Plants adapt to their unique soil environments by altering the number and placement of lateral roots post-embryonic. Mutants were identified in Arabidopsis thaliana that exhibit increased lateral root formation. Eight mutants were characterized in detail and were found to have increased lateral root formation due to at least three distinct mechanisms. The causal mutation in one of these mutants was found in the XEG113 gene, recently shown to be involved in plant cell wall biosynthesis. Lateral root primordia initiation is unaltered in this mutant. In contrast, synchronization of lateral root initiation demonstrated that mutation of XEG113 increases the rate at which lateral root primordia develop and emerge to form lateral roots. The effect of the XEG113 mutation was specific to the root system and had no apparent effect on shoot growth. Screening of 17 additional cell wall mutants, altering a myriad of cell wall components, revealed that many (but not all) types of cell wall defects promote lateral root formation. These results suggest that proper cell wall biosynthesis is necessary to constrain lateral root primordia emergence. While previous reports have shown that lateral root emergence is accompanied by active remodelling of cell walls overlying the primordia, this study is the first to demonstrate that alteration of the cell wall is sufficient to promote lateral root formation. Therefore, inherent cell wall properties may play a previously unappreciated role in regulation of root system architecture.
Hudik, Elodie; Yoshioka, Yasushi; Domenichini, Séverine; Bourge, Mickaël; Soubigout-Taconnat, Ludivine; Mazubert, Christelle; Yi, Dalong; Bujaldon, Sandrine; Hayashi, Hiroyuki; De Veylder, Lieven; Bergounioux, Catherine; Benhamed, Moussa; Raynaud, Cécile
2014-01-01
The majority of research on cell cycle regulation is focused on the nuclear events that govern the replication and segregation of the genome between the two daughter cells. However, eukaryotic cells contain several compartmentalized organelles with specialized functions, and coordination among these organelles is required for proper cell cycle progression, as evidenced by the isolation of several mutants in which both organelle function and overall plant development were affected. To investigate how chloroplast dysfunction affects the cell cycle, we analyzed the crumpled leaf (crl) mutant of Arabidopsis (Arabidopsis thaliana), which is deficient for a chloroplastic protein and displays particularly severe developmental defects. In the crl mutant, we reveal that cell cycle regulation is altered drastically and that meristematic cells prematurely enter differentiation, leading to reduced plant stature and early endoreduplication in the leaves. This response is due to the repression of several key cell cycle regulators as well as constitutive activation of stress-response genes, among them the cell cycle inhibitor SIAMESE-RELATED5. One unique feature of the crl mutant is that it produces aplastidic cells in several organs, including the root tip. By investigating the consequence of the absence of plastids on cell cycle progression, we showed that nuclear DNA replication occurs in aplastidic cells in the root tip, which opens future research prospects regarding the dialogue between plastids and the nucleus during cell cycle regulation in higher plants. PMID:25037213
Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit.
Liu, Cheng-Qian; Hu, Kang-Di; Li, Ting-Ting; Yang, Ying; Yang, Feng; Li, Yan-Hong; Liu, He-Ping; Chen, Xiao-Yan; Zhang, Hua
2017-01-01
Aspergillus niger, a saprophytic fungus, is widely distributed in soil, air and cereals, and can cause postharvest diseases in fruit. Polygalacturonase (PG) is one of the main enzymes in fungal pathogens to degrade plant cell wall. To evaluate whether the deletion of an exo-polygalacturonase gene pgxB would influence fungal pathogenicity to fruit, pgxB gene was deleted in Aspergillus niger MA 70.15 (wild type) via homologous recombination. The ΔpgxB mutant showed similar growth behavior compared with the wild type. Pectin medium induced significant higher expression of all pectinase genes in both wild type and ΔpgxB in comparison to potato dextrose agar medium. However, the ΔpgxB mutant was less virulent on apple fruits as the necrosis diameter caused by ΔpgxB mutant was significantly smaller than that of wild type. Results of quantitive-PCR showed that, in the process of infection in apple fruit, gene expressions of polygalacturonase genes pgaI, pgaII, pgaA, pgaC, pgaD and pgaE were enhanced in ΔpgxB mutant in comparison to wild type. These results prove that, despite the increased gene expression of other polygalacturonase genes in ΔpgxB mutant, the lack of pgxB gene significantly reduced the virulence of A. niger on apple fruit, suggesting that pgxB plays an important role in the infection process on the apple fruit.
Chenevert, J M; Naumovski, L; Schultz, R A; Friedberg, E C
1986-04-01
The denV gene of bacteriophage T4 was reconstituted from two overlapping DNA fragments cloned in M13 vectors. The coding region of the intact gene was tailored into a series of plasmid vectors containing different promoters suitable for expression of the gene in E. coli and in yeast. Induction of the TAC promoter with IPTG resulted in overexpression of the gene, which was lethal to E. coli. Expression of the TACdenV gene in the absence of IPTG, or the use of the yeast GAL1 or ADH promoters resulted in partial complementation of the UV sensitivity of uvrA, uvrB, uvrC and recA mutants of E. coli and rad1, rad2, rad3, rad4 and rad10 mutants of S. cerevisiae. The extent of denV-mediated reactivation of excision-defective mutants was approximately equal to that of photoreactivation of such strains. Excision proficient E. coli cells transformed with a plasmid containing the denV gene were slightly more resistant to ultraviolet (UV) radiation than control cells without the denV gene. On the other hand, excision proficient yeast cells were slightly more sensitive to killing by UV radiation following transformation with a plasmid containing the denV gene. This effect was more pronounced in yeast mutants of the RAD52 epistasis group.
Characterization of multilocus lesions in human cells exposed to X radiation and radon
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chaudhry, M.A.; Jiang, Q.; Ricanati, M.
Human TK6 lymphoblasts were exposed to X radiation or radon, and thymidine kinase negative (TK{sup -/-}) mutants were selected, isolated and harvested for analysis of structural changes in the TK gene. A large majority (82%) of the radon-induced mutants, 74% of the X-radiation-induced mutants and 45% of the spontaneous mutants lost the entire active TK allele. To analyze these mutants further we measured the loss of heterozygosity at several loci neighboring the TK locus on chromosome 17q. A greater proportion (61%) of the radon-induced mutants than X-radiation-induced or spontaneous mutants harbored the smaller lesions involving the TK allele alone ormore » extending from the TK locus to one or both of the closest neighboring sequences tested. Further, 21% of the X-radiation-induced mutants but only 5% of the radon-induced mutants lost heterozygosity at the col1A1 locus, 31 Mb from the TK gene. These results are in agreement with a recent analysis of radon- and X-radiation-induced lesions inactivating the HPRT gene of TK6 cells, in which we reported that a lower percentage of radon- than X-radiation-induced mutants showed lesions extending to markers 800 kb or more from the HPRT gene on the X chromosome. In the present study, we observed that the percentage of slowly growing and very slowly growing TK{sup -/-} mutants was greater after treatment with radon than after treatment with X radiation, regardless of the type of lesion present. It is possible, therefore, that the radon-induced lesions are complex and/or less easily repaired, leading to slow growth in a large proportion of the surviving mutant cells. 36 refs., 6 figs., 2 tabs.« less
Karska-Wysocki, B; Mamet-Bratley, M D; Verly, W G
1976-01-01
After treatment with methyl or ethyl methane sulfonate, T7 amber mutants display a reduced capacity for recombination. Moreover, alkylation reduces recombination frequency involving markers on the right-hand side of the genetic map more than it reduces recombination frequency involving markers on the left-hand side. We interpret this to mean that alkylation can stop DNA injection at any point along the DNA molecule, and that T7 phage injects its DNA in a unique fashion starting from the end carrying the genes for early proteins. PMID:183007
Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M
2017-06-01
Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Strøman, Per; Reinert, William; Case, Mary E.; Giles, Norman H.
1979-01-01
In Neurospora crassa, the enzyme quinate (shikimate) dehydrogenase catalyzes the first reaction in the inducible quinic acid catabolic pathway and is encoded in the qa-3 gene of the qa cluster. In this cluster, the order of genes has been established as qa-1 qa-3 qa-4 qa-2. Amino-terminal sequences have been determined for purified quinate dehydrogenase from wild type and from UV-induced revertants in two different qa-3 mutants. These two mutants (M16 and M45) map at opposite ends of the qa-3 locus. In addition, mapping data (Case et al. 1978) indicate that the end of the qa-3 gene specified by M45 is closer to the adjacent qa-1 gene than is the end specified by the M16 mutant site. In one of the revertants (R45 from qa-3 mutant M45), the aminoterminal sequence for the first ten amino acids is identical to that of wild type. The other revertant (R1 from qa-3 mutant M16) differs from wild type at the amino-terminal end by a single altered residue at position three in the sequence. The observed change involves the substitution of an isoleucine in M16-R1 for a proline in wild type. This substitution requires a two-nucleotide change in the corresponding wild-type codon.——The combined genetic and biochemical data indicate that the qa-3 mutants M16 and M45 carry amino acid substitutions near the amino-terminal and carboxyl-terminal ends of the quinate dehydrogenase enzyme, respectively. On this basis we conclude that transcription of the qa-3 gene proceeds from the end specified by the M16 mutant site in the direction of the qa-1 gene. It appears probable that transcription is initiated from a promoter site within the qa cluster, possibly immediately adjacent to the qa-3 gene. PMID:159203
Eckardt-Schupp, Friederike; Siede, Wolfram; Game, John C.
1987-01-01
The moderately UV- and X-ray-sensitive mutant of Saccharomyces cerevisiae originally designated rs1 complements all rad and mms mutants available. Therefore, the new nomination rad24-1 according to the RAD nomenclature is suggested. RAD24 maps on chromosome V, close to RAD3 (1.3 cM). In order to associate the RAD24 gene with one of the three repair pathways, double mutants of rad24 and various representative genes of each pathway were constructed. The UV and X-ray sensitivities of the double mutants compared to the single mutants indicate that RAD24 is involved in excision repair of UV damage (RAD3 epistasis group), as well as in recombination repair of UV and X-ray damage (RAD52 epistasis group). Properties of the mutant are discussed which hint at the control of late steps in the pathways. PMID:3549445
Comprehensive mutational profiling of core binding factor acute myeloid leukemia.
Duployez, Nicolas; Marceau-Renaut, Alice; Boissel, Nicolas; Petit, Arnaud; Bucci, Maxime; Geffroy, Sandrine; Lapillonne, Hélène; Renneville, Aline; Ragu, Christine; Figeac, Martin; Celli-Lebras, Karine; Lacombe, Catherine; Micol, Jean-Baptiste; Abdel-Wahab, Omar; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric; Preudhomme, Claude
2016-05-19
Acute myeloid leukemia (AML) with t(8;21) or inv(16) have been recognized as unique entities within AML and are usually reported together as core binding factor AML (CBF-AML). However, there is considerable clinical and biological heterogeneity within this group of diseases, and relapse incidence reaches up to 40%. Moreover, translocations involving CBFs are not sufficient to induce AML on its own and the full spectrum of mutations coexisting with CBF translocations has not been elucidated. To address these issues, we performed extensive mutational analysis by high-throughput sequencing in 215 patients with CBF-AML enrolled in the Phase 3 Trial of Systematic Versus Response-adapted Timed-Sequential Induction in Patients With Core Binding Factor Acute Myeloid Leukemia and Treating Patients with Childhood Acute Myeloid Leukemia with Interleukin-2 trials (age, 1-60 years). Mutations in genes activating tyrosine kinase signaling (including KIT, N/KRAS, and FLT3) were frequent in both subtypes of CBF-AML. In contrast, mutations in genes that regulate chromatin conformation or encode members of the cohesin complex were observed with high frequencies in t(8;21) AML (42% and 18%, respectively), whereas they were nearly absent in inv(16) AML. High KIT mutant allele ratios defined a group of t(8;21) AML patients with poor prognosis, whereas high N/KRAS mutant allele ratios were associated with the lack of KIT or FLT3 mutations and a favorable outcome. In addition, mutations in epigenetic modifying or cohesin genes were associated with a poor prognosis in patients with tyrosine kinase pathway mutations, suggesting synergic cooperation between these events. These data suggest that diverse cooperating mutations may influence CBF-AML pathophysiology as well as clinical behavior and point to potential unique pathogenesis of t(8;21) vs inv(16) AML. © 2016 by The American Society of Hematology.
Characterization and gene cloning of the rice (Oryza sativa L.) dwarf and narrow-leaf mutant dnl3.
Shi, L; Wei, X J; Adedze, Y M N; Sheng, Z H; Tang, S Q; Hu, P S; Wang, J L
2016-09-16
The dwarf and narrow-leaf rice (Oryza sativa L.) mutant dnl3 was isolated from the Japonica cultivar Zhonghua 11 (wild-type). dnl3 exhibited pleiotropic developmental defects. The narrow-leaf phenotype resulted from a marked reduction in the number of vascular bundles, while the dwarf stature was caused by the formation of foreshortened internodes and a reduced number of parenchyma cells. The suggestion that cell division is impaired in the mutant was consistent with the transcriptional behavior of various genes associated with cell division. The mutant was less responsive to exogenously supplied gibberellic acid than the wild-type, and profiling the transcription of genes involved in gibberellin synthesis and response revealed that a lesion in the mutant affected gibberellin signal transduction. The dnl3 phenotype was inherited as a single-dominant gene, mapping within a 19.1-kb region of chromosome 12, which was found to harbor three open reading frames. Resequencing the open reading frames revealed that the mutant carried an allele at one of the three genes that differed from the wild-type sequence by 2-bp deletions; this gene encoded a cellulose synthase-like D4 (CSLD4) protein. Therefore, OsCSLD4 is a candidate gene for DNL3. DNL3 was expressed in all of the rice organs tested at the heading stage, particularly in the leaves, roots, and culms. These results suggest that DNL3 plays important roles in rice leaf morphogenesis and vegetative development.
Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S
2014-01-01
The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-l-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., 1994), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. PMID:24286468
Maruta, Takanori; Miyazaki, Nozomi; Nosaka, Ryota; Tanaka, Hiroyuki; Padilla-Chacon, Daniel; Otori, Kumi; Kimura, Ayako; Tanabe, Noriaki; Yoshimura, Kazuya; Tamoi, Masahiro; Shigeoka, Shigeru
2015-05-01
Plastid gene expression (PGE) is one of the signals that regulate the expression of photosynthesis-associated nuclear genes (PhANGs) via GENOMES UNCOUPLED1 (GUN1)-dependent retrograde signaling. We recently isolated Arabidopsis sugar-inducible cotyledon yellow-192 (sicy-192), a gain-of-function mutant of plastidic invertase, and showed that following the treatment of this mutant with sucrose, the expression of PhANGs as well as PGE decreased, suggesting that the sicy-192 mutation activates a PGE-evoked and GUN1-mediated retrograde pathway. To clarify the relationship between the sicy-192 mutation, PGE, and GUN1-mediated pathway, plastid and nuclear gene expression in a double mutant of sicy-192 and gun1-101, a null mutant of GUN1 was studied. Plastid-encoded RNA polymerase (PEP)-dependent PGE was markedly suppressed in the sicy-192 mutant by the sucrose treatment, but the suppression as well as cotyledon yellow phenotype was not mitigated by GUN1 disruption. Microarray analysis revealed that the altered expression of nuclear genes such as PhANG in the sucrose-treated sicy-192 mutant was largely dependent on GUN1. The present findings demonstrated that the sicy-192 mutation alters nuclear gene expression with sucrose treatment via GUN1, which is possibly followed by inhibiting PEP-dependent PGE, providing a new insight into the role of plastid sugar metabolism in nuclear gene expression. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira
2014-12-01
Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.
Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103.
Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M; Prescott, John F
2007-01-01
Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genesfurA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes.
Li, Huapeng; Wang, Yun; Li, Xiaocheng; Gao, Yong; Wang, Zhijun; Zhao, Yun; Wang, Maolin
2011-01-01
A dwarf mutant from Brassica napus, namely NDF-1, which was derived from a high doubled haploid (DH) line '3529'(Brassica napus L.) of which seeds were jointly treated with chemical inducers and fast neutron bombardment, was revealed that dwarfism is under the control of a major gene(designated as ndf1) with a mainly additive effect and non-significant dominance effect. The germination and hypocotyls elongation response of dwarf mutants after exogenous GA and uniconazol application showed NDF-1 was a gibberellin insensitive dwarf. We cloned the Brassica napus GID1 gene, named BnGID1, and found it was the ortholog of AtGID1a. The sequence blasting of the BnGID1 genes from NDF-1 and wild type showed there was no mutant in the gene. But the quantitative RT-PCR analysis of GID1 EST pointed out the mutation was caused by the low-level expression of BnGID1 gene. After sequenced the BnGID1 gene's upstream, we found three bases mutated in the pyrimidine box (P-box) of the BnGID1 promoter, which is linkage with the dwarf mutant.
Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.
2011-01-01
Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235
Rahman, Hafizur; Xu, You-Ping; Zhang, Xuan-Rui; Cai, Xin-Zhong
2016-01-01
Calmodulin-binding transcription activators (CAMTAs) play important roles in various plant biological processes including disease resistance and abiotic stress tolerance. Oilseed rape (Brassica napus L.) is one of the most important oil-producing crops worldwide. To date, compositon of CAMTAs in genomes of Brassica species and role of CAMTAs in resistance to the devastating necrotrophic fungal pathogen Sclerotinia sclerotiorum are still unknown. In this study, 18 CAMTA genes were identified in oilseed rape genome through bioinformatics analyses, which were inherited from the nine copies each in its progenitors Brassica rapa and Brassica oleracea and represented the highest number of CAMTAs in a given plant species identified so far. Gene structure, protein domain organization and phylogentic analyses showed that the oilseed rape CAMTAs were structurally similar and clustered into three major groups as other plant CAMTAs, but had expanded subgroups CAMTA3 and CAMTA4 genes uniquely in rosids species occurring before formation of oilseed rape. A large number of stress response-related cis-elements existed in the 1.5 kb promoter regions of the BnCAMTA genes. BnCAMTA genes were expressed differentially in various organs and in response to treatments with plant hormones and the toxin oxalic acid (OA) secreted by S. sclerotiorum as well as the pathogen inoculation. Remarkably, the expression of BnCAMTA3A1 and BnCAMTA3C1 was drastically induced in early phase of S. sclerotiorum infection, indicating their potential role in the interactions between oilseed rape and S. sclerotiorum. Furthermore, inoculation analyses using Arabidopsis camta mutants demonstrated that Atcamta3 mutant plants exhibited significantly smaller disease lesions than wild-type and other Atcamta mutant plants. In addition, compared with wild-type plants, Atcamta3 plants accumulated obviously more hydrogen peroxide in response to the PAMP chitin and exhibited much higher expression of the CGCG-box-containing genes BAK1 and JIN1, which are essential to the PAMP triggered immunity (PTI) and/or plant resistance to pathogens including S. sclerotiorum. Our results revealed that CAMTA3 negatively regulated PTI probably by directly targeting BAK1 and it also negatively regulated plant defense through suppressing JA signaling pathway probably via directly targeting JIN1. PMID:27200054
Knobloch, Johannes K.-M.; Nedelmann, Max; Kiel, Kathrin; Bartscht, Katrin; Horstkotte, Matthias A.; Dobinsky, Sabine; Rohde, Holger; Mack, Dietrich
2003-01-01
Transposon mutagenesis with the Enterococcus faecalis transposon Tn917 is a genetic approach frequently used to identify genes related with specific phenotypes in gram-positive bacteria. We established an arbitrary PCR for the rapid and easy identification of Tn917 insertion sites in Staphylococcus epidermidis with six independent, well-characterized biofilm-negative Tn917 transposon mutants, which were clustered in the icaADBC gene locus or harbor Tn917 in the regulatory gene rsbU. For all six of these mutants, short chromosomal DNA fragments flanking both transposon ends could be amplified. All fragments were sufficient to correctly identify the Tn917 insertion sites in the published S. epidermidis genomes. By using this technique, the Tn917 insertion sites of three not-yet-characterized biofilm-negative or nonmucoid mutants were identified. In the biofilm-negative and nonmucoid mutant M12, Tn917 is inserted into a gene homologous to the regulatory gene purR of Bacillus subtilis and Staphylococcus aureus. The Tn917 insertions of the nonmucoid but biofilm-positive mutants M16 and M20 are located in genes homologous to components of the phosphoenolpyruvate-sugar phosphotransferase system (PTS) of B. subtilis, S. aureus, and Staphylococcus carnosus, indicating an influence of the PTS on the mucoid phenotype in S. epidermidis. PMID:14532029
Huo, Heqiang; Henry, Isabelle M; Coppoolse, Eric R; Verhoef-Post, Miriam; Schut, Johan W; de Rooij, Han; Vogelaar, Aat; Joosen, Ronny V L; Woudenberg, Leo; Comai, Luca; Bradford, Kent J
2016-11-01
Lettuce (Lactuca sativa) seeds exhibit thermoinhibition, or failure to complete germination when imbibed at warm temperatures. Chemical mutagenesis was employed to develop lettuce lines that exhibit germination thermotolerance. Two independent thermotolerant lettuce seed mutant lines, TG01 and TG10, were generated through ethyl methanesulfonate mutagenesis. Genetic and physiological analyses indicated that these two mutations were allelic and recessive. To identify the causal gene(s), we applied bulked segregant analysis by whole genome sequencing. For each mutant, bulked DNA samples of segregating thermotolerant (mutant) seeds were sequenced and analyzed for homozygous single-nucleotide polymorphisms. Two independent candidate mutations were identified at different physical positions in the zeaxanthin epoxidase gene (ABSCISIC ACID DEFICIENT 1/ZEAXANTHIN EPOXIDASE, or ABA1/ZEP) in TG01 and TG10. The mutation in TG01 caused an amino acid replacement, whereas the mutation in TG10 resulted in alternative mRNA splicing. Endogenous abscisic acid contents were reduced in both mutants, and expression of the ABA1 gene from wild-type lettuce under its own promoter fully complemented the TG01 mutant. Conventional genetic mapping confirmed that the causal mutations were located near the ZEP/ABA1 gene, but the bulked segregant whole genome sequencing approach more efficiently identified the specific gene responsible for the phenotype. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis
Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A
2015-01-01
Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829
Dictyostelium discoideum mutants with conditional defects in phagocytosis
1994-01-01
We have isolated and characterized Dictyostelium discoideum mutants with conditional defects in phagocytosis. Under suspension conditions, the mutants exhibited dramatic reductions in the uptake of bacteria and polystyrene latex beads. The initial binding of these ligands was unaffected, however, indicating that the defect was not in a plasma membrane receptor: Because of the phagocytosis defect, the mutants were unable to grow when cultured in suspensions of heat-killed bacteria. The mutants exhibited normal capacities for fluid phase endocytosis and grew as rapidly as parental (AX4) cells in axenic medium. Both the defects in phagocytosis and growth on bacteria were corrected when the mutant Dictyostelium cells were cultured on solid substrates. Reversion and genetic complementation analysis suggested that the mutant phenotypes were caused by single gene defects. While the precise site of action of the mutations was not established, the mutations are likely to affect an early signaling event because the binding of bacteria to mutant cells in suspension was unable to trigger the localized polymerization of actin filaments required for ingestion; other aspects of actin function appeared normal. This class of conditional phagocytosis mutant should prove to be useful for the expression cloning of the affected gene(s). PMID:7519624
BIG: a calossin-like protein required for polar auxin transport in Arabidopsis
Gil, Pedro; Dewey, Elizabeth; Friml, Jiri; Zhao, Yunde; Snowden, Kimberley C.; Putterill, Jo; Palme, Klaus; Estelle, Mark; Chory, Joanne
2001-01-01
Polar auxin transport is crucial for the regulation of auxin action and required for some light-regulated responses during plant development. We have found that two mutants of Arabidopsis—doc1, which displays altered expression of light-regulated genes, and tir3, known for its reduced auxin transport—have similar defects and define mutations in a single gene that we have renamed BIG. BIG is very similar to the Drosophila gene Calossin/Pushover, a member of a gene family also present in Caenorhabditis elegans and human genomes. The protein encoded by BIG is extraordinary in size, 560 kD, and contains several putative Zn-finger domains. Expression-profiling experiments indicate that altered expression of multiple light-regulated genes in doc1 mutants can be suppressed by elevated levels of auxin caused by overexpression of an auxin biosynthetic gene, suggesting that normal auxin distribution is required to maintain low-level expression of these genes in the dark. Double mutants of tir3 with the auxin mutants pin1, pid, and axr1 display severe defects in auxin-dependent growth of the inflorescence. Chemical inhibitors of auxin transport change the intracellular localization of the auxin efflux carrier PIN1 in doc1/tir3 mutants, supporting the idea that BIG is required for normal auxin efflux. PMID:11485992
Kamerewerd, Jens; Jansson, Malin; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich
2008-09-01
Sordaria macrospora, a self-fertile filamentous ascomycete, carries genes encoding three different alpha-subunits of heterotrimeric G proteins (gsa, G protein Sordaria alpha subunit). We generated knockout strains for all three gsa genes (Deltagsa1, Deltagsa2, and Deltagsa3) as well as all combinations of double mutants. Phenotypic analysis of single and double mutants showed that the genes for Galpha-subunits have distinct roles in the sexual life cycle. While single mutants show some reduction of fertility, double mutants Deltagsa1Deltagsa2 and Deltagsa1Deltagsa3 are completely sterile. To test whether the pheromone receptors PRE1 and PRE2 mediate signaling via distinct Galpha-subunits, two recently generated Deltapre strains were crossed with all Deltagsa strains. Analyses of the corresponding double mutants revealed that compared to GSA2, GSA1 is a more predominant regulator of a signal transduction cascade downstream of the pheromone receptors and that GSA3 is involved in another signaling pathway that also contributes to fruiting body development and fertility. We further isolated the gene encoding adenylyl cyclase (AC) (sac1) for construction of a knockout strain. Analyses of the three DeltagsaDeltasac1 double mutants and one Deltagsa2Deltagsa3Deltasac1 triple mutant indicate that SAC1 acts downstream of GSA3, parallel to a GSA1-GSA2-mediated signaling pathway. In addition, the function of STE12 and PRO41, two presumptive signaling components, was investigated in diverse double mutants lacking those developmental genes in combination with the gsa genes. This analysis was further completed by expression studies of the ste12 and pro41 transcripts in wild-type and mutant strains. From the sum of all our data, we propose a model for how different Galpha-subunits interact with pheromone receptors, adenylyl cyclase, and STE12 and thus cooperatively regulate sexual development in S. macrospora.
Amiour, Nardjis; Imbaud, Sandrine; Clément, Gilles; Agier, Nicolas; Zivy, Michel; Valot, Benoît; Balliau, Thierry; Quilleré, Isabelle; Tercé-Laforgue, Thérèse; Dargel-Graffin, Céline; Hirel, Bertrand
2014-11-20
To identify the key elements controlling grain production in maize, it is essential to have an integrated view of the responses to alterations in the main steps of nitrogen assimilation by modification of gene expression. Two maize mutant lines (gln1.3 and gln1.4), deficient in two genes encoding cytosolic glutamine synthetase, a key enzyme involved in nitrogen assimilation, were previously characterized by a reduction of kernel size in the gln1.4 mutant and by a reduction of kernel number in the gln1.3 mutant. In this work, the differences in leaf gene transcripts, proteins and metabolite accumulation in gln1.3 and gln1.4 mutants were studied at two key stages of plant development, in order to identify putative candidate genes, proteins and metabolic pathways contributing on one hand to the control of plant development and on the other to grain production. The most interesting finding in this study is that a number of key plant processes were altered in the gln1.3 and gln1.4 mutants, including a number of major biological processes such as carbon metabolism and transport, cell wall metabolism, and several metabolic pathways and stress responsive and regulatory elements. We also found that the two mutants share common or specific characteristics across at least two or even three of the "omics" considered at the vegetative stage of plant development, or during the grain filling period. This is the first comprehensive molecular and physiological characterization of two cytosolic glutamine synthetase maize mutants using a combined transcriptomic, proteomic and metabolomic approach. We find that the integration of the three "omics" procedures is not straight forward, since developmental and mutant-specific levels of regulation seem to occur from gene expression to metabolite accumulation. However, their potential use is discussed with a view to improving our understanding of nitrogen assimilation and partitioning and its impact on grain production.
Yuan, Fengjie; Yu, Xiaomin; Dong, Dekun; Yang, Qinghua; Fu, Xujun; Zhu, Shenlong; Zhu, Danhua
2017-01-18
Seed germination is important to soybean (Glycine max) growth and development, ultimately affecting soybean yield. A lower seed field emergence has been the main hindrance for breeding soybeans low in phytate. Although this reduction could be overcome by additional breeding and selection, the mechanisms of seed germination in different low phytate mutants remain unknown. In this study, we performed a comparative transcript analysis of two low phytate soybean mutants (TW-1 and TW-1-M), which have the same mutation, a 2 bp deletion in GmMIPS1, but show a significant difference in seed field emergence, TW-1-M was higher than that of TW-1 . Numerous genes analyzed by RNA-Seq showed markedly different expression levels between TW-1-M and TW-1 mutants. Approximately 30,000-35,000 read-mapped genes and ~21000-25000 expressed genes were identified for each library. There were ~3900-9200 differentially expressed genes (DEGs) in each contrast library, the number of up-regulated genes was similar with down-regulated genes in the mutant TW-1and TW-1-M. Gene ontology functional categories of DEGs indicated that the ethylene-mediated signaling pathway, the abscisic acid-mediated signaling pathway, response to hormone, ethylene biosynthetic process, ethylene metabolic process, regulation of hormone levels, and oxidation-reduction process, regulation of flavonoid biosynthetic process and regulation of abscisic acid-activated signaling pathway had high correlations with seed germination. In total, 2457 DEGs involved in the above functional categories were identified. Twenty-two genes with 20 biological functions were the most highly up/down- regulated (absolute value Log2FC >5) in the high field emergence mutant TW-1-M and were related to metabolic or signaling pathways. Fifty-seven genes with 36 biological functions had the greatest expression abundance (FRPM >100) in germination-related pathways. Seed germination in the soybean low phytate mutants is a very complex process, which involves a series of physiological, morphological and transcriptional changes. Compared with TW-1, TW-1-M had a very different gene expression profile, which included genes related to plant hormones, antioxidation, anti-stress and energy metabolism processes. Our research provides a molecular basis for understanding germination mechanisms, and is also an important resource for the genetic analysis of germination in low phytate crops. Plant hormone- and antioxidation-related genes might strongly contribute to the high germination rate in the TW-1-M mutant.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geller, A.I.; Keyomarsi, K.; Bryan, J.
1990-11-01
The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli {beta}-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; tsmore » mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses {beta}-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system.« less
Lon Protease of Azorhizobium caulinodans ORS571 Is Required for Suppression of reb Gene Expression
Nakajima, Azusa; Tsukada, Shuhei; Siarot, Lowela; Ogawa, Tetsuhiro; Oyaizu, Hiroshi
2012-01-01
Bacterial Lon proteases play important roles in a variety of biological processes in addition to housekeeping functions. In this study, we focused on the Lon protease of Azorhizobium caulinodans, which can fix nitrogen both during free-living growth and in stem nodules of the legume Sesbania rostrata. The nitrogen fixation activity of an A. caulinodans lon mutant in the free-living state was not significantly different from that of the wild-type strain. However, the stem nodules formed by the lon mutant showed little or no nitrogen fixation activity. By microscopic analyses, two kinds of host cells were observed in the stem nodules formed by the lon mutant. One type has shrunken host cells containing a high density of bacteria, and the other type has oval or elongated host cells containing a low density or no bacteria. This phenotype is similar to a praR mutant highly expressing the reb genes. Quantitative reverse transcription-PCR analyses revealed that reb genes were also highly expressed in the lon mutant. Furthermore, a lon reb double mutant formed stem nodules showing higher nitrogen fixation activity than the lon mutant, and shrunken host cells were not observed in these stem nodules. These results suggest that Lon protease is required to suppress the expression of the reb genes and that high expression of reb genes in part causes aberrance in the A. caulinodans-S. rostrata symbiosis. In addition to the suppression of reb genes, it was found that Lon protease was involved in the regulation of exopolysaccharide production and autoagglutination of bacterial cells. PMID:22752172
Dong, Zhaobin; Jiang, Chuan; Chen, Xiaoyang; Zhang, Tao; Ding, Lian; Song, Weibin; Luo, Hongbing; Lai, Jinsheng; Chen, Huabang; Liu, Renyi; Zhang, Xiaolan; Jin, Weiwei
2013-11-01
Auxin is a plant hormone that plays key roles in both shoot gravitropism and inflorescence development. However, these two processes appear to be parallel and to be regulated by distinct players. Here, we report that the maize (Zea mays) prostrate stem1 mutant, which is allelic to the classic mutant lazy plant1 (la1), displays prostrate growth with reduced shoot gravitropism and defective inflorescence development. Map-based cloning identified maize ZmLA1 as the functional ortholog of LAZY1 in rice (Oryza sativa) and Arabidopsis (Arabidopsis thaliana). It has a unique role in inflorescence development and displays enriched expression in reproductive organs such as tassels and ears. Transcription of ZmLA1 responds to auxin and is repressed by light. Furthermore, ZmLA1 physically interacts with a putative auxin transport regulator in the plasma membrane and a putative auxin signaling protein in the nucleus. RNA-SEQ data showed that dozens of auxin transport, auxin response, and light signaling genes were differentially expressed in la1 mutant stems. Therefore, ZmLA1 might mediate the cross talk between shoot gravitropism and inflorescence development by regulating auxin transport, auxin signaling, and probably light response in maize.
ARID1B is a specific vulnerability in ARID1A-mutant cancers
Helming, Katherine C.; Wang, Xiaofeng; Wilson, Boris G.; Vazquez, Francisca; Haswell, Jeffrey R.; Manchester, Haley E.; Kim, Youngha; Kryukov, Gregory V.; Ghandi, Mahmoud; Aguirre, Andrew J.; Jagani, Zainab; Wang, Zhong; Garraway, Levi A.; Hahn, William C.; Roberts, Charles W. M.
2014-01-01
Summary Recent studies have revealed that ARID1A is frequently mutated across a wide variety of human cancers and also has bona fide tumor suppressor properties. Consequently, identification of vulnerabilities conferred by ARID1A mutation would have major relevance for human cancer. Here, using a broad screening approach, we identify ARID1B, a related but mutually exclusive homolog of ARID1A in the SWI/SNF chromatin remodeling complex, as the number one gene preferentially required for the survival of ARID1A-mutant cancer cell lines. We show that loss of ARID1B in ARID1A-deficient backgrounds destabilizes SWI/SNF and impairs proliferation. Intriguingly, we also find that ARID1A and ARID1B are frequently co-mutated in cancer, but that ARID1A-deficient cancers retain at least one ARID1B allele. These results suggest that loss of ARID1A and ARID1B alleles cooperatively promotes cancer formation but also results in a unique functional dependence. The results further identify ARID1B as a potential therapeutic target for ARID1A-mutant cancers. PMID:24562383
Can the silkworm (Bombyx mori) be used as a human disease model?
Tabunoki, Hiroko; Bono, Hidemasa; Ito, Katsuhiko; Yokoyama, Takeshi
2016-02-01
Bombyx mori (silkworm) is the most famous lepidopteran in Japan. B. mori has long been used in the silk industry and also as a model insect for agricultural research. In recent years, B. mori has attracted interest in its potential for use in pathological analysis of model animals. For example, the human macular carotenoid transporter was discovered using information of B. mori carotenoid transporter derived from yellow-cocoon strain. The B. mori carotenoid transport system is useful in human studies. To develop a human disease model, we characterized the human homologs of B. mori, and by constructing KAIKO functional annotation pipeline, and to analyze gene expression profile of a unique B. mori mutant strain using microarray analysis. As a result, we identified a novel molecular network involved in Parkinson's disease. Here we describe the potential use of a spontaneous mutant silkworm strain as a human disease model. We also summarize recent progress in the application of genomic information for annotation of human homologs in B. mori. The B. mori mutant will provide a clue to pathological mechanisms, and the findings will be helpful for the development of therapies and for medical drug discovery.
An undergraduate laboratory class using CRISPR/Cas9 technology to mutate drosophila genes.
Adame, Vanesa; Chapapas, Holly; Cisneros, Marilyn; Deaton, Carol; Deichmann, Sophia; Gadek, Chauncey; Lovato, TyAnna L; Chechenova, Maria B; Guerin, Paul; Cripps, Richard M
2016-05-06
CRISPR/Cas9 genome editing technology is used in the manipulation of genome sequences and gene expression. Because of the ease and rapidity with which genes can be mutated using CRISPR/Cas9, we sought to determine if a single-semester undergraduate class could be successfully taught, wherein students isolate mutants for specific genes using CRISPR/Cas9. Six students were each assigned a single Drosophila gene, for which no mutants currently exist. Each student designed and created plasmids to encode single guide RNAs that target their selected gene; injected the plasmids into Cas9-expressing embryos, in order to delete the selected gene; carried out a three-generation cross to test for germline transmission of a mutated allele and generate a stable stock of the mutant; and characterized the mutant alleles by PCR and sequencing. Three genes out of six were successfully mutated. Pre- and post- survey evaluations of the students in the class revealed that student attitudes towards their research competencies increased, although the changes were not statistically significant. We conclude that it is feasible to develop a laboratory genome editing class, to provide effective laboratory training to undergraduate students, and to generate mutant lines for use by the broader scientific community. © 2016 by The International Union of Biochemistry and Molecular Biology, 44:263-275, 2016. © 2016 The International Union of Biochemistry and Molecular Biology.
Moores, J C; Magazin, M; Ditta, G S; Leong, J
1984-01-01
A gene bank of DNA from plant growth-promoting Pseudomonas sp. strain B10 was constructed using the broad host-range conjugative cosmid pLAFR1. The recombinant cosmids contained insert DNA averaging 21.5 kilobase pairs in length. Nonfluorescent mutants of Pseudomonas sp. strain B10 were obtained by mutagenesis with N-methyl-N'-nitro-N-nitrosoguanidine, ethyl methanesulfonate, or UV light and were defective in the biosynthesis of its yellow-green, fluorescent siderophore (microbial iron transport agent) pseudobactin. No yellow-green, fluorescent mutants defective in the production of pseudobactin were identified. Nonfluorescent mutants were individually complemented by mating the gene bank en masse and identifying fluorescent transconjugants. Eight recombinant cosmids were sufficient to complement 154 nonfluorescent mutants. The pattern of complementation suggests that a minimum of 12 genes arranged in four gene clusters is required for the biosynthesis of pseudobactin. This minimum number of genes seems reasonable considering the structural complexity of pseudobactin. Images PMID:6690426
Mutant p53 proteins counteract autophagic mechanism sensitizing cancer cells to mTOR inhibition.
Cordani, Marco; Oppici, Elisa; Dando, Ilaria; Butturini, Elena; Dalla Pozza, Elisa; Nadal-Serrano, Mercedes; Oliver, Jordi; Roca, Pilar; Mariotto, Sofia; Cellini, Barbara; Blandino, Giovanni; Palmieri, Marta; Di Agostino, Silvia; Donadelli, Massimo
2016-08-01
Mutations in TP53 gene play a pivotal role in tumorigenesis and cancer development. Here, we report that gain-of-function mutant p53 proteins inhibit the autophagic pathway favoring antiapoptotic effects as well as proliferation of pancreas and breast cancer cells. We found that mutant p53 significantly counteracts the formation of autophagic vesicles and their fusion with lysosomes throughout the repression of some key autophagy-related proteins and enzymes as BECN1 (and P-BECN1), DRAM1, ATG12, SESN1/2 and P-AMPK with the concomitant stimulation of mTOR signaling. As a paradigm of this mechanism, we show that atg12 gene repression was mediated by the recruitment of the p50 NF-κB/mutant p53 protein complex onto the atg12 promoter. Either mutant p53 or p50 NF-κB depletion downregulates atg12 gene expression. We further correlated the low expression levels of autophagic genes (atg12, becn1, sesn1, and dram1) with a reduced relapse free survival (RFS) and distant metastasis free survival (DMFS) of breast cancer patients carrying TP53 gene mutations conferring a prognostic value to this mutant p53-and autophagy-related signature. Interestingly, the mutant p53-driven mTOR stimulation sensitized cancer cells to the treatment with the mTOR inhibitor everolimus. All these results reveal a novel mechanism through which mutant p53 proteins promote cancer cell proliferation with the concomitant inhibition of autophagy. Copyright © 2016 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Krause, William C.; Shafi, Ayesha A.; Nakka, Manjula; Weigel, Nancy L.
2014-01-01
Prostate cancer (PCa) is an androgen-dependent disease, and tumors that are resistant to androgen ablation therapy often remain androgen receptor (AR) dependent. Among the contributors to castration-resistant PCa are AR splice variants that lack the ligand-binding domain (LBD). Instead, they have small amounts of unique sequence derived from cryptic exons or from out of frame translation. The AR-V7 (or AR3) variant is constitutively active and is expressed under conditions consistent with CRPC. AR-V7 is reported to regulate a transcriptional program that is similar but not identical to that of AR. However, it is unknown whether these differences are due to the unique sequence in AR-V7, or simply to loss of the LBD. To examine transcriptional regulation by AR-V7, we have used lentiviruses encoding AR-V7 (amino acids 1-627 of AR with the 16 amino acids unique to the variant) to prepare a derivative of the androgen-dependent LNCaP cells with inducible expression of AR-V7. An additional cell line was generated with regulated expression of AR-NTD (amino acids 1-660 of AR); this mutant lacks the LBD but does not have the AR-V7 specific sequence. We find that AR and AR-V7 have distinct activities on target genes that are co-regulated by FOXA1. Transcripts regulated by AR-V7 were similarly regulated by AR-NTD, indicating that loss of the LBD is sufficient for the observed differences. Differential regulation of target genes correlates with preferential recruitment of AR or AR-V7 to specific cis-regulatory DNA sequences providing an explanation for some of the observed differences in target gene regulation. PMID:25008967
Genetic Perturbation of the Maize Methylome[W
Li, Qing; Hermanson, Peter J.; Zaunbrecher, Virginia M.; Song, Jawon; Wendt, Jennifer; Rosenbaum, Heidi; Madzima, Thelma F.; Sloan, Amy E.; Huang, Ji; Burgess, Daniel L.; Richmond, Todd A.; McGinnis, Karen M.; Meeley, Robert B.; Danilevskaya, Olga N.; Vaughn, Matthew W.; Kaeppler, Shawn M.; Jeddeloh, Jeffrey A.
2014-01-01
DNA methylation can play important roles in the regulation of transposable elements and genes. A collection of mutant alleles for 11 maize (Zea mays) genes predicted to play roles in controlling DNA methylation were isolated through forward- or reverse-genetic approaches. Low-coverage whole-genome bisulfite sequencing and high-coverage sequence-capture bisulfite sequencing were applied to mutant lines to determine context- and locus-specific effects of these mutations on DNA methylation profiles. Plants containing mutant alleles for components of the RNA-directed DNA methylation pathway exhibit loss of CHH methylation at many loci as well as CG and CHG methylation at a small number of loci. Plants containing loss-of-function alleles for chromomethylase (CMT) genes exhibit strong genome-wide reductions in CHG methylation and some locus-specific loss of CHH methylation. In an attempt to identify stocks with stronger reductions in DNA methylation levels than provided by single gene mutations, we performed crosses to create double mutants for the maize CMT3 orthologs, Zmet2 and Zmet5, and for the maize DDM1 orthologs, Chr101 and Chr106. While loss-of-function alleles are viable as single gene mutants, the double mutants were not recovered, suggesting that severe perturbations of the maize methylome may have stronger deleterious phenotypic effects than in Arabidopsis thaliana. PMID:25527708
Pham, Nikki T.; Wei, Tong; Schackwitz, Wendy S.; Lipzen, Anna M.; Duong, Phat Q.; Jones, Kyle C.; Ruan, Deling; Bauer, Diane; Peng, Yi; Schmutz, Jeremy
2017-01-01
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. PMID:28576844
Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C
2002-05-01
Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.
Moon, Sunok; Oo, Moe Moe; Kim, Backki; Koh, Hee-Jong; Oh, Sung Aeong; Yi, Gihwan; An, Gynheung; Park, Soon Ki; Jung, Ki-Hong
2018-04-23
Understanding late pollen development, including the maturation and pollination process, is a key component in maintaining crop yields. Transcriptome data obtained through microarray or RNA-seq technologies can provide useful insight into those developmental processes. Six series of microarray data from a public transcriptome database, the Gene Expression Omnibus of the National Center for Biotechnology Information, are related to anther and pollen development. We performed a systematic and functional study across the rice genome of genes that are preferentially expressed in the late stages of pollen development, including maturation and germination. By comparing the transcriptomes of sporophytes and male gametes over time, we identified 627 late pollen-preferred genes that are conserved among japonica and indica rice cultivars. Functional classification analysis with a MapMan tool kit revealed a significant association between cell wall organization/metabolism and mature pollen grains. Comparative analysis of rice and Arabidopsis demonstrated that genes involved in cell wall modifications and the metabolism of major carbohydrates are unique to rice. We used the GUS reporter system to monitor the expression of eight of those genes. In addition, we evaluated the significance of our candidate genes, using T-DNA insertional mutant population and the CRISPR/Cas9 system. Mutants from T-DNA insertion and CRISPR/Cas9 systems of a rice gene encoding glycerophosphoryl diester phosphodiesterase are defective in their male gamete transfer. Through the global analyses of the late pollen-preferred genes from rice, we found several biological features of these genes. First, biological process related to cell wall organization and modification is over-represented in these genes to support rapid tube growth. Second, comparative analysis of late pollen preferred genes between rice and Arabidopsis provide a significant insight on the evolutional disparateness in cell wall biogenesis and storage reserves of pollen. In addition, these candidates might be useful targets for future examinations of late pollen development, and will be a valuable resource for accelerating the understanding of molecular mechanisms for pollen maturation and germination processes in rice.
Jang, Seong Han; Jang, Ho Am; Lee, Junbeom; Kim, Jong Uk; Lee, Seung Ah; Park, Kyoung-Eun; Kim, Byung Hyun; Jo, Yong Hun; Lee, Bok Luel
2017-06-01
Five genes encoding PhaP family proteins and one phaR gene have been identified in the genome of Burkholderia symbiont strain RPE75. PhaP proteins function as the surface proteins of polyhydroxyalkanoate (PHA) granules, and the PhaR protein acts as a negative regulator of PhaP biosynthesis. Recently, we characterized one phaP gene to understand the molecular cross talk between Riptortus insects and Burkholderia gut symbionts. In this study, we constructed four other phaP gene-depleted mutants (Δ phaP1 , Δ phaP2 , Δ phaP3 , and Δ phaP4 mutants), one phaR gene-depleted mutant, and a phaR -complemented mutant (Δ phaR/phaR mutant). To address the biological roles of four phaP family genes and the phaR gene during insect-gut symbiont interaction, these Burkholderia mutants were fed to the second-instar nymphs, and colonization ability and fitness parameters were examined. In vitro , the Δ phaP3 and Δ phaR mutants cannot make a PHA granule normally in a stressful environment. Furthermore, the Δ phaR mutation decreased the colonization ability in the host midgut and negatively affected the host insect's fitness compared with wild-type Burkholderia -infected insects. However, other phaP family gene-depleted mutants colonized well in the midgut of the fifth-instar nymph insects. However, in the case of females, the colonization rate of the Δ phaP3 mutant was decreased and the host's fitness parameters were decreased compared with the wild-type-infected host, suggesting that the environment of the female midgut may be more hostile than that of the male midgut. These results demonstrate that PhaR plays an important role in the biosynthesis of PHA granules and that it is significantly related to the colonization of the Burkholderia gut symbiont in the host insects' midgut. IMPORTANCE Bacterial polyhydroxyalkanoate (PHA) biosynthesis is a complex process requiring several enzymes. The biological roles of PHA granule synthesis enzymes and the surface proteins of PHA granules during host-gut symbiont interactions are not fully understood. Here, we report the effects on colonization ability in the host midguts and the fitness of host insects after feeding Burkholderia mutant cells (four phaP -depleted mutants and one phaR -depleted mutant) to the host insects. Analyses of both synthesized PHA granule amounts and CFU numbers suggest that the phaR gene is closely related to synthesis of the PHA granule and the colonization of the Burkholderia gut symbiont in the host insect's midgut. Like our previous report, this study also supports the idea that the environment of the host midgut may not be favorable to symbiotic Burkholderia cells and that PHA granules may be required to adapt in the host midgut. Copyright © 2017 American Society for Microbiology.
Jang, Seong Han; Jang, Ho Am; Lee, Junbeom; Kim, Jong Uk; Lee, Seung Ah; Park, Kyoung-Eun; Kim, Byung Hyun; Jo, Yong Hun
2017-01-01
ABSTRACT Five genes encoding PhaP family proteins and one phaR gene have been identified in the genome of Burkholderia symbiont strain RPE75. PhaP proteins function as the surface proteins of polyhydroxyalkanoate (PHA) granules, and the PhaR protein acts as a negative regulator of PhaP biosynthesis. Recently, we characterized one phaP gene to understand the molecular cross talk between Riptortus insects and Burkholderia gut symbionts. In this study, we constructed four other phaP gene-depleted mutants (ΔphaP1, ΔphaP2, ΔphaP3, and ΔphaP4 mutants), one phaR gene-depleted mutant, and a phaR-complemented mutant (ΔphaR/phaR mutant). To address the biological roles of four phaP family genes and the phaR gene during insect-gut symbiont interaction, these Burkholderia mutants were fed to the second-instar nymphs, and colonization ability and fitness parameters were examined. In vitro, the ΔphaP3 and ΔphaR mutants cannot make a PHA granule normally in a stressful environment. Furthermore, the ΔphaR mutation decreased the colonization ability in the host midgut and negatively affected the host insect's fitness compared with wild-type Burkholderia-infected insects. However, other phaP family gene-depleted mutants colonized well in the midgut of the fifth-instar nymph insects. However, in the case of females, the colonization rate of the ΔphaP3 mutant was decreased and the host's fitness parameters were decreased compared with the wild-type-infected host, suggesting that the environment of the female midgut may be more hostile than that of the male midgut. These results demonstrate that PhaR plays an important role in the biosynthesis of PHA granules and that it is significantly related to the colonization of the Burkholderia gut symbiont in the host insects' midgut. IMPORTANCE Bacterial polyhydroxyalkanoate (PHA) biosynthesis is a complex process requiring several enzymes. The biological roles of PHA granule synthesis enzymes and the surface proteins of PHA granules during host-gut symbiont interactions are not fully understood. Here, we report the effects on colonization ability in the host midguts and the fitness of host insects after feeding Burkholderia mutant cells (four phaP-depleted mutants and one phaR-depleted mutant) to the host insects. Analyses of both synthesized PHA granule amounts and CFU numbers suggest that the phaR gene is closely related to synthesis of the PHA granule and the colonization of the Burkholderia gut symbiont in the host insect's midgut. Like our previous report, this study also supports the idea that the environment of the host midgut may not be favorable to symbiotic Burkholderia cells and that PHA granules may be required to adapt in the host midgut. PMID:28341680
Efficient transformation and expression of gfp gene in Valsa mali var. mali.
Chen, Liang; Sun, Gengwu; Wu, Shujing; Liu, Huixiang; Wang, Hongkai
2015-01-01
Valsa mali var. mali, the causal agent of valsa canker of apple, causes great loss of apple production in apple producing regions. The pathogenic mechanism of the pathogen has not been studied extensively, thus a suitable gene marker for pathogenic invasion analysis and a random insertion of T-DNA for mutants are desirable. In this paper, we reported the construction of a binary vector pKO1-HPH containing a positive selective gene hygromycin phosphotransferase (hph), a reporter gene gfp conferring green fluorescent protein, and an efficient protocol for V. mali var. mali transformation mediated by Agrobacterium tumefaciens. A transformation efficiency up to about 75 transformants per 10(5) conidia was achieved when co-cultivation of V. mali var. mali and A. tumefaciens for 48 h in A. tumefaciens inductive medium agar plates. The insertions of hph gene and gfp gene into V. mali var. mali genome verified by polymerase chain reaction and southern blot analysis showed that 10 randomly-selected transformants exhibited a single, unique hybridization pattern. This is the first report of A. tumefaciens-mediated transformation of V. mali var mali carrying a 'reporter' gfp gene that stably and efficiently expressed in the transformed V. mali var. mali species.
Liu, Huiquan; Zhang, Shijie; Ma, Jiwen; Dai, Yafeng; Li, Chaohui; Lyu, Xueliang; Wang, Chenfang; Xu, Jin-Rong
2015-06-01
Eukaryotic cell cycle involves a number of protein kinases important for the onset and progression through mitosis, most of which are well characterized in the budding and fission yeasts and conserved in other fungi. However, unlike the model yeast and filamentous fungi that have a single Cdc2 essential for cell cycle progression, the wheat scab fungus Fusarium graminearum contains two CDC2 orthologs. The cdc2A and cdc2B mutants had no obvious defects in growth rate and conidiation but deletion of both of them is lethal, indicating that these two CDC2 orthologs have redundant functions during vegetative growth and asexual reproduction. However, whereas the cdc2B mutant was normal, the cdc2A mutant was significantly reduced in virulence and rarely produced ascospores. Although deletion of CDC2A had no obvious effect on the formation of penetration branches or hyphopodia, the cdc2A mutant was limited in the differentiation and growth of infectious growth in wheat tissues. Therefore, CDC2A plays stage-specific roles in cell cycle regulation during infectious growth and sexual reproduction. Both CDC2A and CDC2B are constitutively expressed but only CDC2A was up-regulated during plant infection and ascosporogenesis. Localization of Cdc2A- GFP to the nucleus but not Cdc2B-GFP was observed in vegetative hyphae, ascospores, and infectious hyphae. Complementation assays with chimeric fusion constructs showed that both the N- and C-terminal regions of Cdc2A are important for its functions in pathogenesis and ascosporogenesis but only the N-terminal region is important for its subcellular localization. Among the Sordariomycetes, only three Fusarium species closely related to F. graminearum have two CDC2 genes. Furthermore, F. graminearum uniquely has two Aurora kinase genes and one additional putative cyclin gene, and its orthologs of CAK1 and other four essential mitotic kinases in the budding yeast are dispensable for viability. Overall, our data indicate that cell cycle regulation is different between vegetative and infectious hyphae in F. graminearum and Cdc2A, possibly by interacting with a stage-specific cyclin, plays a more important role than Cdc2B during ascosporogenesis and plant infection.
Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L
2010-05-01
Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.
VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.
Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G
1993-04-01
Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.
Qin, Zhiwei; Baker, Alexander Thomas; Raab, Andrea; Huang, Sheng; Wang, Tiehui; Yu, Yi; Jaspars, Marcel; Secombes, Christopher J; Deng, Hai
2013-05-24
Holomycin and its derivatives belong to a class of broad-spectrum antibacterial natural products containing a rare dithiolopyrrolone heterobicyclic scaffold. The antibacterial mechanism of dithiolopyrrolone compounds has been attributed to the inhibition of bacterial RNA polymerase activities, although the exact mode of action has not been established in vitro. Some dithiopyrrolone derivatives display potent anticancer activities. Recently the biosynthetic gene cluster of holomycin has been identified and characterized in Streptomyces clavuligerus. Here we report that the fish pathogen Yersinia ruckeri is a holomycin producer, as evidenced through genome mining, chemical isolation, and structural elucidation as well as genetic manipulation. We also identified a unique regulatory gene hom15 at one end of the gene cluster encoding a cold-shock-like protein that likely regulates the production of holomycin in low cultivation temperatures. Inactivation of hom15 resulted in a significant loss of holomycin production. Finally, gene disruption of an RNA methyltransferase gene hom12 resulted in the sensitivity of the mutant toward holomycin. A complementation experiment of hom12 restored the resistance against holomycin. Although the wild-type Escherichia coli BL21(DE3) Gold is susceptible to holomycin, the mutant harboring hom12 showed tolerance toward holomycin. High resolution liquid chromatography (LC)-ESI/MS analysis of digested RNA fragments demonstrated that the wild-type Y. ruckeri and E. coli harboring hom12 contain a methylated RNA fragment, whereas the mutated Y. ruckeri and the wild-type E. coli only contain normal non-methylated RNA fragments. Taken together, our results strongly suggest that this putative RNA methyltransferase Hom12 is the self-resistance protein that methylates the RNA of Y. ruckeri to reduce the cytotoxic effect of holomycin during holomycin production.
Li, Shuyu; Wang, Bao; Huang, Tingting; Du, Minmin; Sun, Jiaqiang; Kang, Le; Li, Chang-Bao; Li, Chuanyou
2013-01-01
In response to insect attack and mechanical wounding, plants activate the expression of genes involved in various defense-related processes. A fascinating feature of these inducible defenses is their occurrence both locally at the wounding site and systemically in undamaged leaves throughout the plant. Wound-inducible proteinase inhibitors (PIs) in tomato (Solanum lycopersicum) provide an attractive model to understand the signal transduction events leading from localized injury to the systemic expression of defense-related genes. Among the identified intercellular molecules in regulating systemic wound response of tomato are the peptide signal systemin and the oxylipin signal jasmonic acid (JA). The systemin/JA signaling pathway provides a unique opportunity to investigate, in a single experimental system, the mechanism by which peptide and oxylipin signals interact to coordinate plant systemic immunity. Here we describe the characterization of the tomato suppressor of prosystemin-mediated responses8 (spr8) mutant, which was isolated as a suppressor of (pro)systemin-mediated signaling. spr8 plants exhibit a series of JA-dependent immune deficiencies, including the inability to express wound-responsive genes, abnormal development of glandular trichomes, and severely compromised resistance to cotton bollworm (Helicoverpa armigera) and Botrytis cinerea. Map-based cloning studies demonstrate that the spr8 mutant phenotype results from a point mutation in the catalytic domain of TomLoxD, a chloroplast-localized lipoxygenase involved in JA biosynthesis. We present evidence that overexpression of TomLoxD leads to elevated wound-induced JA biosynthesis, increased expression of wound-responsive genes and, therefore, enhanced resistance to insect herbivory attack and necrotrophic pathogen infection. These results indicate that TomLoxD is involved in wound-induced JA biosynthesis and highlight the application potential of this gene for crop protection against insects and pathogens. PMID:24348260
Yan, Liuhua; Zhai, Qingzhe; Wei, Jianing; Li, Shuyu; Wang, Bao; Huang, Tingting; Du, Minmin; Sun, Jiaqiang; Kang, Le; Li, Chang-Bao; Li, Chuanyou
2013-01-01
In response to insect attack and mechanical wounding, plants activate the expression of genes involved in various defense-related processes. A fascinating feature of these inducible defenses is their occurrence both locally at the wounding site and systemically in undamaged leaves throughout the plant. Wound-inducible proteinase inhibitors (PIs) in tomato (Solanum lycopersicum) provide an attractive model to understand the signal transduction events leading from localized injury to the systemic expression of defense-related genes. Among the identified intercellular molecules in regulating systemic wound response of tomato are the peptide signal systemin and the oxylipin signal jasmonic acid (JA). The systemin/JA signaling pathway provides a unique opportunity to investigate, in a single experimental system, the mechanism by which peptide and oxylipin signals interact to coordinate plant systemic immunity. Here we describe the characterization of the tomato suppressor of prosystemin-mediated responses8 (spr8) mutant, which was isolated as a suppressor of (pro)systemin-mediated signaling. spr8 plants exhibit a series of JA-dependent immune deficiencies, including the inability to express wound-responsive genes, abnormal development of glandular trichomes, and severely compromised resistance to cotton bollworm (Helicoverpa armigera) and Botrytis cinerea. Map-based cloning studies demonstrate that the spr8 mutant phenotype results from a point mutation in the catalytic domain of TomLoxD, a chloroplast-localized lipoxygenase involved in JA biosynthesis. We present evidence that overexpression of TomLoxD leads to elevated wound-induced JA biosynthesis, increased expression of wound-responsive genes and, therefore, enhanced resistance to insect herbivory attack and necrotrophic pathogen infection. These results indicate that TomLoxD is involved in wound-induced JA biosynthesis and highlight the application potential of this gene for crop protection against insects and pathogens.
Park, Joohae; Tefsen, Boris; Arentshorst, Mark; Lagendijk, Ellen; van den Hondel, Cees Amjj; van Die, Irma; Ram, Arthur Fj
2014-01-01
Galactofuranose (Gal f )-containing glycoconjugates are important to secure the integrity of the cell wall of filamentous fungi. Mutations that prevent the biosynthesis of Gal f -containing molecules compromise cell wall integrity. In response to cell wall weakening, the cell wall integrity (CWI)-pathway is activated to reinforce the strength of the cell wall. Activation of CWI-pathway in Aspergillus niger is characterized by the specific induction of the agsA gene, which encodes a cell wall α-glucan synthase. In this study, we screened a collection of cell wall mutants with an induced expression of agsA for defects in Gal f biosynthesis using a with anti-Gal f antibody (L10). From this collection of mutants, we previously identified mutants in the UDP-galactopyranose mutase encoding gene ( ugmA ). Here, we have identified six additional UDP-galactopyranose mutase ( ugmA ) mutants and one mutant (named mutant #41) in an additional complementation group that displayed strongly reduced Gal f -levels in the cell wall. By using a whole genome sequencing approach, 21 SNPs in coding regions were identified between mutant #41 and its parental strain which changed the amino acid sequence of the encoded proteins. One of these mutations was in gene An14g03820, which codes for a putative UDP-glucose-4-epimerase (UgeA). The A to G mutation in this gene causes an amino acid change of Asn to Asp at position 191 in the UgeA protein. Targeted deletion of ugeA resulted in an even more severe reduction of Gal f in N-linked glucans, indicating that the UgeA protein in mutant #41 is partially active. The ugeA gene is also required for growth on galactose despite the presence of two UgeA homologs in the A. niger genome. By using a classical mutant screen and whole genome sequencing of a new Gal f -deficient mutant, the UDP-glucose-4-epimerase gene ( ugeA ) has been identified. UgeA is required for the biosynthesis of Gal f as well as for galactose metabolism in Aspergillus niger .
Bozue, Joel; Cote, Christopher K; Chance, Taylor; Kugelman, Jeffrey; Kern, Steven J; Kijek, Todd K; Jenkins, Amy; Mou, Sherry; Moody, Krishna; Fritz, David; Robinson, Camenzind G; Bell, Todd; Worsham, Patricia
2014-01-01
Bacterial proteins destined for the Tat pathway are folded before crossing the inner membrane and are typically identified by an N-terminal signal peptide containing a twin arginine motif. Translocation by the Tat pathway is dependent on the products of genes which encode proteins possessing the binding site of the signal peptide and mediating the actual translocation event. In the fully virulent CO92 strain of Yersinia pestis, the tatA gene was deleted. The mutant was assayed for loss of virulence through various in vitro and in vivo assays. Deletion of the tatA gene resulted in several consequences for the mutant as compared to wild-type. Cell morphology of the mutant bacteria was altered and demonstrated a more elongated form. In addition, while cultures of the mutant strain were able to produce a biofilm, we observed a loss of adhesion of the mutant biofilm structure compared to the biofilm produced by the wild-type strain. Immuno-electron microscopy revealed a partial disruption of the F1 antigen on the surface of the mutant. The virulence of the ΔtatA mutant was assessed in various murine models of plague. The mutant was severely attenuated in the bubonic model with full virulence restored by complementation with the native gene. After small-particle aerosol challenge in a pneumonic model of infection, the mutant was also shown to be attenuated. In contrast, when mice were challenged intranasally with the mutant, very little difference in the LD50 was observed between wild-type and mutant strains. However, an increased time-to-death and delay in bacterial dissemination was observed in mice infected with the ΔtatA mutant as compared to the parent strain. Collectively, these findings demonstrate an essential role for the Tat pathway in the virulence of Y. pestis in bubonic and small-aerosol pneumonic infection but less important role for intranasal challenge.
Bozue, Joel; Cote, Christopher K.; Chance, Taylor; Kugelman, Jeffrey; Kern, Steven J.; Kijek, Todd K.; Jenkins, Amy; Mou, Sherry; Moody, Krishna; Fritz, David; Robinson, Camenzind G.; Bell, Todd; Worsham, Patricia
2014-01-01
Bacterial proteins destined for the Tat pathway are folded before crossing the inner membrane and are typically identified by an N-terminal signal peptide containing a twin arginine motif. Translocation by the Tat pathway is dependent on the products of genes which encode proteins possessing the binding site of the signal peptide and mediating the actual translocation event. In the fully virulent CO92 strain of Yersinia pestis, the tatA gene was deleted. The mutant was assayed for loss of virulence through various in vitro and in vivo assays. Deletion of the tatA gene resulted in several consequences for the mutant as compared to wild-type. Cell morphology of the mutant bacteria was altered and demonstrated a more elongated form. In addition, while cultures of the mutant strain were able to produce a biofilm, we observed a loss of adhesion of the mutant biofilm structure compared to the biofilm produced by the wild-type strain. Immuno-electron microscopy revealed a partial disruption of the F1 antigen on the surface of the mutant. The virulence of the ΔtatA mutant was assessed in various murine models of plague. The mutant was severely attenuated in the bubonic model with full virulence restored by complementation with the native gene. After small-particle aerosol challenge in a pneumonic model of infection, the mutant was also shown to be attenuated. In contrast, when mice were challenged intranasally with the mutant, very little difference in the LD50 was observed between wild-type and mutant strains. However, an increased time-to-death and delay in bacterial dissemination was observed in mice infected with the ΔtatA mutant as compared to the parent strain. Collectively, these findings demonstrate an essential role for the Tat pathway in the virulence of Y. pestis in bubonic and small-aerosol pneumonic infection but less important role for intranasal challenge. PMID:25101850
Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit
Yang, Ying; Yang, Feng; Li, Yan-Hong; Liu, He-Ping; Chen, Xiao-Yan
2017-01-01
Aspergillus niger, a saprophytic fungus, is widely distributed in soil, air and cereals, and can cause postharvest diseases in fruit. Polygalacturonase (PG) is one of the main enzymes in fungal pathogens to degrade plant cell wall. To evaluate whether the deletion of an exo-polygalacturonase gene pgxB would influence fungal pathogenicity to fruit, pgxB gene was deleted in Aspergillus niger MA 70.15 (wild type) via homologous recombination. The ΔpgxB mutant showed similar growth behavior compared with the wild type. Pectin medium induced significant higher expression of all pectinase genes in both wild type and ΔpgxB in comparison to potato dextrose agar medium. However, the ΔpgxB mutant was less virulent on apple fruits as the necrosis diameter caused by ΔpgxB mutant was significantly smaller than that of wild type. Results of quantitive-PCR showed that, in the process of infection in apple fruit, gene expressions of polygalacturonase genes pgaI, pgaII, pgaA, pgaC, pgaD and pgaE were enhanced in ΔpgxB mutant in comparison to wild type. These results prove that, despite the increased gene expression of other polygalacturonase genes in ΔpgxB mutant, the lack of pgxB gene significantly reduced the virulence of A. niger on apple fruit, suggesting that pgxB plays an important role in the infection process on the apple fruit. PMID:28257463
Kawasaki, Haruhisa; Suzuki, Takahiro; Ito, Kumpei; Takahara, Tsubasa; Goto-Inoue, Naoko; Setou, Mitsutoshi; Sakata, Kazuki; Ishida, Norio
2017-05-30
Gaucher's disease in humans is considered a deficiency of glucocerebrosidase (GlcCerase) that result in the accumulation of its substrate, glucocerebroside (GlcCer). Although mouse models of Gaucher's disease have been reported from several laboratories, these models are limited due to the perinatal lethality of GlcCerase gene. Here, we examined phenotypes of Drosophila melanogaster homologues genes of the human Gaucher's disease gene by using Minos insertion. One of two Minos insertion mutants to unknown function gene (CG31414) accumulates the hydroxy-GlcCer in whole body of Drosophila melanogaster. This mutant showed abnormal phenotypes of climbing ability and sleep, and short lifespan. These abnormal phenotypes are very similar to that of Gaucher's disease in human. In contrast, another Minos insertion mutant (CG31148) and its RNAi line did not show such severe phenotype as observed in CG31414 gene mutation. The data suggests that Drosophila CG31414 gene mutation might be useful for unraveling the molecular mechanism of Gaucher's disease. Copyright © 2017 Elsevier B.V. All rights reserved.
Fused pulmonary lobes is a rat model of human Fraser syndrome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kiyozumi, Daiji; Nakano, Itsuko; Takahashi, Ken L.
Highlights: {yields} Fused pulmonary lobes (fpl) mutant rats exhibit similar phenotypes to Fraser syndrome. {yields} The fpl gene harbors a nonsense mutation in Fraser syndrome-associated gene Frem2. {yields} Fpl mutant is defined as a first model of human Fraser syndrome in rats. -- Abstract: Fused pulmonary lobes (fpl) is a mutant gene that is inherited in an autosomal recessive manner and causes various developmental defects, including fusion of pulmonary lobes, and eyelid and digit anomalies in rats. Since these developmental defects closely resemble those observed in patients with Fraser syndrome, a recessive multiorgan disorder, and its model animals, we investigatedmore » whether the abnormal phenotypes observed in fpl/fpl mutant rats are attributable to a genetic disorder similar to Fraser syndrome. At the epidermal basement membrane in fpl/fpl mutant neonates, the expression of QBRICK, a basement membrane protein whose expression is attenuated in Fraser syndrome model mice, was greatly diminished compared with control littermates. Quantitative RT-PCR analyses of Fraser syndrome-related genes revealed that Frem2 transcripts were markedly diminished in QBRICK-negative embryos. Genomic DNA sequencing of the fpl/fpl mutant identified a nonsense mutation that introduced a stop codon at serine 2005 in Frem2. These findings indicate that the fpl mutant is a rat model of human Fraser syndrome.« less
Wright, Robin; Parrish, Mark L; Cadera, Emily; Larson, Lynnelle; Matson, Clinton K; Garrett-Engele, Philip; Armour, Chris; Lum, Pek Yee; Shoemaker, Daniel D
2003-07-30
Increased levels of HMG-CoA reductase induce cell type- and isozyme-specific proliferation of the endoplasmic reticulum. In yeast, the ER proliferations induced by Hmg1p consist of nuclear-associated stacks of smooth ER membranes known as karmellae. To identify genes required for karmellae assembly, we compared the composition of populations of homozygous diploid S. cerevisiae deletion mutants following 20 generations of growth with and without karmellae. Using an initial population of 1,557 deletion mutants, 120 potential mutants were identified as a result of three independent experiments. Each experiment produced a largely non-overlapping set of potential mutants, suggesting that differences in specific growth conditions could be used to maximize the comprehensiveness of similar parallel analysis screens. Only two genes, UBC7 and YAL011W, were identified in all three experiments. Subsequent analysis of individual mutant strains confirmed that each experiment was identifying valid mutations, based on the mutant's sensitivity to elevated HMG-CoA reductase and inability to assemble normal karmellae. The largest class of HMG-CoA reductase-sensitive mutations was a subset of genes that are involved in chromatin structure and transcriptional regulation, suggesting that karmellae assembly requires changes in transcription or that the presence of karmellae may interfere with normal transcriptional regulation. Copyright 2003 John Wiley & Sons, Ltd.
Himuro, Yasuyo; Tanaka, Hidenori; Hashiguchi, Masatsugu; Ichikawa, Takanari; Nakazawa, Miki; Seki, Motoaki; Fujita, Miki; Shinozaki, Kazuo; Matsui, Minami; Akashi, Ryo; Hoffmann, Franz
2011-01-15
Using the full-length cDNA overexpressor (FOX) gene-hunting system, we have generated 130 Arabidopsis FOX-superroot lines in bird's-foot trefoil (Lotus corniculatus) for the systematic functional analysis of genes expressed in roots and for the selection of induced mutants with interesting root growth characteristics. We used the Arabidopsis-FOX Agrobacterium library (constructed by ligating pBIG2113SF) for the Agrobacterium-mediated transformation of superroots (SR) and the subsequent selection of gain-of-function mutants with ectopically expressed Arabidopsis genes. The original superroot culture of L. corniculatus is a unique host system displaying fast root growth in vitro, allowing continuous root cloning, direct somatic embryogenesis and mass regeneration of plants under entirely hormone-free culture conditions. Several of the Arabidopsis FOX-superroot lines show interesting deviations from normal growth and morphology of roots from SR-plants, such as differences in pigmentation, growth rate, length or diameter. Some of these mutations are of potential agricultural interest. Genomic PCR analysis revealed that 100 (76.9%) out of the 130 transgenic lines showed the amplification of single fragments. Sequence analysis of the PCR fragments from these 100 lines identified full-length cDNA in 74 of them. Forty-three out of 74 full-length cDNA carried known genes. The Arabidopsis FOX-superroot lines of L. corniculatus, produced in this study, expand the FOX hunting system and provide a new tool for the genetic analysis and control of root growth in a leguminous forage plant. Copyright © 2010 Elsevier GmbH. All rights reserved.
Competition among gene regulatory networks imposes order within the eye-antennal disc of Drosophila
Weasner, Bonnie M.; Kumar, Justin P.
2013-01-01
The eye-antennal disc of Drosophila gives rise to numerous adult tissues, including the compound eyes, ocelli, antennae, maxillary palps and surrounding head capsule. The fate of each tissue is governed by the activity of unique gene regulatory networks (GRNs). The fate of the eye, for example, is controlled by a set of fourteen interlocking genes called the retinal determination (RD) network. Mutations within network members lead to replacement of the eyes with head capsule. Several studies have suggested that in these instances all retinal progenitor and precursor cells are eliminated via apoptosis and as a result the surrounding head capsule proliferates to compensate for retinal tissue loss. This model implies that the sole responsibility of the RD network is to promote the fate of the eye. We have re-analyzed eyes absent mutant discs and propose an alternative model. Our data suggests that in addition to promoting an eye fate the RD network simultaneously functions to actively repress GRNs that are responsible for directing antennal and head capsule fates. Compromising the RD network leads to the inappropriate expression of several head capsule selector genes such as cut, Lim1 and wingless. Instead of undergoing apoptosis, a population of mutant retinal progenitors and precursor cells adopt a head capsule fate. This transformation is accompanied by an adjustment of cell proliferation rates such that just enough head capsule is generated to produce an intact adult head. We propose that GRNs simultaneously promote primary fates, inhibit alternative fates and establish cell proliferation states. PMID:23222441
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Neill, G.P.; Michelsen, U.; Soll, D.
Ethylmethane sulfonate-induced mutants of several Escherichia coli strains that required {delta}-aminolevulinic acid (ALA) for growth were isolated by penicillin enrichment or by selection for respiratory-defective strains resistant to the aminoglycoside antibiotic kanamycin. Three classes of mutants were obtained. Two-thirds of the strains were mutants in hemA. Representative of a third of the mutations was the hem-201 mutation. This mutation was mapped to min 8.6 to 8.7. Complementation of the auxotrophic phenotype by wild-type DNA from the corresponding phage 8F10 allowed the isolation of the gene. DNA sequence analysis revealed that the hem-201 gene encoded ALA dehydratase and was similar tomore » a known hemB gene of E. coli. Complementation studies of hem-201 and hemB1 mutant strains with various hem-201 gene subfragments showed that hem-201 and the previously reported hemB1 mutation are in the same gene and that no other gene is required to complement the hem-201 mutant. ALA-forming activity from glutamate could not be detected by in vitro or in vivo assays. Extracts of hem-201 cells had drastically reduce ALA dehydratase levels, while cells transformed with the plasmid-encoded wild-type gene possessed highly elevated enzyme levels. The ALA requirement for growth, the lack of any ALA-forming enzymatic activity, and greatly reduced ALA dehydratase activity of the hem-201 strain suggest that a diffusible product of an enzyme in the heme biosynthetic pathway after ALA formation is involved in positive regulation of ALA biosynthesis. Analysis of another class of ALA-requiring mutants showed that the auxotrophy of the hem-205 mutant could be relieved by either methionine or cysteine and that the mutation maps in the cysG gene, which encodes uroporphyrinogen III methylase. The properties of these nonleaky ALA-requiring strains suggest that ALA is involved more extensively in E. coli intermediary metabolism than has been appreciated to date.« less
Barcode Sequencing Screen Identifies SUB1 as a Regulator of Yeast Pheromone Inducible Genes
Sliva, Anna; Kuang, Zheng; Meluh, Pamela B.; Boeke, Jef D.
2016-01-01
The yeast pheromone response pathway serves as a valuable model of eukaryotic mitogen-activated protein kinase (MAPK) pathways, and transcription of their downstream targets. Here, we describe application of a screening method combining two technologies: fluorescence-activated cell sorting (FACS), and barcode analysis by sequencing (Bar-Seq). Using this screening method, and pFUS1-GFP as a reporter for MAPK pathway activation, we readily identified mutants in known mating pathway components. In this study, we also include a comprehensive analysis of the FUS1 induction properties of known mating pathway mutants by flow cytometry, featuring single cell analysis of each mutant population. We also characterized a new source of false positives resulting from the design of this screen. Additionally, we identified a deletion mutant, sub1Δ, with increased basal expression of pFUS1-GFP. Here, in the first ChIP-Seq of Sub1, our data shows that Sub1 binds to the promoters of about half the genes in the genome (tripling the 991 loci previously reported), including the promoters of several pheromone-inducible genes, some of which show an increase upon pheromone induction. Here, we also present the first RNA-Seq of a sub1Δ mutant; the majority of genes have no change in RNA, but, of the small subset that do, most show decreased expression, consistent with biochemical studies implicating Sub1 as a positive transcriptional regulator. The RNA-Seq data also show that certain pheromone-inducible genes are induced less in the sub1Δ mutant relative to the wild type, supporting a role for Sub1 in regulation of mating pathway genes. The sub1Δ mutant has increased basal levels of a small subset of other genes besides FUS1, including IMD2 and FIG1, a gene encoding an integral membrane protein necessary for efficient mating. PMID:26837954
MET exon 14 skipping defines a unique molecular class of non-small cell lung cancer.
Zheng, Difan; Wang, Rui; Ye, Ting; Yu, Su; Hu, Haichuan; Shen, Xuxia; Li, Yuan; Ji, Hongbin; Sun, Yihua; Chen, Haiquan
2016-07-05
Recurrent MET exon 14 splicing has been revealed in lung cancers and is a promising therapeutic target. Because we have limited knowledge about the natural history of MET mutant tumors, the current study was aiming to determine the clinical and pathological characteristics in non-small cell lung cancers (NSCLC). Twenty-three patients (1.3%) were positive for MET exon 14 skipping. Patients with MET exon 14 skipping displayed unique characteristics: female, non-smokers, earlier pathology stage and older age. MET exon 14 skipping indicated an early event as other drivers in lung cancer, while MET copy number gain was more likely a late event in lung cancer. Overall survival (OS) of patients harboring MET exon 14 skipping was longer than patients with KRAS mutation. Almost four-fifths of the lung tumors with MET exon 14 skipping had EGFR and/or HER2 gene copy number gains. EGFR inhibitor showed moderate antitumor activity in treatment of a patient harboring MET exon 14 skipping. From October 2007 to June 2013, we screened 1770 patients with NSCLC and correlated MET status with clinical pathologic characteristics and mutations in EGFR, KRAS, BRAF, HER2, and ALK. Quantitative Real-Time PCR was used to detect MET gene copy number gain. Immunohistochemistry (IHC) was also performed to screen MET exon 14 skipping. Clinicopathological characteristics and survival information were analyzed. MET exon 14 skipping was detected in 1.3% (23/1770) of the Chinese patients with NSCLC. MET exon 14 skipping defined a new molecular subset of NSCLC with identifiable clinical characteristics. The therapeutic EGFR inhibitors might be an alternative treatment for patients with MET mutant NSCLC.
2014-01-01
Background The disaccharide trehalose is a major component of fungal spores and is released upon germination. Moreover, the sugar is well known for is protective functions, e.g. against thermal stress and dehydration. The properties and synthesis of trehalose have been well investigated in the bakers’ yeast Saccharomyces cerevisiae. In filamentous fungi, such knowledge is limited, although several gene products have been identified. Results Using Aspergillus niger as a model fungus, the aim of this study was to provide an overview of all genes involved in trehalose synthesis. This fungus has three potential trehalose-6-phosphate synthase encoding genes, tpsA-C, and three putative trehalose phosphate phosphatase encoding genes, tppA-C, of which two have not previously been identified. Expression of all six genes was confirmed using real-time PCR, and conserved orthologs could be identified in related Aspergilli. Using a two-hybrid approach, there is a strong indication that four of the proteins physically interact, as has previously been shown in S. cerevisiae. When creating null mutants of all the six genes, three of them, ΔtpsA, ΔtppA and ΔtppB, had lower internal trehalose contents. The only mutant with a pronounced morphological difference was ΔtppA, in which sporulation was severely reduced with abnormal conidiophores. This was also the only mutant with accumulated levels of trehalose-6-phosphate, indicating that the encoded protein is the main phosphatase under normal conditions. Besides ΔtppA, the most studied deletion mutant in this work was ΔtppB. This gene encodes a protein conserved in filamentous Ascomycota. The ΔtppB mutant displayed a low, but not depleted, internal trehalose content, and conidia were more susceptible to thermal stress. Conclusion A. niger contains at least 6 genes putatively involved in trehalose synthesis. Gene expressions related to germination have been quantified and deletion mutants characterized: Mutants lacking tpsA, tppA or tppB have reduced internal trehalose contents. Furthermore, tppA, under normal conditions, encodes the functional trehalose-6-phosphate-phosphatase. PMID:24725382
Lee, Hyoung Yool; Byeon, Yeong; Tan, Dun-Xian; Reiter, Russel J; Back, Kyoungwhan
2015-04-01
Serotonin N-acetyltransferase (SNAT) is the penultimate enzyme in the melatonin biosynthesis pathway in plants. We examined the effects of SNAT gene inactivation in two Arabidopsis T-DNA insertion mutant lines. After inoculation with the avirulent pathogen Pseudomonas syringe pv. tomato DC3000 harboring the elicitor avrRpt2 (Pst-avrRpt2), melatonin levels in the snat knockout mutant lines were 50% less than in wild-type Arabidopsis Col-0 plants. The snat knockout mutant lines exhibited susceptibility to pathogen infection that coincided with decreased induction of defense genes including PR1, ICS1, and PDF1.2. Because melatonin acts upstream of salicylic acid (SA) synthesis, the reduced melatonin levels in the snat mutant lines led to decreased SA levels compared to wild-type, suggesting that the increased pathogen susceptibility of the snat mutant lines could be attributed to decreased SA levels and subsequent attenuation of defense gene induction. Exogenous melatonin treatment failed to induce defense gene expression in nahG Arabidopsis plants, but restored the induction of defense gene expression in the snat mutant lines. In addition, melatonin caused translocation of NPR1 (nonexpressor of PR1) protein from the cytoplasm into the nucleus indicating that melatonin-elicited pathogen resistance in response to avirulent pathogen attack is SA-dependent in Arabidopsis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Silva, Cecilia A.; Blondel, Carlos J.; Quezada, Carolina P.; Porwollik, Steffen; Andrews-Polymenis, Helene L.; Toro, Cecilia S.; Zaldívar, Mercedes; Contreras, Inés
2012-01-01
Salmonella enterica serovar Enteritidis causes a systemic, typhoid-like infection in newly hatched poultry and mice. In the present study, a library of 54,000 transposon mutants of S. Enteritidis phage type 4 (PT4) strain P125109 was screened for mutants deficient in the in vivo colonization of the BALB/c mouse model using a microarray-based negative-selection screening. Mutants in genes known to contribute to systemic infection (e.g., Salmonella pathogenicity island 2 [SPI-2], aro, rfa, rfb, phoP, and phoQ) and enteric infection (e.g., SPI-1 and SPI-5) in this and other Salmonella serovars displayed colonization defects in our assay. In addition, a strong attenuation was observed for mutants in genes and genomic islands that are not present in S. Typhimurium or in most other Salmonella serovars. These genes include a type I restriction/modification system (SEN4290 to SEN4292), the peg fimbrial operon (SEN2144A to SEN2145B), a putative pathogenicity island (SEN1970 to SEN1999), and a type VI secretion system remnant SEN1001, encoding a hypothetical protein containing a lysin motif (LysM) domain associated with peptidoglycan binding. Proliferation defects for mutants in these individual genes and in exemplar genes for each of these clusters were confirmed in competitive infections with wild-type S. Enteritidis. A ΔSEN1001 mutant was defective for survival within RAW264.7 murine macrophages in vitro. Complementation assays directly linked the SEN1001 gene to phenotypes observed in vivo and in vitro. The genes identified here may perform novel virulence functions not characterized in previous Salmonella models. PMID:22083712
Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S
2014-02-01
The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-L-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., ), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.
Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L
2017-07-15
Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.
Selva, E M; Maderazo, A B; Lahue, R S
1997-12-01
The products of the yeast mismatch repair genes MSH2 and MSH3 participate in the inhibition of genetic recombination between homeologous (divergent) DNA sequences. In strains deficient for these genes, homeologous recombination rates between repeated elements are elevated due to the loss of this inhibition. In this study, the effects of these mutations were further analyzed by quantitation of mitotic homeologous recombinants as crossovers, gene conversions or exceptional events in wild-type, msh2, msh3 and msh2 msh3 mutant strains. When homeologous sequences were present as a direct repeat in one orientation, crossovers and gene conversions were elevated in msh2, msh3 and msh2 msh3 strains. The increases were greater in the msh2 msh3 double mutant than in either single mutant. When the order of the homeologous sequences was reversed, the msh2 mutation again yielded increased rates of crossovers and gene conversions. However, in an msh3 strain, gene conversions occurred at higher levels but interchromosomal crossovers were not increased and intrachromosomal crossovers were reduced relative to wild type. The msh2 msh3 double mutant behaved like the msh2 single mutant in this orientation. Control strains harboring homologous duplications were largely but not entirely unaffected in mutant strains, suggesting specificity for the mismatched intermediates of homeologous recombination. In all strains, very few (< 10%) recombinants could be attributed to exceptional events. These results suggest that MSH2 and MSH3 can function differentially to control homeologous exchanges.
Pang, Xiuhua; Aigle, Bertrand; Girardet, Jean-Michel; Mangenot, Sophie; Pernodet, Jean-Luc; Decaris, Bernard; Leblond, Pierre
2004-01-01
Streptomyces ambofaciens has an 8-Mb linear chromosome ending in 200-kb terminal inverted repeats. Analysis of the F6 cosmid overlapping the terminal inverted repeats revealed a locus similar to type II polyketide synthase (PKS) gene clusters. Sequence analysis identified 26 open reading frames, including genes encoding the β-ketoacyl synthase (KS), chain length factor (CLF), and acyl carrier protein (ACP) that make up the minimal PKS. These KS, CLF, and ACP subunits are highly homologous to minimal PKS subunits involved in the biosynthesis of angucycline antibiotics. The genes encoding the KS and ACP subunits are transcribed constitutively but show a remarkable increase in expression after entering transition phase. Five genes, including those encoding the minimal PKS, were replaced by resistance markers to generate single and double mutants (replacement in one and both terminal inverted repeats). Double mutants were unable to produce either diffusible orange pigment or antibacterial activity against Bacillus subtilis. Single mutants showed an intermediate phenotype, suggesting that each copy of the cluster was functional. Transformation of double mutants with a conjugative and integrative form of F6 partially restored both phenotypes. The pigmented and antibacterial compounds were shown to be two distinct molecules produced from the same biosynthetic pathway. High-pressure liquid chromatography analysis of culture extracts from wild-type and double mutants revealed a peak with an associated bioactivity that was absent from the mutants. Two additional genes encoding KS and CLF were present in the cluster. However, disruption of the second KS gene had no effect on either pigment or antibiotic production. PMID:14742212
Mishra, Ankita; Singh, Anuradha; Sharma, Monica; Kumar, Pankaj; Roy, Joy
2016-10-06
Starch is a major part of cereal grain. It comprises two glucose polymer fractions, amylose (AM) and amylopectin (AP), that make up about 25 and 75 % of total starch, respectively. The ratio of the two affects processing quality and digestibility of starch-based food products. Digestibility determines nutritional quality, as high amylose starch is considered a resistant or healthy starch (RS type 2) and is highly preferred for preventive measures against obesity and related health conditions. The topic of nutrition security is currently receiving much attention and consumer demand for food products with improved nutritional qualities has increased. In bread wheat (Triticum aestivum L.), variation in amylose content is narrow, hence its limited improvement. Therefore, it is necessary to produce wheat lines or populations showing wide variation in amylose/resistant starch content. In this study, a set of EMS-induced M4 mutant lines showing dynamic variation in amylose/resistant starch content were produced. Furthermore, two diverse mutant lines for amylose content were used to study quantitative expression patterns of 20 starch metabolic pathway genes and to identify candidate genes for amylose biosynthesis. A population comprising 101 EMS-induced mutation lines (M4 generation) was produced in a bread wheat (Triticum aestivum) variety. Two methods of amylose measurement in grain starch showed variation in amylose content ranging from ~3 to 76 % in the population. The method of in vitro digestion showed variation in resistant starch content from 1 to 41 %. One-way ANOVA analysis showed significant variation (p < 0.05) in amylose and resistant starch content within the population. A multiple comparison test (Dunnett's test) showed that significant variation in amylose and resistant starch content, with respect to the parent, was observed in about 89 and 38 % of the mutant lines, respectively. Expression pattern analysis of 20 starch metabolic pathway genes in two diverse mutant lines (low and high amylose mutants) showed higher expression of key genes of amylose biosynthesis (GBSSI and their isoforms) in the high amylose mutant line, in comparison to the parent. Higher expression of amylopectin biosynthesis (SBE) was observed in the low amylose mutant lines. An additional six candidate genes showed over-expression (BMY, SPA) and reduced-expression (SSIII, SBEI, SBEIII, ISA3) in the high amylose mutant line, indicating that other starch metabolic genes may also contribute to amylose biosynthesis. In this study a set of 101 EMS-induced mutant lines (M4 generation) showing variation in amylose and resistant starch content in seed were produced. This population serves as useful germplasm or pre-breeding material for genome-wide study and improvement of starch-based processing and nutrition quality in wheat. It is also useful for the study of the genetic and molecular basis of amylose/resistant starch variation in wheat. Furthermore, gene expression analysis of 20 starch metabolic genes in the two diverse mutant lines (low and high amylose mutants) indicates that in addition to key genes, several other genes (such as phosphorylases, isoamylases, and pullulanases) may also be involved in contributing to amylose/amylopectin biosynthesis.
Paradigms for pharmacological characterization of C. elegans synaptic transmission mutants.
Locke, Cody; Berry, Kalen; Kautu, Bwarenaba; Lee, Kyle; Caldwell, Kim; Caldwell, Guy
2008-08-18
The nematode, Caenorhabditis elegans, has become an expedient model for studying neurotransmission. C. elegans is unique among animal models, as the anatomy and connectivity of its nervous system has been determined from electron micrographs and refined by pharmacological assays. In this video, we describe how two complementary neural stimulants, an acetylcholinesterase inhibitor, called aldicarb, and a gamma-aminobutyric acid (GABA) receptor antagonist, called pentylenetetrazole (PTZ), may be employed to specifically characterize signaling at C. elegans neuromuscular junctions (NMJs) and facilitate our understanding of antagonistic neural circuits. Of 302 C. elegans neurons, nineteen GABAergic D-type motor neurons innervate body wall muscles (BWMs), while four GABAergic neurons, called RMEs, innervate head muscles. Conversely, thirty-nine motor neurons express the excitatory neurotransmitter, acetylcholine (ACh), and antagonize GABA transmission at BWMs to coordinate locomotion. The antagonistic nature of GABAergic and cholinergic motor neurons at body wall NMJs was initially determined by laser ablation and later buttressed by aldicarb exposure. Acute aldicarb exposure results in a time-course or dose-responsive paralysis in wild-type worms. Yet, loss of excitatory ACh transmission confers resistance to aldicarb, as less ACh accumulates at worm NMJs, leading to less stimulation of BWMs. Resistance to aldicarb may be observed with ACh-specific or general synaptic function mutants. Consistent with antagonistic GABA and ACh transmission, loss of GABA transmission, or a failure to negatively regulate ACh release, confers hypersensitivity to aldicarb. Although aldicarb exposure has led to the isolation of numerous worm homologs of neurotransmission genes, aldicarb exposure alone cannot efficiently determine prevailing roles for genes and pathways in specific C. elegans motor neurons. For this purpose, we have introduced a complementary experimental approach, which uses PTZ. Neurotransmission mutants display clear phenotypes, distinct from aldicarb-induced paralysis, in response to PTZ. Wild-type worms, as well as mutants with specific inabilities to release or receive ACh, do not show apparent sensitivity to PTZ. However, GABA mutants, as well as general synaptic function mutants, display anterior convulsions in a time-course or dose-responsive manner. Mutants that cannot negatively regulate general neurotransmitter release and, thus, secrete excessive amounts of ACh onto BWMs, become paralyzed on PTZ. The PTZ-induced phenotypes of discrete mutant classes indicate that a complementary approach with aldicarb and PTZ exposure paradigms in C. elegans may accelerate our understanding of neurotransmission. Moreover, videos demonstrating how we perform pharmacological assays should establish consistent methods for C. elegans research.
New RNAi strategy for selective suppression of a mutant allele in polyglutamine disease.
Kubodera, Takayuki; Yokota, Takanori; Ishikawa, Kinya; Mizusawa, Hidehiro
2005-12-01
In gene therapy of dominantly inherited diseases with small interfering RNA (siRNA), mutant allele specific suppression may be necessary for diseases in which the defective gene normally has an important role. It is difficult, however, to design a mutant allele-specific siRNA for trinucleotide repeat diseases in which the difference of sequences is only repeat length. To overcome this problem, we use a new RNA interference (RNAi) strategy for selective suppression of mutant alleles. Both mutant and wild-type alleles are inhibited by the most effective siRNA, and wild-type protein is restored using the wild-type mRNA modified to be resistant to the siRNA. Here, we applied this method to spinocerebellar ataxia type 6 (SCA6). We discuss its feasibility and problems for future gene therapy.
Tricarboxylic acid cycle without malate dehydrogenase in Streptomyces coelicolor M-145.
Takahashi-Íñiguez, Tóshiko; Barrios-Hernández, Joana; Rodríguez-Maldonado, Marion; Flores, María Elena
2018-06-23
The oxidation of malate to oxaloacetate is catalysed only by a nicotinamide adenine dinucleotide-dependent malate dehydrogenase encoded by SCO4827 in Streptomyces coelicolor. A mutant lacking the malate dehydrogenase gene was isolated and no enzymatic activity was detected. As expected, the ∆mdh mutant was unable to grow on malate as the sole carbon source. However, the mutant grew less in minimal medium with glucose and there was a delay of 36 h. The same behaviour was observed when the mutant was grown on minimal medium with casamino acids or glycerol. For unknown reasons, the mutant was not able to grow in YEME medium with glucose. The deficiency of malate dehydrogenase affected the expression of the isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase genes, decreasing the expression of both genes by approximately two- to threefold.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A
2008-12-23
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.
2008-01-01
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934
Respiratory-deficient mutants of the unicellular green alga Chlamydomonas: a review.
Salinas, Thalia; Larosa, Véronique; Cardol, Pierre; Maréchal-Drouard, Laurence; Remacle, Claire
2014-05-01
Genetic manipulation of the unicellular green alga Chlamydomonas reinhardtii is straightforward. Nuclear genes can be interrupted by insertional mutagenesis or targeted by RNA interference whereas random or site-directed mutagenesis allows the introduction of mutations in the mitochondrial genome. This, combined with a screen that easily allows discriminating respiratory-deficient mutants, makes Chlamydomonas a model system of choice to study mitochondria biology in photosynthetic organisms. Since the first description of Chlamydomonas respiratory-deficient mutants in 1977 by random mutagenesis, many other mutants affected in mitochondrial components have been characterized. These respiratory-deficient mutants increased our knowledge on function and assembly of the respiratory enzyme complexes. More recently some of these mutants allowed the study of mitochondrial gene expression processes poorly understood in Chlamydomonas. In this review, we update the data concerning the respiratory components with a special focus on the assembly factors identified on other organisms. In addition, we make an inventory of different mitochondrial respiratory mutants that are inactivated either on mitochondrial or nuclear genes. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Blakely, Collin M.; Watkins, Thomas B.K.; Wu, Wei; Gini, Beatrice; Chabon, Jacob J.; McCoach, Caroline E.; McGranahan, Nicholas; Wilson, Gareth A.; Birkbak, Nicolai J.; Olivas, Victor R.; Rotow, Julia; Maynard, Ashley; Wang, Victoria; Gubens, Matthew A.; Banks, Kimberly C.; Lanman, Richard B.; Caulin, Aleah F.; John, John St.; Cordero, Anibal R.; Giannikopoulos, Petros; Simmons, Andrew D.; Mack, Philip C.; Gandara, David R.; Husain, Hatim; Doebele, Robert C.; Riess, Jonathan W.; Diehn, Maximilian; Swanton, Charles; Bivona, Trever G.
2017-01-01
A widespread approach to modern cancer therapy is to identify a single oncogenic driver gene and target its mutant protein product (e.g. EGFR inhibitor treatment in EGFR-mutant lung cancers). However, genetically-driven resistance to targeted therapy limits patient survival. Through genomic analysis of 1122 EGFR-mutant lung cancer cell-free DNA samples and whole exome analysis of seven longitudinally collected tumor samples from an EGFR-mutant lung cancer patient, we identify critical co-occurring oncogenic events present in most advanced-stage EGFR-mutant lung cancers. We define new pathways limiting EGFR inhibitor response, including WNT/β-catenin and cell cycle gene (e.g. CDK4, CDK6) alterations. Tumor genomic complexity increases with EGFR inhibitor treatment and co-occurring alterations in CTNNB1, and PIK3CA exhibit non-redundant functions that cooperatively promote tumor metastasis or limit EGFR inhibitor response. This study challenges the prevailing single-gene driver oncogene view and links clinical outcomes to co-occurring genetic alterations in advanced-stage EGFR-mutant lung cancer patients. PMID:29106415
Jia, Shangang; Li, Aixia; Morton, Kyla; Avoles-Kianian, Penny; Kianian, Shahryar F.; Zhang, Chi; Holding, David
2016-01-01
To better understand maize endosperm filling and maturation, we used γ-irradiation of the B73 maize reference line to generate mutants with opaque endosperm and reduced kernel fill phenotypes, and created a population of 1788 lines including 39 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes. For molecular characterization of the mutants, we developed a novel functional genomics platform that combined bulked segregant RNA and exome sequencing (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. To exemplify the utility of the mutants and provide proof-of-concept for the bioinformatics platform, we present detailed characterization of line 937, an opaque mutant harboring a 6203 bp in-frame deletion covering six exons within the Opaque-1 gene. In addition, we describe mutant line 146 which contains a 4.8 kb intragene deletion within the Sugary-1 gene and line 916 in which an 8.6 kb deletion knocks out a Cyclin A2 gene. The publically available algorithm developed in this work improves the identification of causative deletions and its corresponding gaps within mapping peaks. This study demonstrates the utility of γ-irradiation for forward genetics in large nondense genomes such as maize since deletions often affect single genes. Furthermore, we show how this classical mutagenesis method becomes applicable for functional genomics when combined with state-of-the-art genomics tools. PMID:27261000
Yarimizu, Tohru; Nonklang, Sanom; Nakamura, Junpei; Tokuda, Shuya; Nakagawa, Takaaki; Lorreungsil, Sasithorn; Sutthikhumpha, Surasit; Pukahuta, Charida; Kitagawa, Takao; Nakamura, Mikiko; Cha-Aim, Kamonchai; Limtong, Savitree; Hoshida, Hisashi; Akada, Rinji
2013-12-01
The isolation and application of auxotrophic mutants for gene manipulations, such as genetic transformation, mating selection and tetrad analysis, form the basis of yeast genetics. For the development of these genetic methods in the thermotolerant fermentative yeast Kluyveromyces marxianus, we isolated a series of auxotrophic mutants with defects in amino acid or nucleic acid metabolism. To identify the mutated genes, linear DNA fragments of nutrient biosynthetic pathway genes were amplified from Saccharomyces cerevisiae chromosomal DNA and used to directly transform the K. marxianus auxotrophic mutants by random integration into chromosomes through non-homologous end joining (NHEJ). The appearance of transformant colonies indicated that the specific S. cerevisiae gene complemented the K. marxianus mutant. Using this interspecific complementation approach with linear PCR-amplified DNA, we identified auxotrophic mutations of ADE2, ADE5,7, ADE6, HIS2, HIS3, HIS4, HIS5, HIS6, HIS7, LYS1, LYS2, LYS4, LYS9, LEU1, LEU2, MET2, MET6, MET17, TRP3, TRP4 and TRP5 without the labour-intensive requirement of plasmid construction. Mating, sporulation and tetrad analysis techniques for K. marxianus were also established. With the identified auxotrophic mutant strains and S. cerevisiae genes as selective markers, NHEJ-mediated integrative transformation with PCR-amplified DNA is an attractive system for facilitating genetic analyses in the yeast K. marxianus. Copyright © 2013 John Wiley & Sons, Ltd.
Characterization of a Thermo-Inducible Chlorophyll-Deficient Mutant in Barley.
Wang, Rong; Yang, Fei; Zhang, Xiao-Qi; Wu, Dianxin; Tan, Cong; Westcott, Sharon; Broughton, Sue; Li, Chengdao; Zhang, Wenying; Xu, Yanhao
2017-01-01
Leaf color is an important trait for not only controlling crop yield but also monitoring plant status under temperature stress. In this study, a thermo-inducible chlorophyll-deficient mutant, named V-V-Y, was identified from a gamma-radiated population of the barley variety Vlamingh. The leaves of the mutant were green under normal growing temperature but turned yellowish under high temperature in the glasshouse experiment. The ratio of chlorophyll a and chlorophyll b in the mutant declined much faster in the first 7-9 days under heat treatment. The leaves of V-V-Y turned yellowish but took longer to senesce under heat stress in the field experiment. Genetic analysis indicated that a single nuclear gene controlled the mutant trait. The mutant gene ( vvy ) was mapped to the long arm of chromosome 4H between SNP markers 1_0269 and 1_1531 with a genetic distance of 2.2 cM and a physical interval of 9.85 Mb. A QTL for grain yield was mapped to the same interval and explained 10.4% of the yield variation with a LOD score of 4. This QTL is coincident with the vvy gene interval that is responsible for the thermo-inducible chlorophyll-deficient trait. Fine mapping, based on the barley reference genome sequence, further narrowed the vvy gene to a physical interval of 0.428 Mb with 11 annotated genes. This is the first report of fine mapping a thermo-inducible chlorophyll-deficient gene in barley.
Poyatos-Pertíñez, Sandra; Quinet, Muriel; Ortíz-Atienza, Ana; Yuste-Lisbona, Fernando J; Pons, Clara; Giménez, Estela; Angosto, Trinidad; Granell, Antonio; Capel, Juan; Lozano, Rafael
2016-01-01
Floral organogenesis requires coordinated interactions between genes specifying floral organ identity and those regulating growth and size of developing floral organs. With the aim to isolate regulatory genes linking both developmental processes (i.e., floral organ identity and growth) in the tomato model species, a novel mutant altered in the formation of floral organs was further characterized. Under normal growth conditions, floral organ primordia of mutant plants were correctly initiated, however, they were unable to complete their development impeding the formation of mature and fertile flowers. Thus, the growth of floral buds was blocked at an early stage of development; therefore, we named this mutant as unfinished flower development ( ufd ). Genetic analysis performed in a segregating population of 543 plants showed that the abnormal phenotype was controlled by a single recessive mutation. Global gene expression analysis confirmed that several MADS-box genes regulating floral identity as well as other genes participating in cell division and different hormonal pathways were affected in their expression patterns in ufd mutant plants. Moreover, ufd mutant inflorescences showed higher hormone contents, particularly ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) and strigol compared to wild type. Such results indicate that UFD may have a key function as positive regulator of the development of floral primordia once they have been initiated in the four floral whorls. This function should be performed by affecting the expression of floral organ identity and growth genes, together with hormonal signaling pathways.
Croitoru, Victor; Bucheli-Witschel, Margarete; Hägg, Peter; Abdulkarim, Farhad; Isaksson, Leif A
2004-02-01
Three protein factors IF1, IF2 and IF3 are involved in the initiation of translation in prokaryotes. No clear function has been assigned to the smallest of these three factors, IF1. Therefore, to investigate the role of this protein in the initiation process in Escherichia coli we have mutated the corresponding gene infA. Because IF1 is essential for cell viability and no mutant selection has so far been described, the infA gene in a plasmid was mutated by site-directed mutagenesis in a strain with a chromosomal infA+ gene, followed by deletion of this infA+ gene. Using this approach, the six arginine residues of IF1 were altered to leucine or aspartate. Another set of plasmid-encoded IF1 mutants with a cold-sensitive phenotype was collected using localized random mutagenesis. All mutants with a mutated infA gene on a plasmid and a deletion of the chromosomal infA copy were viable, except for an R65D alteration. Differences in growth phenotypes of the mutants were observed in both minimal and rich media. Some of the mutated infA genes were successfully recombined into the chromosome thereby replacing the wild-type infA+ allele. Several of these recombinants showed reduced growth rate and a partial cold-sensitive phenotype. This paper presents a collection of IF1 mutants designed for in vivo and in vitro studies on the function of IF1.
Mutations associated with base excision repair deficiency and methylation-induced genotoxic stress
Sobol, Robert W.; Watson, David E.; Nakamura, Jun; Yakes, F. Michael; Hou, Esther; Horton, Julie K.; Ladapo, Joseph; Van Houten, Bennett; Swenberg, James A.; Tindall, Kenneth R.; Samson, Leona D.; Wilson, Samuel H.
2002-01-01
The long-term effect of exposure to DNA alkylating agents is entwined with the cell's genetic capacity for DNA repair and appropriate DNA damage responses. A unique combination of environmental exposure and deficiency in these responses can lead to genomic instability; this “gene–environment interaction” paradigm is a theme for research on chronic disease etiology. In the present study, we used mouse embryonic fibroblasts with a gene deletion in the base excision repair (BER) enzymes DNA β-polymerase (β-pol) and alkyladenine DNA glycosylase (AAG), along with exposure to methyl methanesulfonate (MMS) to study mutagenesis as a function of a particular gene–environment interaction. The β-pol null cells, defective in BER, exhibit a modest increase in spontaneous mutagenesis compared with wild-type cells. MMS exposure increases mutant frequency in β-pol null cells, but not in isogenic wild-type cells; UV light exposure or N-methyl-N′-nitro-N-nitrosoguanidine exposure increases mutant frequency similarly in both cell lines. The MMS-induced increase in mutant frequency in β-pol null cells appears to be caused by DNA lesions that are AAG substrates, because overexpression of AAG in β-pol null cells eliminates the effect. In contrast, β-pol/AAG double null cells are slightly more mutable than the β-pol null cells after MMS exposure. These results illustrate that BER plays a role in protecting mouse embryonic fibroblast cells against methylation-induced mutations and characterize the effect of a particular combination of BER gene defect and environmental exposure. PMID:11983862
Kochneva, G V; Kolosova, I V; Lupan, T A; Sivolobova, G F; Iudin, P V; Grazhdantseva, A A; Riabchikova, E I; Kandrina, N Iu; Shchelkunov, S N
2009-01-01
Mousepox (ectromelia) virus genome contains four genes encoding for kelch-like proteins EVM018, EVM027, EVM150 and EVM167. A complete set of insertion plasmids was constructed to allow the production of recombinant ectromelia viruses with targeted deletions of one to four genes of kelch family both individually (single mutants) and in different combinations (double, triple and quadruple mutants). It was shown that deletion of any of the three genes EVMO18, EVM027 or EVM167 resulted in reduction of 50% lethal dose (LD50) by five and more orders in outbred white mice infected intraperitoneally. Deletion of mousepox kelch-gene EVM150 did not influence the virus virulence. Two or more kelch-genes deletion also resulted in high level of attenuation, which could evidently be due to the lack of three genes EVM167, EVM018 and/or EVM027 identified as virulence factors. The local inflammatory process on the model of intradermal injection of mouse ear pinnae (vasodilatation level, hyperemia, cutaneous edema, arterial thrombosis) was significantly more intensive for wild type virus and virulent mutant deltaEVM150 in comparison with avirulent mutant AEVM167.
Dill, Kariena K; Amacher, Sharon L
2005-11-15
We have identified the zebrafish tortuga (tor) gene by an ENU-induced mutation that disrupts the presomitic mesoderm (PSM) expression of Notch pathway genes. In tor mutants, Notch pathway gene expression persists in regions of the PSM where expression is normally off in wild type embryos. The expression of hairy/Enhancer of split-related 1 (her1) is affected first, followed by the delta genes deltaC and deltaD, and finally, by another hairy/Enhancer of split-related gene, her7. In situ hybridization with intron-specific probes for her1 and deltaC indicates that transcriptional bursts of expression are normal in tor mutants, suggesting that tor normally functions to refine her1 and deltaC message levels downstream of transcription. Despite the striking defects in Notch pathway gene expression, somite boundaries form normally in tor mutant embryos, although somitic mesoderm defects are apparent later, when cells mature to form muscle fibers. Thus, while the function of Notch pathway genes is required for proper somite formation, the tor mutant phenotype suggests that precise oscillations of Notch pathway transcripts are not essential for establishing segmental pattern in the presomitic mesoderm.
USDA-ARS?s Scientific Manuscript database
The nuclear male sterility (NMS) trait is a useful tool for sunflower (Helianthus annuus L.) breeding and genetic programs. Previously, we induced NMS mutants in cultivated line HA 89. The mutants possessed single recessive genes, ms6, ms7, and ms8, respectively, in NMS HA 89-872, NMS HA 89-552, and...
Woodcock, M Ryan; Vaughn-Wolfe, Jennifer; Elias, Alexandra; Kump, D Kevin; Kendall, Katharina Denise; Timoshevskaya, Nataliya; Timoshevskiy, Vladimir; Perry, Dustin W; Smith, Jeramiah J; Spiewak, Jessica E; Parichy, David M; Voss, S Randal
2017-01-31
The molecular genetic toolkit of the Mexican axolotl, a classic model organism, has matured to the point where it is now possible to identify genes for mutant phenotypes. We used a positional cloning-candidate gene approach to identify molecular bases for two historic axolotl pigment phenotypes: white and albino. White (d/d) mutants have defects in pigment cell morphogenesis and differentiation, whereas albino (a/a) mutants lack melanin. We identified in white mutants a transcriptional defect in endothelin 3 (edn3), encoding a peptide factor that promotes pigment cell migration and differentiation in other vertebrates. Transgenic restoration of Edn3 expression rescued the homozygous white mutant phenotype. We mapped the albino locus to tyrosinase (tyr) and identified polymorphisms shared between the albino allele (tyr a ) and tyr alleles in a Minnesota population of tiger salamanders from which the albino trait was introgressed. tyr a has a 142 bp deletion and similar engineered alleles recapitulated the albino phenotype. Finally, we show that historical introgression of tyr a significantly altered genomic composition of the laboratory axolotl, yielding a distinct, hybrid strain of ambystomatid salamander. Our results demonstrate the feasibility of identifying genes for traits in the laboratory Mexican axolotl.
Genes Required for Vacuolar Acidity in Saccharomyces Cerevisiae
Preston, R. A.; Reinagel, P. S.; Jones, E. W.
1992-01-01
Mutations that cause loss of acidity in the vacuole (lysosome) of Saccharomyces cerevisiae were identified by screening colonies labeled with the fluorescent, pH-sensitive, vacuolar labeling agent, 6-carboxyfluorescein. Thirty nine vacuolar pH (Vph(-)) mutants were identified. Four of these contained mutant alleles of the previously described PEP3, PEP5, PEP6 and PEP7 genes. The remaining mutants defined eight complementation groups of vph mutations. No alleles of the VAT2 or TFP1 genes (known to encode subunits of the vacuolar H(+)-ATPase) were identified in the Vph(-) screen. Strains bearing mutations in any of six of the VPH genes failed to grow on medium buffered at neutral pH; otherwise, none of the vph mutations caused notable growth inhibition on standard yeast media. Expression of the vacuolar protease, carboxypeptidase Y, was defective in strains bearing vph4 mutations but was apparently normal in strains bearing any of the other vph mutations. Defects in vacuolar morphology at the light microscope level were evident in all Vph(-) mutants. Strains that contained representative mutant alleles of the 17 previously described PEP genes were assayed for vacuolar pH; mutations in seven of the PEP genes (including PEP3, PEP5, PEP6 and PEP7) caused loss of vacuolar acidity. PMID:1628805
Koga, Makoto; Ohshima, Yasumi
2004-02-20
Chemotaxis to water-soluble chemicals such as sodium ion is an important behavior of Caenorhabditis elegans for seeking food, and ASE chemosensory neurons have a major role in this behavior. We isolated mutants defective in chemotaxis to sodium acetate. We show here that among them ks86 had a mutation in the ceh-36 gene. ceh-36 :: gfp reporter constructs were expressed in ASE and AWC neurons. In a mutant of the che-1 gene, which encodes another transcription factor and is required for specification of ASE neurons, expression of the ceh-36 :: gfp reporter in ASE is lost. This indicates that the ceh-36 gene functions downstream of the che-1 gene in ASE. In the ceh-36(ks86) mutant, expression of the tax-2 gene encoding a cyclic nucleotide-gated channel was reduced in ASE and AWC. This affords an explanation for defects of the ceh-36 mutant in the chemotaxis mediated by ASE and AWC. When a ceh-36 cDNA was expressed in an adult ceh-36 mutant by a heat shock promoter, chemotaxis to sodium acetate was recovered. These results suggest that ceh-36 is required for functions, and not for development, of ASE.
Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto
2015-02-01
Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. © 2015 American Society of Plant Biologists. All Rights Reserved.
KRAS-G12C mutation is associated with poor outcome in surgically resected lung adenocarcinoma.
Nadal, Ernest; Chen, Guoan; Prensner, John R; Shiratsuchi, Hiroe; Sam, Christine; Zhao, Lili; Kalemkerian, Gregory P; Brenner, Dean; Lin, Jules; Reddy, Rishindra M; Chang, Andrew C; Capellà, Gabriel; Cardenal, Felipe; Beer, David G; Ramnath, Nithya
2014-10-01
The aim of this study was to examine the effects of KRAS mutant subtypes on the outcome of patients with resected lung adenocarcinoma (AC). Using clinical and sequencing data, we identified 179 patients with resected lung AC for whom KRAS mutational status was determined. A multivariate Cox model was used to identify factors associated with disease-free survival (DFS) and overall survival (OS). Publicly available mutation and gene-expression data from lung cancer cell lines and lung AC were used to assess whether distinct KRAS mutant variants have a different profile. Patients with KRAS mutation had a significantly shorter DFS compared with those with KRAS wild-type (p = 0.009). Patients with KRAS-G12C mutant tumors had significantly shorter DFS compared with other KRAS mutants and KRAS wild-type tumors (p < 0.001). In the multivariate Cox model, KRAS-G12C remained as an independent prognostic marker for DFS (Hazard ratio = 2.46, 95% confidence interval 1.51-4.00, p < 0.001) and for OS (Hazard ratio = 2.35, 95% confidence interval 1.35-4.10, p = 0.003). No genes were statistically significant when comparing the mutational or transcriptional profile of lung cancer cell lines and lung AC harboring KRAS-G12C with other KRAS mutant subtypes. Gene set enrichment analysis revealed that KRAS-G12C mutants overexpressed epithelial to mesenchymal transition genes and expressed lower levels of genes predicting KRAS dependency. KRAS-G12C mutation is associated with worse DFS and OS in resected lung AC. Gene-expression profiles in lung cancer cell lines and surgically resected lung AC revealed that KRAS-G12C mutants had an epithelial to mesenchymal transition and a KRAS-independent phenotype.
Strategy for Restoring Drug Sensitivity to Triple-Negative Breast Cancer
2011-09-01
tocopherol ether-linked acetic acid analog -TEA), a non-hydrolyzable ether analog of RRR- - tocopherol in p53 mutant TNBC cells, and to understand...cells with a unique analog of vitamin E (alpha- tocopherol ether-linked acetic acid analog; abbreviated α-TEA) in combination with chemotherapeutic...p53-mutant, triple-negative breast cancer (TNBC) cells with a unique analog of vitamin E (alpha- tocopherol ether-linked acetic acid analog
Hsieh, J; Liu, J; Kostas, S A; Chang, C; Sternberg, P W; Fire, A
1999-11-15
Context-dependent gene silencing is used by many organisms to stably modulate gene activity for large chromosomal regions. We have used tandem array transgenes as a model substrate in a screen for Caenorhabditis elegans mutants that affect context-dependent gene silencing in somatic tissues. This screen yielded multiple alleles of a previously uncharacterized gene, designated tam-1 (for tandem-array-modifier). Loss-of-function mutations in tam-1 led to a dramatic reduction in the activity of numerous highly repeated transgenes. These effects were apparently context dependent, as nonrepetitive transgenes retained activity in a tam-1 mutant background. In addition to the dramatic alterations in transgene activity, tam-1 mutants showed modest alterations in expression of a subset of endogenous cellular genes. These effects include genetic interactions that place tam-1 into a group called the class B synMuv genes (for a Synthetic Multivulva phenotype); this family plays a negative role in the regulation of RAS pathway activity in C. elegans. Loss-of-function mutants in other members of the class-B synMuv family, including lin-35, which encodes a protein similar to the tumor suppressor Rb, exhibit a hypersilencing in somatic transgenes similar to that of tam-1 mutants. Molecular analysis reveals that tam-1 encodes a broadly expressed nuclear protein with RING finger and B-box motifs.
Guilhabert, Magalie R; Kirkpatrick, Bruce C
2005-08-01
Xylella fastidosa, a gram-negative, xylem-limited bacterium, is the causal agent of several economically important plant diseases, including Pierce's disease (PD) and citrus variegated chlorosis (CVC). Until recently, the inability to transform or produce transposon mutants of X. fastidosa had been a major impediment to identifying X. fastidosa genes that mediate pathogen and plant interactions. A random transposon (Tn5) library of X. fastidosa was constructed and screened for mutants showing more severe symptoms and earlier grapevine death (hypervirulence) than did vines infected with the wild type. Seven hypervirulent mutants identified in this screen moved faster and reached higher populations than the wild type in grapevines. These results suggest that X. fastidosa attenuates its virulence in planta and that movement is important in X. fastidosa virulence. The mutated genes were sequenced and none had been described previously as antivirulence genes, although six of them showed similarity with genes of known functions in other organisms. One transposon insertion inactivated a hemagglutinin adhesin gene (PD2118), which we named HxfA. Another mutant in a second putative X. fastidosa hemagglutinin gene, PD1792 (HxfB), was constructed, and further characterization of these hxf mutants suggests that X. fastidosa hemagglutinins mediate contact between X. fastidosa cells, which results in colony formation and biofilm maturation within the xylem vessels.
Delimitation of essential genes of cassava latent virus DNA 2.
Etessami, P; Callis, R; Ellwood, S; Stanley, J
1988-01-01
Insertion and deletion mutagenesis of both extended open reading frames (ORFs) of cassava latent virus DNA 2 destroys infectivity. Infectivity is restored by coinoculating constructs that contain single mutations within different ORFs. Although frequent intermolecular recombination produces dominant parental-type virus, mutants can be retained within the virus population indicating that they are competent for replication and suggesting that rescue can occur by complementation of trans acting gene products. By cloning specific fragments into DNA 1 coat protein deletion vectors we have delimited the DNA 2 coding regions and provide substantive evidence that both are essential for virus infection. Although a DNA 2 component is unique to whitefly-transmitted geminiviruses, the results demonstrate that neither coding region is involved solely in insect transmission. The requirement for a bipartite genome for whitefly-transmitted geminiviruses is discussed. Images PMID:3387209
A mutational approach for the detection of genetic factors affecting seed size in maize.
Sangiorgio, Stefano; Carabelli, Laura; Gabotti, Damiano; Manzotti, Priscilla Sofia; Persico, Martina; Consonni, Gabriella; Gavazzi, Giuseppe
2016-12-01
Genes influencing seed size. The designation emp (empty pericarp) refers to a group of defective kernel mutants that exhibit a drastic reduction in endosperm tissue production. They allow the isolation of genes controlling seed development and affecting seed size. Nine independently isolated emp mutants have been analyzed in this study and in all cases longitudinal sections of mature seeds revealed the absence of morphogenesis in the embryo proper, an observation that correlates with their failure to germinate. Complementation tests with the nine emp mutants, crossed inter se in all pairwise combinations, identified complementing and non-complementing pairs in the F 1 progenies. Data were then validated in the F 2 /F 3 generations. Mutant chromosomal location was also established. Overall our study has identified two novel emp genes and a novel allele at the previously identified emp4 gene. The introgression of single emp mutants in a different genetic background revealed the existence of a cryptic genetic variation (CGV) recognizable as a variable increase in the endosperm tissue. The unmasking of CGV by introducing single mutants in different genetic backgrounds is the result of the interaction of the emp mutants with a suppressor that has no obvious phenotype of its own and is present in the genetic background of the inbred lines into which the emp mutants were transferred. On the basis of these results, emp mutants could be used as tools for the detection of genetic factors that enhance the amount of endosperm tissue in the maize kernel and which could thus become valuable targets to exploit in future breeding programs.
Genetic analysis of vertebrate sensory hair cell mechanosensation: the zebrafish circler mutants.
Nicolson, T; Rüsch, A; Friedrich, R W; Granato, M; Ruppersberg, J P; Nüsslein-Volhard, C
1998-02-01
The molecular basis of sensory hair cell mechanotransduction is largely unknown. In order to identify genes that are essential for mechanosensory hair cell function, we characterized a group of recently isolated zebrafish motility mutants. These mutants are defective in balance and swim in circles but have no obvious morphological defects. We examined the mutants using calcium imaging of acoustic-vibrational and tactile escape responses, high resolution microscopy of sensory neuroepithelia in live larvae, and recordings of extracellular hair cell potentials (microphonics). Based on the analyses, we have identified several classes of genes. Mutations in sputnik and mariner affect hair bundle integrity. Mutant astronaut and cosmonaut hair cells have relatively normal microphonics and thus appear to affect events downstream of mechanotransduction. Mutant orbiter, mercury, and gemini larvae have normal hair cell morphology and yet do not respond to acoustic-vibrational stimuli. The microphonics of lateral line hair cells of orbiter, mercury, and gemini larvae are absent or strongly reduced. Therefore, these genes may encode components of the transduction apparatus.
Probst, Frank J.; Corrigan, Rebecca R.; del Gaudio, Daniela; Salinger, Andrew P.; Lorenzo, Isabel; Gao, Simon S.; Chiu, Ilene; Xia, Anping
2013-01-01
The study of mouse hearing impairment mutants has led to the identification of a number of human hearing impairment genes and has greatly furthered our understanding of the physiology of hearing. The novel mouse mutant neurological/sensory 5 (nse5) demonstrates a significantly reduced or absent startle response to sound and is therefore a potential murine model of human hearing impairment. Genetic analysis of 500 intercross progeny localized the mutant locus to a 524 kilobase (kb) interval on mouse chromosome 15. A missense mutation in a highly-conserved amino acid was found in the asparagine-linked glycosylation 10B gene (Alg10b), which is within the critical interval for the nse5 mutation. A 20.4 kb transgene containing a wildtype copy of the Alg10b gene rescued the mutant phenotype in nse5/nse5 homozygous animals, confirming that the mutation in Alg10b is responsible for the nse5/nse5 mutant phenotype. Homozygous nse5/nse5 mutants had abnormal auditory brainstem responses (ABRs), distortion product otoacoustic emissions (DPOAEs), and cochlear microphonics (CMs). Endocochlear potentials (EPs), on the other hand, were normal. ABRs and DPOAEs also confirmed the rescue of the mutant nse5/nse5 phenotype by the wildtype Alg10b transgene. These results suggested a defect in the outer hair cells of mutant animals, which was confirmed by histologic analysis. This is the first report of mutation in a gene involved in the asparagine (N)-linked glycosylation pathway causing nonsyndromic hearing impairment, and it suggests that the hearing apparatus, and the outer hair cells in particular, are exquisitely sensitive to perturbations of the N-linked glycosylation pathway. PMID:24303013
Ji, S H; Gururani, M A; Lee, J W; Ahn, B-O; Chun, S-C
2014-03-01
We have isolated a severe dwarf mutant derived from a Ds (Dissociation) insertion mutant rice (Oryza sativa var. japonica c.v. Dongjin). This severe dwarf phenotype, has short and dark green leaves, reduced shoot growth early in the seedling stage, and later severe dwarfism with failure to initiate flowering. When treated with bioactive GA3 , mutants are restored to the normal wild-type phenotype. Reverse transcription PCR analyses of 22 candidate genes related to the gibberellin (GA) biosynthesis pathway revealed that among 22 candidate genes tested, a dwarf mutant transcript was not expressed only in one OsKS2 gene. Genetic analysis revealed that the severe dwarf phenotype was controlled by recessive mutation of a single nuclear gene. The putative OsKS2 gene was a chromosome 4-located ent-kaurene synthase (KS), encoding the enzyme that catalyses an early step of the GA biosynthesis pathway. Sequence analysis revealed that osks2 carried a 1-bp deletion in the ORF region of OsKS2, which led to a loss-of-function mutation. The expression pattern of OsKS2 in wild-type cv Dongjin, showed that it is expressed in all organs, most prominently in the stem and floral organs. Morphological characteristics of the dwarf mutant showed dramatic modifications in internal structure and external morphology. We propose that dwarfism in this mutant is caused by a point mutation in OsKS2, which plays a significant role in growth and development of higher plants. Further investigation on OsKS2 and other OsKS-like proteins is underway and may yield better understanding of the putative role of OsKS in severe dwarf mutants. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.
Hingston, Patricia A.; Piercey, Marta J.
2015-01-01
Listeria monocytogenes is a foodborne pathogen whose survival in food processing environments may be associated with its tolerance to desiccation. To probe the molecular mechanisms used by this bacterium to adapt to desiccation stress, a transposon library of 11,700 L. monocytogenes mutants was screened, using a microplate assay, for strains displaying increased or decreased desiccation survival (43% relative humidity, 15°C) in tryptic soy broth (TSB). The desiccation phenotypes of selected mutants were subsequently assessed on food-grade stainless steel (SS) coupons in TSB plus 1% glucose (TSB-glu). Single transposon insertions in mutants exhibiting a change in desiccation survival of >0.5 log CFU/cm2 relative to that of the wild type were determined by sequencing arbitrary PCR products. Strain morphology, motility, and osmotic stress survival (in TSB-glu plus 20% NaCl) were also analyzed. The initial screen selected 129 desiccation-sensitive (DS) and 61 desiccation-tolerant (DT) mutants, out of which secondary screening on SS confirmed 15 DT and 15 DS mutants. Among the DT mutants, seven immotile and flagellum-less strains contained transposons in genes involved in flagellum biosynthesis (fliP, flhB, flgD, flgL) and motor control (motB, fliM, fliY), while others harbored transposons in genes involved in membrane lipid biosynthesis, energy production, potassium uptake, and virulence. The genes that were interrupted in the 15 DS mutants included those involved in energy production, membrane transport, protein metabolism, lipid biosynthesis, oxidative damage control, and putative virulence. Five DT and 14 DS mutants also demonstrated similar significantly (P < 0.05) different survival relative to that of the wild type when exposed to osmotic stress, demonstrating that some genes likely have similar roles in allowing the organism to survive the two water stresses. PMID:26025900
Characterization and classification of zebrafish brain morphology mutants
Lowery, Laura Anne; De Rienzo, Gianluca; Gutzman, Jennifer H.; Sive, Hazel
2010-01-01
The mechanisms by which the vertebrate brain achieves its three-dimensional structure are clearly complex, requiring the functions of many genes. Using the zebrafish as a model, we have begun to define genes required for brain morphogenesis, including brain ventricle formation, by studying 16 mutants previously identified as having embryonic brain morphology defects. We report the phenotypic characterization of these mutants at several time-points, using brain ventricle dye injection, imaging, and immunohistochemistry with neuronal markers. Most of these mutants display early phenotypes, affecting initial brain shaping, while others show later phenotypes, affecting brain ventricle expansion. In the early phenotype group, we further define four phenotypic classes and corresponding functions required for brain morphogenesis. Although we did not use known genotypes for this classification, basing it solely on phenotypes, many mutants with defects in functionally related genes clustered in a single class. In particular, class 1 mutants show midline separation defects, corresponding to epithelial junction defects; class 2 mutants show reduced brain ventricle size; class 3 mutants show midbrain-hindbrain abnormalities, corresponding to basement membrane defects; and class 4 mutants show absence of ventricle lumen inflation, corresponding to defective ion pumping. Later brain ventricle expansion requires the extracellular matrix, cardiovascular circulation, and transcription/splicing-dependent events. We suggest that these mutants define processes likely to be used during brain morphogenesis throughout the vertebrates. PMID:19051268
Nucleotide substitutions revealing specific functions of Polycomb group genes.
Bajusz, Izabella; Sipos, László; Pirity, Melinda K
2015-04-01
POLYCOMB group (PCG) proteins belong to the family of epigenetic regulators of genes playing important roles in differentiation and development. Mutants of PcG genes were isolated first in the fruit fly, Drosophila melanogaster, resulting in spectacular segmental transformations due to the ectopic expression of homeotic genes. Homologs of Drosophila PcG genes were also identified in plants and in vertebrates and subsequent experiments revealed the general role of PCG proteins in the maintenance of the repressed state of chromatin through cell divisions. The past decades of gene targeting experiments have allowed us to make significant strides towards understanding how the network of PCG proteins influences multiple aspects of cellular fate determination during development. Being involved in the transmission of specific expression profiles of different cell lineages, PCG proteins were found to control wide spectra of unrelated epigenetic processes in vertebrates, such as stem cell plasticity and renewal, genomic imprinting and inactivation of X-chromosome. PCG proteins also affect regulation of metabolic genes being important for switching programs between pluripotency and differentiation. Insight into the precise roles of PCG proteins in normal physiological processes has emerged from studies employing cell culture-based systems and genetically modified animals. Here we summarize the findings obtained from PcG mutant fruit flies and mice generated to date with a focus on PRC1 and PRC2 members altered by nucleotide substitutions resulting in specific alleles. We also include a compilation of lessons learned from these models about the in vivo functions of this complex protein family. With multiple knockout lines, sophisticated approaches to study the consequences of peculiar missense point mutations, and insights from complementary gain-of-function systems in hand, we are now in a unique position to significantly advance our understanding of the molecular basis of in vivo functions of PcG proteins. Copyright © 2015 Elsevier Inc. All rights reserved.
Ishibashi, Naoki; Himeno, Kohei; Masuda, Yoshimitsu; Perez, Rodney Honrada; Iwatani, Shun; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji
2014-01-01
Enterococcus faecium NKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA [ent53A], enkC [ent53C], enkD [ent53D], and enkZ [ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIaz and enkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies of enkT and ΔenkT mutant strains showed that enkT is responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRK mutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter. PMID:25149515
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tai, Akiko; Kamei, Yuka; Mukai, Yukio
In eukaryotes, numerous genetic factors contribute to the lifespan including metabolic enzymes, signal transducers, and transcription factors. As previously reported, the forkhead-like transcription factor (FHL1) gene was required for yeast replicative lifespan and cell proliferation. To determine how Fhl1p regulates the lifespan, we performed a DNA microarray analysis of a heterozygous diploid strain deleted for FHL1. We discovered numerous Fhl1p-target genes, which were then screened for lifespan-regulating activity. We identified the ribonucleotide reductase (RNR) 1 gene (RNR1) as a regulator of replicative lifespan. RNR1 encodes a large subunit of the RNR complex, which consists of two large (Rnr1p/Rnr3p) and twomore » small (Rnr2p/Rnr4p) subunits. Heterozygous deletion of FHL1 reduced transcription of RNR1 and RNR3, but not RNR2 and RNR4. Chromatin immunoprecipitation showed that Fhl1p binds to the promoter regions of RNR1 and RNR3. Cells harboring an RNR1 deletion or an rnr1-C428A mutation, which abolishes RNR catalytic activity, exhibited a short lifespan. In contrast, cells with a deletion of the other RNR genes had a normal lifespan. Overexpression of RNR1, but not RNR3, restored the lifespan of the heterozygous FHL1 mutant to the wild-type (WT) level. The Δfhl1/FHL1 mutant conferred a decrease in dNTP levels and an increase in hydroxyurea (HU) sensitivity. These findings reveal that Fhl1p regulates RNR1 gene transcription to maintain dNTP levels, thus modulating longevity by protection against replication stress. - Highlights: • Fhl1p regulates replicative lifespan and transcription of RNR large subunit genes. • Rnr1p uniquely acts as a lifespan regulator independent of the RNR complex. • dNTP levels modulate longevity by protection against replication stress.« less
Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji
2009-09-01
We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.
Multiple organ gigantism caused by mutation in VmPPD gene in blackgram (Vigna mungo).
Naito, Ken; Takahashi, Yu; Chaitieng, Bubpa; Hirano, Kumi; Kaga, Akito; Takagi, Kyoko; Ogiso-Tanaka, Eri; Thavarasook, Charaspon; Ishimoto, Masao; Tomooka, Norihiko
2017-03-01
Seed size is one of the most important traits in leguminous crops. We obtained a recessive mutant of blackgram that had greatly enlarged leaves, stems and seeds. The mutant produced 100% bigger leaves, 50% more biomass and 70% larger seeds though it produced 40% less number of seeds. We designated the mutant as multiple-organ-gigantism ( mog ) and found the mog phenotype was due to increase in cell numbers but not in cell size. We also found the mog mutant showed a rippled leaf ( rl ) phenotype, which was probably caused by a pleiotropic effect of the mutation. We performed a map-based cloning and successfully identified an 8 bp deletion in the coding sequence of VmPPD gene, an orthologue of Arabidopsis PEAPOD ( PPD ) that regulates arrest of cell divisions in meristematic cells . We found no other mutations in the neighboring genes between the mutant and the wild type. We also knocked down GmPPD genes and reproduced both the mog and rl phenotypes in soybean. Controlling PPD genes to produce the mog phenotype is highly valuable for breeding since larger seed size could directly increase the commercial values of grain legumes.
Multiple organ gigantism caused by mutation in VmPPD gene in blackgram (Vigna mungo)
Naito, Ken; Takahashi, Yu; Chaitieng, Bubpa; Hirano, Kumi; Kaga, Akito; Takagi, Kyoko; Ogiso-Tanaka, Eri; Thavarasook, Charaspon; Ishimoto, Masao; Tomooka, Norihiko
2017-01-01
Seed size is one of the most important traits in leguminous crops. We obtained a recessive mutant of blackgram that had greatly enlarged leaves, stems and seeds. The mutant produced 100% bigger leaves, 50% more biomass and 70% larger seeds though it produced 40% less number of seeds. We designated the mutant as multiple-organ-gigantism (mog) and found the mog phenotype was due to increase in cell numbers but not in cell size. We also found the mog mutant showed a rippled leaf (rl) phenotype, which was probably caused by a pleiotropic effect of the mutation. We performed a map-based cloning and successfully identified an 8 bp deletion in the coding sequence of VmPPD gene, an orthologue of Arabidopsis PEAPOD (PPD) that regulates arrest of cell divisions in meristematic cells. We found no other mutations in the neighboring genes between the mutant and the wild type. We also knocked down GmPPD genes and reproduced both the mog and rl phenotypes in soybean. Controlling PPD genes to produce the mog phenotype is highly valuable for breeding since larger seed size could directly increase the commercial values of grain legumes. PMID:28588392
Mogre, Aalap; Veetil, Reshma T.; Seshasayee, Aswin Sai Narain
2017-01-01
Evolve and resequence experiments have provided us a tool to understand bacterial adaptation to antibiotics. In our previous work, we used short-term evolution to isolate mutants resistant to the ribosome targeting antibiotic kanamycin, and reported that Escherichia coli develops low cost resistance to kanamycin via different point mutations in the translation Elongation Factor-G (EF-G). Furthermore, we had shown that the resistance of EF-G mutants could be increased by second site mutations in the genes rpoD/cpxA/topA/cyaA. Mutations in three of these genes had been discovered in earlier screens for aminoglycoside resistance. In this work, we expand our understanding of these second site mutations, the goal being to understand how these mutations affect the activities of the mutated gene products to confer resistance. We show that the mutation in cpxA most likely results in an active Cpx stress response. Further evolution of an EF-G mutant in a higher concentration of kanamycin than what was used in our previous experiments identified the cpxA locus as a primary target for a significant increase in resistance. The mutation in cyaA results in a loss of catalytic activity and probably results in resistance via altered CRP function. Despite a reduction in cAMP levels, the CyaAN600Y mutant has a transcriptome indicative of increased CRP activity, pointing to an unknown role for CyaA and / or cAMP in gene expression. From the transcriptomes of double and single mutants, we describe the epistasis between the mutation in EF-G and these second site mutations. We show that the large scale transcriptomic changes in the topoisomerase I (FusAA608E-TopAS180L) mutant likely result from increased negative supercoiling in the cell. Finally, genes with known roles in aminoglycoside resistance were present among the misregulated genes in the mutants. PMID:29046437
Deng, Ying; Nagachar, Nivedita; Xiao, Chaowen; Tien, Ming
2013-01-01
The acs operon of Gluconacetobacter is thought to encode AcsA, AcsB, AcsC, and AcsD proteins that constitute the cellulose synthase complex, required for the synthesis and secretion of crystalline cellulose microfibrils. A few other genes have been shown to be involved in this process, but their precise role is unclear. We report here the use of Tn5 transposon insertion mutagenesis to identify and characterize six non-cellulose-producing (Cel−) mutants of Gluconacetobacter hansenii ATCC 23769. The genes disrupted were acsA, acsC, ccpAx (encoding cellulose-complementing protein [the subscript “Ax” indicates genes from organisms formerly classified as Acetobacter xylinum]), dgc1 (encoding guanylate dicyclase), and crp-fnr (encoding a cyclic AMP receptor protein/fumarate nitrate reductase transcriptional regulator). Protein blot analysis revealed that (i) AcsB and AcsC were absent in the acsA mutant, (ii) the levels of AcsB and AcsC were significantly reduced in the ccpAx mutant, and (iii) the level of AcsD was not affected in any of the Cel− mutants. Promoter analysis showed that the acs operon does not include acsD, unlike the organization of the acs operon of several strains of closely related Gluconacetobacter xylinus. Complementation experiments confirmed that the gene disrupted in each Cel− mutant was responsible for the phenotype. Quantitative real-time PCR and protein blotting results suggest that the transcription of bglAx (encoding β-glucosidase and located immediately downstream from acsD) was strongly dependent on Crp/Fnr. A bglAx knockout mutant, generated via homologous recombination, produced only ∼16% of the wild-type cellulose level. Since the crp-fnr mutant did not produce any cellulose, Crp/Fnr may regulate the expression of other gene(s) involved in cellulose biosynthesis. PMID:24013627
Bhat, Ashwin; Tamuli, Ranjan; Kasbekar, Durgadas P
2004-01-01
The pseudohomothallic fungus Neurospora tetrasperma is naturally resistant to the antibiotic hygromycin. We discovered that mutation of its erg-3 (sterol C-14 reductase) gene confers a hygromycin-sensitive phenotype that can be used to select transformants on hygromycin medium by complementation with the N. crassa erg-3+ and bacterial hph genes. Cotransformation of hph with PCR-amplified DNA of other genes enabled us to construct strains duplicated for the amplified DNA. Using transformation we constructed self-fertile strains that were homoallelic for an ectopic erg-3+ transgene and a mutant erg-3 allele at the endogenous locus. Self-crosses of these strains yielded erg-3 mutant ascospores that produced colonies with the characteristic morphology on Vogel's sorbose agar described previously for erg-3 mutants of N. crassa. The mutants were generated by repeat-induced point mutation (RIP), a genome defense process that causes numerous G:C to A:T mutations in duplicated DNA sequences. Homozygosity for novel recessive RIP-deficient mutations was signaled by self-crosses of erg-3-duplication strains that fail to produce erg-3 mutant progeny. Using this assay we isolated a UV-induced mutant with a putative partial RIP defect. RIP-induced mutants were isolated in rid-1 and sad-1, which are essential genes, respectively, for RIP and another genome defense mechanism called meiotic silencing by unpaired DNA. PMID:15280231
Gene disruption in Salmonella typhimurim by modified λ Red disruption system.
Ahani Azari, A; Zahraei Salehi, T; Nayeri Fasaei, B; Alebouyeh, M
2015-01-01
There are many techniques to knock out directed genes in bacteria, some of which have been described in Salmonella species. In this study, a combination of SOEing PCR method and the λ Red disruption system were used to disrupt phoP gene in wild type and standard strains of Salmonella typhimurium. Three standards PCR and one fusion PCR reactions were performed to construct a linear DNA including upstream and downstream of phoP gene and Kanamycin cassette. As a template plasmid, we used pKD4 which carries kanamycin gene flanked by FRT (FLP recognition target) sites. The resulting construct was electroporated into prepared competent cells of S. typhimurium. The transformants colonies related to the standard strain appeared on the LB-Km-agar plates after incubation, but there was no colony on LB-Km-agar plates corresponding to the wild type strain. The failure in transformation of the wild type strain may be because of inflexibility of the λ Red disruption system in this strain or its unique restriction-modification system. However, by this construct we are able to generate phoP mutant in many of the Salmonella species due to high homology of the phoP gene which exists in different species.
NASA Astrophysics Data System (ADS)
Cross, Sarah E.; Kreth, Jens; Zhu, Lin; Qi, Fengxia; Pelling, Andrew E.; Shi, Wenyuan; Gimzewski, James K.
2006-02-01
Atomic force microscopy (AFM) has garnered much interest in recent years for its ability to probe the structure, function and cellular nanomechanics inherent to specific biological cells. In particular, we have used AFM to probe the important structure-function relationships of the bacterium Streptococcus mutans. S. mutans is the primary aetiological agent in human dental caries (tooth decay), and is of medical importance due to the virulence properties of these cells in biofilm initiation and formation, leading to increased tolerance to antibiotics. We have used AFM to characterize the unique surface structures of distinct mutants of S. mutans. These mutations are located in specific genes that encode surface proteins, thus using AFM we have resolved characteristic surface features for mutant strains compared to the wild type. Ultimately, our characterization of surface morphology has shown distinct differences in the local properties displayed by various S. mutans strains on the nanoscale, which is imperative for understanding the collective properties of these cells in biofilm formation.
Genomic amplification of the caprine EDNRA locus might lead to a dose dependent loss of pigmentation
Menzi, Fiona; Keller, Irene; Reber, Irene; Beck, Julia; Brenig, Bertram; Schütz, Ekkehard; Leeb, Tosso; Drögemüller, Cord
2016-01-01
The South African Boer goat displays a characteristic white spotting phenotype, in which the pigment is limited to the head. Exploiting the existing phenotype variation within the breed, we mapped the locus causing this white spotting phenotype to chromosome 17 by genome wide association. Subsequent whole genome sequencing identified a 1 Mb copy number variant (CNV) harboring 5 genes including EDNRA. The analysis of 358 Boer goats revealed 3 alleles with one, two, and three copies of this CNV. The copy number is correlated with the degree of white spotting in goats. We propose a hypothesis that ectopic overexpression of a mutant EDNRA scavenges EDN3 required for EDNRB signaling and normal melanocyte development and thus likely lead to an absence of melanocytes in the non-pigmented body areas of Boer goats. Our findings demonstrate the value of domestic animals as reservoir of unique mutants and for identifying a precisely defined functional CNV. PMID:27329507
Wittkopp, Tyler M.; Warakanont, Jaruswan; Dubini, Alexandra; Catalanotti, Claudia; Kim, Rick G.; Nowack, Eva C. M.; Mackinder, Luke C. M.; Aksoy, Munevver; Page, Mark Dudley; D’Adamo, Sarah; Saroussi, Shai; Heinnickel, Mark; Johnson, Xenie; Richaud, Pierre; Alric, Jean; Boehm, Marko; Jonikas, Martin C.; Benning, Christoph; Merchant, Sabeeha S.; Posewitz, Matthew C.; Grossman, Arthur R.
2015-01-01
Photosynthetic microorganisms typically have multiple isoforms of the electron transfer protein ferredoxin, although we know little about their exact functions. Surprisingly, a Chlamydomonas reinhardtii mutant null for the ferredoxin-5 gene (FDX5) completely ceased growth in the dark, with both photosynthetic and respiratory functions severely compromised; growth in the light was unaffected. Thylakoid membranes in dark-maintained fdx5 mutant cells became severely disorganized concomitant with a marked decrease in the ratio of monogalactosyldiacylglycerol to digalactosyldiacylglycerol, major lipids in photosynthetic membranes, and the accumulation of triacylglycerol. Furthermore, FDX5 was shown to physically interact with the fatty acid desaturases CrΔ4FAD and CrFAD6, likely donating electrons for the desaturation of fatty acids that stabilize monogalactosyldiacylglycerol. Our results suggest that in photosynthetic organisms, specific redox reactions sustain dark metabolism, with little impact on daytime growth, likely reflecting the tailoring of electron carriers to unique intracellular metabolic circuits under these two very distinct redox conditions. PMID:26627249
Jacoby, Arie S.; Busch-Nentwich, Elisabeth; Bryson-Richardson, Robert J.; Hall, Thomas E.; Berger, Joachim; Berger, Silke; Sonntag, Carmen; Sachs, Caroline; Geisler, Robert; Stemple, Derek L.; Currie, Peter D.
2009-01-01
Summary The skeletal muscle basement membrane fulfils several crucial functions during development and in the mature myotome and defects in its composition underlie certain forms of muscular dystrophy. A major component of this extracellular structure is the laminin polymer, which assembles into a resilient meshwork that protects the sarcolemma during contraction. Here we describe a zebrafish mutant, softy, which displays severe embryonic muscle degeneration as a result of initial basement membrane failure. The softy phenotype is caused by a mutation in the lamb2 gene, identifying laminin β2 as an essential component of this basement membrane. Uniquely, softy homozygotes are able to recover and survive to adulthood despite the loss of myofibre adhesion. We identify the formation of ectopic, stable basement membrane attachments as a novel means by which detached fibres are able to maintain viability. This demonstration of a muscular dystrophy model possessing innate fibre viability following muscle detachment suggests basement membrane augmentation as a therapeutic strategy to inhibit myofibre loss. PMID:19736328
Li, Guotian; Jain, Rashmi; Chern, Mawsheng; Pham, Nikki T; Martin, Joel A; Wei, Tong; Schackwitz, Wendy S; Lipzen, Anna M; Duong, Phat Q; Jones, Kyle C; Jiang, Liangrong; Ruan, Deling; Bauer, Diane; Peng, Yi; Barry, Kerrie W; Schmutz, Jeremy; Ronald, Pamela C
2017-06-01
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake ( Oryza sativa ssp japonica ), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. © 2017 American Society of Plant Biologists. All rights reserved.
Chauhan, Priyanka
2018-01-01
ABSTRACT Previously we had developed a triple gene mutant of Mycobacterium tuberculosis (MtbΔmms) harboring disruption in three genes, namely mptpA, mptpB and sapM. Though vaccination with MtbΔmms strain induced protection in the lungs of guinea pigs, the mutant strain failed to control the hematogenous spread of the challenge strain to the spleen. Additionally, inoculation with MtbΔmms resulted in some pathological damage to the spleens in the early phase of infection. In order to generate a strain that overcomes the pathology caused by MtbΔmms in spleen of guinea pigs and controls dissemination of the challenge strain, MtbΔmms was genetically modified by disrupting bioA gene to generate MtbΔmmsb strain. Further, in vivo attenuation of MtbΔmmsb was evaluated and its protective efficacy was assessed against virulent M. tuberculosis challenge in guinea pigs. MtbΔmmsb mutant strain was highly attenuated for growth and virulence in guinea pigs. Vaccination with MtbΔmmsb mutant generated significant protection in comparison to sham-immunized animals at 4 and 12 weeks post-infection in lungs and spleen of infected animals. However, the protection imparted by MtbΔmmsb was significantly less in comparison to BCG immunized animals. This study indicates the importance of attenuated multiple gene deletion mutants of M. tuberculosis for generating protection against tuberculosis. PMID:29242198
Dockter, Christoph; Gruszka, Damian; Braumann, Ilka; Druka, Arnis; Druka, Ilze; Franckowiak, Jerome; Gough, Simon P; Janeczko, Anna; Kurowska, Marzena; Lundqvist, Joakim; Lundqvist, Udda; Marzec, Marek; Matyszczak, Izabela; Müller, André H; Oklestkova, Jana; Schulz, Burkhard; Zakhrabekova, Shakhira; Hansson, Mats
2014-12-01
Reduced plant height and culm robustness are quantitative characteristics important for assuring cereal crop yield and quality under adverse weather conditions. A very limited number of short-culm mutant alleles were introduced into commercial crop cultivars during the Green Revolution. We identified phenotypic traits, including sturdy culm, specific for deficiencies in brassinosteroid biosynthesis and signaling in semidwarf mutants of barley (Hordeum vulgare). This set of characteristic traits was explored to perform a phenotypic screen of near-isogenic short-culm mutant lines from the brachytic, breviaristatum, dense spike, erectoides, semibrachytic, semidwarf, and slender dwarf mutant groups. In silico mapping of brassinosteroid-related genes in the barley genome in combination with sequencing of barley mutant lines assigned more than 20 historic mutants to three brassinosteroid-biosynthesis genes (BRASSINOSTEROID-6-OXIDASE, CONSTITUTIVE PHOTOMORPHOGENIC DWARF, and DIMINUTO) and one brassinosteroid-signaling gene (BRASSINOSTEROID-INSENSITIVE1 [HvBRI1]). Analyses of F2 and M2 populations, allelic crosses, and modeling of nonsynonymous amino acid exchanges in protein crystal structures gave a further understanding of the control of barley plant architecture and sturdiness by brassinosteroid-related genes. Alternatives to the widely used but highly temperature-sensitive uzu1.a allele of HvBRI1 represent potential genetic building blocks for breeding strategies with sturdy and climate-tolerant barley cultivars. © 2014 American Society of Plant Biologists. All Rights Reserved.
Wang, Hong; Wang, Congcong; Li, Ya; Yue, Xiaofeng; Ma, Zhonghua; Talbot, Nicholas J.; Wang, Zhengyi
2013-01-01
Methylenetetrahydrofolate reductases (MTHFRs) play a key role in the biosynthesis of methionine in both prokaryotic and eukaryotic organisms. In this study, we report the identification of a novel T-DNA-tagged mutant WH672 in the rice blast fungus Magnaporthe oryzae, which was defective in vegetative growth, conidiation and pathogenicity. Analysis of the mutation confirmed a single T-DNA insertion upstream of MET13, which encodes a 626-amino-acid protein encoding a MTHFR. Targeted gene deletion of MET13 resulted in mutants that were non-pathogenic and significantly impaired in aerial growth and melanin pigmentation. All phenotypes associated with Δmet13 mutants could be overcome by addition of exogenous methionine. The M. oryzae genome contains a second predicted MTHFR-encoding gene, MET12. The deduced amino acid sequences of Met13 and Met12 share 32% identity. Interestingly, Δmet12 mutants produced significantly less conidia compared with the isogenic wild-type strain and grew very poorly in the absence of methionine, but were fully pathogenic. Deletion of both genes resulted in Δmet13Δmet12 mutants that showed similar phenotypes to single Δmet13 mutants. Taken together, we conclude that the MTHFR gene, MET13, is essential for infection-related morphogenesis by the rice blast fungus M. oryzae. PMID:24116181
Li, Guotian; Jain, Rashmi; Chern, Mawsheng; ...
2017-06-02
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportionmore » of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. In conclusion, this work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations.« less
Dockter, Christoph; Gruszka, Damian; Braumann, Ilka; Druka, Arnis; Druka, Ilze; Franckowiak, Jerome; Gough, Simon P.; Janeczko, Anna; Kurowska, Marzena; Lundqvist, Joakim; Lundqvist, Udda; Marzec, Marek; Matyszczak, Izabela; Müller, André H.; Oklestkova, Jana; Schulz, Burkhard; Zakhrabekova, Shakhira; Hansson, Mats
2014-01-01
Reduced plant height and culm robustness are quantitative characteristics important for assuring cereal crop yield and quality under adverse weather conditions. A very limited number of short-culm mutant alleles were introduced into commercial crop cultivars during the Green Revolution. We identified phenotypic traits, including sturdy culm, specific for deficiencies in brassinosteroid biosynthesis and signaling in semidwarf mutants of barley (Hordeum vulgare). This set of characteristic traits was explored to perform a phenotypic screen of near-isogenic short-culm mutant lines from the brachytic, breviaristatum, dense spike, erectoides, semibrachytic, semidwarf, and slender dwarf mutant groups. In silico mapping of brassinosteroid-related genes in the barley genome in combination with sequencing of barley mutant lines assigned more than 20 historic mutants to three brassinosteroid-biosynthesis genes (BRASSINOSTEROID-6-OXIDASE, CONSTITUTIVE PHOTOMORPHOGENIC DWARF, and DIMINUTO) and one brassinosteroid-signaling gene (BRASSINOSTEROID-INSENSITIVE1 [HvBRI1]). Analyses of F2 and M2 populations, allelic crosses, and modeling of nonsynonymous amino acid exchanges in protein crystal structures gave a further understanding of the control of barley plant architecture and sturdiness by brassinosteroid-related genes. Alternatives to the widely used but highly temperature-sensitive uzu1.a allele of HvBRI1 represent potential genetic building blocks for breeding strategies with sturdy and climate-tolerant barley cultivars. PMID:25332507
Menanteau-Ledouble, Simon; Lawrence, Mark L
2013-03-23
Initial invasion of the host is the first and vital part of any infection process. We have demonstrated that Edwardsiella ictaluri is capable of colonizing and penetrating catfish skin. Therefore, a mutant library was constructed by random insertion of the Mar2xT7 transposon into the chromosome of E. ictaluri harboring the bioluminescence plasmid pAKgfplux1. This library was then screened through a series of three consecutive challenges for mutants showing a decreased ability to colonize the catfish epithelium. Eighteen mutants were identified that have decreased adhesion and virulence. Mutated genes encoded one sensor protein, two transport proteins, five enzymes, two regulatory proteins, and five hypothetical proteins. Among the mutated genes, the first one identified was a gene encoding for RstA/B, which is known to play a role in regulating the expression of invasion genes in Salmonella enterica Typhimurium. Another mutant was lacking a putative ribonuclease similar to a Shigella protein that regulates the expression of adhesin. A third mutant was defective in a protein similar to a Brucella protein that was initially identified as a transporter, but actually is a member of a newly discovered adhesin family. Results from this study could enable development of a new strategy for blocking E. ictaluri invasion at the initial adherence stage. Copyright © 2012 Elsevier B.V. All rights reserved.
2011-01-01
Background In rice, the major part of the post-embryonic root system is made of stem-derived roots named crown roots (CR). Among the few characterized rice mutants affected in root development, crown rootless1 mutant is unable to initiate crown root primordia. CROWN ROOTLESS1 (CRL1) is induced by auxin and encodes an AS2/LOB-domain transcription factor that acts upstream of the gene regulatory network controlling CR development. Results To identify genes involved in CR development, we compared global gene expression profile in stem bases of crl1 mutant and wild-type (WT) plants. Our analysis revealed that 250 and 236 genes are down- and up-regulated respectively in the crl1 mutant. Auxin induces CRL1 expression and consequently it is expected that auxin also alters the expression of genes that are early regulated by CRL1. To identify genes under the early control of CRL1, we monitored the expression kinetics of a selected subset of genes, mainly chosen among those exhibiting differential expression, in crl1 and WT following exogenous auxin treatment. This analysis revealed that most of these genes, mainly related to hormone, water and nutrient, development and homeostasis, were likely not regulated directly by CRL1. We hypothesized that the differential expression for these genes observed in the crl1 mutant is likely a consequence of the absence of CR formation. Otherwise, three CRL1-dependent auxin-responsive genes: FSM (FLATENNED SHOOT MERISTEM)/FAS1 (FASCIATA1), GTE4 (GENERAL TRANSCRIPTION FACTOR GROUP E4) and MAP (MICROTUBULE-ASSOCIATED PROTEIN) were identified. FSM/FAS1 and GTE4 are known in rice and Arabidopsis to be involved in the maintenance of root meristem through chromatin remodelling and cell cycle regulation respectively. Conclusion Our data showed that the differential regulation of most genes in crl1 versus WT may be an indirect consequence of CRL1 inactivation resulting from the absence of CR in the crl1 mutant. Nevertheless some genes, FAS1/FSM, GTE4 and MAP, require CRL1 to be induced by auxin suggesting that they are likely directly regulated by CRL1. These genes have a function related to polarized cell growth, cell cycle regulation or chromatin remodelling. This suggests that these genes are controlled by CRL1 and involved in CR initiation in rice. PMID:21806801
A novel human pain insensitivity disorder caused by a point mutation in ZFHX2
Habib, Abdella M; Matsuyama, Ayako; Okorokov, Andrei L; Santana-Varela, Sonia; Bras, Jose T; Aloisi, Anna Maria; Emery, Edward C; Bogdanov, Yury D; Follenfant, Maryne; Gossage, Sam J; Gras, Mathilde; Humphrey, Jack; Kolesnikov, Anna; Le Cann, Kim; Li, Shengnan; Minett, Michael S; Pereira, Vanessa; Ponsolles, Clara; Sikandar, Shafaq; Torres, Jesus M; Yamaoka, Kenji; Zhao, Jing; Komine, Yuriko; Yamamori, Tetsuo; Maniatis, Nikolas; Panov, Konstantin I; Houlden, Henry; Ramirez, Juan D; Bennett, David L H; Marsili, Letizia; Bachiocco, Valeria; Wood, John N; Cox, James J
2018-01-01
Abstract Chronic pain is a major global public health issue causing a severe impact on both the quality of life for sufferers and the wider economy. Despite the significant clinical burden, little progress has been made in terms of therapeutic development. A unique approach to identifying new human-validated analgesic drug targets is to study rare families with inherited pain insensitivity. Here we have analysed an otherwise normal family where six affected individuals display a pain insensitive phenotype that is characterized by hyposensitivity to noxious heat and painless bone fractures. This autosomal dominant disorder is found in three generations and is not associated with a peripheral neuropathy. A novel point mutation in ZFHX2, encoding a putative transcription factor expressed in small diameter sensory neurons, was identified by whole exome sequencing that segregates with the pain insensitivity. The mutation is predicted to change an evolutionarily highly conserved arginine residue 1913 to a lysine within a homeodomain. Bacterial artificial chromosome (BAC) transgenic mice bearing the orthologous murine p.R1907K mutation, as well as Zfhx2 null mutant mice, have significant deficits in pain sensitivity. Gene expression analyses in dorsal root ganglia from mutant and wild-type mice show altered expression of genes implicated in peripheral pain mechanisms. The ZFHX2 variant and downstream regulated genes associated with a human pain-insensitive phenotype are therefore potential novel targets for the development of new analgesic drugs. PMID:29253101
Ikram, Sobia; Durandet, Monique; Vesa, Simona; Pereira, Serge; Guerche, Philippe; Bonhomme, Sandrine
2014-06-01
F-box protein genes family is one of the largest gene families in plants, with almost 700 predicted genes in the model plant Arabidopsis. F-box proteins are key components of the ubiquitin proteasome system that allows targeted protein degradation. Transcriptome analyses indicate that half of these F-box protein genes are found expressed in microspore and/or pollen, i.e., during male gametogenesis. To assess the role of F-box protein genes during this crucial developmental step, we selected 34 F-box protein genes recorded as highly and specifically expressed in pollen and isolated corresponding insertion mutants. We checked the expression level of each selected gene by RT-PCR and confirmed pollen expression for 25 genes, but specific expression for only 10 of the 34 F-box protein genes. In addition, we tested the expression level of selected F-box protein genes in 24 mutant lines and showed that 11 of them were null mutants. Transmission analysis of the mutations to the progeny showed that none of the single mutations was gametophytic lethal. These unaffected transmission efficiencies suggested leaky mutations or functional redundancy among F-box protein genes. Cytological observation of the gametophytes in the mutants confirmed these results. Combinations of mutations in F-box protein genes from the same subfamily did not lead to transmission defect either, further highlighting functional redundancy and/or a high proportion of pseudogenes among these F-box protein genes.
Wilson, Melissa A.; Zhao, Fengmin; Letrero, Richard; D’Andrea, Kurt; Rimm, David L.; Kirkwood, John M.; Kluger, Harriet M.; Lee, Sandra J.; Schuchter, Lynn M.; Flaherty, Keith T.; Nathanson, Katherine L.
2014-01-01
Purpose Sorafenib is an inhibitor of VEGFR, PDGFR, and RAF kinases, amongst others. We assessed the association of somatic mutations with clinicopathologic features and clinical outcomes in patients with metastatic melanoma treated on E2603, comparing treatment with carboplatin, paclitaxel +/− sorafenib (CP vs. CPS). Experimental Design Pre-treatment tumor samples from 179 unique individuals enrolled on E2603 were analyzed. Genotyping was performed using a custom iPlex panel interrogating 74 mutations in 13 genes. Statistical analysis was performed using Fisher’s exact test, logistic regression, and Cox’s proportional-hazards models. Progression free survival and overall survival were estimated using Kaplan-Meier methods. Results BRAF and NRAS mutations were found at frequencies consistent with other metastatic melanoma cohorts. BRAF-mutant melanoma was associated with worse performance status, increased number of disease sites, and younger age at diagnosis; NRAS-mutant melanoma was associated with better performance status, fewer sites of disease, and female gender. BRAF and NRAS mutations were not significantly predictive of response or survival when treated with CPS vs. CP. However, patients with NRAS-mutant melanoma trended towards a worse response and PFS on CP than those with BRAF-mutant or WT/WT melanoma, an association that was reversed for this group on the CPS arm. Conclusions This study of somatic mutations in melanoma is the last prospectively collected phase III clinical trial population prior to the era of BRAF targeted therapy. A trend towards improved clinical response in patients with NRAS-mutant melanoma treated with CPS was observed, possibly due to sorafenib’s effect on CRAF. PMID:24714776
O'Tuathaigh, Colm M P; Mathur, Naina; O'Callaghan, Matthew J; MacIntyre, Lynsey; Harvey, Richard; Lai, Donna; Waddington, John L; Pickard, Benjamin S; Watson, David G; Moran, Paula M
2017-09-01
Although there is considerable genetic and pathologic evidence for an association between neuregulin 1 (NRG1) dysregulation and schizophrenia, the underlying molecular and cellular mechanisms remain unclear. Mutant mice containing disruption of the transmembrane (TM) domain of the NRG1 gene constitute a heuristic model for dysregulation of NRG1-ErbB4 signaling in schizophrenia. The present study focused on hitherto uncharacterized information processing phenotypes in this mutant line. Using a mass spectrometry-based metabolomics approach, we also quantified levels of unique metabolites in brain. Across 2 different sites and protocols, Nrg1 mutants demonstrated deficits in prepulse inhibition, a measure of sensorimotor gating, that is, disrupted in schizophrenia; these deficits were partially reversed by acute treatment with second, but not first-, generation antipsychotic drugs. However, Nrg1 mutants did not show a specific deficit in latent inhibition, a measure of selective attention that is also disrupted in schizophrenia. In contrast, in a "what-where-when" object recognition memory task, Nrg1 mutants displayed sex-specific (males only) disruption of "what-when" performance, indicative of impaired temporal aspects of episodic memory. Differential metabolomic profiling revealed that these behavioral phenotypes were accompanied, most prominently, by alterations in lipid metabolism pathways. This study is the first to associate these novel physiological mechanisms, previously independently identified as being abnormal in schizophrenia, with disruption of NRG1 function. These data suggest novel mechanisms by which compromised neuregulin function from birth might lead to schizophrenia-relevant behavioral changes in adulthood. © The Author 2017. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center.
Katayama, Masafumi; Kiyono, Tohru; Horie, Kengo; Hirayama, Takashi; Eitsuka, Takahiro; Kuroda, Kengo; Donai, Kenichiro; Hidema, Shizu; Nishimori, Katsuhiko; Fukuda, Tomokazu
2015-01-01
The prairie vole (Microtus ochrogaster) shows social behaviors such as monogamy and parenting of infants with pair bonding. These social behaviors are specific to the prairie vole and have not been observed in other types of voles, such as mountain voles. Although the prairie vole has several unique characteristics, an in vitro cell culture system has not been established for this species. Furthermore, establishment of cultured cells derived from the prairie vole may be beneficial based on the three Rs (i.e., Replacement, Reduction, and Refinement) concept. Therefore, in this study, we attempted to establish an immortalized cell line derived from the prairie vole. Our previous research has shown that transduction with mutant forms of cyclin-dependent kinase 4 (CDK4), cyclin D, and telomerase reverse transcriptase (TERT) could efficiently immortalize cells from multiple species, including humans, cattle, pigs, and monkeys. Here, we introduced these three genes into prairie vole-derived muscle fibroblasts. The expression of mutant CDK4 and cyclin D proteins was confirmed by western blotting, and telomerase activity was detected in immortalized vole muscle-derived fibroblasts (VMF-K4DT cells or VMFs) by stretch PCR. Population doubling analysis showed that the introduction of mutant CDK4, cyclin D, and TERT extended the lifespan of VMFs. To the best of our knowledge, this is the first report describing the establishment of an immortalized cell line derived from the prairie vole through the expression of mutant CDK4, cyclin D, and human TERT. PMID:26496927
Katayama, Masafumi; Kiyono, Tohru; Horie, Kengo; Hirayama, Takashi; Eitsuka, Takahiro; Kuroda, Kengo; Donai, Kenichiro; Hidema, Shizu; Nishimori, Katsuhiko; Fukuda, Tomokazu
2016-01-01
The prairie vole (Microtus ochrogaster) shows social behaviors such as monogamy and parenting of infants with pair bonding. These social behaviors are specific to the prairie vole and have not been observed in other types of voles, such as mountain voles. Although the prairie vole has several unique characteristics, an in vitro cell culture system has not been established for this species. Furthermore, establishment of cultured cells derived from the prairie vole may be beneficial based on the three Rs (i.e., Replacement, Reduction, and Refinement) concept. Therefore, in this study, we attempted to establish an immortalized cell line derived from the prairie vole. Our previous research has shown that transduction with mutant forms of cyclin-dependent kinase 4 (CDK4), cyclin D, and telomerase reverse transcriptase (TERT) could efficiently immortalize cells from multiple species, including humans, cattle, pigs, and monkeys. Here, we introduced these three genes into prairie vole-derived muscle fibroblasts. The expression of mutant CDK4 and cyclin D proteins was confirmed by western blotting, and telomerase activity was detected in immortalized vole muscle-derived fibroblasts (VMF-K4DT cells or VMFs) by stretch PCR. Population doubling analysis showed that the introduction of mutant CDK4, cyclin D, and TERT extended the lifespan of VMFs. To the best of our knowledge, this is the first report describing the establishment of an immortalized cell line derived from the prairie vole through the expression of mutant CDK4, cyclin D, and human TERT.
A proof of the DBRF-MEGN method, an algorithm for deducing minimum equivalent gene networks
2011-01-01
Background We previously developed the DBRF-MEGN (difference-based regulation finding-minimum equivalent gene network) method, which deduces the most parsimonious signed directed graphs (SDGs) consistent with expression profiles of single-gene deletion mutants. However, until the present study, we have not presented the details of the method's algorithm or a proof of the algorithm. Results We describe in detail the algorithm of the DBRF-MEGN method and prove that the algorithm deduces all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. Conclusions The DBRF-MEGN method provides all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. PMID:21699737
Kato, Takehide; Morita, Miyo Terao; Fukaki, Hidehiro; Yamauchi, Yoshiro; Uehara, Michiko; Niihama, Mitsuru; Tasaka, Masao
2002-01-01
In higher plants, the shoot and the root generally show negative and positive gravitropism, respectively. To elucidate the molecular mechanisms involved in gravitropism, we have isolated many shoot gravitropism mutants in Arabidopsis. The sgr2 and zig/sgr4 mutants exhibited abnormal gravitropism in both inflorescence stems and hypocotyls. These genes probably are involved in the early step(s) of the gravitropic response. The sgr2 mutants also had misshapen seed and seedlings, whereas the stem of the zig/sgr4 mutants elongated in a zigzag fashion. The SGR2 gene encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid–preferring phospholipase A1 containing a putative transmembrane domain. This gene family has been reported only in eukaryotes. The ZIG gene was found to encode AtVTI11, a protein that is homologous with yeast VTI1 and is involved in vesicle transport. Our observations suggest that the two genes may be involved in a vacuolar membrane system that affects shoot gravitropism. PMID:11826297
Zhu, Chunhua; Sun, Boyi; Liu, Taigang; Zheng, Huajun; Gu, Wenyi; He, Wei; Sun, Fengjiao; Wang, Yaping; Yang, Meicheng; Bei, Weicheng; Peng, Xu; She, Qunxin; Xie, Lu; Chen, Lanming
2017-06-05
Vibrio parahaemolyticus causes serious seafood-borne gastroenteritis and death in humans. Raw seafood is often subjected to post-harvest processing and low-temperature storage. To date, very little information is available regarding the biological functions of cold shock proteins (CSPs) in the low-temperature survival of the bacterium. In this study, we determined the complete genome sequence of V. parahaemolyticus CHN25 (serotype: O5:KUT). The two main CSP-encoding genes (VpacspA and VpacspD) were deleted from the bacterial genome, and comparative transcriptomic analysis between the mutant and wild-type strains was performed to dissect the possible molecular mechanisms that underlie low-temperature adaptation by V. parahaemolyticus. The 5,443,401-bp V. parahaemolyticus CHN25 genome (45.2% G + C) consisted of two circular chromosomes and three plasmids with 4,724 predicted protein-encoding genes. One dual-gene and two single-gene deletion mutants were generated for VpacspA and VpacspD by homologous recombination. The growth of the ΔVpacspA mutant was strongly inhibited at 10 °C, whereas the VpacspD gene deletion strongly stimulated bacterial growth at this low temperature compared with the wild-type strain. The complementary phenotypes were observed in the reverse mutants (ΔVpacspA-com, and ΔVpacspD-com). The transcriptome data revealed that 12.4% of the expressed genes in V. parahaemolyticus CHN25 were significantly altered in the ΔVpacspA mutant when it was grown at 10 °C. These included genes that were involved in amino acid degradation, secretion systems, sulphur metabolism and glycerophospholipid metabolism along with ATP-binding cassette transporters. However, a low temperature elicited significant expression changes for 10.0% of the genes in the ΔVpacspD mutant, including those involved in the phosphotransferase system and in the metabolism of nitrogen and amino acids. The major metabolic pathways that were altered by the dual-gene deletion mutant (ΔVpacspAD) radically differed from those that were altered by single-gene mutants. Comparison of the transcriptome profiles further revealed numerous differentially expressed genes that were shared among the three mutants and regulators that were specifically, coordinately or antagonistically modulated by VpaCspA and VpaCspD. Our data also revealed several possible molecular coping strategies for low-temperature adaptation by the bacterium. This study is the first to describe the complete genome sequence of V. parahaemolyticus (serotype: O5:KUT). The gene deletions, complementary insertions, and comparative transcriptomics demonstrate that VpaCspA is a primary CSP in the bacterium, while VpaCspD functions as a growth inhibitor at 10 °C. These results have improved our understanding of the genetic basis for low-temperature survival by the most common seafood-borne pathogen worldwide.
Yadav, Ravi P.; Gakhar, Lokesh; Yu, Liping
2017-01-01
FKBP-domain proteins (FKBPs) are pivotal modulators of cellular signaling, protein folding, and gene transcription. Aryl hydrocarbon receptor-interacting protein-like 1 (AIPL1) is a distinctive member of the FKBP superfamily in terms of its biochemical properties, and it plays an important biological role as a chaperone of phosphodiesterase 6 (PDE6), an effector enzyme of the visual transduction cascade. Malfunction of mutant AIPL1 proteins triggers a severe form of Leber congenital amaurosis and leads to blindness. The mechanism underlying the chaperone activity of AIPL1 is largely unknown, but involves the binding of isoprenyl groups on PDE6 to the FKBP domain of AIPL1. We solved the crystal structures of the AIPL1–FKBP domain and its pathogenic mutant V71F, both in the apo form and in complex with isoprenyl moieties. These structures reveal a module for lipid binding that is unparalleled within the FKBP superfamily. The prenyl binding is enabled by a unique “loop-out” conformation of the β4-α1 loop and a conformational “flip-out” switch of the key W72 residue. A second major conformation of apo AIPL1–FKBP was identified by NMR studies. This conformation, wherein W72 flips into the ligand-binding pocket and renders the protein incapable of prenyl binding, is supported by molecular dynamics simulations and appears to underlie the pathogenicity of the V71F mutant. Our findings offer critical insights into the mechanisms that underlie AIPL1 function in health and disease, and highlight the structural and functional diversity of the FKBPs. PMID:28739921
Lv, Weigang; Wei, Xianda; Guo, Ruolan; Liu, Qin; Zheng, Yu; Chang, Jiazhen; Bai, Ting; Li, Haoxian; Zhang, Jianguang; Song, Zhuo; Cram, David S; Liang, Desheng; Wu, Lingqian
2015-01-01
Noninvasive prenatal testing (NIPT) for monogenic diseases by use of PCR-based strategies requires precise quantification of mutant fetal alleles circulating in the maternal plasma. The study describes the development and validation of a novel assay termed circulating single-molecule amplification and resequencing technology (cSMART) for counting single allelic molecules in plasma. Here we demonstrate the suitability of cSMART for NIPT, with Wilson Disease (WD) as proof of concept. We used Sanger and whole-exome sequencing to identify familial ATP7B (ATPase, Cu(++) transporting, β polypeptide) gene mutations. For cSMART, single molecules were tagged with unique barcodes and circularized, and alleles were targeted and replicated by inverse PCR. The unique single allelic molecules were identified by sequencing and counted, and the percentage of mutant alleles in the original maternal plasma sample was used to determine fetal genotypes. Four families with WD pedigrees consented to the study. Using Sanger and whole-exome sequencing, we mapped the pathogenic ATP7B mutations in each pedigree and confirmed the proband's original diagnosis of WD. After validation of cSMART with defined plasma models mimicking fetal inheritance of paternal, maternal, or both parental mutant alleles, we retrospectively showed in second pregnancies that the fetal genotypes assigned by invasive testing and NIPT were concordant. We developed a reliable and accurate NIPT assay that correctly diagnosed the fetal genotypes in 4 pregnancies at risk for WD. This novel technology has potential as a universal strategy for NIPT of other monogenic disorders, since it requires only knowledge of the parental pathogenic mutations. © 2014 American Association for Clinical Chemistry.
Geber, A; Hitchcock, C A; Swartz, J E; Pullen, F S; Marsden, K E; Kwon-Chung, K J; Bennett, J E
1995-01-01
We have cloned and sequenced the structural genes encoding the delta 5,6 sterol desaturase (ERG3 gene) and the 14 alpha-methyl sterol demethylase (ERG11 gene) from Candida glabrata L5 (leu2). Single and double mutants of these genes were created by gene deletion. The phenotypes of these mutants, including sterol profiles, aerobic viabilities, antifungal susceptibilities, and generation times, were studied. Strain L5D (erg3 delta::LEU2) accumulated mainly ergosta-7,22-dien-3 beta-ol, was aerobically viable, and remained susceptible to antifungal agents but had a slower generation time than its parent strain. L5LUD (LEU2 erg11 delta::URA3) strains required medium supplemented with ergosterol and an anaerobic environment for growth. A spontaneous aerobically viable mutant, L5LUD40R (LEU erg11 delta::URA3), obtained from L5LUD (LEU2 erg11 delta::URA3), was found to accumulate lanosterol and obtusifoliol, was resistant to azole antifungal agents, demonstrated some increase in resistance to amphotericin B, and exhibited a 1.86-fold increase in generation time in comparison with L5 (leu2). The double-deletion mutant L5DUD61 (erg3 delta::LEU2 erg11 delta::URA3) was aerobically viable, produced mainly 14 alpha-methyl fecosterol, and had the same antifungal susceptibility pattern as L5LUD40R (LEU2 erg11 delta::URA3), and its generation time was threefold greater than that of L5 (leu2). Northern (RNA) analysis revealed that the single-deletion mutants had a marked increase in message for the undeleted ERG3 and ERG11 genes. These results indicate that differences in antifungal susceptibilities and the restoration of aerobic viability exist between the C. glabrata ergosterol mutants created in this study and those sterol mutants with similar genetic lesions previously reported for Saccharomyces cerevisiae. PMID:8593007
Ito, Hiroya; Takahashi, Sayaka; Asai, Tetsuo; Tamura, Yutaka; Yamamoto, Koshi
2018-01-01
An atypical urease-negative mutant of Actinobacillus pleuropneumoniae serovar 2 was isolated in Japan. Nucleotide sequence analysis of the urease gene cluster revealed that the insertion of a short DNA sequence into the cbiM gene was responsible for the urease-negative activity of the mutant. Veterinary diagnostic laboratories should be watchful for the presence of aberrant urease-negative A. pleuropneumoniae isolates.
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis
Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-01-01
Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587
Kamerewerd, Jens; Jansson, Malin; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich
2008-01-01
Sordaria macrospora, a self-fertile filamentous ascomycete, carries genes encoding three different α-subunits of heterotrimeric G proteins (gsa, G protein Sordaria alpha subunit). We generated knockout strains for all three gsa genes (Δgsa1, Δgsa2, and Δgsa3) as well as all combinations of double mutants. Phenotypic analysis of single and double mutants showed that the genes for Gα-subunits have distinct roles in the sexual life cycle. While single mutants show some reduction of fertility, double mutants Δgsa1Δgsa2 and Δgsa1Δgsa3 are completely sterile. To test whether the pheromone receptors PRE1 and PRE2 mediate signaling via distinct Gα-subunits, two recently generated Δpre strains were crossed with all Δgsa strains. Analyses of the corresponding double mutants revealed that compared to GSA2, GSA1 is a more predominant regulator of a signal transduction cascade downstream of the pheromone receptors and that GSA3 is involved in another signaling pathway that also contributes to fruiting body development and fertility. We further isolated the gene encoding adenylyl cyclase (AC) (sac1) for construction of a knockout strain. Analyses of the three ΔgsaΔsac1 double mutants and one Δgsa2Δgsa3Δsac1 triple mutant indicate that SAC1 acts downstream of GSA3, parallel to a GSA1–GSA2-mediated signaling pathway. In addition, the function of STE12 and PRO41, two presumptive signaling components, was investigated in diverse double mutants lacking those developmental genes in combination with the gsa genes. This analysis was further completed by expression studies of the ste12 and pro41 transcripts in wild-type and mutant strains. From the sum of all our data, we propose a model for how different Gα-subunits interact with pheromone receptors, adenylyl cyclase, and STE12 and thus cooperatively regulate sexual development in S. macrospora. PMID:18723884
Stevenson, David A.; Viskochil, David H.; Rope, Alan F.; Carey, John C.
2011-01-01
NF-Noonan syndrome (NFNS) has been described as a unique phenotype, combining manifestations of neurofibromatosis type 1 (NF1) and Noonan syndromes, which are separate syndromes. Potential etiologies of NF-Noonan syndrome include a discrete syndrome of distinct etiology, co-segregation of two mutated common genes, variable clinical expressivity of NF1, and/or allelic heterogeneity. We present an informative family with an unusual NF1 mutation with variable features of NF1 and Noonan syndrome. We hypothesize that an NF1 mutant allele can lead to diagnostic manifestations of Noonan syndrome, supporting the hypothesis that NF1 allelic heterogeneity causes NFNS. PMID:16542390
Park, Joohae; Hulsman, Mark; Arentshorst, Mark; Breeman, Matthijs; Alazi, Ebru; Lagendijk, Ellen L; Rocha, Marina C; Malavazi, Iran; Nitsche, Benjamin M; van den Hondel, Cees A M J J; Meyer, Vera; Ram, Arthur F J
2016-09-01
The biosynthesis of cell surface-located galactofuranose (Galf)-containing glycostructures such as galactomannan, N-glycans and O-glycans in filamentous fungi is important to secure the integrity of the cell wall. UgmA encodes an UDP-galactopyranose mutase, which is essential for the formation of Galf. Consequently, the ΔugmA mutant lacks Galf-containing molecules. Our previous work in Aspergillus niger work suggested that loss of function of ugmA results in activation of the cell wall integrity (CWI) pathway which is characterized by increased expression of the agsA gene, encoding an α-glucan synthase. In this study, the transcriptional response of the ΔugmA mutant was further linked to the CWI pathway by showing the induced and constitutive phosphorylation of the CWI-MAP kinase in the ΔugmA mutant. To identify genes involved in cell wall remodelling in response to the absence of galactofuranose biosynthesis, a genome-wide expression analysis was performed using RNAseq. Over 400 genes were higher expressed in the ΔugmA mutant compared to the wild-type. These include genes that encode enzymes involved in chitin (gfaB, gnsA, chsA) and α-glucan synthesis (agsA), and in β-glucan remodelling (bgxA, gelF and dfgC), and also include several glycosylphosphatidylinositol (GPI)-anchored cell wall protein-encoding genes. In silico analysis of the 1-kb promoter regions of the up-regulated genes in the ΔugmA mutant indicated overrepresentation of genes with RlmA, MsnA, PacC and SteA-binding sites. The importance of these transcription factors for survival of the ΔugmA mutant was analysed by constructing the respective double mutants. The ΔugmA/ΔrlmA and ΔugmA/ΔmsnA double mutants showed strong synthetic growth defects, indicating the importance of these transcription factors to maintain cell wall integrity in the absence of Galf biosynthesis. © 2016 The Authors Cellular Microbiology Published by John Wiley & Sons Ltd.
Kim, Jung-Hoon; Yang, Yoon-Mo; Ji, Chang-Jun; Ryu, Su-Hyun; Won, Young-Bin; Ju, Shin-Yeong; Kwon, Yumi; Lee, Yeh-Eun; Youn, Hwan; Lee, Jin-Won
2017-06-01
PerR, a member of Fur family protein, is a metal-dependent H 2 O 2 sensing transcription factor that regulates genes involved in peroxide stress response. Industrially important bacterium Bacillus licheniformis contains three PerR-like proteins (PerR BL , PerR2, and PerR3) compared to its close relative Bacillus subtilis. Interestingly, unlike other bacteria including B. subtilis, no authentic perR BL null mutant could be established for B. licheniformis. Thus, we constructed a conditional perR BL mutant using a xylose-inducible promoter, and investigated the genes under the control of PerR BL . PerR BL regulon genes include katA, mrgA, ahpC, pfeT, hemA, fur, and perR as observed for PerR BS . However, there is some variation in the expression levels of fur and hemA genes between B. subtilis and B. licheniformis in the derepressed state. Furthermore, katA, mrgA, and ahpC are strongly induced, whereas the others are only weakly or not induced by H 2 O 2 treatment. In contrast to the B. subtilis perR null mutant which frequently gives rise to large colony phenotype mainly due to the loss of katA, the suppressors of B. licheniformis perR mutant, which can form colonies on LB agar, were all catalase-positive. Instead, many of the suppressors showed increased levels of siderophore production, suggesting that the suppressor mutation is linked to the fur gene. Consistent with this, perR fur double mutant could grow on LB agar without Fe supplementation, whereas perR katA double mutant could only grow on LB agar with Fe supplementation. Taken together, our data suggest that in B. licheniformis, despite the similarity in PerR BL and PerR BS regulon genes, perR is an essential gene required for growth and that the inability of perR null mutant to grow is mainly due to elevated expression of Fur.
The dlt genes play a role in antimicrobial tolerance of Streptococcus mutans biofilms.
Nilsson, Martin; Rybtke, Morten; Givskov, Michael; Høiby, Niels; Twetman, Svante; Tolker-Nielsen, Tim
2016-09-01
Microbial biofilms are tolerant to antibiotic treatment and therefore cause problematic infections. Knowledge about the molecular mechanisms underlying biofilm-associated antimicrobial tolerance will aid the development of antibiofilm drugs. Screening of a Streptococcus mutans transposon mutant library for genes that are important for biofilm-associated antimicrobial tolerance provided evidence that the dlt genes play a role in the tolerance of S. mutans biofilms towards gentamicin. The minimum bactericidal concentration for biofilm cells (MBC-B) for a dltA transposon mutant was eight-fold lower than that of the wild-type. The minimum bactericidal concentration for planktonic cells (MBC-P) was only slightly reduced, indicating that the mechanism involved in the observed antimicrobial tolerance has a predominant role specifically in biofilms. Experiments with a knockout dltA mutant and complemented strain confirmed that the dlt genes in S. mutans play a role in biofilm-associated tolerance to gentamicin. Confocal laser scanning microscopy analyses of biofilms grown on glass slides showed that the dltA mutant produced roughly the same amount of biofilm as the wild-type, indicating that the reduced antimicrobial tolerance of the dltA mutant is not due to a defect in biofilm formation. The products of the dlt genes have been shown to mediate alanylation of teichoic acids, and in accordance the dltA mutant showed a more negatively charged surface than the wild-type, which likely is an important factor in the reduced tolerance of the dltA mutant biofilms towards the positively charged gentamicin. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Dahl, Marlis; Müller, Susanne; Voll, Lars M.; Koch, Christian
2015-01-01
We used insertional mutagenesis by Agrobacterium tumefaciens mediated transformation (ATMT) to isolate pathogenicity mutants of Colletotrichum higginsianum. From a collection of 7200 insertion mutants we isolated 75 mutants with reduced symptoms. 19 of these were affected in host penetration, while 17 were affected in later stages of infection, like switching to necrotrophic growth. For 16 mutants the location of T-DNA insertions could be identified by PCR. A potential plasma membrane H+-ATPase Pma2 was targeted in five independent insertion mutants. We genetically inactivated the Ku80 component of the non-homologous end-joining pathway in C. higginsianum to establish an efficient gene knockout protocol. Chpma2 deletion mutants generated by homologous recombination in the ΔChku80 background form fully melanized appressoria but entirely fail to penetrate the host tissue and are non-pathogenic. The ChPMA2 gene is induced upon appressoria formation and infection of A. thaliana. Pma2 activity is not important for vegetative growth of saprophytically growing mycelium, since the mutant shows no growth penalty under these conditions. Colletotrichum higginsianum codes for a closely related gene (ChPMA1), which is highly expressed under most growth conditions. ChPMA1 is more similar to the homologous yeast genes for plasma membrane pumps. We propose that expression of a specific proton pump early during infection may be common to many appressoria forming fungal pathogens as we found ChPMA2 orthologs in several plant pathogenic fungi. PMID:25992547
notch3 is essential for oligodendrocyte development and vascular integrity in zebrafish
Zaucker, Andreas; Mercurio, Sara; Sternheim, Nitzan; Talbot, William S.; Marlow, Florence L.
2013-01-01
SUMMARY Mutations in the human NOTCH3 gene cause CADASIL syndrome (cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy). CADASIL is an inherited small vessel disease characterized by diverse clinical manifestations including vasculopathy, neurodegeneration and dementia. Here we report two mutations in the zebrafish notch3 gene, one identified in a previous screen for mutations with reduced expression of myelin basic protein (mbp) and another caused by a retroviral insertion. Reduced mbp expression in notch3 mutant embryos is associated with fewer oligodendrocyte precursor cells (OPCs). Despite an early neurogenic phenotype, mbp expression recovered at later developmental stages and some notch3 homozygous mutants survived to adulthood. These mutants, as well as adult zebrafish carrying both mutant alleles together, displayed a striking stress-associated accumulation of blood in the head and fins. Histological analysis of mutant vessels revealed vasculopathy, including: an enlargement (dilation) of vessels in the telencephalon and fin, disorganization of the normal stereotyped arrangement of vessels in the fin, and an apparent loss of arterial morphological structure. Expression of hey1, a well-known transcriptional target of Notch signaling, was greatly reduced in notch3 mutant fins, suggesting that Notch3 acts via a canonical Notch signaling pathway to promote normal vessel structure. Ultrastructural analysis confirmed the presence of dilated vessels in notch3 mutant fins and revealed that the vessel walls of presumed arteries showed signs of deterioration. Gaps in the arterial wall and the presence of blood cells outside of vessels in mutants indicated that compromised vessel structure led to hemorrhage. In notch3 heterozygotes, we found elevated expression of both notch3 itself and target genes, indicating that specific alterations in gene expression due to partial loss of Notch3 function might contribute to the abnormalities observed in heterozygous larvae and adults. Our analysis of zebrafish notch3 mutants indicates that Notch3 regulates OPC development and mbp gene expression in larvae, and maintains vascular integrity in adults. PMID:23720232
Hayashi, J; Nishikawa, K; Hirano, R; Noguchi, T; Yoshimura, F
2000-01-01
Porphyromonas gingivalis, a periodontopathogen, is an oral anaerobic gram-negative bacterium with numerous fimbriae on the cell surface. Fimbriae have been considered to be an important virulence factor in this organism. We analyzed the genomic DNA of transposon-induced, fimbria-deficient mutants derived from ATCC 33277 and found that seven independent mutants had transposon insertions within the same restriction fragment. Cloning and sequencing of the disrupted region from one of the mutants revealed two adjacent open reading frames (ORFs) which seemed to encode a two-component signal transduction system. We also found that six of the mutants had insertions in a gene, fimS, a homologue of the genes encoding sensor kinase, and that the insertion in the remaining one disrupted the gene immediately downstream, fimR, a homologue of the response regulator genes in other bacteria. These findings suggest that this two-component regulatory system is involved in fimbriation of P. gingivalis.
The clock gene Period1 regulates innate routine behaviour in mice
Bechstein, Philipp; Rehbach, Nils-Jörn; Yuhasingham, Gowzekan; Schürmann, Christoph; Göpfert, Melanie; Kössl, Manfred; Maronde, Erik
2014-01-01
Laboratory mice are well capable of performing innate routine behaviour programmes necessary for courtship, nest-building and exploratory activities although housed for decades in animal facilities. We found that in mice inactivation of the clock gene Period1 profoundly changes innate routine behaviour programmes like those necessary for courtship, nest building, exploration and learning. These results in wild-type and Period1 mutant mice, together with earlier findings on courtship behaviour in wild-type and period-mutant Drosophila melanogaster, suggest a conserved role of Period-genes on innate routine behaviour. Additionally, both per-mutant flies and Period1-mutant mice display spatial learning and memory deficits. The profound influence of Period1 on routine behaviour programmes in mice, including female partner choice, may be independent of its function as a circadian clock gene, since Period1-deficient mice display normal circadian behaviour. PMID:24598427
The clock gene Period1 regulates innate routine behaviour in mice.
Bechstein, Philipp; Rehbach, Nils-Jörn; Yuhasingham, Gowzekan; Schürmann, Christoph; Göpfert, Melanie; Kössl, Manfred; Maronde, Erik
2014-04-22
Laboratory mice are well capable of performing innate routine behaviour programmes necessary for courtship, nest-building and exploratory activities although housed for decades in animal facilities. We found that in mice inactivation of the clock gene Period1 profoundly changes innate routine behaviour programmes like those necessary for courtship, nest building, exploration and learning. These results in wild-type and Period1 mutant mice, together with earlier findings on courtship behaviour in wild-type and period-mutant Drosophila melanogaster, suggest a conserved role of Period-genes on innate routine behaviour. Additionally, both per-mutant flies and Period1-mutant mice display spatial learning and memory deficits. The profound influence of Period1 on routine behaviour programmes in mice, including female partner choice, may be independent of its function as a circadian clock gene, since Period1-deficient mice display normal circadian behaviour.
Genes and signaling pathways involved in memory enhancement in mutant mice
2014-01-01
Mutant mice have been used successfully as a tool for investigating the mechanisms of memory at multiple levels, from genes to behavior. In most cases, manipulating a gene expressed in the brain impairs cognitive functions such as memory and their underlying cellular mechanisms, including synaptic plasticity. However, a remarkable number of mutations have been shown to enhance memory in mice. Understanding how to improve a system provides valuable insights into how the system works under normal conditions, because this involves understanding what the crucial components are. Therefore, more can be learned about the basic mechanisms of memory by studying mutant mice with enhanced memory. This review will summarize the genes and signaling pathways that are altered in the mutants with enhanced memory, as well as their roles in synaptic plasticity. Finally, I will discuss how knowledge of memory-enhancing mechanisms could be used to develop treatments for cognitive disorders associated with impaired plasticity. PMID:24894914
Donnini, C; Lodi, T; Ferrero, I; Puglisi, P P
1992-02-01
The IMP2 gene of Saccharomyces cerevisiae is involved in the nucleo-mitochondrial control of maltose, galactose and raffinose utilization as shown by the inability of imp2 mutants to grow on these carbon sources in respiratory-deficient conditions or in the presence of ethidium bromide and erythromycin. The negative phenotype cannot be scored in the presence of inhibitors of respiration and oxidative phosphorylation, indicating that the role of the mitochondria in the utilization of the above-mentioned carbon sources in imp2 mutants is not at the energetical level. Mutations in the IMP2 gene also confer many phenotypic alterations in respiratory-sufficient conditions, e.g. leaky phenotype on oxidizable carbon sources, sensitivity to heat shock and sporulation deficiency. The IMP2 gene has been cloned, sequenced and disrupted. The phenotype of null imp2 mutants is indistinguishable from that of the originally isolated mutant.
Sources of Variation in Sweat Chloride Measurements in Cystic Fibrosis.
Collaco, Joseph M; Blackman, Scott M; Raraigh, Karen S; Corvol, Harriet; Rommens, Johanna M; Pace, Rhonda G; Boelle, Pierre-Yves; McGready, John; Sosnay, Patrick R; Strug, Lisa J; Knowles, Michael R; Cutting, Garry R
2016-12-01
Expanding the use of cystic fibrosis transmembrane conductance regulator (CFTR) potentiators and correctors for the treatment of cystic fibrosis (CF) requires precise and accurate biomarkers. Sweat chloride concentration provides an in vivo assessment of CFTR function, but it is unknown the degree to which CFTR mutations account for sweat chloride variation. To estimate potential sources of variation for sweat chloride measurements, including demographic factors, testing variability, recording biases, and CFTR genotype itself. A total of 2,639 sweat chloride measurements were obtained in 1,761 twins/siblings from the CF Twin-Sibling Study, French CF Modifier Gene Study, and Canadian Consortium for Genetic Studies. Variance component estimation was performed by nested mixed modeling. Across the tested CF population as a whole, CFTR gene mutations were found to be the primary determinant of sweat chloride variability (56.1% of variation) with contributions from variation over time (e.g., factors related to testing on different days; 13.8%), environmental factors (e.g., climate, family diet; 13.5%), other residual factors (e.g., test variability; 9.9%), and unique individual factors (e.g., modifier genes, unique exposures; 6.8%) (likelihood ratio test, P < 0.001). Twin analysis suggested that modifier genes did not play a significant role because the heritability estimate was negligible (H 2 = 0; 95% confidence interval, 0.0-0.35). For an individual with CF, variation in sweat chloride was primarily caused by variation over time (58.1%) with the remainder attributable to residual/random factors (41.9%). Variation in the CFTR gene is the predominant cause of sweat chloride variation; most of the non-CFTR variation is caused by testing variability and unique environmental factors. If test precision and accuracy can be improved, sweat chloride measurement could be a valuable biomarker for assessing response to therapies directed at mutant CFTR.
Sources of Variation in Sweat Chloride Measurements in Cystic Fibrosis
Blackman, Scott M.; Raraigh, Karen S.; Corvol, Harriet; Rommens, Johanna M.; Pace, Rhonda G.; Boelle, Pierre-Yves; McGready, John; Sosnay, Patrick R.; Strug, Lisa J.; Knowles, Michael R.; Cutting, Garry R.
2016-01-01
Rationale: Expanding the use of cystic fibrosis transmembrane conductance regulator (CFTR) potentiators and correctors for the treatment of cystic fibrosis (CF) requires precise and accurate biomarkers. Sweat chloride concentration provides an in vivo assessment of CFTR function, but it is unknown the degree to which CFTR mutations account for sweat chloride variation. Objectives: To estimate potential sources of variation for sweat chloride measurements, including demographic factors, testing variability, recording biases, and CFTR genotype itself. Methods: A total of 2,639 sweat chloride measurements were obtained in 1,761 twins/siblings from the CF Twin-Sibling Study, French CF Modifier Gene Study, and Canadian Consortium for Genetic Studies. Variance component estimation was performed by nested mixed modeling. Measurements and Main Results: Across the tested CF population as a whole, CFTR gene mutations were found to be the primary determinant of sweat chloride variability (56.1% of variation) with contributions from variation over time (e.g., factors related to testing on different days; 13.8%), environmental factors (e.g., climate, family diet; 13.5%), other residual factors (e.g., test variability; 9.9%), and unique individual factors (e.g., modifier genes, unique exposures; 6.8%) (likelihood ratio test, P < 0.001). Twin analysis suggested that modifier genes did not play a significant role because the heritability estimate was negligible (H2 = 0; 95% confidence interval, 0.0–0.35). For an individual with CF, variation in sweat chloride was primarily caused by variation over time (58.1%) with the remainder attributable to residual/random factors (41.9%). Conclusions: Variation in the CFTR gene is the predominant cause of sweat chloride variation; most of the non-CFTR variation is caused by testing variability and unique environmental factors. If test precision and accuracy can be improved, sweat chloride measurement could be a valuable biomarker for assessing response to therapies directed at mutant CFTR. PMID:27258095
Kaurilind, Eve; Brosché, Mikael
2017-01-01
Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.
AmyR Is a Novel Negative Regulator of Amylovoran Production in Erwinia amylovora
Wang, Dongping; Korban, Schuyler S.; Pusey, P. Lawrence; Zhao, Youfu
2012-01-01
In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora. PMID:23028751
AmyR is a novel negative regulator of amylovoran production in Erwinia amylovora.
Wang, Dongping; Korban, Schuyler S; Pusey, P Lawrence; Zhao, Youfu
2012-01-01
In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora.
Poyatos-Pertíñez, Sandra; Quinet, Muriel; Ortíz-Atienza, Ana; Bretones, Sandra; Yuste-Lisbona, Fernando J; Lozano, Rafael
2016-09-01
Genetic interactions of UFD gene support its specific function during reproductive development of tomato; in this process, UFD could play a pivotal role between inflorescence architecture and flower initiation genes. Tomato (Solanum lycopersicum L.) is a major vegetable crop that also constitutes a model species for the study of plant developmental processes. To gain insight into the control of flowering and floral development, a novel tomato mutant, unfinished flower development (ufd), whose inflorescence and flowers were unable to complete their normal development was characterized using double mutant and gene expression analyses. Genetic interactions of ufd with mutations affecting inflorescence fate (uniflora, jointless and single flower truss) were additive and resulted in double mutants displaying the inflorescence structure of the non-ufd parental mutant and the flower phenotype of the ufd mutant. In addition, ufd mutation promotes an earlier inflorescence meristem termination. Taken together, both results indicated that UFD is not involved in the maintenance of inflorescence meristem identity, although it could participate in the regulatory system that modulates the rate of meristem maturation. Regarding the floral meristem identity, the falsiflora mutation was epistatic to the ufd mutation even though FALSIFLORA was upregulated in ufd inflorescences. In terms of floral organ identity, the ufd mutation was epistatic to macrocalyx, and MACROCALYX expression was differently regulated depending on the inflorescence developmental stage. These results suggest that the UFD gene may play a pivotal role between the genes required for flowering initiation and inflorescence development (such as UNIFLORA, FALSIFLORA, JOINTLESS and SINGLE FLOWER TRUSS) and those required for further floral organ development such as the floral organ identity genes.
Ito, M; Jameson, J L; Ito, M
1997-01-01
Mutations in the arginine vasopressin (AVP) gene cause autosomal dominant familial neurohypophyseal diabetes insipidus (FNDI). The dominant inheritance pattern has been postulated to reflect neuronal toxicity of the mutant proteins, but the mechanism for such cytotoxicity is unknown. In this study, wild-type or several different mutant AVP genes were stably expressed in neuro2A neuroblastoma cells. When cells were treated with valproic acid to induce neuronal differentiation, each of the mutants caused reduced viability. Metabolic labeling revealed diminished intracellular trafficking of mutant AVP precursors and confirmed inefficient secretion of immunoreactive AVP. Immunofluorescence studies demonstrated marked accumulation of mutant AVP precursors within the endoplasmic reticulum. These studies suggest that the cellular toxicity in FNDI may be caused by the intracellular accumulation of mutant precursor proteins. PMID:9109434
Henderson, Morgan L; Kreuzer, Kenneth N
2015-01-01
Expression of mutant EcoRII methyltransferase protein (M.EcoRII-C186A) in Escherichia coli leads to tightly bound DNA-protein complexes (TBCs), located sporadically on the chromosome rather than in tandem arrays. The mechanisms behind the lethality induced by such sporadic TBCs are not well studied, nor is it clear whether very tight binding but non-covalent complexes are processed in the same way as covalent DNA-protein crosslinks (DPCs). Using 2D gel electrophoresis, we found that TBCs induced by M.EcoRII-C186A block replication forks in vivo. Specific bubble molecules were detected as spots on the 2D gel, only when M.EcoRII-C186A was induced, and a mutation that eliminates a specific EcoRII methylation site led to disappearance of the corresponding spot. We also performed a candidate gene screen for mutants that are hypersensitive to TBCs induced by M.EcoRII-C186A. We found several gene products necessary for protection against these TBCs that are known to also protect against DPCs induced with wild-type M.EcoRII (after 5-azacytidine incorporation): RecA, RecBC, RecG, RuvABC, UvrD, FtsK, XerCD and SsrA (tmRNA). In contrast, the RecFOR pathway and Rep helicase are needed for protection against TBCs but not DPCs induced by M.EcoRII. We propose that stalled fork processing by RecFOR and RecA promotes release of tightly bound (but non-covalent) blocking proteins, perhaps by licensing Rep helicase-driven dissociation of the blocking M.EcoRII-C186A. Our studies also argued against the involvement of several proteins that might be expected to protect against TBCs. We took the opportunity to directly compare the sensitivity of all tested mutants to two quinolone antibiotics, which target bacterial type II topoisomerases and induce a unique form of DPC. We uncovered rep, ftsK and xerCD as novel quinolone hypersensitive mutants, and also obtained evidence against the involvement of a number of functions that might be expected to protect against quinolones.
Minkenberg, Bastian; Xie, Kabin; Yang, Yinong
2017-02-01
The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 nuclease (Cas9) system depends on a guide RNA (gRNA) to specify its target. By efficiently co-expressing multiple gRNAs that target different genomic sites, the polycistronic tRNA-gRNA gene (PTG) strategy enables multiplex gene editing in the family of closely related mitogen-activated protein kinase (MPK) genes in Oryza sativa (rice). In this study, we identified MPK1 and MPK6 (Arabidopsis AtMPK6 and AtMPK4 orthologs, respectively) as essential genes for rice development by finding the preservation of MPK functional alleles and normal phenotypes in CRISPR-edited mutants. The true knock-out mutants of MPK1 were severely dwarfed and sterile, and homozygous mpk1 seeds from heterozygous parents were defective in embryo development. By contrast, heterozygous mpk6 mutant plants completely failed to produce homozygous mpk6 seeds. In addition, the functional importance of specific MPK features could be evaluated by characterizing CRISPR-induced allelic variation in the conserved kinase domain of MPK6. By simultaneously targeting between two and eight genomic sites in the closely related MPK genes, we demonstrated 45-86% frequency of biallelic mutations and the successful creation of single, double and quadruple gene mutants. Indels and fragment deletion were both stably inherited to the next generations, and transgene-free mutants of rice MPK genes were readily obtained via genetic segregation, thereby eliminating any positional effects of transgene insertions. Taken together, our study reveals the essentiality of MPK1 and MPK6 in rice development, and enables the functional discovery of previously inaccessible genes or domains with phenotypes masked by lethality or redundancy. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
[The inheritance of an ultra-dwarf plant mutant from upland cotton].
Chen, Xu-Sheng; DI, Jia-Chun; Xu, Nai-Yin; Xiao, Song-Hua; Liu, Jian-Guang
2007-04-01
The inheritance of an ultra-dwarf plant mutant from upland cotton (Gossypium hirsutum L.) was studied, which showed that the mutant was controlled by single recessive quality gene. This gene was denominated as du tentatively. No similar mutant has been found in upland cotton. The mutation could not normally flower and produce bolls under natural conditions, and its mature height was only 10.5 cm. When treated with exogenous GA3, it could normally flower and boll, and plant height could reach 57.8 cm finally.
Labandeira-Rey, Maria; Janowicz, Diane M; Blick, Robert J; Fortney, Kate R; Zwickl, Beth; Katz, Barry P; Spinola, Stanley M; Hansen, Eric J
2009-08-01
Haemophilus ducreyi 35000HP contains a homologue of the luxS gene, which encodes an enzyme that synthesizes autoinducer 2 (AI-2) in other gram-negative bacteria. H. ducreyi 35000HP produced AI-2 that functioned in a Vibrio harveyi-based reporter system. A H. ducreyi luxS mutant was constructed by insertional inactivation of the luxS gene and lost the ability to produce AI-2. Provision of the H. ducreyi luxS gene in trans partially restored AI-2 production by the mutant. The luxS mutant was compared with its parent for virulence in the human challenge model of experimental chancroid. The pustule-formation rate in 5 volunteers was 93.3% (95% confidence interval, 81.7%-99.9%) at 15 parent sites and 60.0% (95% confidence interval, 48.3%-71.7%) at 15 mutant sites (1-tailed P < .001). Thus, the luxS mutant was partially attenuated for virulence. This is the first report of AI-2 production contributing to the pathogenesis of a genital ulcer disease.
Killiny, N; Martinez, R Hernandez; Dumenyo, C Korsi; Cooksey, D A; Almeida, R P P
2013-09-01
Exopolysaccharides (EPS) synthesized by plant-pathogenic bacteria are generally essential for virulence. The role of EPS produced by the vector-transmitted bacterium Xylella fastidiosa was investigated by knocking out two genes implicated in the EPS biosynthesis, gumD and gumH. Mutant strains were affected in growth characteristics in vitro, including adhesion to surfaces and biofilm formation. In addition, different assays were used to demonstrate that the mutant strains produced significantly less EPS compared with the wild type. Furthermore, gas chromatography-mass spectrometry showed that both mutant strains did not produce oligosaccharides. Biologically, the mutants were deficient in movement within plants, resulting in an avirulent phenotype. Additionally, mutant strains were affected in transmission by insects: they were very poorly transmitted by and retained within vectors. The gene expression profile indicated upregulation of genes implicated in cell-to-cell signaling and adhesins while downregulation in genes was required for within-plant movement in EPS-deficient strains. These results suggest an essential role for EPS in X. fastidiosa interactions with both plants and insects.
Chatterjee, Ranjini; Millard, Cynthia Sanville; Champion, Kathleen; Clark, David P.; Donnelly, Mark I.
2001-01-01
Escherichia coli NZN111 is blocked in the ability to grow fermentatively on glucose but gave rise spontaneously to a mutant that had this ability. The mutant carries out a balanced fermentation of glucose to give approximately 1 mol of succinate, 0.5 mol of acetate, and 0.5 mol of ethanol per mol of glucose. The causative mutation was mapped to the ptsG gene, which encodes the membrane-bound, glucose-specific permease of the phosphotransferase system, protein EIICBglc. Replacement of the chromosomal ptsG gene with an insertionally inactivated form also restored growth on glucose and resulted in the same distribution of fermentation products. The physiological characteristics of the spontaneous and null mutants were consistent with loss of function of the ptsG gene product; the mutants possessed greatly reduced glucose phosphotransferase activity and lacked normal glucose repression. Introduction of the null mutant into strains not blocked in the ability to ferment glucose also increased succinate production in those strains. This phenomenon was widespread, occurring in different lineages of E. coli, including E. coli B. PMID:11133439
Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth
2016-04-16
Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p<0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434 (inlB), lmo0263 (inlH), lmo0543, lmo0057 (EsaA), lmo2563, lmo0453), caused enhanced biofilm formation in the bacterium at 15 °C. The remaining mutants harbored interruptions in 10 genetic loci previously associated with biofilm formation at higher temperatures, indicating some temperature driven differences in the formation of biofilm by L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
Srinivasan, Karpagam; Leone, Dino P; Bateson, Rosalie K; Dobreva, Gergana; Kohwi, Yoshinori; Kohwi-Shigematsu, Terumi; Grosschedl, Rudolf; McConnell, Susan K
2012-11-20
Neurons within each layer in the mammalian cortex have stereotypic projections. Four genes-Fezf2, Ctip2, Tbr1, and Satb2-regulate these projection identities. These genes also interact with each other, and it is unclear how these interactions shape the final projection identity. Here we show, by generating double mutants of Fezf2, Ctip2, and Satb2, that cortical neurons deploy a complex genetic switch that uses mutual repression to produce subcortical or callosal projections. We discovered that Tbr1, EphA4, and Unc5H3 are critical downstream targets of Satb2 in callosal fate specification. This represents a unique role for Tbr1, implicated previously in specifying corticothalamic projections. We further show that Tbr1 expression is dually regulated by Satb2 and Ctip2 in layers 2-5. Finally, we show that Satb2 and Fezf2 regulate two disease-related genes, Auts2 (Autistic Susceptibility Gene2) and Bhlhb5 (mutated in Hereditary Spastic Paraplegia), providing a molecular handle to investigate circuit disorders in neurodevelopmental diseases.
Functional Genomics Using the Saccharomyces cerevisiae Yeast Deletion Collections.
Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri
2016-09-01
Constructed by a consortium of 16 laboratories, the Saccharomyces genome-wide deletion collections have, for the past decade, provided a powerful, rapid, and inexpensive approach for functional profiling of the yeast genome. Loss-of-function deletion mutants were systematically created using a polymerase chain reaction (PCR)-based gene deletion strategy to generate a start-to-stop codon replacement of each open reading frame by homologous recombination. Each strain carries two molecular barcodes that serve as unique strain identifiers, enabling their growth to be analyzed in parallel and the fitness contribution of each gene to be quantitatively assessed by hybridization to high-density oligonucleotide arrays or through the use of next-generation sequencing technologies. Functional profiling of the deletion collections, using either strain-by-strain or parallel assays, provides an unbiased approach to systematically survey the yeast genome. The Saccharomyces yeast deletion collections have proved immensely powerful in contributing to the understanding of gene function, including functional relationships between genes and genetic pathways in response to diverse genetic and environmental perturbations. © 2016 Cold Spring Harbor Laboratory Press.
Sun, Chongchong; Chen, Si; Jin, Yujian; Song, Hao; Ruan, Songlin; Fu, Zhengwei; Asad, Muhammad Asad Ullah; Qian, Haifeng
2016-06-08
Photosynthesis is a very important metabolic pathway for plant growth and crop yield. This report investigated the effect of the herbicide imazethapyr on photosynthesis in the Arabidopsis thaliana pnsB3 mutant (a defect in the NDH pathway) and pgr5 mutant (a defect in the PGR5 pathway) to determine which cyclic electron transport chain (CET) of the NDH and PGR5 pathways is more important for protecting the photosynthetic system under herbicide stress. The results showed that 20 μg/L imazethapyr markedly inhibited the growth of the three ecotypes of A. thaliana and produced more anthocyanins and reactive oxygen species (ROS), particularly in the pgr5 mutant. The chlorophyll fluorescence results showed that PSII was severely damaged in the pgr5 mutant. Additionally, the CET was significantly stimulated to protect the photosynthetic system from light damage in Wt and the pnsB3 mutant but not the pgr5 mutant. The real-time PCR analysis indicated that imazethapyr treatment considerably decreased the transcript levels of most photosynthesis-related genes in the three treated groups. Several genes in the PGR5 pathway were significantly induced in the pnsB3 mutant, but no genes in the NDH pathway were induced in the pgr5 mutant. The gene transcription analysis showed that the pgr5 mutant cannot compensate for the deficit in the PGR5 pathway by stimulating the NDH pathway, whereas the pnsB3 mutant can compensate for the deficit in the CET cycle by regulating the PGR5 pathway. The iTRAQ analyses also showed that the photosynthesis system, glycolysis, and TCA cycle suffered the most severe damage in the pgr5 mutant. All of these results showed that the PGR5 pathway is more critical for electron transfer around PSI than the NDH pathway to resist herbicide stress.
Kück, Ulrich
2005-10-01
Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.
Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Hualan; Price, Morgan N.; Waters, Robert Jordan
Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach for discovering the functions of bacterial genes. However, the development of a suitable TnSeq strategy for a given bacterium can be costly and time-consuming. To meet this challenge, we describe a part-based strategy for constructing libraries of hundreds of transposon delivery vectors, which we term “magic pools.” Within a magic pool, each transposon vector has a different combination of upstream sequences (promoters and ribosome binding sites) and antibiotic resistance markers as well as a random DNA barcode sequence, which allows the tracking of each vector during mutagenesis experiments. Tomore » identify an efficient vector for a given bacterium, we mutagenize it with a magic pool and sequence the resulting insertions; we then use this efficient vector to generate a large mutant library. We used the magic pool strategy to construct transposon mutant libraries in five genera of bacteria, including three genera of the phylumBacteroidetes. IMPORTANCEMolecular genetics is indispensable for interrogating the physiology of bacteria. However, the development of a functional genetic system for any given bacterium can be time-consuming. Here, we present a streamlined approach for identifying an effective transposon mutagenesis system for a new bacterium. Our strategy first involves the construction of hundreds of different transposon vector variants, which we term a “magic pool.” The efficacy of each vector in a magic pool is monitored in parallel using a unique DNA barcode that is introduced into each vector design. Using archived DNA “parts,” we next reassemble an effective vector for making a whole-genome transposon mutant library that is suitable for large-scale interrogation of gene function using competitive growth assays. Here, we demonstrate the utility of the magic pool system to make mutant libraries in five genera of bacteria.« less
Magic Pools: Parallel Assessment of Transposon Delivery Vectors in Bacteria
Liu, Hualan; Price, Morgan N.; Waters, Robert Jordan; ...
2018-01-16
Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach for discovering the functions of bacterial genes. However, the development of a suitable TnSeq strategy for a given bacterium can be costly and time-consuming. To meet this challenge, we describe a part-based strategy for constructing libraries of hundreds of transposon delivery vectors, which we term “magic pools.” Within a magic pool, each transposon vector has a different combination of upstream sequences (promoters and ribosome binding sites) and antibiotic resistance markers as well as a random DNA barcode sequence, which allows the tracking of each vector during mutagenesis experiments. Tomore » identify an efficient vector for a given bacterium, we mutagenize it with a magic pool and sequence the resulting insertions; we then use this efficient vector to generate a large mutant library. We used the magic pool strategy to construct transposon mutant libraries in five genera of bacteria, including three genera of the phylumBacteroidetes. IMPORTANCEMolecular genetics is indispensable for interrogating the physiology of bacteria. However, the development of a functional genetic system for any given bacterium can be time-consuming. Here, we present a streamlined approach for identifying an effective transposon mutagenesis system for a new bacterium. Our strategy first involves the construction of hundreds of different transposon vector variants, which we term a “magic pool.” The efficacy of each vector in a magic pool is monitored in parallel using a unique DNA barcode that is introduced into each vector design. Using archived DNA “parts,” we next reassemble an effective vector for making a whole-genome transposon mutant library that is suitable for large-scale interrogation of gene function using competitive growth assays. Here, we demonstrate the utility of the magic pool system to make mutant libraries in five genera of bacteria.« less
2011-01-01
Background Cellulase and hemicellulase genes in the fungus Trichoderma reesei are repressed by glucose and induced by lactose. Regulation of the cellulase genes is mediated by the repressor CRE1 and the activator XYR1. T. reesei strain Rut-C30 is a hypercellulolytic mutant, obtained from the natural strain QM6a, that has a truncated version of the catabolite repressor gene, cre1. It has been previously shown that bacterial mutants lacking phosphoglucose isomerase (PGI) produce more nucleotide precursors and amino acids. PGI catalyzes the second step of glycolysis, the formation of fructose-6-P from glucose-6-P. Results We deleted the gene pgi1, encoding PGI, in the T. reesei strain Rut-C30 and we introduced the cre1 gene in a Δpgi1 mutant. Both Δpgi1 and cre1+Δpgi1 mutants showed a pellet-like and growth as well as morphological alterations compared with Rut-C30. None of the mutants grew in media with fructose, galactose, xylose, glycerol or lactose but they grew in media with glucose, with fructose and glucose, with galactose and fructose or with lactose and fructose. No growth was observed in media with xylose and glucose. On glucose, Δpgi1 and cre1+Δpgi1 mutants showed higher cellulase activity than Rut-C30 and QM6a, respectively. But in media with lactose, none of the mutants improved the production of the reference strains. The increase in the activity did not correlate with the expression of mRNA of the xylanase regulator gene, xyr1. Δpgi1 mutants were also affected in the extracellular β-galactosidase activity. Levels of mRNA of the glucose 6-phosphate dehydrogenase did not increase in Δpgi1 during growth on glucose. Conclusions The ability to grow in media with glucose as the sole carbon source indicated that Trichoderma Δpgi1 mutants were able to use the pentose phosphate pathway. But, they did not increase the expression of gpdh. Morphological characteristics were the result of the pgi1 deletion. Deletion of pgi1 in Rut-C30 increased cellulase production, but only under repressing conditions. This increase resulted partly from the deletion itself and partly from a genetic interaction with the cre1-1 mutation. The lower cellulase activity of these mutants in media with lactose could be attributed to a reduced ability to hydrolyse this sugar but not to an effect on the expression of xyr1. PMID:21609467
Choi, M; Kadara, H; Zhang, J; Parra, E R; Rodriguez-Canales, J; Gaffney, S G; Zhao, Z; Behrens, C; Fujimoto, J; Chow, C; Kim, K; Kalhor, N; Moran, C; Rimm, D; Swisher, S; Gibbons, D L; Heymach, J; Kaftan, E; Townsend, J P; Lynch, T J; Schlessinger, J; Lee, J; Lifton, R P; Herbst, R S; Wistuba, I I
2017-01-01
Lung squamous cell carcinoma (LUSC) accounts for 20–30% of non-small cell lung cancers (NSCLCs). There are limited treatment strategies for LUSC in part due to our inadequate understanding of the molecular underpinnings of the disease. We performed whole-exome sequencing (WES) and comprehensive immune profiling of a unique set of clinically annotated early-stage LUSCs to increase our understanding of the pathobiology of this malignancy. Matched pairs of surgically resected stage I-III LUSCs and normal lung tissues (n = 108) were analyzed by WES. Immunohistochemistry and image analysis-based profiling of 10 immune markers were done on a subset of LUSCs (n = 91). Associations among mutations, immune markers and clinicopathological variables were statistically examined using analysis of variance and Fisher’s exact test. Cox proportional hazards regression models were used for statistical analysis of clinical outcome. This early-stage LUSC cohort displayed an average of 209 exonic mutations per tumor. Fourteen genes exhibited significant enrichment for somatic mutation: TP53, MLL2, PIK3CA, NFE2L2, CDH8, KEAP1, PTEN, ADCY8, PTPRT, CALCR, GRM8, FBXW7, RB1 and CDKN2A. Among mutated genes associated with poor recurrence-free survival, MLL2 mutations predicted poor prognosis in both TP53 mutant and wild-type LUSCs. We also found that in treated patients, FBXW7 and KEAP1 mutations were associated with poor response to adjuvant therapy, particularly in TP53-mutant tumors. Analysis of mutations with immune markers revealed that ADCY8 and PIK3CA mutations were associated with markedly decreased tumoral PD-L1 expression, LUSCs with PIK3CA mutations exhibited elevated CD45ro levels and CDKN2A-mutant tumors displayed an up-regulated immune response. Our findings pinpoint mutated genes that may impact clinical outcome as well as personalized strategies for targeted immunotherapies in early-stage LUSC.
Sanchez, Belkys C; Chang, Chungyu; Wu, Chenggang; Tran, Bryan; Ton-That, Hung
2017-06-20
The Gram-positive actinobacteria Actinomyces spp. are key colonizers in the development of oral biofilms due to the inherent ability of Actinomyces to adhere to receptor polysaccharides on the surface of oral streptococci and host cells. This receptor-dependent bacterial interaction, or coaggregation, requires a unique sortase-catalyzed pilus consisting of the pilus shaft FimA and the coaggregation factor CafA forming the pilus tip. While the essential role of the sortase machine SrtC2 in pilus assembly, biofilm formation, and coaggregation has been established, little is known about trans -acting factors contributing to these processes. We report here a large-scale Tn 5 transposon screen for mutants defective in Actinomyces oris coaggregation with Streptococcus oralis We obtained 33 independent clones, 13 of which completely failed to aggregate with S. oralis , and the remainder of which exhibited a range of phenotypes from severely to weakly defective coaggregation. The former had Tn 5 insertions in fimA , cafA , or srtC2 , as expected; the latter were mapped to genes coding for uncharacterized proteins and various nuo genes encoding the NADH dehydrogenase subunits. Electron microscopy and biochemical analyses of mutants with nonpolar deletions of nuo genes and ubiE , a menaquinone C-methyltransferase-encoding gene downstream of the nuo locus, confirmed the pilus and coaggregation defects. Both nuoA and ubiE mutants were defective in oxidation of MdbA, the major oxidoreductase required for oxidative folding of pilus proteins. Furthermore, supplementation of the ubiE mutant with exogenous menaquinone-4 rescued the cell growth and pilus defects. Altogether, we propose that the A. oris electron transport chain is biochemically linked to pilus assembly via oxidative protein folding. IMPORTANCE The Gram-positive actinobacterium A. oris expresses adhesive pili, or fimbriae, that are essential to biofilm formation and Actinomyces interactions with other bacteria, termed coaggregation. While the critical role of the conserved sortase machine in pilus assembly and the disulfide bond-forming catalyst MdbA in oxidative folding of pilins has been established, little is known about other trans -acting factors involved in these processes. Using a Tn 5 transposon screen for mutants defective in coaggregation with Streptococcus oralis , we found that genetic disruption of the NADH dehydrogenase and menaquinone biosynthesis detrimentally alters pilus assembly. Further biochemical characterizations determined that menaquinone is important for reactivation of MdbA. This study supports the notion that the electron transport chain is biochemically linked to pilus assembly in A. oris via oxidative folding of pilin precursors. Copyright © 2017 Sanchez et al.
Shimoda, Yoshikazu; Mitsui, Hisayuki; Kamimatsuse, Hiroko; Minamisawa, Kiwamu; Nishiyama, Eri; Ohtsubo, Yoshiyuki; Nagata, Yuji; Tsuda, Masataka; Shinpo, Sayaka; Watanabe, Akiko; Kohara, Mitsuyo; Yamada, Manabu; Nakamura, Yasukazu; Tabata, Satoshi; Sato, Shusei
2008-01-01
Rhizobia are nitrogen-fixing soil bacteria that establish endosymbiosis with some leguminous plants. The completion of several rhizobial genome sequences provides opportunities for genome-wide functional studies of the physiological roles of many rhizobial genes. In order to carry out genome-wide phenotypic screenings, we have constructed a large mutant library of the nitrogen-fixing symbiotic bacterium, Mesorhizobium loti, by transposon mutagenesis. Transposon insertion mutants were generated using the signature-tagged mutagenesis (STM) technique and a total of 29 330 independent mutants were obtained. Along with the collection of transposon mutants, we have determined the transposon insertion sites for 7892 clones, and confirmed insertions in 3680 non-redundant M. loti genes (50.5% of the total number of M. loti genes). Transposon insertions were randomly distributed throughout the M. loti genome without any bias toward G+C contents of insertion target sites and transposon plasmids used for the mutagenesis. We also show the utility of STM mutants by examining the specificity of signature tags and test screenings for growth- and nodulation-deficient mutants. This defined mutant library allows for genome-wide forward- and reverse-genetic functional studies of M. loti and will serve as an invaluable resource for researchers to further our understanding of rhizobial biology. PMID:18658183
Lewis, Derrick L.; Notey, Jaspreet S.; Chandrayan, Sanjeev K.; ...
2014-12-04
In this paper, a mutant (‘lab strain’) of the hyperthermophilic archaeon Pyrococcus furiosus DSM3638 exhibited an extended exponential phase and atypical cell aggregation behavior. Genomic DNA from the mutant culture was sequenced and compared to wild-type (WT) DSM3638, revealing 145 genes with one or more insertions, deletions, or substitutions (12 silent, 33 amino acid substitutions, and 100 frame shifts). Approximately, half of the mutated genes were transposases or hypothetical proteins. The WT transcriptome revealed numerous changes in amino acid and pyrimidine biosynthesis pathways coincidental with growth phase transitions, unlike the mutant whose transcriptome reflected the observed prolonged exponential phase. Targetedmore » gene deletions, based on frame-shifted ORFs in the mutant genome, in a genetically tractable strain of P. furiosus (COM1) could not generate the extended exponential phase behavior observed for the mutant. For example, a putative radical SAM family protein (PF2064) was the most highly up-regulated ORF (>25-fold) in the WT between exponential and stationary phase, although this ORF was unresponsive in the mutant; deletion of this gene in P. furiosus COM1 resulted in no apparent phenotype. On the other hand, frame-shifting mutations in the mutant genome negatively impacted transcription of a flagellar biosynthesis operon (PF0329-PF0338).Consequently, cells in the mutant culture lacked flagella and, unlike the WT, showed minimal evidence of exopolysaccharide-based cell aggregation in post-exponential phase. Finally, electron microscopy of PF0331-PF0337 deletions in P. furiosus COM1 showed that absence of flagella impacted normal cell aggregation behavior and, furthermore, indicated that flagella play a key role, beyond motility, in the growth physiology of P. furiosus.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lewis, Derrick L.; Notey, Jaspreet S.; Chandrayan, Sanjeev K.
In this paper, a mutant (‘lab strain’) of the hyperthermophilic archaeon Pyrococcus furiosus DSM3638 exhibited an extended exponential phase and atypical cell aggregation behavior. Genomic DNA from the mutant culture was sequenced and compared to wild-type (WT) DSM3638, revealing 145 genes with one or more insertions, deletions, or substitutions (12 silent, 33 amino acid substitutions, and 100 frame shifts). Approximately, half of the mutated genes were transposases or hypothetical proteins. The WT transcriptome revealed numerous changes in amino acid and pyrimidine biosynthesis pathways coincidental with growth phase transitions, unlike the mutant whose transcriptome reflected the observed prolonged exponential phase. Targetedmore » gene deletions, based on frame-shifted ORFs in the mutant genome, in a genetically tractable strain of P. furiosus (COM1) could not generate the extended exponential phase behavior observed for the mutant. For example, a putative radical SAM family protein (PF2064) was the most highly up-regulated ORF (>25-fold) in the WT between exponential and stationary phase, although this ORF was unresponsive in the mutant; deletion of this gene in P. furiosus COM1 resulted in no apparent phenotype. On the other hand, frame-shifting mutations in the mutant genome negatively impacted transcription of a flagellar biosynthesis operon (PF0329-PF0338).Consequently, cells in the mutant culture lacked flagella and, unlike the WT, showed minimal evidence of exopolysaccharide-based cell aggregation in post-exponential phase. Finally, electron microscopy of PF0331-PF0337 deletions in P. furiosus COM1 showed that absence of flagella impacted normal cell aggregation behavior and, furthermore, indicated that flagella play a key role, beyond motility, in the growth physiology of P. furiosus.« less
Potential complications when developing gene deletion clones in Xylella fastidiosa.
Johnson, Kameka L; Cursino, Luciana; Athinuwat, Dusit; Burr, Thomas J; Mowery, Patricia
2015-04-16
The Gram-negative xylem-limited bacterium, Xylella fastidiosa, is an important plant pathogen that infects a number of high value crops. The Temecula 1 strain infects grapevines and induces Pierce's disease, which causes symptoms such as scorching on leaves, cluster collapse, and eventual plant death. In order to understand the pathogenesis of X. fastidiosa, researchers routinely perform gene deletion studies and select mutants via antibiotic markers. Site-directed pilJ mutant of X. fastidiosa were generated and selected on antibiotic media. Mutant cultures were assessed by PCR to determine if they were composed of purely transformant cells or included mixtures of non-transformants cells. Then pure pilJ mutant and wildtype cells were mixed in PD2 medium and following incubation and exposure to kanamycin were assessed by PCR for presence of mutant and wildtype populations. We have discovered that when creating clones of targeted mutants of X. fastidiosa Temecula 1 with selection on antibiotic plates, X. fastidiosa lacking the gene deletion often persist in association with targeted mutant cells. We believe this phenomenon is due to spontaneous antibiotic resistance and/or X. fastidiosa characteristically forming aggregates that can be comprised of transformed and non-transformed cells. A combined population was confirmed by PCR, which showed that targeted mutant clones were mixed with non-transformed cells. After repeated transfer and storage the non-transformed cells became the dominant clone present. We have discovered that special precautions are warranted when developing a targeted gene mutation in X. fastidiosa because colonies that arise following transformation and selection are often comprised of transformed and non-transformed cells. Following transfer and storage the cells can consist primarily of the non-transformed strain. As a result, careful monitoring of targeted mutant strains must be performed to avoid mixed populations and confounding results.
Ma, Zheng; Luo, Shuai; Xu, Xianhao; Bechthold, Andreas; Yu, Xiaoping
2016-04-01
Modification of enzymes involved in transcription- or translation-processes is an interesting way to increase secondary metabolite production in Streptomycetes. However, application of such methods has not been widely described for strains which produce nucleoside antibiotics. The nucleoside antibiotic toyocamycin (TM) is produced by Streptomyces diastatochromogenes 1628. For improving TM production in S. diastatochromogenes 1628, the strain was spread on rifamycin-resistant (Rif(r)) medium. Several spontaneous mutants were obtained with mutations in the rpoB gene which encodes a RNA polymerase β-subunit. The mutants which showed increased TM production were detected at a frequency of 7.5 % among the total Rif(r) mutants. Mutant 1628-T15 harboring amino acid substitution His437Arg was the best TM producer with a 4.5-fold increase in comparison to that of the wild-type strain. The worst producer was mutant 1628-T62 which also showed a poor sporulation behavior. RT-PCR was performed to study the transcription levels of the TM biosynthetic gene toyG in the parental strain as well as in mutants 1628-T15 and 1628-T62. The transcriptional level of toyG was higher in mutant 1628-T15 than that in parental strain 1628, while much lower in mutant 1628-T62. In mutant strain 1628-T62 the expression of adpA sd gene, which is required for morphological differentiation, was also much lower. Our studies also indicate that the introduction of mutations into rpoB is an effective strategy to improve the production of TM which is an important nucleoside antibiotic.
Escherichia coli mutants impaired in maltodextrin transport.
Wandersman, C; Schwartz, M; Ferenci, T
1979-10-01
Wild-type Escherichia coli K-12 was found to grow equally well on maltose and on maltodextrins containing up to seven glucose residues. Three classes of mutants unable to grow on maltodextrins, but still able to grow on maltose, were investigated in detail. The first class, already known, was composed of phage lambda-resistant mutants, which lack the outer membrane protein coded by gene lamB. These mutants grow on maltose and maltotriose but not at all on maltotetraose and longer maltodextrins which cannot cross the outer membrane. A second class of mutants were affected in malE, the structural gene of the periplasmic maltose binding protein. The maltose binding proteins isolated from the new mutants were altered in their substrate binding properties, but not in a way that could account for the mutant phenotypes. Rather, the results of growth experiments and transport studies suggest that these malE mutants are impaired in their ability to transport maltodextrins across the outer membrane. This implies that the maltose binding protein (in wild-type strains) cooperates with the lambda receptor in permeation through the outer membrane. The last class of mutants described in this paper were affected in malG, or perhaps in an as yet undetected gene close to malG. They were defective in the transfer of maltodextrins from the periplasmic space to the cytoplasm but only slightly affected in the transport of maltose.
2011-01-01
Background The genome of Pseudomonas aeruginosa contains at least three genes encoding eukaryotic-type Ser/Thr protein kinases, one of which, ppkA, has been implicated in P. aeruginosa virulence. Together with the adjacent pppA phosphatase gene, they belong to the type VI secretion system (H1-T6SS) locus, which is important for bacterial pathogenesis. To determine the biological function of this protein pair, we prepared a pppA-ppkA double mutant and characterised its phenotype and transcriptomic profiles. Results Phenotypic studies revealed that the mutant grew slower than the wild-type strain in minimal media and exhibited reduced secretion of pyoverdine. In addition, the mutant had altered sensitivity to oxidative and hyperosmotic stress conditions. Consequently, mutant cells had an impaired ability to survive in murine macrophages and an attenuated virulence in the plant model of infection. Whole-genome transcriptome analysis revealed that pppA-ppkA deletion affects the expression of oxidative stress-responsive genes, stationary phase σ-factor RpoS-regulated genes, and quorum-sensing regulons. The transcriptome of the pppA-ppkA mutant was also analysed under conditions of oxidative stress and showed an impaired response to the stress, manifested by a weaker induction of stress adaptation genes as well as the genes of the SOS regulon. In addition, expression of either RpoS-regulated genes or quorum-sensing-dependent genes was also affected. Complementation analysis confirmed that the transcription levels of the differentially expressed genes were specifically restored when the pppA and ppkA genes were expressed ectopically. Conclusions Our results suggest that in addition to its crucial role in controlling the activity of P. aeruginosa H1-T6SS at the post-translational level, the PppA-PpkA pair also affects the transcription of stress-responsive genes. Based on these data, it is likely that the reduced virulence of the mutant strain results from an impaired ability to survive in the host due to the limited response to stress conditions. PMID:21880152
Liu, Zezhou; Fang, Zhiyuan; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Liu, Yumei; Li, Zhansheng; Sun, Peitian; Tang, Jun; Liu, Dongming; Zhang, Zhenxian; Yang, Limei
2017-01-01
Cuticular waxes covering the outer plant surface impart a whitish appearance. Wax-less cabbage mutant shows glossy in leaf surface and plays important roles in riching cabbage germplasm resources and breeding brilliant green cabbage. This is the first report describing the characterization and fine-mapping of a wax biosynthesis gene using a novel glossy Brassica oleracea mutant. In the present paper, we identified a glossy cabbage mutant (line10Q-961) with a brilliant green phenotype. Genetic analyses indicated that the glossy trait was controlled by a single recessive gene. Preliminary mapping results using an F2 population containing 189 recessive individuals revealed that the Cgl1 gene was located at the end of chromosome C08. Several new markers closely linked to the target gene were designed according to the cabbage reference genome sequence. Another population of 1,172 recessive F2 individuals was used to fine-map the Cgl1 gene to a 188.7-kb interval between the C08SSR61 simple sequence repeat marker and the end of chromosome C08. There were 33 genes located in this region. According to gene annotation and homology analyses, the Bol018504 gene, which is a homolog of CER1 in Arabidopsis thaliana, was the most likely candidate for the Cgl1 gene. Its coding and promoter regions were sequenced, which indicated that the RNA splice site was altered because of a 2,722-bp insertion in the first intron of Bol018504 in the glossy mutant. Based on the FGENESH 2.6 prediction and sequence alignments, the PLN02869 domain, which controls fatty aldehyde decarbonylase activity, was absent from the Bol018504 gene of the 10Q-961 glossy mutant. We inferred that the inserted sequence in Bol018504 may result in the glossy cabbage mutant. This study represents the first step toward the characterization of cuticular wax biosynthesis in B. oleracea, and may contribute to the breeding of new cabbage varieties exhibiting a brilliant green phenotype. PMID:28265282
Goldová, Jana; Ulrych, Aleš; Hercík, Kamil; Branny, Pavel
2011-08-31
The genome of Pseudomonas aeruginosa contains at least three genes encoding eukaryotic-type Ser/Thr protein kinases, one of which, ppkA, has been implicated in P. aeruginosa virulence. Together with the adjacent pppA phosphatase gene, they belong to the type VI secretion system (H1-T6SS) locus, which is important for bacterial pathogenesis. To determine the biological function of this protein pair, we prepared a pppA-ppkA double mutant and characterised its phenotype and transcriptomic profiles. Phenotypic studies revealed that the mutant grew slower than the wild-type strain in minimal media and exhibited reduced secretion of pyoverdine. In addition, the mutant had altered sensitivity to oxidative and hyperosmotic stress conditions. Consequently, mutant cells had an impaired ability to survive in murine macrophages and an attenuated virulence in the plant model of infection. Whole-genome transcriptome analysis revealed that pppA-ppkA deletion affects the expression of oxidative stress-responsive genes, stationary phase σ-factor RpoS-regulated genes, and quorum-sensing regulons. The transcriptome of the pppA-ppkA mutant was also analysed under conditions of oxidative stress and showed an impaired response to the stress, manifested by a weaker induction of stress adaptation genes as well as the genes of the SOS regulon. In addition, expression of either RpoS-regulated genes or quorum-sensing-dependent genes was also affected. Complementation analysis confirmed that the transcription levels of the differentially expressed genes were specifically restored when the pppA and ppkA genes were expressed ectopically. Our results suggest that in addition to its crucial role in controlling the activity of P. aeruginosa H1-T6SS at the post-translational level, the PppA-PpkA pair also affects the transcription of stress-responsive genes. Based on these data, it is likely that the reduced virulence of the mutant strain results from an impaired ability to survive in the host due to the limited response to stress conditions.
2010-01-01
Background The alteration of fatty acid profiles in soybean [Glycine max (L.) Merr.] to improve soybean oil quality is an important and evolving theme in soybean research to meet nutritional needs and industrial criteria in the modern market. Soybean oil with elevated oleic acid is desirable because this monounsaturated fatty acid improves the nutrition and oxidative stability of the oil. Commodity soybean oil typically contains 20% oleic acid and the target for high oleic acid soybean oil is approximately 80% of the oil; previous conventional plant breeding research to raise the oleic acid level to just 50-60% of the oil was hindered by the genetic complexity and environmental instability of the trait. The objective of this work was to create the high oleic acid trait in soybeans by identifying and combining mutations in two delta-twelve fatty acid desaturase genes, FAD2-1A and FAD2-1B. Results Three polymorphisms found in the FAD2-1B alleles of two soybean lines resulted in missense mutations. For each of the two soybean lines, there was one unique amino acid change within a highly conserved region of the protein. The mutant FAD2-1B alleles were associated with an increase in oleic acid levels, although the FAD2-1B mutant alleles alone were not capable of producing a high oleic acid phenotype. When existing FAD2-1A mutations were combined with the novel mutant FAD2-1B alleles, a high oleic acid phenotype was recovered only for those lines which were homozygous for both of the mutant alleles. Conclusions We were able to produce conventional soybean lines with 80% oleic acid in the oil in two different ways, each requiring the contribution of only two genes. The high oleic acid soybean germplasm developed contained a desirable fatty acid profile, and it was stable in two production environments. The presumed causative sequence polymorphisms in the FAD2-1B alleles were developed into highly efficient molecular markers for tracking the mutant alleles. The resources described here for the creation of high oleic acid soybeans provide a framework to efficiently develop soybean varieties to meet changing market demands. PMID:20828382
Pham, Anh-Tung; Lee, Jeong-Dong; Shannon, J Grover; Bilyeu, Kristin D
2010-09-09
The alteration of fatty acid profiles in soybean [Glycine max (L.) Merr.] to improve soybean oil quality is an important and evolving theme in soybean research to meet nutritional needs and industrial criteria in the modern market. Soybean oil with elevated oleic acid is desirable because this monounsaturated fatty acid improves the nutrition and oxidative stability of the oil. Commodity soybean oil typically contains 20% oleic acid and the target for high oleic acid soybean oil is approximately 80% of the oil; previous conventional plant breeding research to raise the oleic acid level to just 50-60% of the oil was hindered by the genetic complexity and environmental instability of the trait. The objective of this work was to create the high oleic acid trait in soybeans by identifying and combining mutations in two delta-twelve fatty acid desaturase genes, FAD2-1A and FAD2-1B. Three polymorphisms found in the FAD2-1B alleles of two soybean lines resulted in missense mutations. For each of the two soybean lines, there was one unique amino acid change within a highly conserved region of the protein. The mutant FAD2-1B alleles were associated with an increase in oleic acid levels, although the FAD2-1B mutant alleles alone were not capable of producing a high oleic acid phenotype. When existing FAD2-1A mutations were combined with the novel mutant FAD2-1B alleles, a high oleic acid phenotype was recovered only for those lines which were homozygous for both of the mutant alleles. We were able to produce conventional soybean lines with 80% oleic acid in the oil in two different ways, each requiring the contribution of only two genes. The high oleic acid soybean germplasm developed contained a desirable fatty acid profile, and it was stable in two production environments. The presumed causative sequence polymorphisms in the FAD2-1B alleles were developed into highly efficient molecular markers for tracking the mutant alleles. The resources described here for the creation of high oleic acid soybeans provide a framework to efficiently develop soybean varieties to meet changing market demands.
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Avivi, Yigal; Lev-Yadun, Simcha; Morozova, Nadya; Libs, Laurence; Williams, Leor; Zhao, Jing; Varghese, George; Grafi, Gideon
2000-01-01
Class I knox genes play an important role in shoot meristem function and are thus involved in the ordered development of stems, leaves, and reproductive organs. To elucidate the mechanism underlying the expression pattern of these homeobox genes, we studied a spontaneous tomato (Lycopersicon esculentum) mutant that phenotypically resembles, though is more extreme than, transgenic plants misexpressing class I knox genes. This mutant was found to carry a recessive allele, denoted clausa:shootyleaf (clau:shl)—a newly identified allele of clausa. Mutant plants exhibited abnormal leaf and flower morphology, epiphyllus inflorescences, fusion of organs, calyx asymmetry, and navel-like fruits. Analysis by scanning electron microscopy revealed that such fruits carried ectopic ovules, various vegetative primordia, as well as “forests” of stalked glandular trichomes. In situ RNA hybridization showed a peculiar expression pattern of the class I knox gene LeT6/TKn2; expression was restricted to the vascular system and palisade layer of mature leaves and to the inner part of ovules integuments. We conclude that CLAUSA regulates various aspects of tomato plant development, at least partly, by rendering the LeT6/TKn2 gene silent in specific tissues during development. Considering the expression pattern of LeT6/TKn2 in the clausa mutant, we suggest that the control over a given homeobox gene is maintained by several different regulatory mechanisms, in a cell type-dependent manner. PMID:11027705
2009-01-01
Background Citrus canker is a disease caused by the phytopathogens Xanthomonas citri subsp. citri, Xanthomonas fuscans subsp. aurantifolli and Xanthomonas alfalfae subsp. citrumelonis. The first of the three species, which causes citrus bacterial canker type A, is the most widely spread and severe, attacking all citrus species. In Brazil, this species is the most important, being found in practically all areas where citrus canker has been detected. Like most phytobacterioses, there is no efficient way to control citrus canker. Considering the importance of the disease worldwide, investigation is needed to accurately detect which genes are related to the pathogen-host adaptation process and which are associated with pathogenesis. Results Through transposon insertion mutagenesis, 10,000 mutants of Xanthomonas citri subsp. citri strain 306 (Xcc) were obtained, and 3,300 were inoculated in Rangpur lime (Citrus limonia) leaves. Their ability to cause citrus canker was analyzed every 3 days until 21 days after inoculation; a set of 44 mutants showed altered virulence, with 8 presenting a complete loss of causing citrus canker symptoms. Sequencing of the insertion site in all 44 mutants revealed that 35 different ORFs were hit, since some ORFs were hit in more than one mutant, with mutants for the same ORF presenting the same phenotype. An analysis of these ORFs showed that some encoded genes were previously known as related to pathogenicity in phytobacteria and, more interestingly, revealed new genes never implicated with Xanthomonas pathogenicity before, including hypothetical ORFs. Among the 8 mutants with no canker symptoms are the hrpB4 and hrpX genes, two genes that belong to type III secretion system (TTSS), two hypothetical ORFS and, surprisingly, the htrA gene, a gene reported as involved with the virulence process in animal-pathogenic bacteria but not described as involved in phytobacteria virulence. Nucleic acid hybridization using labeled cDNA probes showed that some of the mutated genes are differentially expressed when the bacterium is grown in citrus leaves. Finally, comparative genomic analysis revealed that 5 mutated ORFs are in new putative pathogenicity islands. Conclusion The identification of these new genes related with Xcc infection and virulence is a great step towards the understanding of plant-pathogen interactions and could allow the development of strategies to control citrus canker. PMID:19149882
A Genetic Selection For Neurospora crassa Mutants Altered in Their Light Regulation of Transcription
Navarro-Sampedro, Laura; Yanofsky, Charles; Corrochano, Luis M.
2008-01-01
Transcription of the Neurospora crassa gene con-10 is induced during conidiation and following exposure of vegetative mycelia to light, but light activation is transient due to photoadaptation. We describe mutational analyses of photoadaptation using a N. crassa strain bearing a translational fusion of con-10, including its regulatory region, to a selectable bacterial gene conferring hygromycin resistance (hph). Growth of this strain was sensitive to hygromycin, upon continuous culture in the light. Five mutants were isolated that were resistant to hygromycin when cultured under constant light. Three mutant strains displayed elevated, sustained accumulation of con-10∷hph mRNA during continued light exposure, suggesting that they bear mutations that reduce or eliminate the presumed light-dependent repression mechanism that blocks con-10 transcription upon prolonged illumination. These mutations altered photoadaptation for only a specific group of genes (con-10 and con-6), suggesting that regulation of photoadaptation is relatively gene specific. The mutations increased light-dependent mRNA accumulation for genes al-1, al-2, and al-3, each required for carotenoid biosynthesis, resulting in a threefold increase in carotenoid accumulation following continuous light exposure. Identification of the altered gene or genes in these mutants may reveal novel proteins that participate in light regulation of gene transcription in fungi. PMID:18202366
An 'instant gene bank' method for gene cloning by mutant complementation.
Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J
1994-02-01
We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.
Gene Deletions in Mycobacterium bovis BCG Stimulate Increased CD8+ T Cell Responses
Panas, Michael W.; Sixsmith, Jaimie D.; White, KeriAnn; Korioth-Schmitz, Birgit; Shields, Shana T.; Moy, Brian T.; Lee, Sunhee; Schmitz, Joern E.; Jacobs, William R.; Porcelli, Steven A.; Haynes, Barton F.; Letvin, Norman L.
2014-01-01
Mycobacteria, the etiological agents of tuberculosis and leprosy, have coevolved with mammals for millions of years and have numerous ways of suppressing their host's immune response. It has been suggested that mycobacteria may contain genes that reduce the host's ability to elicit CD8+ T cell responses. We screened 3,290 mutant Mycobacterium bovis bacillus Calmette Guerin (BCG) strains to identify genes that decrease major histocompatibility complex (MHC) class I presentation of mycobacterium-encoded epitope peptides. Through our analysis, we identified 16 mutant BCG strains that generated increased transgene product-specific CD8+ T cell responses. The genes disrupted in these mutant strains had disparate predicted functions. Reconstruction of strains via targeted deletion of genes identified in the screen recapitulated the enhanced immunogenicity phenotype of the original mutant strains. When we introduced the simian immunodeficiency virus (SIV) gag gene into several of these novel BCG strains, we observed enhanced SIV Gag-specific CD8+ T cell responses in vivo. This study demonstrates that mycobacteria carry numerous genes that act to dampen CD8+ T cell responses and suggests that genetic modification of these genes may generate a novel group of recombinant BCG strains capable of serving as more effective and immunogenic vaccine vectors. PMID:25287928
Gene deletions in Mycobacterium bovis BCG stimulate increased CD8+ T cell responses.
Panas, Michael W; Sixsmith, Jaimie D; White, KeriAnn; Korioth-Schmitz, Birgit; Shields, Shana T; Moy, Brian T; Lee, Sunhee; Schmitz, Joern E; Jacobs, William R; Porcelli, Steven A; Haynes, Barton F; Letvin, Norman L; Gillard, Geoffrey O
2014-12-01
Mycobacteria, the etiological agents of tuberculosis and leprosy, have coevolved with mammals for millions of years and have numerous ways of suppressing their host's immune response. It has been suggested that mycobacteria may contain genes that reduce the host's ability to elicit CD8(+) T cell responses. We screened 3,290 mutant Mycobacterium bovis bacillus Calmette Guerin (BCG) strains to identify genes that decrease major histocompatibility complex (MHC) class I presentation of mycobacterium-encoded epitope peptides. Through our analysis, we identified 16 mutant BCG strains that generated increased transgene product-specific CD8(+) T cell responses. The genes disrupted in these mutant strains had disparate predicted functions. Reconstruction of strains via targeted deletion of genes identified in the screen recapitulated the enhanced immunogenicity phenotype of the original mutant strains. When we introduced the simian immunodeficiency virus (SIV) gag gene into several of these novel BCG strains, we observed enhanced SIV Gag-specific CD8(+) T cell responses in vivo. This study demonstrates that mycobacteria carry numerous genes that act to dampen CD8(+) T cell responses and suggests that genetic modification of these genes may generate a novel group of recombinant BCG strains capable of serving as more effective and immunogenic vaccine vectors. Copyright © 2014, American Society for Microbiology. All Rights Reserved.