Sample records for unique nuclear receptor

  1. Heterodimers of Retinoic Acid Receptors and Thyroid Hormone Receptors Display Unique Combinatorial Regulatory Properties

    PubMed Central

    Lee, Sangho; Privalsky, Martin L.

    2009-01-01

    Nuclear receptors are ligand-regulated transcription factors that regulate key aspects of metazoan development, differentiation, and homeostasis. Nuclear receptors recognize target genes by binding to specific DNA recognition sequences, denoted hormone response elements (HREs). Many nuclear receptors can recognize HREs as either homodimers or heterodimers. Retinoid X receptors (RXRs), in particular, serve as important heterodimer partners for many other nuclear receptors, including thyroid hormone receptors (TRs), and RXR/TR heterodimers have been proposed to be the primary mediators of target gene regulation by T3 hormone. Here, we report that the retinoic acid receptors (RARs), a distinct class of nuclear receptors, are also efficient heterodimer partners for TRs. These RAR/TR heterodimers form with similar affinities as RXR/TR heterodimers on an assortment of consensus and natural HREs, and preferentially assemble with the RAR partner 5′ of the TR moiety. The corepressor and coactivator recruitment properties of these RAR/TR heterodimers and their transcriptional activities in vivo are distinct from those observed with the corresponding RXR heterodimers. Our studies indicate that RXRs are not unique in their ability to partner with TRs, and that RARs can also serve as robust heterodimer partners and combinatorial regulators of T3-modulated gene expression. PMID:15650024

  2. Phospholipid Regulation of the Nuclear Receptor Superfamily

    PubMed Central

    Crowder, Mark K.; Seacrist, Corey D.; Blind, Raymond D.

    2016-01-01

    Nuclear receptors are ligand-activated transcription factors whose diverse biological functions are classically regulated by cholesterol-based small molecules. Over the past few decades, a growing body of evidence has demonstrated that phospholipids and other similar amphipathic molecules can also specifically bind and functionally regulate the activity of certain nuclear receptors, suggesting a critical role for these non-cholesterol-based molecules in transcriptional regulation. Phosphatidylcholines, phosphoinositides and sphingolipids are a few of the many phospholipid like molecules shown to quite specifically regulate nuclear receptors in mouse models, cell lines and in vitro. More recent evidence has also shown that certain nuclear receptors can “present” a bound phospholipid headgroup to key lipid signaling enzymes, which can then modify the phospholipid headgroup with very unique kinetic properties. Here, we review the broad array of phospholipid / nuclear receptor interactions, from the perspective of the chemical nature of the phospholipid, and the cellular abundance of the phospholipid. We also view the data in the light of well established paradigms for phospholipid mediated transcriptional regulation, as well as newer models of how phospholipids might effect transcription in the acute regulation of complex nuclear signaling pathways. Thus, this review provides novel insight into the new, non-membrane associated roles nuclear phospholipids play in regulating complex nuclear events, centered on the nuclear receptor superfamily of transcription factors. PMID:27838257

  3. Genome-wide identification of nuclear receptor (NR) superfamily genes in the copepod Tigriopus japonicus.

    PubMed

    Hwang, Dae-Sik; Lee, Bo-Young; Kim, Hui-Su; Lee, Min Chul; Kyung, Do-Hyun; Om, Ae-Son; Rhee, Jae-Sung; Lee, Jae-Seong

    2014-11-18

    Nuclear receptors (NRs) are a large superfamily of proteins defined by a DNA-binding domain (DBD) and a ligand-binding domain (LBD). They function as transcriptional regulators to control expression of genes involved in development, homeostasis, and metabolism. The number of NRs differs from species to species, because of gene duplications and/or lineage-specific gene losses during metazoan evolution. Many NRs in arthropods interact with the ecdysteroid hormone and are involved in ecdysone-mediated signaling in arthropods. The nuclear receptor superfamily complement has been reported in several arthropods, including crustaceans, but not in copepods. We identified the entire NR repertoire of the copepod Tigriopus japonicus, which is an important marine model species for ecotoxicology and environmental genomics. Using whole genome and transcriptome sequences, we identified a total of 31 nuclear receptors in the genome of T. japonicus. Nomenclature of the nuclear receptors was determined based on the sequence similarities of the DNA-binding domain (DBD) and ligand-binding domain (LBD). The 7 subfamilies of NRs separate into five major clades (subfamilies NR1, NR2, NR3, NR4, and NR5/6). Although the repertoire of NR members in, T. japonicus was similar to that reported for other arthropods, there was an expansion of the NR1 subfamily in Tigriopus japonicus. The twelve unique nuclear receptors identified in T. japonicus are members of NR1L. This expansion may be a unique lineage-specific feature of crustaceans. Interestingly, E78 and HR83, which are present in other arthropods, were absent from the genomes of T. japonicus and two congeneric copepod species (T. japonicus and Tigriopus californicus), suggesting copepod lineage-specific gene loss. We identified all NR receptors present in the copepod, T. japonicus. Knowledge of the copepod nuclear receptor repertoire will contribute to a better understanding of copepod- and crustacean-specific NR evolution.

  4. BXR, an embryonic orphan nuclear receptor activated by a novel class of endogenous benzoate metabolites

    PubMed Central

    Blumberg, Bruce; Kang, Heonjoong; Bolado, Jack; Chen, Hongwu; Craig, A. Grey; Moreno, Tanya A.; Umesono, Kazuhiko; Perlmann, Thomas; De Robertis, Eddy M.; Evans, Ronald M.

    1998-01-01

    Nuclear receptors are ligand-modulated transcription factors that respond to steroids, retinoids, and thyroid hormones to control development and body physiology. Orphan nuclear receptors, which lack identified ligands, provide a unique, and largely untapped, resource to discover new principles of physiologic homeostasis. We describe the isolation and characterization of the vertebrate orphan receptor, BXR, which heterodimerizes with RXR and binds high-affinity DNA sites composed of a variant thyroid hormone response element. A bioactivity-guided screen of embryonic extracts revealed that BXR is activatable by low-molecular-weight molecules with spectral patterns distinct from known nuclear receptor ligands. Mass spectrometry and 1H NMR analysis identified alkyl esters of amino and hydroxy benzoic acids as potent, stereoselective activators. In vitro cofactor association studies, along with competable binding of radiolabeled compounds, establish these molecules as bona fide ligands. Benzoates comprise a new molecular class of nuclear receptor ligand and their activity suggests that BXR may control a previously unsuspected vertebrate signaling pathway. PMID:9573044

  5. Ligand and coactivator identity determines the requirement of the charge clamp for coactivation of the peroxisome proliferator-activated receptor gamma.

    PubMed

    Wu, Yifei; Chin, William W; Wang, Yong; Burris, Thomas P

    2003-03-07

    The activation function 2 (AF-2)-dependent recruitment of coactivator is essential for gene activation by nuclear receptors. We show that the peroxisome proliferator-activated receptor gamma (PPARgamma) (NR1C3) coactivator-1 (PGC-1) requires both the intact AF-2 domain of PPARgamma and the LXXLL domain of PGC-1 for ligand-dependent and ligand-independent interaction and coactivation. Although the AF-2 domain of PPARgamma is absolutely required for PGC-1-mediated coactivation, this coactivator displayed a unique lack of requirement for the charge clamp of the ligand-binding domain of the receptor that is thought to be essential for LXXLL motif recognition. The mutation of a single serine residue adjacent to the core LXXLL motif of PGC-1 led to restoration of the typical charge clamp requirement. Thus, the unique structural features of the PGC-1 LXXLL motif appear to mediate an atypical mode of interaction with PPARgamma. Unexpectedly, we discovered that various ligands display variability in terms of their requirement for the charge clamp of PPARgamma for coactivation by PGC-1. This ligand-selective variable requirement for the charge clamp was coactivator-specific. Thus, distinct structural determinants, which may be unique for a particular ligand, are utilized by the receptor to recognize the coactivator. Our data suggest that even subtle differences in ligand structure are perceived by the receptor and translated into a unique display of the coactivator-binding surface of the ligand-binding domain, allowing for differential recognition of coactivators that may underlie distinct pharmacological profiles observed for ligands of a particular nuclear receptor.

  6. Estrogen-related receptor β (ERRβ) – renaissance receptor or receptor renaissance?

    PubMed Central

    Divekar, Shailaja D.; Tiek, Deanna M.; Fernandez, Aileen; Riggins, Rebecca B.

    2016-01-01

    Estrogen-related receptors (ERRs) are founding members of the orphan nuclear receptor (ONR) subgroup of the nuclear receptor superfamily. Twenty-seven years of study have yet to identify cognate ligands for the ERRs, though they have firmly placed ERRα and ERRγ at the intersection of cellular metabolism and oncogenesis. The pace of discovery for novel functions of ERRβ, however, has until recently been somewhat slower than that of its family members. ERRβ has also been largely ignored in summaries and perspectives of the ONR literature. Here, we provide an overview of established and emerging knowledge of ERRβ in mouse, man, and other species, highlighting unique aspects of ERRβ biology that set it apart from the other two estrogen-related receptors, with a focus on the impact of alternative splicing on the structure and function of this receptor. PMID:27507929

  7. Quantitative High-throughput Luciferase Screening in Identifying CAR Modulators

    PubMed Central

    Lynch, Caitlin; Zhao, Jinghua; Wang, Hongbing; Xia, Menghang

    2017-01-01

    Summary The constitutive androstane receptor (CAR, NR1I3) is responsible for the transcription of multiple drug metabolizing enzymes and transporters. There are two possible methods of activation for CAR, direct ligand binding and a ligand-independent method, which makes this a unique nuclear receptor. Both of these mechanisms require translocation of CAR from the cytoplasm into the nucleus. Interestingly, CAR is constitutively active in immortalized cell lines due to the basal nuclear location of this receptor. This creates an important challenge in most in vitro assay models because immortalized cells cannot be used without inhibiting the basal activity. In this book chapter, we go into detail of how to perform quantitative high-throughput screens to identify hCAR1 modulators through the employment of a double stable cell line. Using this line, we are able to identify activators, as well as deactivators, of the challenging nuclear receptor, CAR. PMID:27518621

  8. Quantitative High-Throughput Luciferase Screening in Identifying CAR Modulators.

    PubMed

    Lynch, Caitlin; Zhao, Jinghua; Wang, Hongbing; Xia, Menghang

    2016-01-01

    The constitutive androstane receptor (CAR, NR1I3) is responsible for the transcription of multiple drug metabolizing enzymes and transporters. There are two possible methods of activation for CAR, direct ligand binding and a ligand-independent method, which makes this a unique nuclear receptor. Both of these mechanisms require translocation of CAR from the cytoplasm into the nucleus. Interestingly, CAR is constitutively active in immortalized cell lines due to the basal nuclear location of this receptor. This creates an important challenge in most in vitro assay models because immortalized cells cannot be used without inhibiting the high basal activity. In this book chapter, we go into detail of how to perform quantitative high-throughput screens to identify hCAR1 modulators through the employment of a double stable cell line. Using this line, we are able to identify activators, as well as deactivators, of the challenging nuclear receptor, CAR.

  9. The estrogen receptor alpha nuclear localization sequence is critical for fulvestrant-induced degradation of the receptor.

    PubMed

    Casa, Angelo J; Hochbaum, Daniel; Sreekumar, Sreeja; Oesterreich, Steffi; Lee, Adrian V

    2015-11-05

    Fulvestrant, a selective estrogen receptor down-regulator (SERD) is a pure competitive antagonist of estrogen receptor alpha (ERα). Fulvestrant binds ERα and reduces the receptor's half-life by increasing protein turnover, however, its mechanism of action is not fully understood. In this study, we show that removal of the ERα nuclear localization sequence (ERΔNLS) resulted in a predominantly cytoplasmic ERα that was degraded in response to 17-β-estradiol (E2) but was resistant to degradation by fulvestrant. ERΔNLS bound the ligands and exhibited receptor interaction similar to ERα, indicating that the lack of degradation was not due to disruption of these processes. Forcing ERΔNLS into the nucleus with a heterologous SV40-NLS did not restore degradation, suggesting that the NLS domain itself, and not merely receptor localization, is critical for fulvestrant-induced ERα degradation. Indeed, cloning of the endogenous ERα NLS onto the N-terminus of ERΔNLS significantly restored both its nuclear localization and turnover in response to fulvestrant. Moreover, mutation of the sumoylation targets K266 and K268 within the NLS impaired fulvestrant-induced ERα degradation. In conclusion, our study provides evidence for the unique role of the ERα NLS in fulvestrant-induced degradation of the receptor. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Molecular and Structural Traits of Insulin Receptor Substrate 1/LC3 Nuclear Structures and Their Role in Autophagy Control and Tumor Cell Survival.

    PubMed

    Lassak, Adam; Dean, Mathew; Wyczechowska, Dorota; Wilk, Anna; Marrero, Luis; Trillo-Tinoco, Jimena; Boulares, A Hamid; Sarkaria, Jann N; Del Valle, Luis; Peruzzi, Francesca; Ochoa, Augusto; Reiss, Krzysztof

    2018-05-15

    Insulin receptor substrate 1 (IRS-1) is a common cytosolic adaptor molecule involved in signal transduction from insulin and insulin-like growth factor I (IGF-I) receptors. IRS-1 can also be found in the nucleus. We report here a new finding of unique IRS-1 nuclear structures, which we observed initially in glioblastoma biopsy specimens and glioblastoma xenografts. These nuclear structures can be reproduced in vitro by the ectopic expression of IRS-1 cDNA cloned in frame with the nuclear localization signal (NLS-IRS-1). In these structures, IRS-1 localizes at the periphery, while the center harbors a key autophagy protein, LC3. These new nuclear structures are highly dynamic, rapidly exchange IRS-1 molecules with the surrounding nucleoplasm, disassemble during mitosis, and require a growth stimulus for their reassembly and maintenance. In tumor cells engineered to express NLS-IRS-1, the IRS-1/LC3 nuclear structures repress autophagy induced by either amino acid starvation or rapamycin treatment. In this process, IRS-1 nuclear structures sequester LC3 inside the nucleus, possibly preventing its cytosolic translocation and the formation of new autophagosomes. This novel mechanism provides a quick and reversible way of inhibiting autophagy, which could counteract autophagy-induced cancer cell death under severe stress, including anticancer therapies. Copyright © 2018 American Society for Microbiology.

  11. Molecular mechanism of peroxisome proliferator-activated receptor α activation by WY14643: a new mode of ligand recognition and receptor stabilization.

    PubMed

    Bernardes, Amanda; Souza, Paulo C T; Muniz, João R C; Ricci, Clarisse G; Ayers, Stephen D; Parekh, Nili M; Godoy, André S; Trivella, Daniela B B; Reinach, Peter; Webb, Paul; Skaf, Munir S; Polikarpov, Igor

    2013-08-23

    Peroxisome proliferator-activated receptors (PPARs) are members of a superfamily of nuclear transcription factors. They are involved in mediating numerous physiological effects in humans, including glucose and lipid metabolism. PPARα ligands effectively treat dyslipidemia and have significant antiinflammatory and anti-atherosclerotic activities. These effects and their ligand-dependent activity make nuclear receptors obvious targets for drug design. Here, we present the structure of the human PPARα in complex with WY14643, a member of fibrate class of drug, and a widely used PPAR activator. The crystal structure of this complex suggests that WY14643 induces activation of PPARα in an unusual bipartite mechanism involving conventional direct helix 12 stabilization and an alternative mode that involves a second ligand in the pocket. We present structural observations, molecular dynamics and activity assays that support the importance of the second site in WY14643 action. The unique binding mode of WY14643 reveals a new pattern of nuclear receptor ligand recognition and suggests a novel basis for ligand design, offering clues for improving the binding affinity and selectivity of ligand. We show that binding of WY14643 to PPARα was associated with antiinflammatory disease in a human corneal cell model, suggesting possible applications for PPARα ligands. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Utilization of DR1 as true RARE in regulating the Ssm, a novel retinoic acid-target gene in the mouse testis.

    PubMed

    Han, Kyuyong; Song, Haengseok; Moon, Irene; Augustin, Robert; Moley, Kelle; Rogers, Melissa; Lim, Hyunjung

    2007-03-01

    Various nuclear receptors form dimers to activate target genes via specific response elements located within promoters or enhancers. Retinoid X receptor (RXR) serves as a dimerization partner for many nuclear receptors including retinoic acid receptor (RAR) and peroxisome proliferator-activated receptor (PPAR). Dimers show differential preference towards directly repeated response elements with 1-5 nucleotide spacing, and direct repeat 1 (DR1) is a promiscuous element which recruits RAR/RXR, RXR/RXR, and PPAR/RXR in vitro. In the present investigation, we report identification of a novel RAR/RXR target gene which is regulated by DR1s in the promoter region. This gene, namely spermatocyte-specific marker (Ssm), recruits all the three combinations of nuclear receptors in vitro, but in vivo regulation is observed by trans-retinoic acid-activated RAR/RXR dimer. Indeed, chromatin immunoprecipitation experiment demonstrates binding of RARbeta and RXRalpha in the promoter region of the Ssm. Interestingly, expression of Ssm is almost exclusively observed in spermatocytes in the adult mouse testis, where RA signaling is known to regulate developmental program of male germ cells. The results show that Ssm is a RAR/RXR target gene uniquely using DR1 and exhibits stage-specific expression in the mouse testis with potential function in later stages of spermatogenesis. This finding exemplifies usage of DR1s as retinoic acid response element (RARE) under a specific in vivo context.

  13. Protoparvovirus Knocking at the Nuclear Door.

    PubMed

    Mäntylä, Elina; Kann, Michael; Vihinen-Ranta, Maija

    2017-10-02

    Protoparvoviruses target the nucleus due to their dependence on the cellular reproduction machinery during the replication and expression of their single-stranded DNA genome. In recent years, our understanding of the multistep process of the capsid nuclear import has improved, and led to the discovery of unique viral nuclear entry strategies. Preceded by endosomal transport, endosomal escape and microtubule-mediated movement to the vicinity of the nuclear envelope, the protoparvoviruses interact with the nuclear pore complexes. The capsids are transported actively across the nuclear pore complexes using nuclear import receptors. The nuclear import is sometimes accompanied by structural changes in the nuclear envelope, and is completed by intranuclear disassembly of capsids and chromatinization of the viral genome. This review discusses the nuclear import strategies of protoparvoviruses and describes its dynamics comprising active and passive movement, and directed and diffusive motion of capsids in the molecularly crowded environment of the cell.

  14. Coregulator profiling of the glucocorticoid receptor in lymphoid malignancies

    PubMed Central

    Clarisse, Dorien; Thommis, Jonathan; Van Wesemael, Karlien; Houtman, René; Ratman, Dariusz; Tavernier, Jan; Offner, Fritz; Beck, Ilse; De Bosscher, Karolien

    2017-01-01

    Coregulators cooperate with nuclear receptors, such as the glucocorticoid receptor (GR), to enhance or repress transcription. These regulatory proteins are implicated in cancer, yet, their role in lymphoid malignancies, including multiple myeloma (MM) and acute lymphoblastic leukemia (ALL), is largely unknown. Here, we report the use and extension of the microarray assay for real-time nuclear receptor coregulator interactions (MARCoNI) technology to detect coregulator associations with endogenous GR in cell lysates. We use MARCoNI to determine the GR coregulator profile of glucocorticoid-sensitive (MM and ALL) and glucocorticoid-resistant (ALL) cells, and identify common and unique coregulators for different cell line comparisons. Overall, we identify SRC-1/2/3, PGC-1α, RIP140 and DAX-1 as the strongest interacting coregulators of GR in MM and ALL cells and show that the interaction strength does not correlate with GR protein levels. Lastly, as a step towards patient samples, we determine the GR coregulator profile of peripheral blood mononuclear cells. We profile the interactions between GR and coregulators in MM and ALL cells and suggest to further explore the GR coregulator profile in hematological patient samples. PMID:29312638

  15. Coregulator profiling of the glucocorticoid receptor in lymphoid malignancies.

    PubMed

    Clarisse, Dorien; Thommis, Jonathan; Van Wesemael, Karlien; Houtman, René; Ratman, Dariusz; Tavernier, Jan; Offner, Fritz; Beck, Ilse; De Bosscher, Karolien

    2017-12-12

    Coregulators cooperate with nuclear receptors, such as the glucocorticoid receptor (GR), to enhance or repress transcription. These regulatory proteins are implicated in cancer, yet, their role in lymphoid malignancies, including multiple myeloma (MM) and acute lymphoblastic leukemia (ALL), is largely unknown. Here, we report the use and extension of the microarray assay for real-time nuclear receptor coregulator interactions (MARCoNI) technology to detect coregulator associations with endogenous GR in cell lysates. We use MARCoNI to determine the GR coregulator profile of glucocorticoid-sensitive (MM and ALL) and glucocorticoid-resistant (ALL) cells, and identify common and unique coregulators for different cell line comparisons. Overall, we identify SRC-1/2/3, PGC-1α, RIP140 and DAX-1 as the strongest interacting coregulators of GR in MM and ALL cells and show that the interaction strength does not correlate with GR protein levels. Lastly, as a step towards patient samples, we determine the GR coregulator profile of peripheral blood mononuclear cells. We profile the interactions between GR and coregulators in MM and ALL cells and suggest to further explore the GR coregulator profile in hematological patient samples.

  16. The Drosophila Juvenile Hormone Receptor Candidates Methoprene-tolerant (MET) and Germ Cell-expressed (GCE) Utilize a Conserved LIXXL Motif to Bind the FTZ-F1 Nuclear Receptor*

    PubMed Central

    Bernardo, Travis J.; Dubrovsky, Edward B.

    2012-01-01

    Juvenile hormone (JH) has been implicated in many developmental processes in holometabolous insects, but its mechanism of signaling remains controversial. We previously found that in Drosophila Schneider 2 cells, the nuclear receptor FTZ-F1 is required for activation of the E75A gene by JH. Here, we utilized insect two-hybrid assays to show that FTZ-F1 interacts with two JH receptor candidates, the bHLH-PAS paralogs MET and GCE, in a JH-dependent manner. These interactions are severely reduced when helix 12 of the FTZ-F1 activation function 2 (AF2) is removed, implicating AF2 as an interacting site. Through homology modeling, we found that MET and GCE possess a C-terminal α-helix featuring a conserved motif LIXXL that represents a novel nuclear receptor (NR) box. Docking simulations supported by two-hybrid experiments revealed that FTZ-F1·MET and FTZ-F1·GCE heterodimer formation involves a typical NR box-AF2 interaction but does not require the canonical charge clamp residues of FTZ-F1 and relies primarily on hydrophobic contacts, including a unique interaction with helix 4. Moreover, we identified paralog-specific features, including a secondary interaction site found only in MET. Our findings suggest that a novel NR box enables MET and GCE to interact JH-dependently with the AF2 of FTZ-F1. PMID:22249180

  17. Annotation of the Nuclear Receptors in an Estuarine Fish species, Fundulus heteroclitus

    PubMed Central

    Baldwin, William S.; Boswell, W. Tyler; Ginjupalli, Gautam; Litoff, Elizabeth J.

    2017-01-01

    The nuclear receptors (NRs) are ligand-dependent transcription factors that respond to various internal as well as external cues such as nutrients, pheromones, and steroid hormones that play crucial roles in regulation and maintenance of homeostasis and orchestrating the physiological and stress responses of an organism. We annotated the Fundulus heteroclitus (mummichog; Atlantic killifish) nuclear receptors. Mummichog are a non-migratory, estuarine fish with a limited home range often used in environmental research as a field model for studying ecological and evolutionary responses to variable environmental conditions such as salinity, oxygen, temperature, pH, and toxic compounds because of their hardiness. F. heteroclitus have at least 74 NRs spanning all seven gene subfamilies. F. heteroclitus is unique in that no RXRα member was found within the genome. Interestingly, some of the NRs are highly conserved between species, while others show a higher degree of divergence such as PXR, SF1, and ARα. Fundulus like other fish species show expansion of the RAR (NR1B), Rev-erb (NR1D), ROR (NR1F), COUPTF (NR2F), ERR (NR3B), RXR (NR2B), and to a lesser extent the NGF (NR4A), and NR3C steroid receptors (GR/AR). Of particular interest is the co-expansion of opposing NRs, Reverb-ROR, and RAR/RXR-COUPTF. PMID:28804711

  18. The emerging role of nuclear viral DNA sensors.

    PubMed

    Diner, Benjamin A; Lum, Krystal K; Cristea, Ileana M

    2015-10-30

    Detecting pathogenic DNA by intracellular receptors termed "sensors" is critical toward galvanizing host immune responses and eliminating microbial infections. Emerging evidence has challenged the dogma that sensing of viral DNA occurs exclusively in sub-cellular compartments normally devoid of cellular DNA. The interferon-inducible protein IFI16 was shown to bind nuclear viral DNA and initiate immune signaling, culminating in antiviral cytokine secretion. Here, we review the newly characterized nucleus-originating immune signaling pathways, their links to other crucial host defenses, and unique mechanisms by which viruses suppress their functions. We frame these findings in the context of human pathologies associated with nuclear replicating DNA viruses. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Neurokinin-1 receptor: functional significance in the immune system in reference to selected infections and inflammation

    PubMed Central

    Douglas, Steven D.; Leeman, Susan E.

    2010-01-01

    The G-protein coupled receptor (GPCR), Neurokinin-1 Receptor (NK1R), and its preferred ligand, substance P (SP), are reviewed in relationship to the immune system and selected infections. NK1R and substance P are ubiquitous throughout the animal kingdom. This important pathway has unique functions in numerous cells and tissues. The interaction of SP with its preferred receptor, NK1R, leads to the activation of nuclear factor-kappa-b (NF-κb) and proinflammatory cytokines. NK1R has two isoforms, both a full-length and a truncated form. These isoforms have different functional significances and differ in cell signaling capability. The proinflammatory signals modulated by substance P are important in bacterial, viral, fungal, and parasitic diseases, as well as in immune system function. The SP-NK1R system is a major Class 1, rhodopsin-like GPCR ligand-receptor interaction. PMID:21091716

  20. Metabotropic glutamate receptor 5 mediates phosphorylation of vascular endothelial cadherin and nuclear localization of β-catenin in response to homocysteine.

    PubMed

    Beard, Richard S; Reynolds, Jason J; Bearden, Shawn E

    2012-01-01

    Elevated plasma homocysteine (Hcy) is an independent risk factor for vascular disease and stroke in part by causing generalized endothelial dysfunction. A receptor that is sensitive to Hcy and its intracellular signaling systems has not been identified. β-catenin is a pleiotropic regulator of transcription and cell function. Using a brain microvascular endothelial cell line (bEnd.3), we tested the hypothesis that Hcy causes receptor-dependent nuclear translocation of β-catenin. Hcy increased phosphorylation of Y731 on vascular endothelial cadherin (VE-cadherin), a site involved in coupling β-catenin to VE-cadherin. This was blocked by inhibition of either metabotropic glutamate receptor 5 (mGluR5) or ionotropic glutamate receptor (NMDAr) and by shRNA knockdown of mGluR5. Expression of these receptors was confirmed by flow cytometry, immunohistochemistry, and western blotting. Directed pharmacology with specific agonists elucidated a signaling cascade where Hcy activates mGluR5 which activates NMDAr with subsequent PKC activation and uncoupling of the VE-cadherin/β-catenin complex. Moreover, Hcy caused a shift in localization of β-catenin from membrane-bound VE-cadherin to the cell nucleus, where it bound DNA, including a regulatory region of the gene for claudin-5, leading to reduced expression of claudin-5. Nuclear localization, DNA binding of β-catenin, and reduced claudin-5 expression were blocked by inhibition of mGluR5. Knockdown of mGluR5 expression with shRNA also rescued claudin-5 expression from the effects of Hcy treatment. These data uniquely identify mGluR5 as a master switch that drives β-catenin nuclear localization in vascular endothelium and regulates cell-cell coupling in response to elevated Hcy levels. These studies dissect a pharmacological opportunity for developing new therapeutic strategies in HHcy. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Sequence and characterization of cytoplasmic nuclear protein import factor p97

    PubMed Central

    1995-01-01

    Nuclear location sequence-mediated binding of karyophilic proteins to the nuclear pore complexes is one of the earliest steps in nuclear protein import. We previously identified two cytosolic proteins that reconstitute this step in a permeabilized cell assay: the 54/56-kD NLS receptor and p97. A monoclonal antibody to p97 localizes the protein to the cytoplasm and the nuclear envelope. p97 is extracted from nuclear envelopes under the same conditions as the O-glycosylated nucleoporins indicating a tight association with the pore complex. The antibody inhibits import in a permeabilized cell assay but does not affect binding of karyophiles to the nuclear pore complex. Immunodepletion of p97 renders the cytosol inactive for import and identifies at least three other cytosolic proteins that interact with p97. cDNA cloning of p97 shows that it is a unique protein containing 23 cysteine residues. Recombinant p97 binds zinc and a bound metal ion is required for the nuclear envelope binding activity of the protein. PMID:7615630

  2. Research resource: Tissue-specific transcriptomics and cistromics of nuclear receptor signaling: a web research resource.

    PubMed

    Ochsner, Scott A; Watkins, Christopher M; LaGrone, Benjamin S; Steffen, David L; McKenna, Neil J

    2010-10-01

    Nuclear receptors (NRs) are ligand-regulated transcription factors that recruit coregulators and other transcription factors to gene promoters to effect regulation of tissue-specific transcriptomes. The prodigious rate at which the NR signaling field has generated high content gene expression and, more recently, genome-wide location analysis datasets has not been matched by a committed effort to archiving this information for routine access by bench and clinical scientists. As a first step towards this goal, we searched the MEDLINE database for studies, which referenced either expression microarray and/or genome-wide location analysis datasets in which a NR or NR ligand was an experimental variable. A total of 1122 studies encompassing 325 unique organs, tissues, primary cells, and cell lines, 35 NRs, and 91 NR ligands were retrieved and annotated. The data were incorporated into a new section of the Nuclear Receptor Signaling Atlas Molecule Pages, Transcriptomics and Cistromics, for which we designed an intuitive, freely accessible user interface to browse the studies. Each study links to an abstract, the MEDLINE record, and, where available, Gene Expression Omnibus and ArrayExpress records. The resource will be updated on a regular basis to provide a current and comprehensive entrez into the sum of transcriptomic and cistromic research in this field.

  3. Targeting Nuclear Receptors with Marine Natural Products

    PubMed Central

    Yang, Chunyan; Li, Qianrong; Li, Yong

    2014-01-01

    Nuclear receptors (NRs) are important pharmaceutical targets because they are key regulators of many metabolic and inflammatory diseases, including diabetes, dyslipidemia, cirrhosis, and fibrosis. As ligands play a pivotal role in modulating nuclear receptor activity, the discovery of novel ligands for nuclear receptors represents an interesting and promising therapeutic approach. The search for novel NR agonists and antagonists with enhanced selectivities prompted the exploration of the extraordinary chemical diversity associated with natural products. Recent studies involving nuclear receptors have disclosed a number of natural products as nuclear receptor ligands, serving to re-emphasize the translational possibilities of natural products in drug discovery. In this review, the natural ligands of nuclear receptors will be described with an emphasis on their mechanisms of action and their therapeutic potentials, as well as on strategies to determine potential marine natural products as nuclear receptor modulators. PMID:24473166

  4. RNA-Seq reveals common and unique PXR- and CAR-target gene signatures in the mouse liver transcriptome.

    PubMed

    Cui, Julia Yue; Klaassen, Curtis D

    2016-09-01

    The pregnane X receptor (PXR) and constitutive androstane receptor (CAR) are well-known xenobiotic-sensing nuclear receptors with overlapping functions. However, there lacks a quantitative characterization to distinguish between the PXR and CAR target genes and signaling pathways in the liver. The present study performed a transcriptomic comparison of the PXR- and CAR-targets using RNA-Seq in livers of adult wild-type mice that were treated with the prototypical PXR ligand PCN (200mg/kg, i.p. once daily for 4days in corn oil) or the prototypical CAR ligand TCPOBOP (3mg/kg, i.p., once daily for 4days in corn oil). At the given doses, TCPOBOP differentially regulated many more genes (2125) than PCN (212), and 147 of the same genes were differentially regulated by both chemicals. As expected, the top pathways differentially regulated by both PCN and TCPOBOP were involved in xenobiotic metabolism, and they also up-regulated genes involved in retinoid metabolism, but down-regulated genes involved in inflammation and iron homeostasis. Regarding unique pathways, PXR activation appeared to overlap with the aryl hydrocarbon receptor signaling, whereas CAR activation appeared to overlap with the farnesoid X receptor signaling, acute-phase response, and mitochondrial dysfunction. The mRNAs of differentially regulated drug-processing genes (DPGs) partitioned into three patterns, namely TCPOBOP-induced, PCN-induced, as well as TCPOBOP-suppressed gene clusters. The cumulative mRNAs of the differentially regulated DPGs, phase-I and -II enzymes, as well as efflux transporters were all up-regulated by both PCN and TCPOBOPOP, whereas the cumulative mRNAs of the uptake transporters were down-regulated only by TCPOBOP. The absolute mRNA abundance in control and receptor-activated conditions was examined in each DPG category to predict the contribution of specific DPG genes in the PXR/CAR-mediated pharmacokinetic responses. The preferable differential regulation by TCPOBOP in the entire hepatic transcriptome correlated with a marked change in the expression of many DNA and histone epigenetic modifiers. In conclusion, the present study has revealed known and novel, as well as common and unique targets of PXR and CAR in mouse liver following pharmacological activation using their prototypical ligands. Results from this study will further support the role of these receptors in regulating the homeostasis of xenobiotic and intermediary metabolism in the liver, and aid in distinguishing between PXR and CAR signaling at various physiological and pathophysiological conditions. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Phytol metabolites are circulating dietary factors that activate the nuclear receptor RXR.

    PubMed Central

    Kitareewan, S; Burka, L T; Tomer, K B; Parker, C E; Deterding, L J; Stevens, R D; Forman, B M; Mais, D E; Heyman, R A; McMorris, T; Weinberger, C

    1996-01-01

    RXR is a nuclear receptor that plays a central role in cell signaling by pairing with a host of other receptors. Previously, 9-cis-retinoic acid (9cRA) was defined as a potent RXR activator. Here we describe a unique RXR effector identified from organic extracts of bovine serum by following RXR-dependent transcriptional activity. Structural analyses of material in active fractions pointed to the saturated diterpenoid phytanic acid, which induced RXR-dependent transcription at concentrations between 4 and 64 microM. Although 200 times more potent than phytanic acid, 9cRA was undetectable in equivalent amounts of extract and cannot be present at a concentration that could account for the activity. Phytanic acid, another phytol metabolite, was synthesized and stimulated RXR with a potency and efficacy similar to phytanic acid. These metabolites specifically displaced [3H]-9cRA from RXR with Ki values of 4 microM, indicating that their transcriptional effects are mediated by direct receptor interactions. Phytol metabolites are compelling candidates for physiological effectors, because their RXR binding affinities and activation potencies match their micromolar circulating concentrations. Given their exclusive dietary origin, these chlorophyll metabolites may represent essential nutrients that coordinate cellular metabolism through RXR-dependent signaling pathways. PMID:8856661

  6. Lipids Derived from Virulent Francisella tularensis Broadly Inhibit Pulmonary Inflammation via Toll-Like Receptor 2 and Peroxisome Proliferator-Activated Receptor α

    PubMed Central

    Crane, Deborah D.; Ireland, Robin; Alinger, Joshua B.; Small, Pamela

    2013-01-01

    Francisella tularensis is a Gram-negative facultative intracellular pathogen that causes an acute lethal respiratory disease in humans. The heightened virulence of the pathogen is linked to its unique ability to inhibit Toll-like receptor (TLR)-mediated inflammatory responses. The bacterial component and mechanism of this inhibition are unknown. Here we show that lipids isolated from virulent but not attenuated strains of F. tularensis are not detected by host cells, inhibit production of proinflammatory cytokines by primary macrophages in response to known TLR ligands, and suppress neutrophil recruitment in vivo. We further show that lipid-mediated inhibition of inflammation is dependent on TLR2, MyD88, and the nuclear hormone and fatty acid receptor peroxisome proliferator-activated receptor α (PPARα). Pathogen lipid-mediated interference with inflammatory responses through the engagement of TLR2 and PPARα represents a novel manipulation of host signaling pathways consistent with the ability of highly virulent F. tularensis to efficiently evade host immune responses. PMID:23925884

  7. The Nuclear Receptor HIZR-1 Uses Zinc as a Ligand to Mediate Homeostasis in Response to High Zinc

    PubMed Central

    Warnhoff, Kurt; Roh, Hyun C.; Kocsisova, Zuzana; Tan, Chieh-Hsiang; Morrison, Andrew; Croswell, Damari; Schneider, Daniel L.; Kornfeld, Kerry

    2017-01-01

    Nuclear receptors were originally defined as endocrine sensors in humans, leading to the identification of the nuclear receptor superfamily. Despite intensive efforts, most nuclear receptors have no known ligand, suggesting new ligand classes remain to be discovered. Furthermore, nuclear receptors are encoded in the genomes of primitive organisms that lack endocrine signaling, suggesting the primordial function may have been environmental sensing. Here we describe a novel Caenorhabditis elegans nuclear receptor, HIZR-1, that is a high zinc sensor in an animal and the master regulator of high zinc homeostasis. The essential micronutrient zinc acts as a HIZR-1 ligand, and activated HIZR-1 increases transcription of genes that promote zinc efflux and storage. The results identify zinc as the first inorganic molecule to function as a physiological ligand for a nuclear receptor and direct environmental sensing as a novel function of nuclear receptors. PMID:28095401

  8. Atypical nuclear localization of VIP receptors in glioma cell lines and patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barbarin, Alice; Séité, Paule; Godet, Julie

    Highlights: • The VIP receptor VPAC1 contains a putative NLS signal. • VPAC1 is predominantly nuclear in GBM cell lines but not VPAC2. • Non-nuclear VPAC1/2 protein expression is correlated with glioma grade. • Nuclear VPAC1 is observed in 50% of stage IV glioma (GBM). - Abstract: An increasing number of G protein-coupled receptors, like receptors for vasoactive intestinal peptide (VIP), are found in cell nucleus. As VIP receptors are involved in the regulation of glioma cell proliferation and migration, we investigated the expression and the nuclear localization of the VIP receptors VPAC1 and VPAC2 in this cancer. First, bymore » applying Western blot and immunofluorescence detection in three human glioblastoma (GBM) cell lines, we observed a strong nuclear staining for the VPAC1 receptor and a weak nuclear VPAC2 receptor staining. Second, immunohistochemical staining of VPAC1 and VPAC2 on tissue microarrays (TMA) showed that the two receptors were expressed in normal brain and glioma tissues. Expression in the non-nuclear compartment of the two receptors significantly increased with the grade of the tumors. Analysis of nuclear staining revealed a significant increase of VPAC1 staining with glioma grade, with up to 50% of GBM displaying strong VPAC1 nuclear staining, whereas nuclear VPAC2 staining remained marginal. The increase in VPAC receptor expression with glioma grades and the enhanced nuclear localization of the VPAC1 receptors in GBM might be of importance for glioma progression.« less

  9. Nuclear receptors and nonalcoholic fatty liver disease1

    PubMed Central

    Cave, Matthew C.; Clair, Heather B.; Hardesty, Josiah E.; Falkner, K. Cameron; Feng, Wenke; Clark, Barbara J.; Sidey, Jennifer; Shi, Hongxue; Aqel, Bashar A.; McClain, Craig J.; Prough, Russell A.

    2016-01-01

    Nuclear receptors are transcription factors which sense changing environmental or hormonal signals and effect transcriptional changes to regulate core life functions including growth, development, and reproduction. To support this function, following ligand-activation by xenobiotics, members of subfamily 1 nuclear receptors (NR1s) may heterodimerize with the retinoid X receptor (RXR) to regulate transcription of genes involved in energy and xenobiotic metabolism and inflammation. Several of these receptors including the peroxisome proliferator-activated receptors (PPARs), the pregnane and xenobiotic receptor (PXR), the constitutive androstane receptor (CAR), the liver X receptor (LXR) and the farnesoid X receptor (FXR) are key regulators of the gut:liver:adipose axis and serve to coordinate metabolic responses across organ systems between the fed and fasting states. Non-alcoholic fatty liver disease (NAFLD) is the most common liver disease and may progress to cirrhosis and even hepatocellular carcinoma. NAFLD is associated with inappropriate nuclear receptor function and perturbations along the gut:liver:adipose axis including obesity, increased intestinal permeability with systemic inflammation, abnormal hepatic lipid metabolism, and insulin resistance. Environmental chemicals may compound the problem by directly interacting with nuclear receptors leading to metabolic confusion and the inability to differentiate fed from fasting conditions. This review focuses on the impact of nuclear receptors in the pathogenesis and treatment of NAFLD. Clinical trials including PIVENS and FLINT demonstrate that nuclear receptor targeted therapies may lead to the paradoxical dissociation of steatosis, inflammation, fibrosis, insulin resistance, dyslipidemia and obesity. Novel strategies currently under development (including tissue-specific ligands and dual receptor agonists) may be required to separate the beneficial effects of nuclear receptor activation from unwanted metabolic side effects. The impact of nuclear receptor crosstalk in NAFLD is likely to be profound, but requires further elucidation. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. PMID:26962021

  10. An emerging link between LIM domain proteins and nuclear receptors.

    PubMed

    Sala, Stefano; Ampe, Christophe

    2018-06-01

    Nuclear receptors are ligand-activated transcription factors that partake in several biological processes including development, reproduction and metabolism. Over the last decade, evidence has accumulated that group 2, 3 and 4 LIM domain proteins, primarily known for their roles in actin cytoskeleton organization, also partake in gene transcription regulation. They shuttle between the cytoplasm and the nucleus, amongst other as a consequence of triggering cells with ligands of nuclear receptors. LIM domain proteins act as important coregulators of nuclear receptor-mediated gene transcription, in which they can either function as coactivators or corepressors. In establishing interactions with nuclear receptors, the LIM domains are important, yet pleiotropy of LIM domain proteins and nuclear receptors frequently occurs. LIM domain protein-nuclear receptor complexes function in diverse physiological processes. Their association is, however, often linked to diseases including cancer.

  11. Nuclear Receptors in Neurodegenerative Diseases

    PubMed Central

    Skerrett, Rebecca; Malm, Tarja; Landreth, Gary

    2014-01-01

    Nuclear receptors have generated substantial interest in the past decade as potential therapeutic targets for the treatment of neurodegenerative disorders. Despite years of effort, effective treatments for progressive neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease and ALS remain elusive, making non-classical drug targets such as nuclear receptors an attractive alternative. A substantial literature in mouse models of disease and several clinical trials have investigated the role of nuclear receptors in various neurodegenerative disorders, most prominently AD. These studies have met with mixed results, yet the majority of studies in mouse models report positive outcomes. The mechanisms by which nuclear receptor agonists affect disease pathology remain unclear. Deciphering the complex signaling underlying nuclear receptor action in neurodegenerative diseases is essential for understanding this variability in preclinical studies, and for the successful translation of nuclear receptor agonists into clinical therapies. PMID:24874548

  12. Expression and Functional Pathway Analysis of Nuclear Receptor NR2F2 in Ovarian Cancer

    PubMed Central

    Hawkins, Shannon M.; Loomans, Holli A.; Wan, Ying-Wooi; Ghosh-Choudhury, Triparna; Coffey, Donna; Xiao, Weimin; Liu, Zhandong; Sangi-Haghpeykar, Haleh

    2013-01-01

    Context: Recent evidence implicates the orphan nuclear receptor, nuclear receptor subfamily 2, group F, member 2 (NR2F2; chicken ovalbumin upstream promoter-transcription factor II) as both a master regulator of angiogenesis and an oncogene in prostate and other human cancers. Objective: The objective of the study was to determine whether NR2F2 plays a role in ovarian cancer and dissect its potential mechanisms of action. Design, Setting, and Patients: We examined NR2F2 expression in healthy ovary and ovarian cancers using quantitative PCR and immunohistochemistry. NR2F2 expression was targeted in established ovarian cancer cell lines to assess the impact of dysregulated NR2F2 expression in the epithelial compartment of ovarian cancers. Results: Our results indicate that NR2F2 is robustly expressed in the stroma of healthy ovary with little or no expression in epithelia lining the ovarian surface, clefts, or crypts. This pattern of NR2F2 expression was markedly disrupted in ovarian cancers, in which decreased levels of stromal expression and ectopic epithelial expression were frequently observed. Ovarian cancers with the most disrupted patterns of NR2F2 were associated with significantly shorter disease-free interval by Kaplan-Meier analysis. Targeting NR2F2 expression in established ovarian cancer cell lines enhanced apoptosis and increased proliferation. In addition, we found that NR2F2 regulates the expression of NEK2, RAI14, and multiple other genes involved in the cell cycle, suggesting potential pathways by which dysregulated expression of NR2F2 impacts ovarian cancer. Conclusions: These results uncover novel roles for NR2F2 in ovarian cancer and point to a unique scenario in which a single nuclear receptor plays potentially distinct roles in the stromal and epithelial compartments of the same tissue. PMID:23690307

  13. Nuclear Receptors, RXR, and the Big Bang.

    PubMed

    Evans, Ronald M; Mangelsdorf, David J

    2014-03-27

    Isolation of genes encoding the receptors for steroids, retinoids, vitamin D, and thyroid hormone and their structural and functional analysis revealed an evolutionarily conserved template for nuclear hormone receptors. This discovery sparked identification of numerous genes encoding related proteins, termed orphan receptors. Characterization of these orphan receptors and, in particular, of the retinoid X receptor (RXR) positioned nuclear receptors at the epicenter of the "Big Bang" of molecular endocrinology. This Review provides a personal perspective on nuclear receptors and explores their integrated and coordinated signaling networks that are essential for multicellular life, highlighting the RXR heterodimer and its associated ligands and transcriptional mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Dietary fat and fiber interact to uniquely modify global histone post-translational epigenetic programming in a rat colon cancer progression model.

    PubMed

    Triff, Karen; McLean, Mathew W; Callaway, Evelyn; Goldsby, Jennifer; Ivanov, Ivan; Chapkin, Robert S

    2018-04-16

    Dietary fermentable fiber generates short-chain fatty acids (SCFA), e.g., butyrate, in the colonic lumen which serves as a chemoprotective histone deacetylase inhibitor and/or as an acetylation substrate for histone acetylases. In addition, n-3 polyunsaturated fatty acids (n-3 PUFA) in fish oil can affect the chromatin landscape by acting as ligands for tumor suppressive nuclear receptors. In an effort to gain insight into the global dimension of post-translational modification of histones (including H3K4me3 and H3K9ac) and clarify the chemoprotective impact of dietary bioactive compounds on transcriptional control in a preclinical model of colon cancer, we generated high-resolution genome-wide RNA (RNA-Seq) and "chromatin-state" (H3K4me3-seq and H3K9ac-seq) maps for intestinal (epithelial colonocytes) crypts in rats treated with a colon carcinogen and fed diets containing bioactive (i) fish oil, (ii) fermentable fiber (a rich source of SCFA), (iii) a combination of fish oil plus pectin or (iv) control, devoid of fish oil or pectin. In general, poor correlation was observed between differentially transcribed (DE) and enriched genes (DERs) at multiple epigenetic levels. The combinatorial diet (fish oil + pectin) uniquely affected transcriptional profiles in the intestinal epithelium, e.g., upregulating lipid catabolism and beta-oxidation associated genes. These genes were linked to activated ligand-dependent nuclear receptors associated with n-3 PUFA and were also correlated with the mitochondrial L-carnitine shuttle and the inhibition of lipogenesis. These findings demonstrate that the chemoprotective fish oil + pectin combination diet uniquely induces global histone state modifications linked to the expression of chemoprotective genes. This article is protected by copyright. All rights reserved. © 2018 UICC.

  15. Nuclear positioning rather than contraction controls ordered rearrangements of immunoglobulin loci.

    PubMed

    Rother, Magdalena B; Palstra, Robert-Jan; Jhunjhunwala, Suchit; van Kester, Kevin A M; van IJcken, Wilfred F J; Hendriks, Rudi W; van Dongen, Jacques J M; Murre, Cornelis; van Zelm, Menno C

    2016-01-08

    Progenitor-B cells recombine their immunoglobulin (Ig) loci to create unique antigen receptors. Despite a common recombination machinery, the Ig heavy and Ig light chain loci rearrange in a stepwise manner. We studied pre-pro-B cells and Rag(-/-) progenitor-B cells to determine whether Ig locus contraction or nuclear positioning is decisive for stepwise rearrangements. We found that both Ig loci were contracted in pro-B and pre-B cells. Igh relocated from the nuclear lamina to central domains only at the pro-B cell stage, whereas, Igκ remained sequestered at the lamina, and only at the pre-B cell stage located to central nuclear domains. Finally, in vitro induced re-positioning of Ig alleles away from the nuclear periphery increased germline transcription of Ig loci in pre-pro-B cells. Thus, Ig locus contraction juxtaposes genomically distant elements to mediate efficient recombination, however, sequential positioning of Ig loci away from the nuclear periphery determines stage-specific accessibility of Ig loci. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. CL 316, 243 mediated reductions in blood glucose are enhanced in RIP140{sup −/−} mice independent of alterations in lipolysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peppler, Willem T.; Miotto, Paula M.; Holloway, Graham P.

    The β-3 adrenergic agonist CL 316, 243 acutely lowers blood glucose through a mechanism thought to involve fatty-acid induced insulin release. The purpose of this study was to determine if ablation of the nuclear receptor, receptor-inactivating protein 140 (RIP140), altered this response. Here, we used a single injection of CL 316, 243 (1 mg/kg) and found that whole body RIP140{sup −/−} mice had a greater decline in blood glucose over 2 h. This occurred alongside increased hexokinase II (HKII) protein content in adipose tissue and skeletal muscle, but independent of changes in circulating insulin or indices of lipolysis. These data indicate thatmore » RIP140 has a unique role in the acute effect of β-3 adrenergic receptor activation using CL 316, 243.« less

  17. Role of Mex67-Mtr2 in the Nuclear Export of 40S Pre-Ribosomes

    PubMed Central

    Occhipinti, Laura; Kemmler, Stefan; Panse, Vikram G.

    2012-01-01

    Nuclear export of mRNAs and pre-ribosomal subunits (pre40S and pre60S) is fundamental to all eukaryotes. While genetic approaches in budding yeast have identified bona fide export factors for mRNAs and pre60S subunits, little is known regarding nuclear export of pre40S subunits. The yeast heterodimeric transport receptor Mex67-Mtr2 (TAP-p15 in humans) binds mRNAs and pre60S subunits in the nucleus and facilitates their passage through the nuclear pore complex (NPC) into the cytoplasm by interacting with Phe-Gly (FG)-rich nucleoporins that line its transport channel. By exploiting a combination of genetic, cell-biological, and biochemical approaches, we uncovered an unanticipated role of Mex67-Mtr2 in the nuclear export of 40S pre-ribosomes. We show that recruitment of Mex67-Mtr2 to pre40S subunits requires loops emanating from its NTF2-like domains and that the C-terminal FG-rich nucleoporin interacting UBA-like domain within Mex67 contributes to the transport of pre40S subunits to the cytoplasm. Remarkably, the same loops also recruit Mex67-Mtr2 to pre60S subunits and to the Nup84 complex, the respective interactions crucial for nuclear export of pre60S subunits and mRNAs. Thus Mex67-Mtr2 is a unique transport receptor that employs a common interaction surface to participate in the nuclear export of both pre-ribosomal subunits and mRNAs. Mex67-Mtr2 could engage a regulatory crosstalk among the three major export pathways for optimal cellular growth and proliferation. PMID:22956913

  18. Nuclear Receptor Coactivator Function in Reproductive Physiology and Behavior

    PubMed Central

    Molenda, Heather A.; Kilts, Caitlin P.; Allen, Rachel L.; Tetel, Marc J.

    2009-01-01

    Gonadal steroid hormones act throughout the body to elicit changes in gene expression that result in profound effects on reproductive physiology and behavior. Steroid hormones exert many of these effects by binding to their respective intracellular receptors, which are members of a nuclear receptor superfamily of transcriptional activators. A variety of in vitro studies indicate that nuclear receptor coactivators are required for efficient transcriptional activity of steroid receptors. Many of these coactivators are found in a variety of steroid hormone-responsive reproductive tissues, including the reproductive tract, mammary gland, and brain. While many nuclear receptor coactivators have been investigated in vitro, we are only now beginning to understand their function in reproductive physiology and behavior. In this review, we discuss the general mechanisms of action of nuclear receptor coactivators in steroid-dependent gene transcription. We then review some recent and exciting findings on the function of nuclear receptor coactivators in steroid-dependent brain development and reproductive physiology and behavior. PMID:12855594

  19. Identification of Gene Markers for Activation of the Nuclear Receptor Pregnane X Receptor

    EPA Science Inventory

    Many environmentally-relevant chemicals and drugs activate the nuclear receptor pregnane X receptor (PXR). Activation of PXR in the mouse liver can lead to increases in liver weight in part through increased hepatocyte replication similar to chemicals that activate other nuclear ...

  20. Components of the CCR4-NOT complex function as nuclear hormone receptor coactivators via association with the NRC-interacting Factor NIF-1.

    PubMed

    Garapaty, Shivani; Mahajan, Muktar A; Samuels, Herbert H

    2008-03-14

    CCR4-NOT is an evolutionarily conserved, multicomponent complex known to be involved in transcription as well as mRNA degradation. Various subunits (e.g. CNOT1 and CNOT7/CAF1) have been reported to be involved in influencing nuclear hormone receptor activities. Here, we show that CCR4/CNOT6 and RCD1/CNOT9, members of the CCR4-NOT complex, potentiate nuclear receptor activity. RCD1 interacts in vivo and in vitro with NIF-1 (NRC-interacting factor), a previously characterized nuclear receptor cotransducer that activates nuclear receptors via its interaction with NRC. As with NIF-1, RCD1 and CCR4 do not directly associate with nuclear receptors; however, they enhance ligand-dependent transcriptional activation by nuclear hormone receptors. CCR4 mediates its effect through the ligand binding domain of nuclear receptors and small interference RNA-mediated silencing of endogenous CCR4 results in a marked decrease in nuclear receptor activation. Furthermore, knockdown of CCR4 results in an attenuated stimulation of RARalpha target genes (e.g. Sox9 and HoxA1) as shown by quantitative PCR assays. The silencing of endogenous NIF-1 also resulted in a comparable decrease in the RAR-mediated induction of both Sox9 and HoxA1. Furthermore, CCR4 associates in vivo with NIF-1. In addition, the CCR4-enhanced transcriptional activation by nuclear receptors is dependent on NIF-1. The small interference RNA-mediated knockdown of NIF-1 blocks the ligand-dependent potentiating effect of CCR4. Our results suggest that CCR4 plays a role in the regulation of certain endogenous RARalpha target genes and that RCD1 and CCR4 might mediate their function through their interaction with NIF-1.

  1. Protein kinase A is part of a mechanism that regulates nuclear reimport of the nuclear tRNA export receptors Los1p and Msn5p.

    PubMed

    Pierce, Jacqueline B; van der Merwe, George; Mangroo, Dev

    2014-02-01

    The two main signal transduction mechanisms that allow eukaryotes to sense and respond to changes in glucose availability in the environment are the cyclic AMP (cAMP)/protein kinase A (PKA) and AMP-activated protein kinase (AMPK)/Snf1 kinase-dependent pathways. Previous studies have shown that the nuclear tRNA export process is inhibited in Saccharomyces cerevisiae deprived of glucose. However, the signal transduction pathway involved and the mechanism by which glucose availability regulates nuclear-cytoplasmic tRNA trafficking are not understood. Here, we show that inhibition of nuclear tRNA export is caused by a block in nuclear reimport of the tRNA export receptors during glucose deprivation. Cytoplasmic accumulation of the tRNA export receptors during glucose deprivation is not caused by activation of Snf1p. Evidence obtained suggests that PKA is part of the mechanism that regulates nuclear reimport of the tRNA export receptors in response to glucose availability. This mechanism does not appear to involve phosphorylation of the nuclear tRNA export receptors by PKA. The block in nuclear reimport of the tRNA export receptors appears to be caused by activation of an unidentified mechanism when PKA is turned off during glucose deprivation. Taken together, the data suggest that PKA facilitates return of the tRNA export receptors to the nucleus by inhibiting an unidentified activity that facilitates cytoplasmic accumulation of the tRNA export receptors when glucose in the environment is limiting. A PKA-independent mechanism was also found to regulate nuclear tRNA export in response to glucose availability. This mechanism, however, does not regulate nuclear reimport of the tRNA export receptors.

  2. Protein Kinase A Is Part of a Mechanism That Regulates Nuclear Reimport of the Nuclear tRNA Export Receptors Los1p and Msn5p

    PubMed Central

    Pierce, Jacqueline B.; van der Merwe, George

    2014-01-01

    The two main signal transduction mechanisms that allow eukaryotes to sense and respond to changes in glucose availability in the environment are the cyclic AMP (cAMP)/protein kinase A (PKA) and AMP-activated protein kinase (AMPK)/Snf1 kinase-dependent pathways. Previous studies have shown that the nuclear tRNA export process is inhibited in Saccharomyces cerevisiae deprived of glucose. However, the signal transduction pathway involved and the mechanism by which glucose availability regulates nuclear-cytoplasmic tRNA trafficking are not understood. Here, we show that inhibition of nuclear tRNA export is caused by a block in nuclear reimport of the tRNA export receptors during glucose deprivation. Cytoplasmic accumulation of the tRNA export receptors during glucose deprivation is not caused by activation of Snf1p. Evidence obtained suggests that PKA is part of the mechanism that regulates nuclear reimport of the tRNA export receptors in response to glucose availability. This mechanism does not appear to involve phosphorylation of the nuclear tRNA export receptors by PKA. The block in nuclear reimport of the tRNA export receptors appears to be caused by activation of an unidentified mechanism when PKA is turned off during glucose deprivation. Taken together, the data suggest that PKA facilitates return of the tRNA export receptors to the nucleus by inhibiting an unidentified activity that facilitates cytoplasmic accumulation of the tRNA export receptors when glucose in the environment is limiting. A PKA-independent mechanism was also found to regulate nuclear tRNA export in response to glucose availability. This mechanism, however, does not regulate nuclear reimport of the tRNA export receptors. PMID:24297441

  3. Nuclear receptors in bile acid metabolism

    PubMed Central

    Li, Tiangang; Chiang, John Y. L.

    2013-01-01

    Bile acids are signaling molecules that activate nuclear receptors, such as farnesoid X receptor, pregnane X receptor, constitutive androstane receptor, and vitamin D receptor, and play a critical role in the regulation of lipid, glucose, energy, and drug metabolism. These xenobiotic/endobiotic-sensing nuclear receptors regulate phase I oxidation, phase II conjugation, and phase III transport in bile acid and drug metabolism in the digestive system. Integration of bile acid metabolism with drug metabolism controls absorption, transport, and metabolism of nutrients and drugs to maintain metabolic homeostasis and also protects against liver injury, inflammation, and related metabolic diseases, such as nonalcoholic fatty liver disease, diabetes, and obesity. Bile-acid–based drugs targeting nuclear receptors are in clinical trials for treating cholestatic liver diseases and fatty liver disease. PMID:23330546

  4. REV-ERB and ROR nuclear receptors as drug targets

    PubMed Central

    Kojetin, Douglas J.; Burris, Thomas P.

    2016-01-01

    The nuclear receptors REV-ERB (consisting of REV-ERBα and REV-ERBβ) and retinoic acid receptor-related orphan receptors (RORs; consisting of RORα, RORβ and RORγ) are involved in many physiological processes, including regulation of metabolism, development and immunity as well as the circadian rhythm. The recent characterization of endogenous ligands for these former orphan nuclear receptors has stimulated the development of synthetic ligands and opened up the possibility of targeting these receptors to treat several diseases, including diabetes, atherosclerosis, autoimmunity and cancer. This Review focuses on the latest developments in ROR and REV-ERB pharmacology indicating that these nuclear receptors are druggable targets and that ligands targeting these receptors may be useful in the treatment of several disorders. PMID:24577401

  5. Differential Sox10 Genomic Occupancy in Myelinating Glia

    PubMed Central

    Lopez-Anido, Camila; Sun, Guannan; Koenning, Matthias; Srinivasan, Rajini; Hung, Holly A.; Emery, Ben; Keles, Sunduz; Svaren, John

    2015-01-01

    Myelin is formed by specialized myelinating glia: oligodendrocytes and Schwann cells in the central and peripheral nervous systems, respectively. While there are distinct developmental aspects and regulatory pathways in these two cell types, myelination in both systems requires the transcriptional activator Sox10. Sox10 interacts with cell type-specific transcription factors at some loci to induce myelin gene expression, but it is largely unknown how Sox10 transcriptional networks globally compare between oligodendrocytes and Schwann cells. We used in vivo ChIP-Seq analysis of spinal cord and peripheral nerve (sciatic nerve) to identify unique and shared Sox10 binding sites and assess their correlation with active enhancers and transcriptional profiles in oligodendrocytes and Schwann cells. Sox10 binding sites overlap with active enhancers and critical cell type-specific regulators of myelination, such as Olig2 and Myrf in oligodendrocytes, and Egr2/Krox20 in Schwann cells. Sox10 sites also associate with genes critical for myelination in both oligodendrocytes and Schwann cells, and are found within super-enhancers previously defined in brain. In Schwann cells, Sox10 sites contain binding motifs of putative partners in the Sp/Klf, Tead, and nuclear receptor protein families. Specifically, siRNA analysis of nuclear receptors Nr2f1 and Nr2f2 revealed downregulation of myelin genes Mbp and Ndrg1 in primary Schwann cells. Our analysis highlights different mechanisms that establish cell type-specific genomic occupancy of Sox10, which reflects the unique characteristics of oligodendrocyte and Schwann cell differentiation. PMID:25974668

  6. Role of molecular chaperones and TPR-domain proteins in the cytoplasmic transport of steroid receptors and their passage through the nuclear pore.

    PubMed

    Galigniana, Mario D; Echeverría, Pablo C; Erlejman, Alejandra G; Piwien-Pilipuk, Graciela

    2010-01-01

    In the absence of hormone, corticosteroid receptors such as GR (glucocorticoid receptor) and (mineralocorticoid receptor) are primarily located in the cytoplasm. Upon steroid-binding, they rapidly accumulate in the nucleus. Regardless of their primary location, these receptors and many other nuclear factors undergo a constant and dynamic nucleocytoplasmic shuttling. All members of the steroid receptor family are known to form large oligomeric structures with the heat-shock proteins of 90-kDa (hsp90) and 70-kDa (hsp70), the small acidic protein p23, and a tetratricopeptide repeat (TPR) -domain protein such as FK506-binding proteins (FKBPs), cyclophilins (CyPs) or the serine/threonine protein phosphatase 5 (PP5). It has always been stated that the dissociation of the chaperone heterocomplex (a process normally referred to as receptor "transformation") is the first step that permits the nuclear import of steroid receptors. However the experimental evidence is consistent with a model where the chaperone machinery is required for the retrotransport of the receptor through the cytoplasm and also facilitates the passage through the nuclear pore. Recent evidence indicates that the hsp90-based chaperone system also interacts with structures of the nuclear pore such as importin β and the integral nuclear pore glycoprotein Nup62 facilitating the passage of the untransformed receptor through the nuclear pore.

  7. The role of DAB2IP in androgen receptor activation during prostate cancer progression.

    PubMed

    Wu, K; Liu, J; Tseng, S-F; Gore, C; Ning, Z; Sharifi, N; Fazli, L; Gleave, M; Kapur, P; Xiao, G; Sun, X; Oz, O K; Min, W; Alexandrakis, G; Yang, C-R; Hsieh, C-L; Wu, H-C; He, D; Xie, D; Hsieh, J-T

    2014-04-10

    Altered androgen-receptor (AR) expression and/or constitutively active AR are commonly associated with prostate cancer (PCa) progression. Targeting AR remains a focal point for designing new strategy of PCa therapy. Here, we have shown that DAB2IP, a novel tumor suppressor in PCa, can inhibit AR-mediated cell growth and gene activation in PCa cells via distinct mechanisms. DAB2IP inhibits the genomic pathway by preventing AR nuclear translocation or phosphorylation and suppresses the non-genomic pathway via its unique functional domain to inactivate c-Src. Also, DAB2IP is capable of suppressing AR activation in an androgen-independent manner. In addition, DAB2IP can inhibit several AR splice variants showing constitutive activity in PCa cells. In DAB2IP(-/-) mice, the prostate gland exhibits hyperplastic epithelia, in which AR becomes more active. Consistently, DAB2IP expression inversely correlates with AR activation status particularly in recurrent or metastatic PCa patients. Taken together, DAB2IP is a unique intrinsic AR modulator in normal cells, and likely can be further developed into a therapeutic agent for PCa.

  8. Rational Quantitative Structure-Activity Relationship (RQSAR) Screen for PXR and CAR Isoform-Specific Nuclear Receptor Ligands

    PubMed Central

    Dring, Ann M.; Anderson, Linnea E.; Qamar, Saima; Stoner, Matthew A.

    2010-01-01

    Constitutive androstane receptor (CAR) and pregnane X receptor (PXR) are closely related orphan nuclear receptor proteins that share several ligands and target overlapping sets of genes involved in homeostasis and all phases of drug metabolism. CAR and PXR are involved in the development of certain diseases, including diabetes, metabolic syndrome and obesity. Ligand screens for these receptors so far have typically focused on steroid hormone analogs with pharmacophore-based approaches, only to find relatively few new hits. Multiple CAR isoforms have been detected in human liver, with the most abundant being the constitutively active reference, CAR1, and the ligand-dependent isoform CAR3. It has been assumed that any compound that binds CAR1 should also activate CAR3, and so CAR3 can be used as a ligand-activated surrogate for CAR1 studies. The possibility of CAR3-specific ligands has not, so far, been addressed. To investigate the differences between CAR1, CAR3 and PXR, and to look for more CAR ligands that may be of use in quantitative structure-activity relationship (QSAR) studies, we performed a luciferase transactivation assay screen of 60 mostly non-steroid compounds. Known active compounds with different core chemistries were chosen as starting points and structural variants were rationally selected for screening. Distinct differences in agonist versus inverse agonist/antagonist effects were seen in 49 compounds that had some ligand effect on at least one receptor and 18 that had effects on all three receptors; eight were CAR1 ligands only, three were CAR3 only ligands and four affected PXR only. This work provides evidence for new CAR ligands, some of which have CAR3-specific effects, and provides observational data on CAR and PXR ligands with which to inform in silico strategies. Compounds that demonstrated unique activity on any one receptor are potentially valuable diagnostic tools for the investigation of in vivo molecular targets. PMID:20869355

  9. NR4A nuclear receptors support memory enhancement by histone deacetylase inhibitors

    PubMed Central

    Hawk, Joshua D.; Bookout, Angie L.; Poplawski, Shane G.; Bridi, Morgan; Rao, Allison J.; Sulewski, Michael E.; Kroener, Brian T.; Manglesdorf, David J.; Abel, Ted

    2012-01-01

    The formation of a long-lasting memory requires a transcription-dependent consolidation period that converts a short-term memory into a long-term memory. Nuclear receptors compose a class of transcription factors that regulate diverse biological processes, and several nuclear receptors have been implicated in memory formation. Here, we examined the potential contribution of nuclear receptors to memory consolidation by measuring the expression of all 49 murine nuclear receptors after learning. We identified 13 nuclear receptors with increased expression after learning, including all 3 members of the Nr4a subfamily. These CREB-regulated Nr4a genes encode ligand-independent “orphan” nuclear receptors. We found that blocking NR4A activity in memory-supporting brain regions impaired long-term memory but did not impact short-term memory in mice. Further, expression of Nr4a genes increased following the memory-enhancing effects of histone deacetylase (HDAC) inhibitors. Blocking NR4A signaling interfered with the ability of HDAC inhibitors to enhance memory. These results demonstrate that the Nr4a gene family contributes to memory formation and is a promising target for improving cognitive function. PMID:22996661

  10. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    PubMed

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  11. Targeting nuclear receptors for the treatment of fatty liver disease.

    PubMed

    Tanaka, Naoki; Aoyama, Toshifumi; Kimura, Shioko; Gonzalez, Frank J

    2017-11-01

    Ligand-activated nuclear receptors, including peroxisome proliferator-activated receptor alpha (PPARα), pregnane X receptor, and constitutive androstane receptor, were first identified as key regulators of the responses against chemical toxicants. However, numerous studies using mouse disease models and human samples have revealed critical roles for these receptors and others, such as PPARβ/δ, PPARγ, farnesoid X receptor (FXR), and liver X receptor (LXR), in maintaining nutrient/energy homeostasis in part through modulation of the gut-liver-adipose axis. Recently, disorders associated with disrupted nutrient/energy homeostasis, e.g., obesity, metabolic syndrome, and non-alcoholic fatty liver disease (NAFLD), are increasing worldwide. Notably, in NAFLD, a progressive subtype exists, designated as non-alcoholic steatohepatitis (NASH) that is characterized by typical histological features resembling alcoholic steatohepatitis (ASH), and NASH/ASH are recognized as major causes of hepatitis virus-unrelated liver cirrhosis and hepatocellular carcinoma. Since hepatic steatosis is basically caused by an imbalance between fat/energy influx and utilization, abnormal signaling of these nuclear receptors contribute to the pathogenesis of fatty liver disease. Standard therapeutic interventions have not been fully established for fatty liver disease, but some new agents that activate or inhibit nuclear receptor signaling have shown promise as possible therapeutic targets. In this review, we summarize recent findings on the roles of nuclear receptors in fatty liver disease and discuss future perspectives to develop promising pharmacological strategies targeting nuclear receptors for NAFLD/NASH. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Computational identification of post-translational modification-based nuclear import regulations by characterizing nuclear localization signal-import receptor interaction.

    PubMed

    Lin, Jhih-Rong; Liu, Zhonghao; Hu, Jianjun

    2014-10-01

    The binding affinity between a nuclear localization signal (NLS) and its import receptor is closely related to corresponding nuclear import activity. PTM-based modulation of the NLS binding affinity to the import receptor is one of the most understood mechanisms to regulate nuclear import of proteins. However, identification of such regulation mechanisms is challenging due to the difficulty of assessing the impact of PTM on corresponding nuclear import activities. In this study we proposed NIpredict, an effective algorithm to predict nuclear import activity given its NLS, in which molecular interaction energy components (MIECs) were used to characterize the NLS-import receptor interaction, and the support vector regression machine (SVR) was used to learn the relationship between the characterized NLS-import receptor interaction and the corresponding nuclear import activity. Our experiments showed that nuclear import activity change due to NLS change could be accurately predicted by the NIpredict algorithm. Based on NIpredict, we developed a systematic framework to identify potential PTM-based nuclear import regulations for human and yeast nuclear proteins. Application of this approach has identified the potential nuclear import regulation mechanisms by phosphorylation of two nuclear proteins including SF1 and ORC6. © 2014 Wiley Periodicals, Inc.

  13. The Orphan Nuclear Receptor TR4 Is a Vitamin A-activated Nuclear Receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, X. Edward; Suino-Powell, Kelly M.; Xu, Yong

    2015-11-30

    Testicular receptors 2 and 4 (TR2/4) constitute a subgroup of orphan nuclear receptors that play important roles in spermatogenesis, lipid and lipoprotein regulation, and the development of the central nervous system. Currently, little is known about the structural features and the ligand regulation of these receptors. Here we report the crystal structure of the ligand-free TR4 ligand binding domain, which reveals an autorepressed conformation. The ligand binding pocket of TR4 is filled by the C-terminal half of helix 10, and the cofactor binding site is occupied by the AF-2 helix, thus preventing ligand-independent activation of the receptor. However, TR4 exhibitsmore » constitutive transcriptional activity on multiple promoters, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, or ligand binding substantially reduce the transcriptional activity of this receptor. Importantly, both retinol and retinoic acid are able to promote TR4 to recruit coactivators and to activate a TR4-regulated reporter. These findings demonstrate that TR4 is a ligand-regulated nuclear receptor and suggest that retinoids might have a much wider regulatory role via activation of orphan receptors such as TR4.« less

  14. Evolution of the nuclear receptor gene superfamily.

    PubMed Central

    Laudet, V; Hänni, C; Coll, J; Catzeflis, F; Stéhelin, D

    1992-01-01

    Nuclear receptor genes represent a large family of genes encoding receptors for various hydrophobic ligands such as steroids, vitamin D, retinoic acid and thyroid hormones. This family also contains genes encoding putative receptors for unknown ligands. Nuclear receptor gene products are composed of several domains important for transcriptional activation, DNA binding (C domain), hormone binding and dimerization (E domain). It is not known whether these genes have evolved through gene duplication from a common ancestor or if their different domains came from different independent sources. To test these possibilities we have constructed and compared the phylogenetic trees derived from two different domains of 30 nuclear receptor genes. The tree built from the DNA binding C domain clearly shows a common progeny of all nuclear receptors, which can be grouped into three subfamilies: (i) thyroid hormone and retinoic acid receptors, (ii) orphan receptors and (iii) steroid hormone receptors. The tree constructed from the central part of the E domain which is implicated in transcriptional regulation and dimerization shows the same distribution in three subfamilies but two groups of receptors are in a different position from that in the C domain tree: (i) the Drosophila knirps family genes have acquired very different E domains during evolution, and (ii) the vitamin D and ecdysone receptors, as well as the FTZ-F1 and the NGF1B genes, seem to have DNA binding and hormone binding domains belonging to different classes. These data suggest a complex evolutionary history for nuclear receptor genes in which gene duplication events and swapping between domains of different origins took place. PMID:1312460

  15. Lipid-sensors, enigmatic-orphan and orphan nuclear receptors as therapeutic targets in breast-cancer.

    PubMed

    Garattini, Enrico; Bolis, Marco; Gianni', Maurizio; Paroni, Gabriela; Fratelli, Maddalena; Terao, Mineko

    2016-07-05

    Breast-cancer is heterogeneous and consists of various groups with different biological characteristics. Innovative pharmacological approaches accounting for this heterogeneity are needed. The forty eight human Nuclear-Hormone-Receptors are ligand-dependent transcription-factors and are classified into Endocrine-Receptors, Adopted-Orphan-Receptors (Lipid-sensors and Enigmatic-Orphans) and Orphan-receptors. Nuclear-Receptors represent ideal targets for the design/synthesis of pharmacological ligands. We provide an overview of the literature available on the expression and potential role played by Lipid-sensors, Enigmatic-Orphans and Orphan-Receptors in breast-cancer. The data are complemented by an analysis of the expression levels of each selected Nuclear-Receptor in the PAM50 breast-cancer groups, following re-elaboration of the data publicly available. The major aim is to support the idea that some of the Nuclear-Receptors represent largely unexploited therapeutic-targets in breast-cancer treatment/chemo-prevention. On the basis of our analysis, we conclude that the Lipid-Sensors, NR1C3, NR1H2 and NR1H3 are likely to be onco-suppressors in breast-cancer. The Enigmatic-Orphans, NR1F1 NR2A1 and NR3B3 as well as the Orphan-Receptors, NR0B1, NR0B2, NR1D1, NR2F1, NR2F2 and NR4A3 exert a similar action. These Nuclear-Receptors represent candidates for the development of therapeutic strategies aimed at increasing their expression or activating them in tumor cells. The group of Nuclear-Receptors endowed with potential oncogenic properties consists of the Lipid-Sensors, NR1C2 and NR1I2, the Enigmatic-Orphans, NR1F3, NR3B1 and NR5A2, as well as the Orphan-Receptors, NR2E1, NR2E3 and NR6A1. These oncogenic Nuclear-Receptors should be targeted with selective antagonists, reverse-agonists or agents/strategies capable of reducing their expression in breast-cancer cells.

  16. Panning for SNuRMs: using cofactor profiling for the rational discovery of selective nuclear receptor modulators.

    PubMed

    Kremoser, Claus; Albers, Michael; Burris, Thomas P; Deuschle, Ulrich; Koegl, Manfred

    2007-10-01

    Drugs that target nuclear receptors are clinically, as well as commercially, successful. Their widespread use, however, is limited by an inherent propensity of nuclear receptors to trigger beneficial, as well as adverse, pharmacological effects upon drug activation. Hence, selective drugs that display reduced adverse effects, such as the selective estrogen receptor modulator (SERM) Raloxifene, have been developed by guidance through classical cell culture assays and animal trials. Full agonist and selective modulator nuclear receptor drugs, in general, differ by their ability to recruit certain cofactors to the receptor protein. Hence, systematic cofactor profiling is advancing into an approach for the rationally guided identification of selective NR modulators (SNuRMs) with improved therapeutic ratio.

  17. A nuclear-receptor-dependent phosphatidylcholine pathway with antidiabetic effects

    USDA-ARS?s Scientific Manuscript database

    Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (also known as NR5A2) regulates bile acid biosynthesis. Structural studies have identified phospholipids as potential LRH-1 ligands, but their functional relevance is unclear. Here we show that an unu...

  18. PRIC320, a transcription coactivator, isolated from peroxisome proliferator-binding protein complex.

    PubMed

    Surapureddi, Sailesh; Viswakarma, Navin; Yu, Songtao; Guo, Dongsheng; Rao, M Sambasiva; Reddy, Janardan K

    2006-05-05

    Ciprofibrate, a potent peroxisome proliferator, induces pleiotropic responses in liver by activating peroxisome proliferator-activated receptor alpha (PPARalpha), a nuclear receptor. Transcriptional regulation by liganded nuclear receptors involves the participation of coregulators that form multiprotein complexes possibly to achieve cell and gene specific transcription. SDS-PAGE and matrix-assisted laser desorption/ionization reflection time-of-flight mass spectrometric analyses of ciprofibrate-binding proteins from liver nuclear extracts obtained using ciprofibrate-Sepharose affinity matrix resulted in the identification of a new high molecular weight nuclear receptor coactivator, which we designated PRIC320. The full-length human cDNA encoding this protein has an open-reading frame that codes for a 320kDa protein containing 2882 amino acids. PRIC320 contains five LXXLL signature motifs that mediate interaction with nuclear receptors. PRIC320 binds avidly to nuclear receptors PPARalpha, CAR, ERalpha, and RXR, but only minimally with PPARgamma. PRIC320 also interacts with transcription cofactors CBP, PRIP, and PBP. Immunoprecipitation-immunoblotting as well as cellular localization studies confirmed the interaction between PPARalpha and PRIC320. PRIC320 acts as a transcription coactivator by stimulating PPARalpha-mediated transcription. We conclude that ciprofibrate, a PPARalpha ligand, binds a multiprotein complex and PRIC320 cloned from this complex functions as a nuclear receptor coactivator.

  19. Natural compounds regulate energy metabolism by the modulating the activity of lipid-sensing nuclear receptors.

    PubMed

    Goto, Tsuyoshi; Kim, Young-Il; Takahashi, Nobuyuki; Kawada, Teruo

    2013-01-01

    Obesity causes excess fat accumulation in various tissues, most notoriously in the adipose tissue, along with other insulin-responsive organs such as skeletal muscle and the liver, which predisposes an individual to the development of metabolic abnormalities. The molecular mechanisms underlying obesity-induced metabolic abnormalities have not been completely elucidated; however, in recent years, the search for therapies to prevent the development of obesity and obesity-associated metabolic disorders has increased. It is known that several nuclear receptors, when activated by specific ligands, regulate carbohydrate and lipid metabolism at the transcriptional level. The expression of lipid metabolism-related enzymes is directly regulated by the activity of various nuclear receptors via their interaction with specific response elements in promoters of those genes. Many natural compounds act as ligands of nuclear receptors and regulate carbohydrate and lipid metabolism by regulating the activities of these nuclear receptors. In this review, we describe our current knowledge of obesity, the role of lipid-sensing nuclear receptors in energy metabolism, and several examples of food factors that act as agonists or antagonists of nuclear receptors, which may be useful for the management of obesity and the accompanying energy metabolism abnormalities. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Med1 subunit of the mediator complex in nuclear receptor-regulated energy metabolism, liver regeneration, and hepatocarcinogenesis.

    PubMed

    Jia, Yuzhi; Viswakarma, Navin; Reddy, Janardan K

    2014-01-01

    Several nuclear receptors regulate diverse metabolic functions that impact on critical biological processes, such as development, differentiation, cellular regeneration, and neoplastic conversion. In the liver, some members of the nuclear receptor family, such as peroxisome proliferator-activated receptors (PPARs), constitutive androstane receptor (CAR), farnesoid X receptor (FXR), liver X receptor (LXR), pregnane X receptor (PXR), glucocorticoid receptor (GR), and others, regulate energy homeostasis, the formation and excretion of bile acids, and detoxification of xenobiotics. Excess energy burning resulting from increases in fatty acid oxidation systems in liver generates reactive oxygen species, and the resulting oxidative damage influences liver regeneration and liver tumor development. These nuclear receptors are important sensors of exogenous activators as well as receptor-specific endogenous ligands. In this regard, gene knockout mouse models revealed that some lipid-metabolizing enzymes generate PPARα-activating ligands, while others such as ACOX1 (fatty acyl-CoA oxidase1) inactivate these endogenous PPARα activators. In the absence of ACOX1, the unmetabolized ACOX1 substrates cause sustained activation of PPARα, and the resulting increase in energy burning leads to hepatocarcinogenesis. Ligand-activated nuclear receptors recruit the multisubunit Mediator complex for RNA polymerase II-dependent gene transcription. Evidence indicates that the Med1 subunit of the Mediator is essential for PPARα, PPARγ, CAR, and GR signaling in liver. Med1 null hepatocytes fail to respond to PPARα activators in that these cells do not show induction of peroxisome proliferation and increases in fatty acid oxidation enzymes. Med1-deficient hepatocytes show no increase in cell proliferation and do not give rise to liver tumors. Identification of nuclear receptor-specific coactivators and Mediator subunits should further our understanding of the complexities of metabolic diseases associated with increased energy combustion in liver.

  1. Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

    PubMed Central

    Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

    2010-01-01

    Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

  2. Studying Nuclear Receptor Complexes in the Cellular Environment.

    PubMed

    Schaufele, Fred

    2016-01-01

    The ligand-regulated structure and biochemistry of nuclear receptor complexes are commonly determined by in vitro studies of isolated receptors, cofactors, and their fragments. However, in the living cell, the complexes that form are governed not just by the relative affinities of isolated cofactors for the receptor but also by the cell-specific sequestration or concentration of subsets of competing or cooperating cofactors, receptors, and other effectors into distinct subcellular domains and/or their temporary diversion into other cellular activities. Most methods developed to understand nuclear receptor function in the cellular environment involve the direct tagging of the nuclear receptor or its cofactors with fluorescent proteins (FPs) and the tracking of those FP-tagged factors by fluorescence microscopy. One of those approaches, Förster resonance energy transfer (FRET) microscopy, quantifies the transfer of energy from a higher energy "donor" FP to a lower energy "acceptor" FP attached to a single protein or to interacting proteins. The amount of FRET is influenced by the ligand-induced changes in the proximities and orientations of the FPs within the tagged nuclear receptor complexes, which is an indicator of the structure of the complexes, and by the kinetics of the interaction between FP-tagged factors. Here, we provide a guide for parsing information about the structure and biochemistry of nuclear receptor complexes from FRET measurements in living cells.

  3. Clinical validation of nuclear factor kappa B expression in invasive breast cancer.

    PubMed

    Agrawal, Anil Kumar; Pielka, Ewa; Lipinski, Artur; Jelen, Michal; Kielan, Wojciech; Agrawal, Siddarth

    2018-01-01

    Breast cancer is the most commonly diagnosed cancer in Polish women. The expression of transcription nuclear factor kappa B, a key inducer of inflammatory response promoting carcinogenesis and cancer progression in breast cancer, is not well-established. We assessed the nuclear factor kappa B expression in a total of 119 invasive breast carcinomas and 25 healthy control samples and correlated this expression pattern with several clinical and pathologic parameters including histologic type and grade, tumor size, lymph node status, estrogen receptor status, and progesterone receptor status. The data used for the analysis were derived from medical records. An immunohistochemical analysis of nuclear factor kappa B, estrogen receptor, and progesterone receptor was carried out and evaluation of stainings was performed. The expression of nuclear factor kappa B was significantly higher than that in the corresponding healthy control samples. No statistical difference was demonstrated in nuclear factor kappa B expression in relation to age, menopausal status, lymph node status, tumor size and location, grade and histologic type of tumor, and hormonal status (estrogen receptor and progesterone receptor). Nuclear factor kappa B is significantly overexpressed in invasive breast cancer tissues. Although nuclear factor kappa B status does not correlate with clinicopathological findings, it might provide important additional information on prognosis and become a promising object for targeted therapy.

  4. Nuclear Receptor Regulation of Aquaglyceroporins in Metabolic Organs.

    PubMed

    Tardelli, Matteo; Claudel, Thierry; Bruschi, Francesca Virginia; Trauner, Michael

    2018-06-15

    Nuclear receptors, such as the farnesoid X receptor (FXR) and the peroxisome proliferator-activated receptors gamma and alpha (PPAR-γ, -α), are major metabolic regulators in adipose tissue and the liver, where they govern lipid, glucose, and bile acid homeostasis, as well as inflammatory cascades. Glycerol and free fatty acids are the end products of lipid droplet catabolism driven by PPARs. Aquaporins (AQPs), a family of 13 small transmembrane proteins, facilitate the shuttling of water, urea, and/or glycerol. The peculiar role of AQPs in glycerol transport makes them pivotal targets in lipid metabolism, especially considering their tissue-specific regulation by the nuclear receptors PPARγ and PPARα. Here, we review the role of nuclear receptors in the regulation of glycerol shuttling in liver and adipose tissue through the function and expression of AQPs.

  5. P53 nuclear stabilization is associated with FHIT loss and younger age of onset in squamous cell carcinoma of oral tongue

    PubMed Central

    2014-01-01

    Background Squamous cell carcinoma of tongue (SCCT) is expected to harbor unique clinico-pathological and molecular genetic features since a significant proportion of patients are young and exhibit no association with tobacco or alcohol. Methods We determined P53, epidermal growth factor receptor, microsatellite instability, human papilloma virus infection and loss of heterozygosity status at several tumor suppressor loci in one hundred and twenty one oral SCCT (SSCOT) samples and analyzed their association with clinico-pathological features and patient survival. Results Our results revealed a significantly higher incidence of p53 nuclear stabilization in early (as against late) onset SCCOT. FHIT loss was significantly associated with p53 nuclear stabilization and the association was stronger in patients with no history of tobacco use. Samples harboring mutation in p53 DNA binding domain or exhibiting p53 nuclear stabilization, were significantly associated with poor survival. Conclusion Our study has therefore identified distinct features in SCCOT tumorigenesis with respect to age and tobacco exposure and revealed possible prognostic utility of p53. PMID:25152695

  6. Profiling of 3696 Nuclear Receptor-Coregulator Interactions: A Resource for Biological and Clinical Discovery.

    PubMed

    Broekema, Marjoleine F; Hollman, Danielle A A; Koppen, Arjen; van den Ham, Henk-Jan; Melchers, Diana; Pijnenburg, Dirk; Ruijtenbeek, Rob; van Mil, Saskia W C; Houtman, René; Kalkhoven, Eric

    2018-06-01

    Nuclear receptors (NRs) are ligand-inducible transcription factors that play critical roles in metazoan development, reproduction, and physiology and therefore are implicated in a broad range of pathologies. The transcriptional activity of NRs critically depends on their interaction(s) with transcriptional coregulator proteins, including coactivators and corepressors. Short leucine-rich peptide motifs in these proteins (LxxLL in coactivators and LxxxIxxxL in corepressors) are essential and sufficient for NR binding. With 350 different coregulator proteins identified to date and with many coregulators containing multiple interaction motifs, an enormous combinatorial potential is present for selective NR-mediated gene regulation. However, NR-coregulator interactions have often been determined experimentally on a one-to-one basis across diverse experimental conditions. In addition, NR-coregulator interactions are difficult to predict because the molecular determinants that govern specificity are not well established. Therefore, many biologically and clinically relevant NR-coregulator interactions may remain to be discovered. Here, we present a comprehensive overview of 3696 NR-coregulator interactions by systematically characterizing the binding of 24 nuclear receptors with 154 coregulator peptides. We identified unique ligand-dependent NR-coregulator interaction profiles for each NR, confirming many well-established NR-coregulator interactions. Hierarchical clustering based on the NR-coregulator interaction profiles largely recapitulates the classification of NR subfamilies based on the primary amino acid sequences of the ligand-binding domains, indicating that amino acid sequence is an important, although not the only, molecular determinant in directing and fine-tuning NR-coregulator interactions. This NR-coregulator peptide interactome provides an open data resource for future biological and clinical discovery as well as NR-based drug design.

  7. Functional Analysis of Nuclear Estrogen Receptors in Zebrafish Reproduction by Genome Editing Approach.

    PubMed

    Lu, Huijie; Cui, Yong; Jiang, Liwen; Ge, Wei

    2017-07-01

    Estrogens signal through both nuclear and membrane receptors with most reported effects being mediated via the nuclear estrogen receptors (nERs). Although much work has been reported on nERs in the zebrafish, there is a lack of direct genetic evidence for their functional roles and importance in reproduction. To address this issue, we undertook this study to disrupt all three nERs in the zebrafish, namely esr1 (ERα), esr2a (ERβII), and esr2b (ERβI), by the genome-editing technology clustered regularly interspaced short palindromic repeats and its associated nuclease (CRISPR/Cas9). Using this loss-of-function genetic approach, we successfully created three mutant zebrafish lines with each nER knocked out. In addition, we also generated all possible double and triple knockouts of the three nERs. The phenotypes of these mutants in reproduction were analyzed in all single, double, and triple nER knockouts in both females and males. Surprisingly, all three single nER mutant fish lines display normal reproductive development and function in both females and males, suggesting functional redundancy among these nERs. Further analysis of double and triple knockouts showed that nERs, especially Esr2a and Esr2b, were essential for female reproduction, and loss of these two nERs led to an arrest of folliculogenesis at previtellogenic stage II followed by sex reversal from female to male. In addition, the current study also revealed a unique role for Esr2a in follicle cell proliferation and transdifferentiation, follicle growth, and chorion formation. Taken together, this study provides the most comprehensive genetic analysis for differential functions of esr1, esr2a, and esr2b in fish reproduction. Copyright © 2017 Endocrine Society.

  8. Cross-species extrapolation of an adverse outcome pathway for ecdysone receptor activation

    EPA Science Inventory

    Different invertebrate nuclear receptors serve as targets for a variety of environmental contaminants. One of these is the ecdysteroid receptor (EcR). Due to the important role of this nuclear receptor in regulating development and reproduction in invertebrates, particularly duri...

  9. Cross-species extrapolation of an adverse outcome pathway for ecdysteroid receptor activation

    EPA Science Inventory

    Different invertebrate nuclear receptors serve as targets for a variety of environmental contaminants. One of these is the ecdysteroid receptor (EcR). Due to the important role of this nuclear receptor in regulating development and reproduction in invertebrates, particularly duri...

  10. Balanced nuclear and cytoplasmic activities of EDS1 are required for a complete plant innate immune response.

    PubMed

    García, Ana V; Blanvillain-Baufumé, Servane; Huibers, Robin P; Wiermer, Marcel; Li, Guangyong; Gobbato, Enrico; Rietz, Steffen; Parker, Jane E

    2010-07-01

    An important layer of plant innate immunity to host-adapted pathogens is conferred by intracellular nucleotide-binding/oligomerization domain-leucine rich repeat (NB-LRR) receptors recognizing specific microbial effectors. Signaling from activated receptors of the TIR (Toll/Interleukin-1 Receptor)-NB-LRR class converges on the nucleo-cytoplasmic immune regulator EDS1 (Enhanced Disease Susceptibility1). In this report we show that a receptor-stimulated increase in accumulation of nuclear EDS1 precedes or coincides with the EDS1-dependent induction and repression of defense-related genes. EDS1 is capable of nuclear transport receptor-mediated shuttling between the cytoplasm and nucleus. By enhancing EDS1 export from inside nuclei (through attachment of an additional nuclear export sequence (NES)) or conditionally releasing EDS1 to the nucleus (by fusion to a glucocorticoid receptor (GR)) in transgenic Arabidopsis we establish that the EDS1 nuclear pool is essential for resistance to biotrophic and hemi-biotrophic pathogens and for transcriptional reprogramming. Evidence points to post-transcriptional processes regulating receptor-triggered accumulation of EDS1 in nuclei. Changes in nuclear EDS1 levels become equilibrated with the cytoplasmic EDS1 pool and cytoplasmic EDS1 is needed for complete resistance and restriction of host cell death at infection sites. We propose that coordinated nuclear and cytoplasmic activities of EDS1 enable the plant to mount an appropriately balanced immune response to pathogen attack.

  11. A New Family of Nuclear Receptor Coregulators That Integrate Nuclear Receptor Signaling through CREB-Binding Protein

    PubMed Central

    Mahajan, Muktar A.; Samuels, Herbert H.

    2000-01-01

    We describe the cloning and characterization of a new family of nuclear receptor coregulators (NRCs) which modulate the function of nuclear hormone receptors in a ligand-dependent manner. NRCs are expressed as alternatively spliced isoforms which may exhibit different intrinsic activities and receptor specificities. The NRCs are organized into several modular structures and contain a single functional LXXLL motif which associates with members of the steroid hormone and thyroid hormone/retinoid receptor subfamilies with high affinity. Human NRC (hNRC) harbors a potent N-terminal activation domain (AD1), which is as active as the herpesvirus VP16 activation domain, and a second activation domain (AD2) which overlaps with the receptor-interacting LXXLL region. The C-terminal region of hNRC appears to function as an inhibitory domain which influences the overall transcriptional activity of the protein. Our results suggest that NRC binds to liganded receptors as a dimer and this association leads to a structural change in NRC resulting in activation. hNRC binds CREB-binding protein (CBP) with high affinity in vivo, suggesting that hNRC may be an important functional component of a CBP complex involved in mediating the transcriptional effects of nuclear hormone receptors. PMID:10866662

  12. Bmal1 is a direct transcriptional target of the orphan nuclear receptor, NR2F1

    USDA-ARS?s Scientific Manuscript database

    Orphan nuclear receptor NR2F1 (also known as COUP-TFI, Chicken Ovalbumin Upstream Promoter Transcription Factor I) is a highly conserved member of the nuclear receptor superfamily. NR2F1 plays a critical role during embryonic development, particularly in the central and peripheral nervous systems a...

  13. A protein that interacts with members of the nuclear hormone receptor family: identification and cDNA cloning.

    PubMed Central

    Zeiner, M; Gehring, U

    1995-01-01

    In search of proteins which interact with activated steroid hormone receptors, we screened a human liver lambda gt11 expression library with the glucocorticoid receptor. We identified and cloned a cDNA sequence of 1322 bp that encodes a protein of 274 aa. This protein consists predominantly of hydrophilic amino acids and contains a putative bipartite nuclear localization signal. The in vitro translated receptor-associating protein runs in SDS/polyacrylamide gels with an apparent molecular mass of 46 kDa. By use of the bacterially expressed fusion protein with glutathione S-transferase we have found that interaction is not limited to the glucocorticoid receptor but included other nuclear receptors--most notably, the estrogen and thyroid receptors. Binding also occurs with the glucocorticoid receptor complexed with the antiglucocorticoid RU 38486, with the estrogen receptor complexed with the antiestrogen 4-hydroxytamoxifen or ICI 164,384, and even with receptors not complexed with ligand. Association with steroid hormone receptors depends on prior receptor activation--i.e., release from heat shock proteins. The sequence identified here appears to be a general partner protein for nuclear hormone receptors, with the gene being expressed in a variety of mammalian tissues. Images Fig. 2 Fig. 3 Fig. 4 PMID:8524784

  14. Mode of Action and Human Relevance Analysis for Nuclear Receptor-Mediated Liver Toxicity: A Case Study with Phenobarbital as a Model Constitutive Androstane Receptor (CAR) Activator

    EPA Science Inventory

    The constitutive androstane receptor (CAR) and pregnane X receptor (PXR) are key nuclear receptors involved in the regulation of cellular responses. to exposure to many xenobiotics and various physiological processes. Phenobarbital (PB) is a non­ genotoxic i...

  15. Mouse neutrophils lacking lamin B receptor expression exhibit aberrant development and lack critical functional responses

    PubMed Central

    Gaines, Peter; Tien, Chiung W.; Olins, Ada L.; Olins, Donald E.; Shultz, Leonard D.; Carney, Lisa; Berliner, Nancy

    2008-01-01

    Objective The capacity of neutrophils to eradicate bacterial infections is dependent on normal development and the activation of functional responses, which include chemotaxis and the generation of oxygen radicals during the respiratory burst. A unique feature of the neutrophil is its highly lobulated nucleus, which is thought to facilitate chemotaxis but may also play a role in other critical neutrophil functions. Nuclear lobulation is dependent on the expression of the inner nuclear envelope protein, the lamin B receptor (LBR), mutations of which cause hypolobulated neutrophil nuclei in human Pelger-Huët anomaly (PHA) and the "ichthyosis" (ic) phenotype in mice. In this study we have investigated roles for LBR in mediating neutrophil development and the activation of multiple neutrophil functions, including chemotaxis and the respiratory burst. Materials and Methods A progenitor EML cell line was generated from an ic/ic mouse, and derived cells that lacked LBR expression were induced to mature neutrophils and then examined for abnormal morphology and functional responses. Results Neutrophils derived from EML-ic/ic cells exhibited nuclear hypolobulation identical to that observed in ichthyosis mice. The ic/ic neutrophils also displayed abnormal chemotaxis, supporting the notion that nuclear segmentation augments neutrophil extravasation. Furthermore, promyelocytic forms of ic/ic cells displayed decreased proliferative responses and produced a deficient respiratory burst upon terminal maturation. Conclusions Our studies of promyelocytes that lack LBR expression have identified roles for LBR in regulating not only the morphologic maturation of the neutrophil nucleus but also proliferative and functional responses that are critical to innate immunity. PMID:18550262

  16. Nuclear actions of insulin-like growth factor binding protein-3.

    PubMed

    Baxter, Robert C

    2015-09-10

    In addition to its actions outside the cell, cellular uptake and nuclear import of insulin-like growth factor binding protein-3 (IGFBP-3) has been recognized for almost two decades, but knowledge of its nuclear actions has been slow to emerge. IGFBP-3 has a functional nuclear localization signal and interacts with the nuclear transport protein importin-β. Within the nucleus IGFBP-3 appears to have a role in transcriptional regulation. It can bind to the nuclear receptor, retinoid X receptor-α and several of its dimerization partners, including retinoic acid receptor, vitamin D receptor (VDR), and peroxisome proliferator-activated receptor-γ (PPARγ). These interactions modulate the functions of these receptors, for example inhibiting VDR-dependent transcription in osteoblasts and PPARγ-dependent transcription in adipocytes. Nuclear IGFBP-3 can be detected by immunohistochemistry in cancer and other tissues, and its presence in the nucleus has been shown in many cell culture studies to be necessary for its pro-apoptotic effect, which may also involve interaction with the nuclear receptor Nur77, and export from the nucleus. IGFBP-3 is p53-inducible and in response to DNA damage, forms a complex with the epidermal growth factor receptor (EGFR), translocating to the nucleus to interact with DNA-dependent protein kinase. Inhibition of EGFR kinase activity or downregulation of IGFBP-3 can inhibit DNA double strand-break repair by nonhomologous end joining. IGFBP-3 thus has the ability to influence many cell functions through its interactions with intranuclear pathways, but the importance of these interactions in vivo, and their potential to be targeted for therapeutic benefit, require further investigation. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Rethinking Nuclear Receptors as Potential Therapeutic Targets for Retinal Diseases.

    PubMed

    Choudhary, Mayur; Malek, Goldis

    2016-12-01

    Collectively, retinal diseases, including age-related macular degeneration, retinitis pigmentosa, and diabetic retinopathy, result in severe vision impairment worldwide. The absence and/or limited availability of successful drug therapies for these blinding disorders necessitates further understanding their pathobiology and identifying new targetable signaling pathways. Nuclear receptors are transcription regulators of many key aspects of human physiology, as well as pathophysiology, with reported roles in development, aging, and disease. Some of the pathways regulated by nuclear receptors include, but are not limited to, angiogenesis, inflammation, and lipid metabolic dysregulation, mechanisms also important in the initiation and development of several retinal diseases. Herein, we present an overview of the biology of three diseases affecting the posterior eye, summarize a growing body of evidence that suggests direct or indirect involvement of nuclear receptors in disease progression, and discuss the therapeutic potential of targeting nuclear receptors for treatment.

  18. Rethinking Nuclear Receptors as Potential Therapeutic Targets for Retinal Diseases

    PubMed Central

    Choudhary, Mayur; Malek, Goldis

    2017-01-01

    Collectively, retinal diseases, including age-related macular degeneration, retinitis pigmentosa, and diabetic retinopathy, result in severe vision impairment worldwide. The absence and/or limited availability of successful drug therapies for these blinding disorders necessitates further understanding their pathobiology and identifying new targetable signaling pathways. Nuclear receptors are transcription regulators of many key aspects of human physiology, as well as pathophysiology, with reported roles in development, aging, and disease. Some of the pathways regulated by nuclear receptors include, but are not limited to, angiogenesis, inflammation, and lipid metabolic dysregulation, mechanisms also important in the initiation and development of several retinal diseases. Herein, we present an overview of the biology of three diseases affecting the posterior eye, summarize a growing body of evidence that suggests direct or indirect involvement of nuclear receptors in disease progression, and discuss the therapeutic potential of targeting nuclear receptors for treatment. PMID:27455994

  19. Mediator-dependent Nuclear Receptor Functions

    PubMed Central

    Chen, Wei; Roeder, Robert

    2011-01-01

    As gene-specific transcription factors, nuclear hormone receptors are broadly involved in many important biological processes. Their function on target genes requires the stepwise assembly of different coactivator complexes that facilitate chromatin remodeling and subsequent preinitiation complex (PIC) formation and function. Mediator has proved to be a crucial, and general, nuclear receptor-interacting coactivator, with demonstrated functions in transcription steps ranging from chromatin remodeling to subsequent PIC formation and function. Here we discuss (i) our current understanding of pathways that nuclear receptors and other interacting cofactors employ to recruit Mediator to target gene enhancers and promoters, including conditional requirements for the strong NR-Mediator interactions mediated by the NR AF2 domain and the MED1 LXXLLL motifs and (ii) mechanisms by which Mediator acts to transmit signals from enhancer-bound nuclear receptors to the general transcription machinery at core promoters to effect PIC formation and function. PMID:21854863

  20. Unique nuclear localization of Nile tilapia (Oreochromis niloticus) Neu4 sialidase is regulated by nuclear transport receptor importin α/β.

    PubMed

    Honda, Akinobu; Chigwechokha, Petros Kingstone; Kamada-Futagami, Yuko; Komatsu, Masaharu; Shiozaki, Kazuhiro

    2018-06-01

    Sialidase catalyzes the removal of sialic acids from glycoconjugates. Different from Neu1 and Neu3 sialidases, Neu4 enzymatic properties such as substrate specificity and subcellular localization are not well-conserved among vertebrates. In fish only zebrafish and medaka neu4 genes have been cloned and their polypeptides have been characterized so far. Thus, characterization of Neu4 from other fish species is necessary to evaluate Neu4 physiological functions. Here, Nile tilapia was chosen for the characterization of Neu4 polypeptide considering that it is one of the major cultured fish all over the world and that its genomic sequences are now available. Coding DNA sequence of tilapia Neu4 was identified as 1,497 bp and its recombinant protein showed broad substrate specificity and optimal sialidase enzyme activity pH at 4.0. Neu4 activity was sustained even in neutral and alkali pH. Interestingly, immunofluorescence analysis revealed that major subcellular localization of tilapia Neu4 was nuclear, quite distinct from zebrafish (ER) and medaka Neu4 (lysosome). Bioinformatic analysis showed the existence of putative nuclear localization signal (NLS) in tilapia Neu4. In general, it is known that importin families bind to several proteins via NLS and transfer them into nucleus. Therefore, to determine the involvement of putative NLS in Neu4 nuclear localization, Neu4 mutant deleting NLS was constructed and expressed in cultured cells. As a result, NLS deletion significantly diminished the nuclear localization. Furthermore, treatment of importazole, interrupter of binding importin β and RanGTP, significantly suppressed Neu4 nuclear localization. In summary, tilapia Neu4 is a unique sialidase localized at nucleus and its transport system into nucleus is regulated by importin. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  1. Mesonephric (Wolffian) Pseudoendometrioid Carcinoma of the Broad Ligament, Arising From a Papillary Cystadenoma.

    PubMed

    Moerman, Philippe; Amant, Frederic; Vergote, Ignace

    2016-10-01

    This article describes the case of a 70-year-old woman with an adnexal cystadenocarcinoma located in the right broad ligament and displaying a striking resemblance to a well-differentiated endometrioid adenocarcinoma. The uniqueness of this pseudoendometrioid carcinoma lies in the fact that its mesonephric nature is revealed by the origin from a papillary cystadenoma of the broad ligament, where remnants of the mesonephric duct are seated, and the immunohistochemical profile, particularly a uniform negativity for estrogen and progesterone receptors, apical-luminal positivity for CD10, and strong nuclear positivity for GATA3. © The Author(s) 2016.

  2. Identification of Modulators of the Nuclear Receptor Peroxisome Proliferator-Activated Receptor α (PPARα) in a Mouse Liver Gene Expression Compendium

    EPA Science Inventory

    The nuclear receptor family member peroxisome proliferator-activated receptor α (PPARα) is activated by therapeutic hypolipidemic drugs and environmentally-relevant chemicals to regulate genes involved in lipid transport and catabolism. Chronic activation of PPARα in rodents inc...

  3. Stimulus-dependent regulation of nuclear Ca2+ signaling in cardiomyocytes: a role of neuronal calcium sensor-1.

    PubMed

    Nakao, Shu; Wakabayashi, Shigeo; Nakamura, Tomoe Y

    2015-01-01

    In cardiomyocytes, intracellular calcium (Ca2+) transients are elicited by electrical and receptor stimulations, leading to muscle contraction and gene expression, respectively. Although such elevations of Ca2+levels ([Ca2+]) also occur in the nucleus, the precise mechanism of nuclear [Ca2+] regulation during different kinds of stimuli, and its relationship with cytoplasmic [Ca2+] regulation are not fully understood. To address these issues, we used a new region-specific fluorescent protein-based Ca2+ indicator, GECO, together with the conventional probe Fluo-4 AM. We confirmed that nuclear Ca2+ transients were elicited by both electrical and receptor stimulations in neonatal mouse ventricular myocytes. Kinetic analysis revealed that electrical stimulation-elicited nuclear Ca2+ transients are slower than cytoplasmic Ca2+ transients, and chelating cytoplasmic Ca2+ abolished nuclear Ca2+ transients, suggesting that nuclear Ca2+ are mainly derived from the cytoplasm during electrical stimulation. On the other hand, receptor stimulation such as with insulin-like growth factor-1 (IGF-1) preferentially increased nuclear [Ca2+] compared to cytoplasmic [Ca2+]. Experiments using inhibitors revealed that electrical and receptor stimulation-elicited Ca2+ transients were mainly mediated by ryanodine receptors and inositol 1,4,5-trisphosphate receptors (IP3Rs), respectively, suggesting different mechanisms for the two signals. Furthermore, IGF-1-elicited nuclear Ca2+ transient amplitude was significantly lower in myocytes lacking neuronal Ca2+ sensor-1 (NCS-1), a Ca2+ binding protein implicated in IP3R-mediated pathway in the heart. Moreover, IGF-1 strengthened the interaction between NCS-1 and IP3R. These results suggest a novel mechanism for receptor stimulation-induced nuclear [Ca2+] regulation mediated by IP3R and NCS-1 that may further fine-tune cardiac Ca2+ signal regulation.

  4. Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway

    PubMed Central

    Li, Shiwei; Li, Qi; Kong, Yuanyuan; Wu, Shuang; Cui, Qingpo; Zhang, Mingming; Zhang, Shaobing O.

    2017-01-01

    Nuclear receptors play important roles in regulating fat metabolism and energy production in humans. The regulatory functions and endogenous ligands of many nuclear receptors are still unidentified, however. Here, we report that CYP-37A1 (ortholog of human cytochrome P450 CYP4V2), EMB-8 (ortholog of human P450 oxidoreductase POR), and DAF-12 (homolog of human nuclear receptors VDR/LXR) constitute a hormone synthesis and nuclear receptor pathway in Caenorhabditis elegans. This pathway specifically regulates the thermosensitive fusion of fat-storing lipid droplets. CYP-37A1, together with EMB-8, synthesizes a lipophilic hormone not identical to Δ7-dafachronic acid, which represses the fusion-promoting function of DAF-12. CYP-37A1 also negatively regulates thermotolerance and lifespan at high temperature in a DAF-12–dependent manner. Human CYP4V2 can substitute for CYP-37A1 in C. elegans. This finding suggests the existence of a conserved CYP4V2-POR–nuclear receptor pathway that functions in converting multilocular lipid droplets to unilocular ones in human cells; misregulation of this pathway may lead to pathogenic fat storage. PMID:28760992

  5. Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway.

    PubMed

    Li, Shiwei; Li, Qi; Kong, Yuanyuan; Wu, Shuang; Cui, Qingpo; Zhang, Mingming; Zhang, Shaobing O

    2017-08-15

    Nuclear receptors play important roles in regulating fat metabolism and energy production in humans. The regulatory functions and endogenous ligands of many nuclear receptors are still unidentified, however. Here, we report that CYP-37A1 (ortholog of human cytochrome P450 CYP4V2), EMB-8 (ortholog of human P450 oxidoreductase POR), and DAF-12 (homolog of human nuclear receptors VDR/LXR) constitute a hormone synthesis and nuclear receptor pathway in Caenorhabditis elegans This pathway specifically regulates the thermosensitive fusion of fat-storing lipid droplets. CYP-37A1, together with EMB-8, synthesizes a lipophilic hormone not identical to Δ7-dafachronic acid, which represses the fusion-promoting function of DAF-12. CYP-37A1 also negatively regulates thermotolerance and lifespan at high temperature in a DAF-12-dependent manner. Human CYP4V2 can substitute for CYP-37A1 in C. elegans This finding suggests the existence of a conserved CYP4V2-POR-nuclear receptor pathway that functions in converting multilocular lipid droplets to unilocular ones in human cells; misregulation of this pathway may lead to pathogenic fat storage.

  6. Mapping the Dynamics of the Glucocorticoid Receptor within the Nuclear Landscape.

    PubMed

    Stortz, Martin; Presman, Diego M; Bruno, Luciana; Annibale, Paolo; Dansey, Maria V; Burton, Gerardo; Gratton, Enrico; Pecci, Adali; Levi, Valeria

    2017-07-24

    The distribution of the transcription machinery among different sub-nuclear domains raises the question on how the architecture of the nucleus modulates the transcriptional response. Here, we used fluorescence fluctuation analyses to quantitatively explore the organization of the glucocorticoid receptor (GR) in the interphase nucleus of living cells. We found that this ligand-activated transcription factor diffuses within the nucleus and dynamically interacts with bodies enriched in the coregulator NCoA-2, DNA-dependent foci and chromatin targets. The distribution of the receptor among the nuclear compartments depends on NCoA-2 and the conformation of the receptor as assessed with synthetic ligands and GR mutants with impaired transcriptional abilities. Our results suggest that the partition of the receptor in different nuclear reservoirs ultimately regulates the concentration of receptor available for the interaction with specific targets, and thus has an impact on transcription regulation.

  7. RORα, a Potential Tumor Suppressor and Therapeutic Target of Breast Cancer

    PubMed Central

    Du, Jun; Xu, Ren

    2012-01-01

    The function of the nuclear receptor (NR) in breast cancer progression has been investigated for decades. The majority of the nuclear receptors have well characterized natural ligands, but a few of them are orphan receptors for which no ligand has been identified. RORα, one member of the retinoid orphan nuclear receptor (ROR) subfamily of orphan receptors, regulates various cellular and pathological activities. RORα is commonly down-regulated and/or hypoactivated in breast cancer compared to normal mammary tissue. Expression of RORα suppresses malignant phenotypes in breast cancer cells, in vitro and in vivo. Activity of RORα can be categorized into the canonical and non-canonical nuclear receptor pathways, which in turn regulate various breast cancer cellular function, including cell proliferation, apoptosis and invasion. This information suggests that RORα is a potent tumor suppressor and a potential therapeutic target for breast cancer. PMID:23443091

  8. Phenobarbital Meets Phosphorylation of Nuclear Receptors

    PubMed Central

    2017-01-01

    Phenobarbital was the first therapeutic drug to be characterized for its induction of hepatic drug metabolism. Essentially at the same time, cytochrome P450, an enzyme that metabolizes drugs, was discovered. After nearly 50 years of investigation, the molecular target of phenobarbital induction has now been delineated to phosphorylation at threonine 38 of the constitutive androstane receptor (NR1I3), a member of the nuclear receptor superfamily. Determining this mechanism has provided us with the molecular basis to understand drug induction of drug metabolism and disposition. Threonine 38 is conserved as a phosphorylation motif in the majority of both mouse and human nuclear receptors, providing us with an opportunity to integrate diverse functions of nuclear receptors. Here, I review the works and accomplishments of my laboratory at the National Institutes of Health National Institute of Environmental Health Sciences and the future research directions of where our study of the constitutive androstane receptor might take us. PMID:28356313

  9. Identification of a unique loss-of-function mutation in IGF1R and a crosstalk between IGF1R and Wnt/β-catenin signaling pathways.

    PubMed

    Jamwal, Gayatri; Singh, Gurjinder; Dar, Mohd Saleem; Singh, Paramjeet; Bano, Nasima; Syed, Sajad Hussain; Sandhu, Padmani; Akhter, Yusuf; Monga, Satdarshan P; Dar, Mohd Jamal

    2018-06-01

    IGF1R is a ubiquitous receptor tyrosine kinase that plays critical roles in cell proliferation, growth and survival. Clinical studies have demonstrated upregulation of IGF1R mediated signaling in a number of malignancies including colon, breast, and lung cancers. Overexpression of the IGF1R in these malignancies is associated with a poor prognosis and overall survival. IGF1R specific kinase inhibitors have failed in multiple clinical trials partly because of the complex nature of IGF1R signaling. Thus identifying new binding partners and allosteric sites on IGF1R are emerging areas of research. More recently, IGF1R has been shown to translocate into the nucleus and perform many functions. In this study, we generated a library of IGF1R deletion and point mutants to examine IGF1R subcellular localization and activation of downstream signaling pathways. We show that the nuclear localization of IGF1R is primarily defined by its cytoplasmic domain. We identified a cross-talk between IGF1R and Wnt/β-catenin signaling pathways and showed, for the first time, that IGF1R is associated with upregulation of TCF-mediated β-catenin transcriptional activity. Using loss-of-function mutants, deletion analysis and IGF1R specific inhibitor(s), we show that cytoplasmic and nuclear activities are two independent functions of IGF1R. Furthermore, we identified a unique loss-of-function mutation in IGF1R. This unique loss-of-function mutant retains only nuclear functions and sits in a pocket, outside ATP and substrate binding region, that is suited for designing allosteric inhibitors of IGF1R. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. GPER-1/GPR30 a novel estrogen receptor sited in the cell membrane: therapeutic coupling to breast cancer.

    PubMed

    Molina, Luis; Figueroa, Carlos D; Bhoola, Kanti D; Ehrenfeld, Pamela

    2017-08-01

    Breast cancer is clinically classified as 'estrogen-positive' when at least 1% of cancer cells stain for the estrogen receptor alpha (ERα). However, recent research on both basic and clinical aspects of breast cancer suggests that GPER-1 (G protein-coupled estrogen receptor-1) may have an important role in breast cancer. Areas covered: This review provides a comprehensive and systematic literature search on GPER-1. We have focused on the role of GPER-1 in breast cancer and on resistance to endocrine therapy, an unsolved clinical issue still under discussion. Expert opinion: The discovery of GPER-1 as a novel estrogen receptor is unique and the signaling pathways activated by its stimulation, when compared to the classical nuclear ERα, indicate a potential role of GPER-1 in the genesis and mechanisms of drug resistance in breast cancer. Tumors expressing ERα represent the largest group of breast cancer patients indicating that more women eventually die from ERα-positive breast tumors than from other more malignant breast cancer subtypes such as HER2-positive and the triple negative groups. It is important to develop new strategies on endocrine therapy with regard to ERα and GPER-1 receptors to achieve innovative successful therapeutic tools.

  11. Minireview: The Role of Nuclear Receptors in Photoreceptor Differentiation and Disease

    PubMed Central

    Swaroop, Anand

    2012-01-01

    Rod and cone photoreceptors are specialized sensory cells that mediate vision. Transcriptional controls are critical for the development and long-term survival of photoreceptors; when these controls become ineffective, retinal dysfunction or degenerative disease may result. This review discusses the role of nuclear receptors, a class of ligand-regulated transcription factors, at key stages of photoreceptor life in the mammalian retina. Nuclear receptors with known ligands, such as retinoids or thyroid hormone, together with several orphan receptors without identified physiological ligands, complement other classes of transcription factors in directing the differentiation and functional maintenance of photoreceptors. The potential of nuclear receptors to respond to ligands introduces versatility into the control of photoreceptor development and function and may suggest new opportunities for treatments of photoreceptor disease. PMID:22556342

  12. How does oxygen rise drive evolution? Clues from oxygen-dependent biosynthesis of nuclear receptor ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Ying-Ying; Kong, De-Xin; Qin, Tao

    2010-01-08

    It is well known that oxygen rise greatly facilitated biological evolution. However, the underlying mechanisms remain elusive. Recently, Raymond and Segre revealed that molecular oxygen allows 1000 more metabolic reactions than can occur in anoxic conditions. From the novel metabolites produced in aerobic metabolism, we serendipitously found that some of the metabolites are signaling molecules that target nuclear receptors. Since nuclear signaling systems are indispensable to superior organisms, we speculated that aerobic metabolism may facilitate biological evolution through promoting the establishment of nuclear signaling systems. This hypothesis is validated by the observation that most (97.5%) nuclear receptor ligands are producedmore » by aerobic metabolism, which is further explained in terms of the chemical criteria (appropriate volume and rather high hydrophobicity) of nuclear receptor ligands that aerobic metabolites are more ready than anaerobic counterparts to satisfy these criteria.« less

  13. The Therapeutic Role of Xenobiotic Nuclear Receptors against Metabolic Syndrome.

    PubMed

    Pu, Shuqi; Wu, Xiaojie; Yang, Xiaoying; Zhang, Yunzhan; Dai, Yunkai; Zhang, Yueling; Wu, Xiaoting; Liu, Yan; Cui, Xiaona; Jin, Haiyong; Cao, Jianhong; Li, Ruliu; Cai, Jiazhong; Cao, Qizhi; Hu, Ling; Gao, Yong

    2018-06-10

    Xenobiotic nuclear receptors (XNRs) are nuclear receptors that characterized by coordinately regulating the expression of genes encoding drug-metabolizing enzymes and transporters to essentially eliminate and detoxify xenobiotics and endobiotics from the body, including the peroxisome proliferator-activated receptor (PPAR), the farnesoid X receptor (FXR), the liver X receptor (LXR), the pregnane X receptor (PXR) and the constitutive androstane receptor (CAR). Heretofore, increasing evidences have suggested that these five XNRs are not only involved in the regulation of xeno-/endo-biotics detoxication but also the development of human diseases, such as cancer, obesity and diabetes. PPAR, FXR, LXR, PXR and CAR, as the receptors for numerous natural or synthetic compounds may be the most effective therapeutic targets in the treatment of metabolic diseases. In this review, we will focus on these five XNRs and their recently discovered functions in diabetes and its complications. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. Analysis of the Heat Shock Response in Mouse Liver Reveals Transcriptional Dependence on the Nuclear Receptor Peroxisome Proliferator-Activated Receptor alpha (PPARα)

    EPA Science Inventory

    BACKGROUND: The nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha) regulates responses to chemical or physical stress in part by altering expression of genes involved in proteome maintenance. Many of these genes are also transcriptionally regulated by h...

  15. Human GRK4γ142V Variant Promotes Angiotensin II Type I Receptor-Mediated Hypertension via Renal Histone Deacetylase Type 1 Inhibition.

    PubMed

    Wang, Zheng; Zeng, Chunyu; Villar, Van Anthony M; Chen, Shi-You; Konkalmatt, Prasad; Wang, Xiaoyan; Asico, Laureano D; Jones, John E; Yang, Yu; Sanada, Hironobu; Felder, Robin A; Eisner, Gilbert M; Weir, Matthew R; Armando, Ines; Jose, Pedro A

    2016-02-01

    The influence of a single gene on the pathogenesis of essential hypertension may be difficult to ascertain, unless the gene interacts with other genes that are germane to blood pressure regulation. G-protein-coupled receptor kinase type 4 (GRK4) is one such gene. We have reported that the expression of its variant hGRK4γ(142V) in mice results in hypertension because of impaired dopamine D1 receptor. Signaling through dopamine D1 receptor and angiotensin II type I receptor (AT1R) reciprocally modulates renal sodium excretion and blood pressure. Here, we demonstrate the ability of the hGRK4γ(142V) to increase the expression and activity of the AT1R. We show that hGRK4γ(142V) phosphorylates histone deacetylase type 1 and promotes its nuclear export to the cytoplasm, resulting in increased AT1R expression and greater pressor response to angiotensin II. AT1R blockade and the deletion of the Agtr1a gene normalize the hypertension in hGRK4γ(142V) mice. These findings illustrate the unique role of GRK4 by targeting receptors with opposite physiological activity for the same goal of maintaining blood pressure homeostasis, and thus making the GRK4 a relevant therapeutic target to control blood pressure. © 2015 American Heart Association, Inc.

  16. The relationship of the oestrogen and progestin receptors in the abnormal uterus of the adult anovulatory rat. Effects of neonatal treatment with testosterone propionate or clomiphene citrate.

    PubMed Central

    White, J O; Moore, P A; Elder, M G; Lim, L

    1981-01-01

    The neonatal administration of testosterone propionate to Wistar rats resulted in anovulatory adults in persistent vaginal oestrus. Clomiphene citrate had a similar effect. In both groups of adults, hyperplasia of the uterine epithelium and occasional metaplasia was observed. The uterine nuclear and cytosol oestrogen and progestin receptors of these anovulatory rats were found to have affinities for their respective ligands similar to those of normal females. The nuclear oestrogen receptor comprised occupied and unoccupied components, as in normal females. The content of the nuclear oestrogen receptor was comparable with that of females in the late dioestrous or pro-oestrous phase. This content was higher in the clomiphene-treated group. Despite the relatively high nuclear oestrogen receptor content the content of progestin receptors, a putative index of the oestrogenic response, was lower in the treated rats than in normal adult females throughout the cycle. Administration of oestradiol to both treatment groups resulted in depletion of cytosol oestrogen receptor content 1 h later, which, however, was not reflected by an increase in the content of nuclear oestrogen receptors. There was no measurable increase in progesterone receptor content in treated rats after daily administration of oestrogen (5 microgram/rat) for 3 days. These changes in sex-hormone-receptor interactions involving an impairment of the normal oestrogenic response may be associated with the abnormal differentiation of the uterus in these sterile, anovulatory animals. Images Fig. 1. Fig. 2. PMID:7316994

  17. Mechanism regulating nuclear calcium signaling.

    PubMed

    Malviya, Anant N; Klein, Christian

    2006-01-01

    Although the outer nuclear membrane is continuous with the endoplasmic reticulum, it is possible to isolate nuclei both intact and free from endoplasmic reticulum contaminants. The outer and the inner nuclear membranes can be purified free from cross-contamination. Evidence in support of autonomous regulation of nuclear calcium signaling relies upon the investigations with isolated nuclei. Mechanisms for generating calcium signaling in the nucleus have been identified. Two calcium transporting systems, an ATP-dependant nuclear Ca(2+)-ATPase and an IP4-mediated inositol 1,3,4,5-tetrakisphosphate receptor, are located on the outer nuclear membrane. Thus, ATP and IP4, depending on external free calcium concentrations, are responsible for filling the nuclear envelope calcium pool. The inositol 1,4,5-trisphosphate receptor is located on the inner nuclear membrane with its ligand binding domain facing toward the nucleoplasm. Likewise, the ryanodine receptor is located on the inner nuclear membrane and its ligand cADP-ribose is generated within the nucleus. A 120 kDa protein fragment of nuclear PLC-gamma1 is stimulated in vivo by epidermal growth factor nuclear signaling coincident with the time course of nuclear membrane epidermal growth factor receptor activation. Stimulated 120 kDa protein fragment interacts with PIKE, a nuclear GTPase, and together they form a complex with PI[3]kinase serving as a module for nuclear PI[3]K stimulation. Thus, the nucleus has its own IP(3) generating system.

  18. An integrated mechanism of cardiomyocyte nuclear Ca(2+) signaling.

    PubMed

    Ibarra, Cristián; Vicencio, Jose Miguel; Varas-Godoy, Manuel; Jaimovich, Enrique; Rothermel, Beverly A; Uhlén, Per; Hill, Joseph A; Lavandero, Sergio

    2014-10-01

    In cardiomyocytes, Ca(2+) plays a central role in governing both contraction and signaling events that regulate gene expression. Current evidence indicates that discrimination between these two critical functions is achieved by segregating Ca(2+) within subcellular microdomains: transcription is regulated by Ca(2+) release within nuclear microdomains, and excitation-contraction coupling is regulated by cytosolic Ca(2+). Accordingly, a variety of agonists that control cardiomyocyte gene expression, such as endothelin-1, angiotensin-II or insulin-like growth factor-1, share the feature of triggering nuclear Ca(2+) signals. However, signaling pathways coupling surface receptor activation to nuclear Ca(2+) release, and the phenotypic responses to such signals, differ between agonists. According to earlier hypotheses, the selective control of nuclear Ca(2+) signals by activation of plasma membrane receptors relies on the strategic localization of inositol trisphosphate receptors at the nuclear envelope. There, they mediate Ca(2+) release from perinuclear Ca(2+) stores upon binding of inositol trisphosphate generated in the cytosol, which diffuses into the nucleus. More recently, identification of such receptors at nuclear membranes or perinuclear sarcolemmal invaginations has uncovered novel mechanisms whereby agonists control nuclear Ca(2+) release. In this review, we discuss mechanisms for the selective control of nuclear Ca(2+) signals with special focus on emerging models of agonist receptor activation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Tissue specificity of the hormonal response in sex accessory tissues is associated with nuclear matrix protein patterns.

    PubMed

    Getzenberg, R H; Coffey, D S

    1990-09-01

    The DNA of interphase nuclei have very specific three-dimensional organizations that are different in different cell types, and it is possible that this varying DNA organization is responsible for the tissue specificity of gene expression. The nuclear matrix organizes the three-dimensional structure of the DNA and is believed to be involved in the control of gene expression. This study compares the nuclear structural proteins between two sex accessory tissues in the same animal responding to the same androgen stimulation by the differential expression of major tissue-specific secretory proteins. We demonstrate here that the nuclear matrix is tissue specific in the rat ventral prostate and seminal vesicle, and undergoes characteristic alterations in its protein composition upon androgen withdrawal. Three types of nuclear matrix proteins were observed: 1) nuclear matrix proteins that are different and tissue specific in the rat ventral prostate and seminal vesicle, 2) a set of nuclear matrix proteins that either appear or disappear upon androgen withdrawal, and 3) a set of proteins that are common to both the ventral prostate and seminal vesicle and do not change with the hormonal state of the animal. Since the nuclear matrix is known to bind androgen receptors in a tissue- and steroid-specific manner, we propose that the tissue specificity of the nuclear matrix arranges the DNA in a unique conformation, which may be involved in the specific interaction of transcription factors with DNA sequences, resulting in tissue-specific patterns of secretory protein expression.

  20. Roles of steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF) 2 in androgen receptor activity in mice

    PubMed Central

    Ye, Xiangcang; Han, Sang Jun; Tsai, Sophia Y.; DeMayo, Francesco J.; Xu, Jianming; Tsai, Ming-Jer; O'Malley, Bert W.

    2005-01-01

    Genetic disruption of the steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF)2/SRC-2 in mouse resulted in distinctive mutant phenotypes. To quantify their roles in the function of androgen receptor (AR) transcriptional activity in vivo, we generated a unique transgenic AR-reporter mouse and analyzed the cell-specific contributions of SRC-1 and TIF2 to the activity of AR in mouse testis. Transgenic AR-luciferase and transgenic AR-lacZ mice harbor a recombinant mouse AR gene, ARGAL4DBD, which is functionally coupled with a upstream activation sequence-mediated reporter gene (AR activity indicator). After characterization of these mice in terms of AR function, we further derived bigenic mice by crossing AR activity indicator mice with the SRC-1-/- or TIF2+/- mutant mice. Analyses of the resultant bigenic mice by in vivo imaging and luciferase assays showed that testicular AR activity was decreased significantly in those with the TIF2+/- mutation but not in the SRC-1+/- background, suggesting that TIF2 serves as the preferential coactivator for AR in testis. Immunohistological analysis confirmed that AR and TIF2 coexist in mouse testicular Sertoli cell nuclei under normal conditions. Although SRC-1 concentrates in Sertoli cell nuclei in the absence of TIF2, nuclear SRC-1 is not able to rescue AR activity in the TIF2 mutant background. Interestingly, SRC-1 appears to negatively influence AR activity, thereby counterbalancing the TIF2-stimulated AR activity. Our results provide unique in vivo insights to the multidimensional cell-type-specific interactions between AR and coregulators. PMID:15983373

  1. Roles of steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF) 2 in androgen receptor activity in mice.

    PubMed

    Ye, Xiangcang; Han, Sang Jun; Tsai, Sophia Y; DeMayo, Francesco J; Xu, Jianming; Tsai, Ming-Jer; O'Malley, Bert W

    2005-07-05

    Genetic disruption of the steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF)2/SRC-2 in mouse resulted in distinctive mutant phenotypes. To quantify their roles in the function of androgen receptor (AR) transcriptional activity in vivo, we generated a unique transgenic AR-reporter mouse and analyzed the cell-specific contributions of SRC-1 and TIF2 to the activity of AR in mouse testis. Transgenic AR-luciferase and transgenic AR-lacZ mice harbor a recombinant mouse AR gene, AR(GAL4DBD), which is functionally coupled with a upstream activation sequence-mediated reporter gene (AR activity indicator). After characterization of these mice in terms of AR function, we further derived bigenic mice by crossing AR activity indicator mice with the SRC-1-/- or TIF2+/- mutant mice. Analyses of the resultant bigenic mice by in vivo imaging and luciferase assays showed that testicular AR activity was decreased significantly in those with the TIF2+/- mutation but not in the SRC-1+/- background, suggesting that TIF2 serves as the preferential coactivator for AR in testis. Immunohistological analysis confirmed that AR and TIF2 coexist in mouse testicular Sertoli cell nuclei under normal conditions. Although SRC-1 concentrates in Sertoli cell nuclei in the absence of TIF2, nuclear SRC-1 is not able to rescue AR activity in the TIF2 mutant background. Interestingly, SRC-1 appears to negatively influence AR activity, thereby counterbalancing the TIF2-stimulated AR activity. Our results provide unique in vivo insights to the multidimensional cell-type-specific interactions between AR and coregulators.

  2. Differential Regulation of Gene Expression by Cholesterol Biosynthesis Inhibitors That Reduce (Pravastatin) or Enhance (Squalestatin 1) Nonsterol Isoprenoid Levels in Primary Cultured Mouse and Rat Hepatocytes

    PubMed Central

    Rondini, Elizabeth A.; Duniec-Dmuchowski, Zofia; Cukovic, Daniela; Dombkowski, Alan A.

    2016-01-01

    Squalene synthase inhibitors (SSIs), such as squalestatin 1 (SQ1), reduce cholesterol biosynthesis but cause the accumulation of isoprenoids derived from farnesyl pyrophosphate (FPP), which can modulate the activity of nuclear receptors, including the constitutive androstane receptor (CAR), farnesoid X receptor, and peroxisome proliferator-activated receptors (PPARs). In comparison, 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibitors (e.g., pravastatin) inhibit production of both cholesterol and nonsterol isoprenoids. To characterize the effects of isoprenoids on hepatocellular physiology, microarrays were used to compare orthologous gene expression from primary cultured mouse and rat hepatocytes that were treated with either SQ1 or pravastatin. Compared with controls, 47 orthologs were affected by both inhibitors, 90 were affected only by SQ1, and 51 were unique to pravastatin treatment (P < 0.05, ≥1.5-fold change). When the effects of SQ1 and pravastatin were compared directly, 162 orthologs were found to be differentially coregulated between the two treatments. Genes involved in cholesterol and unsaturated fatty acid biosynthesis were up-regulated by both inhibitors, consistent with cholesterol depletion; however, the extent of induction was greater in rat than in mouse hepatocytes. SQ1 induced several orthologs associated with microsomal, peroxisomal, and mitochondrial fatty acid oxidation and repressed orthologs involved in cell cycle regulation. By comparison, pravastatin repressed the expression of orthologs involved in retinol and xenobiotic metabolism. Several of the metabolic genes altered by isoprenoids were inducible by a PPARα agonist, whereas cytochrome P450 isoform 2B was inducible by activators of CAR. Our findings indicate that SSIs uniquely influence cellular lipid metabolism and cell cycle regulation, probably due to FPP catabolism through the farnesol pathway. PMID:27225895

  3. Design of selective nuclear receptor modulators: RAR and RXR as a case study.

    PubMed

    de Lera, Angel R; Bourguet, William; Altucci, Lucia; Gronemeyer, Hinrich

    2007-10-01

    Retinoic acid receptors (RARs) and retinoid X receptors (RXRs) are members of the nuclear receptor superfamily whose effects on cell growth and survival can be modulated therapeutically by small-molecule ligands. Although compounds that target these receptors are powerful anticancer drugs, their use is limited by toxicity. An improved understanding of the structural biology of RXRs and RARs and recent advances in the chemical synthesis of modified retinoid and rexinoid ligands should enable the rational design of more selective agents that might overcome such problems. Here, we review structural data for RXRs and RARs, discuss strategies in the design of selective RXR and RAR modulators, and consider lessons that can be learned for the design of selective nuclear-receptor modulators in general.

  4. Generalized Resistance to Thyroid Hormone Associated with a Mutation in the Ligand-Binding Domain of the Human Thyroid Hormone Receptor β

    NASA Astrophysics Data System (ADS)

    Sakurai, Akihiro; Takeda, Kyoko; Ain, Kenneth; Ceccarelli, Paola; Nakai, Akira; Seino, Susumu; Bell, Graeme I.; Refetoff, Samuel; Degroot, Leslie J.

    1989-11-01

    The syndrome of generalized resistance to thyroid hormone is characterized by elevated circulating levels of thyroid hormone in the presence of an overall eumetabolic state and failure to respond normally to triiodothyronine. We have evaluated a family with inherited generalized resistance to thyroid hormone for abnormalities in the thyroid hormone nuclear receptors. A single guanine --> cytosine replacement in the codon for amino acid 340 resulted in a glycine --> arginine substitution in the hormone-binding domain of one of two alleles of the patient's thyroid hormone nuclear receptor β gene. In vitro translation products of this mutant human thyroid hormone nuclear receptor β gene did not bind triiodothyronine. Thus, generalized resistance to thyroid hormone can result from expression of an abnormal thyroid hormone nuclear receptor molecule.

  5. A muscle-specific knockout implicates nuclear receptor coactivator MED1 in the regulation of glucose and energy metabolism.

    PubMed

    Chen, Wei; Zhang, Xiaoting; Birsoy, Kivanc; Roeder, Robert G

    2010-06-01

    As conventional transcriptional factors that are activated in diverse signaling pathways, nuclear receptors play important roles in many physiological processes that include energy homeostasis. The MED1 subunit of the Mediator coactivator complex plays a broad role in nuclear receptor-mediated transcription by anchoring the Mediator complex to diverse promoter-bound nuclear receptors. Given the significant role of skeletal muscle, in part through the action of nuclear receptors, in glucose and fatty acid metabolism, we generated skeletal muscle-specific Med1 knockout mice. Importantly, these mice show enhanced insulin sensitivity and improved glucose tolerance as well as resistance to high-fat diet-induced obesity. Furthermore, the white muscle of these mice exhibits increased mitochondrial density and expression of genes specific to type I and type IIA fibers, indicating a fast-to-slow fiber switch, as well as markedly increased expression of the brown adipose tissue-specific UCP-1 and Cidea genes that are involved in respiratory uncoupling. These dramatic results implicate MED1 as a powerful suppressor in skeletal muscle of genetic programs implicated in energy expenditure and raise the significant possibility of therapeutical approaches for metabolic syndromes and muscle diseases through modulation of MED1-nuclear receptor interactions.

  6. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response

    PubMed Central

    Pondugula, Satyanarayana R.; Mani, Sridhar

    2012-01-01

    Pregnane xenobiotic receptor (PXR) is an orphan nuclear receptor that regulates the metabolism of endobiotics and xenobiotics. PXR is promiscuous and unique in that it is activated by a diverse group of xenochemicals, including therapeutic anticancer drugs and naturally-occurring endocrine disruptors. PXR has been predominantly studied to understand its regulatory role in xenobiotic clearance in liver and intestine via induction of drug metabolizing enzymes and drug transporters. PXR, however, is widely expressed and has functional implications in other normal and malignant tissues, including breast, prostate, ovary, endometrium and bone. The differential expression of PXR and its target genes in cancer tissues has been suggested to determine the prognosis of chemotherapeutic outcome. In addition, the emerging evidence points to the implications of PXR in regulating apoptotic and antiapoptotic as well as growth factor signaling that promote tumor proliferation and metastasis. In this review, we highlight the recent progress made in understanding the role of PXR in cancer, discuss the future directions to further understand the mechanistic role of PXR in cancer, and conclude with the need to identify novel selective PXR modulators. PMID:22939994

  7. Calcium responses to synaptically activated bursts of action potentials and their synapse-independent replay in cultured networks of hippocampal neurons.

    PubMed

    Bengtson, C Peter; Kaiser, Martin; Obermayer, Joshua; Bading, Hilmar

    2013-07-01

    Both synaptic N-methyl-d-aspartate (NMDA) receptors and voltage-operated calcium channels (VOCCs) have been shown to be critical for nuclear calcium signals associated with transcriptional responses to bursts of synaptic input. However the direct contribution to nuclear calcium signals from calcium influx through NMDA receptors and VOCCs has been obscured by their concurrent roles in action potential generation and synaptic transmission. Here we compare calcium responses to synaptically induced bursts of action potentials with identical bursts devoid of any synaptic contribution generated using the pre-recorded burst as the voltage clamp command input to replay the burst in the presence of blockers of action potentials or ionotropic glutamate receptors. Synapse independent replays of bursts produced nuclear calcium responses with amplitudes around 70% of their original synaptically generated signals and were abolished by the L-type VOCC blocker, verapamil. These results identify a major direct source of nuclear calcium from local L-type VOCCs whose activation is boosted by NMDA receptor dependent depolarization. The residual component of synaptically induced nuclear calcium signals which was both VOCC independent and NMDA receptor dependent showed delayed kinetics consistent with a more distal source such as synaptic NMDA receptors or internal stores. The dual requirement of NMDA receptors and L-type VOCCs for synaptic activity-induced nuclear calcium dependent transcriptional responses most likely reflects a direct somatic calcium influx from VOCCs whose activation is amplified by synaptic NMDA receptor-mediated depolarization and whose calcium signal is boosted by a delayed input from distal calcium sources mostly likely entry through NMDA receptors and release from internal stores. This article is part of a Special Issue entitled: 12th European Symposium on Calcium. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Phosphorylation of a conserved serine in the deoxyribonucleic acid binding domain of nuclear receptors alters intracellular localization.

    PubMed

    Sun, Kai; Montana, Vedrana; Chellappa, Karthikeyani; Brelivet, Yann; Moras, Dino; Maeda, Yutaka; Parpura, Vladimir; Paschal, Bryce M; Sladek, Frances M

    2007-06-01

    Nuclear receptors (NRs) are a superfamily of transcription factors whose genomic functions are known to be activated by lipophilic ligands, but little is known about how to deactivate them or how to turn on their nongenomic functions. One obvious mechanism is to alter the nuclear localization of the receptors. Here, we show that protein kinase C (PKC) phosphorylates a highly conserved serine (Ser) between the two zinc fingers of the DNA binding domain of orphan receptor hepatocyte nuclear factor 4alpha (HNF4alpha). This Ser (S78) is adjacent to several positively charged residues (Arg or Lys), which we show here are involved in nuclear localization of HNF4alpha and are conserved in nearly all other NRs, along with the Ser/threonine (Thr). A phosphomimetic mutant of HNF4alpha (S78D) reduced DNA binding, transactivation ability, and protein stability. It also impaired nuclear localization, an effect that was greatly enhanced in the MODY1 mutant Q268X. Treatment of the hepatocellular carcinoma cell line HepG2 with PKC activator phorbol 12-myristate 13-acetate also resulted in increased cytoplasmic localization of HNF4alpha as well as decreased endogenous HNF4alpha protein levels in a proteasome-dependent fashion. We also show that PKC phosphorylates the DNA binding domain of other NRs (retinoic acid receptor alpha, retinoid X receptor alpha, and thyroid hormone receptor beta) and that phosphomimetic mutants of the same Ser/Thr result in cytoplasmic localization of retinoid X receptor alpha and peroxisome proliferator-activated receptor alpha. Thus, phosphorylation of this conserved Ser between the two zinc fingers may be a common mechanism for regulating the function of NRs.

  9. The Orphan Nuclear Receptors at Their 25th Year Reunion

    PubMed Central

    Mullican, Shannon E.; DiSpirito, Joanna R.; Lazar, Mitchell A.

    2013-01-01

    The Nuclear Receptor superfamily includes many receptors identified based on their similarity to steroid hormone receptors but without a known ligand. The study of how these receptors are diversely regulated to interact with genomic regions to control a plethora of biological processes has provided critical insight into development, physiology and the molecular pathology of disease. Here we provide a compendium of these so-called Orphan Receptors, and focus on what has been learned about their modes of action, physiological functions, and therapeutic promise. PMID:24096517

  10. Phenobarbital Meets Phosphorylation of Nuclear Receptors.

    PubMed

    Negishi, Masahiko

    2017-05-01

    Phenobarbital was the first therapeutic drug to be characterized for its induction of hepatic drug metabolism. Essentially at the same time, cytochrome P450, an enzyme that metabolizes drugs, was discovered. After nearly 50 years of investigation, the molecular target of phenobarbital induction has now been delineated to phosphorylation at threonine 38 of the constitutive androstane receptor (NR1I3), a member of the nuclear receptor superfamily. Determining this mechanism has provided us with the molecular basis to understand drug induction of drug metabolism and disposition. Threonine 38 is conserved as a phosphorylation motif in the majority of both mouse and human nuclear receptors, providing us with an opportunity to integrate diverse functions of nuclear receptors. Here, I review the works and accomplishments of my laboratory at the National Institutes of Health National Institute of Environmental Health Sciences and the future research directions of where our study of the constitutive androstane receptor might take us. U.S. Government work not protected by U.S. copyright.

  11. Plant nuclear hormone receptors: a role for small molecules in protein-protein interactions.

    PubMed

    Lumba, Shelley; Cutler, Sean; McCourt, Peter

    2010-01-01

    Plant hormones are a group of chemically diverse small molecules that direct processes ranging from growth and development to biotic and abiotic stress responses. Surprisingly, genome analyses suggest that classic animal nuclear hormone receptor homologs do not exist in plants. It now appears that plants have co-opted several protein families to perceive hormones within the nucleus. In one solution to the problem, the hormones auxin and jasmonate (JA) act as “molecular glue” that promotes protein-protein interactions between receptor F-boxes and downstream corepressor targets. In another solution, gibberellins (GAs) bind and elicit a conformational change in a novel soluble receptor family related to hormone-sensitive lipases. Abscisic acid (ABA), like GA, also acts through an allosteric mechanism involving a START-domain protein. The molecular identification of plant nuclear hormone receptors will allow comparisons with animal nuclear receptors and testing of fundamental questions about hormone function in plant development and evolution.

  12. Perspectives in molecular imaging through translational research, human medicine, and veterinary medicine.

    PubMed

    Berry, Clifford R; Garg, Predeep

    2014-01-01

    The concept of molecular imaging has taken off over the past 15 years to the point of the renaming of the Society of Nuclear Medicine (Society of Nuclear Medicine and Molecular Imaging) and Journals (European Journal of Nuclear Medicine and Molecular Imaging) and offering of medical fellowships specific to this area of study. Molecular imaging has always been at the core of functional imaging related to nuclear medicine. Even before the phrase molecular imaging came into vogue, radionuclides and radiopharmaceuticals were developed that targeted select physiological processes, proteins, receptor analogs, antibody-antigen interactions, metabolites and specific metabolic pathways. In addition, with the advent of genomic imaging, targeted genomic therapy, and theranostics, a number of novel radiopharmaceuticals for the detection and therapy of specific tumor types based on unique biological and cellular properties of the tumor itself have been realized. However, molecular imaging and therapeutics as well as the concept of theranostics are yet to be fully realized. The purpose of this review article is to present an overview of the translational approaches to targeted molecular imaging with application to some naturally occurring animal models of human disease. © 2013 Published by Elsevier Inc.

  13. The peroxisome proliferator-activated receptor: A family of nuclear receptors role in various diseases

    PubMed Central

    Tyagi, Sandeep; Gupta, Paras; Saini, Arminder Singh; Kaushal, Chaitnya; Sharma, Saurabh

    2011-01-01

    Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors of nuclear hormone receptor superfamily comprising of the following three subtypes: PPARα, PPARγ, and PPARβ/δ. Activation of PPAR-α reduces triglyceride level and is involved in regulation of energy homeostasis. Activation of PPAR-γ causes insulin sensitization and enhances glucose metabolism, whereas activation of PPAR-β/δ enhances fatty acids metabolism. Thus, PPAR family of nuclear receptors plays a major regulatory role in energy homeostasis and metabolic function. The present review critically analyzes the protective and detrimental effect of PPAR agonists in dyslipidemia, diabetes, adipocyte differentiation, inflammation, cancer, lung diseases, neurodegenerative disorders, fertility or reproduction, pain, and obesity. PMID:22247890

  14. Cross-talk between an activator of nuclear receptors-mediated transcription and the D1 dopamine receptor signaling pathway.

    PubMed

    Schmidt, Azriel; Vogel, Robert; Rutledge, Su Jane; Opas, Evan E; Rodan, Gideon A; Friedman, Eitan

    2005-03-01

    Nuclear receptors are transcription factors that usually interact, in a ligand-dependent manner, with specific DNA sequences located within promoters of target genes. The nuclear receptors can also be controlled in a ligand-independent manner via the action of membrane receptors and cellular signaling pathways. 5-Tetradecyloxy-2-furancarboxylic acid (TOFA) was shown to stimulate transcription from the MMTV promoter via chimeric receptors that consist of the DNA binding domain of GR and the ligand binding regions of the PPARbeta or LXRbeta nuclear receptors (GR/PPARbeta and GR/LXRbeta). TOFA and hydroxycholesterols also modulate transcription from NF-kappaB- and AP-1-controlled reporter genes and induce neurite differentiation in PC12 cells. In CV-1 cells that express D(1) dopamine receptors, D(1) dopamine receptor stimulation was found to inhibit TOFA-stimulated transcription from the MMTV promoter that is under the control of chimeric GR/PPARbeta and GR/LXRbeta receptors. Treatment with the D(1) dopamine receptor antagonist, SCH23390, prevented dopamine-mediated suppression of transcription, and by itself increased transcription controlled by GR/LXRbeta. Furthermore, combined treatment of CV-1 cells with TOFA and SCH23390 increased transcription controlled by the GR/LXRbeta chimeric receptor synergistically. The significance of this in vitro synergy was demonstrated in vivo, by the observation that SCH23390 (but not haloperidol)-mediated catalepsy in rats was potentiated by TOFA, thus showing that an agent that mimics the in vitro activities of compounds that activate members of the LXR and PPAR receptor families can influence D1 dopamine receptor elicited responses.

  15. N-3 polyunsaturated fatty acid regulation of hepatic gene transcription

    PubMed Central

    Jump, Donald B.

    2009-01-01

    Purpose of review The liver plays a central role in whole body lipid metabolism and adapts rapidly to changes in dietary fat composition. This adaption involves changes in the expression of genes involved in glycolysis, de-novo lipogenesis, fatty acid elongation, desaturation and oxidation. This review brings together metabolic and molecular studies that help explain n-3 (omega-3) polyunsaturated fatty acid regulation of hepatic gene transcription. Recent findings Dietary n-3 polyunsaturated fatty acid regulates hepatic gene expression by targeting three major transcriptional regulatory networks: peroxisome proliferator-activated receptor α, sterol regulatory element binding protein-1 and the carbohydrate regulatory element binding protein/Max-like factor X heterodimer. 22 : 6,n-3, the most prominent n-3 polyunsaturated fatty acid in tissues, is a weak activator of peroxisome proliferator-activated receptor α. Hepatic metabolism of 22 : 6,n-3, however, generates 20 : 5,n-3, a strong peroxisome proliferator-activated receptor α activator. In contrast to peroxisome proliferator-activated receptor α, 22 : 6,n-3 is the most potent fatty acid regulator of hepatic sterol regulatory element binding protein-1. 22 : 6,n-3 suppresses sterol regulatory element binding protein-1 gene expression while enhancing degradation of nuclear sterol regulatory element binding protein-1 through 26S proteasome and Erk1/2-dependent mechanisms. Both n-3 and n-6 polyunsaturated fatty acid suppress carbohydrate regulatory element binding protein and Max-like factor X nuclear abundance and interfere with glucose-regulated hepatic metabolism. Summary These studies have revealed unique mechanisms by which specific polyunsaturated fatty acids control peroxisome proliferator activated receptor α, sterol regulatory element binding protein-1 and carbohydrate regulatory element binding protein/Max-like factor X function. As such, specific metabolic and signal transduction pathways contribute significantly to the fatty acid regulation of these transcription factors and their corresponding regulatory networks. PMID:18460914

  16. Radiobromine production, isolation and radiosynthesis for the development of a novel prostate cancer radiotherapeutic agent

    NASA Astrophysics Data System (ADS)

    Ellison, Paul A.; Graves, Stephen A.; Murali, Dhanabalan; De Jesus, Onofre T.; Barnhart, Todd E.; Thomadsen, Bruce R.; Speer, Tod; Nickles, Robert J.

    2017-05-01

    The radioactive isotopes of bromine accessible with low energy medical cyclotrons have unique potential for diagnostic and radiotherapeutic nuclear medicine applications. These include bromine-76 (t1/2 = 16 h) for positron emission tomography and bromine-77 (t1/2 = 57 h) for Auger radionuclide therapy. Methods are presented to synthesize NiSe discs from elemental starting materials for proton irradiation in a 4π water cooling target configuration. Radiobromide was isolated from the irradiated NiSe material by dry distillation and used to radiolabel 7α-BrDHT for investigation as an Androgen-receptor-targeted theranostic radiopharmaceutical.

  17. Identification of a novel selective PPARγ ligand with a unique binding mode and improved therapeutic profile in vitro

    PubMed Central

    Yi, Wei; Shi, Jingjing; Zhao, Guanguan; Zhou, X. Edward; Suino-Powell, Kelly; Melcher, Karsten; Xu, H. Eric

    2017-01-01

    Thiazolidinediones (TZD) function as potent anti-diabetic drugs through their direct action on the nuclear receptor peroxisome proliferator-activated receptor γ (PPARγ), but their therapeutic benefits are compromised by severe side effects. To address this concern, here we developed a potent “hit” compound, VSP-51, which is a novel selective PPARγ-modulating ligand with improved therapeutic profiles in vitro compared to the multi-billion dollar TZD drug rosiglitazone (Rosi). Unlike Rosi, VSP-51 is a partial agonist of PPARγ with improved insulin sensitivity due to its ability to bind PPARγ with high affinity without stimulating adipocyte differentiation and the expression of adipogenesis-related genes. We have determined the crystal structure of the PPARγ ligand-binding domain (LBD) in complex with VSP-51, which revealed a unique mode of binding for VSP-51 and provides the molecular basis for the discrimination between VSP-51 from TZDs and other ligands such as telmisartan, SR1663 and SR1664. Taken together, our findings demonstrate that: a) VSP-51 can serve as a promising candidate for anti-diabetic drug discovery; and b) provide a rational basis for the development of future pharmacological agents targeting PPARγ with advantages over current TZD drugs. PMID:28128331

  18. Berberine binds RXRα to suppress β-catenin signaling in colon cancer cells.

    PubMed

    Ruan, H; Zhan, Y Y; Hou, J; Xu, B; Chen, B; Tian, Y; Wu, D; Zhao, Y; Zhang, Y; Chen, X; Mi, P; Zhang, L; Zhang, S; Wang, X; Cao, H; Zhang, W; Wang, H; Li, H; Su, Y; Zhang, X K; Hu, T

    2017-12-14

    Berberine, an isoquinoline alkaloid, is a traditional oriental medicine used to treat diarrhea and gastroenteritis. Recently, we reported that it could inhibit the growth of intestinal polyp in animals and in patients with the familial adenomatous polyposis by downregulating β-catenin signaling. However, the intracellular target mediating the effects of berberine remains elusive. Here, we provide evidence that berberine inhibits β-catenin function via directly binding to a unique region comprising residues Gln275, Arg316 and Arg371 in nuclear receptor retinoid X receptor alpha (RXRα), where berberine concomitantly binding to and synergistically activating RXRα with 9-cis-retinoic acid (9-cis-RA), a natural ligand binding to the classical ligand-binding pocket of RXRα. Berberine binding promotes RXRα interaction with nuclear β-catenin, leading to c-Cbl mediated degradation of β-catenin, and consequently inhibits the proliferation of colon cancer cells. Furthermore, berberine suppresses the growth of human colon carcinoma xenograft in nude mice in an RXRα-dependent manner. Together, our study not only identifies RXRα as a direct protein target for berberine but also dissects their binding mode and validates that berberine indeed suppresses β-catenin signaling and cell growth in colon cancer via binding RXRα, which provide new strategies for the design of new RXRα-based antitumor agents and drug combinations.

  19. Berberine binds RXRα to suppress β-catenin signaling in colon cancer cells

    PubMed Central

    Ruan, H; Zhan, Y Y; Hou, J; Xu, B; Chen, B; Tian, Y; Wu, D; Zhao, Y; Zhang, Y; Chen, X; Mi, P; Zhang, L; Zhang, S; Wang, X; Cao, H; Zhang, W; Wang, H; Li, H; Su, Y; Zhang, X K; Hu, T

    2017-01-01

    Berberine, an isoquinoline alkaloid, is a traditional oriental medicine used to treat diarrhea and gastroenteritis. Recently, we reported that it could inhibit the growth of intestinal polyp in animals and in patients with the familial adenomatous polyposis by downregulating β-catenin signaling. However, the intracellular target mediating the effects of berberine remains elusive. Here, we provide evidence that berberine inhibits β-catenin function via directly binding to a unique region comprising residues Gln275, Arg316 and Arg371 in nuclear receptor retinoid X receptor alpha (RXRα), where berberine concomitantly binding to and synergistically activating RXRα with 9-cis-retinoic acid (9-cis-RA), a natural ligand binding to the classical ligand-binding pocket of RXRα. Berberine binding promotes RXRα interaction with nuclear β-catenin, leading to c-Cbl mediated degradation of β-catenin, and consequently inhibits the proliferation of colon cancer cells. Furthermore, berberine suppresses the growth of human colon carcinoma xenograft in nude mice in an RXRα-dependent manner. Together, our study not only identifies RXRα as a direct protein target for berberine but also dissects their binding mode and validates that berberine indeed suppresses β-catenin signaling and cell growth in colon cancer via binding RXRα, which provide new strategies for the design of new RXRα-based antitumor agents and drug combinations. PMID:28846104

  20. Ligand-dependent nucleo-cytoplasmic shuttling of peroxisome proliferator-activated receptors, PPARα and PPARγ.

    PubMed

    Umemoto, Tomoe; Fujiki, Yukio

    2012-07-01

    Peroxisome proliferator-activated receptors (PPARs) play important roles in diverse biological processes including metabolisms of sugars and lipids and differentiation of cells such as adipocytes. PPARs are transcription factors belonging to the ligand-dependent hormone receptor group. To function as transcription factors, PPARs translocate into nucleus where they associate with transcription apparatus. However, mechanisms underlying nuclear transport of PPARs remain enigmatic. We show here that PPARα and PPARγ dynamically shuttle between nucleus and cytoplasm, although they constitutively and predominantly appear in nucleus. With a series of truncation mutants, we identify that PPAR nuclear transport is mediated by at least two nuclear localization signals (NLSs) in DNA-binding domain (DBD)-hinge and activation function 1 (AF1) regions and their respective receptors including importinα/β, importin 7, and an unidentified receptor. PPARs also harbor two nuclear export signals in DBD and ligand-binding domain regions that are recognized by distinct export receptors, calreticulin and CRM1. Moreover, we show that nuclear-cytoplasmic shuttling of PPARs is regulated by respective PPAR ligands and Ca2+ concentration. Taken together, we suggest that the multiple pathways for the nuclear-cytoplasmic transport of PPARs regulate the biological functions of PPARs in response to external signals. © 2012 The Authors Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  1. Androgen Receptor Content of the Normal and Hyperplastic Canine Prostate

    PubMed Central

    Shain, Sydney A.; Boesel, Robert W.

    1978-01-01

    A procedure was developed for measurement of androgen receptors in cytoplasmic extracts of prostates from intact dogs. The protocol utilized exchange saturation analysis at 15°C employing the synthetic androgen R1881 (17β-hydroxy-17α-methylestra-4,9,11-trien-3-one) as the ligand probe and quantitatively detected total cytoplasmic androgen receptor (Rc, androgen-free receptor, and RcA, androgen-occupied receptor) present at the initiation of the assay. This protocol was employed in conjunction with a tissue mince saturation analysis procedure (for quantitation of nuclear androgen receptor) to quantitate total androgen receptor content of normal and hyperplastic prostates obtained from young (2.5- or 4.6-yr old) and aged (12.5-yr old) purebred dogs of known birth date. The total cytoplasmic androgen receptor content (picomoles per prostate) of hyperplastic prostates was 4.6-fold greater than that of normal prostates. The total nuclear androgen receptor content of hyperplastic prostates (picomoles per prostate measured in crude nuclear preparations) was either 5.0- (4.6-yr-old dogs) or 7.8-fold (2.5-yr-old dogs) greater than that of normal prostates. However, androgen receptor content per cell was identical for hyperplastic and normal canine prostates, with the exception that nuclear androgen receptor was diminished in prostates from 2.5-yr-old dogs. The cell content per gram dry weight was identical for hyperplastic and normal canine prostates. We conclude that canine prostate hyperplasia is characterized by coordinate proliferation of androgen receptor-positive and androgen receptor-negative cells and is not a consequence of increased accumulation of 5α-dihydrotestosterone due to proliferation of androgen receptors per prostate cell. PMID:76635

  2. Comparison of steroid receptors from the androgen responsive DDT1 cell line and the nonresponsive HVP cell line.

    PubMed

    Norris, J S; Kohler, P O

    1978-01-01

    Two hamster cell lines have been isolated from androgen target tissue. The DDT1 cells derived from ductus deferens tissue exhibit a growth response to androgens, while the HVP cells derived from ventral prostate are androgen unresponsive. Both cell lines contain androgen receptors, that are similar when compared by kinetic methods, sedimentation velocity, chromatographic procedures or nuclear translocation ability. The forms of the high salt extracted nuclear receptors are indistinguishable chromatographically. Therefore, we postulate that the lesion preventing androgen induced growth in the HVP cell line is subseqent to nuclear translocation of the steroid receptor complex.

  3. Cloning retinoid and peroxisome proliferator-activated nuclear receptors of the Pacific oyster and in silico binding to environmental chemicals

    PubMed Central

    Vogeler, Susanne; Galloway, Tamara S.; Isupov, Michail

    2017-01-01

    Disruption of nuclear receptors, a transcription factor superfamily regulating gene expression in animals, is one proposed mechanism through which pollution causes effects in aquatic invertebrates. Environmental pollutants have the ability to interfere with the receptor’s functions through direct binding and inducing incorrect signals. Limited knowledge of invertebrate endocrinology and molecular regulatory mechanisms, however, impede the understanding of endocrine disruptive effects in many aquatic invertebrate species. Here, we isolated three nuclear receptors of the Pacific oyster, Crassostrea gigas: two isoforms of the retinoid X receptor, CgRXR-1 and CgRXR-2, a retinoic acid receptor ortholog CgRAR, and a peroxisome proliferator-activated receptor ortholog CgPPAR. Computer modelling of the receptors based on 3D crystal structures of human proteins was used to predict each receptor’s ability to bind to different ligands in silico. CgRXR showed high potential to bind and be activated by 9-cis retinoic acid and the organotin tributyltin (TBT). Computer modelling of CgRAR revealed six residues in the ligand binding domain, which prevent the successful interaction with natural and synthetic retinoid ligands. This supports an existing theory of loss of retinoid binding in molluscan RARs. Modelling of CgPPAR was less reliable due to high discrepancies in sequence to its human ortholog. Yet, there are suggestions of binding to TBT, but not to rosiglitazone. The effect of potential receptor ligands on early oyster development was assessed after 24h of chemical exposure. TBT oxide (0.2μg/l), all-trans retinoic acid (ATRA) (0.06 mg/L) and perfluorooctanoic acid (20 mg/L) showed high effects on development (>74% abnormal developed D-shelled larvae), while rosiglitazone (40 mg/L) showed no effect. The results are discussed in relation to a putative direct (TBT) disruption effect on nuclear receptors. The inability of direct binding of ATRA to CgRAR suggests either a disruptive effect through a pathway excluding nuclear receptors or an indirect interaction. Our findings provide valuable information on potential mechanisms of molluscan nuclear receptors and the effects of environmental pollution on aquatic invertebrates. PMID:28426724

  4. Receptor Expression in Rat Skeletal Muscle Cell Cultures

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.

    1996-01-01

    One on the most persistent problems with long-term space flight is atrophy of skeletal muscles. Skeletal muscle is unique as a tissue in the body in that its ability to undergo atrophy or hypertrophy is controlled exclusively by cues from the extracellular environment. The mechanism of communication between muscle cells and their environment is through a group of membrane-bound and soluble receptors, each of which carries out unique, but often interrelated, functions. The primary receptors include acetyl choline receptors, beta-adrenergic receptors, glucocorticoid receptors, insulin receptors, growth hormone (i.e., somatotropin) receptors, insulin-like growth factor receptors, and steroid receptors. This project has been initiated to develop an integrated approach toward muscle atrophy and hypertrophy that takes into account information on the populations of the entire group of receptors (and their respective hormone concentrations), and it is hypothesized that this information can form the basis for a predictive computer model for muscle atrophy and hypertrophy. The conceptual basis for this project is illustrated in the figure below. The individual receptors are shown as membrane-bound, with the exception of the glucocorticoid receptor which is a soluble intracellular receptor. Each of these receptors has an extracellular signalling component (e.g., innervation, glucocorticoids, epinephrine, etc.), and following the interaction of the extracellular component with the receptor itself, an intracellular signal is generated. Each of these intracellular signals is unique in its own way; however, they are often interrelated.

  5. Steroid receptor coupling becomes nuclear.

    PubMed

    Galigniana, Mario D

    2012-06-22

    In this issue of Chemistry & Biology, Grossman et al. report a study on aldosterone-dependent nuclear translocation of the mineralocorticoid receptor (MR). They analyze the dependency of MR retrotransport, DNA-binding, and transcriptional activity on Hsp90 and demonstrate that MR dimerization is a nuclear event. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Atropisomers of 2,2',3,3',6,6'-hexachlorobiphenyl (PCB 136) exhibit stereoselective effects on activation of nuclear receptors in vitro.

    PubMed

    Pěnčíková, Kateřina; Brenerová, Petra; Svržková, Lucie; Hrubá, Eva; Pálková, Lenka; Vondráček, Jan; Lehmler, Hans-Joachim; Machala, Miroslav

    2017-11-09

    PCB 136 is an environmentally relevant chiral PCB congener, which has been found in vivo to be present in form of rotational isomers (atropisomers). Its atropselective biotransformation or neurotoxic effects linked with sensitization of ryanodine receptor suggest that it might interact also with other intracellular receptors in a stereospecific manner. However, possible atropselective effects of PCB 136 on nuclear receptor transactivation remain unknown. Therefore, in this study, atropselective effects of PCB 136 on nuclear receptors controlling endocrine signaling and/or expression of xenobiotic and steroid hormone catabolism were investigated. PCB136 atropisomers were found to exert differential effects on estrogen receptor (ER) activation; (+)-PCB 136 was estrogenic, while (-)-PCB 136 was antiestrogenic. In contrast, inhibition of androgen receptor (AR) activity was not stereospecific. Both PCB136 stereoisomers induced the constitutive androgen receptor (CAR)-dependent gene expression; however, no significant stereospecificity of PCB 136 atropisomers was observed. PCB136 was a partial inducer of the pregnane X receptor (PXR)-dependent gene expression. Here, (-)-PCB 136 was a significantly more potent inducer of PXR activity than (+)-PCB 136. Taken together, the present results indicate that at least two nuclear receptors participating in endocrine regulation or metabolism, ER and PXR, could be regulated in an atropselective manner by chiral PCB 136. The enantioselective enrichment of PCB atropisomers in animal and human tissues may thus have significant consequences for endocrine-disrupting effects of chiral ortho-substituted PCB congeners.

  7. NR4A nuclear receptors are orphans but not lonesome.

    PubMed

    Kurakula, Kondababu; Koenis, Duco S; van Tiel, Claudia M; de Vries, Carlie J M

    2014-11-01

    The NR4A subfamily of nuclear receptors consists of three mammalian members: Nur77, Nurr1, and NOR-1. The NR4A receptors are involved in essential physiological processes such as adaptive and innate immune cell differentiation, metabolism and brain function. They act as transcription factors that directly modulate gene expression, but can also form trans-repressive complexes with other transcription factors. In contrast to steroid hormone nuclear receptors such as the estrogen receptor or the glucocorticoid receptor, no ligands have been described for the NR4A receptors. This lack of known ligands might be explained by the structure of the ligand-binding domain of NR4A receptors, which shows an active conformation and a ligand-binding pocket that is filled with bulky amino acid side-chains. Other mechanisms, such as transcriptional control, post-translational modifications and protein-protein interactions therefore seem to be more important in regulating the activity of the NR4A receptors. For Nur77, over 80 interacting proteins (the interactome) have been identified so far, and roughly half of these interactions has been studied in more detail. Although the NR4As show some overlap in interacting proteins, less information is available on the interactome of Nurr1 and NOR-1. Therefore, the present review will describe the current knowledge on the interactomes of all three NR4A nuclear receptors with emphasis on Nur77. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Nuclear-specific AR-V7 Protein Localization is Necessary to Guide Treatment Selection in Metastatic Castration-resistant Prostate Cancer.

    PubMed

    Scher, Howard I; Graf, Ryon P; Schreiber, Nicole A; McLaughlin, Brigit; Lu, David; Louw, Jessica; Danila, Daniel C; Dugan, Lyndsey; Johnson, Ann; Heller, Glenn; Fleisher, Martin; Dittamore, Ryan

    2017-06-01

    Circulating tumor cells (CTCs) expressing AR-V7 protein localized to the nucleus (nuclear-specific) identify metastatic castration-resistant prostate cancer (mCRPC) patients with improved overall survival (OS) on taxane therapy relative to the androgen receptor signaling inhibitors (ARSi) abiraterone acetate, enzalutamide, and apalutamide. To evaluate if expanding the positivity criteria to include both nuclear and cytoplasmic AR-V7 localization ("nuclear-agnostic") identifies more patients who would benefit from a taxane over an ARSi. The study used a cross-sectional cohort. Between December 2012 and March 2015, 193 pretherapy blood samples, 191 of which were evaluable, were collected and processed from 161 unique mCRPC patients before starting a new line of systemic therapy for disease progression at the Memorial Sloan Kettering Cancer Center. The association between two AR-V7 scoring criteria, post-therapy prostate-specific antigen (PSA) change (PTPC) and OS following ARSi or taxane treatment, was explored. One criterion required nuclear-specific AR-V7 localization, and the other required an AR-V7 signal but was agnostic to protein localization in CTCs. Correlation of AR-V7 status to PTPC and OS was investigated. Relationships with survival were analyzed using multivariable Cox regression and log-rank analyses. A total of 34 (18%) samples were AR-V7-positive using nuclear-specific criteria, and 56 (29%) were AR-V7-positive using nuclear-agnostic criteria. Following ARSi treatment, none of the 16 nuclear-specific AR-V7-positive samples and six of the 32 (19%) nuclear-agnostic AR-V7-positive samples had ≥50% PTPC at 12 weeks. The strongest baseline factor influencing OS was the interaction between the presence of nuclear-specific AR-V7-positive CTCs and treatment with a taxane (hazard ratio 0.24, 95% confidence interval 0.078-0.79; p=0.019). This interaction was not significant when nuclear-agnostic criteria were used. To reliably inform treatment selection using an AR-V7 protein biomarker in CTCs, nuclear-specific localization is required. We analyzed outcomes for patients with metastatic castration-resistant prostate cancer on androgen receptor signaling inhibitors and standard chemotherapy. Patients with circulating tumor cells that had AR-V7 protein in the cellular nuclei were very likely to survive longer on taxane-based chemotherapy, and tests unable to distinguish where the protein is located in the cell are not as predictive of benefit. Copyright © 2016 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  9. Design principles of nuclear receptor signaling: how complex networking improves signal transduction

    PubMed Central

    Kolodkin, Alexey N; Bruggeman, Frank J; Plant, Nick; Moné, Martijn J; Bakker, Barbara M; Campbell, Moray J; van Leeuwen, Johannes P T M; Carlberg, Carsten; Snoep, Jacky L; Westerhoff, Hans V

    2010-01-01

    The topology of nuclear receptor (NR) signaling is captured in a systems biological graphical notation. This enables us to identify a number of ‘design' aspects of the topology of these networks that might appear unnecessarily complex or even functionally paradoxical. In realistic kinetic models of increasing complexity, calculations show how these features correspond to potentially important design principles, e.g.: (i) cytosolic ‘nuclear' receptor may shuttle signal molecules to the nucleus, (ii) the active export of NRs may ensure that there is sufficient receptor protein to capture ligand at the cytoplasmic membrane, (iii) a three conveyor belts design dissipating GTP-free energy, greatly aids response, (iv) the active export of importins may prevent sequestration of NRs by importins in the nucleus and (v) the unspecific nature of the nuclear pore may ensure signal-flux robustness. In addition, the models developed are suitable for implementation in specific cases of NR-mediated signaling, to predict individual receptor functions and differential sensitivity toward physiological and pharmacological ligands. PMID:21179018

  10. NUREBASE: database of nuclear hormone receptors.

    PubMed

    Duarte, Jorge; Perrière, Guy; Laudet, Vincent; Robinson-Rechavi, Marc

    2002-01-01

    Nuclear hormone receptors are an abundant class of ligand activated transcriptional regulators, found in varying numbers in all animals. Based on our experience of managing the official nomenclature of nuclear receptors, we have developed NUREBASE, a database containing protein and DNA sequences, reviewed protein alignments and phylogenies, taxonomy and annotations for all nuclear receptors. The reviewed NUREBASE is completed by NUREBASE_DAILY, automatically updated every 24 h. Both databases are organized under a client/server architecture, with a client written in Java which runs on any platform. This client, named FamFetch, integrates a graphical interface allowing selection of families, and manipulation of phylogenies and alignments. NUREBASE sequence data is also accessible through a World Wide Web server, allowing complex queries. All information on accessing and installing NUREBASE may be found at http://www.ens-lyon.fr/LBMC/laudet/nurebase.html.

  11. Discovering relationships between nuclear receptor signaling pathways, genes, and tissues in Transcriptomine.

    PubMed

    Becnel, Lauren B; Ochsner, Scott A; Darlington, Yolanda F; McOwiti, Apollo; Kankanamge, Wasula H; Dehart, Michael; Naumov, Alexey; McKenna, Neil J

    2017-04-25

    We previously developed a web tool, Transcriptomine, to explore expression profiling data sets involving small-molecule or genetic manipulations of nuclear receptor signaling pathways. We describe advances in biocuration, query interface design, and data visualization that enhance the discovery of uncharacterized biology in these pathways using this tool. Transcriptomine currently contains about 45 million data points encompassing more than 2000 experiments in a reference library of nearly 550 data sets retrieved from public archives and systematically curated. To make the underlying data points more accessible to bench biologists, we classified experimental small molecules and gene manipulations into signaling pathways and experimental tissues and cell lines into physiological systems and organs. Incorporation of these mappings into Transcriptomine enables the user to readily evaluate tissue-specific regulation of gene expression by nuclear receptor signaling pathways. Data points from animal and cell model experiments and from clinical data sets elucidate the roles of nuclear receptor pathways in gene expression events accompanying various normal and pathological cellular processes. In addition, data sets targeting non-nuclear receptor signaling pathways highlight transcriptional cross-talk between nuclear receptors and other signaling pathways. We demonstrate with specific examples how data points that exist in isolation in individual data sets validate each other when connected and made accessible to the user in a single interface. In summary, Transcriptomine allows bench biologists to routinely develop research hypotheses, validate experimental data, or model relationships between signaling pathways, genes, and tissues. Copyright © 2017, American Association for the Advancement of Science.

  12. Fatty Acid Amide Hydrolase (FAAH) Inhibition Enhances Memory Acquisition through Activation of PPAR-alpha Nuclear Receptors

    ERIC Educational Resources Information Center

    Mazzola, Carmen; Medalie, Julie; Scherma, Maria; Panlilio, Leigh V.; Solinas, Marcello; Tanda, Gianluigi; Drago, Filippo; Cadet, Jean Lud; Goldberg, Steven R.; Yasar, Sevil

    2009-01-01

    Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of anandamide (a cannabinoid CB[subscript 1]-receptor ligand) and oleoylethanolamide and palmitoylethanolamide (OEA and PEA, ligands for alpha-type peroxisome proliferator-activated nuclear receptors, PPAR-alpha) when and where they are naturally released in the brain.…

  13. Negative regulation of parathyroid hormone-related protein expression by steroid hormones

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kajitani, Takashi; Tamamori-Adachi, Mimi; Okinaga, Hiroko

    Highlights: {yields} Steroid hormones repress expression of PTHrP in the cell lines where the corresponding nuclear receptors are expressed. {yields} Nuclear receptors are required for suppression of PTHrP expression by steroid hormones, except for androgen receptor. {yields} Androgen-induced suppression of PTHrP expression appears to be mediated by estrogen receptor. -- Abstract: Elevated parathyroid hormone-related protein (PTHrP) is responsible for humoral hypercalcemia of malignancy (HHM), which is of clinical significance in treatment of terminal patients with malignancies. Steroid hormones were known to cause suppression of PTHrP expression. However, detailed studies linking multiple steroid hormones to PTHrP expression are lacking. Here wemore » studied PTHrP expression in response to steroid hormones in four cell lines with excessive PTHrP production. Our study established that steroid hormones negatively regulate PTHrP expression. Vitamin D receptor, estrogen receptor {alpha}, glucocorticoid receptor, and progesterone receptor, were required for repression of PTHrP expression by the cognate ligands. A notable exception was the androgen receptor, which was dispensable for suppression of PTHrP expression in androgen-treated cells. We propose a pathway(s) involving nuclear receptors to suppress PTHrP expression.« less

  14. Normalization of TAM post-receptor signaling reveals a cell invasive signature for Axl tyrosine kinase.

    PubMed

    Kimani, Stanley G; Kumar, Sushil; Davra, Viralkumar; Chang, Yun-Juan; Kasikara, Canan; Geng, Ke; Tsou, Wen-I; Wang, Shenyan; Hoque, Mainul; Boháč, Andrej; Lewis-Antes, Anita; De Lorenzo, Mariana S; Kotenko, Sergei V; Birge, Raymond B

    2016-09-06

    Tyro3, Axl, and Mertk (TAMs) are a family of three conserved receptor tyrosine kinases that have pleiotropic roles in innate immunity and homeostasis and when overexpressed in cancer cells can drive tumorigenesis. In the present study, we engineered EGFR/TAM chimeric receptors (EGFR/Tyro3, EGFR/Axl, and EGF/Mertk) with the goals to interrogate post-receptor functions of TAMs, and query whether TAMs have unique or overlapping post-receptor activation profiles. Stable expression of EGFR/TAMs in EGFR-deficient CHO cells afforded robust EGF inducible TAM receptor phosphorylation and activation of downstream signaling. Using a series of unbiased screening approaches, that include kinome-view analysis, phosphor-arrays, RNAseq/GSEA analysis, as well as cell biological and in vivo readouts, we provide evidence that each TAM has unique post-receptor signaling platforms and identify an intrinsic role for Axl that impinges on cell motility and invasion compared to Tyro3 and Mertk. These studies demonstrate that TAM show unique post-receptor signatures that impinge on distinct gene expression profiles and tumorigenic outcomes.

  15. Activity and subcellular compartmentalization of peroxisome proliferator-activated receptor alpha are altered by the centrosome-associated protein CAP350.

    PubMed

    Patel, Hansa; Truant, Ray; Rachubinski, Richard A; Capone, John P

    2005-01-01

    Peroxisome proliferator-activated nuclear hormone receptors (PPAR) are ligand-activated transcription factors that play pivotal roles in governing metabolic homeostasis and cell growth. PPARs are primarily in the nucleus but, under certain circumstances, can be found in the cytoplasm. We show here that PPAR(alpha) interacts with the centrosome-associated protein CAP350. CAP350 also interacts with PPAR(delta), PPAR(gamma) and liver-X-receptor alpha, but not with the 9-cis retinoic acid receptor, RXR(alpha). Immunofluorescence analysis indicated that PPAR(alpha) is diffusely distributed in the nucleus and excluded from the cytoplasm. However, in the presence of coexpressed CAP350, PPAR(alpha) colocalizes with CAP350 to discrete nuclear foci and to the centrosome, perinuclear region and intermediate filaments. In contrast, the subcellular distribution of RXR(alpha) or of thyroid hormone receptor alpha was not altered by coexpression of CAP350. An amino-terminal fragment of CAP350 was localized exclusively to nuclear foci and was sufficient to recruit PPAR(alpha) to these sites. Mutation of the single putative nuclear hormone receptor interacting signature motif LXXLL present in this fragment had no effect on its subnuclear localization but abrogated recruitment of PPAR(alpha) to nuclear foci. Surprisingly, mutation of the LXXLL motif in this CAP350 subfragment did not prevent its binding to PPAR(alpha) in vitro, suggesting that this motif serves some function other than PPAR(alpha) binding in recruiting PPAR(alpha) to nuclear spots. CAP350 inhibited PPAR(alpha)-mediated transactivation in an LXXLL-dependent manner, suggesting that CAP350 represses PPAR(alpha) function. Our findings implicate CAP350 in a dynamic process that recruits PPAR(alpha) to discrete nuclear and cytoplasmic compartments and suggest that altered intracellular compartmentalization represents a regulatory process that modulates PPAR function.

  16. Action mechanisms of Liver X Receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gabbi, Chiara; Warner, Margaret; Gustafsson, Jan-Åke, E-mail: jgustafs@central.uh.edu

    2014-04-11

    Highlights: • LXRα and LXRβ are ligand-activated nuclear receptors. • They share oxysterol ligands and the same heterodimerization partner, RXR. • LXRs regulate lipid and glucose metabolism, CNS and immune functions, and water transport. - Abstract: The two Liver X Receptors, LXRα and LXRβ, are nuclear receptors belonging to the superfamily of ligand-activated transcription factors. They share more than 78% homology in amino acid sequence, a common profile of oxysterol ligands and the same heterodimerization partner, Retinoid X Receptor. LXRs play crucial roles in several metabolic pathways: lipid metabolism, in particular in preventing cellular cholesterol accumulation; glucose homeostasis; inflammation; centralmore » nervous system functions and water transport. As with all nuclear receptors, the transcriptional activity of LXR is the result of an orchestration of numerous cellular factors including ligand bioavailability, presence of corepressors and coactivators and cellular context i.e., what other pathways are activated in the cell at the time the receptor recognizes its ligand. In this mini-review we summarize the factors regulating the transcriptional activity and the mechanisms of action of these two receptors.« less

  17. The Genomic Actions and Functional Implications of Nuclear PRLr in Human Breast Carcinoma

    DTIC Science & Technology

    2011-03-01

    Johnston CL, Cox HC, Gomm JJ, Coombes RC 1995 Fibroblast growth factor receptors ( FGFRs ) localize in different cellular compartments. A splice variant...has been observed (11). The Jak2/Stat5a pathway is widely shared with other transmembrane receptors such as epidermal growth factor receptor (EGFR...2005 Novel prognostic value of nuclear epidermal growth factor receptor in breast cancer. Cancer Res 65:338-348 13. Lin SY, Makino K, Xia W, Matin A

  18. Identification of COUP-TFII Orphan Nuclear Receptor as a Retinoic Acid-Activated Receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kruse, Schoen W; Suino-Powell, Kelly; Zhou, X Edward

    2010-01-12

    The chicken ovalbumin upstream promoter-transcription factors (COUP-TFI and II) make up the most conserved subfamily of nuclear receptors that play key roles in angiogenesis, neuronal development, organogenesis, cell fate determination, and metabolic homeostasis. Although the biological functions of COUP-TFs have been studied extensively, little is known of their structural features or aspects of ligand regulation. Here we report the ligand-free 1.48 {angstrom} crystal structure of the human COUP-TFII ligand-binding domain. The structure reveals an autorepressed conformation of the receptor, where helix {alpha}10 is bent into the ligand-binding pocket and the activation function-2 helix is folded into the cofactor binding site,more » thus preventing the recruitment of coactivators. In contrast, in multiple cell lines, COUP-TFII exhibits constitutive transcriptional activity, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, and ligand binding, substantially reduce the COUP-TFII transcriptional activity. Importantly, retinoid acids are able to promote COUP-TFII to recruit coactivators and activate a COUP-TF reporter construct. Although the concentration needed is higher than the physiological levels of retinoic acids, these findings demonstrate that COUP-TFII is a ligand-regulated nuclear receptor, in which ligands activate the receptor by releasing it from the autorepressed conformation.« less

  19. Integrated in silico and in vivo approaches to investigate effects of BDE-99 mediated by the nuclear receptors on developing zebrafish.

    PubMed

    Zhang, Li; Jin, Yaru; Han, Zhihua; Liu, Hongling; Shi, Laihao; Hua, Xiaoxue; Doering, Jon A; Tang, Song; Giesy, John P; Yu, Hongxia

    2018-03-01

    One of the most abundant polybrominated diphenyl ethers (PBDEs) is 2,2',4,4',5-pentabromodiphenyl ether (BDE-99), which persists and potentially bioaccumulates in aquatic wildlife. Previous studies in mammals have shown that BDE-99 affects development and disrupts certain endocrine functions through signaling pathways mediated by nuclear receptors. However, fewer studies have investigated the potential of BDE-99 to interact with nuclear receptors in aquatic vertebrates such as fish. In the present study, interactions between BDE-99 and nuclear receptors were investigated by in silico and in vivo approaches. This PBDE was able to dock into the ligand-binding domain of zebrafish aryl hydrocarbon receptor 2 (AhR2) and pregnane X receptor (PXR). It had a significant effect on the transcriptional profiles of genes associated with AhR or PXR. Based on the developed cytoscape of all zebrafish genes, it was also inferred that AhR and PXR could interact via cross-talk. In addition, both the in silico and in vivo approaches found that BDE-99 affected peroxisome proliferator-activated receptor alpha (PPARα), glucocorticoid receptor, and thyroid receptor. Collectively, our results demonstrate for the first time detailed in silico evidence that BDE-99 can bind to and interact with zebrafish AhR and PXR. These findings can be used to elaborate the molecular mechanism of BDE-99 and guide more objective environmental risk assessments. Environ Toxicol Chem 2018;37:780-787. © 2017 SETAC. © 2017 SETAC.

  20. Parathyroid Hormone Directs Bone Marrow Mesenchymal Cell Fate.

    PubMed

    Fan, Yi; Hanai, Jun-Ichi; Le, Phuong T; Bi, Ruiye; Maridas, David; DeMambro, Victoria; Figueroa, Carolina A; Kir, Serkan; Zhou, Xuedong; Mannstadt, Michael; Baron, Roland; Bronson, Roderick T; Horowitz, Mark C; Wu, Joy Y; Bilezikian, John P; Dempster, David W; Rosen, Clifford J; Lanske, Beate

    2017-03-07

    Intermittent PTH administration builds bone mass and prevents fractures, but its mechanism of action is unclear. We genetically deleted the PTH/PTHrP receptor (PTH1R) in mesenchymal stem cells using Prx1Cre and found low bone formation, increased bone resorption, and high bone marrow adipose tissue (BMAT). Bone marrow adipocytes traced to Prx1 and expressed classic adipogenic markers and high receptor activator of nuclear factor kappa B ligand (Rankl) expression. RANKL levels were also elevated in bone marrow supernatant and serum, but undetectable in other adipose depots. By cell sorting, Pref1 + RANKL + marrow progenitors were twice as great in mutant versus control marrow. Intermittent PTH administration to control mice reduced BMAT significantly. A similar finding was noted in male osteoporotic patients. Thus, marrow adipocytes exhibit osteogenic and adipogenic characteristics, are uniquely responsive to PTH, and secrete RANKL. These studies reveal an important mechanism for PTH's therapeutic action through its ability to direct mesenchymal cell fate. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Nuclear receptor/microRNA circuitry links muscle fiber type to energy metabolism.

    PubMed

    Gan, Zhenji; Rumsey, John; Hazen, Bethany C; Lai, Ling; Leone, Teresa C; Vega, Rick B; Xie, Hui; Conley, Kevin E; Auwerx, Johan; Smith, Steven R; Olson, Eric N; Kralli, Anastasia; Kelly, Daniel P

    2013-06-01

    The mechanisms involved in the coordinate regulation of the metabolic and structural programs controlling muscle fitness and endurance are unknown. Recently, the nuclear receptor PPARβ/δ was shown to activate muscle endurance programs in transgenic mice. In contrast, muscle-specific transgenic overexpression of the related nuclear receptor, PPARα, results in reduced capacity for endurance exercise. We took advantage of the divergent actions of PPARβ/δ and PPARα to explore the downstream regulatory circuitry that orchestrates the programs linking muscle fiber type with energy metabolism. Our results indicate that, in addition to the well-established role in transcriptional control of muscle metabolic genes, PPARβ/δ and PPARα participate in programs that exert opposing actions upon the type I fiber program through a distinct muscle microRNA (miRNA) network, dependent on the actions of another nuclear receptor, estrogen-related receptor γ (ERRγ). Gain-of-function and loss-of-function strategies in mice, together with assessment of muscle biopsies from humans, demonstrated that type I muscle fiber proportion is increased via the stimulatory actions of ERRγ on the expression of miR-499 and miR-208b. This nuclear receptor/miRNA regulatory circuit shows promise for the identification of therapeutic targets aimed at maintaining muscle fitness in a variety of chronic disease states, such as obesity, skeletal myopathies, and heart failure.

  2. Transcriptional activation of PPARalpha by phenobarbital in the absence of CAR and PXR.

    PubMed

    Tamasi, Viola; Juvan, Peter; Beer, Markus; Rozman, Damjana; Meyer, Urs A

    2009-01-01

    The nuclear receptors CAR (constitutive androstane receptor) and PXR (pregnane X receptor) mediate the effects of phenobarbital on gene transcription. To investigate the relative contribution of these nuclear receptors to the expression of specific genes we studied the effect of phenobarbital in livers of wild type, CAR(-/-), PXR(-/-) and CAR/PXR(-/-) knockout mice. Spotted Steroltalk v1 cDNA arrays were applied containing probes for genes involved in drug metabolism, sterol biosynthesis, steroid synthesis/transport and heme synthesis. In the absence of CAR and PXR, phenobarbital unexpectedly induced mRNAs of several nuclear receptors, including PPARalpha and its target genes Cyp4a10 and Cyp4a14. Interestingly, in primary cultures of hepatocytes isolated from CAR/PXR(-/-) knockout mice, phenobarbital increased HNF-4alpha levels. In further experiments in these hepatocyte cultures we provide evidence that phenobarbital directly induces transcription of the PPARalpha gene via its HNF-4alpha response element, and indirectly by lack of inhibitory crosstalk of AMPK, CAR and PXR with HNF-4alpha. Our results provide further insight into CAR and PXR-independent effects of phenobarbital and the crosstalk between different nuclear receptor signaling pathways.

  3. The Peptide Near the C Terminus Regulates Receptor CAR Nuclear Translocation Induced by Xenochemicals in Mouse Liver

    PubMed Central

    Zelko, Igor; Sueyoshi, Tatsuya; Kawamoto, Takeshi; Moore, Rick; Negishi, Masahiko

    2001-01-01

    In response to phenobarbital (PB) and other PB-type inducers, the nuclear receptor CAR translocates to the mouse liver nucleus (T. Kawamoto et al., Mol. Cell. Biol. 19:6318–6322, 1999). To define the translocation mechanism, fluorescent protein-tagged human CAR (hCAR) was expressed in the mouse livers using the in situ DNA injection and gene delivery systems. As in the wild-type hCAR, the truncated receptor lacking the C-terminal 10 residues (i.e., AF2 domain) translocated to the nucleus, indicating that the PB-inducible translocation is AF2 independent. Deletion of the 30 C-terminal residues abolished the receptor translocation, and subsequent site-directed mutagenesis delineated the PB-inducible translocation activity of the receptor to the peptide L313GLL316AEL319. Ala mutations of Leu313, Leu316, or Leu319 abrogated the translocation of CAR in the livers, while those of Leu312 or Leu315 did not affect the nuclear translocation. The leucine-rich peptide dictates the nuclear translocation of hCAR in response to various PB-type inducers and appears to be conserved in the mouse and rat receptors. PMID:11283262

  4. The REV-ERBs and RORs: molecular links between circadian rhythms and lipid homeostasis

    PubMed Central

    Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P

    2011-01-01

    Research efforts spanning the past two decades have established a clear link between nuclear receptor function, regulation of the circadian clock and lipid homeostasis. As such, this family of receptors represents an important area of research. Recent advances in the field have identified two nuclear receptor subfamilies, the REV-ERBs and the ‘retinoic acid receptor-related orphan receptors’ (RORs), as critical regulators of the circadian clock with significant roles in lipid homeostasis. In this review, the latest information garnered from cutting-edge research on these two nuclear receptor subfamilies will be discussed. Through direct targeting of the REV-ERBs and RORs with synthetic ligands, generation of novel tools aimed at characterizing their function in vivo have been developed, which may lead to novel therapeutics for the treatment of metabolic disorders. PMID:21526899

  5. Distinct gene regulatory programs define the inhibitory effects of liver X receptors and PPARG on cancer cell proliferation.

    PubMed

    Savic, Daniel; Ramaker, Ryne C; Roberts, Brian S; Dean, Emma C; Burwell, Todd C; Meadows, Sarah K; Cooper, Sara J; Garabedian, Michael J; Gertz, Jason; Myers, Richard M

    2016-07-11

    The liver X receptors (LXRs, NR1H2 and NR1H3) and peroxisome proliferator-activated receptor gamma (PPARG, NR1C3) nuclear receptor transcription factors (TFs) are master regulators of energy homeostasis. Intriguingly, recent studies suggest that these metabolic regulators also impact tumor cell proliferation. However, a comprehensive temporal molecular characterization of the LXR and PPARG gene regulatory responses in tumor cells is still lacking. To better define the underlying molecular processes governing the genetic control of cellular growth in response to extracellular metabolic signals, we performed a comprehensive, genome-wide characterization of the temporal regulatory cascades mediated by LXR and PPARG signaling in HT29 colorectal cancer cells. For this analysis, we applied a multi-tiered approach that incorporated cellular phenotypic assays, gene expression profiles, chromatin state dynamics, and nuclear receptor binding patterns. Our results illustrate that the activation of both nuclear receptors inhibited cell proliferation and further decreased glutathione levels, consistent with increased cellular oxidative stress. Despite a common metabolic reprogramming, the gene regulatory network programs initiated by these nuclear receptors were widely distinct. PPARG generated a rapid and short-term response while maintaining a gene activator role. By contrast, LXR signaling was prolonged, with initial, predominantly activating functions that transitioned to repressive gene regulatory activities at late time points. Through the use of a multi-tiered strategy that integrated various genomic datasets, our data illustrate that distinct gene regulatory programs elicit common phenotypic effects, highlighting the complexity of the genome. These results further provide a detailed molecular map of metabolic reprogramming in cancer cells through LXR and PPARG activation. As ligand-inducible TFs, these nuclear receptors can potentially serve as attractive therapeutic targets for the treatment of various cancers.

  6. Retinoids induce integrin-independent lymphocyte adhesion through RAR-α nuclear receptor activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Whelan, Jarrett T.; Wang, Lei; Chen, Jianming

    2014-11-28

    Highlights: • Transcription and translation are required for retinoid-induced lymphocyte adhesion. • RAR activation is sufficient to induced lymphocyte cell adhesion. • Vitamin D derivatives inhibit RAR-prompted lymphocyte adhesion. • Adhesion occurs through a novel binding site within ADAM disintegrin domains. • RARα is a key nuclear receptor for retinoid-dependent lymphocyte cell adhesion. - Abstract: Oxidative metabolites of vitamin A, in particular all-trans-retinoic acid (atRA), have emerged as key factors in immunity by specifying the localization of immune cells to the gut. Although it is appreciated that isomers of retinoic acid activate the retinoic acid receptor (RAR) and retinoid Xmore » receptor (RXR) family of nuclear receptors to elicit cellular changes, the molecular details of retinoic acid action remain poorly defined in immune processes. Here we employ a battery of agonists and antagonists to delineate the specific nuclear receptors utilized by retinoids to evoke lymphocyte cell adhesion to ADAM (adisintegrin and metalloprotease) protein family members. We report that RAR agonism is sufficient to promote immune cell adhesion in both immortal and primary immune cells. Interestingly, adhesion occurs independent of integrin function, and mutant studies demonstrate that atRA-induced adhesion to ADAM members required a distinct binding interface(s) as compared to integrin recognition. Anti-inflammatory corticosteroids as well as 1,25-(OH){sub 2}D{sub 3}, a vitamin D metabolite that prompts immune cell trafficking to the skin, potently inhibited the observed adhesion. Finally, our data establish that induced adhesion was specifically attributable to the RAR-α receptor isotype. The current study provides novel molecular resolution as to which nuclear receptors transduce retinoid exposure into immune cell adhesion.« less

  7. Nuclear hormone receptor coregulator: role in hormone action, metabolism, growth, and development.

    PubMed

    Mahajan, Muktar A; Samuels, Herbert H

    2005-06-01

    Nuclear hormone receptor coregulator (NRC) (also referred to as activating signal cointegrator-2, thyroid hormone receptor-binding protein, peroxisome proliferator activating receptor-interacting protein, and 250-kDa receptor associated protein) belongs to a growing class of nuclear cofactors widely known as coregulators or coactivators that are necessary for transcriptional activation of target genes. The NRC gene is also amplified and overexpressed in breast, colon, and lung cancers. NRC is a 2063-amino acid protein that harbors a potent N-terminal activation domain (AD1) and a second more centrally located activation domain (AD2) that is rich in Glu and Pro. Near AD2 is a receptor-interacting domain containing an LxxLL motif (LxxLL-1), which interacts with a wide variety of ligand-bound nuclear hormone receptors with high affinity. A second LxxLL motif (LxxLL-2) located in the C-terminal region of NRC is more restricted in its nuclear hormone receptor specificity. The intrinsic activation potential of NRC is regulated by a C-terminal serine, threonine, leucine-regulatory domain. The potential role of NRC as a cointegrator is suggested by its ability to enhance transcriptional activation of a wide variety of transcription factors and from its in vivo association with a number of known transcriptional regulators including CBP/p300. Recent studies in mice indicate that deletion of both NRC alleles leads to embryonic lethality resulting from general growth retardation coupled with developmental defects in the heart, liver, brain, and placenta. NRC(-/-) mouse embryo fibroblasts spontaneously undergo apoptosis, indicating the importance of NRC as a prosurvival and antiapoptotic gene. Studies with 129S6 NRC(+/-) mice indicate that NRC is a pleiotropic regulator that is involved in growth, development, reproduction, metabolism, and wound healing.

  8. Brain nuclear receptors and body weight regulation

    USDA-ARS?s Scientific Manuscript database

    Neural pathways, especially those in the hypothalamus, integrate multiple nutritional, hormonal, and neural signals, resulting in the coordinated control of body weight balance and glucose homeostasis. Nuclear receptors (NRs) sense changing levels of nutrients and hormones, and therefore play essent...

  9. Nuclear receptors HR96 and ultraspiracle from the fall armyworm (Spodoptera frugiperda), developmental expression and induction by xenobiotics.

    PubMed

    Giraudo, Maeva; Audant, Pascaline; Feyereisen, René; Le Goff, Gaëlle

    2013-05-01

    The fall armyworm Spodoptera frugiperda is a major polyphagous pest in agriculture and little is known on how this insect can adapt to the diverse and potentially toxic plant allelochemicals that they ingest or to insecticides. To investigate the involvement of nuclear receptors in the response of S. frugiperda to its chemical environment, we cloned SfHR96, a nuclear receptor orthologous to the mammalian xenobiotic receptors, pregnane X receptor (PXR) and constitutive androstane receptor (CAR). We also cloned ultraspiracle (USP), the ortholog of retinoid X receptor (RXR) that serves as partner of dimerization of PXR and CAR. Cloning of SfUSP revealed the presence of two isoforms, SfUSP-1 and SfUSP-2 in this species, that differ in their N-terminal region. The expression of these receptors as well as the ecdysone receptor was studied during specific steps of development in different tissues. SfHR96 was constitutively expressed in larval midgut, fat body and Malpighian tubules throughout the last two instars and pupal stage, as well as in Sf9 cells. EcR and SfUSP-2 showed peaks of expression before larval moults and during metamorphosis, whereas SfUSP-1 was mainly expressed in the pre-pupal stage. Receptor induction was followed after exposure of larvae or cells to 11 chemical compounds. SfHR96 was not inducible by the tested compounds. EcR was significantly induced by the 20-hydroxyecdysone agonist, methoxyfenozide, and SfUSP showed an increase expression when exposed to the juvenile hormone analog, methoprene. The cloning of these nuclear receptors is a first step in understanding the important capacities of adaptation of this insect pest. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. The Unique Dopamine/Ecdysteroid Receptor Modulates Ethanol-Induced Sedation in Drosophila.

    PubMed

    Petruccelli, Emily; Li, Qi; Rao, Yi; Kitamoto, Toshihiro

    2016-04-20

    Steroids profoundly influence behavioral responses to alcohol by activating canonical nuclear hormone receptors and exerting allosteric effects on ion channels. Accumulating evidence has demonstrated that steroids can also trigger biological effects by directly binding G-protein-coupled receptors (GPCRs), yet physiological roles of such unconventional steroid signaling in controlling alcohol-induced behaviors remain unclear. The dopamine/ecdysteroid receptor (DopEcR) is a GPCR that mediates nongenomic actions of ecdysteroids, the major steroid hormones in insects. Here, we report that Drosophila DopEcR plays a critical role in ethanol-induced sedation.DopEcR mutants took longer than control flies to become sedated during exposure to ethanol, despite having normal ethanol absorption or metabolism. RNAi-mediated knockdown of DopEcR expression revealed that this receptor is necessary after eclosion, and is required in particular neuronal subsets, including cholinergic and peptidergic neurons, to mediate this behavior. Additionally, flies ubiquitously overexpressing DopEcR cDNA had a tendency to become sedated quickly upon ethanol exposure. These results indicate that neuronal subset-specific expression of DopEcR in adults is required for normal sedation upon exposure to ethanol. We also obtained evidence indicating that DopEcR may promote ethanol sedation by suppressing epidermal growth factor receptor/extracellular signal-regulated kinase signaling. Last, genetic and pharmacological analyses suggested that in adult flies ecdysone may serve as an inverse agonist of DopEcR and suppress the sedation-promoting activity of DopEcR in the context of ethanol exposure. Our findings provide the first evidence for the involvement of nongenomic G-protein-coupled steroid receptors in the response to alcohol, and shed new light on the potential roles of steroids in alcohol-use disorders. Alcohol abuse is an alarming personal and societal burden. The improvement of prevention and treatment strategies for alcohol-use disorders requires a better understanding of their biological basis. Steroid hormones profoundly affect alcohol-induced behaviors, but the contribution of their unconventional, nongenomic actions during these responses has not yet been elucidated. We found that Drosophila DopEcR, a unique G-protein-coupled receptor (GPCR) with dual specificity for dopamine and steroids, mediates noncanonical steroid actions to promote ethanol-induced sedation. Because steroid signaling and the behavioral response to alcohol are evolutionarily well conserved, our findings suggest that analogous mammalian receptors likely play important roles in alcohol-use disorders. Our work provides a foundation for further characterizing the function and mechanisms of action of nonclassical steroid GPCR signaling. Copyright © 2016 the authors 0270-6474/16/364647-11$15.00/0.

  11. The Unique Dopamine/Ecdysteroid Receptor Modulates Ethanol-Induced Sedation in Drosophila

    PubMed Central

    Petruccelli, Emily; Li, Qi; Rao, Yi

    2016-01-01

    Steroids profoundly influence behavioral responses to alcohol by activating canonical nuclear hormone receptors and exerting allosteric effects on ion channels. Accumulating evidence has demonstrated that steroids can also trigger biological effects by directly binding G-protein-coupled receptors (GPCRs), yet physiological roles of such unconventional steroid signaling in controlling alcohol-induced behaviors remain unclear. The dopamine/ecdysteroid receptor (DopEcR) is a GPCR that mediates nongenomic actions of ecdysteroids, the major steroid hormones in insects. Here, we report that Drosophila DopEcR plays a critical role in ethanol-induced sedation. DopEcR mutants took longer than control flies to become sedated during exposure to ethanol, despite having normal ethanol absorption or metabolism. RNAi-mediated knockdown of DopEcR expression revealed that this receptor is necessary after eclosion, and is required in particular neuronal subsets, including cholinergic and peptidergic neurons, to mediate this behavior. Additionally, flies ubiquitously overexpressing DopEcR cDNA had a tendency to become sedated quickly upon ethanol exposure. These results indicate that neuronal subset-specific expression of DopEcR in adults is required for normal sedation upon exposure to ethanol. We also obtained evidence indicating that DopEcR may promote ethanol sedation by suppressing epidermal growth factor receptor/extracellular signal-regulated kinase signaling. Last, genetic and pharmacological analyses suggested that in adult flies ecdysone may serve as an inverse agonist of DopEcR and suppress the sedation-promoting activity of DopEcR in the context of ethanol exposure. Our findings provide the first evidence for the involvement of nongenomic G-protein-coupled steroid receptors in the response to alcohol, and shed new light on the potential roles of steroids in alcohol-use disorders. SIGNIFICANCE STATEMENT Alcohol abuse is an alarming personal and societal burden. The improvement of prevention and treatment strategies for alcohol-use disorders requires a better understanding of their biological basis. Steroid hormones profoundly affect alcohol-induced behaviors, but the contribution of their unconventional, nongenomic actions during these responses has not yet been elucidated. We found that Drosophila DopEcR, a unique G-protein-coupled receptor (GPCR) with dual specificity for dopamine and steroids, mediates noncanonical steroid actions to promote ethanol-induced sedation. Because steroid signaling and the behavioral response to alcohol are evolutionarily well conserved, our findings suggest that analogous mammalian receptors likely play important roles in alcohol-use disorders. Our work provides a foundation for further characterizing the function and mechanisms of action of nonclassical steroid GPCR signaling. PMID:27098705

  12. The role of retinoic acid receptors and their cognate ligands in reproduction in a context of triorganotin based endocrine disrupting chemicals.

    PubMed

    Macejova, Dana; Toporova, L; Brtko, J

    2016-07-01

    Retinoic acid (RA), an active form of vitamin A, regulates the embryonic development, male and female reproduction and induces important effects on the cell development, proliferation, and differentiation. These effects are mediated by the retinoid (RAR) and rexinoid nuclear receptors (RXR), which are considered to be a ligand-activated, DNA-binding, trans-acting, and transcription-modulating proteins, involved in a general molecular mechanism responsible for the transcriptional responses in target genes. Organotin compounds are typical environmental contaminants and suspected endocrine disrupting substances. They may affect processes of reproductive system in mammals, predominantly via nuclear receptor signaling pathways. Triorganotins, such as tributyltin chloride (TBTCl) and triphenyltin chloride (TPTCl), are capable to bind to RXR molecules, and thus represent potent agonists of RXR subtypes of nuclear receptors not sharing any structural characteristics with endogenous ligands of nuclear receptors. Th is article summarizes selected effects of biologically active retinoids and rexinoids on both male and female reproduction and also deals with the effects of organotin compounds evoking endocrine disrupting actions in reproduction.

  13. Atmospheric transport modelling in support of CTBT verification—overview and basic concepts

    NASA Astrophysics Data System (ADS)

    Wotawa, Gerhard; De Geer, Lars-Erik; Denier, Philippe; Kalinowski, Martin; Toivonen, Harri; D'Amours, Real; Desiato, Franco; Issartel, Jean-Pierre; Langer, Matthias; Seibert, Petra; Frank, Andreas; Sloan, Craig; Yamazawa, Hiromi

    Under the provisions of the Comprehensive Nuclear-Test-Ban Treaty (CTBT), a global monitoring system comprising different verification technologies is currently being set up. The network will include 80 radionuclide (RN) stations distributed all over the globe that measure treaty-relevant radioactive species. While the seismic subsystem cannot distinguish between chemical and nuclear explosions, RN monitoring would provide the "smoking gun" of a possible treaty violation. Atmospheric transport modelling (ATM) will be an integral part of CTBT verification, since it provides a geo-temporal location capability for the RN technology. In this paper, the basic concept for the future ATM software system to be installed at the International Data Centre is laid out. The system is based on the operational computation of multi-dimensional source-receptor sensitivity fields for all RN samples by means of adjoint tracer transport modelling. While the source-receptor matrix methodology has already been applied in the past, the system that we suggest will be unique and unprecedented, since it is global, real-time and aims at uncovering source scenarios that are compatible with measurements. Furthermore, it has to deal with source dilution ratios that are by orders of magnitude larger than in typical transport model applications. This new verification software will need continuous scientific attention, and may well provide a prototype system for future applications in areas of environmental monitoring, emergency response and verification of other international agreements and treaties.

  14. Nuclear deterrents: Intrinsic regulators of IL-1β-induced effects on hippocampal neurogenesis.

    PubMed

    O'Léime, Ciarán S; Cryan, John F; Nolan, Yvonne M

    2017-11-01

    Hippocampal neurogenesis, the process by which new neurons are born and develop into the host circuitry, begins during embryonic development and persists throughout adulthood. Over the last decade considerable insights have been made into the role of hippocampal neurogenesis in cognitive function and the cellular mechanisms behind this process. Additionally, an increasing amount of evidence exists on the impact of environmental factors, such as stress and neuroinflammation on hippocampal neurogenesis and subsequent impairments in cognition. Elevated expression of the pro-inflammatory cytokine interleukin-1β (IL-1β) in the hippocampus is established as a significant contributor to the neuronal demise evident in many neurological and psychiatric disorders and is now known to negatively regulate hippocampal neurogenesis. In order to prevent the deleterious effects of IL-1β on neurogenesis it is necessary to identify signalling pathways and regulators of neurogenesis within neural progenitor cells that can interact with IL-1β. Nuclear receptors are ligand regulated transcription factors that are involved in modulating a large number of cellular processes including neurogenesis. In this review we focus on the signalling mechanisms of specific nuclear receptors involved in regulating neurogenesis (glucocorticoid receptors, peroxisome proliferator activated receptors, estrogen receptors, and nuclear receptor subfamily 2 group E member 1 (NR2E1 or TLX)). We propose that these nuclear receptors could be targeted to inhibit neuroinflammatory signalling pathways associated with IL-1β. We discuss their potential to be therapeutic targets for neuroinflammatory disorders affecting hippocampal neurogenesis and associated cognitive function. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. [AGEs and RAGE - advanced glycation end-products and their receptor in questions and answers].

    PubMed

    Kalousová, Marta; Zima, Tomáš

    2014-09-01

    Advanced glycation end products (AGEs) play an important role in the pathogenesis of chronic diseases and their complications, especially diabetic complications, atherosclerosis, complications of chronic kidney diseases and neurodegenerative diseases. These substances are formed via non-enzymatic glycation and their formation is potentiated in case of carbonyl stress. AGEs are represented by a heterogeneous group of compounds, e.g. carboxymethyllysine, pentosine, methylglyoxallysin dimer, vesperlysine, imidazolones etc. AGEs can modify proteins and so change their physical and chemical properties and can act also via specific receptors, among them RAGE (receptor for advanced glycation end products) is the best known but not the unique one. RAGE is a multiligand receptor capable to bind also HMGB1 (high mobility group box protein 1), S100 proteins or amyloid fibrils. RAGE - ligand interactions results to activation of a variety of signaling pathways including oxidative stress and activation of nuclear factor κB and subsequent proinflammatory response depending on the cell type. AGEs and RAGE together with further mechanisms - hexosamine pathway, polyol pathway, lipid metabolism disorder, activation of proteinkinase C, oxidative stress and inflammatory reaction take part in the pathogenesis of diabetic complications. Terapeuticaly it is possible to decrease endogenous formation of AGEs, influence the AGEs intake to the organism and their absorption in the intestine or stimulate their degradation.Key words: AGEs - advanced glycation end-products - carbonyl stress - diabetes mellitus - inflammation - oxidative stress - RAGE - receptor for AGEs - sRAGE.

  16. 0610009K11Rik, a testis-specific and germ cell nuclear receptor-interacting protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang Heng; Denhard, Leslie A.; Zhou Huaxin

    Using an in silico approach, a putative nuclear receptor-interacting protein 0610009K11Rik was identified in mouse testis. We named this gene testis-specific nuclear receptor-interacting protein-1 (Tnrip-1). Tnrip-1 was predominantly expressed in the testis of adult mouse tissues. Expression of Tnrip-1 in the testis was regulated during postnatal development, with robust expression in 14-day-old or older testes. In situ hybridization analyses showed that Tnrip-1 is highly expressed in pachytene spermatocytes and spermatids. Consistent with its mRNA expression, Tnrip-1 protein was detected in adult mouse testes. Immunohistochemical studies showed that Tnrip-1 is a nuclear protein and mainly expressed in pachytene spermatocytes and roundmore » spermatids. Moreover, co-immunoprecipitation analyses showed that endogenous Tnrip-1 protein can interact with germ cell nuclear receptor (GCNF) in adult mouse testes. Our results suggest that Tnrip-1 is a testis-specific and GCNF-interacting protein which may be involved in the modulation of GCNF-mediated gene transcription in spermatogenic cells within the testis.« less

  17. Modulation of NRF2 signaling pathway by nuclear receptors: implications for cancer.

    PubMed

    Namani, Akhileshwar; Li, Yulong; Wang, Xiu Jun; Tang, Xiuwen

    2014-09-01

    Nuclear factor-erythroid 2 p45-related factor 2 (NRF2, also known as Nfe2l2) plays a critical role in regulating cellular defense against electrophilic and oxidative stress by activating the expression of an array of antioxidant response element-dependent genes. On one hand, NRF2 activators have been used in clinical trials for cancer prevention and the treatment of diseases associated with oxidative stress; on the other hand, constitutive activation of NRF2 in many types of tumors contributes to the survival and growth of cancer cells, as well as resistance to anticancer therapy. In this review, we provide an overview of the NRF2 signaling pathway and discuss its role in carcinogenesis. We also introduce the inhibition of NRF2 by nuclear receptors. Further, we address the biological significance of regulation of the NRF2 signaling pathway by nuclear receptors in health and disease. Finally, we discuss the possible impact of NRF2 inhibition by nuclear receptors on cancer therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. NMR Study Reveals the Receiver Domain of Arabidopsis ETHYLENE RESPONSE1 Ethylene Receptor as an Atypical Type Response Regulator.

    PubMed

    Hung, Yi-Lin; Jiang, Ingjye; Lee, Yi-Zong; Wen, Chi-Kuang; Sue, Shih-Che

    2016-01-01

    The gaseous plant hormone ethylene, recognized by plant ethylene receptors, plays a pivotal role in various aspects of plant growth and development. ETHYLENE RESPONSE1 (ETR1) is an ethylene receptor isolated from Arabidopsis and has a structure characteristic of prokaryotic two-component histidine kinase (HK) and receiver domain (RD), where the RD structurally resembles bacteria response regulators (RRs). The ETR1 HK domain has autophosphorylation activity, and little is known if the HK can transfer the phosphoryl group to the RD for receptor signaling. Unveiling the correlation of the receptor structure and phosphorylation status would advance the studies towards the underlying mechanisms of ETR1 receptor signaling. In this study, using the nuclear magnetic resonance technique, our data suggested that the ETR1-RD is monomeric in solution and the rigid structure of the RD prevents the conserved aspartate residue phosphorylation. Comparing the backbone dynamics with other RRs, we propose that backbone flexibility is critical to the RR phosphorylation. Besides the limited flexibility, ETR1-RD has a unique γ loop conformation of opposite orientation, which makes ETR1-RD unfavorable for phosphorylation. These two features explain why ETR1-RD cannot be phosphorylated and is classified as an atypical type RR. As a control, phosphorylation of the ETR1-RD was also impaired when the sequence was swapped to the fragment of the bacterial typical type RR, CheY. Here, we suggest a molecule insight that the ETR1-RD already exists as an active formation and executes its function through binding with the downstream factors without phosphorylation.

  19. Nuclear Receptor Activity and Liver Cancer Lesion Progression

    EPA Science Inventory

    Nuclear receptors (NRs) are ligand-activated transcription factors that control diverse cellular processes. Chronic stimulation of some NRs is a non-genotoxic mechanism of rodent liver cancer with unclear relevance to humans. We explored this question using human CAR, PXR, PPARα,...

  20. Evidence for triclosan-induced activation of human and rodent xenobiotic nuclear receptors

    EPA Science Inventory

    The bacteriostat triclosan (2,4,40-trichloro-20-hydroxydiphenylether) (TCS) decreases rat serum thyroxine via putative nuclear receptor (NR) interaction(s) and subsequent transcriptional up-regulation of hepatic catabolism and clearance. However, due to the evolutionary divergenc...

  1. Mode of action from dose-response microarray data: case study using 10 environmental chemicals

    EPA Science Inventory

    Ligand-activated nuclear receptors regulate many biological processes through complex interactions with biological macromolecules. Certain xenobiotics alter nuclear receptor signaling through direct or indirect interactions. Defining the mode of action of such xenobiotics is di...

  2. Rapid, portable detection of endocrine disrupting chemicals through ligand-nuclear hormone receptor interactions.

    PubMed

    Hunt, J Porter; Schinn, Song-Min; Jones, Matthew D; Bundy, Bradley C

    2017-12-04

    Endocrine disrupting chemicals (EDC) are structurally diverse compounds that can interact with nuclear hormone receptors, posing significant risk to human and ecological health. Unfortunately, many conventional biosensors have been too structure-specific, labor-intensive or laboratory-oriented to detect broad ranges of EDC effectively. Recently, several technological advances are providing more rapid, portable, and affordable detection of endocrine-disrupting activity through ligand-nuclear hormone receptor interactions. Here, we overview these recent advances applied to EDC biosensors - including cell lyophilization, cell immobilization, cell-free systems, smartphone-based signal detection, and improved competitive binding assays.

  3. Estrogen receptor alpha phosphorylation and its functional impact in human breast cancer.

    PubMed

    Anbalagan, Muralidharan; Rowan, Brian G

    2015-12-15

    Estrogen receptor α (ERα) is a member of the nuclear receptor superfamily of transcription factors that regulates cell proliferation, differentiation and homeostasis in various tissues. Sustained exposure to estrogen/estradiol (E2) increases the risk of breast, endometrial and ovarian cancers. ERα function is also regulated by phosphorylation through various kinase signaling pathways that will impact various ERα functions including chromatin interaction, coregulator recruitment and gene expression, as well impact breast tumor growth/morphology and breast cancer patient response to endocrine therapy. However, many of the previously characterized ERα phosphorylation sites do not fully explain the impact of receptor phosphorylation on ERα function. This review discusses work from our laboratory toward understanding a role of ERα site-specific phosphorylation in ERα function and breast cancer. The key findings discussed in this review are: (1) the effect of site specific ERα phosphorylation on temporal recruitment of ERα and unique coactivator complexes to specific genes; (2) the impact of stable disruption of ERα S118 and S167 phosphorylation in breast cancer cells on eliciting unique gene expression profiles that culminate in significant effects on breast cancer growth/morphology/migration/invasion; (3) the Src kinase signaling pathway that impacts ERα phosphorylation to alter ERα function; and (4) circadian disruption by light exposure at night leading to elevated ERK1/2 and Src kinase and phosphorylation of ERα, concomitant with tamoxifen resistance in breast tumor models. Results from these studies demonstrate that even changes to single ERα phosphorylation sites can have a profound impact on ERα function in breast cancer. Future work will extend beyond single site phosphorylation analysis toward identification of specific patterns/profiles of ERα phosphorylation under different physiological/pharmacological conditions to understand how common phosphorylation profiles in breast cancer program specific physiological endpoints such as growth, apoptosis, migration/invasion, and endocrine therapy response. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Role of NF-κB in oxidative stress-induced defective dopamine D1 receptor signaling in the renal proximal tubules of Sprague Dawley rats

    PubMed Central

    Fardoun, Riham Zein; Asghar, Mohammad; Lokhandwala, Mustafa

    2009-01-01

    Dopamine promotes sodium excretion, in part, via activation of D1 receptors in renal proximal tubules (PT) and subsequent inhibition of Na, K-ATPase. Recently, we have reported that oxidative stress causes D1 receptors-G-protein uncoupling via mechanisms involving Protein Kinase C (PKC) and G-protein Coupled Receptor Kinase 2 (GRK2) in the primary culture of renal PT of Sprague Dawley (SD) rats. There are reports suggesting that redox-sensitive nuclear transcription factor, NF-κB, is activated in conditions associated with oxidative stress. This study was designed to identify the role of NF-κB in oxidative stress–induced defective renal D1 receptor –G-protein coupling and function. Treatment of the PT with hydrogen peroxide (H2O2, 50 μM/20 min) induced the nuclear translocation of NF-κB, increased PKC activity, and triggered the translocation of GRK2 to the proximal tubular membranes. This was accompanied by hyperphosphorylation of D1 receptors and defective D1 receptor-G-protein coupling. The functional consequence of these changes was decreased D1 receptor activation-mediated inhibition of Na, K-ATPase activity. Interestingly, pre-treatment with pyrrolidine dithiocarbamate (PDTC, 25 μM/10min), an NF-κB inhibitor, blocked the H2O2-induced nuclear translocation of NF-κB, increase in PKC activity, as well as GRK2 translocation and hyperphosphorylation of D1 receptors in the proximal tubular membranes. Furthermore, PDTC restored D1 receptor G-protein coupling and D1 receptor agonist-mediated inhibition of the Na, KATPase activity. Therefore, we suggest that oxidative stress causes nuclear translocation of NF-κB in the renal proximal tubules, which contributes to defective D1-receptor-G-protein coupling and function via mechanism involving PKC, membranous translocation of GRK 2, and subsequent phosphorylation of dopamine D1 receptors. PMID:17320758

  5. Leukotriene E4 activates peroxisome proliferator-activated receptor gamma and induces prostaglandin D2 generation by human mast cells.

    PubMed

    Paruchuri, Sailaja; Jiang, Yongfeng; Feng, Chunli; Francis, Sanjeev A; Plutzky, Jorge; Boyce, Joshua A

    2008-06-13

    Cysteinyl leukotrienes (cys-LTs) are potent inflammatory lipid mediators, of which leukotriene (LT) E(4) is the most stable and abundant in vivo. Although only a weak agonist of established G protein-coupled receptors (GPCRs) for cys-LTs, LTE(4) potentiates airway hyper-responsiveness (AHR) by a cyclooxygenase (COX)-dependent mechanism and induces bronchial eosinophilia. We now report that LTE(4) activates human mast cells (MCs) by a pathway involving cooperation between an MK571-sensitive GPCR and peroxisome proliferator-activated receptor (PPAR)gamma, a nuclear receptor for dietary lipids. Although LTD(4) is more potent than LTE(4) for inducing calcium flux by the human MC sarcoma line LAD2, LTE(4) is more potent for inducing proliferation and chemokine generation, and is at least as potent for upregulating COX-2 expression and causing prostaglandin D(2) (PGD(2)) generation. LTE(4) caused phosphorylation of extracellular signal-regulated kinase (ERK), p90RSK, and cyclic AMP-regulated-binding protein (CREB). ERK activation in response to LTE(4), but not to LTD(4), was resistant to inhibitors of phosphoinositol 3-kinase. LTE(4)-mediated COX-2 induction, PGD(2) generation, and ERK phosphorylation were all sensitive to interference by the PPARgamma antagonist GW9662 and to targeted knockdown of PPARgamma. Although LTE(4)-mediated PGD(2) production was also sensitive to MK571, an antagonist for the type 1 receptor for cys-LTs (CysLT(1)R), it was resistant to knockdown of this receptor. This LTE(4)-selective receptor-mediated pathway may explain the unique physiologic responses of human airways to LTE(4) in vivo.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peters, J.; Glucksberg, N.; Fogg, A.

    During the site closure of nuclear facilities where both radionuclides and chemicals are present in environmental media, state and federal regulatory agencies other than the Nuclear Regulatory Commission often have a stake in the regulation of the site closure process. At the Connecticut Yankee Atomic Power Company (CYAPCO) Haddam Neck Plant in Haddam, Connecticut, the site closure process includes both radiological and chemical cleanup which is regulated by two separate divisions within the state and two federal agencies. Each of the regulatory agencies has unique closure criteria which pertain to radionuclides and, consequently, there is overlapping and in some casesmore » disparate regulation of radionuclides. Considerable effort has been expended by CYAPCO to find common ground in meeting the site closure requirements for radionuclides required by each of the agencies. This paper discusses the approaches that have been used by CYAPCO to address radionuclide site closure requirements. Significant lessons learned from these approaches include the demonstration that public health cleanup criteria for most radionuclides of concern at nuclear power generation facilities are protective for chemical toxicity concerns and are protective for ecological receptors and, consequently, performing a baseline ecological risk assessment for radionuclides at power generation facilities is not generally necessary. (authors)« less

  7. Endothelial nuclear lamina is not required for glucocorticoid receptor nuclear import but does affect receptor-mediated transcription activation.

    PubMed

    Nayebosadri, Arman; Ji, Julie Y

    2013-08-01

    The lamina serves to maintain the nuclear structure and stiffness while acting as a scaffold for heterochromatin and many transcriptional proteins. Its role in endothelial mechanotransduction, specifically how nuclear mechanics impact gene regulation under shear stress, is not fully understood. In this study, we successfully silenced lamin A/C in bovine aortic endothelial cells to determine its role in both glucocorticoid receptor (GR) nuclear translocation and glucocorticoid response element (GRE) transcriptional activation in response to dexamethasone and shear stress. Nuclear translocation of GR, an anti-inflammatory nuclear receptor, in response to dexamethasone or shear stress (5, 10, and 25 dyn/cm(2)) was observed via time-lapse cell imaging and quantified using a Bayesian image analysis algorithm. Transcriptional activity of the GRE promoter was assessed using a dual-luciferase reporter plasmid. We found no dependence on nuclear lamina for GR translocation from the cytoplasm into the nucleus. However, the absence of lamin A/C led to significantly increased expression of luciferase under dexamethasone and shear stress induction as well as changes in histone protein function. PCR results for NF-κB inhibitor alpha (NF-κBIA) and dual specificity phosphatase 1 (DUSP1) genes further supported our luciferase data with increased expression in the absence of lamin. Our results suggest that absence of lamin A/C does not hinder passage of GR into the nucleus, but nuclear lamina is important to properly regulate GRE transcription. Nuclear lamina, rather than histone deacetylase (HDAC), is a more significant mediator of shear stress-induced transcriptional activity, while dexamethasone-initiated transcription is more HDAC dependent. Our findings provide more insights into the molecular pathways involved in nuclear mechanotransduction.

  8. Endothelial nuclear lamina is not required for glucocorticoid receptor nuclear import but does affect receptor-mediated transcription activation

    PubMed Central

    Nayebosadri, Arman

    2013-01-01

    The lamina serves to maintain the nuclear structure and stiffness while acting as a scaffold for heterochromatin and many transcriptional proteins. Its role in endothelial mechanotransduction, specifically how nuclear mechanics impact gene regulation under shear stress, is not fully understood. In this study, we successfully silenced lamin A/C in bovine aortic endothelial cells to determine its role in both glucocorticoid receptor (GR) nuclear translocation and glucocorticoid response element (GRE) transcriptional activation in response to dexamethasone and shear stress. Nuclear translocation of GR, an anti-inflammatory nuclear receptor, in response to dexamethasone or shear stress (5, 10, and 25 dyn/cm2) was observed via time-lapse cell imaging and quantified using a Bayesian image analysis algorithm. Transcriptional activity of the GRE promoter was assessed using a dual-luciferase reporter plasmid. We found no dependence on nuclear lamina for GR translocation from the cytoplasm into the nucleus. However, the absence of lamin A/C led to significantly increased expression of luciferase under dexamethasone and shear stress induction as well as changes in histone protein function. PCR results for NF-κB inhibitor alpha (NF-κBIA) and dual specificity phosphatase 1 (DUSP1) genes further supported our luciferase data with increased expression in the absence of lamin. Our results suggest that absence of lamin A/C does not hinder passage of GR into the nucleus, but nuclear lamina is important to properly regulate GRE transcription. Nuclear lamina, rather than histone deacetylase (HDAC), is a more significant mediator of shear stress-induced transcriptional activity, while dexamethasone-initiated transcription is more HDAC dependent. Our findings provide more insights into the molecular pathways involved in nuclear mechanotransduction. PMID:23703529

  9. Discrimination between NL1- and NL2-Mediated Nuclear Localization of the Glucocorticoid Receptor

    PubMed Central

    Savory, Joanne G. A.; Hsu, Brian; Laquian, Ian R.; Giffin, Ward; Reich, Terry; Haché, Robert J. G.; Lefebvre, Yvonne A.

    1999-01-01

    Glucocorticoid receptor (GR) cycles between a free liganded form that is localized to the nucleus and a heat shock protein (hsp)-immunophilin-complexed, unliganded form that is usually localized to the cytoplasm but that can also be nuclear. In addition, rapid nucleocytoplasmic exchange or shuttling of the receptor underlies its localization. Nuclear import of liganded GR is mediated through a well-characterized sequence, NL1, adjacent to the receptor DNA binding domain and a second, uncharacterized motif, NL2, that overlaps with the ligand binding domain. In this study we report that rapid nuclear import (half-life [t1/2] of 4 to 6 min) of agonist- and antagonist-treated GR and the localization of unliganded, hsp-associated GRs to the nucleus in G0 are mediated through NL1 and correlate with the binding of GR to pendulin/importin α. By contrast, NL2-mediated nuclear transfer of GR occurred more slowly (t1/2 = 45 min to 1 h), was agonist specific, and appeared to be independent of binding to importin α. Together, these results suggest that NL2 mediates the nuclear import of GR through an alternative nuclear import pathway. Nuclear export of GR was inhibited by leptomycin B, suggesting that the transfer of GR to the cytoplasm is mediated through the CRM1-dependent pathway. Inhibition of GR nuclear export by leptomycin B enhanced the nuclear localization of both unliganded, wild-type GR and hormone-treated NL1− GR. These results highlight that the subcellular localization of both liganded and unliganded GRs is determined, at least in part, by a flexible equilibrium between the rates of nuclear import and export. PMID:9891038

  10. Daphnia HR96 is a Promiscuous Xenobiotic and Endobiotic Nuclear Receptor

    PubMed Central

    Karimullina, Elina; Li, Yangchun; Ginjupalli, Gautam; Baldwin, William S.

    2012-01-01

    Daphnia pulex is the first crustacean to have its genome sequenced. The genome project provides new insight and data into how an aquatic crustacean may respond to environmental stressors, including toxicants. We cloned Daphnia pulex HR96 (DappuHR96), a nuclear receptor orthologous to the CAR/PXR/VDR group of nuclear receptors. In Drosophila melanogaster, (hormone receptor 96) HR96 responds to phenobarbital exposure and has been hypothesized as a toxicant receptor. Therefore, we set up a transactivation assay to test whether DappuHR96 is a promiscuous receptor activated by xenobiotics and endobiotics similar to the constitutive androstane receptor (CAR) and the pregnane X-receptor (PXR). Transactivation assays performed with a GAL4-HR96 chimera demonstrate that HR96 is a promiscuous toxicant receptor activated by a diverse set of chemicals such as pesticides, hormones, and fatty acids. Several environmental toxicants activate HR96 including estradiol, pyriproxyfen, chlorpyrifos, atrazine, and methane arsonate. We also observed repression of HR96 activity by chemicals such as triclosan, androstanol, and fluoxetine. Nearly 50% of the chemicals tested activated or inhibited HR96. Interestingly, unsaturated fatty acids were common activators or inhibitors of HR96 activity, indicating a link between diet and toxicant response. The omega-6 and omega-9 unsaturated fatty acids linoleic and oleic acid activated HR96, but the omega-3 unsaturated fatty acids alpha-linolenic acid and docosahexaenoic acid inhibited HR96, suggesting that these two distinct sets of lipids perform opposing roles in Daphnia physiology. This also provides a putative mechanism by which the ratio of dietary unsaturated fats may affect the ability of an organism to respond to a toxic insult. In summary, HR96 is a promiscuous nuclear receptor activated by numerous endo- and xenobiotics. PMID:22466357

  11. In vitro nuclear receptor inhibition and cytotoxicity of hydraulic fracturing chemicals and their binary mixtures.

    PubMed

    Bain, Peter A; Kumar, Anu

    2018-05-01

    The widespread use of hydraulic fracturing (HF) in oil and gas extraction operations has led to concern over environmental risks posed by chemicals used in HF fluids. Here we employed a suite of stable luciferase reporter gene assays to investigate the potential for selected HF chemicals or geogenics to activate or antagonise nuclear receptor signalling. We screened three biocides (bronopol [BP], glutaraldehyde [GA], and tetrakis(hydroxymethyl)phosphonium sulfate [THPS]), a surfactant (2-butoxyethanol), a friction reducer (polyacrylamide), and a coal seam geogenic (o-cresol) for their potential to act as agonists or antagonists of the estrogen receptor, androgen receptor, progesterone receptor (PR), glucocorticoid receptor or peroxisome proliferator-activated receptor gamma (PPARγ). None of the chemicals induced luciferase activity in any of assays used in the study. In antagonistic mode, BP, GA and THPS caused reductions in luciferase activity in the reporter assays at higher concentrations (50-100 μM), while at low concentrations (2-10 μM) GA and THPS enhanced luciferase activity in some assays relative to controls. None of the other tested chemicals exhibited antagonism in the selected assays. In most cases, altered receptor signalling only occurred at concentrations exhibiting cytotoxicity. However, PPARγ activity, and to a lesser extent PR activity, were inhibited by THPS at sub-cytotoxic concentrations. The majority of binary combinations tested exhibited significantly less-than-additive cytotoxicity, and none of the combinations exhibited synergistic cytotoxicity. In summary, the results of the present study indicate that the selected chemicals are not likely to function as direct agonists of the nuclear receptors tested, and only one chemical, THPS was an apparent partial antagonist of two nuclear receptors. Copyright © 2017. Published by Elsevier Ltd.

  12. Using Nuclear Receptor Activity to Stratify Hepatocarcinogens

    EPA Science Inventory

    Nuclear receptors (NR) are a superfamily of ligand-activated transcription factors that control a range of cellular processes. Persistent stimulation of some NR is a non-genotoxic mechanism of rodent liver cancer with unclear relevance to humans. Here we report on a systematic an...

  13. A Boolean Network Model of Nuclear Receptor Mediated Cell Cycle Progression

    EPA Science Inventory

    Nuclear receptors (NRs) are ligand-activated transcription factors that regulate a broad range of cellular processes. Hormones, lipids and xenobiotics have been shown to activate NRs with a range of consequences on development, metabolism, oxidative stress, apoptosis, and prolif...

  14. A Boolean Network Model of Nuclear Receptor Mediated Cell Cycle Progression (S)

    EPA Science Inventory

    Nuclear receptors (NRs) are ligand-activated transcription factors that regulate a broad range of cellular processes. Hormones, lipids and xenobiotics have been shown to activate NRs with a range of consequences on development, metabolism, oxidative stress, apoptosis, and prolif...

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Guodong; Department of Abdominal Surgery, Cancer treatment center, Fourth Affiliated Hospital of Harbin Medical University, Harbin; Lin, Wenwei

    Farnesoid X receptor (FXR) is a ligand-activated nuclear receptor and serves as a key regulator to maintain health of the liver and intestine. Bile acids are endogenous ligands of FXR, and there are increasing efforts to identify FXR modulators to serve as biological probes and/or pharmaceutical agents. Natural FXR ligands isolated from plants may serve as models to synthesize novel FXR modulators. In this study, we demonstrated that epigallocatechin-3-gallate (EGCG), a major tea catechin, specifically and dose-dependently activates FXR. In addition, EGCG induced FXR target gene expression in vitro. Surprisingly, in a co-activator (SRC2) recruitment assay, we found that EGCGmore » does not recruit SRC2 to FXR, but it dose-dependently inhibits recruitment of SRC2 to FXR (IC{sub 50}, 1 μM) by GW6064, which is a potent FXR synthetic ligand. In addition, EGCG suppressed FXR target gene expression induced by either GW4064 or chenodeoxycholic acid in vitro. Furthermore, wild-type and FXR knockout mice treated with an acute dose of EGCG had induced mRNA expression in a subset of FXR target genes in the intestine but not in the liver. In conclusion, EGCG is a unique modulator of FXR in the intestine and may serve as an important model for future development of FXR modulators. -- Highlights: ► Epigallocatechin-3-gallate (EGCG) is a unique farnesoid X receptor (FXR) modulator. ► EGCG activates FXR by itself, but inhibits FXR transactivation by other agonists. ► Low concentration of EGCG activates FXR in mouse intestine but not liver. ► EGCG activates FXR to induce a subset of FXR target genes in mouse intestine.« less

  16. HUMAN GRK4γ142V VARIANT PROMOTES AT1R-MEDIATED HYPERTENSION VIA RENAL HDAC1 INHIBITION

    PubMed Central

    Wang, Zheng; Zeng, Chunyu; Villar, Van Anthony M.; Chen, Shi-You; Konkalmatt, Prasad; Wang, Xiaoyan; Asico, Laureano D.; Jones, John E.; Yang, Yu; Sanada, Hironobu; Felder, Robin A.; Eisner, Gilbert M.; Weir, Matthew R.; Armando, Ines; Jose, Pedro A.

    2015-01-01

    The influence of a single gene on the etiology of essential hypertension may be difficult to ascertain, unless the gene interacts with other genes that are germane to blood pressure regulation. G protein-coupled receptor kinase type 4 (GRK4) is one such gene. We have reported that the expression of its variant hGRK4γ142V in mice results in hypertension due to impaired dopamine D1 receptor (D1R). Signaling through D1R and angiotensin II type I receptor (AT1R) reciprocally modulates renal sodium excretion and blood pressure. Here, we demonstrate the ability of the hGRK4γ142V to increase the expression and activity of the AT1R. We show that hGRK4γ142V phosphorylates histone deacetylase type 1 and promotes its nuclear export to the cytoplasm, resulting in increased AT1R expression and greater pressor response to angiotensin II. AT1R blockade and the deletion of the Agtr1a gene normalize the hypertension in hGRK4γ142V mice. These findings illustrate the unique role of GRK4 by targeting receptors with opposite physiological activity for the same goal of maintaining blood pressure homeostasis, and thus making the GRK4 a relevant therapeutic target to control blood pressure. PMID:26667412

  17. Kinetic Contributions to Gating by Interactions Unique to N-methyl-d-aspartate (NMDA) Receptors*

    PubMed Central

    Borschel, William F.; Cummings, Kirstie A.; Tindell, LeeAnn K.; Popescu, Gabriela K.

    2015-01-01

    Among glutamate-gated channels, NMDA receptors produce currents that subside with unusually slow kinetics, and this feature is essential to the physiology of central excitatory synapses. Relative to the homologous AMPA and kainate receptors, NMDA receptors have additional intersubunit contacts in the ligand binding domain that occur at both conserved and non-conserved sites. We examined GluN1/GluN2A single-channel currents with kinetic analyses and modeling to probe these class-specific intersubunit interactions for their role in glutamate binding and receptor gating. We found that substitutions that eliminate such interactions at non-conserved sites reduced stationary gating, accelerated deactivation, and imparted sensitivity to aniracetam, an AMPA receptor-selective positive modulator. Abolishing unique contacts at conserved sites also reduced stationary gating and accelerated deactivation. These results show that contacts specific to NMDA receptors, which brace the heterodimer interface within the ligand binding domain, stabilize actively gating receptor conformations and result in longer bursts and slower deactivations. They support the view that the strength of the heterodimer interface modulates gating in both NMDA and non-NMDA receptors and that unique interactions at this interface are responsible in part for basic differences between the kinetics of NMDA and non-NMDA currents at glutamatergic synapses. PMID:26370091

  18. Orphan Nuclear Receptors as Targets for Drug Development

    PubMed Central

    Mukherjee, Subhajit

    2012-01-01

    Orphan nuclear receptors regulate diverse biological processes. These important molecules are ligand-activated transcription factors that act as natural sensors for a wide range of steroid hormones and xenobiotic ligands. Because of their importance in regulating various novel signaling pathways, recent research has focused on identifying xenobiotics targeting these receptors for the treatment of multiple human diseases. In this review, we will highlight these receptors in several physiologic and pathophysiologic actions and demonstrate how their functions can be exploited for the successful development of newer drugs. PMID:20372994

  19. LASSO-ing Potential Nuclear Receptor Agonists and Antagonists: A New Computational Method for Database Screening

    EPA Science Inventory

    Nuclear receptors (NRs) are important biological macromolecular transcription factors that are implicated in multiple biological pathways and may interact with other xenobiotics that are endocrine disruptors present in the environment. Examples of important NRs include the androg...

  20. Epigenetic regulation of the expression of genes involved in steroid hormone biosynthesis and action

    PubMed Central

    Martinez-Arguelles, Daniel B.; Papadopoulos, Vassilios

    2010-01-01

    Steroid hormones participate in organ development, reproduction, body homeostasis, and stress responses. The steroid machinery is expressed in a development- and tissue-specific manner, with the expression of these factors being tightly regulated by an array of transcription factors (TFs). Epigenetics provides an additional layer of gene regulation through DNA methylation and histone tail modifications. Evidence of epigenetic regulation of key steroidogenic enzymes is increasing, though this does not seem to be a predominant regulatory pathway. Steroid hormones exert their action in target tissues through steroid nuclear receptors belonging to the NR3A and NR3C families. Nuclear receptor expression levels and post-translational modifications regulate their function and dictate their sensitivity to steroid ligands. Nuclear receptors and TFs are more likely to be epigenetically regulated than proteins involved in steroidogenesis and have secondary impact on the expression of these steroidogenic enzymes. Here we review evidence for epigenetic regulation of enzymes, transcription factors, and nuclear receptors related to steroid biogenesis and action. PMID:20156469

  1. Estrogen Receptor β and Its Domains Interact with Casein Kinase 2, Phosphokinase C, and N-Myristoylation Sites of Mitochondrial and Nuclear Proteins in Mouse Brain*

    PubMed Central

    Paramanik, Vijay; Thakur, Mahendra Kumar

    2012-01-01

    The localization of estrogen receptor (ER)β in mitochondria suggests ERβ-dependent regulation of genes, which is poorly understood. Here, we analyzed the ERβ interacting mitochondrial as well as nuclear proteins in mouse brain using pull-down assay and matrix-assisted laser desorption ionization mass spectroscopy (MALDI-MS). In the case of mitochondria, ERβ interacted with six proteins of 35–152 kDa, its transactivation domain (TAD) interacted with four proteins of 37–172 kDa, and ligand binding domain (LBD) interacted with six proteins of 37–161 kDa. On the other hand, in nuclei, ERβ interacted with seven proteins of 30–203 kDa, TAD with ten proteins of 31–160 kDa, and LBD with fourteen proteins of 42–179 kDa. For further identification, these proteins were cleaved by trypsin into peptides and analyzed by MALDI-MS using mascot search engine, immunoprecipitation, immunoblotting, and far-Western blotting. To find the consensus binding motifs in interacting proteins, their unique tryptic peptides were analyzed by the motif scan software. All the interacting proteins were found to contain casein kinase (CK) 2, phosphokinase (PK)C phosphorylation, and N-myristoylation sites. These were further confirmed by peptide pull-down assays using specific mutations in the interacting sites. Thus, the present findings provide evidence for the interaction of ERβ with specific mitochondrial and nuclear proteins through consensus CK2, PKC phosphorylation, and N-myristoylation sites, and may represent an essential step toward designing selective ER modulators for regulating estrogen-mediated signaling. PMID:22566700

  2. A Transcriptional Regulatory Network Containing Nuclear Receptors and Long Noncoding RNAs Controls Basal and Drug-Induced Expression of Cytochrome P450s in HepaRG Cells.

    PubMed

    Chen, Liming; Bao, Yifan; Piekos, Stephanie C; Zhu, Kexin; Zhang, Lirong; Zhong, Xiao-Bo

    2018-07-01

    Cytochrome P450 (P450) enzymes are responsible for metabolizing drugs. Expression of P450s can directly affect drug metabolism, resulting in various outcomes in therapeutic efficacy and adverse effects. Several nuclear receptors are transcription factors that can regulate expression of P450s at both basal and drug-induced levels. Some long noncoding RNAs (lncRNAs) near a transcription factor are found to participate in the regulatory functions of the transcription factors. The aim of this study is to determine whether there is a transcriptional regulatory network containing nuclear receptors and lncRNAs controlling both basal and drug-induced expression of P450s in HepaRG cells. Small interfering RNAs or small hairpin RNAs were applied to knock down four nuclear receptors [hepatocyte nuclear factor 1 α (HNF1 α ), hepatocyte nuclear factor 4 α (HNF4 α ), pregnane X receptor (PXR), and constitutive androstane receptor (CAR)] as well as two lncRNAs [HNF1 α antisense RNA 1 (HNF1 α -AS1) and HNF4 α antisense RNA 1 (HNF4 α -AS1)] in HepaRG cells with or without treatment of phenobarbital or rifampicin. Expression of eight P450 enzymes was examined in both basal and drug-induced levels. CAR and PXR mainly regulated expression of specific P450s. HNF1 α and HNF4 α affected expression of a wide range of P450s as well as other transcription factors. HNF1 α and HNF4 α controlled the expression of their neighborhood lncRNAs, HNF1 α -AS1 and HNF4 α -AS1, respectively. HNF1 α -AS1 and HNF4 α -AS1 was also involved in the regulation of P450s and transcription factors in diverse manners. Altogether, our study concludes that a transcription regulatory network containing the nuclear receptors and lncRNAs controls both basal and drug-induced expression of P450s in HepaRG cells. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

  3. ROR nuclear receptors: structures, related diseases, and drug discovery

    PubMed Central

    Zhang, Yan; Luo, Xiao-yu; Wu, Dong-hai; Xu, Yong

    2015-01-01

    Nuclear receptors (NRs) are ligand-regulated transcription factors that regulate metabolism, development and immunity. The NR superfamily is one of the major classes of drug targets for human diseases. Retinoic acid receptor-related orphan receptor (ROR) α, β and γ belong to the NR superfamily, and these receptors are still considered as 'orphan' receptors because the identification of their endogenous ligands has been controversial. Recent studies have demonstrated that these receptors are regulated by synthetic ligands, thus emerge as important drug targets for the treatment of multiple sclerosis, rheumatoid arthritis, psoriasis, etc. Studying the structural basis and ligand development of RORs will pave the way for a better understanding of the roles of these receptors in human diseases. Here, we review the structural basis, disease relevance, strategies for ligand identification, and current status of development of therapeutic ligands for RORs. PMID:25500868

  4. Effect of propofol on androgen receptor activity in prostate cancer cells.

    PubMed

    Tatsumi, Kenichiro; Hirotsu, Akiko; Daijo, Hiroki; Matsuyama, Tomonori; Terada, Naoki; Tanaka, Tomoharu

    2017-08-15

    Androgen receptor is a nuclear receptor and transcription factor activated by androgenic hormones. Androgen receptor activity plays a pivotal role in the development and progression of prostate cancer. Although accumulating evidence suggests that general anesthetics, including opioids, affect cancer cell growth and impact patient prognosis, the effect of those drugs on androgen receptor in prostate cancer is not clear. The purpose of this study was to investigate the effect of the general anesthetic propofol on androgen receptor activity in prostate cancer cells. An androgen-dependent human prostate cancer cell line (LNCaP) was stimulated with dihydrotestosterone (DHT) and exposed to propofol. The induction of androgen receptor target genes was investigated using real-time reverse transcription polymerase chain reaction, and androgen receptor protein levels and localization patterns were analyzed using immunoblotting and immunofluorescence assays. The effect of propofol on the proliferation of LNCaP cells was analyzed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays. Propofol significantly inhibited DHT-induced expression of androgen receptor target genes in a dose- and time-dependent manner, and immunoblotting and immunofluorescence assays indicated that propofol suppressed nuclear levels of androgen receptor proteins. Exposure to propofol for 24h suppressed the proliferation of LNCaP cells, whereas 4h of exposure did not exert significant effects. Together, our results indicate that propofol suppresses nuclear androgen receptor protein levels, and inhibits androgen receptor transcriptional activity and proliferation in LNCaP cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Nuclear translocation of IGF1R by intracellular amphiregulin contributes to the resistance of lung tumour cells to EGFR-TKI.

    PubMed

    Guerard, Marie; Robin, Thomas; Perron, Pascal; Hatat, Anne-Sophie; David-Boudet, Laurence; Vanwonterghem, Laetitia; Busser, Benoit; Coll, Jean-Luc; Lantuejoul, Sylvie; Eymin, Beatrice; Hurbin, Amandine; Gazzeri, Sylvie

    2018-04-28

    Many Receptor Tyrosine Kinases translocate from the cell surface to the nucleus in normal and pathological conditions, including cancer. Here we report the nuclear expression of insulin-like growth factor-1 receptor (IGF1R) in primary human lung tumours. Using lung cancer cell lines and lung tumour xenografts, we demonstrate that the epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) gefitinib induces the nuclear accumulation of IGF1R in mucinous lung adenocarcinoma by a mechanism involving the intracellular re-localization of the growth factor amphiregulin. Amphiregulin allows the binding of IGF1R to importin-β1 and promotes its nuclear transport. The nuclear accumulation of IGF1R by amphiregulin induces cell cycle arrest through p21 WAF1/CIP1 upregulation, and prevents the induction of apoptosis in response to gefitinib. These results identify amphiregulin as the first nuclear localization signal-containing protein that interacts with IGF1R and allows its nuclear translocation. Furthermore they indicate that nuclear expression of IGF1R contributes to EGFR-TKI resistance in lung cancer. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Over-accumulation of nuclear IGF-1 receptor in tumor cells requires elevated expression of the receptor and the SUMO-conjugating enzyme Ubc9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Deng, Hua; Lin, Yingbo; Badin, Margherita

    2011-01-14

    Research highlights: {yields} SUMOylation mediates nuclear translocation of IGF-1R which activates transcription. {yields} Here we show that nuclear IGF-1R over-accumulates in tumor cells. {yields} This requires overexpression of the receptor that is a common feature in tumor cells. {yields} An increased expression of the SUMO ligase Ubc9 seems to be an involved mechanism too. -- Abstract: The insulin-like growth factor 1 receptor (IGF-1R) plays crucial roles in tumor cell growth and is overexpressed in many cancers. IGF-1R's trans-membrane kinase signaling pathways have been well characterized. Very recently, we showed that SUMOylation mediates nuclear translocation of the IGF-1R, and that nuclearmore » IGF-1R (nIGF-1R) binds to enhancer regions and activates transcription. We identified three lysine residues in the {beta}-subunit of the receptor and that mutation of these blocks nuclear translocation and gene activation. Furthermore, accumulation of nIGF-1R was proven strongly dependent on the specific SUMO-conjugating enzyme Ubc9. Here we show that nIGF-1R originates solely from the cell membrane and that phosphorylation of the core tyrosine residues of the receptor kinase is crucial for nuclear accumulation. We also compared the levels of nIGF-1R, measured as nuclear/membrane ratios, in tumor and normal cells. We found that the breast cancer cell line MCF-7 has 13-fold higher amounts of nIGF-1R than breast epithelial cells (IME) which showed only a small amount of nIGF-1R. In comparison, the total expression of IGF-1R was only 3.7- higher in MCF-7. Comparison of several other tumor and normal cell lines showed similar tumor cell over-accumulation of nIGF-1R, exceeding the total receptor expression substantially. Ectopic overexpression (>10-fold) of the receptor increased nIGF-1R in IME cells but not to that high level as in wild type MCF-7. The levels of Ubc9 were higher in all tumor cell lines, compared to the normal cells, and this probably contributes to over-accumulation of nIGF-1R. Over-accumulation of nIGF-1R may contribute to deregulated gene expression and therewith play a pathophysiological role in cancer cells.« less

  7. ERRα: a metabolic function for the oldest orphan

    PubMed Central

    Villena, Josep A.; Kralli, Anastasia

    2009-01-01

    Estrogen receptor related receptor (ERR)α was one of the first identified (1988) orphan nuclear receptors. Many of the orphan receptors identified after ERRα were deorphanized in a timely manner and appreciated as key transcriptional regulators of metabolic pathways. ERRα, however, remains an orphan. Nevertheless, recent studies have defined regulatory mechanisms and transcriptional targets of ERRα, allowing this receptor to join ranks with other nuclear receptors that control metabolism. Notably, mice lacking ERRα show defects when challenged with stressors that require a ‘shift of gears’ in energy metabolism, such as exposure to cold, cardiac overload or infection. These findings establish the importance of ERRα for adaptive energy metabolism, and suggest that strategies targeting ERRα may be useful in fighting metabolic diseases. PMID:18778951

  8. Nuclear receptors in pancreatic tumor cells.

    PubMed

    Damaskos, Christos; Garmpis, Nikolaos; Karatzas, Theodore; Kostakis, Ioannis D; Nikolidakis, Lampros; Kostakis, Alkiviadis; Kouraklis, Gregory

    2014-12-01

    This review focuses on nuclear receptors expressed in pancreatic cancer. An extensive search of articles published up to March 2013 was conducted using the MEDLINE database. The key words used were "pancreatic cancer", "molecular receptors" and "growth factors". A total of 112 articles referred to pancreatic cancer, molecular receptors and/or growth factors were included. Receptors of growth factors, such as the epithelial growth factor receptor, insulin-like growth factor-1 receptor, vascular endothelial growth factor receptor and others, such as integrin α5β1, somatostatin receptors, the death receptor 5, claudin, notch receptors, mesothelin receptors, follicle-stimulating hormone receptors, the MUC1 receptor, the adrenomedullin receptor, the farnesoid X receptor, the transferrin receptor, sigma-2 receptors, the chemokine receptor CXCR4, the urokinase plasminogen activator receptor, the ephrine A2 receptor, the GRIA3 receptor, the RON receptor and the angiotensin II receptor AT-1 are expressed in pancreatic tumor cells. These molecules are implicated in tumor growth, apoptosis, angiogenesis, metastasis etc. After identifying the molecular receptors associated with the pancreatic cancer, many more target molecules playing important roles in tumor pathophysiology and senescence-associated signal transduction in cancer cells will be identified. This may have a significant influence on diagnosis, therapy and prognosis of pancreatic cancer. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  9. MicroRNA-22 and microRNA-140 suppress NF-{kappa}B activity by regulating the expression of NF-{kappa}B coactivators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takata, Akemi; Otsuka, Motoyuki, E-mail: otsukamo-tky@umin.ac.jp; Kojima, Kentaro

    2011-08-12

    Highlights: {yields} miRNAs were screened for their ability to regulate NF-{kappa}B activity. {yields} miRNA-22 and miRNA-140-3p suppress NF-{kappa}B activity by regulating coactivators. {yields} miRNA-22 targets nuclear receptor coactivator 1 (NCOA1). {yields} miRNA-140-3p targets nuclear receptor-interacting protein 1 (NRIP1). -- Abstract: Nuclear factor {kappa}B (NF-{kappa}B) is a transcription factor that regulates a set of genes that are critical to many biological phenomena, including liver tumorigenesis. To identify microRNAs (miRNAs) that regulate NF-{kappa}B activity in the liver, we screened 60 miRNAs expressed in hepatocytes for their ability to modulate NF-{kappa}B activity. We found that miRNA-22 and miRNA-140-3p significantly suppressed NF-{kappa}B activity bymore » regulating the expression of nuclear receptor coactivator 1 (NCOA1) and nuclear receptor-interacting protein 1 (NRIP1), both of which are NF-{kappa}B coactivators. Our results provide new information about the roles of miRNAs in the regulation of NF-{kappa}B activity.« less

  10. Aberrant localization of lamin B receptor (LBR) in cellular senescence in human cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arai, Rumi; En, Atsuki; Ukekawa, Ryo

    2016-05-13

    5-Bromodeoxyuridine (BrdU), a thymidine analogue, induces cellular senescence in mammalian cells. BrdU induces cellular senescence probably through the regulation of chromatin because BrdU destabilizes or disrupts nucleosome positioning and decondenses heterochromatin. Since heterochromatin is tethered to the nuclear periphery through the interaction with the nuclear envelope proteins, we examined the localization of the several nuclear envelope proteins such as lamins, lamin-interacting proteins, nuclear pore complex proteins, and nuclear transport proteins in senescent cells. We have shown here that lamin B receptor (LBR) showed a change in localization in both BrdU-induced and replicative senescent cells.

  11. Bisphenol A affects androgen receptor function via multiple mechanisms.

    PubMed

    Teng, Christina; Goodwin, Bonnie; Shockley, Keith; Xia, Menghang; Huang, Ruili; Norris, John; Merrick, B Alex; Jetten, Anton M; Austin, Christopher P; Tice, Raymond R

    2013-05-25

    Bisphenol A (BPA), is a well-known endocrine disruptor compound (EDC) that affects the normal development and function of the female and male reproductive system, however the mechanisms of action remain unclear. To investigate the molecular mechanisms of how BPA may affect ten different nuclear receptors, stable cell lines containing individual nuclear receptor ligand binding domain (LBD)-linked to the β-Gal reporter were examined by a quantitative high throughput screening (qHTS) format in the Tox21 Screening Program of the NIH. The results showed that two receptors, estrogen receptor alpha (ERα) and androgen receptor (AR), are affected by BPA in opposite direction. To confirm the observed effects of BPA on ERα and AR, we performed transient transfection experiments with full-length receptors and their corresponding response elements linked to luciferase reporters. We also included in this study two BPA analogs, bisphenol AF (BPAF) and bisphenol S (BPS). As seen in African green monkey kidney CV1 cells, the present study confirmed that BPA and BPAF act as ERα agonists (half maximal effective concentration EC50 of 10-100 nM) and as AR antagonists (half maximal inhibitory concentration IC50 of 1-2 μM). Both BPA and BPAF antagonized AR function via competitive inhibition of the action of synthetic androgen R1881. BPS with lower estrogenic activity (EC50 of 2.2 μM), did not compete with R1881 for AR binding, when tested at 30 μM. Finally, the effects of BPA were also evaluated in a nuclear translocation assays using EGPF-tagged receptors. Similar to 17β-estradiol (E2) which was used as control, BPA was able to enhance ERα nuclear foci formation but at a 100-fold higher concentration. Although BPA was able to bind AR, the nuclear translocation was reduced. Furthermore, BPA was unable to induce functional foci in the nuclei and is consistent with the transient transfection study that BPA is unable to activate AR. Published by Elsevier Ireland Ltd.

  12. Application of an in silico liver model to determine nuclear receptor mediated pathways in liver cancer

    EPA Science Inventory

    Nuclear receptors (NRs) are ligand-activated transcription factors that control diverse cellular processes. Chronic stimulation of some NRs in rodents can result in increased incidence of liver tumors. These are generally thought to develop through a non-genotoxic mechanism with...

  13. Huntingtin interacting protein 1 modulates the transcriptional activity of nuclear hormone receptors.

    PubMed

    Mills, Ian G; Gaughan, Luke; Robson, Craig; Ross, Theodora; McCracken, Stuart; Kelly, John; Neal, David E

    2005-07-18

    Internalization of activated receptors regulates signaling, and endocytic adaptor proteins are well-characterized in clathrin-mediated uptake. One of these adaptor proteins, huntingtin interacting protein 1 (HIP1), induces cellular transformation and is overexpressed in some prostate cancers. We have discovered that HIP1 associates with the androgen receptor through a central coiled coil domain and is recruited to DNA response elements upon androgen stimulation. HIP1 is a novel androgen receptor regulator, significantly repressing transcription when knocked down using a silencing RNA approach and activating transcription when overexpressed. We have also identified a functional nuclear localization signal at the COOH terminus of HIP1, which contributes to the nuclear translocation of the protein. In conclusion, we have discovered that HIP1 is a nucleocytoplasmic protein capable of associating with membranes and DNA response elements and regulating transcription.

  14. The roles of bile acids and sphingosine-1-phosphate signaling in the hepatobiliary diseases

    PubMed Central

    Nagahashi, Masayuki; Yuza, Kizuki; Hirose, Yuki; Nakajima, Masato; Ramanathan, Rajesh; Hait, Nitai C.; Hylemon, Phillip B.; Zhou, Huiping; Takabe, Kazuaki; Wakai, Toshifumi

    2016-01-01

    Based on research carried out over the last decade, it has become increasingly evident that bile acids act not only as detergents, but also as important signaling molecules that exert various biological effects via activation of specific nuclear receptors and cell signaling pathways. Bile acids also regulate the expression of numerous genes encoding enzymes and proteins involved in the synthesis and metabolism of bile acids, glucose, fatty acids, and lipoproteins, as well as energy metabolism. Receptors activated by bile acids include, farnesoid X receptor α, pregnane X receptor, vitamin D receptor, and G protein-coupled receptors, TGR5, muscarinic receptor 2, and sphingosine-1-phosphate receptor (S1PR)2. The ligand of S1PR2, sphingosine-1-phosphate (S1P), is a bioactive lipid mediator that regulates various physiological and pathophysiological cellular processes. We have recently reported that conjugated bile acids, via S1PR2, activate and upregulate nuclear sphingosine kinase 2, increase nuclear S1P, and induce genes encoding enzymes and transporters involved in lipid and sterol metabolism in the liver. Here, we discuss the role of bile acids and S1P signaling in the regulation of hepatic lipid metabolism and in hepatobiliary diseases. PMID:27459945

  15. Information needs for siting new, and evaluating current, nuclear facilities: ecology, fate and transport, and human health.

    PubMed

    Burger, Joanna; Clarke, James; Gochfeld, Michael

    2011-01-01

    The USA is entering an era of energy diversity, and increasing nuclear capacity and concerns focus on accidents, security, waste, and pollution. Physical buffers that separate outsiders from nuclear facilities often support important natural ecosystems but may contain contaminants. The US Nuclear Regulatory Commission (NRC) licenses nuclear reactors; the applicant provides environmental assessments that serve as the basis for Environmental Impact Statements developed by NRC. We provide a template for the types of information needed for safe siting of nuclear facilities with buffers in three categories: ecological, fate and transport, and human health information that can be used for risk evaluations. Each item on the lists is an indicator for evaluation, and individual indicators can be selected for specific region. Ecological information needs include biodiversity (species, populations, communities) and structure and functioning of ecosystems, habitats, and landscapes, in addition to common, abundant, and unique species and endangered and rare ones. The key variables of fate and transport are sources of release for radionuclides and other chemicals, nature of releases (atmospheric vapors, subsurface liquids), features, and properties of environmental media (wind speed, direction and atmospheric stability, hydraulic gradient, hydraulic conductivity, groundwater chemistry). Human health aspects include receptor populations (demography, density, dispersion, and distance), potential pathways (drinking water sources, gardening, fishing), and exposure opportunities (lifestyle activities). For each of the three types of information needs, we expect that only a few of the indicators will be applicable to a particular site and that stakeholders should agree on a site-specific suite.

  16. Selective ligand activity at Nur/retinoid X receptor complexes revealed by dimer-specific bioluminescence resonance energy transfer-based sensors

    PubMed Central

    Giner, Xavier C; Cotnoir-White, David; Mader, Sylvie; Lévesque, Daniel

    2017-01-01

    Retinoid X receptors (RXR) play a role as master regulators due to their capacity to form heterodimers with other nuclear receptors. Accordingly, retinoid signaling is involved in multiple biological processes, including development, cell differentiation, metabolism and cell death. However, the role and functions of RXR in different heterodimer complexes remain unsolved, mainly because most RXR drugs (called rexinoids) are not selective to specific heterodimer complexes. This also strongly limits the use of rexinoids for specific therapeutic approaches. In order to better characterize rexinoids at specific nuclear receptor complexes, we have developed and optimized luciferase protein complementation-based Bioluminescence Resonance Energy Transfer (BRET) assays, which can directly measure recruitment of a co-activator motif fused to yellow fluorescent protein (YFP) by specific nuclear receptor dimers. To validate the assays, we compared rexinoid modulation of co-activator recruitment by RXR homodimer, and heterodimers Nur77/RXR and Nurr1/RXR. Results reveal that some rexinoids display selective co-activator recruitment activities with homo- or hetero-dimer complexes. In particular, SR11237 (BMS649) has increased potency for recruitment of co-activator motif and transcriptional activity with the Nur77/RXR heterodimer compared to other complexes. This technology should prove useful to identify new compounds with specificity for individual dimeric species formed by nuclear receptors. PMID:26148973

  17. Epidermal growth factor receptors destined for the nucleus are internalized via a clathrin-dependent pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Angelis Campos, Ana Carolina; Rodrigues, Michele Angela; Andrade, Carolina de

    2011-08-26

    Highlights: {yields} EGF and its receptor translocates to the nucleus in liver cells. {yields} Real time imaging shows that EGF moves to the nucleus. {yields} EGF moves with its receptor to the nucleus. {yields} Dynamin and clathrin are necessary for EGFR nuclear translocation. -- Abstract: The epidermal growth factor (EGF) transduces its actions via the EGF receptor (EGFR), which can traffic from the plasma membrane to either the cytoplasm or the nucleus. However, the mechanism by which EGFR reaches the nucleus is unclear. To investigate these questions, liver cells were analyzed by immunoblot of cell fractions, confocal immunofluorescence and realmore » time confocal imaging. Cell fractionation studies showed that EGFR was detectable in the nucleus after EGF stimulation with a peak in nuclear receptor after 10 min. Movement of EGFR to the nucleus was confirmed by confocal immunofluorescence and labeled EGF moved with the receptor to the nucleus. Small interference RNA (siRNA) was used to knockdown clathrin in order to assess the first endocytic steps of EGFR nuclear translocation in liver cells. A mutant dynamin (dynamin K44A) was also used to determine the pathways for this traffic. Movement of labeled EGF or EGFR to the nucleus depended upon dynamin and clathrin. This identifies the pathway that mediates the first steps for EGFR nuclear translocation in liver cells.« less

  18. Intracrine action of angiotensin II in mesangial cells: subcellular distribution of angiotensin II receptor subtypes AT1 and AT2.

    PubMed

    da Silva Novaes, Antônio; Ribeiro, Rosemara Silva; Pereira, Luciana Guilhermino; Borges, Fernanda Teixeira; Boim, Mirian Aparecida

    2018-02-17

    Biological effects of angiotensin II (AngII) such as regulation of AngII target genes may be triggered by interaction of AngII with intracellular AngII receptor types 1 and 2 (AT 1 and AT 2 ), defined as intracrine response. The aim of this study was to examine the presence of AT 1 and AT 2 receptors in nuclear membrane of human mesangial cells (HMCs) and evaluate the possible biological effects mediated by intracellular AT 1 through an intracrine mechanism. Subcellular distribution of AT 1 and AT 2 was evaluated by immunofluorescence and by western blot in isolated nuclear extract. Endogenous intracellular synthesis of AngII was stimulated by high glucose (HG). Effects of HG were analyzed in the presence of candesartan, which prevents AngII internalization. Both receptors were found in nuclear membrane. Fluorescein isothiocyanate (FITC)-labeled AngII added to isolated nuclei produced a fluorescence that was reduced in the presence of losartan or PD-123319 and quenched in the presence of both inhibitors simultaneously. HG induced overexpression of fibronectin and increased cell proliferation in the presence of candesartan, indicating an intracrine action of AngII induced by HG. Results showed the presence of nuclear receptors in HMCs that can be activated by AngII through an intracrine response independent of cytoplasmic membrane AngII receptors.

  19. Dose-dependent difference of nuclear receptors involved in murine liver hypertrophy by piperonyl butoxide.

    PubMed

    Sakamoto, Yohei; Yoshida, Midori; Tamura, Kei; Takahashi, Miwa; Kodama, Yukio; Inoue, Kaoru

    2015-12-01

    Nuclear receptors play important roles in chemically induced liver hypertrophy in rodents. To clarify the involvement of constitutive androstane receptor (CAR) and other nuclear receptors in mouse liver hypertrophy induced by different doses of piperonyl butoxide (PBO), wild-type and CAR-knockout mice were administered PBO (200, 1,000, or 5,000 ppm) in the basal diet for 1 week. Increased liver weight and diffuse hepatocellular hypertrophy were observed at 5,000 ppm for both genotypes, accompanied by increased Cyp3a11 mRNA and CYP3A protein expression, suggesting that CAR-independent pathway, possibly pregnane X receptor (PXR), plays a major role in the induction of hypertrophy. Moreover, wild-type mice at 5,000 ppm showed enhanced hepatocellular hypertrophy and strong positive staining for CYP2B in the centrilobular area, suggesting the localized contribution of CAR. At 1,000 ppm, only wild-type mice showed liver weight increase and centrilobular hepatocellular hypertrophy concurrent with elevated Cyp2b10 mRNA expression and strong CYP2B staining, indicating that CAR was essential at 1,000 ppm. We concluded that high-dose PBO induced hypertrophy via CAR and another pathway, while lower dose of PBO induced a pathway mediated predominantly by CAR. The dose-responsiveness on liver hypertrophy is important for understanding the involvement of nuclear receptors.

  20. Nuclear receptor coactivators: regulators of steroid action in brain and behaviour.

    PubMed

    Tetel, M J; Acharya, K D

    2013-11-01

    Steroid hormones act in specific regions of the brain to alter behaviour and physiology. Although it has been well established that the bioavailability of the steroid and the expression of its receptor is critical for understanding steroid action in the brain, the importance of nuclear receptor coactivators in the brain is becoming more apparent. The present review focuses on the function of the p160 family of coactivators, which includes steroid receptor coactivator-1 (SRC-1), SRC-2 and SRC-3, in steroid receptor action in the brain. The expression, regulation and function of these coactivators in steroid-dependent gene expression in both brain and behaviour are discussed. © 2013 British Society for Neuroendocrinology.

  1. Cytosol-nucleus traffic and colocalization with FXR of conjugated bile acids in rat hepatocytes.

    PubMed

    Monte, Maria J; Rosales, Ruben; Macias, Rocio I R; Iannota, Valeria; Martinez-Fernandez, Almudena; Romero, Marta R; Hofmann, Alan F; Marin, Jose J G

    2008-07-01

    Bile acids (BAs) are natural ligands of nuclear receptors, in particular farnesoid X receptor (FXR). Whether, in addition to protein-mediated cytosolic-nuclear BA translocation, other mechanisms are involved in the access of BAs to nuclear FXR was investigated. When rat hepatocytes were incubated with radiolabeled taurocholic acid, taurodeoxycholic acid, taurochenodeoxycholic acid, and tauroursodeoxycholic acid, their nuclear accumulation was proportional to their intracellular levels. With the use of flow cytometry analysis, the accumulation by nuclei isolated from rat liver cells was found to differ for several fluorescent compounds of similar molecular weight and different charge, including fluorescein-tagged BAs [cholylglycyl amidofluorescein (CGamF), ursodeoxycholylglycyl amidofluorescein, or chenodeoxycholylglycyl amidofluorescein]. When we varied nuclear volume by incubation with different sucrose concentrations, a similar relationship between nuclear volume and content of FITC and 4-kDa FITC-dextran was found. In contrast, this relationship was markedly lower for CGamF. Confocal microscopy studies revealed that fluorescein-tagged BAs, but also FITC or 10-kDa FITC-dextran were found in the nuclear envelope and concentrated in regions where DNA was less densely packed. In contrast to the cytosolic subcellular localization of peroxisome proliferator-activated receptor-alpha, FXR and nucleolin (a marker of transcriptional active chromatin) were also localized by immunoreactivity in these intranuclear regions. In conclusion, although intranuclear levels of small organic molecules including conjugated BAs depend on their concentrations in the extranuclear space, the existence of certain molecular selectivity (not strictly dependent on molecular weight or charge) suggests that, in addition to simple diffusional exchange, other mechanisms may be also involved in determining their overall nuclear content in regions where these compounds coincide and may interact with nuclear receptors such as FXR.

  2. Utp22p acts in concert with Utp8p to channel aminoacyl-tRNA from the nucleolus to the nuclear tRNA export receptor Los1p but not Msn5p.

    PubMed

    Eswara, Manoja B K; Clayton, Ashley; Mangroo, Dev

    2012-12-01

    Utp8p is an essential nucleolar protein that channels aminoacyl-tRNAs from aminoacyl-tRNA synthetases in the nucleolus to the nuclear tRNA export receptors located in the nucleoplasm and nuclear pore complex in Saccharomyces cerevisiae. Utp8p is also part of the U3 snoRNA-associated protein complex involved in 18S rRNA biogenesis in the nucleolus. We report that Utp22p, which is another member of the U3 snoRNA-associated protein complex, is also an intranuclear component of the nuclear tRNA export machinery. Depletion of Utp22p results in nuclear retention of mature tRNAs derived from intron-containing and intronless precursors. Moreover, Utp22p copurifies with the nuclear tRNA export receptor Los1p, the aminoacyl-tRNA synthetase Tys1p and Utp8p, but not with the RanGTPase Gsp1p and the nuclear tRNA export receptor Msn5p. Utp22p interacts directly with Utp8p and Los1p in a tRNA-independent manner in vitro. Utp22p also interacts directly with Tys1p, but this binding is stimulated when Tys1p is bound to tRNA. However, Utp22p, unlike Utp8p, does not bind tRNA saturably. These data suggest that Utp22p recruits Utp8p to aminoacyl-tRNA synthetases in the nucleolus to collect aminoacyl-tRNA and then accompanies the Utp8p-tRNA complex to deliver the aminoacyl-tRNAs to Los1p but not Msn5p. It is possible that Nrap/Nol6, the mammalian orthologue of Utp22p, plays a role in channelling aminoacyl-tRNA to the nuclear tRNA export receptor exportin-t.

  3. Chemiluminometric Immuno-Analysis of Innate Immune Response against Repetitive Bacterial Stimulations for the Same Mammalian Cells

    PubMed Central

    Jeon, Jin-Woo; Cho, Il-Hoon; Ha, Un-Hwan; Seo, Sung-Kyu; Paek, Se-Hwan

    2014-01-01

    For monitoring of human cellular response to repetitive bacterial stimulations (e.g., Pseudomonas aeruginosa in a lysate form), we devised a chemiluminescent immuno-analytical system for toll-like receptor 1 (TLR1) as marker present on cell surfaces (e.g., A549). Upon stimulation, TLR1 recognizes pathogen-associated molecular patterns of the infectious agent and are then up-regulated via activation of the nuclear factor-κB (NF-κB) pathway. In this study, the receptor density was quantified by employing an antibody specific to the target receptor and by producing a chemiluminometric signal from an enzyme labeled to the binder. The activated status was then switched back to normal down-regulated stage, by changing the culture medium to one containing animal serum. The major factors affecting activation were the stimulation dose of the bacterial lysate, stimulation timing during starvation, and up- and down-regulation time intervals. Reiterative TLR regulation switching up to three times was not affected by either antibody remained after immunoassay or enzyme substrate (e.g., hydrogen peroxide) in solution. This immuno-analysis for TLRs could be unique to acquire accumulated response of the human cells to repeated stimulations and, therefore, can eventually apply to persistency testing of the cellular regulation in screening of anti-inflammatory substances. PMID:25109895

  4. Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chi, Seung-Wook; Lee, Si-Hyung; Kim, Do-Hyoung

    2005-12-30

    {alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, amore » kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.« less

  5. HIV-1 Nef protein in the nucleus influences adipogenesis as well as viral transcription through the peroxisome proliferator-activated receptors.

    PubMed

    Otake, Kaori; Omoto, Shinya; Yamamoto, Takuya; Okuyama, Harumi; Okada, Hidechika; Okada, Noriko; Kawai, Masahiro; Saksena, Nitin K; Fujii, Yoichi R

    2004-01-23

    Although the HIV-1 Nef protein (27 kDa) localizes primarily in cytoplasm, there is considerable evidence suggesting its occasional localization in the nucleus. Nef is known to play an important role in transcriptional events and viral replication, but the actual target of Nef in the nucleus remains to be identified. To examine the functional roles of Nef in the nucleus and its possible interactions with other unknown factors in the nucleus. High-density microarray analysis was used to screen directly the unique functions of Nef on host gene transcription. The nuclear localization of Nef and its effects on the expression of peroxisome proliferator-activated receptors (PPAR) was examined using PPAR promoter/reporter assay and immunoblotting. A long terminal repeat/reporter assay was used to investigated the effects of Nef and PPAR on viral transcription. Nef in the nucleus suppressed PPAR gamma expression and reduced fatty acid levels in human T and macrophage cell lines. Expression of Nef or PPAR suppressed viral replication; the effect of PPAR gamma or retinoid X receptor-alpha on viral replication were reduced by coexpression of Nef in MT(-)4 T cells. Nef may be involved in both viral replication and the wasting syndrome associated with AIDS.

  6. PGC-1α dictates endothelial function through regulation of eNOS expression

    PubMed Central

    Craige, Siobhan M.; Kröller-Schön, Swenja; Li, Chunying; Kant, Shashi; Cai, Shenghe; Chen, Kai; Contractor, Mayur M.; Pei, Yongmei; Schulz, Eberhard; Keaney, John F.

    2016-01-01

    Endothelial dysfunction is a characteristic of many vascular related diseases such as hypertension. Peroxisome proliferator activated receptor gamma, coactivator 1α (PGC-1α) is a unique stress sensor that largely acts to promote adaptive responses. Therefore, we sought to define the role of endothelial PGC-1α in vascular function using mice with endothelial specific loss of function (PGC-1α EC KO) and endothelial specific gain of function (PGC-1α EC TG). Here we report that endothelial PGC-1α is suppressed in angiotensin-II (ATII)-induced hypertension. Deletion of endothelial PGC-1α sensitized mice to endothelial dysfunction and hypertension in response to ATII, whereas PGC-1α EC TG mice were protected. Mechanistically, PGC-1α promotes eNOS expression and activity, which is necessary for protection from ATII-induced dysfunction as mice either treated with an eNOS inhibitor (LNAME) or lacking eNOS were no longer responsive to transgenic endothelial PGC-1α expression. Finally, we determined that the orphan nuclear receptor, estrogen related receptor α (ERRα) is required to coordinate the PGC-1α -induced eNOS expression. In conclusion, endothelial PGC-1α expression protects from vascular dysfunction by promoting NO• bioactivity through ERRα induced expression of eNOS. PMID:27910955

  7. Membrane estrogen receptors - is it an alternative way of estrogen action?

    PubMed

    Soltysik, K; Czekaj, P

    2013-04-01

    The functions of estrogens are relatively well known, however the molecular mechanism of their action is not clear. The classical pathway of estrogen action is dependent on ERα and ERβ which act as transcription factors. The effects of this pathway occur within hours or days. In addition, so-called, non-classical mechanism of steroid action dependent on membrane estrogen receptors (mER) was described. In this mechanism the effects of estrogen action are observed in a much shorter time. Here we review the structure and cellular localization of mER, molecular basis of non-classical mER action, physiological role of mER as well as implications of mER action for cancer biology. Finally, some concerns about the new estrogen receptor - GPER and candidates for estrogen receptors - ER-X and ERx, are briefly discussed. It seems that mER is a complex containing signal proteins (signalosome), as IGF receptor, EGF receptor, Ras protein, adaptor protein Shc, non-receptor kinase c-Src and PI-3K, what rationalizes production of second messengers. Some features of membrane receptors are almost identical if compared to nuclear receptors. Probably, membrane and nuclear estrogen receptors are not separate units, but rather the components of a complex mechanism in which they both cooperate with each other. We conclude that the image of the estrogen receptor as a simple transcription factor is a far-reaching simplification. A better understanding of the mechanisms of estrogen action will help us to design more effective drugs affecting signal pathways depending on both membrane and nuclear receptors.

  8. Purification and characterization of rat liver nuclear thyroid hormone receptors.

    PubMed Central

    Ichikawa, K; DeGroot, L J

    1987-01-01

    Nuclear thyroid hormone receptor was purified to 904 pmol of L-3,5,3'-triiodothyronine (T3) binding capacity per mg of protein with 2.5-5.2% recovery by sequentially using hydroxylapatite column chromatography, ammonium sulfate precipitation, Sephadex G-150 gel filtration, DNA-cellulose column chromatography, DEAE-Sephadex column chromatography, and heparin-Sepharose column chromatography. Assuming that one T3 molecule binds to the 49,000-Da unit of the receptor, we reproducibly obtained 6.4-14.7 micrograms of receptor protein with 4.2-4.9% purity from 4-5 kg of rat liver. Elution of receptor from the heparin-Sepharose column was performed using 10 mM pyridoxal 5'-phosphate, which was observed to diminish binding of receptor to heparin-Sepharose or DNA-cellulose. This effect was specific for pyridoxal 5'-phosphate, since related compounds were not effective. Purified receptor bound T3 with high affinity (6.0 X 10(9) liter/mol), and the order of affinity of iodothyronine analogues to purified receptor was identical to that observed with crude receptor preparations [3,5,3'-triiodothyroacetic acid greater than L-T3 greater than D-3,5,3'-triiodothyronine (D-T3) greater than L-thyroxine greater than D-thyroxine]. Purified receptor had a sedimentation coefficient of 3.4 S, Stokes radius of 34 A, and calculated molecular mass of 49,000. Among several bands identified by silver staining after electrophoresis in NaDodSO4/polyacrylamide gels, one 49,000-Da protein showed photoaffinity labeling with [125I]thyroxine that was displaceable with excess unlabeled T3. The tryptic fragment and endogenous proteinase-digested fragment of the affinity-labeled receptor showed saturable binding in 27,000-Da and 36,000-Da peptides, respectively. These molecular masses are in agreement with estimates from gel filtration and gradient sedimentation, indicating that affinity labeling occurred at the hormone binding domain of nuclear thyroid hormone receptor. This procedure reproducibly provides classical native rat liver T3 nuclear receptor in useful quantity and purity and of the highest specific activity so far reported. Images PMID:3472213

  9. Extrinsic Tryptophans as NMR Probes of Allosteric Coupling in Membrane Proteins: Application to the A2A Adenosine Receptor.

    PubMed

    Eddy, Matthew T; Gao, Zhan-Guo; Mannes, Philip; Patel, Nilkanth; Jacobson, Kenneth A; Katritch, Vsevolod; Stevens, Raymond C; Wüthrich, Kurt

    2018-06-20

    Tryptophan indole 15 N- 1 H signals are well separated in nuclear magnetic resonance (NMR) spectra of proteins. Assignment of the indole 15 N- 1 H signals therefore enables one to obtain site-specific information on complex proteins in supramacromolecular systems, even when extensive assignment of backbone 15 N- 1 H resonances is challenging. Here we exploit the unique indole 15 N- 1 H chemical shift by introducing extrinsic tryptophan reporter residues at judiciously chosen locations in a membrane protein for increased coverage of structure and function by NMR. We demonstrate this approach with three variants of the human A 2A adenosine receptor (A 2A AR), a class A G protein-coupled receptor, each containing a single extrinsic tryptophan near the receptor intracellular surface, in helix V, VI, or VII, respectively. We show that the native A 2A AR global protein fold and ligand binding activity are preserved in these A 2A AR variants. The indole 15 N- 1 H signals from the extrinsic tryptophan reporter residues show different responses to variable efficacy of drugs bound to the receptor orthosteric cavity, and the indole 15 N- 1 H chemical shift of the tryptophan introduced at the intracellular end of helix VI is sensitive to conformational changes resulting from interactions with a polypeptide from the carboxy terminus of the Gα S intracellular partner protein. Introducing extrinsic tryptophans into proteins in complex supramolecular systems thus opens new avenues for NMR investigations in solution.

  10. Genomic characterization and regulation of CYP3a13: role of xenobiotics and nuclear receptors.

    PubMed

    Anakk, Sayeepriyadarshini; Kalsotra, Auinash; Shen, Qi; Vu, Mary T; Staudinger, Jeffrey L; Davies, Peter J A; Strobel, Henry W

    2003-09-01

    We report that CYP3a13 gene, located on mouse chromosome 5, spans 27.5 Kb and contains 13 exons. The transcription start site is 35 bp upstream of the coding region and results in a 109 bp 5' untranslated region. CYP3a13 promoter shows putative binding sites for retinoid X receptor, pregnane X receptor, and estrogen receptor. CYP3a13 shows a broad tissue distribution with predominant expression in liver. Although CYP3a13 shares 92% nucleotide identity with the female-specific rat CYP3A9, its expression does not exhibit sexual dimorphism. Ligand activation of peroxisomal proliferator-activated receptor-gamma and retinoid X receptor inhibit expression of CYP3a13 at the transcription level in a tissue-specific manner. Another novel finding is hepatic induction of CYP3a13 by dexamethasone occurring only in pregnane X receptor null mice. We also report that pregnane X receptor is essential to maintain robust in vivo basal levels of CYP3a13 in contrast to CYP3a11. CYP3a13 protein expressed in vitro can metabolize clinically active drugs ethylmorphine and erythromycin, as well as benzphetamine. We conclude that CYP3a13 is regulated differentially by various nuclear receptors. In humans this may lead to altered drug metabolism, as many of the newly synthesized ligands/drugs targeted toward these nuclear receptors could influence CYP3A gene expression.

  11. Nuclear localisation of calreticulin in vivo is enhanced by its interaction with glucocorticoid receptors.

    PubMed

    Roderick, H L; Campbell, A K; Llewellyn, D H

    1997-03-24

    The multi-functional protein calreticulin (CRT) is normally found within the lumen of the endoplasmic reticulum (ER). However, some of its proposed functions require it to be located within the nucleus, where its presence is contentious. We have investigated this in live COS7, HeLa and LM(TK-) cells using green fluorescent protein (GFP)-fusion proteins. GFP-CRT, and GFP, with an ER signal peptide and a KDEL sequence (ER-GFP), were localised to the ER. In addition, GFP-CRT was located in the nucleus of all the cell types at low levels. The higher levels of nuclear fluorescence in LM(TK-) and HeLa cells suggested that glucocorticoid receptors might enhance nuclear localisation of calreticulin. Dexamethasone treatment of LM(TK-) cells doubled the amount of nuclear GFP-CRT, but did not affect the localisation of a GFP-CRT fusion in which the glucocorticoid receptor-binding N-domain of calreticulin had been deleted. Thus, despite ER targeting and retention signals, calreticulin is also located within the nucleus where its presence increases due to its interaction with glucocorticoid receptors.

  12. Functionalized UO[sub 2] salenes. Neutral receptors for anions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rudkevich, D.M.; Verboom, W.; Brzozka, Z.

    1994-05-18

    A novel class of neutral receptors for anions that contain a unique combination of an immobilized Lewis acidic binding site (UO[sub 2][sup 2+]) and additional amide C(O)NH groups, which can form a favorable H-bond with a coordinated anion guest, has been developed. The unique combination of a Lewis acidic UO[sub 2] center and amide C(O)NH groups in one receptor leads to highly specific H[sub 2]PO[sub 4[sup [minus

  13. Targeting protein-trafficking pathways alters melanoma treatment sensitivity

    PubMed Central

    Huang, Zhi-ming; Chinen, Milka; Chang, Philip J.; Xie, Tong; Zhong, Lily; Demetriou, Stephanie; Patel, Mira P.; Scherzer, Rebecca; Sviderskaya, Elena V.; Bennett, Dorothy C.; Millhauser, Glenn L.; Oh, Dennis H.; Cleaver, James E.; Wei, Maria L.

    2012-01-01

    Protein-trafficking pathways are targeted here in human melanoma cells using methods independent of oncogene mutational status, and the ability to up-regulate and down-regulate tumor treatment sensitivity is demonstrated. Sensitivity of melanoma cells to cis-diaminedichloroplatinum II (cDDP, cis-platin), carboplatin, dacarbazine, or temozolomide together with velaparib, an inhibitor of poly (ADP ribose) polymerase 1, is increased by up to 10-fold by targeting genes that regulate both protein trafficking and the formation of melanosomes, intracellular organelles unique to melanocytes and melanoma cells. Melanoma cells depleted of either of the protein-trafficking regulators vacuolar protein sorting 33A protein (VPS33A) or cappuccino protein (CNO) have increased nuclear localization of cDDP, increased nuclear DNA damage by platination, and increased apoptosis, resulting in increased treatment sensitivity. Depleted cells also exhibit a decreased proportion of intracellular, mature melanosomes compared with undepleted cells. Modulation of protein trafficking via cell-surface signaling by binding the melanocortin 1 receptor with the antagonist agouti-signaling protein decreased the proportion of mature melanosomes formed and increased cDDP sensitivity, whereas receptor binding with the agonist melanocyte-stimulating hormone resulted in an increased proportion of mature melanosomes formed and in decreased sensitivity (i.e., increased resistance) to cDDP. Mutation of the protein-trafficking gene Hps6, known to impair the formation of mature melanosomes, also increased cDDP sensitivity. Together, these results indicate that targeting protein-trafficking molecules markedly increases melanoma treatment sensitivity and influences the degree of melanosomes available for sequestration of therapeutic agents. PMID:22203954

  14. NR2E3 mutations in enhanced S-cone sensitivity syndrome (ESCS), Goldmann-Favre syndrome (GFS), clumped pigmentary retinal degeneration (CPRD), and retinitis pigmentosa (RP).

    PubMed

    Schorderet, Daniel F; Escher, Pascal

    2009-11-01

    NR2E3, also called photoreceptor-specific nuclear receptor (PNR), is a transcription factor of the nuclear hormone receptor superfamily whose expression is uniquely restricted to photoreceptors. There, its physiological activity is essential for proper rod and cone photoreceptor development and maintenance. Thirty-two different mutations in NR2E3 have been identified in either homozygous or compound heterozygous state in the recessively inherited enhanced S-cone sensitivity syndrome (ESCS), Goldmann-Favre syndrome (GFS), and clumped pigmentary retinal degeneration (CPRD). The clinical phenotype common to all these patients is night blindness, rudimental or absent rod function, and hyperfunction of the "blue" S-cones. A single p.G56R mutation is inherited in a dominant manner and causes retinitis pigmentosa (RP). We have established a new locus-specific database for NR2E3 (www.LOVD.nl/eye), containing all reported mutations, polymorphisms, and unclassified sequence variants, including novel ones. A high proportion of mutations are located in the evolutionarily-conserved DNA-binding domains (DBDs) and ligand-binding domains (LBDs) of NR2E3. Based on homology modeling of these NR2E3 domains, we propose a structural localization of mutated residues. The high variability of clinical phenotypes observed in patients affected by NR2E3-linked retinal degenerations may be caused by different disease mechanisms, including absence of DNA-binding, altered interactions with transcriptional coregulators, and differential activity of modifier genes.

  15. Huntingtin interacting protein 1 modulates the transcriptional activity of nuclear hormone receptors

    PubMed Central

    Mills, Ian G.; Gaughan, Luke; Robson, Craig; Ross, Theodora; McCracken, Stuart; Kelly, John; Neal, David E.

    2005-01-01

    Internalization of activated receptors regulates signaling, and endocytic adaptor proteins are well-characterized in clathrin-mediated uptake. One of these adaptor proteins, huntingtin interacting protein 1 (HIP1), induces cellular transformation and is overexpressed in some prostate cancers. We have discovered that HIP1 associates with the androgen receptor through a central coiled coil domain and is recruited to DNA response elements upon androgen stimulation. HIP1 is a novel androgen receptor regulator, significantly repressing transcription when knocked down using a silencing RNA approach and activating transcription when overexpressed. We have also identified a functional nuclear localization signal at the COOH terminus of HIP1, which contributes to the nuclear translocation of the protein. In conclusion, we have discovered that HIP1 is a nucleocytoplasmic protein capable of associating with membranes and DNA response elements and regulating transcription. PMID:16027218

  16. Improving Mode of Action Analysis Using Transcript Profiling in Nullizygous Mouse Models

    EPA Science Inventory

    A number of nuclear receptors (NR) mediate transcriptional, hepatocyte growth and carcinogenic effects in the rodent liver after chemical exposure. These receptors include the constitutive activated/androstane receptor (CAR), pregnane X receptor (PXR), and peroxisome proliferator...

  17. Signatures of Extended Storage of Used Nuclear Fuel in Casks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rauch, Eric Benton

    2016-09-28

    As the amount of used nuclear fuel continues to grow, more and more used nuclear fuel will be transferred to storage casks. A consolidated storage facility is currently in the planning stages for storing these casks, where at least 10,000 MTHM of fuel will be stored. This site will have potentially thousands of casks once it is operational. A facility this large presents new safeguards and nuclear material accounting concerns. A new signature based on the distribution of neutron sources and multiplication within casks was part of the Department of Energy Office of Nuclear Energy’s Material Protection, Account and Controlmore » Technologies (MPACT) campaign. Under this project we looked at fingerprinting each cask's neutron signature. Each cask has a unique set of fuel, with a unique spread of initial enrichment, burnup, cooling time, and power history. The unique set of fuel creates a unique signature of neutron intensity based on the arrangement of the assemblies. The unique arrangement of neutron sources and multiplication produces a reliable and unique identification of the cask that has been shown to be relatively constant over long time periods. The work presented here could be used to restore from a loss of continuity of knowledge at the storage site. This presentation will show the steps used to simulate and form this signature from the start of the effort through its conclusion in September 2016.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Yanbo; Thyagarajan, Narmadaa; Coady, Breanne M.

    Highlights: • Lipoprotein hydrolysis products were produced by lipoprotein lipase. • Hydrolysis products lowers expression of macrophage cholesterol transporters. • Hydrolysis products reduces expression of select nuclear receptors. • Fatty acid products lowers cholesterol transporters and select nuclear receptors. • Fatty acid products reduces cholesterol efflux from macrophages. - Abstract: Lipoprotein lipase (LPL) is an extracellular lipase that primarily hydrolyzes triglycerides within circulating lipoproteins. Macrophage LPL contributes to atherogenesis, but the mechanisms behind it are poorly understood. We hypothesized that the products of lipoprotein hydrolysis generated by LPL promote atherogenesis by inhibiting the cholesterol efflux ability by macrophages. To testmore » this hypothesis, we treated human THP-1 macrophages with total lipoproteins that were hydrolyzed by LPL and we found significantly reduced transcript levels for the cholesterol transporters ATP binding cassette transporter A1 (ABCA1), ABCG1, and scavenger receptor BI. These decreases were likely due to significant reductions for the nuclear receptors liver-X-receptor-α, peroxisome proliferator activated receptor (PPAR)-α, and PPAR-γ. We prepared a mixture of free fatty acids (FFA) that represented the ratios of FFA species within lipoprotein hydrolysis products, and we found that the FFA mixture also significantly reduced cholesterol transporters and nuclear receptors. Finally, we tested the efflux of cholesterol from THP-1 macrophages to apolipoprotein A-I, and we found that the treatment of THP-1 macrophages with the FFA mixture significantly attenuated cholesterol efflux. Overall, these data show that the FFA component of lipoprotein hydrolysis products generated by LPL may promote atherogenesis by inhibiting cholesterol efflux, which partially explains the pro-atherogenic role of macrophage LPL.« less

  19. Ayurvedic genomics, constitutional psychology, and endocrinology: the missing connection.

    PubMed

    Rizzo-Sierra, Carlos V

    2011-05-01

    A recent methodological approach for human classification, diagnosis, and therapeutics through the combination of current Western constitutional psychology somatotypes and traditional Indian medicine (prakriti) body types and mind (manas) is herein presented. The striking similarities between psychologic somatotypes and Indian medicine body types permits proposal of a finite genopsycho-somatotyping of humans. Genopsycho-somatotyping of humans consists of a set of common physiologic, physical, and psychologic attributes related to a common basic birth constitution that remains somewhat permanent during human lifetime, since it is proposed that this birth constitution is programmed in the person's DNA (genes). This mainly provides a tool for classifying the human population based on broad and finite phenotype clusters across different ethnicity, languages, geographical location, or self-reported ancestry. In spite of any social or environmental traumatic event, I propose for males that every basic constitution has an associated identification organ, a measured property or marker, a soma, and some psyche general tendencies suggesting specific behavior or recurrent conduct. Three (3) basic extreme genopsycho-somatotypes or birth constitutions are enunciated: mesomorphic or andrus (Pitta), endomorphic or thymus (Khapa), and ectomorphic or thyrus (Vata). The method further predicts that male andrus constitution across races shares similarities in androgen (An) nuclear receptor behavior, whereas thymus constitutions are mainly regulated by T-cells (Tc) nuclear receptor behavior. Moreover, it suggests that thyrus constitutions share similarities in thyroxine (Th) nuclear receptor behavior. These proposed nuclear receptors are expected to regulate the expression of specific genes, thereby controlling the embryonic development, adult homeostasis, and metabolism of the human organism in a very profound way. The method finally predicts small differences in measured property (An, Tc, and Th nuclear receptors behavior) within a birth constitution across different races to be expected by modulation effects in melanocyte-stimulating hormone receptor behavior.

  20. Changes in amount and intracellular distribution of androgen receptor in human foreskin as a function of age.

    PubMed Central

    Roehrborn, C G; Lange, J L; George, F W; Wilson, J D

    1987-01-01

    To provide insight into the factors that control growth of the penis we measured the amount and intracellular distribution of specific high affinity androgen receptor in foreskins obtained at circumcision from 49 males varying in age from newborn to 59 yr. Total (cytosolic plus nuclear extract) androgen receptor decreased from approximately 40 fmol/g tissue weight in newborn foreskins to approximately 25 fmol/g by 1 yr of age. The amount of receptor rose in childhood to approximately 180 fmol/g in the late teenage years and fell thereafter to approximately 20-40 fmol/g in men older than 40 yr. The amount of receptor in the nuclear fraction increased at the time of puberty and subsequently decreased in parallel with the decline in total receptor level. These changes in androgen-receptor amount are similar when expressed per milligram DNA or per milligram protein. Images PMID:3491838

  1. Transcriptional targets shared by estrogen receptor- related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta.

    PubMed Central

    Vanacker, J M; Pettersson, K; Gustafsson, J A; Laudet, V

    1999-01-01

    The physiological activities of estrogens are thought to be mediated by specific nuclear receptors, ERalpha and ERbeta. However, certain tissues, such as the bone, that are highly responsive to estrogens only express a low level of these receptors. Starting from this apparent contradiction, we have evaluated the potentials of two related receptors ERRalpha and ERRbeta to intervene in estrogen signaling. ERalpha, ERRalpha and ERRbeta bind to and activate transcription through both the classical estrogen response element (ERE) and the SF-1 response element (SFRE). In contrast, ERbeta DNA-binding and transcriptional activity is restricted to the ERE. Accordingly, the osteopontin gene promoter is stimulated through SFRE sequences, by ERRalpha as well as by ERalpha, but not by ERbeta. Analysis of the cross-talk within the ER/ERR subgroup of nuclear receptors thus revealed common targets but also functional differences between the two ERs. PMID:10428965

  2. Structural Overview of the Nuclear Receptor Superfamily: Insights into Physiology and Therapeutics

    PubMed Central

    Huang, Pengxiang; Chandra, Vikas; Rastinejad, Fraydoon

    2013-01-01

    As ligand-regulated transcription factors, the nuclear hormone receptors are nearly ideal drug targets, with internal pockets that bind to hydrophobic, drug-like molecules and well-characterized ligand-induced conformational changes that recruit transcriptional coregulators to promoter elements. Yet, due to the multitude of genes under the control of a single receptor, the major challenge has been the identification of ligands with gene-selective actions, impacting disease outcomes through a narrow subset of target genes and not across their entire gene-regulatory repertoire. Here, we summarize the concepts and work to date underlying the development of steroidal and nonsteroidal receptor ligands, including the use of crystal structures, high-throughput screens, and rational design approaches for finding useful therapeutic molecules. Difficulties in finding selective receptor modulators require a more complete understanding of receptor interdomain communications, posttranslational modifications, and receptor-protein interactions that could be exploited for target gene selectivity. PMID:20148675

  3. Transportin mediates nuclear entry of DNA in vertebrate systems.

    PubMed

    Lachish-Zalait, Aurelie; Lau, Corine K; Fichtman, Boris; Zimmerman, Ella; Harel, Amnon; Gaylord, Michelle R; Forbes, Douglass J; Elbaum, Michael

    2009-10-01

    Delivery of DNA to the cell nucleus is an essential step in many types of viral infection, transfection, gene transfer by the plant pathogen Agrobacterium tumefaciens and in strategies for gene therapy. Thus, the mechanism by which DNA crosses the nuclear pore complex (NPC) is of great interest. Using nuclei reconstituted in vitro in Xenopus egg extracts, we previously studied DNA passage through the nuclear pores using a single-molecule approach based on optical tweezers. Fluorescently labeled DNA molecules were also seen to accumulate within nuclei. Here we find that this import of DNA relies on a soluble protein receptor of the importin family. To identify this receptor, we used different pathway-specific cargoes in competition studies as well as pathway-specific dominant negative inhibitors derived from the nucleoporin Nup153. We found that inhibition of the receptor transportin suppresses DNA import. In contrast, inhibition of importin beta has little effect on the nuclear accumulation of DNA. The dependence on transportin was fully confirmed in assays using permeabilized HeLa cells and a mammalian cell extract. We conclude that the nuclear import of DNA observed in these different vertebrate systems is largely mediated by the receptor transportin. We further report that histones, a known cargo of transportin, can act as an adaptor for the binding of transportin to DNA.

  4. Intracellular calcium: a prerequisite for aldosterone action.

    PubMed

    Schäfer, C; Shahin, V; Albermann, L; Schillers, H; Hug, M J; Oberleithner, H

    2003-12-01

    Transport of salt and water in various tissues is under control of the mineralocorticoid hormone aldosterone. As a liphophilic hormone, aldosterone diffuses through the plasma membrane and, then, binds to cytosolic mineralocorticoid receptors in the target cells. After binding to nuclear pore complexes, the activated receptor is translocated to the nucleus where transcription processes are initiated. After a lag period of about 20 minutes hormone-specific early mRNA transcripts leave the nucleus through nuclear pores. Some of the steps in this cascade can be followed by electrophysiology in Xenopus laevis oocyte nuclei. In addition to the genomic pathway, aldosterone exerts a rapid pre-genomic response that involves an increase in intracellular calcium. In this study, we tested for the potential role of Ca(2+) in the genomic response of the hormone. We measured the electrical resistance across the nuclear envelope in response to aldosterone, in presence and absence of intracellular Ca(2+). Nuclear envelope electrical resistance reflects receptor binding to the nuclear pore complexes ("early" resistance peak, 2 minutes after aldosterone), ongoing transcription ("transient" resistance drop, 5-15 minutes after aldosterone) and mRNA export ("late" resistance peak, 20 minutes after aldosterone). Pre-injection of the Ca(2+) chelator EGTA eliminated all electrical responses evoked by aldosterone. The transient resistance drop and the late resistance peak, induced by the hormone, were prevented by the transcription inhibitor actinomycin D, coinjected with aldosterone, while the early resistance peak remained unaffected. We conclude that (i). the presence of intracellular Ca(2+) is a prerequisite for the genomic action of aldosterone. (ii). Intracellular calcium plays a role early in the signaling cascade, either in agonist-receptor interaction, or receptor transport/docking to the nuclear pore complexes.

  5. Pharmacological evaluation of the mechanisms involved in increased adiposity in zebrafish triggered by the environmental contaminant tributyltin.

    PubMed

    Ouadah-Boussouf, Nafia; Babin, Patrick J

    2016-03-01

    One proposed contributing factor to the rise in overweight and obesity is exposure to endocrine disrupting chemicals. Tributyltin chloride (TBT), an organotin, induces adipogenesis in cell culture models and may increases adipose mass in vivo in vertebrate model organisms. It has been hypothesized that TBT acts via the peroxisome proliferator activated receptor (PPAR)γ-dependent pathway. However, the mechanisms involved in the effects of TBT exposure on in vivo adipose tissue metabolism remain unexplored. Semitransparent zebrafish larvae, with their well-developed white adipose tissue, offer a unique opportunity for studying the effects of toxicant chemicals and pharmaceuticals on adipocyte biology and whole-organism adiposity in a vertebrate model. Within hours, zebrafish larvae, treated at environmentally-relevant nanomolar concentrations of TBT, exhibited a remarkable increase in adiposity linked to adipocyte hypertrophy. Under the experimental conditions used, we also demonstrated that zebrafish larvae adipose tissue proved to be highly responsive to selected human nuclear receptor agonists and antagonists. Retinoid X receptor (RXR) homodimers and RXR/liver X receptor heterodimers were suggested to be in vivo effectors of the obesogenic effect of TBT on zebrafish white adipose tissue. RXR/PPARγ heterodimers may be recruited to modulate adiposity in zebrafish but were not a necessary requirement for the short term in vivo TBT obesogenic effect. Together, the present results suggest that TBT may induce the promotion of triacylglycerol storage in adipocytes via RXR-dependent pathways without necessary using PPAR isoforms. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. [Nutrigenomics--bioactive dietary components].

    PubMed

    Gętek, Monika; Czech, Natalia; Fizia, Katarzyna; Białek-Dratwa, Agnieszka; Muc-Wierzgoń, Małgorzata; Kokot, Teresa; Nowakowska-Zajdel, Ewa

    2013-04-05

    Nutrigenomics analyzes relations between diet and genes, and identifies mechanisms in which food and nutrition affect health and lifestyles and noncommunicable diseases (R. Chadwick, 2004). Bioactive dietary components are signal molecules that carry information from the external environment and affect in terms of quantity and quality in the process of gene expression. The biological effect of bioactive dietary components depends on various of physiological processes that can occur within a few genes. Polymorphism of genes can change their function and physiological response of the body for nutrients. Bioactive dietary components work on at least two levels of the expression of genes as factors regulating chromatin structure and as factors directly regulate the activity of nuclear receptors. The processes of synthesis and DNA repair are regulated by some of vitamins, macro-and micro-elements. They provide, among others, cofactors of enzymes that catalyze the replication of DNA methylation and its repair. DNA methylation profile may change under the influence of diet, single nucleotide polymorphisms and environmental factors. Bioactive dietary components may directly affect the process of gene expression by acting as ligands for nuclear receptors. Sensitive to dietary group of nuclear receptors are sensory receptors. This group includes, among others receptor PPAR (peroxisome proliferator activated), responsible for energy metabolism and receptors LXR (liver X receptor), FXR (farnesoid X receptor) and RXR, which is responsible for the metabolism of cholesterol.

  7. Exclusive nuclear location of estrogen receptors in Squalus testis.

    PubMed Central

    Callard, G V; Mak, P

    1985-01-01

    An estrogen (E)-binding molecule having both occupied and unoccupied sites is restricted to nuclear subfractions in the testis of the spiny dogfish (Squalus acanthias). We investigated the hypothesis that a species characterized by high body-fluid osmolarity (1010 mosM) has an estrogen receptor (ER) that binds to chromatin with high affinity and consequently resists redistribution during tissue processing. Although the steroid binding and sedimentation properties of the Squalus nuclear ER conformed to those of classical ER, its elution maximum from DNA-cellulose was unusually high (0.55 M NaCl). A tendency to adhere tightly to cell nuclei was reflected in the high salt concentration (0.43 M KCl) required to extract 50% of the receptors from the nuclear compartment during homogenization and in the stability of the nuclear ER population in the presence of high concentrations of a nonionic solute (urea) or increased buffer volume. Mixing and redistribution experiments showed that nuclear ER could be quantitatively and qualitatively measured in cytosolic extracts, ruling out the possibility that soluble receptors were being masked. Although Squalus oviduct ER was similar to that of testis, ER in the testis and liver of a related elasmobranch (Potamotrygon) that maintains osmotic equilibrium at 300 mosM more closely resembled mammalian ER in its elution maximum from DNA-cellulose (0.22 M NaCl) and cytosolic/nuclear ratios in low-salt buffers. We conclude that Squalus testis has a single ER pool located exclusively in the nuclear compartment. These observations support a revised concept of steroid action and further indicate that the chromatin affinity of the hormone-ER complex is an important factor in determining subfractional distribution during tissue processing. PMID:3856265

  8. Role of RANKL in bone diseases.

    PubMed

    Anandarajah, Allen P

    2009-03-01

    Bone remodeling is a tightly regulated process of osteoclast-mediated bone resorption, balanced by osteoblast-mediated bone formation. Disruption of this balance can lead to increased bone turnover, resulting in excessive bone loss or extra bone formation and consequent skeletal disease. The receptor activator of nuclear factor kappaB ligand (RANKL) (along with its receptor), the receptor activator of nuclear factor kappaB and its natural decoy receptor, osteoprotegerin, are the final effector proteins of osteoclastic bone resorption. Here, I provide an overview of recent studies that highlight the key role of RANKL in the pathophysiology of several bone diseases and discuss the novel therapeutic approaches afforded by the modulation of RANKL.

  9. Reassessment of the Unique Mode of Binding between Angiotensin II Type 1 Receptor and Their Blockers

    PubMed Central

    Matsuo, Yoshino; Saku, Keijiro; Karnik, Sadashiva S.

    2013-01-01

    While the molecular structures of angiotensin II (Ang II) type 1 (AT1) receptor blockers (ARBs) are very similar, they are also slightly different. Although each ARB has been shown to exhibit a unique mode of binding to AT1 receptor, different positions of the AT1 receptor have been analyzed and computational modeling has been performed using different crystal structures for the receptor as a template and different kinds of software. Therefore, we systematically analyzed the critical positions of the AT1 receptor, Tyr113, Tyr184, Lys199, His256 and Gln257 using a mutagenesis study, and subsequently performed computational modeling of the binding of ARBs to AT1 receptor using CXCR4 receptor as a new template and a single version of software. The interactions between Tyr113 in the AT1 receptor and the hydroxyl group of olmesartan, between Lys199 and carboxyl or tetrazole groups, and between His256 or Gln257 and the tetrazole group were studied. The common structure, a tetrazole group, of most ARBs similarly bind to Lys199, His256 and Gln257 of AT1 receptor. Lys199 in the AT1 receptor binds to the carboxyl group of EXP3174, candesartan and azilsartan, whereas oxygen in the amidecarbonyl group of valsartan may bind to Lys199. The benzimidazole portion of telmisartan may bind to a lipophilic pocket that includes Tyr113. On the other hand, the n-butyl group of irbesartan may bind to Tyr113. In conclusion, we confirmed that the slightly different structures of ARBs may be critical for binding to AT1 receptor and for the formation of unique modes of binding. PMID:24260317

  10. The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

    PubMed Central

    Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

    1997-01-01

    The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

  11. Body Mass Index Influences the Prognostic Impact of Combined Nuclear Insulin Receptor and Estrogen Receptor Expression in Primary Breast Cancer.

    PubMed

    Björner, Sofie; Rosendahl, Ann H; Simonsson, Maria; Markkula, Andrea; Jirström, Karin; Borgquist, Signe; Rose, Carsten; Ingvar, Christian; Jernström, Helena

    2017-01-01

    The prognostic importance of tumor-specific nuclear insulin receptor (InsR) expression in breast cancer is unclear, while membrane and cytoplasmic localization of InsR is better characterized. The insulin signaling network is influenced by obesity and may interact with the estrogen receptor α (ERα) signaling. The purpose was to investigate the interplay between nuclear InsR, ER, body mass index (BMI), and prognosis. Tumor-specific expression of nuclear InsR was evaluated by immunohistochemistry in tissue microarrays from 900 patients with primary invasive breast cancer without preoperative treatment, included in a population-based cohort in Sweden (2002-2012) in relation to prognosis. Patients were followed for up to 11 years during which 107 recurrences were observed. Nuclear InsR + expression was present in 214 patients (23.8%) and increased with longer time between surgery and staining ( P  < 0.001). There were significant effect modifications by ER status and BMI in relation to clinical outcomes. Nuclear InsR + conferred higher recurrence-risk in patients with ER + tumors, but lower risk in patients with ER - tumors ( P interaction  = 0.003). Normal-weight patients with nuclear InsR + tumors had higher recurrence-risk, while overweight or obese patients had half the recurrence-risk compared to patients with nuclear InsR - tumors ( P interaction  = 0.007). Normal-weight patients with a nuclear InsR - /ER + tumor had the lowest risk for recurrence compared to all other nuclear InsR/ER combinations [HR adj 0.50, 95% confidence interval (CI): 0.25-0.97], while overweight or obese patients with nuclear InsR - /ER - tumors had the worst prognosis (HR adj 7.75, 95% CI: 2.04-29.48). Nuclear InsR was more prognostic than ER among chemotherapy-treated patients. In summary, nuclear InsR may have prognostic impact among normal-weight patients with ER + tumors and in overweight or obese patients with ER - tumors. Normal-weight patients with nuclear InsR - /ER + tumors may benefit from less treatment than normal-weight patients with other nuclear InsR/ER combinations. Overweight or obese patients with nuclear InsR - /ER - tumors may benefit from more tailored treatment or weight management.

  12. Mitochondrial damage elicits a TCDD-inducible poly(ADP-ribose) polymerase-mediated antiviral response

    PubMed Central

    Kozaki, Tatsuya; Komano, Jun; Kanbayashi, Daiki; Takahama, Michihiro; Misawa, Takuma; Satoh, Takashi; Takeuchi, Osamu; Kawai, Taro; Shimizu, Shigeomi; Matsuura, Yoshiharu; Akira, Shizuo; Saitoh, Tatsuya

    2017-01-01

    The innate immune system senses RNA viruses by pattern recognition receptors (PRRs) and protects the host from virus infection. PRRs mediate the production of immune modulatory factors and direct the elimination of RNA viruses. Here, we show a unique PRR that mediates antiviral response. Tetrachlorodibenzo-p-dioxin (TCDD)-inducible poly(ADP ribose) polymerase (TIPARP), a Cysteine3 Histidine (CCCH)-type zinc finger-containing protein, binds to Sindbis virus (SINV) RNA via its zinc finger domain and recruits an exosome to induce viral RNA degradation. TIPARP typically localizes in the nucleus, but it accumulates in the cytoplasm after SINV infection, allowing targeting of cytoplasmic SINV RNA. Redistribution of TIPARP is induced by reactive oxygen species (ROS)-dependent oxidization of the nuclear pore that affects cytoplasmic-nuclear transport. BCL2-associated X protein (BAX) and BCL2 antagonist/killer 1 (BAK1), B-cell leukemia/lymphoma 2 (BCL2) family members, mediate mitochondrial damage to generate ROS after SINV infection. Thus, TIPARP is a viral RNA-sensing PRR that mediates antiviral responses triggered by BAX- and BAK1-dependent mitochondrial damage. PMID:28213497

  13. Single-round selection yields a unique retroviral envelope utilizing GPR172A as its host receptor.

    PubMed

    Mazari, Peter M; Linder-Basso, Daniela; Sarangi, Anindita; Chang, Yehchung; Roth, Monica J

    2009-04-07

    The recognition by a viral envelope of its cognate host-cell receptor is the initial critical step in defining the viral host-range and tissue specificity. This study combines a single-round of selection of a random envelope library with a parallel cDNA screen for receptor function to identify a distinct retroviral envelope/receptor pair. The 11-aa targeting domain of the modified feline leukemia virus envelope consists of a constrained peptide. Critical to the binding of the constrained peptide envelope to its cellular receptor are a pair of internal cysteines and an essential Trp required for maintenance of titers >10(5) lacZ staining units per milliliter. The receptor used for viral entry is the human GPR172A protein, a G-protein-coupled receptor isolated from osteosarcoma cells. The ability to generate unique envelopes capable of using tissue- or disease-specific receptors marks an advance in the development of efficient gene-therapy vectors.

  14. Isolation, characterization, and expression analyses of ecdysone receptor 1, ecdysone receptor 2 and ultraspiracle genes in varroa destructor mite

    USDA-ARS?s Scientific Manuscript database

    The varroa mite, Varroa destructor, is a honeybee ectoparasite considered the most important pest in apiaries throughout the US. Ecdysone receptor is a hormone secreted by the prothoracic gland of insects that controls ecdysis and stimulates metamorphosis. The ecdysone receptor is a nuclear receptor...

  15. Featured Article: Nuclear export of opioid growth factor receptor is CRM1 dependent.

    PubMed

    Kren, Nancy P; Zagon, Ian S; McLaughlin, Patricia J

    2016-02-01

    Opioid growth factor receptor (OGFr) facilitates growth inhibition in the presence of its specific ligand opioid growth factor (OGF), chemically termed [Met(5)]-enkephalin. The function of the OGF-OGFr axis requires the receptor to translocate to the nucleus. However, the mechanism of nuclear export of OGFr is unknown. In this study, endogenous OGFr, as well as exogenously expressed OGFr-EGFP, demonstrated significant nuclear accumulation in response to leptomycin B (LMB), an inhibitor of CRM1-dependent nuclear export, suggesting that OGFr is exported in a CRM1-dependent manner. One consensus sequence for a nuclear export signal (NES) was identified. Mutation of the associated leucines, L217 L220 L223 and L225, to alanine resulted in decreased nuclear accumulation. NES-EGFP responded to LMB, indicating that this sequence is capable of functioning as an export signal in isolation. To determine why the sequence functions differently in isolation than as a full length protein, the localization of subNES was evaluated in the presence and absence of MG132, a potent inhibitor of proteosomal degradation. MG132 had no effect of subNES localization. The role of tandem repeats located at the C-terminus of OGFr was examined for their role in nuclear trafficking. Six of seven tandem repeats were removed to form deltaTR. DeltaTR localized exclusively to the nucleus indicating that the tandem repeats may contribute to the localization of the receptor. Similar to the loss of cellular proliferation activity (i.e. inhibition) recorded with subNES, deltaTR also demonstrated a significant loss of inhibitory activity indicating that the repeats may be integral to receptor function. These experiments reveal that OGFr contains one functional NES, L217 L220 L223 and L225 and can be exported from the nucleus in a CRM1-dependent manner. © 2015 by the Society for Experimental Biology and Medicine.

  16. Novel Positive Regulatory Role for the SPL6 Transcription Factor in the N TIR-NB-LRR Receptor-Mediated Plant Innate Immunity

    PubMed Central

    Padmanabhan, Meenu S.; Ma, Shisong; Burch-Smith, Tessa M.; Czymmek, Kirk; Huijser, Peter; Dinesh-Kumar, Savithramma P.

    2013-01-01

    Following the recognition of pathogen-encoded effectors, plant TIR-NB-LRR immune receptors induce defense signaling by a largely unknown mechanism. We identify a novel and conserved role for the SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-domain transcription factor SPL6 in enabling the activation of the defense transcriptome following its association with a nuclear-localized immune receptor. During an active immune response, the Nicotiana TIR-NB-LRR N immune receptor associates with NbSPL6 within distinct nuclear compartments. NbSPL6 is essential for the N-mediated resistance to Tobacco mosaic virus. Similarly, the presumed Arabidopsis ortholog AtSPL6 is required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that AtSPL6 positively regulates a subset of defense genes. A pathogen-activated nuclear-localized TIR-NB-LRR like N can therefore regulate defense genes through SPL6 in a mechanism analogous to the induction of MHC genes by mammalian immune receptors like CIITA and NLRC5. PMID:23516366

  17. Microsomal receptor for steroid hormones: functional implications for nuclear activity.

    PubMed

    Muldoon, T G; Watson, G H; Evans, A C; Steinsapir, J

    1988-01-01

    Target tissues for steroid hormones are responsive by virtue of and to the extent of their content of functional intracellular receptors. Recent years have seen a shift in considerations of the cellular dynamics and distribution of these receptors, with current views favoring predominant intranuclear localization in the intact cell. This paper summarizes our analyses of the microsomal estrogen and androgen binding capability of rat uterine and ventral prostate tissue, respectively; these studies have revealed a set of high affinity sites that may act as a conduit for estrogen traversing the cell en route to the nucleus. These sites have many properties in common with cytosolic receptors, with the salient difference of a failure to activate to a more avid DNA-binding form under conditions which permit such activation of cytosolic receptors. The microsomal estrogen-binding proteins also have appreciable affinity for progesterone, another distinction from other known cellular estrogen receptor species. Various experimental approaches were employed to demonstrate that the microsomal receptors were not simply cytosol contaminants; the most convincing evidence is the recent successful separation of the cytosolic and microsomal forms by differential ammonium sulfate precipitation. Discrete subfractionation of subcellular components on successive sucrose gradients, with simultaneous assessments of binding capability and marker enzyme concentrations, indicates that the major portion of the binding is localized within the vesicles of the endoplasmic reticulum free of significant plasma membrane contamination. The microsomal receptors are readily solubilized by extraction with high- or low-salt-containing buffers or with steroid. The residual microsomes following such extraction have the characteristics of saturable acceptor sites for cytosolic estrogen-receptor complexes. The extent to which these sites will accept the cytosolic complexes is equal to the concentration of microsomal binding sites extracted. These observations suggest three possible roles for the microsomal receptor-like proteins: (a) modulation of estrogen access to nuclear binding sites; (b) formation of functional complexes which diffuse to other extranuclear sites to alter non-genomic cellular processes; (c) regulation of nuclear concentration of estrogen-receptor complexes by virtue of producing microsomal acceptor sites for uptake of free or loosely associated nuclear complexes, previously thought to exist in the cytoplasm.

  18. The calcium-sensing receptor and its interacting proteins

    PubMed Central

    Huang, Chunfa; Miller, R Tyler

    2007-01-01

    Abstract Seven membrane-spanning, or G protein-coupled receptors were originally thought to act through het-erotrimeric G proteins that in turn activate intracellular enzymes or ion channels, creating relatively simple, linear signalling pathways. Although this basic model remains true in that this family does act via a relatively small number of G proteins, these signalling systems are considerably more complex because the receptors interact with or are located near additional proteins that are often unique to a receptor or subset of receptors. These additional proteins give receptors their unique signalling ‘personalities’. The extracellular Ca-sensing receptor (CaR) signals via Gαi, Gαq and Gα12/13, but its effects in vivo demonstrate that the signalling pathways controlled by these subunits are not sufficient to explain all its biologic effects. Additional structural or signalling proteins that interact with the CaR may explain its behaviour more fully. Although the CaR is less well studied in this respect than other receptors, several CaR-interacting proteins such as filamin, a potential scaffolding protein, receptor activity modifying proteins (RAMPs) and potassium channels may contribute to the unique characteristics of the CaR. The CaR also appears to interact with additional proteins common to other G protein-coupled receptors such as arrestins, G protein receptor kinases, protein kinase C, caveolin and proteins in the ubiquitination pathway. These proteins probably represent a few initial members of CaR-based signalling complex. These and other proteins may not all be associated with the CaR in all tissues, but they form the basis for understanding the complete nature of CaR signalling. PMID:17979874

  19. Tracking of Nuclear Production using Indigenous Species: Final LDRD Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alam, Todd Michael; Alam, Mary Kathleen; McIntyre, Sarah K.

    Our LDRD research project sought to develop an analytical method for detection of chemicals used in nuclear materials processing. Our approach is distinctly different than current research involving hardware-based sensors. By utilizing the response of indigenous species of plants and/or animals surrounding (or within) a nuclear processing facility, we propose tracking 'suspicious molecules' relevant to nuclear materials processing. As proof of concept, we have examined TBP, tributylphosphate, used in uranium enrichment as well as plutonium extraction from spent nuclear fuels. We will compare TBP to the TPP (triphenylphosphate) analog to determine the uniqueness of the metabonomic response. We show thatmore » there is a unique metabonomic response within our animal model to TBP. The TBP signature can further be delineated from that of TPP. We have also developed unique methods of instrumental transfer for metabonomic data sets.« less

  20. Nuclear Receptor Signaling Atlas: Opening Access to the Biology of Nuclear Receptor Signaling Pathways.

    PubMed

    Becnel, Lauren B; Darlington, Yolanda F; Ochsner, Scott A; Easton-Marks, Jeremy R; Watkins, Christopher M; McOwiti, Apollo; Kankanamge, Wasula H; Wise, Michael W; DeHart, Michael; Margolis, Ronald N; McKenna, Neil J

    2015-01-01

    Signaling pathways involving nuclear receptors (NRs), their ligands and coregulators, regulate tissue-specific transcriptomes in diverse processes, including development, metabolism, reproduction, the immune response and neuronal function, as well as in their associated pathologies. The Nuclear Receptor Signaling Atlas (NURSA) is a Consortium focused around a Hub website (www.nursa.org) that annotates and integrates diverse 'omics datasets originating from the published literature and NURSA-funded Data Source Projects (NDSPs). These datasets are then exposed to the scientific community on an Open Access basis through user-friendly data browsing and search interfaces. Here, we describe the redesign of the Hub, version 3.0, to deploy "Web 2.0" technologies and add richer, more diverse content. The Molecule Pages, which aggregate information relevant to NR signaling pathways from myriad external databases, have been enhanced to include resources for basic scientists, such as post-translational modification sites and targeting miRNAs, and for clinicians, such as clinical trials. A portal to NURSA's Open Access, PubMed-indexed journal Nuclear Receptor Signaling has been added to facilitate manuscript submissions. Datasets and information on reagents generated by NDSPs are available, as is information concerning periodic new NDSP funding solicitations. Finally, the new website integrates the Transcriptomine analysis tool, which allows for mining of millions of richly annotated public transcriptomic data points in the field, providing an environment for dataset re-use and citation, bench data validation and hypothesis generation. We anticipate that this new release of the NURSA database will have tangible, long term benefits for both basic and clinical research in this field.

  1. Nuclear Transcription Factors in the Mitochondria: A New Paradigm in Fine-Tuning Mitochondrial Metabolism.

    PubMed

    Sepuri, Naresh Babu V; Tammineni, Prasad; Mohammed, Fareed; Paripati, Arunkumar

    2017-01-01

    Noncanonical functions of several nuclear transcription factors in the mitochondria have been gaining exceptional traction over the years. These transcription factors include nuclear hormone receptors like estrogen, glucocorticoid, and thyroid hormone receptors: p53, IRF3, STAT3, STAT5, CREB, NF-kB, and MEF-2D. Mitochondria-localized nuclear transcription factors regulate mitochondrial processes like apoptosis, respiration and mitochondrial transcription albeit being nuclear in origin and having nuclear functions. Hence, the cell permits these multi-stationed transcription factors to orchestrate and fine-tune cellular metabolism at various levels of operation. Despite their ubiquitous distribution in different subcompartments of mitochondria, their targeting mechanism is poorly understood. Here, we review the current status of mitochondria-localized transcription factors and discuss the possible targeting mechanism besides the functional interplay between these factors.

  2. Development of an image analysis screen for estrogen receptor alpha (ERα) ligands through measurement of nuclear translocation dynamics.

    PubMed

    Dull, Angie; Goncharova, Ekaterina; Hager, Gordon; McMahon, James B

    2010-11-01

    We have developed a robust high-content assay to screen for novel estrogen receptor alpha (ERα) agonists and antagonists by quantitation of cytoplasmic to nuclear translocation of an estrogen receptor chimera in 384-well plates. The screen utilizes a green fluorescent protein tagged-glucocorticoid/estrogen receptor (GFP-GRER) chimera which consisted of the N-terminus of the glucocorticoid receptor fused to the human ER ligand binding domain. The GFP-GRER exhibited cytoplasmic localization in the absence of ERα ligands, and translocated to the nucleus in response to stimulation with ERα agonists or antagonists. The BD Pathway 435 imaging system was used for image acquisition, analysis of translocation dynamics, and cytotoxicity measurements. The assay was validated with known ERα agonists and antagonists, and the Library of Pharmacologically Active Compounds (LOPAC 1280). Additionally, screening of crude natural product extracts demonstrated the robustness of the assay, and the ability to quantitate the effects of toxicity on nuclear translocation dynamics. The GFP-GRER nuclear translocation assay was very robust, with z' values >0.7, CVs <5%, and has been validated with known ER ligands, and inclusion of cytotoxicity filters will facilitate screening of natural product extracts. This assay has been developed for future primary screening of synthetic, pure natural products, and natural product extracts libraries available at the National Cancer Institute at Frederick. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. Retinoic Acid Inducible Gene 1 Protein (RIG1)-like Receptor Pathway is Required for Efficient Nuclear Reprogramming

    PubMed Central

    Sayed, Nazish; Ospino, Frank; Himmati, Farhan; Lee, Jieun; Chanda, Palas; Mocarski, Edward S.; Cooke, John P.

    2017-01-01

    We have revealed a critical role for innate immune signaling in nuclear reprogramming to pluripotency, and in the nuclear reprogramming required for somatic cell transdifferentiation. Activation of innate immune signaling causes global changes in the expression and activity of epigenetic modifiers to promote epigenetic plasticity. In our previous papers, we focused on the role of toll-like receptor 3 (TLR3) in this signaling pathway. Here we define the role of another innate immunity pathway known to participate in the response to viral RNA, the retinoic acid-inducible gene 1 receptor (RIG-1)-like receptor (RLR) pathway. This pathway is represented by the sensors of viral RNA, RIG-1, LGP2 and MDA5. We first found that TLR3 deficiency only causes a partial inhibition of nuclear reprogramming to pluripotency in mouse tail-tip fibroblasts, which motivated us to determine the contribution of RLR. We found that knockdown of iPS-1, the common adaptor protein for the RLR family, substantially reduced nuclear reprogramming induced by retroviral or by mmRNA expression of Oct 4, Sox2, KLF4 and cMYC (OSKM). Importantly a double knockdown of both RLR and TLR3 pathway led to a further decrease in iPSC colonies suggesting an additive effect of both these pathways on nuclear reprogramming. Furthermore, in murine embryonic fibroblasts expressing a dox-inducible cassette of the genes encoding OSKM, an RLR agonist increased the yield of iPSCs. Similarly, the RLR agonist enhanced nuclear reprogramming by cell permeant peptides of the Yamanaka factors. Finally, in the dox-inducible system, RLR activation promotes activating histone marks in the promoter region of pluripotency genes. To conclude, innate immune signaling mediated by RLR plays a critical role in nuclear reprogramming. Manipulation of innate immune signaling may facilitate nuclear reprogramming to achieve pluripotency. PMID:28276156

  4. Expression of the G protein-coupled estrogen receptor (GPER) in endometriosis: a tissue microarray study.

    PubMed

    Samartzis, Nicolas; Samartzis, Eleftherios P; Noske, Aurelia; Fedier, André; Dedes, Konstantin J; Caduff, Rosmarie; Fink, Daniel; Imesch, Patrick

    2012-04-20

    The G protein-coupled estrogen receptor (GPER) is thought to be involved in non-genomic estrogen responses as well as processes such as cell proliferation and migration. In this study, we analyzed GPER expression patterns from endometriosis samples and normal endometrial tissue samples and compared these expression profiles to those of the classical sex hormone receptors. A tissue microarray, which included 74 samples from different types of endometriosis (27 ovarian, 19 peritoneal and 28 deep-infiltrating) and 30 samples from normal endometrial tissue, was used to compare the expression levels of the GPER, estrogen receptor (ER)-alpha, ER-beta and progesterone receptor (PR). The immunoreactive score (IRS) was calculated separately for epithelium and stroma as the product of the staining intensity and the percentage of positive cells. The expression levels of the hormonal receptors were dichotomized into low (IRS < 6) and high (IRS > = 6) expression groups. The mean epithelial IRS (+/- standard deviation, range) of cytoplasmic GPER expression was 1.2 (+/- 1.7, 0-4) in normal endometrium and 5.1 (+/- 3.5, 0-12) in endometriosis (p < 0.001), of nuclear GPER 6.4 (+/- 2.6, 0-12) and 6.8 (+/- 2.9, 2-12; p = 0.71), of ER-alpha 10.6 (+/- 2.4, 3-12) and 9.8 (+/- 3.0, 2-12; p = 0.26), of ER-beta 2.4 (+/- 2.2; 0-8) and 5.6 (+/- 2.6; 0-10; p < 0.001), and of PR 11.5 (+/- 1.7; 3-12) and 8.1 (+/- 4.5; 0-12; p < 0.001), respectively. The mean stromal IRS of nuclear GPER expression was 7.7 (+/- 3.0; 2-12) in endometrium and 10.8 (+/- 1.7; 6-12) in endometriosis (p < 0.001), of ER-alpha 8.7 (+/- 3.1; 2-12) and 10.6 (+/- 2.4; 2-12; p = 0.001), of ER-beta 1.8 (+/- 2.0; 0-8) and 5.4 (+/- 2.5; 0-10; p < 0.001), and of PR 11.7 (+/- 0.9; 8-12) and 10.9 (+/- 2.0; 3-12; p = 0.044), respectively. Cytoplasmic GPER expression was not detectable in the stroma of endometrium and endometriosis. The observed frequency of high epithelial cytoplasmic GPER expression levels was 50% (n = 30/60) in the endometriosis and none (0/30) in the normal endometrium samples (p < 0.001). High epithelial cytoplasmic GPER expression levels were more frequent in endometriomas (14/20, 70%; p = 0.01), as compared to peritoneal (9/18, 50%) or deep-infiltrating endometriotic lesions (7/22, 31.8%). The frequency of high stromal nuclear GPER expression levels was 100% (n = 74/74) in endometriosis and 76.7% (n = 23/30) in normal endometrium (p < 0.001). The frequency of high epithelial nuclear GPER expression levels did not differ between endometriosis and normal endometrium. The present data indicate a unique GPER expression pattern in endometriosis, especially in endometriomas as compared to the normal endometrium. The overexpression of GPER in endometriotic lesions suggests a potential role for GPER in the hormonal regulation of endometriosis, which should be taken into consideration for future hormonal treatment strategies.

  5. DEPENDENCE OF PPAR LIGAND-INDUCED MAPK SIGNALING ON EPIDERMAL GROWTH FACTOR RECEPTOR TRANSACTIVATION HEPARIN-BINDING EGF CLEAVAGE MEDIATES ZINC-INDUCED EGF RECEPTOR PHOSPHORYLATION

    EPA Science Inventory

    Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that function as ligand-activated transcription factors regulating lipid metabolism and homeostasis. In addition to their ability to regulate PPAR-mediated gene transcription, PPARalpha and gamma li...

  6. Review of the expression of Peroxisome Proliferator Activated Receptors alpha (PPARα), beta (PPAR β), and gamma (PPAR() in rodent and human development.

    EPA Science Inventory

    The peroxisome proliferator-activated receptors (PPAR) belong to the nuclear hormone receptor superfamily and there are three primary isotypes, PPARα, β, and (. These receptors regulate important physiological processes that impact lipid homeostasis, inflammation, adipogenesis, r...

  7. Mode of action framework analysis for receptor-mediated toxicity: the Peroxisome Proliferator-Activated Receptor alpha (PPARα) as a case study

    EPA Science Inventory

    Therapeutic hypolipidemic agents and industrial chemicals that cause peroxisome proliferation and induce liver tumors in rodents activate the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARα). Research has elucidated the cellular and molecular events by w...

  8. Enhanced thyroid hormone breakdown in hepatocytes by mutual induction of the constitutive androstane receptor (CAR, NR1I3) and arylhydrocarbon receptor by benzo[a]pyrene and phenobarbital.

    PubMed

    Schraplau, Anne; Schewe, Bettina; Neuschäfer-Rube, Frank; Ringel, Sebastian; Neuber, Corinna; Kleuser, Burkhard; Püschel, Gerhard P

    2015-02-03

    Xenobiotics may interfere with the hypothalamic-pituitary-thyroid endocrine axis by inducing enzymes that inactivate thyroid hormones and thereby reduce the metabolic rate. This induction results from an activation of xeno-sensing nuclear receptors. The current study shows that benzo[a]pyrene, a frequent contaminant of processed food and activator of the arylhydrocarbon receptor (AhR) activated the promoter and induced the transcription of the nuclear receptor constitutive androstane receptor (CAR, NR1I3) in rat hepatocytes. Likewise, phenobarbital induced the AhR transcription. This mutual induction of the nuclear receptors enhanced the phenobarbital-dependent induction of the prototypic CAR target gene Cyp2b1 as well as the AhR-dependent induction of UDP-glucuronosyltransferases. In both cases, the induction by the combination of both xenobiotics was more than the sum of the induction by either substance alone. By inducing the AhR, phenobarbital enhanced the benzo[a]pyrene-dependent reduction of thyroid hormone half-life and the benzo[a]pyrene-dependent increase in the rate of thyroid hormone glucuronide formation in hepatocyte cultures. CAR ligands might thus augment the endocrine disrupting potential of AhR activators by an induction of the AhR. Copyright © 2014. Published by Elsevier Ireland Ltd.

  9. RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators

    PubMed Central

    Redfern, Andrew D.; Colley, Shane M.; Beveridge, Dianne J.; Ikeda, Naoya; Epis, Michael R.; Li, Xia; Foulds, Charles E.; Stuart, Lisa M.; Barker, Andrew; Russell, Victoria J.; Ramsay, Kerry; Kobelke, Simon J.; Li, Xiaotao; Hatchell, Esme C.; Payne, Christine; Giles, Keith M.; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B.; O’Malley, Bert W.; Leedman, Peter J.

    2013-01-01

    The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing. PMID:23550157

  10. RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators.

    PubMed

    Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J

    2013-04-16

    The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.

  11. Iron Mediates N-Methyl-d-aspartate Receptor-dependent Stimulation of Calcium-induced Pathways and Hippocampal Synaptic Plasticity*

    PubMed Central

    Muñoz, Pablo; Humeres, Alexis; Elgueta, Claudio; Kirkwood, Alfredo; Hidalgo, Cecilia; Núñez, Marco T.

    2011-01-01

    Iron deficiency hinders hippocampus-dependent learning processes and impairs cognitive performance, but current knowledge on the molecular mechanisms underlying the unique role of iron in neuronal function is sparse. Here, we investigated the participation of iron on calcium signal generation and ERK1/2 stimulation induced by the glutamate agonist N-methyl-d-aspartate (NMDA), and the effects of iron addition/chelation on hippocampal basal synaptic transmission and long-term potentiation (LTP). Addition of NMDA to primary hippocampal cultures elicited persistent calcium signals that required functional NMDA receptors and were independent of calcium influx through L-type calcium channels or α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors; NMDA also promoted ERK1/2 phosphorylation and nuclear translocation. Iron chelation with desferrioxamine or inhibition of ryanodine receptor (RyR)-mediated calcium release with ryanodine-reduced calcium signal duration and prevented NMDA-induced ERK1/2 activation. Iron addition to hippocampal neurons readily increased the intracellular labile iron pool and stimulated reactive oxygen species production; the antioxidant N-acetylcysteine or the hydroxyl radical trapper MCI-186 prevented these responses. Iron addition to primary hippocampal cultures kept in calcium-free medium elicited calcium signals and stimulated ERK1/2 phosphorylation; RyR inhibition abolished these effects. Iron chelation decreased basal synaptic transmission in hippocampal slices, inhibited iron-induced synaptic stimulation, and impaired sustained LTP in hippocampal CA1 neurons induced by strong stimulation. In contrast, iron addition facilitated sustained LTP induction after suboptimal tetanic stimulation. Together, these results suggest that hippocampal neurons require iron to generate RyR-mediated calcium signals after NMDA receptor stimulation, which in turn promotes ERK1/2 activation, an essential step of sustained LTP. PMID:21296883

  12. Nuclear degradation of Wilms tumor 1-associating protein and survivin splice variant switching underlie IGF-1-mediated survival.

    PubMed

    Small, Theodore W; Pickering, J Geoffrey

    2009-09-11

    WTAP (Wilms tumor 1-associating protein) is a recently identified nuclear protein that is essential for mouse embryo development. The Drosophila homolog of WTAP, Fl(2)d, regulates pre-mRNA splicing; however, the role of WTAP in mammalian cells is uncertain. To elucidate a context for WTAP action, we screened growth and survival factors for their effects on WTAP expression in vascular smooth muscle cells (SMCs), a cell type previously found to express WTAP dynamically. This revealed that insulin-like growth factor-1 (IGF-1) uniquely reduced WTAP abundance. This decline in WTAP proved to be necessary for IGF-1 to confer its antiapoptotic properties, which were blocked by transducing the WTAP gene into SMCs. WTAP down-regulation by IGF-1 was mediated by an IGF-1 receptor-phosphatidylinositol 3-kinase-Akt signaling axis that directed WTAP degradation via a nuclear 26 S proteasome. Moreover, by promoting the degradation of WTAP, IGF-1 shifted the pre-mRNA splicing program for the survival factor, survivin, to reduce expression of survivin-2B, which is proapoptotic, and increase expression of survivin, which is antiapoptotic. Knockdown of survivin-2B rescued the ability of IGF-1 to promote survival when WTAP was overexpressed. These data uncover a novel regulatory cascade for human SMC survival based on adjusting the nuclear abundance of WTAP to define the splice variant balance among survivin isoforms.

  13. Proteomics on the rims; insights into the biology of the nuclear envelope and flagellar pocket of trypanosomes

    PubMed Central

    Field, Mark C.; Adung’a, Vincent; Obado, Samson; Chait, Brian T.; Rout, Michael P.

    2014-01-01

    SUMMERY Trypanosomatids represent the causative agents of major diseases in humans, livestock and plants, with inevitable suffering and economic hardship as a result. They are also evolutionarily highly divergent organisms, and the many unique aspects of trypanosome biology provide opportunities in terms of identification of drug targets, the challenge of exploiting these putative targets, and at the same time significant scope for exploration of novel and divergent cell biology. We can estimate from genome sequences that the degree of divergence of trypanosomes from animals and fungi is extreme, with perhaps one third to one half of predicted trypanosome proteins having no known function based on homology or recognizable protein domains/architecture. Two highly important aspects of trypanosome biology are the flagellar pocket and the nuclear envelope, where in silico analysis clearly suggests great potential divergence in the proteome. The flagellar pocket is the sole site of endo- and exocytosis in trypanosomes and plays important roles in immune evasion via variant surface glycoprotein (VSG) trafficking and providing a location for sequestration of various invariant receptors. The trypanosome nuclear envelope has been largely unexplored, but by analogy with higher eukaryotes, roles in the regulation of chromatin and most significantly, in controlling VSG gene expression are expected. Here we discuss recent successful proteomics-based approaches towards characterization of the nuclear envelope and the endocytic apparatus, the identification of conserved and novel trypanosomatid-specific features, and the implications of these findings. PMID:22309600

  14. p35 Regulates the CRM1-Dependent Nucleocytoplasmic Shuttling of Nuclear Hormone Receptor Coregulator-Interacting Factor 1 (NIF-1)

    PubMed Central

    Zhao, Xiao-Su; Fu, Wing-Yu; Chien, Winnie W. Y.; Li, Zhen; Fu, Amy K. Y.; Ip, Nancy Y.

    2014-01-01

    Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC)-interacting factor 1 (NIF-1), is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators. PMID:25329792

  15. p35 regulates the CRM1-dependent nucleocytoplasmic shuttling of nuclear hormone receptor coregulator-interacting factor 1 (NIF-1).

    PubMed

    Zhao, Xiao-Su; Fu, Wing-Yu; Chien, Winnie W Y; Li, Zhen; Fu, Amy K Y; Ip, Nancy Y

    2014-01-01

    Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC)-interacting factor 1 (NIF-1), is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators.

  16. Insulin-induced translocation of IR to the nucleus in insulin responsive cells requires a nuclear translocation sequence.

    PubMed

    Kesten, Dov; Horovitz-Fried, Miriam; Brutman-Barazani, Tamar; Sampson, Sanford R

    2018-04-01

    Insulin binding to its cell surface receptor (IR) activates a cascade of events leading to its biological effects. The Insulin-IR complex is rapidly internalized and then is either recycled back to the plasma membrane or sent to lysosomes for degradation. Although most of the receptor is recycled or degraded, a small amount may escape this pathway and migrate to the nucleus of the cell where it might be important in promulgation of receptor signals. In this study we explored the mechanism by which insulin induces IR translocation to the cell nucleus. Experiments were performed cultured L6 myoblasts, AML liver cells and 3T3-L1 adipocytes. Insulin treatment induced a rapid increase in nuclear IR protein levels within 2 to 5 min. Treatment with WGA, an inhibitor of nuclear import, reduced insulin-induced increases nuclear IR protein; IR was, however, translocated to a perinuclear location. Bioinformatics tools predicted a potential nuclear localization sequence (NLS) on IR. Immunofluorescence staining showed that a point mutation on the predicted NLS blocked insulin-induced IR nuclear translocation. In addition, blockade of nuclear IR activation in isolated nuclei by an IR blocking antibody abrogated insulin-induced increases in IR tyrosine phosphorylation and nuclear PKCδ levels. Furthermore, over expression of mutated IR reduced insulin-induced glucose uptake and PKB phosphorylation. When added to isolated nuclei, insulin induced IR phosphorylation but had no effect on nuclear IR protein levels. These results raise questions regarding the possible role of nuclear IR in IR signaling and insulin resistance. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Nuclear Import and Export of the Thyroid Hormone Receptor.

    PubMed

    Zhang, Jibo; Roggero, Vincent R; Allison, Lizabeth A

    2018-01-01

    The thyroid hormone receptors, TRα1 and TRβ1, are members of the nuclear receptor superfamily that forms one of the most abundant classes of transcription factors in multicellular organisms. Although primarily localized to the nucleus, TRα1 and TRβ1 shuttle rapidly between the nucleus and cytoplasm. The fine balance between nuclear import and export of TRs has emerged as a critical control point for modulating thyroid hormone-responsive gene expression. Mutagenesis studies have defined two nuclear localization signal (NLS) motifs that direct nuclear import of TRα1: NLS-1 in the hinge domain and NLS-2 in the N-terminal A/B domain. Three nuclear export signal (NES) motifs reside in the ligand-binding domain. A combined approach of shRNA-mediated knockdown and coimmunoprecipitation assays revealed that nuclear entry of TRα1 is facilitated by importin 7, likely through interactions with NLS-2, and importin β1 and the adapter importin α1 interacting with both NLS-1 and NLS-2. Interestingly, TRβ1 lacks NLS-2 and nuclear import depends solely on the importin α1/β1 heterodimer. Heterokaryon and fluorescence recovery after photobleaching shuttling assays identified multiple exportins that play a role in nuclear export of TRα1, including CRM1 (exportin 1), and exportins 4, 5, and 7. Even single amino acid changes in TRs dramatically alter their intracellular distribution patterns. We conclude that mutations within NLS and NES motifs affect nuclear shuttling activity, and propose that TR mislocalization contributes to the development of some types of cancer and Resistance to Thyroid Hormone syndrome. © 2018 Elsevier Inc. All rights reserved.

  18. Mapping the nuclear localization signal in the matrix protein of potato yellow dwarf virus.

    PubMed

    Anderson, Gavin; Jang, Chanyong; Wang, Renyuan; Goodin, Michael

    2018-05-01

    The ability of the matrix (M) protein of potato yellow dwarf virus (PYDV) to remodel nuclear membranes is controlled by a di-leucine motif located at residues 223 and 224 of its primary structure. This function can be uncoupled from that of its nuclear localization signal (NLS), which is controlled primarily by lysine and arginine residues immediately downstream of the LL motif. In planta localization of green fluorescent protein fusions, bimolecular fluorescence complementation assays with nuclear import receptor importin-α1 and yeast-based nuclear import assays provided three independent experimental approaches to validate the authenticity of the M-NLS. The carboxy terminus of M is predicted to contain a nuclear export signal, which is belived to be functional, given the ability of M to bind the Arabidopsis nuclear export receptor 1 (XPO1). The nuclear shuttle activity of M has implications for the cell-to-cell movement of PYDV nucleocapsids, based upon its interaction with the N and Y proteins.

  19. Dose-response approaches for nuclear receptor-mediated ...

    EPA Pesticide Factsheets

    A public workshop, organized by a Steering Committee of scientists from government, industry, universities, and research organizations, was held at the National Institute of Environmental Health Sciences (NIEHS) in September, 2010. The workshop explored the dose-response implications of toxicant modes of action (MOA) mediated by nuclear receptors. The dominant paradigm in human health risk assessment has been linear extrapolation without a threshold for cancer, and estimation of sub-threshold doses for non-cancer and (in appropriate cases) cancer endpoints. However, recent publications question the application of dose-response modeling approaches with a threshold. The growing body of molecular toxicology information and computational toxicology tools has allowed for exploration of the presence or absence of subthreshold doses for a number of receptor-mediated MOPs. The workshop explored the development of dose-response approaches for nuclear receptor-mediated liver cancer, within a MOA Human Relevance framework (HRF). Case studies addressed activation of the AHR; the CAR/PXR, and the PPARa. This paper describes the workshop process, key issues discussed, and conclusions. The value of an interactive workshop approach to apply current MOA/HRF frameworks was demonstrated. The results may help direct research on the MOA and dose-response of receptor-based toxicity, since there are commonalities for many receptors in the basic pathways involved for late steps in the

  20. Crosstalk between ERK2 and RXR regulates nuclear import of transcription factor NGFI-B

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jacobs, Chris M.; Paulsen, Ragnhild E.

    2005-10-21

    Transcription factor NGFI-B initiates apoptosis when allowed to translocate to mitochondria. Retinoid-X receptor (RXR), another member of the nuclear receptor family, regulates NGFI-B signaling through heterodimerization and nuclear export. Growth factor EGF activates ERK2, which phosphorylates NGFI-B and determines if NGFI-B is allowed to translocate to mitochondria. In the present study, EGF treatment resulted in an increased nuclear import of NGFI-B. Likewise, active ERK2 resulted in a preferential nuclear localization of NGFI-B. When coexpressed with RXR the nuclear import and nuclear localization induced by active ERK2 were strongly reduced. In the presence of its ligand 9-cis-retinoic acid, RXR no longermore » inhibited ERK2-induced nuclear import. Thus, RXR serves a permissive role for ERK2-mediated nuclear accumulation of NGFI-B. This finding represents a novel crosstalk between ERK2 and RXR signaling pathways, and explains how two independent inhibitors of apoptosis (EGF and 9-cis-retinoic acid) may cooperate to regulate nuclear targeting of apoptosis inducer NGFI-B.« less

  1. Human peroxisome proliferator-activated receptor mRNA and protein expression during development

    EPA Science Inventory

    The peroxisome proliferator-activated receptors (PPAR) are nuclear hormone receptors that regulate lipid and glucose homeostasis and are important in reproduction and development. PPARs are targets ofpharmaceuticals and are also activated by environmental contaminants, including ...

  2. Toll-like receptor 4 promotes proliferation and apoptosis resistance in human papillomavirus-related cervical cancer cells through the Toll-like receptor 4/nuclear factor-κB pathway.

    PubMed

    Jiang, Ninghong; Xie, Feng; Guo, Qisang; Li, Ming-Qing; Xiao, Jingjing; Sui, Long

    2017-06-01

    Toll-like receptor 4 is overexpressed in various tumors, including cervical carcinoma. However, the role of Toll-like receptor 4 in cervical cancer remains controversial, and the underlying mechanisms are largely elusive. Therefore, Toll-like receptor 4 in cervical cancer and related mechanisms were investigated in this study. Quantitative reverse transcription polymerase chain reaction and western blot analyses were used to detect messenger RNA and protein levels in HeLa, Caski, and C33A cells with different treatments. Proliferation was quantified using Cell Counting Kit-8. Cell cycle distribution and apoptosis were assessed by flow cytometry. Higher levels of Toll-like receptor 4 expression were found in human papillomavirus-positive cells compared to human papillomavirus-negative cells. Proliferation of HeLa and Caski cells was promoted in lipopolysaccharide-stimulated groups but suppressed in short hairpin RNA-transfected groups. Apoptosis rates were lower in lipopolysaccharide-stimulated groups relative to short hairpin RNA-transfected groups. In addition, G2-phase distribution was enhanced when Toll-like receptor 4 was downregulated. Moreover, the pNF-κBp65 level was positively correlated with the Toll-like receptor 4 level in HeLa and Caski cells, though when an nuclear factor-κB inhibitor was applied to lipopolysaccharide-stimulated groups, the patterns of proliferation and apoptosis were opposite to those of the lipopolysaccharide-stimulated groups without inhibitor treatment. In conclusion, these data suggest that Toll-like receptor 4 promotes proliferation and apoptosis resistance in human papillomavirus-related cervical cancer cells at least in part through the Toll-like receptor 4/nuclear factor-κB pathway, which may be correlated with the occurrence and development of cervical carcinoma.

  3. The pure estrogen receptor antagonist ICI 182,780 promotes a novel interaction of estrogen receptor-alpha with the 3',5'-cyclic adenosine monophosphate response element-binding protein-binding protein/p300 coactivators.

    PubMed

    Jaber, Basem M; Gao, Tong; Huang, Luping; Karmakar, Sudipan; Smith, Carolyn L

    2006-11-01

    Estrogen receptor-alpha (ERalpha) is a member of the nuclear receptor superfamily of ligand-activated transcription factors. Abundant evidence demonstrates that ERalpha agonists promote, whereas antagonists inhibit, receptor binding to coactivators. In this report we demonstrate that binding of the ICI 182,780 (ICI) pure antiestrogen to ERalpha promotes its interaction with the cAMP response element-binding protein-binding protein (CBP)/p300 but not the p160 family of coactivators, demonstrating the specificity of this interaction. Amino acid mutations within the coactivator binding surface of the ERalpha ligand-binding domain revealed that CBP binds to this region of the ICI-liganded receptor. The carboxy-terminal cysteine-histidine rich domain 3 of CBP, rather than its amino-terminal nuclear interacting domain, shown previously to mediate agonist-dependent interactions of CBP with nuclear receptors, is required for binding to ICI-liganded ERalpha. Chromatin immunoprecipitation assays revealed that ICI but not the partial agonist/antagonist 4-hydroxytamoxifen is able to recruit CBP to the pS2 promoter, and this distinguishes ICI from this class of antiestrogens. Chromatin immunoprecipitation assays for pS2 and cytochrome P450 1B1 promoter regions revealed that ICI-dependent recruitment of CBP, but not receptor, to ERalpha targets is gene specific. ICI treatment did not recruit the steroid receptor coactivator 1 to the pS2 promoter, and it failed to induce the expression of this gene. Taken together, these data indicate that recruitment of the CBP coactivator/cointegrator without steroid receptor coactivator 1 to ERalpha is insufficient to promote transcription of ERalpha target genes.

  4. HIV-1 and M-PMV RNA Nuclear Export Elements Program Viral Genomes for Distinct Cytoplasmic Trafficking Behaviors.

    PubMed

    Pocock, Ginger M; Becker, Jordan T; Swanson, Chad M; Ahlquist, Paul; Sherer, Nathan M

    2016-04-01

    Retroviruses encode cis-acting RNA nuclear export elements that override nuclear retention of intron-containing viral mRNAs including the full-length, unspliced genomic RNAs (gRNAs) packaged into assembling virions. The HIV-1 Rev-response element (RRE) recruits the cellular nuclear export receptor CRM1 (also known as exportin-1/XPO1) using the viral protein Rev, while simple retroviruses encode constitutive transport elements (CTEs) that directly recruit components of the NXF1(Tap)/NXT1(p15) mRNA nuclear export machinery. How gRNA nuclear export is linked to trafficking machineries in the cytoplasm upstream of virus particle assembly is unknown. Here we used long-term (>24 h), multicolor live cell imaging to directly visualize HIV-1 gRNA nuclear export, translation, cytoplasmic trafficking, and virus particle production in single cells. We show that the HIV-1 RRE regulates unique, en masse, Rev- and CRM1-dependent "burst-like" transitions of mRNAs from the nucleus to flood the cytoplasm in a non-localized fashion. By contrast, the CTE derived from Mason-Pfizer monkey virus (M-PMV) links gRNAs to microtubules in the cytoplasm, driving them to cluster markedly to the centrosome that forms the pericentriolar core of the microtubule-organizing center (MTOC). Adding each export element to selected heterologous mRNAs was sufficient to confer each distinct export behavior, as was directing Rev/CRM1 or NXF1/NXT1 transport modules to mRNAs using a site-specific RNA tethering strategy. Moreover, multiple CTEs per transcript enhanced MTOC targeting, suggesting that a cooperative mechanism links NXF1/NXT1 to microtubules. Combined, these results reveal striking, unexpected features of retroviral gRNA nucleocytoplasmic transport and demonstrate roles for mRNA export elements that extend beyond nuclear pores to impact gRNA distribution in the cytoplasm.

  5. HIV-1 and M-PMV RNA Nuclear Export Elements Program Viral Genomes for Distinct Cytoplasmic Trafficking Behaviors

    PubMed Central

    Pocock, Ginger M.; Becker, Jordan T.; Swanson, Chad M.; Ahlquist, Paul; Sherer, Nathan M.

    2016-01-01

    Retroviruses encode cis-acting RNA nuclear export elements that override nuclear retention of intron-containing viral mRNAs including the full-length, unspliced genomic RNAs (gRNAs) packaged into assembling virions. The HIV-1 Rev-response element (RRE) recruits the cellular nuclear export receptor CRM1 (also known as exportin-1/XPO1) using the viral protein Rev, while simple retroviruses encode constitutive transport elements (CTEs) that directly recruit components of the NXF1(Tap)/NXT1(p15) mRNA nuclear export machinery. How gRNA nuclear export is linked to trafficking machineries in the cytoplasm upstream of virus particle assembly is unknown. Here we used long-term (>24 h), multicolor live cell imaging to directly visualize HIV-1 gRNA nuclear export, translation, cytoplasmic trafficking, and virus particle production in single cells. We show that the HIV-1 RRE regulates unique, en masse, Rev- and CRM1-dependent “burst-like” transitions of mRNAs from the nucleus to flood the cytoplasm in a non-localized fashion. By contrast, the CTE derived from Mason-Pfizer monkey virus (M-PMV) links gRNAs to microtubules in the cytoplasm, driving them to cluster markedly to the centrosome that forms the pericentriolar core of the microtubule-organizing center (MTOC). Adding each export element to selected heterologous mRNAs was sufficient to confer each distinct export behavior, as was directing Rev/CRM1 or NXF1/NXT1 transport modules to mRNAs using a site-specific RNA tethering strategy. Moreover, multiple CTEs per transcript enhanced MTOC targeting, suggesting that a cooperative mechanism links NXF1/NXT1 to microtubules. Combined, these results reveal striking, unexpected features of retroviral gRNA nucleocytoplasmic transport and demonstrate roles for mRNA export elements that extend beyond nuclear pores to impact gRNA distribution in the cytoplasm. PMID:27070420

  6. Proteins and Carbohydrates from Red Seaweeds: Evidence for Beneficial Effects on Gut Function and Microbiota

    PubMed Central

    Cian, Raúl E.; Drago, Silvina R.; Sánchez de Medina, Fermín; Martínez-Augustin, Olga

    2015-01-01

    Based on their composition, marine algae, and namely red seaweeds, are good potential functional foods. Intestinal mucosal barrier function refers to the capacity of the intestine to provide adequate containment of luminal microorganisms and molecules. Here, we will first outline the component of seaweeds and will summarize the effects of these on the regulation of mucosal barrier function. Special attention will be paid to unique components of red seaweeds: proteins and derived peptides (e.g., phycobiliproteins, glycoproteins that contain “cellulose binding domains”, phycolectins and the related mycosporine-like amino acids) together with polysaccharides (e.g., floridean starch and sulfated galactans, such as carrageenans, agarans and “dl-hybrid”) and minerals. These compounds have been shown to exert prebiotic effects, to regulate intestinal epithelial cell, macrophage and lymphocyte proliferation and differentiation and to modulate the immune response. Molecular mechanisms of action of peptides and polysaccharides are starting to be elucidated, and evidence indicating the involvement of epidermal growth factor receptor (EGFR), insulin-like growth factor receptor (IGFR), Toll-like receptors (TLR) and signal transduction pathways mediated by protein kinase B (PKB or AKT), nuclear factor-κB (NF-κB) and mitogen activated protein kinases (MAPK) will also be summarized. The need for further research is clear, but in vivo experiments point to an overall antiinflammatory effect of these algae, indicating that they can reinforce membrane barrier function. PMID:26308006

  7. Characterization of the human peroxisome proliferator activated receptor delta gene and its expression.

    PubMed

    Skogsberg, J; Kannisto, K; Roshani, L; Gagne, E; Hamsten, A; Larsson, C; Ehrenborg, E

    2000-07-01

    Peroxisome proliferator activated receptors (PPARs) are nuclear receptors regulating the expression of genes involved in lipid and glucose metabolism. Three different PPARs; alpha (PPARA), gamma (PPARG) and delta (PPARD) have been characterized and they are distinguished from each other by tissue distribution and cell activation. In this study, the structure and detailed chromosomal localization of the human PPARD gene was determined. Three genomic clones containing the PPARD gene was isolated from a human P1 library. The gene spans approximately 85 kb of DNA and consists of 9 exons and 8 introns with exons ranging in size from 84 bp to 2.3 kb and introns ranging from 180 bp to 50 kb. All splice acceptor and donor sites conform to the consensus sequences including the AG-GT motif. Although PPARD lacks a TATA box, the gene is transcribed from a unique start site located 380 bp upstream of the ATG initiation codon. The 5' and 3' ends were mapped by rapid amplification of cDNA ends and the mRNA size of PPARD based upon the structure of the gene is 3803 bp. In addition, the chromosomal sublocalization of PPARD was determined by radiation hybrid mapping. The PPARD gene is located at 14 cR from the colipase gene and 15 cR from the serine kinase gene at chromosomal region 6p21.2.

  8. Localization, trafficking, and temperature-dependence of the Aequorea green fluorescent protein in cultured vertebrate cells.

    PubMed Central

    Ogawa, H; Inouye, S; Tsuji, F I; Yasuda, K; Umesono, K

    1995-01-01

    The localization, trafficking, and fluorescence of Aequorea green fluorescent protein (GFP) in cultured vertebrate cells transiently transfected with GFP cDNA were studied. Fluorescence of GFP in UV light was found to be strongest when cells were incubated at 30 degrees C but was barely visible at an incubation temperature of 37 degrees C. COS-1 cells, primary chicken embryonic retina cells, and carp epithelial cells were fluorescently labeled under these conditions. GFP was distributed uniformly throughout the cytoplasm and nucleus independent of cell type examined. When GFP was fused to PML protooncogene product, fluorescence was detected in a unique nuclear organelle pattern indistinguishable from that of PML protein, showing the potential use of GFP as a fluorescent tag. To analyze both function and intracellular trafficking of proteins fused to GFP, a GFP-human glucocorticoid receptor fusion construct was prepared. The GFP-human glucocorticoid receptor efficiently transactivated the mouse mammary tumor virus promoter in response to dexamethasone at 30 degrees C but not at 37 degrees C, indicating that temperature is important, even for function of the GFP fusion protein. The dexamethasone-induced translocation of GFP-human glucocorticoid receptor from cytoplasm to nucleus was complete within 15 min; the translocation could be monitored in a single living cell in real time. Images Fig. 1 Fig. 2 Fig. 3 Fig. 5 PMID:8524871

  9. Proteins and Carbohydrates from Red Seaweeds: Evidence for Beneficial Effects on Gut Function and Microbiota.

    PubMed

    Cian, Raúl E; Drago, Silvina R; de Medina, Fermín Sánchez; Martínez-Augustin, Olga

    2015-08-20

    Based on their composition, marine algae, and namely red seaweeds, are good potential functional foods. Intestinal mucosal barrier function refers to the capacity of the intestine to provide adequate containment of luminal microorganisms and molecules. Here, we will first outline the component of seaweeds and will summarize the effects of these on the regulation of mucosal barrier function. Special attention will be paid to unique components of red seaweeds: proteins and derived peptides (e.g., phycobiliproteins, glycoproteins that contain "cellulose binding domains", phycolectins and the related mycosporine-like amino acids) together with polysaccharides (e.g., floridean starch and sulfated galactans, such as carrageenans, agarans and "dl-hybrid") and minerals. These compounds have been shown to exert prebiotic effects, to regulate intestinal epithelial cell, macrophage and lymphocyte proliferation and differentiation and to modulate the immune response. Molecular mechanisms of action of peptides and polysaccharides are starting to be elucidated, and evidence indicating the involvement of epidermal growth factor receptor (EGFR), insulin-like growth factor receptor (IGFR), Toll-like receptors (TLR) and signal transduction pathways mediated by protein kinase B (PKB or AKT), nuclear factor-κB (NF-κB) and mitogen activated protein kinases (MAPK) will also be summarized. The need for further research is clear, but in vivo experiments point to an overall antiinflammatory effect of these algae, indicating that they can reinforce membrane barrier function.

  10. Use of an In Vitro, Nuclear Receptor Assay Panel to Characterize the Endocrine-Disrupting Activity Load of Wastewater Treatment Plant Effluent Extracts

    EPA Science Inventory

    Use of an In Vitro, Nuclear Receptor Assay Panel to Characterize the Endocrine-Disrupting Activity Load of Wastewater Treatment Plant Effluent Extracts Katie B. Paul 1.2, Ruth Marfil-Vega 1 Marc A. Mills3, Steve 0. Simmons2, Vickie S. Wilson4, Kevin M. Crofton2 10ak Rid...

  11. rigor mortis encodes a novel nuclear receptor interacting protein required for ecdysone signaling during Drosophila larval development.

    PubMed

    Gates, Julie; Lam, Geanette; Ortiz, José A; Losson, Régine; Thummel, Carl S

    2004-01-01

    Pulses of the steroid hormone ecdysone trigger the major developmental transitions in Drosophila, including molting and puparium formation. The ecdysone signal is transduced by the EcR/USP nuclear receptor heterodimer that binds to specific response elements in the genome and directly regulates target gene transcription. We describe a novel nuclear receptor interacting protein encoded by rigor mortis (rig) that is required for ecdysone responses during larval development. rig mutants display defects in molting, delayed larval development, larval lethality, duplicated mouth parts, and defects in puparium formation--phenotypes that resemble those seen in EcR, usp, E75A and betaFTZ-F1 mutants. Although the expression of these nuclear receptor genes is essentially normal in rig mutant larvae, the ecdysone-triggered switch in E74 isoform expression is defective. rig encodes a protein with multiple WD-40 repeats and an LXXLL motif, sequences that act as specific protein-protein interaction domains. Consistent with the presence of these elements and the lethal phenotypes of rig mutants, Rig protein interacts with several Drosophila nuclear receptors in GST pull-down experiments, including EcR, USP, DHR3, SVP and betaFTZ-F1. The ligand binding domain of betaFTZ-F1 is sufficient for this interaction, which can occur in an AF-2-independent manner. Antibody stains reveal that Rig protein is present in the brain and imaginal discs of second and third instar larvae, where it is restricted to the cytoplasm. In larval salivary gland and midgut cells, however, Rig shuttles between the cytoplasm and nucleus in a spatially and temporally regulated manner, at times that correlate with the major lethal phase of rig mutants and major switches in ecdysone-regulated gene expression. Taken together, these data indicate that rig exerts essential functions during larval development through gene-specific effects on ecdysone-regulated transcription, most likely as a cofactor for one or more nuclear receptors. Furthermore, the dynamic intracellular redistribution of Rig protein suggests that it may act to refine spatial and temporal responses to ecdysone during development.

  12. Skeletal muscle and nuclear hormone receptors: implications for cardiovascular and metabolic disease.

    PubMed

    Smith, Aaron G; Muscat, George E O

    2005-10-01

    Skeletal muscle is a major mass peripheral tissue that accounts for approximately 40% of the total body mass and a major player in energy balance. It accounts for >30% of energy expenditure, is the primary tissue of insulin stimulated glucose uptake, disposal, and storage. Furthermore, it influences metabolism via modulation of circulating and stored lipid (and cholesterol) flux. Lipid catabolism supplies up to 70% of the energy requirements for resting muscle. However, initial aerobic exercise utilizes stored muscle glycogen but as exercise continues, glucose and stored muscle triglycerides become important energy substrates. Endurance exercise increasingly depends on fatty acid oxidation (and lipid mobilization from other tissues). This underscores the importance of lipid and glucose utilization as an energy source in muscle. Consequently skeletal muscle has a significant role in insulin sensitivity, the blood lipid profile, and obesity. Moreover, caloric excess, obesity and physical inactivity lead to skeletal muscle insulin resistance, a risk factor for the development of type II diabetes. In this context skeletal muscle is an important therapeutic target in the battle against cardiovascular disease, the worlds most serious public health threat. Major risk factors for cardiovascular disease include dyslipidemia, hypertension, obesity, sedentary lifestyle, and diabetes. These risk factors are directly influenced by diet, metabolism and physical activity. Metabolism is largely regulated by nuclear hormone receptors which function as hormone regulated transcription factors that bind DNA and mediate the patho-physiological regulation of gene expression. Metabolism and activity, which directly influence cardiovascular disease risk factors, are primarily driven by skeletal muscle. Recently, many nuclear receptors expressed in skeletal muscle have been shown to improve glucose tolerance, insulin resistance, and dyslipidemia. Skeletal muscle and nuclear receptors are rapidly emerging as critical targets in the battle against cardiovascular disease risk factors. Understanding the function of nuclear receptors in skeletal muscle has enormous pharmacological utility for the treatment of cardiovascular disease. This review focuses on the molecular regulation of metabolism by nuclear receptors in skeletal muscle in the context of dyslipidemia and cardiovascular disease.

  13. A truncated human peroxisome proliferator-activated receptor alpha splice variant with dominant negative activity.

    PubMed

    Gervois, P; Torra, I P; Chinetti, G; Grötzinger, T; Dubois, G; Fruchart, J C; Fruchart-Najib, J; Leitersdorf, E; Staels, B

    1999-09-01

    The peroxisome proliferator-activated receptor alpha (PPARalpha) plays a key role in lipid and lipoprotein metabolism. However, important inter- and intraspecies differences exist in the response to PPARalpha activators. This incited us to screen for PPARalpha variants with different signaling functions. In the present study, using a RT-PCR approach a variant human PPARalpha mRNA species was identified, which lacks the entire exon 6 due to alternative splicing. This deletion leads to the introduction of a premature stop codon, resulting in the formation of a truncated PPARalpha protein (PPARalphatr) lacking part of the hinge region and the entire ligand-binding domain. RNase protection analysis demonstrated that PPARalphatr mRNA is expressed in several human tissues and cells, representing between 20-50% of total PPARalpha mRNA. By contrast, PPARalphatr mRNA could not be detected in rodent tissues. Western blot analysis using PPARalpha-specific antibodies demonstrated the presence of an immunoreactive protein migrating at the size of in vitro produced PPARalphatr protein both in human hepatoma HepG2 cells and in human hepatocytes. Both in the presence or absence of 9-cis-retinoic acid receptor, PPARalphatr did not bind to DNA in gel shift assays. Immunocytochemical analysis of transfected CV-1 cells indicated that, whereas transfected PPARalphawt was mainly nuclear localized, the majority of PPARalphatr resided in the cytoplasm, with presence in the nucleus depending on cell culture conditions. Whereas a chimeric PPARalphatr protein containing a nuclear localization signal cloned at its N-terminal localized into the nucleus and exhibited strong negative activity on PPARalphawt transactivation function, PPARalphatr interfered with PPARalphatr transactivation function only under culture conditions inducing its nuclear localization. Cotransfection of the coactivator CREB-binding protein relieved the transcriptional repression of PPARalphawt by PPARalphatr, suggesting that the dominant negative effect of PPARalphatr might occur through competition for essential coactivators. In addition, PPARalphatr interfered with transcriptional activity of other nuclear receptors such as PPARgamma, hepatic nuclear factor-4, and glucocorticoid receptor-alpha, which share CREB-binding protein/p300 as a coactivator. Thus, we have identified a human PPARalpha splice variant that may negatively interfere with PPARalphawt function. Factors regulating either the ratio of PPARalphawt vs. PPARalphatr mRNA or the nuclear entry of PPARalphatr protein should therefore lead to altered signaling via the PPARalpha and, possibly also, other nuclear receptor pathways.

  14. A calreticulin-dependent nuclear export signal is involved in the regulation of liver receptor homologue-1 protein folding.

    PubMed

    Yang, Feng-Ming; Feng, Shan-Jung; Lai, Tsai-Chun; Hu, Meng-Chun

    2015-10-15

    As an orphan member of the nuclear receptor family, liver receptor homologue-1 (LRH-1) controls a tremendous range of transcriptional programmes that are essential for metabolism and hormone synthesis. Our previous studies have shown that nuclear localization of the LRH-1 protein is mediated by two nuclear localization signals (NLSs) that are karyopherin/importin-dependent. It is unclear whether LRH-1 can be actively exported from the nucleus to the cytoplasm. In the present study, we describe a nuclear export domain containing two leucine-rich motifs [named nuclear export signal (NES)1 and NES2] within the ligand-binding domain (LBD). Mutation of leucine residues in NES1 or NES2 abolished nuclear export, indicating that both NES1 and NES2 motifs are essential for full nuclear export activity. This NES-mediated nuclear export was insensitive to the chromosomal region maintenance 1 (CRM1) inhibitor leptomycin B (LMB) or to CRM1 knockdown. However, knockdown of calreticulin (CRT) prevented NES-mediated nuclear export. Furthermore, our data show that CRT interacts with LRH-1 and is involved in the nuclear export of LRH-1. With full-length LRH-1, mutation of NES1 led to perinuclear accumulation of the mutant protein. Immunofluorescence analysis showed that these perinuclear aggregates were co-localized with the centrosome marker, microtubule-associated protein 1 light chain 3 (LC3), ubiquitin and heat shock protein 70 (Hsp70), indicating that the mutant was misfolded and sequestered into aggresome-like structures via the autophagic clearance pathway. Our study demonstrates for the first time that LRH-1 has a CRT-dependent NES which is not only required for cytoplasmic trafficking, but also essential for correct protein folding to avoid misfolding-induced aggregation. © 2015 Authors; published by Portland Press Limited.

  15. Subcellular localization of estradiol receptor in MCF7 cells studied with nanogold-labelled antibody fragments.

    PubMed

    Kessels, M M; Qualmann, B; Thole, H H; Sierralta, W D

    1998-01-01

    Ultrastructural localization studies of estradiol receptor in hormone-deprived and hormone-stimulated MCF7 cells were done using F(ab') fragments of three different antibodies (#402, 13H2, HT277) covalently linked to nanogold. These ultra-small, non-charged immunoreagents, combined with a size-enlargement by silver enhancement, localized estradiol receptor in both nuclear and cytoplasmic areas of non-stimulated target cells; stimulation with the steroid induced a predominantly nuclear labelling. In the cytoplasm of resting cells, tagging was often observed at or in the proximity of stress fibers. In the nucleus a large proportion of receptor was found inside the nucleolus, specially with the reagent derived from antibody 13H2. We postulate that different accessibilities of receptor epitopes account for the different labelling densities observed at cytoskeletal elements and the nucleoli.

  16. Trichoplax adhaerens reveals a network of nuclear receptors sensitive to 9-cis-retinoic acid at the base of metazoan evolution

    PubMed Central

    Novotný, Jan Philipp; Chughtai, Ahmed Ali; Kostrouchová, Markéta; Kostrouchová, Veronika; Kostrouch, David; Kaššák, Filip; Kaňa, Radek; Schierwater, Bernd; Kostrouchová, Marta

    2017-01-01

    Trichoplax adhaerens, the only known species of Placozoa is likely to be closely related to an early metazoan that preceded branching of Cnidaria and Bilateria. This animal species is surprisingly well adapted to free life in the World Ocean inhabiting tidal costal zones of oceans and seas with warm to moderate temperatures and shallow waters. The genome of T. adhaerens (sp. Grell) includes four nuclear receptors, namely orthologue of RXR (NR2B), HNF4 (NR2A), COUP-TF (NR2F) and ERR (NR3B) that show a high degree of similarity with human orthologues. In the case of RXR, the sequence identity to human RXR alpha reaches 81% in the DNA binding domain and 70% in the ligand binding domain. We show that T. adhaerens RXR (TaRXR) binds 9-cis retinoic acid (9-cis-RA) with high affinity, as well as high specificity and that exposure of T. adhaerens to 9-cis-RA regulates the expression of the putative T. adhaerens orthologue of vertebrate L-malate-NADP+ oxidoreductase (EC 1.1.1.40) which in vertebrates is regulated by a heterodimer of RXR and thyroid hormone receptor. Treatment by 9-cis-RA alters the relative expression profile of T. adhaerens nuclear receptors, suggesting the existence of natural ligands. Keeping with this, algal food composition has a profound effect on T. adhaerens growth and appearance. We show that nanomolar concentrations of 9-cis-RA interfere with T. adhaerens growth response to specific algal food and causes growth arrest. Our results uncover an endocrine-like network of nuclear receptors sensitive to 9-cis-RA in T. adhaerens and support the existence of a ligand-sensitive network of nuclear receptors at the base of metazoan evolution. PMID:28975052

  17. Retrieval of estradiol receptor in paraffin sections of resting porcine uteri by microwave treatment. Immunostaining patterns obtained with different primary antibodies.

    PubMed

    Sierralta, W D; Thole, H H

    1996-05-01

    The unmasking of estradiol receptor in paraffin sections of Bouin's-fixed uterine tissue from ovariectomized gilts was attained with microwave treatment. Immunocytochemistry of the receptor was performed using a polyclonal or five monoclonal antibodies, two of which are commercially available, reacting with different domains of the protein and an amplified-peroxidase system for detection. With five of the antibodies, a predominance of nuclear staining was observed in cells of endometrial glands, while one monoclonal antibody (13H2), reacting with the receptor's domain E, showed a preference for the cytoplasmic receptor. In stroma, all antibodies detected more receptor in nuclei than in cytoplasm. In epithelium, the commercially available antibody H222, our monoclonals 13H2 and HT65, and the polyclonal antibody 402 demonstrated more receptor in cytoplasmic than in nuclear areas. In myometrium, the nuclei from longitudinal and ring muscles were definitely stained with the antibodies. We conclude that the accessibilities of the antibody epitopes of the receptor differ according to the functional uterine cell type.

  18. Cooperative Dynamics of AR and ER Activity in Breast Cancer

    PubMed Central

    D’Amato, Nicholas C.; Gordon, Michael A.; Babbs, Beatrice L.; Spoelstra, Nicole S.; Carson Butterfield, Kiel T.; Torkko, Kathleen C.; Phan, Vernon T.; Barton, Valerie N.; Rogers, Thomas J.; Sartorius, Carol A; Elias, Anthony D.; Gertz, Jason; Jacobsen, Britta M.; Richer, Jennifer K.

    2016-01-01

    Androgen receptor (AR) is expressed in 90% of estrogen receptor alpha positive (ER+) breast tumors, but its role in tumor growth and progression remains controversial. Use of two anti-androgens that inhibit AR nuclear localization, enzalutamide and MJC13, revealed that AR is required for maximum ER genomic binding. Here, a novel global examination of AR chromatin binding found that estradiol induced AR binding at unique sites compared to dihydrotestosterone (DHT). Estradiol-induced AR binding sites were enriched for estrogen response elements and had significant overlap with ER binding sites. Furthermore, AR inhibition reduced baseline and estradiol-mediated proliferation in multiple ER+/AR+ breast cancer cell lines, and synergized with tamoxifen and fulvestrant. In vivo, enzalutamide significantly reduced viability of tamoxifen-resistant MCF7 xenograft tumors and an ER+/AR+ patient-derived model. Enzalutamide also reduced metastatic burden following cardiac injection. Lastly, in a comparison of ER+/AR+ primary tumors versus patient-matched local recurrences or distant metastases, AR expression was often maintained even when ER was reduced or absent. These data provide pre-clinical evidence that anti-androgens that inhibit AR nuclear localization affect both AR and ER, and are effective in combination with current breast cancer therapies. In addition, single agent efficacy may be possible in tumors resistant to traditional endocrine therapy, since clinical specimens of recurrent disease demonstrate AR expression in tumors with absent or refractory ER. Implications This study suggests that AR plays a previously-unrecognized role in supporting E2-mediated ER activity in ER+/AR+ breast cancer cells, and that enzalutamide may be an effective therapeutic in ER+/AR+ breast cancers. PMID:27565181

  19. The spatial patterning of mouse cone opsin expression is regulated by BMP signaling through downstream effector COUP-TF nuclear receptors

    PubMed Central

    Satoh, Shinya; Tang, Ke; Iida, Atsumi; Inoue, Mariko; Kodama, Tatsuhiko; Tsai, Sophia Y.; Tsai, Ming-Jer; Furuta, Yasuhide; Watanabe, Sumiko

    2009-01-01

    Cone photopigments, known as opsins, are pivotal elements and the first detection module employed in color vision. In mice, cone photoreceptors are distributed throughout the retina, and S- and M-opsins have unique expression patterns in the retina with a gradient along the dorsoventral axis; however, the mechanisms regulating the spatial patterning of cone opsin expression have not been well documented. The purpose of this study was to define the mechanisms regulating the spatial patterning of cone opsin expression. By analyzing knockouts for bone morphogenetic protein (BMP) signaling, we found an essential role for BMP in forming cone opsin expression patterns in the retina; however, BMP signaling is activated only transiently in the dorsal half of the retina during early retinal development. Thus, BMP is not likely to play a direct role in opsin gene expression, which starts at a later stage of retinal development. We identified the chicken ovalbumin upstream promoter-transcription factor (COUP-TF) nuclear receptor as a link between BMP and opsin expression. BMP signaling is essential for the correct dorsoventral spatial expression of COUP-TFI and -TFII. Through gain- and loss-of-function analyses, we found that both COUP-TFI and -TFII are required to suppress S-opsin expression in the dorsal retina but that only COUP-TFI plays an essential role in suppressing M-opsin expression in the ventral retina. Based on these findings, we propose a new molecular cascade involving BMP and COUP-TFs that conveys dorsoventral information to direct the expression of cone opsins during retinal development. PMID:19812316

  20. Expression profiling of nuclear receptors in breast cancer identifies TLX as a mediator of growth and invasion in triple-negative breast cancer.

    PubMed

    Lin, Meng-Lay; Patel, Hetal; Remenyi, Judit; Banerji, Christopher R S; Lai, Chun-Fui; Periyasamy, Manikandan; Lombardo, Ylenia; Busonero, Claudia; Ottaviani, Silvia; Passey, Alun; Quinlan, Philip R; Purdie, Colin A; Jordan, Lee B; Thompson, Alastair M; Finn, Richard S; Rueda, Oscar M; Caldas, Carlos; Gil, Jesus; Coombes, R Charles; Fuller-Pace, Frances V; Teschendorff, Andrew E; Buluwela, Laki; Ali, Simak

    2015-08-28

    The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other NR and there is evidence that ERα function may be recapitulated by other NRs in ERα-negative breast cancer. In order to examine the inter-relationships between nuclear receptors, and to obtain evidence for previously unsuspected roles for any NRs, we undertook quantitative RT-PCR and bioinformatics analysis to examine their expression in breast cancer. While most NRs were expressed, bioinformatic analyses differentiated tumours into distinct prognostic groups that were validated by analyzing public microarray data sets. Although ERα and progesterone receptor were dominant in distinguishing prognostic groups, other NR strengthened these groups. Clustering analysis identified several family members with potential importance in breast cancer. Specifically, RORγ is identified as being co-expressed with ERα, whilst several NRs are preferentially expressed in ERα-negative disease, with TLX expression being prognostic in this subtype. Functional studies demonstrated the importance of TLX in regulating growth and invasion in ERα-negative breast cancer cells.

  1. Controlling Nuclear Jaks and Stats for Specific Gene Activation by Ifn γ and Other Cytokines: A Possible Steroid-like Connection

    PubMed Central

    Johnson, Howard M.; Noon-Song, Ezra; Ahmed, Chulbul M.

    2011-01-01

    The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation. PMID:22924155

  2. Controlling Nuclear Jaks and Stats for Specific Gene Activation by Ifn γ and Other Cytokines: A Possible Steroid-like Connection.

    PubMed

    Johnson, Howard M; Noon-Song, Ezra; Ahmed, Chulbul M

    2011-09-03

    The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation.

  3. Glucocorticoid receptor interacts with PNRC2 in a ligand-dependent manner to recruit UPF1 for rapid mRNA degradation.

    PubMed

    Cho, Hana; Park, Ok Hyun; Park, Joori; Ryu, Incheol; Kim, Jeonghan; Ko, Jesang; Kim, Yoon Ki

    2015-03-31

    Glucocorticoid receptor (GR), which was originally known to function as a nuclear receptor, plays a role in rapid mRNA degradation by acting as an RNA-binding protein. The mechanism by which this process occurs remains unknown. Here, we demonstrate that GR, preloaded onto the 5'UTR of a target mRNA, recruits UPF1 through proline-rich nuclear receptor coregulatory protein 2 (PNRC2) in a ligand-dependent manner, so as to elicit rapid mRNA degradation. We call this process GR-mediated mRNA decay (GMD). Although GMD, nonsense-mediated mRNA decay (NMD), and staufen-mediated mRNA decay (SMD) share upstream frameshift 1 (UPF1) and PNRC2, we find that GMD is mechanistically distinct from NMD and SMD. We also identify de novo cellular GMD substrates using microarray analysis. Intriguingly, GMD functions in the chemotaxis of human monocytes by targeting chemokine (C-C motif) ligand 2 (CCL2) mRNA. Thus, our data provide molecular evidence of a posttranscriptional role of the well-studied nuclear hormone receptor, GR, which is traditionally considered a transcription factor.

  4. Nutrient-sensing nuclear receptors PPARα and FXR control liver energy balance.

    PubMed

    Preidis, Geoffrey A; Kim, Kang Ho; Moore, David D

    2017-04-03

    The nuclear receptors PPARα (encoded by NR1C1) and farnesoid X receptor (FXR, encoded by NR1H4) are activated in the liver in the fasted and fed state, respectively. PPARα activation induces fatty acid oxidation, while FXR controls bile acid homeostasis, but both nuclear receptors also regulate numerous other metabolic pathways relevant to liver energy balance. Here we review evidence that they function coordinately to control key nutrient pathways, including fatty acid oxidation and gluconeogenesis in the fasted state and lipogenesis and glycolysis in the fed state. We have also recently reported that these receptors have mutually antagonistic impacts on autophagy, which is induced by PPARα but suppressed by FXR. Secretion of multiple blood proteins is a major drain on liver energy and nutrient resources, and we present preliminary evidence that the liver secretome may be directly suppressed by PPARα, but induced by FXR. Finally, previous studies demonstrated a striking deficiency in bile acid levels in malnourished mice that is consistent with results in malnourished children. We present evidence that hepatic targets of PPARα and FXR are dysregulated in chronic undernutrition. We conclude that PPARα and FXR function coordinately to integrate liver energy balance.

  5. Nuclear Receptor Signaling Atlas: Opening Access to the Biology of Nuclear Receptor Signaling Pathways

    PubMed Central

    Becnel, Lauren B.; Darlington, Yolanda F.; Ochsner, Scott A.; Easton-Marks, Jeremy R.; Watkins, Christopher M.; McOwiti, Apollo; Kankanamge, Wasula H.; Wise, Michael W.; DeHart, Michael; Margolis, Ronald N.; McKenna, Neil J.

    2015-01-01

    Signaling pathways involving nuclear receptors (NRs), their ligands and coregulators, regulate tissue-specific transcriptomes in diverse processes, including development, metabolism, reproduction, the immune response and neuronal function, as well as in their associated pathologies. The Nuclear Receptor Signaling Atlas (NURSA) is a Consortium focused around a Hub website (www.nursa.org) that annotates and integrates diverse ‘omics datasets originating from the published literature and NURSA-funded Data Source Projects (NDSPs). These datasets are then exposed to the scientific community on an Open Access basis through user-friendly data browsing and search interfaces. Here, we describe the redesign of the Hub, version 3.0, to deploy “Web 2.0” technologies and add richer, more diverse content. The Molecule Pages, which aggregate information relevant to NR signaling pathways from myriad external databases, have been enhanced to include resources for basic scientists, such as post-translational modification sites and targeting miRNAs, and for clinicians, such as clinical trials. A portal to NURSA’s Open Access, PubMed-indexed journal Nuclear Receptor Signaling has been added to facilitate manuscript submissions. Datasets and information on reagents generated by NDSPs are available, as is information concerning periodic new NDSP funding solicitations. Finally, the new website integrates the Transcriptomine analysis tool, which allows for mining of millions of richly annotated public transcriptomic data points in the field, providing an environment for dataset re-use and citation, bench data validation and hypothesis generation. We anticipate that this new release of the NURSA database will have tangible, long term benefits for both basic and clinical research in this field. PMID:26325041

  6. Rho-kinase signaling controls nucleocytoplasmic shuttling of class IIa Histone Deacetylase (HDAC7) and transcriptional activation of orphan nuclear receptor NR4A1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Compagnucci, Claudia; Barresi, Sabina; Petrini, Stefania

    2015-04-03

    Rho-kinase (ROCK) has been well documented to play a key role in RhoA-induced actin remodeling. ROCK activation results in myosin light chain (MLC) phosphorylation either by direct action on MLC kinase (MLCK) or by inhibition of MLC phosphatase (MLCP), modulating actin–myosin contraction. We found that inhibition of the ROCK pathway in induced pluripotent stem cells, leads to nuclear export of HDAC7 and transcriptional activation of the orphan nuclear receptor NR4A1 while in cells with constitutive ROCK hyperactivity due to loss of function of the RhoGTPase activating protein Oligophrenin-1 (OPHN1), the orphan nuclear receptor NR4A1 is downregulated. Our study identify amore » new target of ROCK signaling via myosin phosphatase subunit (MYPT1) and Histone Deacetylase (HDAC7) at the nuclear level and provide new insights in the cellular functions of ROCK. - Highlights: • ROCK regulates nucleocytoplasmic shuttling of HDAC7 via phosphorylation of MYPT1. • Nuclear export of HDAC7 and upregulation of NR4A1 occurs with low ROCK activity. • High levels of ROCK activity due to OPHN1 loss of function downregulate NR4A1.« less

  7. Surface localization of the nuclear receptor CAR in influenza A virus-infected cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takahashi, Tadanobu; Department of Biochemistry, School of Pharmaceutical Sciences, University of Shizuoka, CREST, JST, and COE Program in the 21st Century, Shizuoka 422-8526; Moriyama, Yusuke

    Constitutive active/androstane receptor CAR is a member of the nuclear receptors which regulate transcription of xenobiotic metabolism enzymes. CAR is usually localized in the cytosol and nucleus. Here, we found that CAR was localized at the cell surface of influenza A virus (IAV)-infected cells. Additionally, we demonstrated that expression of a viral envelope glycoprotein, either hemagglutinin (HA) or neuraminidase (NA), but not viral nucleoprotein (NP), was responsible for this localization. This report is the first demonstration of CAR at the surface of tissue culture cells, and suggests that CAR may exert the IAV infection mechanism.

  8. Nuclear Receptor Rev-erb Alpha (Nr1d1) Functions in Concert with Nr2e3 to Regulate Transcriptional Networks in the Retina

    PubMed Central

    Mollema, Nissa J.; Yuan, Yang; Jelcick, Austin S.; Sachs, Andrew J.; von Alpen, Désirée; Schorderet, Daniel; Escher, Pascal; Haider, Neena B.

    2011-01-01

    The majority of diseases in the retina are caused by genetic mutations affecting the development and function of photoreceptor cells. The transcriptional networks directing these processes are regulated by genes such as nuclear hormone receptors. The nuclear hormone receptor gene Rev-erb alpha/Nr1d1 has been widely studied for its role in the circadian cycle and cell metabolism, however its role in the retina is unknown. In order to understand the role of Rev-erb alpha/Nr1d1 in the retina, we evaluated the effects of loss of Nr1d1 to the developing retina and its co-regulation with the photoreceptor-specific nuclear receptor gene Nr2e3 in the developing and mature retina. Knock-down of Nr1d1 expression in the developing retina results in pan-retinal spotting and reduced retinal function by electroretinogram. Our studies show that NR1D1 protein is co-expressed with NR2E3 in the outer neuroblastic layer of the developing mouse retina. In the adult retina, NR1D1 is expressed in the ganglion cell layer and is co-expressed with NR2E3 in the outer nuclear layer, within rods and cones. Several genes co-targeted by NR2E3 and NR1D1 were identified that include: Nr2c1, Recoverin, Rgr, Rarres2, Pde8a, and Nupr1. We examined the cyclic expression of Nr1d1 and Nr2e3 over a twenty-four hour period and observed that both nuclear receptors cycle in a similar manner. Taken together, these studies reveal a novel role for Nr1d1, in conjunction with its cofactor Nr2e3, in regulating transcriptional networks critical for photoreceptor development and function. PMID:21408158

  9. Retinoid Pathway and Cancer Therapeutics

    PubMed Central

    Bushue, Nathan; Wan, Yu-Jui Yvonne

    2010-01-01

    The retinoids are a class of compounds that are structurally related to vitamin A. Retinoic acid, which is the active metabolite of retinol, regulates a wide range of biological processes including development, differentiation, proliferation, and apoptosis. Retinoids exert their effects through a variety of binding proteins including cellular retinol binding protein (CRBP), retinol-binding proteins (RBP), cellular retinoic acid-binding protein (CRABP), and nuclear receptors i.e. retinoic acid receptor (RAR) and retinoid × receptor (RXR). Because of the pleiotropic effects of retinoids, understanding the function of these binding proteins and nuclear receptors assists us in developing compounds that have specific effects. This review summarizes our current understanding of how retinoids are processed and act with the emphasis on the application of retinoids in cancer treatment and prevention. PMID:20654663

  10. A nuclear-receptor-dependent phosphatidylcholine pathway with antidiabetic effects.

    PubMed

    Lee, Jae Man; Lee, Yoon Kwang; Mamrosh, Jennifer L; Busby, Scott A; Griffin, Patrick R; Pathak, Manish C; Ortlund, Eric A; Moore, David D

    2011-05-25

    Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (also known as NR5A2) regulates bile acid biosynthesis. Structural studies have identified phospholipids as potential LRH-1 ligands, but their functional relevance is unclear. Here we show that an unusual phosphatidylcholine species with two saturated 12 carbon fatty acid acyl side chains (dilauroyl phosphatidylcholine (DLPC)) is an LRH-1 agonist ligand in vitro. DLPC treatment induces bile acid biosynthetic enzymes in mouse liver, increases bile acid levels, and lowers hepatic triglycerides and serum glucose. DLPC treatment also decreases hepatic steatosis and improves glucose homeostasis in two mouse models of insulin resistance. Both the antidiabetic and lipotropic effects are lost in liver-specific Lrh-1 knockouts. These findings identify an LRH-1 dependent phosphatidylcholine signalling pathway that regulates bile acid metabolism and glucose homeostasis.

  11. Identification of Estrogen-Related Receptor α Agonists in the Tox21 Compound Library.

    PubMed

    Lynch, Caitlin; Zhao, Jinghua; Huang, Ruili; Kanaya, Noriko; Bernal, Lauren; Hsieh, Jui-Hua; Auerbach, Scott S; Witt, Kristine L; Merrick, B Alex; Chen, Shiuan; Teng, Christina T; Xia, Menghang

    2018-02-01

    The estrogen-related receptor α (ERRα) is an orphan nuclear receptor (NR) that plays a role in energy homeostasis and controls mitochondrial oxidative respiration. Increased expression of ERRα in certain ovarian, breast, and colon cancers has a negative prognosis, indicating an important role for ERRα in cancer progression. An interaction between ERRα and peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α) has also recently been shown to regulate an enzyme in the β-oxidation of free fatty acids, thereby suggesting that ERRα plays an important role in obesity and type 2 diabetes. Therefore, it would be prudent to identify compounds that can act as activators of ERRα. In this study, we screened ∼10,000 (8311 unique) compounds, known as the Tox21 10K collection, to identify agonists of ERRα. We performed this screen using two stably transfected HEK 293 cell lines, one with the ERRα-reporter alone and the other with both ERRα-reporter and PGC-1α expression vectors. After the primary screening, we identified more than five agonist clusters based on compound structural similarity analysis (e.g., statins). By examining the activities of the confirmed ERRα modulators in other Tox21 NR assays, eliminating those with promiscuous NR activity, and performing follow-up assays (e.g., small interfering RNA knockdown), we identified compounds that might act as endocrine disrupters through effects on ERRα signaling. To our knowledge, this study is the first comprehensive analysis in discovering potential endocrine disrupters that affect the ERRα signaling pathway. Copyright © 2018 Endocrine Society.

  12. A Multi-Receptor and Multi-Species Assay for Potential Endocrine Disruptor Targets (SLAS meeting)

    EPA Science Inventory

    Screening methods for detecting potential endocrine disrupting chemicals rely chiefly on transactivation assays targeting nuclear receptors such as the estrogen (ER) and androgen receptors (AR). These assays are predominately human-based; yet environmental exposure can affect div...

  13. The antidepressant fluoxetine normalizes the nuclear glucocorticoid receptor evoked by psychosocial stress

    NASA Astrophysics Data System (ADS)

    Mitić, M.; Simić, I.; Djordjević, J.; Radojčić, M. B.; Adžić, M.

    2011-12-01

    Dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis has been implicated in the pathophysiology of depression and stress disorders. Glucocorticoids, key regulators of the stress response, exert diverse effects on cellular processes in the hippocampus. Beside non-genomic pathways, glucocorticoid effects are mediated through activation of the glucocorticoid receptor (GR), a ligand activated transcriptional factor that belongs to the nuclear hormone receptor superfamily. We analysed the GR protein levels both in the cytoplasmic and nuclear compartments of the hippocampus of Wistar rats exposed to chronic psychosocial isolation stress upon chronic fluoxetine (FLU) treatment. Under chronic stress, corticosterone levels (CORT) were decreased compared to the control, and treatment with FLU did not change its level in the stressed rats. At the molecular level, FLU normalized the level of nuclear GR protein in the hippocampus of the stressed rats. Discrepancy between normalization of nuclear GR in the hippocampus and lack of normalization of HPA axis activity judged by CORT, suggests that other brain structures such as the amygdale and prefrontal cortex that also regulate HPA axis activity, seem not to be normalized by the FLU treatment used in our study.

  14. Nebraska Prostate Cancer Research Program

    DTIC Science & Technology

    2012-05-01

    Powell. (2012). Dioxin exposure enhances nuclear localization of androgen receptor. The 8th Annual National Symposium on Prostate Cancer by CCRTD...cholesterol. Mol . Cellu. Endo. 295:115-120. 2. Siegel, R., Naishadham, D., and Jemal, A. (2012). Cancer Statistics, 2012. CA Cancer J Clin 62: 10-29...Ul DIOXIN J!1XPOSURE EN CES NUCLEAR LOCALIZATION OF ANDROGEN RECEPTOR\\~f..aTayia Aaron, nd Joann Powell, Center for Cancer Research and Therapeutic

  15. Targeting Nuclear EGFR: Strategies for Improving Cetuximab Therapy in Lung Cancer

    DTIC Science & Technology

    2014-09-01

    Triple - negative breast cancer Mol Cancer Ther. 2014 May;13(5):1356-68. PMID: 24634415, PMCID: PMC4013210 6. Brand, TM, Iida, M...Receptor Is a Functional Molecular Target in Triple - Negative Breast Cancer . Molecular cancer therapeutics (2014). 11 26. Iida, M., Brand, T.M...2014). Brand, T.M., et al. Nuclear epidermal growth factor receptor is a functional molecular target in triple - negative breast cancer .

  16. Role of osteoprotegerin/receptor activator of nuclear factor kappa B/receptor activator of nuclear factor kappa B ligand axis in nonalcoholic fatty liver disease.

    PubMed

    Pacifico, Lucia; Andreoli, Gian Marco; D'Avanzo, Miriam; De Mitri, Delia; Pierimarchi, Pasquale

    2018-05-21

    Concomitantly with the increase in the prevalences of overweight/obesity, nonalcoholic fatty liver disease (NAFLD) has worldwide become the main cause of chronic liver disease in both adults and children. Patients with fatty liver display features of metabolic syndrome (MetS), like insulin resistance (IR), glucose intolerance, hypertension and dyslipidemia. Recently, epidemiological studies have linked obesity, MetS, and NAFLD to decreased bone mineral density and osteoporosis, highlighting an intricate interplay among bone, adipose tissue, and liver. Osteoprotegerin (OPG), an important symbol of the receptor activator of nuclear factor-B ligand/receptor activator of nuclear factor kappa B/OPG system activation, typically considered for its role in bone metabolism, may also play critical roles in the initiation and perpetuation of obesity-related comorbidities. Clinical data have indicated that OPG concentrations are associated with hypertension, left ventricular hypertrophy, vascular calcification, endothelial dysfunction, and severity of liver damage in chronic hepatitis C. Nonetheless, the relationship between circulating OPG and IR as a key feature of MetS as well as between OPG and NAFLD remains uncertain. Thus, the aims of the present review are to provide the existent knowledge on these associations and to discuss briefly the underlying mechanisms linking OPG and NAFLD.

  17. Liver X receptors interfere with the deleterious effect of diethylstilbestrol on testicular physiology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oumeddour, Abdelkader; CNRS, UMR 6293, GReD, F-63171 Aubiere; INSERM, UMR 1103, GReD, F-63171 Aubiere

    Highlights: • Part of the neonatal effect of DES on testis needs the presence of Lxrα/β. • Some DES-induced pathways are blocked in Lxr-deficient mice. • Lxr-deficient mice analysis defines DES-target genes protected by Lxr. - Abstract: Liver X receptors LXRα (NR1H3) and LXRβ (NR1H2) are transcription factors belonging to the nuclear receptor superfamily, activated by specific oxysterols, oxidized derivatives of cholesterol. These receptors are involved in the regulation of testis physiology. Lxr-deficient mice pointed to the physiological roles of these nuclear receptors in steroid synthesis, lipid homeostasis and germ cell apoptosis and proliferation. Diethylstilbestrol (DES) is a synthetic estrogenmore » considered as an endocrine disruptor that affects the functions of the testis. Various lines of evidences have made a clear link between estrogens, their nuclear receptors ERα (NR3A1) and ERβ (NR3A2), and Lxrα/β. As LXR activity could also be regulated by the nuclear receptor small heterodimer partner (SHP, NR0A2) and DES could act through SHP, we wondered whether LXR could be targeted by estrogen-like endocrine disruptors such as DES. For that purpose, wild-type and Lxr-deficient mice were daily treated with 0.75 μg DES from days 1 to 5 after birth. The effects of DES were investigated at 10 or 45 days of age. We demonstrated that DES induced a decrease of the body mass at 10 days only in the Lxr-deficient mice suggesting a protective effect of Lxr. We defined three categories of DES-target genes in testis: those whose accumulation is independent of Lxr; those whose accumulation is enhanced by the lack of both Lxrα/β; those whose accumulation is repressed by the absence of Lxrα/β. Lipid accumulation is also modified by neonatal DES injection. Lxr-deficient mice present different lipid profiles, demonstrating that DES could have its effects in part due to Lxrα/β. Altogether, our study shows that both nuclear receptors Lxrα and Lxrβ are not only basally important for testicular physiology but could also have a preventive effect against estrogen-like endocrine disruptors.« less

  18. API2-MALT1 oncoprotein promotes lymphomagenesis via unique program of substrate ubiquitination and proteolysis

    PubMed Central

    Rosebeck, Shaun; Lim, Megan S; Elenitoba-Johnson, Kojo S J; McAllister-Lucas, Linda M; Lucas, Peter C

    2016-01-01

    Lymphoma of mucosa-associated lymphoid tissue (MALT lymphoma) is the most common extranodal B cell tumor and accounts for 8% of non-Hodgkin’s lymphomas. Gastric MALT lymphoma is the best-studied example and is a prototypical neoplasm that occurs in the setting of chronic inflammation brought on by persistent infection or autoimmune disease. Cytogenetic abnormalities are commonly acquired during the course of disease and the most common is chromosomal translocation t(11;18)(q21;q21), which creates the API2-MALT1 fusion oncoprotein. t(11;18)-positive lymphomas can be clinically aggressive and have a higher rate of dissemination than t(11;18)-negative tumors. Many cancers, including MALT lymphomas, characteristically exhibit deregulated over-activation of cellular survival pathways, such as the nuclear factor-κB (NF-κB) pathway. Molecular characterization of API2-MALT1 has revealed it to be a potent activator of NF-κB, which is required for API2-MALT1-induced cellular transformation, however the mechanisms by which API2-MALT1 exerts these effects are only recently becoming apparent. The API2 moiety of the fusion binds tumor necrosis factor (TNF) receptor associated factor (TRAF) 2 and receptor interacting protein 1 (RIP1), two proteins essential for TNF receptor-induced NF-κB activation. By effectively mimicking ligand-bound TNF receptor, API2-MALT1 promotes TRAF2-dependent ubiquitination of RIP1, which then acts as a scaffold for nucleating and activating the canonical NF-κB machinery. Activation occurs, in part, through MALT1 moiety-dependent recruitment of TRAF6, which can directly modify NF-κB essential modulator, the principal downstream regulator of NF-κB. While the intrinsic MALT1 protease catalytic activity is dispensable for this canonical NF-κB signaling, it is critical for non-canonical NF-κB activation. In this regard, API2-MALT1 recognizes NF-κB inducing kinase (NIK), the essential upstream regulator of non-canonical NF-κB, and cleaves it to generate a stable, constitutively active fragment. Thus, API2-MALT1 harnesses multiple unique pathways to achieve deregulated NF-κB activation. Emerging data from our group and others have also detailed additional gain-of-function activities of API2-MALT1 that extend beyond NF-κB activation. Specifically, API2-MALT1 recruits and subverts multiple other signaling factors, including LIM domain and actin-binding protein 1 (LIMA1) and Smac/DIABLO. Like NIK, LIMA1 represents a unique substrate for API2-MALT1 protease activity, but unlike NIK, its cleavage sets in motion a major NF-κB-independent pathway for promoting oncogenesis. In this review, we highlight the most recent results characterizing these unique and diverse gain-of-function activities of API2-MALT1 and how they contribute to lymphomagenesis. PMID:26981201

  19. Nuclear hormone receptor NHR-49 controls fat consumption and fatty acid composition in C. elegans.

    PubMed

    Van Gilst, Marc R; Hadjivassiliou, Haralambos; Jolly, Amber; Yamamoto, Keith R

    2005-02-01

    Mammalian nuclear hormone receptors (NHRs), such as liver X receptor, farnesoid X receptor, and peroxisome proliferator-activated receptors (PPARs), precisely control energy metabolism. Consequently, these receptors are important targets for the treatment of metabolic diseases, including diabetes and obesity. A thorough understanding of NHR fat regulatory networks has been limited, however, by a lack of genetically tractable experimental systems. Here we show that deletion of the Caenorhabditis elegans NHR gene nhr-49 yielded worms with elevated fat content and shortened life span. Employing a quantitative RT-PCR screen, we found that nhr-49 influenced the expression of 13 genes involved in energy metabolism. Indeed, nhr-49 served as a key regulator of fat usage, modulating pathways that control the consumption of fat and maintain a normal balance of fatty acid saturation. We found that the two phenotypes of the nhr-49 knockout were linked to distinct pathways and were separable: The high-fat phenotype was due to reduced expression of enzymes in fatty acid beta-oxidation, and the shortened adult life span resulted from impaired expression of a stearoyl-CoA desaturase. Despite its sequence relationship with the mammalian hepatocyte nuclear factor 4 receptor, the biological activities of nhr-49 were most similar to those of the mammalian PPARs, implying an evolutionarily conserved role for NHRs in modulating fat consumption and composition. Our findings in C. elegans provide novel insights into how NHR regulatory networks are coordinated to govern fat metabolism.

  20. Cardiomyocyte-expressed farnesoid-X-receptor is a novel apoptosis mediator and contributes to myocardial ischaemia/reperfusion injury

    PubMed Central

    Pu, Jun; Yuan, Ancai; Shan, Peiren; Gao, Erhe; Wang, Xiaoliang; Wang, Yajing; Lau, Wayne Bond; Koch, Walter; Ma, Xin-Liang; He, Ben

    2013-01-01

    Aims Emerging evidence indicates that nuclear receptors play a critical regulatory role in cardiovascular physiology/pathology. Recently, farnesoid-X-receptor (FXR), a member of the metabolic nuclear receptor superfamily, has been demonstrated to be expressed in vascular cells, with important roles in vascular physiology/pathology. However, the potential cardiac function of FXR remains unclear. We investigated the cardiac expression and biological function of FXR. Methods and results Farnesoid-X-receptor was detected in both isolated neonatal rat cardiac myocytes and fibroblasts. Natural and synthetic FXR agonists upregulated cardiac FXR expression, stimulated myocyte apoptosis, and reduced myocyte viability dose- and time-dependently. Mechanistic studies demonstrated that FXR agonists disrupted mitochondria, characterized by mitochondrial permeability transition pores activation, mitochondrial potential dissipation, cytochrome c release, and both caspase-9 and -3 activation. Such mitochondrial apoptotic responses were abolished by siRNA-mediated silencing of endogenous FXR or pharmacological inhibition of mitochondrial death signalling. Furthermore, low levels of FXR were detected in the adult mouse heart, with significant (∼2.0-fold) upregulation after myocardial ischaemia/reperfusion (MI/R). Pharmacological inhibition or genetic ablation of FXR significantly reduced myocardial apoptosis by 29.0–53.4%, decreased infarct size by 23.4–49.7%, and improved cardiac function in ischaemic/reperfused myocardium. Conclusion These results demonstrate that nuclear receptor FXR acts as a novel functional receptor in cardiac tissue, regulates apoptosis in cardiomyocytes, and contributes to MI/R injury. PMID:22307460

  1. Localization of PPAR isotypes in the adult mouse and human brain

    PubMed Central

    Warden, Anna; Truitt, Jay; Merriman, Morgan; Ponomareva, Olga; Jameson, Kelly; Ferguson, Laura B.; Mayfield, R. Dayne; Harris, R. Adron

    2016-01-01

    Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that act as ligand-activated transcription factors. PPAR agonists have well-documented anti-inflammatory and neuroprotective roles in the central nervous system. Recent evidence suggests that PPAR agonists are attractive therapeutic agents for treating neurodegenerative diseases as well as addiction. However, the distribution of PPAR mRNA and protein in brain regions associated with these conditions (i.e. prefrontal cortex, nucleus accumbens, amygdala, ventral tegmental area) is not well defined. Moreover, the cell type specificity of PPARs in mouse and human brain tissue has yet to be investigated. We utilized quantitative PCR and double immunofluorescence microscopy to determine that both PPAR mRNA and protein are expressed ubiquitously throughout the adult mouse brain. We found that PPARs have unique cell type specificities that are consistent between species. PPARα was the only isotype to colocalize with all cell types in both adult mouse and adult human brain tissue. Overall, we observed a strong neuronal signature, which raises the possibility that PPAR agonists may be targeting neurons rather than glia to produce neuroprotection. Our results fill critical gaps in PPAR distribution and define novel cell type specificity profiles in the adult mouse and human brain. PMID:27283430

  2. Localization of PPAR isotypes in the adult mouse and human brain.

    PubMed

    Warden, Anna; Truitt, Jay; Merriman, Morgan; Ponomareva, Olga; Jameson, Kelly; Ferguson, Laura B; Mayfield, R Dayne; Harris, R Adron

    2016-06-10

    Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that act as ligand-activated transcription factors. PPAR agonists have well-documented anti-inflammatory and neuroprotective roles in the central nervous system. Recent evidence suggests that PPAR agonists are attractive therapeutic agents for treating neurodegenerative diseases as well as addiction. However, the distribution of PPAR mRNA and protein in brain regions associated with these conditions (i.e. prefrontal cortex, nucleus accumbens, amygdala, ventral tegmental area) is not well defined. Moreover, the cell type specificity of PPARs in mouse and human brain tissue has yet to be investigated. We utilized quantitative PCR and double immunofluorescence microscopy to determine that both PPAR mRNA and protein are expressed ubiquitously throughout the adult mouse brain. We found that PPARs have unique cell type specificities that are consistent between species. PPARα was the only isotype to colocalize with all cell types in both adult mouse and adult human brain tissue. Overall, we observed a strong neuronal signature, which raises the possibility that PPAR agonists may be targeting neurons rather than glia to produce neuroprotection. Our results fill critical gaps in PPAR distribution and define novel cell type specificity profiles in the adult mouse and human brain.

  3. Role of Sigma-1 Receptor in Cocaine Abuse and Neurodegenerative Disease.

    PubMed

    Cai, Yu; Yang, Lu; Niu, Fang; Liao, Ke; Buch, Shilpa

    2017-01-01

    Sigma-1 receptors (Sig-1R) are recognized as a unique class of non-G protein-coupled intracellular protein. Sig-1R binds to its ligand such as cocaine , resulting in dissociation of Sig-1R from mitochondrion-associated ER membrane (MAM) to the endoplasmic reticulum (ER), plasma membrane, and nuclear membrane, regulating function of various proteins. Sig-1R has diverse roles in both physiological as well as in pathogenic processes. The disruption of Sig-1R pathways has been implicated as causative mechanism(s) in the development of both neurodegenerative disorders such as Alzheimer disease (AD ), Parkinson disease (PD ), amyotrophic lateral sclerosis (ALS ) and Huntington Disease (HD ) . Additionally, the interaction of cocaine and Sig-1R has more recently been implicated in potentiating the pathogenesis of HIV-associated neurocognitive disorders (HAND) through impairment of blood-brain barrier (BBB), microglial activation and astrogliosis. On the other hand, restoration of Sig-1R homeostasis has been shown to exert neuroprotective effects. In this review, we provide an overview of how Sig-1R plays a role in the pathogenesis of neurodegenerative disorders and cocaine and implications for future development of therapeutic strategies.

  4. Characterization of Peroxisome Proliferator-Activated Receptor a (PPARa) -Independent Effects of PPARa Activators in the Rodent Liver: Di-(2-ethylhexyl) phthalate Also Activates the Constitutive Activated Receptor

    EPA Science Inventory

    Peroxisome proliferator chemicals (PPC) are thought to mediate their effects in rodents on hepatocyte growth and liver cancer through the nuclear receptor peroxisome proliferatoractivated receptor alpha (PPARa). Recent studies indicate that one such PPC, the plasticizer di2- et...

  5. Characterization of peroxisome proliferator-activiated receptor alpha (PPARalpha)-independent effects of PPARalpha activators in the rodent liver: Di(2-ethylehexyl) phthalate activates the constitutive activated receptor

    EPA Science Inventory

    Peroxisome proliferator chemicals (PPC) are thought to mediate their effects in rodents on hepatocyte growth and liver cancer through the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha). Recent studies indicate that the plasticizer di-2-ethylhexyl ph...

  6. The dynamics of nuclear receptors and nuclear receptor coregulators in the pathogenesis of endometriosis

    PubMed Central

    Han, Sang Jun; O'Malley, Bert W.

    2014-01-01

    BACKGROUND Endometriosis is defined as the colonization and growth of endometrial tissue at anatomic sites outside the uterine cavity. Up to 15% of reproductive-aged women in the USA suffer from painful symptoms of endometriosis, such as infertility, pelvic pain, menstrual cycle abnormalities and increased risk of certain cancers. However, many of the current clinical treatments for endometriosis are not sufficiently effective and yield unacceptable side effects. There is clearly an urgent need to identify new molecular mechanisms that critically underpin the initiation and progression of endometriosis in order to develop more specific and effective therapeutics which lack the side effects of current therapies. The aim of this review is to discuss how nuclear receptors (NRs) and their coregulators promote the progression of endometriosis. Understanding the pathogenic molecular mechanisms for the genesis and maintenance of endometriosis as modulated by NRs and coregulators can reveal new therapeutic targets for alternative endometriosis treatments. METHODS This review was prepared using published gene expression microarray data sets obtained from patients with endometriosis and published literature on NRs and their coregulators that deal with endometriosis progression. Using the above observations, our current understanding of how NRs and NR coregulators are involved in the progression of endometriosis is summarized. RESULTS Aberrant levels of NRs and NR coregulators in ectopic endometriosis lesions are associated with the progression of endometriosis. As an example, endometriotic cell-specific alterations in gene expression are correlated with a differential methylation status of the genome compared with the normal endometrium. These differential epigenetic regulations can generate favorable cell-specific NR and coregulator milieus for endometriosis progression. Genetic alterations, such as single nucleotide polymorphisms and insertion/deletion polymorphisms of NR and coregulator genes, are frequently detected in ectopic lesions compared with the normal endometrium. These genetic variations impart new molecular properties to NRs and coregulators to increase their capacity to stimulate progression of endometriosis. Finally, post-translational modifications of NR coregulators, such as proteolytic processing, generate endometriosis-specific isoforms. Compared with the unmodified coregulators, these coregulator isoforms have unique functions that enhance the pathogenesis of endometriosis. CONCLUSIONS Epigenetic/genetic variations and posttranslational modifications of NRs and coregulators alter their original function so that they become potent ‘drivers’ of endometriosis progression. PMID:24634322

  7. Screening the 10K Tox21 chemical library for thyroid hormone receptor modulators

    EPA Science Inventory

    Few ligands for the thyroid hormone receptor (TR) have been identified outside of endogenous ligands and pharmaceuticals, which suggests that TR is a very selective nuclear receptor (NR). However, large and diverse chemical libraries, particularly of environmental chemicals, have...

  8. EPI-001, a compound active against castration-resistant prostate cancer, targets transactivation unit 5 of the androgen receptor

    PubMed Central

    De Mol, Eva; Fenwick, R. Bryn; Phang, Christopher T. W.; Buzón, Victor; Szulc, Elzbieta; de la Fuente, Alex; Escobedo, Albert; García, Jesús; Bertoncini, Carlos W.; Estébanez-Perpiñá, Eva; McEwan, Iain J.; Riera, Antoni; Salvatella, Xavier

    2016-01-01

    Castration-resistant prostate cancer is the lethal condition suffered by prostate cancer patients that become refractory to androgen deprivation therapy. EPI-001 is a recently identified compound active against this condition that modulates the activity of the androgen receptor, a nuclear receptor that is essential for disease progression. The mechanism by which this compound exerts its inhibitory activity is however not yet fully understood. Here we show, by using high resolution solution nuclear magnetic resonance spectroscopy, that EPI-001 selectively interacts with a partially folded region of the transactivation domain of the androgen receptor, known as transactivation unit 5, that is key for the ability of prostate cells to proliferate in the absence of androgens, a distinctive feature of castration-resistant prostate cancer. Our results can contribute to the development of more potent and less toxic novel androgen receptor antagonists for treating this disease. PMID:27356095

  9. Independent Activation of Hepatitis B Virus Biosynthesis by Retinoids, Peroxisome Proliferators, and Bile Acids

    PubMed Central

    Reese, Vanessa C.; Oropeza, Claudia E.

    2013-01-01

    In the human hepatoma cell line HepG2, retinoic acid, clofibric acid, and bile acid treatment can only modestly increase hepatitis B virus (HBV) biosynthesis. Utilizing the human embryonic kidney cell line 293T, it was possible to demonstrate that the retinoid X receptor α (RXRα) plus its ligand can support viral biosynthesis independently of additional nuclear receptors. In addition, RXRα/peroxisome proliferator-activated receptor α (PPARα) and RXRα/farnesoid X receptor α (FXRα) heterodimeric nuclear receptors can also mediate ligand-dependent HBV transcription and replication when activated by clofibric acid and bile acid, respectively, independently of a requirement for the ligand-dependent activation of RXRα. These observations indicate that there are at least three possible modes of ligand-mediated activation of HBV transcription and replication existing within hepatocytes, suggesting that multiple independent mechanisms control viral production in the livers of infected individuals. PMID:23135717

  10. Identification of SR1078, a synthetic agonist for the orphan nuclear receptors RORα and RORγ.

    PubMed

    Wang, Yongjun; Kumar, Naresh; Nuhant, Philippe; Cameron, Michael D; Istrate, Monica A; Roush, William R; Griffin, Patrick R; Burris, Thomas P

    2010-11-19

    The retinoic acid receptor-related receptors (RORs) are members of the nuclear receptor (NR) superfamily of transcription factors. Several NRs are still characterized as orphan receptors because ligands have not yet been identified for these proteins. Here, we describe the identification of a synthetic RORα/RORγ ligand, SR1078. SR1078 modulates the conformation of RORγ in a biochemical assay and activates RORα and RORγ driven transcription. Furthermore, SR1078 stimulates expression of endogenous ROR target genes in HepG2 cells that express both RORα and RORγ. Pharmacokinetic studies indicate that SR1078 displays reasonable exposure following injection into mice, and consistent with SR1078 functioning as a RORα/RORγ agonist, expression of two ROR target genes, glucose-6-phosphatase and fibroblast growth factor 21, were stimulated in the liver. Thus, we have identified the first synthetic RORα/γ agonist, and this compound can be utilized as a chemical tool to probe the function of these receptors both in vitro and in vivo.

  11. Identification of a Synthetic Agonist for the Orphan Nuclear Receptors RORα and RORγ, SR1078

    PubMed Central

    Wang, Yongjun; Kumar, Naresh; Nuhant, Philippe; Cameron, Michael D.; Istrate, Monica A.; Roush, William R.; Griffin, Patrick R.; Burris, Thomas P.

    2010-01-01

    The retinoic acid receptor-related receptors (RORs) are members of the nuclear receptor (NR) superfamily of transcription factors. Several NRs are still characterized as orphan receptors since ligands have not yet been identified for these proteins. Here, we describe the identification of a synthetic RORα/RORγ ligand, SR1078. SR1078 modulates the conformation of RORγ in a biochemical assay and activates RORα and RORγ driven transcription. Furthermore, SR1078 stimulates expression of endogenous ROR target genes in HepG2 cells that express both RORα and RORγ. Pharmacokinetic studies indicate that SR1078 displays reasonable exposure following injection into mice and consistent with SR1078 functioning as a RORα/RORγ agonist, expression of two ROR target genes, glucose-6-phosphatase and fibroblast growth factor 21, were stimulated in the liver. Thus, we have identified the first synthetic RORα/γ agonist and this compound can be utilized as a chemical tool to probe the function of these receptors both in vitro and in vivo. PMID:20735016

  12. Molecular basis for repression of liver X receptor-mediated gene transcription by receptor-interacting protein 140

    PubMed Central

    Jakobsson, Tomas; Osman, Waffa; Gustafsson, Jan-Åke; Zilliacus, Johanna; Wärnmark, Anette

    2007-01-01

    Similarities in physiological roles of LXR (liver X receptors) and co-repressor RIP140 (receptor-interacting protein 140) in regulating energy homoeostasis and lipid and glucose metabolism suggest that the effects of LXR could at least partly be mediated by recruitment of the co-repressor RIP140. In the present study, we have elucidated the molecular basis for regulation of LXR transcriptional activity by RIP140. LXR is evenly localized in the nucleus and neither the N-terminal domain nor the LBD (ligand-binding domain) is necessary for nuclear localization. Both LXR subtypes, LXRα and LXRβ, interact with RIP140 and co-localize in diffuse large nuclear domains. Interaction and co-localization are dependent on the LBD of the receptor. The C-terminal domain of RIP140 is sufficient for full repressive effect. None of the C-terminal NR (nuclear receptor)-boxes is required for the co-repressor activity, whereas the NR-box-like motif as well as additional elements in the C-terminal region are required for full repressive function. The C-terminal NR-box-like motif is necessary for interaction with LXRβ, whereas additional elements are needed for strong interaction with LXRα. In conclusion, our results suggest that co-repression of LXR activity by RIP140 involves an atypical binding mode of RIP140 and a repression element in the RIP140 C-terminus. PMID:17391100

  13. Activation of orphan nuclear constitutive androstane receptor requires subnuclear targeting by peroxisome proliferator-activated receptor gamma coactivator-1 alpha. A possible link between xenobiotic response and nutritional state.

    PubMed

    Shiraki, Takuma; Sakai, Noriko; Kanaya, Eiko; Jingami, Hisato

    2003-03-28

    In contrast to the classical nuclear receptors, the constitutive androstane receptor (CAR) is transcriptionally active in the absence of ligand. In the course of searching for the mediator of CAR activation, we found that ligand-independent activation of CAR was achieved in cooperation with the peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1 alpha). PGC-1 beta, a PGC-1 alpha homologue, also activated CAR to less of an extent than PGC-1 alpha. Coexpression of the ligand-binding domain of a heterodimerization partner, retinoid X receptor alpha, enhanced the PGC-1 alpha-mediated activation of CAR, although it had a weak effect on the basal activity of CAR in the absence of PGC-1 alpha. Both the N-terminal region, with the LXXLL motif, and the C-terminal region, with a serine/arginine-rich domain (RS domain), in PGC-1 alpha were required for full activation of CAR. Pull-down experiments using recombinant proteins revealed that CAR directly interacted with both the LXXLL motif and the RS domain. Furthermore, we demonstrated that the RS domain of PGC-1 alpha was required for CAR localization at nuclear speckles. These results indicate that PGC-1 alpha mediates the ligand-independent activation of CAR by means of subnuclear targeting through the RS domain of PGC-1 alpha.

  14. A Genomic View of the Sea Urchin Nervous System

    PubMed Central

    Burke, RD; Angerer, LM; Elphick, MR; Humphrey, GW; Yaguchi, S; Kiyama, T; Liang, S; Mu, X; Agca, C; Klein, WH; Brandhorst, BP; Rowe, M; Wilson, K; Churcher, AM; Taylor, JS; Chen, N; Murray, G; Wang, D; Mellott, D; Olinski, R; Hallböök, F; Thorndyke, MC

    2007-01-01

    The sequencing of the Strongylocentrotus purpuratus genome provides a unique opportunity to investigate the function and evolution of neural genes. The neurobiology of sea urchins is of particular interest because they have a close phylogenetic relationship with chordates, yet a distinctive pentaradiate body plan and unusual neural organization. Orthologues of transcription factors that regulate neurogenesis in other animals have been identified and several are expressed in neurogenic domains before gastrulation indicating that they may operate near the top of a conserved neural gene regulatory network. A family of genes encoding voltage-gated ion channels is present but, surprisingly, genes encoding gap junction proteins (connexins and pannexins) appear to be absent. Genes required for synapse formation and function have been identified and genes for synthesis and transport of neurotransmitters are present. There is a large family of G-protein-coupled receptors, including 874 rhodopsin-type receptors, 28 metabotropic glutamate-like receptors and a remarkably expanded group of 161 secretin receptor-like proteins. Absence of cannabinoid, lysophospholipid and melanocortin receptors indicates that this group may be unique to chordates. There are at least 37 putative G-protein coupled peptide receptors and precursors for several neuropeptides and peptide hormones have been identified, including SALMFamides, NGFFFamide, a vasotocin-like peptide, glycoprotein hormones, and insulin/insulin-like growth factors. Identification of a neurotrophin-like gene and Trk receptor in sea urchin indicates that this neural signaling system is not unique to chordates. Several hundred chemoreceptor genes have been predicted using several approaches, a number similar to that for other animals. Intriguingly, genes encoding homologues of rhodopsin, Pax6 and several other key mammalian retinal transcription factors are expressed in tube feet, suggesting tube feet function as photosensory organs. Analysis of the sea urchin genome presents a unique perspective on the evolutionary history of deuterostome nervous systems and reveals new approaches to investigate the development and neurobiology of sea urchins. PMID:16965768

  15. Hormonally active phytochemicals from macroalgae: A largely untapped source of ligands to deorphanize nuclear receptors in emerging marine animal models.

    PubMed

    Markov, Gabriel V; Girard, Jean; Laudet, Vincent; Leblanc, Catherine

    2018-06-15

    Hormonally active phytochemicals (HAPs) are signaling molecules produced by plants that alter hormonal signaling in animals, due to consumption or environmental exposure. To date, HAPs have been investigated mainly in terrestrial ecosystems. To gain a full understanding of the origin and evolution of plant-animal interactions, it is necessary also to study these interactions in the marine environment, where the major photosynthetic lineages are very distant from the terrestrial plants. Here we focus on chemicals from red and brown macroalgae and point out their potential role as modulators of the endocrine system of aquatic animals through nuclear hormone receptors. We show that, regarding steroids and oxylipins, there are already some candidates available for further functional investigations of ligand-receptor interactions. Furthermore, several carotenoids, produced by cyanobacteria provide candidates that could be investigated with respect to their presence in macroalgae. Finally, regarding halogenated compounds, it is not clear yet which molecules could bridge the gap to explain the transition from lipid sensing to thyroid hormone high affinity binding among nuclear receptors. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Regulation of hepatic energy metabolism by the nuclear receptor PXR.

    PubMed

    Hakkola, Jukka; Rysä, Jaana; Hukkanen, Janne

    2016-09-01

    The pregnane X receptor (PXR) is a nuclear receptor that is traditionally thought to be specialized for sensing xenobiotic exposure. In concurrence with this feature PXR was originally identified to regulate drug-metabolizing enzymes and transporters. During the last ten years it has become clear that PXR harbors broader functions. Evidence obtained both in experimental animals and humans indicate that ligand-activated PXR regulates hepatic glucose and lipid metabolism and affects whole body metabolic homeostasis. Currently, the consequences of PXR activation on overall metabolic health are not yet fully understood and varying results on the effect of PXR activation or knockout on metabolic disorders and weight gain have been published in mouse models. Rifampicin and St. John's wort, the prototypical human PXR agonists, impair glucose tolerance in healthy volunteers. Chronic exposure to PXR agonists could potentially represent a risk factor for diabetes and metabolic syndrome. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Transcription control and neuronal differentiation by agents that activate the LXR nuclear receptor family.

    PubMed

    Schmidt, A; Vogel, R; Holloway, M K; Rutledge, S J; Friedman, O; Yang, Z; Rodan, G A; Friedman, E

    1999-09-10

    LXR and PPAR receptors belong to the nuclear receptor superfamily of transcriptional activating factors. Using ligand-dependent transcription assays, we found that 5-tetradecyloxy-2-furancarboxylic acid (TOFA) transactivates chimeric receptors composed of the glucocorticoid receptor DNA binding domain and the ligand binding regions of PPARalpha, PPARbeta (NUC-1) and LXRbeta (NER) receptors. In the same assays, ligands for PPARs (oleic acid, WY-14643 and L-631,033) and LXRs (hydroxycholesterols) maintain their respective receptor selectivity. TOFA and hydroxycholesterols also stimulate transcription from a minimal fibrinogen promoter that is under the control of AP-1 or NF-kappaB transcription factor binding sites. In addition to their effects on transcription, these LXRbeta activators induce neuronal differentiation in rat pheochromocytoma cells. TOFA and the natural LXR agonist, 22 (R)-hydroxycholesterol, stimulate neurite outgrowth in 55 and 28% of cells, respectively. No neurite outgrowth was induced by the related 22(S)-hydroxycholesterol, which does not activate the LXR family. These results suggest that the hydroxycholesterol signaling pathway has a complex effect on transcription that mediates the activity of TOFA and hydroxycholesterol on neuronal differentiation in pheochromocytoma cells.

  18. Modulation of PPAR activity via phosphorylation

    PubMed Central

    Burns, Katherine A.; Vanden Heuvel, John P.

    2009-01-01

    Peroxisome proliferator-activated receptors (PPARs) are members of the nuclear receptor superfamily of transcription factors that respond to specific ligands by altering gene expression in a cell-, developmental- and sex-specific manner. Three subtypes of this receptor have been discovered (PPARα, β and γ), each apparently evolving to fulfill different biological niches. PPARs control a variety of target genes involved in lipid homeostasis, diabetes and cancer. Similar to other nuclear receptors, the PPARs are phosphoproteins and their transcriptional activity is affected by cross-talk with kinases and phosphatases. Phosphorylation by the mitogen-activated protein kinases (ERK- and p38-MAPK), Protein Kinase A and C (PKA, PKC), AMP Kinase (AMPK) and glycogen synthase kinase-3 (GSK3) affect their activity in a ligand-dependent or -independent manner. The effects of phosphorylation depend on the cellular context, receptor subtype and residue metabolized which can be manifested at several steps in the PPAR activation sequence including ligand affinity, DNA binding, coactivator recruitment and proteasomal degradation. The review will summarize the known PPAR kinases that directly act on these receptors, the sites affected and the result of this modification on receptor activity. PMID:17560826

  19. Antidiabetic actions of a phosphatidylcholine ligand for nuclear receptor LRH-1

    PubMed Central

    Lee, Jae Man; Lee, Yoon Kwang; Mamrosh, Jennifer L.; Busby, Scott A.; Griffin, Patrick R.; Pathak, Manish C.; Ortlund, Eric A.; Moore, David D.

    2011-01-01

    Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (NR5A2) regulates bile acid biosynthesis1,2. Structural studies have identified phospholipids as potential LRH-1 ligands3–5, but their functional relevance is unclear. Here we show that an unusual phosphatidylcholine species with two saturated 12 carbon fatty acid acyl side chains (dilauroyl phosphatidylcholine, DLPC) is an LRH-1 agonist ligand in vitro. DLPC treatment induces bile acid biosynthetic enzymes in mouse liver, increases bile acid levels, and lowers hepatic triglycerides and serum glucose. DLPC treatment also decreases hepatic steatosis and improves glucose homeostasis in two mouse models of insulin resistance. Both the antidiabetic and lipotropic effects are lost in liver specific Lrh-1 knockouts. These findings identify an LRH-1 dependent phosphatidylcholine signaling pathway that regulates bile acid metabolism and glucose homeostasis. PMID:21614002

  20. 20180311 - Screening the 10K Tox21 chemical library for thyroid hormone receptor modulators (SOT)

    EPA Science Inventory

    Few ligands for the thyroid hormone receptor (TR) have been identified outside of endogenous ligands and pharmaceuticals, which suggests that TR is a very selective nuclear receptor (NR). However, large and diverse chemical libraries, particularly of environmental chemicals, have...

  1. Regulation of Proteome Maintenance Gene Expression by Activators of Peroxisome Proliferator-Activated Receptor a (PPARa)

    EPA Science Inventory

    The nuclear receptor peroxisome proliferator-activated receptor alpha (PPARa) is activated by a large number of xenobiotic and hypolipidemic compounds called peroxisome proliferator chemicals (PPC). One agonist of PPARa (WY-14,643) regulates responses in the mouse liver to chemic...

  2. Regulation of NT-PGC-1alpha subcellular localization and function by protein kinase A-dependent modulation of nuclear export by CRM1.

    PubMed

    Chang, Ji Suk; Huypens, Peter; Zhang, Yubin; Black, Chelsea; Kralli, Anastasia; Gettys, Thomas W

    2010-06-04

    Peroxisome proliferator-activated receptor gamma co-activator-1alpha (PGC-1alpha) plays a central role in the regulation of cellular energy metabolism and metabolic adaptation to environmental and nutritional stimuli. We recently described a novel, biologically active splice variant of PGC-1alpha (NT-PGC-1alpha, amino acids 1-270) that retains the ability to interact with and transactivate nuclear hormone receptors through its N-terminal transactivation domain. Whereas PGC-1alpha is an unstable nuclear protein sensitive to ubiquitin-mediated targeting to the proteasome, NT-PGC-1alpha is relatively stable and predominantly cytoplasmic, suggesting that its ability to interact with and activate nuclear receptors and transcription factors is dependent upon regulated access to the nucleus. We provide evidence that NT-PGC-1alpha interacts with the nuclear exportin, CRM1, through a specific leucine-rich domain (nuclear export sequence) that regulates its export to the cytoplasm. The nuclear export of NT-PGC-1alpha is inhibited by protein kinase A-dependent phosphorylation of Ser-194, Ser-241, and Thr-256 on NT-PGC-1alpha, which effectively increases its nuclear concentration. Using site-directed mutagenesis to prevent or mimic phosphorylation at these sites, we show that the transcriptional activity of NT-PGC-1alpha is regulated in part through regulation of its subcellular localization. These findings suggest that the function of NT-PGC-1alpha as a transcriptional co-activator is regulated by protein kinase A-dependent inhibition of CRM1-mediated export from the nucleus.

  3. A Review About Lycopene-Induced Nuclear Hormone Receptor Signalling in Inflammation and Lipid Metabolism via still Unknown Endogenous Apo-10´-Lycopenoids.

    PubMed

    Caris-Veyrat, Catherine; Garcia, Ada L; Reynaud, Eric; Lucas, Renata; Aydemir, Gamze; Rühl, Ralph

    2017-10-20

    Lycopene is the red pigment in tomatoes and tomato products and is an important dietary carotenoid found in the human organism. Lycopene-isomers, oxidative lycopene metabolites and apo-lycopenoids are found in the food matrix. Lycopene intake derived from tomato consumption is associated with alteration of lipid metabolism and a lower incidence of cardiovascular diseases (CVD). Lycopene is mainly described as a potent antioxidant but novel studies are shifting towards its metabolites and their capacity to mediate nuclear receptor signalling. Di-/tetra-hydro-derivatives of apo-10´-lycopenoic acid and apo-15´-lycopenoic acids are potential novel endogenous mammalian lycopene metabolites which may act as ligands for nuclear hormone mediated activation and signalling. In this review, we postulate that complex lycopene metabolism results in various lycopene metabolites which have the ability to mediate transactivation of various nuclear hormone receptors like RARs, RXRs and PPARs. A new mechanistic explanation of how tomato consumption could positively modulate inflammation and lipid metabolism is discussed.

  4. Hyper-reactive cloned mice generated by direct nuclear transfer of antigen-specific CD4+ T cells.

    PubMed

    Kaminuma, Osamu; Katayama, Kazufumi; Inoue, Kimiko; Saeki, Mayumi; Nishimura, Tomoe; Kitamura, Noriko; Shimo, Yusuke; Tofukuji, Soichi; Ishida, Satoru; Ogonuki, Narumi; Kamimura, Satoshi; Oikawa, Mami; Katoh, Shigeki; Mori, Akio; Shichijo, Michitaka; Hiroi, Takachika; Ogura, Atsuo

    2017-06-01

    T-cell receptor (TCR)-transgenic mice have been employed for evaluating antigen-response mechanisms, but their non-endogenous TCR might induce immune response differently than the physiologically expressed TCR Nuclear transfer cloning produces animals that retain the donor genotype in all tissues including germline and immune systems. Taking advantage of this feature, we generated cloned mice that carry endogenously rearranged TCR genes from antigen-specific CD4 + T cells. We show that T cells of the cloned mice display distinct developmental pattern and antigen reactivity because of their endogenously pre-rearranged TCRα (rTα) and TCRβ (rTβ) alleles. These alleles were transmitted to the offspring, allowing us to establish a set of mouse lines that show chronic-type allergic phenotypes, that is, bronchial and nasal inflammation, upon local administrations of the corresponding antigens. Intriguingly, the existence of either rTα or rTβ is sufficient to induce in vivo hypersensitivity. These cloned mice expressing intrinsic promoter-regulated antigen-specific TCR are a unique animal model with allergic predisposition for investigating CD4 + T-cell-mediated pathogenesis and cellular commitment in immune diseases. © 2017 The Authors.

  5. Structure of the exportin Xpo4 in complex with RanGTP and the hypusine-containing translation factor eIF5A

    PubMed Central

    Aksu, Metin; Trakhanov, Sergei; Görlich, Dirk

    2016-01-01

    Xpo4 is a bidirectional nuclear transport receptor that mediates nuclear export of eIF5A and Smad3 as well as import of Sox2 and SRY. How Xpo4 recognizes such a variety of cargoes is as yet unknown. Here we present the crystal structure of the RanGTP·Xpo4·eIF5A export complex at 3.2 Å resolution. Xpo4 has a similar structure as CRM1, but the NES-binding site is occluded, and a new interaction site evolved that recognizes both globular domains of eIF5A. eIF5A contains hypusine, a unique amino acid with two positive charges, which is essential for cell viability and eIF5A function in translation. The hypusine docks into a deep, acidic pocket of Xpo4 and is thus a critical element of eIF5A's complex export signature. This further suggests that Xpo4 recognizes other cargoes differently, and illustrates how Xpo4 suppresses – in a chaperone-like manner – undesired interactions of eIF5A inside nuclei. PMID:27306458

  6. Therapeutic androgen receptor ligands

    PubMed Central

    Allan, George F.; Sui, Zhihua

    2003-01-01

    In the past several years, the concept of tissue-selective nuclear receptor ligands has emerged. This concept has come to fruition with estrogens, with the successful marketing of drugs such as raloxifene. The discovery of raloxifene and other selective estrogen receptor modulators (SERMs) has raised the possibility of generating selective compounds for other pathways, including androgens (that is, selective androgen receptor modulators, or SARMs). PMID:16604181

  7. Expression profiling of nuclear receptors in breast cancer identifies TLX as a mediator of growth and invasion in triple-negative breast cancer

    PubMed Central

    Remenyi, Judit; Banerji, Christopher R.S.; Lai, Chun-Fui; Periyasamy, Manikandan; Lombardo, Ylenia; Busonero, Claudia; Ottaviani, Silvia; Passey, Alun; Quinlan, Philip R.; Purdie, Colin A.; Jordan, Lee B.; Thompson, Alastair M.; Finn, Richard S.; Rueda, Oscar M.; Caldas, Carlos; Gil, Jesus; Coombes, R. Charles; Fuller-Pace, Frances V.; Teschendorff, Andrew E.; Buluwela, Laki; Ali, Simak

    2015-01-01

    The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other NR and there is evidence that ERα function may be recapitulated by other NRs in ERα-negative breast cancer. In order to examine the inter-relationships between nuclear receptors, and to obtain evidence for previously unsuspected roles for any NRs, we undertook quantitative RT-PCR and bioinformatics analysis to examine their expression in breast cancer. While most NRs were expressed, bioinformatic analyses differentiated tumours into distinct prognostic groups that were validated by analyzing public microarray data sets. Although ERα and progesterone receptor were dominant in distinguishing prognostic groups, other NR strengthened these groups. Clustering analysis identified several family members with potential importance in breast cancer. Specifically, RORγ is identified as being co-expressed with ERα, whilst several NRs are preferentially expressed in ERα-negative disease, with TLX expression being prognostic in this subtype. Functional studies demonstrated the importance of TLX in regulating growth and invasion in ERα-negative breast cancer cells. PMID:26280373

  8. Novel protective role of the circadian nuclear receptor retinoic acid-related orphan receptor-α in diabetic cardiomyopathy.

    PubMed

    Zhao, Yichao; Xu, Longwei; Ding, Song; Lin, Nan; Ji, Qingqi; Gao, Lingchen; Su, Yuanyuan; He, Ben; Pu, Jun

    2017-04-01

    Diabetic cardiomyopathy is a major complication that significantly contributes to morbidity and mortality in diabetics with few therapies. Moreover, antidiabetic drugs reported inconsistent or even adverse cardiovascular effects, suggesting that it is important to exploit novel therapeutic targets against diabetic cardiomyopathy. Here, we observed that the nuclear melatonin receptor, the retinoic acid-related orphan receptor-α (RORα), was downregulated in diabetic hearts. By utilizing a mouse line with RORα disruption, we demonstrated that RORα deficiency led to significantly augmented diastolic dysfunction and cardiac remodeling induced by diabetes. Microscopic and molecular analyses further indicated that the detrimental effects of RORα deficiency were associated with aggravated myocardial apoptosis, autophagy dysfunction, and oxidative stress by disrupting antioxidant gene expression. By contrast, restoration of cardiac RORα levels in transgenic mice significantly improved cardiac functional and structural parameters at 8 weeks after diabetes induction. Consistent with genetic manipulation, pharmacological activation of RORα by melatonin and SR1078 (a synthetic agonist) showed beneficial effects against diabetic cardiomyopathy, while the RORα inhibitor SR3335 significantly exacerbated cardiac impairments in diabetic mice. Collectively, these findings suggest that cardiac-targeted manipulation of nuclear melatonin receptor RORα may hold promise for delaying diabetic cardiomyopathy development. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Characterization of karyopherins in androgen receptor intracellular trafficking in the yeast model

    PubMed Central

    Nguyen, Minh M; Harmon, Robert M; Wang, Zhou

    2014-01-01

    Background: Mechanisms regulating androgen receptor (AR) subcellular localization represent an essential component of AR signaling. Karyopherins are a family of nucleocytoplasmic trafficking factors. In this paper, we used the yeast model to study the effects of karyopherins on the subcellular localization of the AR. Methods: Yeast mutants deficient in different nuclear transport factors were transformed with various AR based, GFP tagged constructs and their localization was monitored using microscopy. Results: We showed that yeast can mediate androgen-induced AR nuclear localization and that in addition to the import factor, Importinα/β, this process required the import karyopherin Sxm1. We also showed that a previously identified nuclear export sequence (NESAR) in the ligand binding domain of AR does not appear to rely on karyopherins for cytoplasmic localization. Conclusions: These results suggest that while AR nuclear import relies on karyopherin activity, AR nuclear export and/or cytoplasmic localization may require other undefined mechanisms. PMID:25031696

  10. Unique binding behavior of the recently approved angiotensin II receptor blocker azilsartan compared with that of candesartan

    PubMed Central

    Miura, Shin-ichiro; Okabe, Atsutoshi; Matsuo, Yoshino; Karnik, Sadashiva S; Saku, Keijiro

    2014-01-01

    The angiotensin II type 1 (AT1) receptor blocker (ARB) candesartan strongly reduces blood pressure (BP) in patients with hypertension and has been shown to have cardioprotective effects. A new ARB, azilsartan, was recently approved and has been shown to provide a more potent 24-h sustained antihypertensive effect than candesartan. However, the molecular interactions of azilsartan with the AT1 receptor that could explain its strong BP-lowering activity are not yet clear. To address this issue, we examined the binding affinities of ARBs for the AT1 receptor and their inverse agonist activity toward the production of inositol phosphate (IP), and we constructed docking models for the interactions between ARBs and the receptor. Azilsartan, unlike candesartan, has a unique moiety, a 5-oxo-1,2,4-oxadiazole, in place of a tetrazole ring. Although the results regarding the binding affinities of azilsartan and candesartan demonstrated that these ARBs interact with the same sites in the AT1 receptor (Tyr113, Lys199 and Gln257), the hydrogen bonding between the oxadiazole of azilsartan-Gln257 is stronger than that between the tetrazole of candesartan-Gln257, according to molecular docking models. An examination of the inhibition of IP production by ARBs using constitutively active mutant receptors indicated that inverse agonist activity required azilsartan–Gln257 interaction and that azilsartan had a stronger interaction with Gln257 than candesartan. Thus, we speculate that azilsartan has a unique binding behavior to the AT1 receptor due to its 5-oxo-1,2,4-oxadiazole moiety and induces stronger inverse agonism. This property of azilsartan may underlie its previously demonstrated superior BP-lowering efficacy compared with candesartan and other ARBs. PMID:23034464

  11. Unique binding behavior of the recently approved angiotensin II receptor blocker azilsartan compared with that of candesartan.

    PubMed

    Miura, Shin-ichiro; Okabe, Atsutoshi; Matsuo, Yoshino; Karnik, Sadashiva S; Saku, Keijiro

    2013-02-01

    The angiotensin II type 1 (AT(1)) receptor blocker (ARB) candesartan strongly reduces blood pressure (BP) in patients with hypertension and has been shown to have cardioprotective effects. A new ARB, azilsartan, was recently approved and has been shown to provide a more potent 24-h sustained antihypertensive effect than candesartan. However, the molecular interactions of azilsartan with the AT(1) receptor that could explain its strong BP-lowering activity are not yet clear. To address this issue, we examined the binding affinities of ARBs for the AT(1) receptor and their inverse agonist activity toward the production of inositol phosphate (IP), and we constructed docking models for the interactions between ARBs and the receptor. Azilsartan, unlike candesartan, has a unique moiety, a 5-oxo-1,2,4-oxadiazole, in place of a tetrazole ring. Although the results regarding the binding affinities of azilsartan and candesartan demonstrated that these ARBs interact with the same sites in the AT(1) receptor (Tyr(113), Lys(199) and Gln(257)), the hydrogen bonding between the oxadiazole of azilsartan-Gln(257) is stronger than that between the tetrazole of candesartan-Gln(257), according to molecular docking models. An examination of the inhibition of IP production by ARBs using constitutively active mutant receptors indicated that inverse agonist activity required azilsartan-Gln(257) interaction and that azilsartan had a stronger interaction with Gln(257) than candesartan. Thus, we speculate that azilsartan has a unique binding behavior to the AT(1) receptor due to its 5-oxo-1,2,4-oxadiazole moiety and induces stronger inverse agonism. This property of azilsartan may underlie its previously demonstrated superior BP-lowering efficacy compared with candesartan and other ARBs.

  12. A Unique Master's Program in Combined Nuclear Technology and Nuclear Chemistry at Chalmers University of Technology, Sweden

    NASA Astrophysics Data System (ADS)

    Skarnemark, Gunnar; Allard, Stefan; Ekberg, Christian; Nordlund, Anders

    2009-08-01

    The need for engineers and scientists who can ensure safe and secure use of nuclear energy is large in Sweden and internationally. Chalmers University of Technology is therefore launching a new 2-year master's program in Nuclear Engineering, with start from the autumn of 2009. The program is open to Swedish and foreign students. The program starts with compulsory courses dealing with the basics of nuclear chemistry and physics, radiation protection, nuclear power and reactors, nuclear fuel supply, nuclear waste management and nuclear safety and security. There are also compulsory courses in nuclear industry applications and sustainable energy futures. The subsequent elective courses can be chosen freely but there is also a possibility to choose informal tracks that concentrate on nuclear chemistry or reactor technology and physics. The nuclear chemistry track comprises courses in e.g. chemistry of lanthanides, actinides and transactinides, solvent extraction, radioecology and radioanalytical chemistry and radiopharmaceuticals. The program is finished with a one semester thesis project. This is probably a unique master program in the sense of its combination of deep courses in both nuclear technology and nuclear chemistry.

  13. PEROXISOME-PROLIFERATOR ACTIVATED RECEPTORS AS A MACROMOLECULAR TARGET FOR CHEMICAL TOXICITY: MODELS OF THE INTERACTIONS OF PPARS WITH PERFLUORINATED ORGANIC COMPOUNDS.

    EPA Science Inventory

    The Peroxisome Proliferator Activated Receptors (PPARs), a class of nuclear receptors that modulate both transcription and metabolic processes, are implicated in a variety of metabolic disorders linked to lipidogenesis, adipose tissue accumulation, fatty-acid oxidation pathways, ...

  14. Regulation of subcellular localization of the Aryl Hydrocarbon Receptor (AhR)

    USGS Publications Warehouse

    Richter, Catherine A.; Tillitt, Donald E.; Hannink, Mark

    2001-01-01

    The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that mediates the toxicity of dioxin and other xenobiotics. In the absence of exogenous ligand, AhR is cytosolic. We investigated how AhR is retained in the cytosol and how dioxin induces AhR to move to the nucleus. Disruption of nuclear export of AhR by the nuclear export inhibitor leptomycin B (LMB) or by mutation of the AhR nuclear export signal resulted in nuclear accumulation of AhR in the absence of exogenous ligand. Mutation of the AhR nuclear localization signal resulted in defects in nuclear import of AhR in both the presence and the absence of exogenous ligand. Dioxin treatment caused a more rapid accumulation of AhR in the nucleus than LMB treatment. In the presence of both dioxin and LMB, nuclear accumulation of AhR was more rapid than in the presence of dioxin alone. Our results show that AhR shuttles between the nucleus and the cytosol in the absence of exogenous ligand. Binding of ligand induces an increase in the rate of nuclear import of AhR but does not eliminate nuclear export of AhR.

  15. Detection of pAkt protein in imprint cytology of invasive breast cancer: Correlation with HER2/neu, hormone receptors, and other clinicopathological variables.

    PubMed

    Vasou, Olympia; Skagias, Lazaros; Anastasia, Margariti; Paulina, Athanasiadou; Patsouris, Efstratios; Politi, Ekaterini

    2015-01-01

    Akt is a serine/threonine protein kinase and has emerged as a crucial regulator of widely divergent cellular processes, including apoptosis, proliferation, differentiation, and metabolism. Activation of Akt/protein kinase B has been positively associated with human epidermal growth-factor receptor 2 (HER2)/neu overexpression in breast carcinoma and a worse outcome among endocrine treated patients. The Akt signaling pathway currently attracts considerable attention as a new target for effective therapeutic strategies. We therefore investigated the relationship between activation of Akt and clinicopathologic variables including hormone receptor and HER2/neu status. Archival tumor tissues from 100 patients with invasive breast carcinoma were analyzed by immunocytochemistry. This study describes the results of immunocytochemical pAkt expression in breast carcinoma imprints, prepared from cut surfaces of freshly removed tumors. Both nuclear and cytoplasmic expressions were evaluated for pAkt. Nuclear and cytoplasmic positive scores of 72% (72/100) and 42% (42/100), respectively, were found. Coexistence of nuclear and cytoplasmic staining was observed in 32 cases (32/100). Nuclear positive staining correlated with HER2/neu overexpression (P = 0.043) and was significantly associated with positive involvement of axillary lymph nodes (P = 0.013). No correlation was found between cytoplasmic pAkt rate and clinicopathological parameters, estrogen receptor, progesterone receptor or HER2/neu expression. pAkt expression can be evaluated in cytological material and may add valuable information to current prognostic models for breast cancer. pAkt overexpression appears to be linked with potentially aggressive tumor phenotype in invasive breast carcinoma.

  16. Transactivation Assays that Identify Indirect and Direct Activators of Human Pregnane X Receptor (PXR, NR1I2) and Constitutive Androstane Receptor (CAR, NR1I3).

    PubMed

    Pinne, Marija; Ponce, Elsa; Raucy, Judy L

    2017-01-01

    Nuclear Receptors (NRs), including PXR and CAR, are presumed to be ligand-dependent transcription factors, but ligand binding is not an absolute requirement for activation. Indeed, many compounds activate PXR and CAR by indirect mechanisms. Detecting these indirect activators of specific nuclear receptors in vitro has been difficult. As NR activation of either or both PXR and CAR can lead to drug-drug interactions and adverse drug effects, false negatives obtained with screening tools incapable of detecting indirect activators could present liabilities. The aim of this study was to establish assays that identify indirect activators of human PXR and CAR. Commercially available human PXR and CAR transactivation assays were used for analyses. We show that transactivation assays containing full-length nuclear receptors with native promoters can identify indirect activators of human CAR and PXRwhen compared to those of commercially available assays containing only the LBD of PXR and CAR. Of these two assay systems, only human PXR and CAR1 assays with full-length receptors and native promoters are capable of detecting indirect and ligand activators. With this capability, several kinase inhibitors were identified that activate PXR and CAR by indirect mechanisms. Furthermore by using both the LBD and full-length receptors, phenobarbital and midostaurin were found to be direct and indirect activators of PXR while human CAR activation by phenobarbital occurs by indirect mechanisms only. Cell based transactivation assays employing the full-length receptors and native promoters identify both direct and indirect activators of either or both human PXR and CAR. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. The export receptor Crm1 forms a dimer to promote nuclear export of HIV RNA.

    PubMed

    Booth, David S; Cheng, Yifan; Frankel, Alan D

    2014-12-08

    The HIV Rev protein routes viral RNAs containing the Rev Response Element (RRE) through the Crm1 nuclear export pathway to the cytoplasm where viral proteins are expressed and genomic RNA is delivered to assembling virions. The RRE assembles a Rev oligomer that displays nuclear export sequences (NESs) for recognition by the Crm1-Ran(GTP) nuclear receptor complex. Here we provide the first view of an assembled HIV-host nuclear export complex using single-particle electron microscopy. Unexpectedly, Crm1 forms a dimer with an extensive interface that enhances association with Rev-RRE and poises NES binding sites to interact with a Rev oligomer. The interface between Crm1 monomers explains differences between Crm1 orthologs that alter nuclear export and determine cellular tropism for viral replication. The arrangement of the export complex identifies a novel binding surface to possibly target an HIV inhibitor and may point to a broader role for Crm1 dimerization in regulating host gene expression.

  18. Retinoic acid induces nuclear accumulation of Raf1 during differentiation of HL-60 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, James; Bunaciu, Rodica P.; Reiterer, Gudrun

    All trans-retinoic acid (RA) is a standard therapeutic agent used in differentiation induction therapy treatment of acute promyelocytic leukemia (APL). RA and its metabolites use a diverse set of signal transduction pathways during the differentiation program. In addition to the direct transcriptional targets of the nuclear RAR and RXR receptors, signals derived from membrane receptors and the Raf-MEK-ERK pathway are required. Raf1 phosphorylation and the prolonged activation of Raf1 persisting during the entire differentiation process are required for RA-dependent differentiation of HL-60 cells. Here we identify a nuclear redistribution of Raf1 during the RA-induced differentiation of HL-60 cells. In addition,more » the nuclear accumulation of Raf1 correlates with an increase in Raf1 phosphorylated at serine 621. The serine 621 phosphorylated Raf1 is predominantly localized in the nucleus. The RA-dependent nuclear accumulation of Raf1 suggests a novel nuclear role for Raf1 during the differentiation process.« less

  19. β-Carotene-9′,10′-Oxygenase Status Modulates the Impact of Dietary Tomato and Lycopene on Hepatic Nuclear Receptor–, Stress-, and Metabolism-Related Gene Expression in Mice123

    PubMed Central

    Tan, Hsueh-Li; Moran, Nancy E.; Cichon, Morgan J.; Riedl, Ken M.; Schwartz, Steven J.; Erdman, John W.; Pearl, Dennis K.; Thomas-Ahner, Jennifer M.; Clinton, Steven K.

    2014-01-01

    Tomato and lycopene (ψ, ψ-carotene) consumption is hypothesized to protect against nonalcoholic steatohepatitis and hepatocarcinogenesis, processes that may depend upon diet and gene interactions. To investigate the interaction of tomato or lycopene feeding with β-carotene-9′,10′-monooxygenase (Bco2) on hepatic metabolic and signaling pathways, male wild-type (WT) and Bco2−/− mice (3-wk-old; n = 36) were fed semi-purified control, 10% tomato powder–containing, or 0.25% lycopene beadlet–containing diets for 3 wk. Serum lycopene concentrations were higher in lycopene- and tomato-fed Bco2−/− mice compared with WT (P = 0.03). Tomato- and lycopene-fed mice had detectable hepatic apolipoprotein (apo)-6′-, apo-8′-, and apo-12′-lycopenal concentrations. Hepatic expression of β-carotene-15,15’-monooxygenase was increased in Bco2−/− mice compared with WT (P = 0.02), but not affected by diet. Evaluation of hepatic gene expression by focused quantitative reverse transcriptase-polymerase chain reaction arrays for nuclear receptors and coregulators (84 genes) and stress and metabolism (82 genes) genes indicates that tomato feeding affected 31 genes (≥1.5-fold, P < 0.05) and lycopene feeding affected 19 genes, 16 of which were affected by both diets. Lycopene down-regulation of 7 nuclear receptors and coregulators, estrogen-related receptor-α, histone deacetylase 3, nuclear receptor coactivator 4, RevErbA-β, glucocorticoid receptor, peroxisome proliferator-activated receptor (PPAR)-α, and PPAR-γ, coactivator 1 β was dependent upon interaction with Bco2 status. Lycopene and tomato feeding induced gene expression patterns consistent with decreased lipid uptake, decreased cell proliferation and mitosis, down-regulated aryl hydrocarbon receptor signaling, and decreased expression of genes involved in retinoid X receptor heterodimer activation. Tomato feeding also caused expression changes consistent with down-regulation of DNA synthesis and terpenoid metabolism. These data suggest tomato components, particularly lycopene, affect hepatic gene expression, potentially affecting hepatic responses to metabolic, infectious, or chemical stress. PMID:24553694

  20. Nuclear receptor co-activators and HER-2/neu are upregulated in breast cancer patients during neo-adjuvant treatment with aromatase inhibitors

    PubMed Central

    Flågeng, M Hauglid; Haugan Moi, L L; Dixon, J M; Geisler, J; Lien, E A; Miller, W R; Lønning, P E; Mellgren, G

    2009-01-01

    Background: Acquired resistance to endocrine therapy in breast cancer is poorly understood. Characterisation of the molecular response to aromatase inhibitors in breast cancer tissue may provide important information regarding development of oestrogen hypersensitivity. Methods: We examined the expression levels of nuclear receptor co-regulators, the orphan nuclear receptor liver receptor homologue-1 and HER-2/neu growth factor receptor using real-time RT-PCR before and after 13–16 weeks of primary medical treatment with the aromatase inhibitors anastrozole or letrozole. Results: mRNA expression of the steroid receptor co-activator 1 (SRC-1) and peroxisome-proliferator-activated receptor γ co-activator-1α (PGC-1α) was correlated (P=0.002), and both co-activators increased during treatment in the patient group as a whole (P=0.008 and P=0.032, respectively), as well as in the subgroup of patients achieving an objective treatment response (P=0.002 and P=0.006). Although we recorded no significant change in SRC-3/amplified in breast cancer 1 level, the expression correlated positively to the change of SRC-1 (P=0.002). Notably, we recorded an increase in HER-2/neu levels during therapy in the total patient group (18 out of 26; P=0.016), but in particular among responders (15 out of 21; P=0.008). Conclusion: Our results show an upregulation of co-activator mRNA and HER-2/neu during treatment with aromatase inhibitors. These mechanisms may represent an early adaption of the breast cancer cells to oestrogen deprivation in vivo. PMID:19755984

  1. The Hsp90 Inhibitor, 17-AAG, Prevents the Ligand-Independent Nuclear Localization of Androgen Receptor in Refractory Prostate Cancer Cells

    PubMed Central

    Saporita, Anthony J.; Ai, Junkui; Wang, Zhou

    2010-01-01

    BACKGROUND Androgen receptor (AR) is the key molecule in androgen-refractory prostate cancer. Despite androgen ablative conditions, AR remains active and is necessary for the growth of androgen-refractory prostate cancer cells. Nuclear localization of AR is a prerequisite for its transcriptional activation. We examined AR localization in androgen-dependent and androgen-refractory prostate cancer cells. METHODS AND RESULTS We demonstrate increased nuclear localization of a GFP-tagged AR in the absence of hormone in androgen-refractory C4-2 cells compared to parental androgen-sensitive human prostate cancer LNCaP cells. Analysis of AR mutants impaired in ligand-binding indicates that the nuclear localization of AR in C4-2 cells is truly androgen-independent. The hsp90 inhibitor, 17-allylamino-17-demethoxygeldanamycin (17-AAG), inhibits basal PSA expression and disrupts the ligand-independent nuclear localization of AR at doses much lower than required to inhibit androgen-induced nuclear import. CONCLUSIONS Hsp90 is a key regulator of ligand-independent nuclear localization and activation of AR in androgen-refractory prostate cancer cells. PMID:17221841

  2. The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

    PubMed

    Magna, Melinda; Pisetsky, David S

    2016-05-01

    The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.

  3. Molecular Determinants of Magnolol Targeting Both RXRα and PPARγ

    PubMed Central

    Chen, Lili; Chen, Jing; Hu, Lihong; Jiang, Hualiang; Shen, Xu

    2011-01-01

    Nuclear receptors retinoic X receptor α (RXRα) and peroxisome proliferator activated receptor γ (PPARγ) function potently in metabolic diseases, and are both important targets for anti-diabetic drugs. Coactivation of RXRα and PPARγ is believed to synergize their effects on glucose and lipid metabolism. Here we identify the natural product magnolol as a dual agonist targeting both RXRα and PPARγ. Magnolol was previously reported to enhance adipocyte differentiation and glucose uptake, ameliorate blood glucose level and prevent development of diabetic nephropathy. Although magnolol can bind and activate both of these two nuclear receptors, the transactivation assays indicate that magnolol exhibits biased agonism on the transcription of PPAR-response element (PPRE) mediated by RXRα:PPARγ heterodimer, instead of RXR-response element (RXRE) mediated by RXRα:RXRα homodimer. To further elucidate the molecular basis for magnolol agonism, we determine both the co-crystal structures of RXRα and PPARγ ligand-binding domains (LBDs) with magnolol. Structural analyses reveal that magnolol adopts its two 5-allyl-2-hydroxyphenyl moieties occupying the acidic and hydrophobic cavities of RXRα L-shaped ligand-binding pocket, respectively. While, two magnolol molecules cooperatively accommodate into PPARγ Y-shaped ligand-binding pocket. Based on these two complex structures, the key interactions for magnolol activating RXRα and PPARγ are determined. As the first report on the dual agonist targeting RXRα and PPARγ with receptor-ligand complex structures, our results are thus expected to help inspect the potential pharmacological mechanism for magnolol functions, and supply useful hits for nuclear receptor multi-target ligand design. PMID:22140563

  4. Involvement of the orphan nuclear estrogen receptor-related receptor α in osteoclast adhesion and transmigration

    PubMed Central

    Bonnelye, Edith; Saltel, Frédéric; Chabadel, Anne; Zirngibl, Ralph A; Aubin, Jane E; Jurdic, Pierre

    2010-01-01

    The orphan nuclear receptor, estrogen receptor-related receptor α (ERRα) is expressed in osteoblasts and osteoclasts (OCs) and has been proposed to be a modulator of estrogen signaling. To determine the role of ERRα in OC biology, we knocked down ERRα activity by transient transfection of an siRNA directed against ERRα in the RAW264.7 monocyte–macrophage cell line that differentiates into OCs in the presence of receptor activator of nuclear factor κB-ligands and macrophage colony-stimulating factor. In parallel, stable RAW cell lines expressing a dominant-negative form of ERRα and green fluorescent protein (RAW-GFP-ERRαΔAF2) were used. Expression of OC markers was assessed by real-time PCR, and adhesion and transmigration tests were performed. Actin cytoskeletal organization was visualized using confocal microscopy. We found that RAW264.7 cells expressing siRNA directed against ERRα and RAW-GFP-ERRαΔAF2 OCs displayed abnormal spreading, and decreased osteopontin and β3 integrin subunit expression compared with the corresponding control cells. Decreased adhesion and the absence of podosome belts concomitant with abnormal localization of c-src were also observed in RAW-GFP-ERRαΔAF2-derived OCs. In addition, RAW-GFP-ERRαΔAF2-derived OCs failed to transmigrate through osteoblast cell layers. Our data show that the impairment of ERRα function does not alter OC precursor proliferation and differentiation but does alter the adhesion/spreading and migration capacities of mature OCs. PMID:20841427

  5. Receptor-mediated gene transfer vectors: progress towards genetic pharmaceuticals.

    PubMed

    Molas, M; Gómez-Valadés, A G; Vidal-Alabró, A; Miguel-Turu, M; Bermudez, J; Bartrons, R; Perales, J C

    2003-10-01

    Although specific delivery to tissues and unique cell types in vivo has been demonstrated for many non-viral vectors, current methods are still inadequate for human applications, mainly because of limitations on their efficiencies. All the steps required for an efficient receptor-mediated gene transfer process may in principle be exploited to enhance targeted gene delivery. These steps are: DNA/vector binding, internalization, subcellular trafficking, vesicular escape, nuclear import, and unpacking either for transcription or other functions (i.e., antisense, RNA interference, etc.). The large variety of vector designs that are currently available, usually aimed at improving the efficiency of these steps, has complicated the evaluation of data obtained from specific derivatives of such vectors. The importance of the structure of the final vector and the consequences of design decisions at specific steps on the overall efficiency of the vector will be discussed in detail. We emphasize in this review that stability in serum and thus, proper bioavailability of vectors to their specific receptors may be the single greatest limiting factor on the overall gene transfer efficiency in vivo. We discuss current approaches to overcome the intrinsic instability of synthetic vectors in the blood. In this regard, a summary of the structural features of the vectors obtained from current protocols will be presented and their functional characteristics evaluated. Dissecting information on molecular conjugates obtained by such methodologies, when carefully evaluated, should provide important guidelines for the creation of effective, targeted and safe DNA therapeutics.

  6. Multiple Binding Modes between HNF4[alpha] and the LXXLL Motifs of PGC-1[alpha] Lead to Full Activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rha, Geun Bae; Wu, Guangteng; Shoelson, Steven E.

    2010-04-15

    Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a novel nuclear receptor that participates in a hierarchical network of transcription factors regulating the development and physiology of such vital organs as the liver, pancreas, and kidney. Among the various transcriptional coregulators with which HNF4{alpha} interacts, peroxisome proliferation-activated receptor {gamma} (PPAR{gamma}) coactivator 1{alpha} (PGC-1{alpha}) represents a novel coactivator whose activation is unusually robust and whose binding mode appears to be distinct from that of canonical coactivators such as NCoA/SRC/p160 family members. To elucidate the potentially unique molecular mechanism of PGC-1{alpha} recruitment, we have determined the crystal structure of HNF4{alpha} in complex with amore » fragment of PGC-1{alpha} containing all three of its LXXLL motifs. Despite the presence of all three LXXLL motifs available for interactions, only one is bound at the canonical binding site, with no additional contacts observed between the two proteins. However, a close inspection of the electron density map indicates that the bound LXXLL motif is not a selected one but an averaged structure of more than one LXXLL motif. Further biochemical and functional studies show that the individual LXXLL motifs can bind but drive only minimal transactivation. Only when more than one LXXLL motif is involved can significant transcriptional activity be measured, and full activation requires all three LXXLL motifs. These findings led us to propose a model wherein each LXXLL motif has an additive effect, and the multiple binding modes by HNF4{alpha} toward the LXXLL motifs of PGC-1{alpha} could account for the apparent robust activation by providing a flexible mechanism for combinatorial recruitment of additional coactivators and mediators.« less

  7. The Human Orphan Nuclear Receptor Tailless (TLX, NR2E1) Is Druggable

    PubMed Central

    Benod, Cindy; Villagomez, Rosa; Filgueira, Carly S.; Hwang, Peter K.; Leonard, Paul G.; Poncet-Montange, Guillaume; Rajagopalan, Senapathy; Fletterick, Robert J.; Gustafsson, Jan-Åke; Webb, Paul

    2014-01-01

    Nuclear receptors (NRs) are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1), a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC) derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD). Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP). Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal) assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3) that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open. PMID:24936658

  8. The human orphan nuclear receptor tailless (TLX, NR2E1) is druggable.

    PubMed

    Benod, Cindy; Villagomez, Rosa; Filgueira, Carly S; Hwang, Peter K; Leonard, Paul G; Poncet-Montange, Guillaume; Rajagopalan, Senapathy; Fletterick, Robert J; Gustafsson, Jan-Åke; Webb, Paul

    2014-01-01

    Nuclear receptors (NRs) are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1), a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC) derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD). Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP). Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal) assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3) that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open.

  9. Therapeutic uses of vitamin D analogues.

    PubMed

    Brown, A J

    2001-11-01

    The vitamin D endocrine system has been implicated in numerous biological activities throughout the body. The breadth and magnitude of vitamin D activity suggest potential therapeutic applications for the treatment of several diseases and disorders, including hyperproliferative diseases, immune dysfunction, endocrine disorders, and metabolic bone diseases. However, therapy using natural vitamin D hormone, 1,25-dihydroxyvitamin D(3) (1,25[OH](2)D(3)) has been precluded in most cases because of the potent calcemic activity shown by this hormone. Newly developed vitamin D analogues with lower calcemic activity have been shown to retain many therapeutic properties of 1,25(OH)(2)D(3). Molecular studies discussed in this article provide insights into the unique target cell specificity afforded by these analogues. In particular, the importance of the nuclear vitamin D receptor (VDR), serum vitamin D-binding protein, 24-hydroxylase, and membrane receptor is noted because analogue selectivity, specificity, and potency are afforded through their molecular interactions. The nuclear VDR has been isolated from a variety of target cells and tissues, suggesting that vitamin D compounds may have therapeutic potential throughout several body systems. Five vitamin D analogues have been approved for use in patients: calcipotriol (Dovonex; Leo Pharmaceuticals, Copenhagen, Denmark) for the treatment of psoriasis, 19-nor-1,25(OH)(2)D(2) (Zemplar; Abbott Laboratories, Abbott Park, IL) for secondary hyperparathyroidism, doxercalciferol (Hectorol; Bone Care Int, Madison, WI) for reduction of elevated parathyroid hormone levels, 22-oxacalcitriol (Maxacalcitol; Chugai Pharmaceuticals, Tokyo, Japan), and alfacalcidol. Several other analogues are currently being tested in preclinical and clinical trials for the treatment of various types of cancer and osteoporosis, as well as immunosuppression. Understanding how analogues exert their selective actions may allow for the design of more effective and safer vitamin D compounds for the treatment of a wide range of clinical disorders.

  10. Adaptability and selectivity of human peroxisome proliferator-activated receptor (PPAR) pan agonists revealed from crystal structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oyama, Takuji; Toyota, Kenji; Waku, Tsuyoshi

    2009-08-01

    The structures of the ligand-binding domains (LBDs) of human peroxisome proliferator-activated receptors (PPARα, PPARγ and PPARδ) in complexes with a pan agonist, an α/δ dual agonist and a PPARδ-specific agonist were determined. The results explain how each ligand is recognized by the PPAR LBDs at an atomic level. Peroxisome proliferator-activated receptors (PPARs) belong to the nuclear hormone receptor family, which is defined as transcriptional factors that are activated by the binding of ligands to their ligand-binding domains (LBDs). Although the three PPAR subtypes display different tissue distribution patterns and distinct pharmacological profiles, they all are essentially related to fatty-acid andmore » glucose metabolism. Since the PPARs share similar three-dimensional structures within the LBDs, synthetic ligands which simultaneously activate two or all of the PPARs could be potent candidates in terms of drugs for the treatment of abnormal metabolic homeostasis. The structures of several PPAR LBDs were determined in complex with synthetic ligands, derivatives of 3-(4-alkoxyphenyl)propanoic acid, which exhibit unique agonistic activities. The PPARα and PPARγ LBDs were complexed with the same pan agonist, TIPP-703, which activates all three PPARs and their crystal structures were determined. The two LBD–ligand complex structures revealed how the pan agonist is adapted to the similar, but significantly different, ligand-binding pockets of the PPARs. The structures of the PPARδ LBD in complex with an α/δ-selective ligand, TIPP-401, and with a related δ-specific ligand, TIPP-204, were also determined. The comparison between the two PPARδ complexes revealed how each ligand exhibits either a ‘dual selective’ or ‘single specific’ binding mode.« less

  11. Expression and subcellular localization of estrogen receptors α and β in human fetal brown adipose tissue.

    PubMed

    Velickovic, Ksenija; Cvoro, Aleksandra; Srdic, Biljana; Stokic, Edita; Markelic, Milica; Golic, Igor; Otasevic, Vesna; Stancic, Ana; Jankovic, Aleksandra; Vucetic, Milica; Buzadzic, Biljana; Korac, Bato; Korac, Aleksandra

    2014-01-01

    Brown adipose tissue (BAT) has the unique ability of generating heat due to the expression of mitochondrial uncoupling protein 1 (UCP1). A recent discovery regarding functional BAT in adult humans has increased interest in the molecular pathways of BAT development and functionality. An important role for estrogen in white adipose tissue was shown, but the possible role of estrogen in human fetal BAT (fBAT) is unclear. The objective of this study was to determine whether human fBAT expresses estrogen receptor α (ERα) and ERβ. In addition, we examined their localization as well as their correlation with crucial proteins involved in BAT differentiation, proliferation, mitochondriogenesis and thermogenesis including peroxisome proliferator-activated receptor γ (PPARγ), proliferating cell nuclear antigen (PCNA), PPARγ-coactivator-1α (PGC-1α), and UCP1. The fBAT was obtained from 4 human male fetuses aged 15, 17, 20, and 23 weeks gestation. ERα and ERβ expression was assessed using Western blotting, immunohistochemistry, and immunocytochemistry. Possible correlations with PPARγ, PCNA, PGC-1α, and UCP1 were examined by double immunofluorescence. Both ERα and ERβ were expressed in human fBAT, with ERα being dominant. Unlike ERβ, which was present only in mature brown adipocytes, we detected ERα in mature adipocytes, preadipocytes, mesenchymal and endothelial cells. In addition, double immunofluorescence supported the notion that differentiation in fBAT probably involves ERα. Immunocytochemical analysis revealed mitochondrial localization of both receptors. The expression of both ERα and ERβ in human fBAT suggests a role for estrogen in its development, primarily via ERα. In addition, our results indicate that fBAT mitochondria could be targeted by estrogens and pointed out the possible role of both ERs in mitochondriogenesis.

  12. Discovery of a Novel Prolactin in Non-Mammalian Vertebrates: Evolutionary Perspectives and Its Involvement in Teleost Retina Development

    PubMed Central

    Huang, Xigui; Hui, Michelle N. Y.; Liu, Yun; Yuen, Don S. H.; Zhang, Yong; Chan, Wood Yee; Lin, Hao Ran; Cheng, Shuk Han; Cheng, Christopher H. K.

    2009-01-01

    Background The three pituitary hormones, viz. prolactin (PRL), growth hormone (GH) and somatolactin (SL), together with the mammalian placental lactogen (PL), constitute a gene family of hormones with similar gene structure and encoded protein sequences. These hormones are believed to have evolved from a common ancestral gene through several rounds of gene duplication and subsequent divergence. Principal Findings In this study, we have identified a new PRL-like gene in non-mammalian vertebrates through bioinformatics and molecular cloning means. Phylogenetic analyses showed that this novel protein is homologous to the previously identified PRL. A receptor transactivation assay further showed that this novel protein could bind to PRL receptor to trigger the downstream post-receptor event, indicating that it is biologically active. In view of its close phylogenetic relationship with PRL and also its ability to activate PRL receptor, we name it as PRL2 and the previously identified PRL as PRL1. All the newly discovered PRL2 sequences possess three conserved disulfide linkages with the exception of the shark PRL2 which has only two. In sharp contrast to the classical PRL1 which is predominantly expressed in the pituitary, PRL2 was found to be mainly expressed in the eye and brain of the zebrafish but not in the pituitary. A largely reduced inner nuclear layer of the retina was observed after morpholino knockdown of zebrafish PRL2, indicating its role on retina development in teleost. Significance The discovery of this novel PRL has revitalized our understanding on the evolution of the GH/PRL/SL/PL gene family. Its unique expression and functions in the zebrafish eye also provide a new avenue of research on the neuroendocrine control of retina development in vertebrates. PMID:19584915

  13. Pharmacological evaluation of the mechanisms involved in increased adiposity in zebrafish triggered by the environmental contaminant tributyltin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ouadah-Boussouf, Nafia; Babin, Patrick J., E-mail: p.babin@gpp.u-bordeaux1.fr

    One proposed contributing factor to the rise in overweight and obesity is exposure to endocrine disrupting chemicals. Tributyltin chloride (TBT), an organotin, induces adipogenesis in cell culture models and may increases adipose mass in vivo in vertebrate model organisms. It has been hypothesized that TBT acts via the peroxisome proliferator activated receptor (PPAR)γ-dependent pathway. However, the mechanisms involved in the effects of TBT exposure on in vivo adipose tissue metabolism remain unexplored. Semitransparent zebrafish larvae, with their well-developed white adipose tissue, offer a unique opportunity for studying the effects of toxicant chemicals and pharmaceuticals on adipocyte biology and whole-organism adipositymore » in a vertebrate model. Within hours, zebrafish larvae, treated at environmentally-relevant nanomolar concentrations of TBT, exhibited a remarkable increase in adiposity linked to adipocyte hypertrophy. Under the experimental conditions used, we also demonstrated that zebrafish larvae adipose tissue proved to be highly responsive to selected human nuclear receptor agonists and antagonists. Retinoid X receptor (RXR) homodimers and RXR/liver X receptor heterodimers were suggested to be in vivo effectors of the obesogenic effect of TBT on zebrafish white adipose tissue. RXR/PPARγ heterodimers may be recruited to modulate adiposity in zebrafish but were not a necessary requirement for the short term in vivo TBT obesogenic effect. Together, the present results suggest that TBT may induce the promotion of triacylglycerol storage in adipocytes via RXR-dependent pathways without necessary using PPAR isoforms. - Highlights: • The environmental contaminant tributyltin (TBT) may promote obesity development. • TBT may induce adipocyte hypertrophy through a PPARγ independent mechanism. • RXR/RXR and RXR/LXR dimers are potential in vivo effectors of TBT in zebrafish.« less

  14. Bone anabolic effects of S-40503, a novel nonsteroidal selective androgen receptor modulator (SARM), in rat models of osteoporosis.

    PubMed

    Hanada, Keigo; Furuya, Kazuyuki; Yamamoto, Noriko; Nejishima, Hiroaki; Ichikawa, Kiyonoshin; Nakamura, Tsutomu; Miyakawa, Motonori; Amano, Seiji; Sumita, Yuji; Oguro, Nao

    2003-11-01

    A novel nonsteroidal androgen receptor (AR) binder, S-40503, was successfully generated in order to develop selective androgen receptor modulators (SARMs). We evaluated the binding specificity for nuclear receptors (NRs) and osteoanabolic activities of S-40503 in comparison with a natural nonaromatizable steroid, 5alpha-dihydrotestosterone (DHT). The compound preferentially bound to AR with nanomolar affinity among NRs. When S-40503 was administrated into orchiectomized (ORX) rats for 4 weeks, bone mineral density (BMD) of femur and muscle weight of levator ani were increased as markedly as DHT, but prostate weight was not elevated over the normal at any doses tested. In contrast, DHT administration caused about 1.5-fold increase in prostate weight. The reduced virilizing activity was clearly evident from the result that 4-week treatment of normal rats with S-40503 showed no enlargement of prostate. To confirm the bone anabolic effect, S-40503 was given to ovariectomized (OVX) rats for 2 months. The compound significantly increased the BMD and biomechanical strength of femoral cortical bone, whereas estrogen, anti-bone resorptive hormone, did not. The increase in periosteal mineral apposition rate (MAR) of the femur revealed direct bone formation activity of S-40503. It was unlikely that the osteoanabolic effect of the compound was attribute to the enhancement of muscle mass, because immobilized ORX rats treated with S-40503 showed a marked increase in BMD of tibial cortical bone without any actions on the surrounding muscle tissue. Collectively, our novel compound served as a prototype for SARMs, which had unique tissue selectivity with high potency for bone formation and lower impact upon sex accessory tissues.

  15. Nuclear receptor co-regulator Kruppel-like factor 9 and prohibitin 2 expression in estrogen-induced epithelial cell proliferation in the mouse uterus

    USDA-ARS?s Scientific Manuscript database

    Estrogen, acting through its cognate receptor estrogen receptor-' (ESR1), is a critical regulator of uterine endometrial epithelial proliferation. Although the dynamic communication between endometrial stromal (ST) and epithelial cells is considered to be an important component in this process, key ...

  16. Identifying Environmental Chemicals as Agonists of the Androgen Receptor by Applying a Quantitative High-throughput Screening Platform

    EPA Science Inventory

    Background: The androgen receptor (AR, NR3C4) is a nuclear receptor whose main function is acting as a transcription factor regulating gene expression for male sexual development and maintaining accessory sexual organ function. It is also a necessary component of female fertility...

  17. Fatty Acid-binding Proteins 1 and 2 Differentially Modulate the Activation of Peroxisome Proliferator-activated Receptor α in a Ligand-selective Manner*

    PubMed Central

    Hughes, Maria L. R.; Liu, Bonan; Halls, Michelle L.; Wagstaff, Kylie M.; Patil, Rahul; Velkov, Tony; Jans, David A.; Bunnett, Nigel W.; Scanlon, Martin J.; Porter, Christopher J. H.

    2015-01-01

    Nuclear hormone receptors (NHRs) regulate the expression of proteins that control aspects of reproduction, development and metabolism, and are major therapeutic targets. However, NHRs are ubiquitous and participate in multiple physiological processes. Drugs that act at NHRs are therefore commonly restricted by toxicity, often at nontarget organs. For endogenous NHR ligands, intracellular lipid-binding proteins, including the fatty acid-binding proteins (FABPs), can chaperone ligands to the nucleus and promote NHR activation. Drugs also bind FABPs, raising the possibility that FABPs similarly regulate drug activity at the NHRs. Here, we investigate the ability of FABP1 and FABP2 (intracellular lipid-binding proteins that are highly expressed in tissues involved in lipid metabolism, including the liver and intestine) to influence drug-mediated activation of the lipid regulator peroxisome proliferator-activated receptor (PPAR) α. We show by quantitative fluorescence imaging and gene reporter assays that drug binding to FABP1 and FABP2 promotes nuclear localization and PPARα activation in a drug- and FABP-dependent manner. We further show that nuclear accumulation of FABP1 and FABP2 is dependent on the presence of PPARα. Nuclear accumulation of FABP on drug binding is driven largely by reduced nuclear egress rather than an increased rate of nuclear entry. Importin binding assays indicate that nuclear access occurs via an importin-independent mechanism. Together, the data suggest that specific drug-FABP complexes can interact with PPARα to effect nuclear accumulation of FABP and NHR activation. Because FABPs are expressed in a regionally selective manner, this may provide a means to tailor the patterns of NHR drug activation in a tissue-specific manner. PMID:25847235

  18. Fatty Acid-binding Proteins 1 and 2 Differentially Modulate the Activation of Peroxisome Proliferator-activated Receptor α in a Ligand-selective Manner.

    PubMed

    Hughes, Maria L R; Liu, Bonan; Halls, Michelle L; Wagstaff, Kylie M; Patil, Rahul; Velkov, Tony; Jans, David A; Bunnett, Nigel W; Scanlon, Martin J; Porter, Christopher J H

    2015-05-29

    Nuclear hormone receptors (NHRs) regulate the expression of proteins that control aspects of reproduction, development and metabolism, and are major therapeutic targets. However, NHRs are ubiquitous and participate in multiple physiological processes. Drugs that act at NHRs are therefore commonly restricted by toxicity, often at nontarget organs. For endogenous NHR ligands, intracellular lipid-binding proteins, including the fatty acid-binding proteins (FABPs), can chaperone ligands to the nucleus and promote NHR activation. Drugs also bind FABPs, raising the possibility that FABPs similarly regulate drug activity at the NHRs. Here, we investigate the ability of FABP1 and FABP2 (intracellular lipid-binding proteins that are highly expressed in tissues involved in lipid metabolism, including the liver and intestine) to influence drug-mediated activation of the lipid regulator peroxisome proliferator-activated receptor (PPAR) α. We show by quantitative fluorescence imaging and gene reporter assays that drug binding to FABP1 and FABP2 promotes nuclear localization and PPARα activation in a drug- and FABP-dependent manner. We further show that nuclear accumulation of FABP1 and FABP2 is dependent on the presence of PPARα. Nuclear accumulation of FABP on drug binding is driven largely by reduced nuclear egress rather than an increased rate of nuclear entry. Importin binding assays indicate that nuclear access occurs via an importin-independent mechanism. Together, the data suggest that specific drug-FABP complexes can interact with PPARα to effect nuclear accumulation of FABP and NHR activation. Because FABPs are expressed in a regionally selective manner, this may provide a means to tailor the patterns of NHR drug activation in a tissue-specific manner. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Liver X receptor alpha regulates fatty acid synthase expression in chicken.

    PubMed

    Demeure, O; Duby, C; Desert, C; Assaf, S; Hazard, D; Guillou, H; Lagarrigue, S

    2009-12-01

    Liver X receptor alpha (LXRalpha), also referred to as nuclear receptor subfamily 1, group H, member 3 is a member of the nuclear hormone receptor superfamily, and has recently been shown to act as a master transcription factor governing hepatic lipogenesis in mammals. Liver X receptor alpha directly regulates both the expression of other lipogenic transcription factors and the expression of lipogenic enzymes, thereby enhancing hepatic fatty acid synthesis (FASN). In birds, like in humans, fatty acid synthesis primarily occurs in the liver. Whether LXRalpha is involved in hepatic regulation of lipogenic genes remained to be investigated in this species. Here we show that fatty acid synthase and the expression of other lipogenic genes (sterol regulatory element binding protein 1 and steroyl coenzyme A desaturase 1) are induced in chicken hepatoma cells in response to a pharmacological liver X receptor agonist, T0901317. A detailed analysis of the chicken FASN promoter revealed a functional liver X response element. These data define the chicken FASN gene as a direct target of LXRalpha and further expand the role of LXRalpha as a regulator of lipid metabolism in this species.

  20. Progesterone receptors in the female lower urinary tract

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Batra, S.C.; Iosif, C.S.

    1987-11-01

    When female estrogenized rabbits were injected i.v. with /sup 3/H-progesterone, the tritium concentration determined after one hour was about two to three times higher in urethra, urinary bladder and vagina than in the heart. High affinity progesterone receptors (KD = 1-2 nM) could be demonstrated in both cytoplasmic and nuclear fractions prepared from estrogenized rabbit urethra, bladder and vagina. The cytosolic receptor concentration in both urethra and bladder was about half of that in the vagina. The concentration of nuclear receptors in urethra was not significantly different from that in the vagina, but in the bladder the concentration was onlymore » about one fourth of that in the vagina or urethra. The mean KD of cytosolic receptors from bladder was significantly higher than the corresponding values in urethra and vagina. Progesterone binding sites in the bladder had a broader hormonal specificity than those in the urethra or vagina. The present demonstration of specific progesterone receptors in the female urethra might provide a possible link between estrogen progesterone interaction and the appearance of urinary incontinence during pregnancy in women.« less

  1. Ligand-specific Deactivation Time Course of GluN1/GluN2D NMDA Receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    K Vance; N Simorowski; S Traynelis

    2011-12-31

    N-methyl-D-aspartate (NMDA) receptors belong to the family of ionotropic glutamate receptors that mediate a majority of excitatory synaptic transmission. One unique property of GluN1/GluN2D NMDA receptors is an unusually prolonged deactivation time course following the removal of L-glutamate. Here we show, using x-ray crystallography and electrophysiology, that the deactivation time course of GluN1/GluN2D receptors is influenced by the conformational variability of the ligand-binding domain (LBD) as well as the structure of the activating ligand. L-glutamate and L-CCG-IV induce significantly slower deactivation time courses compared with other agonists. Crystal structures of the isolated GluN2D LBD in complex with various ligands revealmore » that the binding of L-glutamate induces a unique conformation at the backside of the ligand-binding site in proximity to the region at which the transmembrane domain would be located in the intact receptors. These data suggest that the activity of the GluN1/GluN2D NMDA receptor is controlled distinctively by the endogenous neurotransmitter L-glutamate.« less

  2. Effects of different ligands on epidermal growth factor receptor (EGFR) nuclear translocation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Faria, Jerusa A.Q.A.; Andrade, Carolina de; Goes, Alfredo M.

    The epidermal growth factor receptor (EGFR) is activated through binding to specific ligands and generates signals for proliferation, differentiation, migration, and cell survival. Recent data show the role of nuclear EGFR in tumors. Although many EGFR ligands are upregulated in cancers, little is known about their effects on EGFR nuclear translocation. We have compared the effects of six EGFR ligands (EGF, HB-EGF, TGF-α, β-Cellulin, amphiregulin, and epiregulin) on nuclear translocation of EGFR, receptor phosphorylation, migration, and proliferation. Cell fractionation and confocal immunofluorescence detected EGFR in the nucleus after EGF, HB-EGF, TGF-α and β-Cellulin stimulation in a dose-dependent manner. In contrast,more » amphiregulin and epiregulin did not generate nuclear translocation of EGFR. EGF, HB-EGF, TGF-α and β-Cellulin showed correlations between a higher rate of wound closure and increased phosphorylation of residues in the carboxy-terminus of EGFR, compared to amphiregulin and epiregulin. The data indicate that EGFR is translocated to the nucleus after stimulation with EGF, HB-EGF, TGF-α and β-Cellulin, and that these ligands are related to increased phosphorylation of EGFR tyrosine residues, inducing migration of SkHep-1 cells. - Highlights: • EGF, HB-EGF, TGF-α, β-Cellulin are involved in the EGFR nuclear translocation. • Amphiregulin and epiregulin did not promote nuclear translocation of EGFR. • EGF, HB-EGF, TGF-α and β-Cellulin have a role in SkHep-1 cells migration. • EGFR ligands associated with better prognosis don't stimulate EGFR translocation.« less

  3. Monomer/Dimer Transition of the Caspase-Recruitment Domain of Human Nod1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srimathi,T.; Robbins, S.; Dubas, R.

    2008-01-01

    Nod1 is an essential cytoplasmic sensor for bacterial peptidoglycans in the innate immune system. The caspase-recruitment domain of Nod1 (Nod1{_}CARD) is indispensable for recruiting a downstream kinase, receptor-interacting protein 2 (RIP2), that activates nuclear factor-?B (NF-?B). The crystal structure of human Nod1{_}CARD at 1.9 Angstroms resolution reveals a novel homodimeric conformation. Our structural and biochemical analysis shows that the homodimerization of Nod1{_}CARD is achieved by swapping the H6 helices at the carboxy termini and stabilized by forming an interchain disulfide bond between the Cys39 residues of the two monomers in solution and in the crystal. In addition, we present experimentalmore » evidence for a pH-sensitive conformational change of Nod1{_}CARD. Our results suggest that the pH-sensitive monomer/dimer transition is a unique molecular property of Nod1{_}CARD.« less

  4. Epidemiological transition of colorectal cancer in developing countries: Environmental factors, molecular pathways, and opportunities for prevention

    PubMed Central

    Bishehsari, Faraz; Mahdavinia, Mahboobeh; Vacca, Michele; Malekzadeh, Reza; Mariani-Costantini, Renato

    2014-01-01

    Colorectal cancer (CRC) is one of the leading causes of cancer and cancer-related mortality worldwide. The disease has been traditionally a major health problem in industrial countries, however the CRC rates are increasing in the developing countries that are undergoing economic growth. Several environmental risk factors, mainly changes in diet and life style, have been suggested to underlie the rise of CRC in these populations. Diet and lifestyle impinge on nuclear receptors, on the intestinal microbiota and on crucial molecular pathways that are implicated in intestinal carcinogenesis. In this respect, the epidemiological transition in several regions of the world offers a unique opportunity to better understand CRC carcinogenesis by studying the disease phenotypes and their environmental and molecular associations in different populations. The data from these studies may have important implications for the global prevention and treatment of CRC. PMID:24876728

  5. daf-16: An HNF-3/forkhead family member that can function to double the life-span of Caenorhabditis elegans.

    PubMed

    Lin, K; Dorman, J B; Rodan, A; Kenyon, C

    1997-11-14

    The wild-type Caenorhabditis elegans nematode ages rapidly, undergoing development, senescence, and death in less than 3 weeks. In contrast, mutants with reduced activity of the gene daf-2, a homolog of the insulin and insulin-like growth factor receptors, age more slowly than normal and live more than twice as long. These mutants are active and fully fertile and have normal metabolic rates. The life-span extension caused by daf-2 mutations requires the activity of the gene daf-16. daf-16 appears to play a unique role in life-span regulation and encodes a member of the hepatocyte nuclear factor 3 (HNF-3)/forkhead family of transcriptional regulators. In humans, insulin down-regulates the expression of certain genes by antagonizing the activity of HNF-3, raising the possibility that aspects of this regulatory system have been conserved.

  6. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  7. Targeting of the Nuclear Receptor Coactivator Isoform DELTA3AIB1 in Breast Cancer

    DTIC Science & Technology

    2007-03-01

    lab showed that the downregulation of overall levels of AIB1 plus ∆3AIB1, using a regulatable AIB1 directed ribozyme , resulted in reduced tumor...overall levels of AIB1 plus ∆3AIB1, using a regulatable AIB1 directed ribozyme , resulted in reduced tumor growth in vivo. Overall, these data indicate a...Reiter R, Powers C, Wellstein A, Riegel AT. Ribozyme targeting shows that the nuclear receptor coactivator AIB1 is a rate-limiting factor for estrogen

  8. Nuclear hormone receptors in parasitic helminths

    PubMed Central

    Wu, Wenjie; LoVerde, Philip T

    2010-01-01

    Nuclear receptors (NRs) belong to a large protein superfamily that are important transcriptional modulators in metazoans. Parasitic helminths include parasitic worms from the Lophotrochozoa (Platyhelminths) and Ecdysozoa (Nematoda). NRs in parasitic helminths diverged into two different evolutionary lineages. NRs in parasitic Platyhelminths have orthologues in Deuterostomes, in arthropods or both with a feature of extensive gene loss and gene duplication within different gene groups. NRs in parasitic Nematoda follow the nematode evolutionary lineage with a feature of multiple duplication of SupNRs and gene loss. PMID:20600585

  9. Changes in nuclear receptor corepressor RIP140 do not influence mitochondrial content in the cortex.

    PubMed

    Herbst, Eric A F; Bonen, Arend; Holloway, Graham P

    2015-10-01

    Changes in nuclear receptor interacting protein 140 (RIP140) influences mitochondrial content in skeletal muscle; however, the translation of these findings to the brain has not been investigated. The present study examined the impact of overexpressing and ablating RIP140 on mitochondrial content in muscle and the cortex through examining mRNA, mtDNA, and mitochondrial protein content. Our results show that changes in RIP140 expression significantly alters markers of mitochondrial content in skeletal muscle but not the brain.

  10. Structural basis for corepressor assembly by the orphan nuclear receptor TLX

    PubMed Central

    Zhou, X. Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten

    2015-01-01

    The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. PMID:25691470

  11. Nuclear receptor ERR alpha and coactivator PGC-1 beta are effectors of IFN-gamma-induced host defense.

    PubMed

    Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M

    2007-08-01

    Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

  12. Abnormal XPD-induced nuclear receptor transactivation in DNA repair disorders: trichothiodystrophy and xeroderma pigmentosum.

    PubMed

    Zhou, Xiaolong; Khan, Sikandar G; Tamura, Deborah; Ueda, Takahiro; Boyle, Jennifer; Compe, Emmanuel; Egly, Jean-Marc; DiGiovanna, John J; Kraemer, Kenneth H

    2013-08-01

    XPD (ERCC2) is a DNA helicase involved in nucleotide excision repair and in transcription as a structural bridge tying the transcription factor IIH (TFIIH) core with the cdk-activating kinase complex, which phosphorylates nuclear receptors. Mutations in XPD are associated with several different phenotypes, including trichothiodystrophy (TTD), with sulfur-deficient brittle hair, bone defects, and developmental abnormalities without skin cancer, xeroderma pigmentosum (XP), with pigmentary abnormalities and increased skin cancer, or XP/TTD with combined features, including skin cancer. We describe the varied clinical features and mutations in nine patients examined at the National Institutes of Health who were compound heterozygotes for XPD mutations but had different clinical phenotypes: four TTD, three XP, and two combined XP/TTD. We studied TFIIH-dependent transactivation by nuclear receptor for vitamin D (VDR) and thyroid in cells from these patients. The vitamin D stimulation ratio of CYP24 and osteopontin was associated with specific pairs of mutations (reduced in 5, elevated in 1) but not correlated with distinct clinical phenotypes. Thyroid receptor stimulation ratio for KLF9 was not significantly different from normal. XPD mutations frequently were associated with abnormal VDR stimulation in compound heterozygote patients with TTD, XP, or XP/TTD.

  13. Structural basis for corepressor assembly by the orphan nuclear receptor TLX

    DOE PAGES

    Zhi, Xiaoyong; Zhou, X. Edward; He, Yuanzheng; ...

    2015-02-15

    The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conservedmore » ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression.« less

  14. The role of interleukin-8 (IL-8) and IL-8 receptors in platinum response in high grade serous ovarian carcinoma

    PubMed Central

    Stronach, Euan A.; Cunnea, Paula; Turner, Christina; Guney, Tankut; Aiyappa, Radhika; Jeyapalan, Senthuran; de Sousa, Camila H.; Browne, Alacoque; Magdy, Nesreen; Studd, James B.; Sriraksa, Ruethairat; Gabra, Hani; El-Bahrawy, Mona

    2015-01-01

    Platinum based drugs are the cornerstone of chemotherapy for ovarian cancer, however the development of chemoresistance hinders its success. IL-8 is involved in regulating several pro-survival pathways in cancer. We studied the expression of IL-8 and IL-8 receptors in platinum sensitive and resistant cell lines. Using qRT-PCR and immunohistochemistry, both platinum sensitive (PEA1, PEO14) and resistant (PEA2, PEO23) show increased expression of IL-8 and IL-8 receptors. IL-8RA shows nuclear and cytoplasmic expression, whilst IL-8RB is present solely in the cytoplasm. Knockdown of IL-8 increased sensitivity to cisplatin in platinum sensitive and reversed platinum resistance in resistant cell lines, decreased the expression of anti-apoptotic Bcl-2 and decreased inhibitory phosphorylation of pro-apoptotic Bad. IL-8 receptor antagonist treatment also enhanced platinum sensitivity. Nuclear localisation of IL-8RA was only detected in platinum resistant tumours. Inhibition of IL-8 signalling can enhance response in platinum sensitive and resistant disease. Nuclear IL-8RA may have potential as a biomarker of resistant disease. PMID:26267317

  15. The role of interleukin-8 (IL-8) and IL-8 receptors in platinum response in high grade serous ovarian carcinoma.

    PubMed

    Stronach, Euan A; Cunnea, Paula; Turner, Christina; Guney, Tankut; Aiyappa, Radhika; Jeyapalan, Senthuran; de Sousa, Camila H; Browne, Alacoque; Magdy, Nesreen; Studd, James B; Sriraksa, Ruethairat; Gabra, Hani; El-Bahrawy, Mona

    2015-10-13

    Platinum based drugs are the cornerstone of chemotherapy for ovarian cancer, however the development of chemoresistance hinders its success. IL-8 is involved in regulating several pro-survival pathways in cancer. We studied the expression of IL-8 and IL-8 receptors in platinum sensitive and resistant cell lines. Using qRT-PCR and immunohistochemistry, both platinum sensitive (PEA1, PEO14) and resistant (PEA2, PEO23) show increased expression of IL-8 and IL-8 receptors. IL-8RA shows nuclear and cytoplasmic expression, whilst IL-8RB is present solely in the cytoplasm. Knockdown of IL-8 increased sensitivity to cisplatin in platinum sensitive and reversed platinum resistance in resistant cell lines, decreased the expression of anti-apoptotic Bcl-2 and decreased inhibitory phosphorylation of pro-apoptotic Bad. IL-8 receptor antagonist treatment also enhanced platinum sensitivity. Nuclear localisation of IL-8RA was only detected in platinum resistant tumours. Inhibition of IL-8 signalling can enhance response in platinum sensitive and resistant disease. Nuclear IL-8RA may have potential as a biomarker of resistant disease.

  16. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  17. In Vitro Evaluation of Molecular Tumor Targets in Nuclear Medicine: Immunohistochemistry Is One Option, but Under Which Conditions?

    PubMed

    Reubi, Jean Claude

    2017-12-01

    The identification of new molecular targets for diagnostic and therapeutic applications using in vitro methods is an important challenge in nuclear medicine. One such method is immunohistochemistry, increasingly popular because it is easy to perform. This review presents the case for conducting receptor immunohistochemistry to evaluate potential molecular targets in human tumor tissue sections. The focus is on the immunohistochemistry of G-protein-coupled receptors, one of the largest families of cell surface proteins, representing a major class of drug targets and thus playing an important role in nuclear medicine. This review identifies common pitfalls and challenges and provides guidelines on performing such immunohistochemical studies. An appropriate validation of the target is a prerequisite for developing robust and informative new molecular probes. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

  18. Nmd3p Is a Crm1p-Dependent Adapter Protein for Nuclear Export of the Large Ribosomal Subunit

    PubMed Central

    Ho, Jennifer Hei-Ngam; Kallstrom, George; Johnson, Arlen W.

    2000-01-01

    In eukaryotic cells, nuclear export of nascent ribosomal subunits through the nuclear pore complex depends on the small GTPase Ran. However, neither the nuclear export signals (NESs) for the ribosomal subunits nor the receptor proteins, which recognize the NESs and mediate export of the subunits, have been identified. We showed previously that Nmd3p is an essential protein from yeast that is required for a late step in biogenesis of the large (60S) ribosomal subunit. Here, we show that Nmd3p shuttles and that deletion of the NES from Nmd3p leads to nuclear accumulation of the mutant protein, inhibition of the 60S subunit biogenesis, and inhibition of the nuclear export of 60S subunits. Moreover, the 60S subunits that accumulate in the nucleus can be coimmunoprecipitated with the NES-deficient Nmd3p. 60S subunit biogenesis and export of truncated Nmd3p were restored by the addition of an exogenous NES. To identify the export receptor for Nmd3p we show that Nmd3p shuttling and 60S export is blocked by the Crm1p-specific inhibitor leptomycin B. These results identify Crm1p as the receptor for Nmd3p export. Thus, export of the 60S subunit is mediated by the adapter protein Nmd3p in a Crm1p-dependent pathway. PMID:11086007

  19. Nuclear Receptors, Mitochondria, and Lipid Metabolism

    PubMed Central

    Alaynick, William A.

    2009-01-01

    Lipid metabolism is a continuum from emulsification and uptake of lipids in the intestine to cellular uptake and transport to compartments such as mitochondria. Whether fats are shuttled into lipid droplets in adipose tissue or oxidized in mitochondria and peroxisomes depends on metabolic substrate availability, energy balance and endocrine signaling of the organism. Several members of the nuclear hormone receptor superfamily are lipid-sensing factors that affect all aspects of lipid metabolism. The physiologic actions of glandular hormones (e.g. thyroid, mineralocorticoid and glucocorticoid), vitamins (e.g. vitamins A and D) and reproductive hormones (e.g. progesterone, estrogen and testosterone) and their cognate receptors are well established. The peroxisome proliferator activated receptors (PPARs) and Liver X receptors (LXRs), acting in concert with PPARγ Coactivator 1α (PGC-1α), have been shown to regulate insulin sensitivity and lipid handling. These receptors are the focus of intense pharmacologic studies to expand the armamentarium of small molecule ligands to treat diabetes and the metabolic syndrome (hypertension, insulin resistance, hyperglycemia, dyslipidemia, and obesity). Recently, additional partners of PGC-1α have moved to the forefront of metabolic research, the Estrogen-related Receptors (ERRs). Although no endogenous ligands for these receptors have been identified, phenotypic analyses of knockout mouse models demonstrate an important role for these molecules in substrate sensing and handling as well as mitochondrial function. PMID:18375192

  20. Detection of pAkt protein in imprint cytology of invasive breast cancer: Correlation with HER2/neu, hormone receptors, and other clinicopathological variables

    PubMed Central

    Vasou, Olympia; Skagias, Lazaros; Anastasia, Margariti; Paulina, Athanasiadou; Patsouris, Efstratios; Politi, Ekaterini

    2015-01-01

    Purpose: Akt is a serine/threonine protein kinase and has emerged as a crucial regulator of widely divergent cellular processes, including apoptosis, proliferation, differentiation, and metabolism. Activation of Akt/protein kinase B has been positively associated with human epidermal growth-factor receptor 2 (HER2)/neu overexpression in breast carcinoma and a worse outcome among endocrine treated patients. The Akt signaling pathway currently attracts considerable attention as a new target for effective therapeutic strategies. We therefore investigated the relationship between activation of Akt and clinicopathologic variables including hormone receptor and HER2/neu status. Methods: Archival tumor tissues from 100 patients with invasive breast carcinoma were analyzed by immunocytochemistry. This study describes the results of immunocytochemical pAkt expression in breast carcinoma imprints, prepared from cut surfaces of freshly removed tumors. Both nuclear and cytoplasmic expressions were evaluated for pAkt. Results: Nuclear and cytoplasmic positive scores of 72% (72/100) and 42% (42/100), respectively, were found. Coexistence of nuclear and cytoplasmic staining was observed in 32 cases (32/100). Nuclear positive staining correlated with HER2/neu overexpression (P = 0.043) and was significantly associated with positive involvement of axillary lymph nodes (P = 0.013). No correlation was found between cytoplasmic pAkt rate and clinicopathological parameters, estrogen receptor, progesterone receptor or HER2/neu expression. Conclusions: pAkt expression can be evaluated in cytological material and may add valuable information to current prognostic models for breast cancer. pAkt overexpression appears to be linked with potentially aggressive tumor phenotype in invasive breast carcinoma. PMID:25838835

  1. Smoking, Sex, and Non-Small Cell Lung Cancer: Steroid Hormone Receptors in Tumor Tissue (S0424).

    PubMed

    Cheng, Ting-Yuan David; Darke, Amy K; Redman, Mary W; Zirpoli, Gary R; Davis, Warren; Payne Ondracek, Rochelle; Bshara, Wiam; Omilian, Angela R; Kratzke, Robert; Reid, Mary E; Molina, Julian R; Kolesar, Jill M; Chen, Yuhchyau; MacRae, Robert M; Moon, James; Mack, Philip; Gandara, David R; Kelly, Karen; Santella, Regina M; Albain, Kathy S; Ambrosone, Christine B

    2018-01-13

    To what extent steroid hormones contribute to lung cancer in male and female never smokers and smokers is unclear. We examined expression of hormone receptors in lung tumors by sex and smoking. Patients with primary non-small cell lung cancer were recruited into an Intergroup study in the United States and Canada, led by SWOG (S0424). Tumors from 813 cases (450 women and 363 men) were assayed using immunohistochemistry for estrogen receptor (ER)-α, ER-β, progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2). Linear regression was used to examine differences in expression by sex and smoking status. Cox proportional hazard models were used to estimate survival associated with the receptors. All statistical tests were two-sided. In ever smokers, postmenopause and oral contraceptive use were associated with lower nuclear ER-β (P = .02) and total (nuclear + cytoplasmic) PR expression (P = .02), respectively. Women had lower cytoplasmic ER-α (regression coefficient [β], or differences in H-scores = -15.8, P = .003) and nuclear ER-β (β = -12.8, P = .04) expression than men, adjusting for age, race, and smoking. Ever smokers had both higher cytoplasmic ER-α (β = 45.0, P < .001) and ER-β (β = 25.9, P < .001) but lower total PR (β = -42.1, P < .001) than never smokers. Higher cytoplasmic ER-α and ER-β were associated with worse survival (hazard ratio = 1.73, 95% confidence interval [CI] = 1.15 to 2.58, and HR = 1.59, 95% CI = 1.08 to 2.33, respectively; quartiles 4 vs 1). Lower expression of nuclear ER-β in women supports the estrogen hypothesis in lung cancer etiology. Increasing cytoplasmic ER-α and ER-β and decreasing PR protein expression may be mechanisms whereby smoking disrupts hormone pathways. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  2. Stimulating the GPR30 estrogen receptor with a novel tamoxifen analogue activates SF-1 and promotes endometrial cell proliferation.

    PubMed

    Lin, Benjamin C; Suzawa, Miyuki; Blind, Raymond D; Tobias, Sandra C; Bulun, Serdar E; Scanlan, Thomas S; Ingraham, Holly A

    2009-07-01

    Estrogens and selective estrogen receptor (ER) modulators such as tamoxifen are known to increase uterine cell proliferation. Mounting evidence suggests that estrogen signaling is mediated not only by ERalpha and ERbeta nuclear receptors, but also by GPR30 (GPER), a seven transmembrane (7TM) receptor. Here, we report that primary human endometriotic H-38 cells express high levels of GPR30 with no detectable ERalpha or ERbeta. Using a novel tamoxifen analogue, STX, which activates GPR30 but not ERs, significant stimulation of the phosphatidylinositol 3-kinase (PI3K) and mitogen-activated protein kinase (MAPK) pathways was observed in H-38 cells and in Ishikawa endometrial cancer cells expressing GPR30; a similar effect was observed in JEG3 choriocarcinoma cells. STX treatment also increased cellular pools of phosphatidylinositol (3,4,5) triphosphate, a proposed ligand for the nuclear hormone receptor SF-1 (NR5A1). Consistent with these findings, STX, tamoxifen, and the phytoestrogen genistein were able to increase SF-1 transcription, promote Ishikawa cell proliferation, and induce the SF-1 target gene aromatase in a GPR30-dependent manner. Our findings suggest a novel signaling paradigm that is initiated by estrogen activation of the 7TM receptor GPR30, with signal transduction cascades (PI3K and MAPK) converging on nuclear hormone receptors (SF-1/LRH-1) to modulate their transcriptional output. We propose that this novel GPR30/SF-1 pathway increases local concentrations of estrogen, and together with classic ER signaling, mediate the proliferative effects of synthetic estrogens such as tamoxifen, in promoting endometriosis and endometrial cancers.

  3. Molecular characterization of human thyroid hormone receptor β isoform 4.

    PubMed

    Moriyama, Kenji; Yamamoto, Hiroyuki; Futawaka, Kumi; Atake, Asami; Kasahara, Masato; Tagami, Tetsuya

    2016-01-01

    Thyroid hormone exerts a pleiotropic effect on development, differentiation, and metabolism through thyroid hormone receptor (TR). A novel thyroid hormone receptor β isoform (TRβ4) was cloned using PCR from a human pituitary cDNA library as a template. We report here the characterization of TRβ4 from a molecular basis. Temporal expression of TRβ4 during the fetal period is abundant in the brain and kidney, comparable with the adult pattern. Western blot analysis revealed that TRs are ubiquitination labile proteins, while TRβ1 is potentially stable. TRβ1, peroxisome proliferator-activated receptors (PPAR), and vitamin D receptor (VDR), which belong to class II transcription factors that function via the formation of heterodimeric complexes with retinoid X receptor (RXR), were suppressed by TRβ4 in a dose-dependent manner. Thus, TRβ4 exhibits ligand-independent transcriptional silencing, possibly as a substitute for dimerized RXR. In this study, TRβ1 and TRβ4 transcripts were detected in several cell lines. Quantitative RT-PCR assay showed that the expression of TRβ4 in human embryonic carcinoma cells of the testis was suppressed by sex hormone in a reciprocal manner to TRβ1. In contrast, TRβ4 was expressed under a high dose of triiodothyronine (T3) in a reciprocal manner to TRβ1. Finally, in transiently transfected NIH-3T3 cells, green fluorescence protein (GFP)-tagged TRβ4 was mostly nuclear in both the absence and the presence of T3. By mutating defined regions of both TRβs, we found that both TRβ1 and TRβ4 had altered nuclear/cytoplasmic distribution as compared with wild-type, and different to T3 and the nuclear receptor corepressor (NCoR). Thus, site-specific DNA binding is not essential for maintaining TRβs within the nucleus.

  4. The Orphan Nuclear Receptor TLX Is an Enhancer of STAT1-Mediated Transcription and Immunity to Toxoplasma gondii.

    PubMed

    Beiting, Daniel P; Hidano, Shinya; Baggs, Julie E; Geskes, Jeanne M; Fang, Qun; Wherry, E John; Hunter, Christopher A; Roos, David S; Cherry, Sara

    2015-07-01

    The protozoan parasite, Toxoplasma, like many intracellular pathogens, suppresses interferon gamma (IFN-γ)-induced signal transducer and activator of transcription 1 (STAT1) activity. We exploited this well-defined host-pathogen interaction as the basis for a high-throughput screen, identifying nine transcription factors that enhance STAT1 function in the nucleus, including the orphan nuclear hormone receptor TLX. Expression profiling revealed that upon IFN-γ treatment TLX enhances the output of a subset of IFN-γ target genes, which we found is dependent on TLX binding at those loci. Moreover, infection of TLX deficient mice with the intracellular parasite Toxoplasma results in impaired production of the STAT1-dependent cytokine interleukin-12 by dendritic cells and increased parasite burden in the brain during chronic infection. These results demonstrate a previously unrecognized role for this orphan nuclear hormone receptor in regulating STAT1 signaling and host defense and reveal that STAT1 activity can be modulated in a context-specific manner by such "modifiers."

  5. Importance of the pharmacological profile of the bound ligand in enrichment on nuclear receptors: toward the use of experimentally validated decoy ligands.

    PubMed

    Lagarde, Nathalie; Zagury, Jean-François; Montes, Matthieu

    2014-10-27

    The evaluation of virtual ligand screening methods is of major importance to ensure their reliability. Taking into account the agonist/antagonist pharmacological profile should improve the quality of the benchmarking data sets since ligand binding can induce conformational changes in the nuclear receptor structure and such changes may vary according to the agonist/antagonist ligand profile. We indeed found that splitting the agonist and antagonist ligands into two separate data sets for a given nuclear receptor target significantly enhances the quality of the evaluation. The pharmacological profile of the ligand bound in the binding site of the target structure was also found to be an additional critical parameter. We also illustrate that active compound data sets for a given pharmacological activity can be used as a set of experimentally validated decoy ligands for another pharmacological activity to ensure a reliable and challenging evaluation of virtual screening methods.

  6. Dioxin Toxicity In Vivo Results from an Increase in the Dioxin-Independent Transcriptional Activity of the Aryl Hydrocarbon Receptor

    PubMed Central

    Céspedes, Miguel Angel; Galindo, Maximo Ibo; Couso, Juan Pablo

    2010-01-01

    The Aryl hydrocarbon receptor (Ahr) is the nuclear receptor mediating the toxicity of dioxins -widespread and persistent pollutants whose toxic effects include tumor promotion, teratogenesis, wasting syndrome and chloracne. Elimination of Ahr in mice eliminates dioxin toxicity but also produces adverse effects, some seemingly unrelated to dioxin. Thus the relationship between the toxic and dioxin-independent functions of Ahr is not clear, which hampers understanding and treatment of dioxin toxicity. Here we develop a Drosophila model to show that dioxin actually increases the in vivo dioxin-independent activity of Ahr. This hyperactivation resembles the effects caused by an increase in the amount of its dimerisation partner Ahr nuclear translocator (Arnt) and entails an increased transcriptional potency of Ahr, in addition to the previously described effect on nuclear translocation. Thus the two apparently different functions of Ahr, dioxin-mediated and dioxin-independent, are in fact two different levels (hyperactivated and basal, respectively) of a single function. PMID:21079739

  7. Transcriptional regulation of human Paraoxonase 1 by nuclear receptors.

    PubMed

    Ponce-Ruiz, N; Murillo-González, F E; Rojas-García, A E; Mackness, Mike; Bernal-Hernández, Y Y; Barrón-Vivanco, B S; González-Arias, C A; Medina-Díaz, I M

    2017-04-25

    Paraoxonase 1 (PON1) is a calcium-dependent lactonase synthesized primarily in the liver and secreted into the plasma, where it is associates with high density lipoproteins (HDL). PON1 acts as antioxidant preventing low-density lipoprotein (LDL) oxidation, a process considered critical in the initiation and progression of atherosclerosis. Additionally, PON1 hydrolyzes and detoxifies some toxic metabolites of organophosphorus compounds (OPs). Thus, PON1 activity and expression levels are important for determining susceptibility to OPs intoxication and risk of developing diseases related to inflammation and oxidative stress. Increasing evidence has demonstrated the modulation of PON1 expression by many factors is due to interaction with nuclear receptors (NRs). Here, we briefly review the studies in this area and discuss the role of nuclear receptors in the regulation of PON1 expression, as well as how understanding these mechanisms may allow us to manipulate PON1 levels to improve drug efficacy and treat disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Smad Signaling Dynamics: Insights from a Parsimonious Model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiley, H. S.; Shankaran, Harish

    2008-09-09

    The molecular mechanisms that transmit information from cell surface receptors to the nucleus are exceedingly complex; thus, much effort has been expended in developing computational models to understand these processes. A recent study on modeling the nuclear-cytoplasmic shuttling of Smad2-Smad4 complexes in response to transforming growth factor β (TGF-β) receptor activation has provided substantial insight into how this signaling network translates the degree of TGF-β receptor activation (input) into the amount of nuclear Smad2-Smad4 complexes (output). The study addressed this question by combining a simple, mechanistic model with targeted experiments, an approach that proved particularly powerful for exploring the fundamentalmore » properties of a complex signaling network. The mathematical model revealed that Smad nuclear-cytoplasmic dynamics enables a proportional, but time-delayed coupling between the input and the output. As a result, the output can faithfully track gradual changes in the input, while the rapid input fluctuations that constitute signaling noise are dampened out.« less

  9. Orphan nuclear receptor TR3 acts in autophagic cell death via mitochondrial signaling pathway.

    PubMed

    Wang, Wei-jia; Wang, Yuan; Chen, Hang-zi; Xing, Yong-zhen; Li, Feng-wei; Zhang, Qian; Zhou, Bo; Zhang, Hong-kui; Zhang, Jie; Bian, Xue-li; Li, Li; Liu, Yuan; Zhao, Bi-xing; Chen, Yan; Wu, Rong; Li, An-zhong; Yao, Lu-ming; Chen, Ping; Zhang, Yi; Tian, Xu-yang; Beermann, Friedrich; Wu, Mian; Han, Jiahuai; Huang, Pei-qiang; Lin, Tianwei; Wu, Qiao

    2014-02-01

    Autophagy is linked to cell death, yet the associated mechanisms are largely undercharacterized. We discovered that melanoma, which is generally resistant to drug-induced apoptosis, can undergo autophagic cell death with the participation of orphan nuclear receptor TR3. A sequence of molecular events leading to cellular demise is launched by a specific chemical compound, 1-(3,4,5-trihydroxyphenyl)nonan-1-one, newly acquired from screening a library of TR3-targeting compounds. The autophagic cascade comprises TR3 translocation to mitochondria through interaction with the mitochondrial outer membrane protein Nix, crossing into the mitochondrial inner membrane through Tom40 and Tom70 channel proteins, dissipation of mitochondrial membrane potential by the permeability transition pore complex ANT1-VDAC1 and induction of autophagy. This process leads to excessive mitochondria clearance and irreversible cell death. It implicates a new approach to melanoma therapy through activation of a mitochondrial signaling pathway that integrates a nuclear receptor with autophagy for cell death.

  10. Revealing a steroid receptor ligand as a unique PPAR[gamma] agonist

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Shengchen; Han, Ying; Shi, Yuzhe

    2012-06-28

    Peroxisome proliferator-activated receptor gamma (PPAR{gamma}) regulates metabolic homeostasis and is a molecular target for anti-diabetic drugs. We report here the identification of a steroid receptor ligand, RU-486, as an unexpected PPAR{gamma} agonist, thereby uncovering a novel signaling route for this steroid drug. Similar to rosiglitazone, RU-486 modulates the expression of key PPAR{gamma} target genes and promotes adipocyte differentiation, but with a lower adipogenic activity. Structural and functional studies of receptor-ligand interactions reveal the molecular basis for a unique binding mode for RU-486 in the PPAR{gamma} ligand-binding pocket with distinctive properties and epitopes, providing the molecular mechanisms for the discrimination ofmore » RU-486 from thiazolidinediones (TZDs) drugs. Our findings together indicate that steroid compounds may represent an alternative approach for designing non-TZD PPAR{gamma} ligands in the treatment of insulin resistance.« less

  11. Short poly-glutamine repeat in the androgen receptor in New World monkeys.

    PubMed

    Hiramatsu, Chihiro; Paukner, Annika; Kuroshima, Hika; Fujita, Kazuo; Suomi, Stephen J; Inoue-Murayama, Miho

    2017-12-01

    The androgen receptor mediates various physiological and developmental functions and is highly conserved in mammals. Although great intraspecific length polymorphisms in poly glutamine (poly-Q) and poly glycine (poly-G) regions of the androgen receptor in humans, apes and several Old World monkeys have been reported, little is known about the characteristics of these regions in New World monkeys. In this study, we surveyed 17 species of New World monkeys and found length polymorphisms in these regions in three species (common squirrel monkeys, tufted capuchin monkeys and owl monkeys). We found that the poly-Q region in New World monkeys is relatively shorter than that in catarrhines (humans, apes and Old World monkeys). In addition, we observed that codon usage for poly-G region in New World monkeys is unique among primates. These results suggest that the length of polymorphic regions in androgen receptor genes have evolved uniquely in New World monkeys.

  12. Arabidopsis thaliana DM2h (R8) within the Landsberg RPP1-like Resistance Locus Underlies Three Different Cases of EDS1-Conditioned Autoimmunity

    PubMed Central

    Garcia, Ana V.; Wagner, Christine; Choudhury, Sayan R.; Wang, Yiming; James, Geo Velikkakam; Griebel, Thomas; Alcázar, Ruben; Tsuda, Kenichi; Schneeberger, Korbinian; Parker, Jane E.

    2016-01-01

    Plants have a large panel of nucleotide-binding/leucine rich repeat (NLR) immune receptors which monitor host interference by diverse pathogen molecules (effectors) and trigger disease resistance pathways. NLR receptor systems are necessarily under tight control to mitigate the trade-off between induced defenses and growth. Hence, mis-regulated NLRs often cause autoimmunity associated with stunting and, in severe cases, necrosis. Nucleocytoplasmic ENHANCED DISEASE SUSCEPTIBILITY1 (EDS1) is indispensable for effector-triggered and autoimmune responses governed by a family of Toll-Interleukin1-Receptor-related NLR receptors (TNLs). EDS1 operates coincidently or immediately downstream of TNL activation to transcriptionally reprogram cells for defense. We show here that low levels of nuclear-enforced EDS1 are sufficient for pathogen resistance in Arabidopsis thaliana, without causing negative effects. Plants expressing higher nuclear EDS1 amounts have the genetic, phenotypic and transcriptional hallmarks of TNL autoimmunity. In a screen for genetic suppressors of nuclear EDS1 autoimmunity, we map multiple, independent mutations to one gene, DM2h, lying within the polymorphic DANGEROUS MIX2 cluster of TNL RPP1-like genes from A. thaliana accession Landsberg erecta (Ler). The DM2 locus is a known hotspot for deleterious epistatic interactions leading to immune-related incompatibilities between A. thaliana natural accessions. We find that DM2hLer underlies two further genetic incompatibilities involving the RPP1-likeLer locus and EDS1. We conclude that the DM2hLer TNL protein and nuclear EDS1 cooperate, directly or indirectly, to drive cells into an immune response at the expense of growth. A further conclusion is that regulating the available EDS1 nuclear pool is fundamental for maintaining homeostatic control of TNL immune pathways. PMID:27082651

  13. Persistence of evolutionary memory: primordial six-transmembrane helical domain mu opiate receptors selectively linked to endogenous morphine signaling.

    PubMed

    Kream, Richard M; Sheehan, Melinda; Cadet, Patrick; Mantione, Kirk J; Zhu, Wei; Casares, Federico; Stefano, George B

    2007-12-01

    Biochemical, molecular and pharmacological evidence for two unique six-transmembrane helical (TMH) domain opiate receptors expressed from the micro opioid receptor (MOR) gene have been shown. Designated micro3 and micro4 receptors, both protein species are Class A rhodopsin-like members of the superfamily of G-protein coupled receptors but are selectively tailored to mediate the cellular regulatory effects of endogenous morphine and related morphinan alkaloids via stimulation of nitric oxide (NO) production and release. Both micro3 and micro4 receptors lack an amino acid sequence of approximately 90 amino acids that constitute the extracellular N-terminal and TMH1 domains and part of the first intracellular loop of the micro1 receptor, but retain the empirically defined ligand binding pocket distributed across conserved TMH2, TMH3, and TMH7 domains of the micro1 sequence. Additionally, the receptor proteins are terminated by unique intracellular C-terminal amino acid sequences that serve as putative coupling or docking domains required for constitutive NO synthase activation. Because the recognition profile of micro3 and micro4 receptors is restricted to rigid benzylisoquinoline alkaloids typified by morphine and its extended family of chemical congeners, it is hypothesized that conformational stabilization provided by interaction of extended extracellular N-terminal protein domains and the extracellular loops is required for binding of endogenous opioid peptides as well as synthetic flexible opiate alkaloids.

  14. Increasing human Th17 differentiation through activation of orphan nuclear receptor retinoid acid-related orphan receptor γ (RORγ) by a class of aryl amide compounds.

    PubMed

    Zhang, Wei; Zhang, Jing; Fang, Leiping; Zhou, Ling; Wang, Shuai; Xiang, Zhijun; Li, Yuan; Wisely, Bruce; Zhang, Guifeng; An, Gang; Wang, Yonghui; Leung, Stewart; Zhong, Zhong

    2012-10-01

    In a screen for small-molecule inhibitors of retinoid acid-related orphan receptor γ (RORγ), we fortuitously discovered that a class of aryl amide compounds behaved as functional activators of the interleukin 17 (IL-17) reporter in Jurkat cells. Three of these compounds were selected for further analysis and found to activate the IL-17 reporter with potencies of ∼0.1 μM measured by EC₅₀. These compounds were shown to directly bind to RORγ by circular dichroism-based thermal stability experiments. Furthermore, they can enhance an in vitro Th17 differentiation process in human primary T cells. As RORγ remains an orphan nuclear receptor, discovery of these aryl amide compounds as functional agonists will now provide pharmacological tools for us to dissect functions of RORγ and facilitate drug discovery efforts for immune-modulating therapies.

  15. Intracellular colocalization of HAP1/STBs with steroid hormone receptors and its enhancement by a proteasome inhibitor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fujinaga, Ryutaro; Takeshita, Yukio; Yoshioka, Kazuhiro

    2011-07-15

    The stigmoid body (STB) is a cytoplasmic inclusion containing huntingtin-associated protein 1 (HAP1), and HAP1/STB formation is induced by transfection of the HAP1 gene into cultured cells. In the present study, we examined the intracellular colocalization of HAP1/STBs with steroid hormone receptors (SHRs), including the androgen receptor (AR), estrogen receptor, glucocorticoid receptor (GR), and mineralocorticoid receptor, in COS-7 cells cotransfected with HAP1 and each receptor. We found that C-terminal ligand-binding domains of all SHRs had potential for colocalization with HAP1/STBs, whereas only AR and GR were clearly colocalized with HAP1/STBs when each full-length SHR was coexpressed with HAP1. In addition,more » it appeared that HAP1/STBs did not disrupt GR and AR functions because the receptors on HAP1/STBs maintained nuclear translocation activity in response to their specific ligands. When the cells were treated with a proteasome inhibitor, GR and AR localized outside HAP1/STBs translocated into the nucleus, whereas the receptors colocalized with HAP1/STBs persisted in their colocalization even after treatment with their ligands. Therefore, HAP1/STBs may be involved in cytoplasmic modifications of the nuclear translocation of GR and AR in a ubiquitin-proteasome system.« less

  16. Nuclear receptors and pathogenesis of pancreatic cancer

    PubMed Central

    Polvani, Simone; Tarocchi, Mirko; Tempesti, Sara; Galli, Andrea

    2014-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is a devastating disease with a median overall survival time of 5 mo and the five years survival less than 5%, a rate essentially unchanged over the course of the years. A well defined progression model of accumulation of genetic alterations ranging from single point mutations to gross chromosomal abnormalities has been introduced to describe the origin of this disease. However, due to the its subtle nature and concurring events PDAC cure remains elusive. Nuclear receptors (NR) are members of a large superfamily of evolutionarily conserved ligand-regulated DNA-binding transcription factors functionally involved in important cellular functions ranging from regulation of metabolism, to growth and development. Given the nature of their ligands, NR are very tempting drug targets and their pharmacological modulation has been widely exploited for the treatment of metabolic and inflammatory diseases. There are now clear evidences that both classical ligand-activated and orphan NR are involved in the pathogenesis of PDAC from its very early stages; nonetheless many aspects of their role are not fully understood. The purpose of this review is to highlight the striking connections that link peroxisome proliferator activated receptors, retinoic acid receptors, retinoid X receptor, androgen receptor, estrogen receptors and the orphan NR Nur, chicken ovalbumin upstream promoter transcription factor II and the liver receptor homologue-1 receptor to PDAC development, connections that could lead to the identification of novel therapies for this disease. PMID:25232244

  17. Selective regulation of nuclear orphan receptors 4A by adenosine receptor subtypes in human mast cells

    PubMed Central

    Zhang, Li; Paine, Catherine

    2010-01-01

    Nuclear orphan receptors 4A (NR4A) are early responsive genes that belong to the superfamily of hormone receptors and comprise NR4A1, NR4A2 and NR4A3. They have been associated to transcriptional activation of multiple genes involved in inflammation, apoptosis and cell cycle control. Here, we establish a link between NR4As and adenosine, a paradoxical inflammatory molecule that can contribute to persistence of inflammation or mediate inflammatory shutdown. Transcriptomics screening of the human mast cell-line HMC-1 revealed a sharp induction of transcriptionally active NR4A2 and NR4A3 by the adenosine analogue NECA. The concomitant treatment of NECA and the adenosine receptor A2A (A2AAR) selective antagonist SCH-58261 exaggerated this effect, suggesting that upregulation of these factors in mast cells is mediated by other AR subtypes (A2B and A3) and that A2AAR activation counteracts NR4A2 and NR4A3 induction. In agreement with this, A2AAR-silencing amplified NR4A induction by NECA. Interestingly, a similar A2AAR modulatory effect was observed on ERK1/2 phosphorylation because A2AAR blockage exacerbated NECA-mediated phosphorylation of ERK1/2. In addition, PKC or MEK1/2 inhibition prevented ERK1/2 phosphorylation and antagonized AR-mediated induction of NR4A2 and NR4A3, suggesting the involvement of these kinases in AR to NR4A signaling. Finally, we observed that selective A2AAR activation with CGS-21680 blocked PMA-induced ERK1/2 phosphorylation and modulated the overexpression of functional nuclear orphan receptors 4A. Taken together, these results establish a novel PKC/ERK/nuclear orphan receptors 4A axis for adenosinergic signaling in mast cells, which can be modulated by A2AAR activation, not only in the context of adenosine but of other mast cell activating stimuli as well. PMID:21234122

  18. Characterization of the Binding of a Potent Synthetic Androgen, Methyltrienolone, to Human Tissues

    PubMed Central

    Menon, Mani; Tananis, Catherine E.; Hicks, L. Louise; Hawkins, Edward F.; McLoughlin, Martin G.; Walsh, Patrick C.

    1978-01-01

    The potent synthetic androgen methytrienolone (R 1881), which does not bind to serum proteins, was utilized to characterize binding to receptors in human androgen responsive tissues. Cytosol extracts prepared from hypertrophic prostates (BPH) were utilized as the source of receptor for the initial studies. High affinity binding was detected in the cytosol of 29 of 30 samples of BPH (average number of binding sites, 45.8±4.7 fmol/mg of protein; dissociation constant, 0.9±0.2 nM). This binding had the characteristics of a receptor: heat lability, precipitability by 0-33% ammonium sulfate and by protamine sulfate, and 8S sedimentation coefficient. High affinity binding was also detected in cytosol prepared from seminal vesicle, epididymis, and genital skin but not in non-genital skin or muscle. However, similar binding was demonstrated in the cytosol of human uterus. The steroid specificities of binding to the cytosol of male tissues of accessory reproduction and of uterus were similar in that progestational agents were more effective competitors than natural androgens. Binding specificities in cytosol prepared from genital skin were distinctly different and were similar to those of ventral prostate from the castrated rat in that dihydrotestosterone was much more potent than progestins in competition. Thus binding of R 1881 to the cytosol of prostate, epididymis, and seminal vesicle has some characteristics of binding to a progesterone receptor. When the nuclear extract from BPH was analyzed, high affinity binding was demonstrated that conformed to the specificities of binding to an androgen receptor. Here dihydrotestosterone was a more potent competitor than progestational agents. Similar patterns of binding were detected in the crude nuclear extracts from seminal vesicle, epididymis, and genital skin but not in uterus, muscle, or non-genital skin. We conclude that the androgen receptor is not demonstrable in the cytosol of prostate, epididymis, or seminal vesicle of non-castrated men but can be measured in the cytosol of genital skin and the nuclear extracts of androgen responsive tissues. Because steroid hormones exert their major influence within the nucleus of target tissues, the measurement of nuclear receptor may provide valuable insight into the regulation of growth of target tissues. PMID:73547

  19. Development of a Systems Computational Model to Investigate Early Biological Events in Hepatic Activation of Constitutive Androstane Receptor (CAR) by Phenobarbital

    EPA Science Inventory

    Activation of the nuclear receptor CAR (constitutive active/androstane receptor) is implicated in the control several key biological events such as metabolic pathways. Here, we combined data from literature with information obtained from in vitro assays in the US EPA ToxCast dat...

  20. Kruppel-like Factor 9 is a Negative Regulator of Ligand-dependent Estrogen Receptor Alpha Signaling in Ishikawa Endometrial Adenocarcinoma Cells

    USDA-ARS?s Scientific Manuscript database

    Estrogen (E) and progesterone (P), acting through their respective receptors and other nuclear proteins, exhibit opposing activities in target cells. We previously reported that Krüppel-like factor 9 (KLF9) cooperates with progesterone receptor (PR) to facilitate P-dependent gene transcription in ut...

  1. Ultraviolet radiation-induced interleukin 6 release in HeLa cells is mediated via membrane events in a DNA damage-independent way.

    PubMed

    Kulms, D; Pöppelmann, B; Schwarz, T

    2000-05-19

    Evidence exists that ultraviolet radiation (UV) affects molecular targets in the nucleus or at the cell membrane. UV-induced apoptosis was found to be mediated via DNA damage and activation of death receptors, suggesting that nuclear and membrane effects are not mutually exclusive. To determine whether participation of nuclear and membrane components is also essential for other UV responses, we studied the induction of interleukin-6 (IL-6) by UV. Exposing HeLa cells to UV at 4 degrees C, which inhibits activation of surface receptors, almost completely prevented IL-6 release. Enhanced repair of UV-mediated DNA damage by addition of the DNA repair enzyme photolyase did not affect UV-induced IL-6 production, suggesting that in this case membrane events predominant over nuclear effects. UV-induced IL-6 release is mediated via NFkappaB since the NFkappaB inhibitor MG132 or transfection of cells with a super-repressor form of the NFkappaB inhibitor IkappaB reduced IL-6 release. Transfection with a dominant negative mutant of the signaling protein TRAF-2 reduced IL-6 release upon exposure to UV, indicating that UV-induced IL-6 release is mediated by activation of the tumor necrosis factor receptor-1. These data demonstrate that UV can exert biological effects mainly by affecting cell surface receptors and that this is independent of its ability to induce nuclear DNA damage.

  2. PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells

    PubMed Central

    Bazzani, Lorenzo; Donnini, Sandra; Finetti, Federica; Christofori, Gerhard; Ziche, Marina

    2017-01-01

    Prostaglandin E2 (PGE2) interacts with tyrosine kinases receptor signaling in both tumor and stromal cells supporting tumor progression. Here we demonstrate that in non-small cell lung carcinoma (NSCLC) cells, A549 and GLC82, PGE2 promotes nuclear translocation of epidermal growth factor receptor (nEGFR), affects gene expression and induces cell growth. Indeed, cyclin D1, COX-2, iNOS and c-Myc mRNA levels are upregulated following PGE2 treatment. The nuclear localization sequence (NLS) of EGFR as well as its tyrosine kinase activity are required for the effect of PGE2 on nEGFR and downstream signaling activities. PGE2 binds its bona fide receptor EP3 which by activating SRC family kinases, induces ADAMs activation which, in turn, releases EGFR-ligands from the cell membrane and promotes nEGFR. Amphiregulin (AREG) and Epiregulin (EREG) appear to be involved in nEGFR promoted by the PGE2/EP3-SRC axis. Pharmacological inhibition or silencing of the PGE2/EP3/SRC-ADAMs signaling axis or EGFR ligands i.e. AREG and EREG expression abolishes nEGFR induced by PGE2. In conclusion, PGE2 induces NSCLC cell proliferation by EP3 receptor, SRC-ADAMs activation, EGFR ligands shedding and finally, phosphorylation and nEGFR. Since nuclear EGFR is a hallmark of cancer aggressiveness, our findings reveal a novel mechanism for the contribution of PGE2 to tumor progression. PMID:28415726

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Sangkyu, E-mail: 49park@cku.ac.kr; Lee, Yoo Jeong; Ko, Eun Hee

    Glucose metabolism is balanced by glycolysis and gluconeogenesis with precise control in the liver. The expression of genes related to glucose metabolism is regulated primarily by glucose and insulin at transcriptional level. Nuclear receptors play important roles in regulating the gene expression of glucose metabolism at transcriptional level. Some of these nuclear receptors form heterodimers with RXRs to bind to their specific regulatory elements on the target promoters. To date, three isotypes of RXRs have been identified; RXRα, RXRβ and RXRγ. However, their involvement in the interactions with other nuclear receptors in the liver remains unclear. In this study, wemore » found RXRγ is rapidly induced after feeding in the mouse liver, indicating a potential role of RXRγ in controlling glucose or lipid metabolism in the fasting–feeding cycle. In addition, RXRγ expression was upregulated by glucose in primary hepatocytes. This implies that glucose metabolism governed by RXRγ in conjunction with other nuclear receptors. The luciferase reporter assay showed that RXRγ as well as RXRα increased SREBP-1c promoter activity in hepatocytes. These results suggest that RXRγ may play an important role in tight control of glucose metabolism in the fasting–feeding cycle. - Highlights: • Refeeding increases the RXRγ expression level in mouse liver. • RXRγ expression is induced by high glucose condition in primary hepatocytes. • RXRγ and LXRα have synergistic effect on SREBP-1c promoter activity. • RXRγ binds to LXRE(-299/-280) located within SREBP-1c promoter region and interacts with LXRα.« less

  4. Nuclear Membranes ETB Receptors Mediate ET-1-induced Increase of Nuclear Calcium in Human Left Ventricular Endocardial Endothelial Cells.

    PubMed

    Jules, Farah; Avedanian, Levon; Al-Khoury, Johny; Keita, Ramatoulaye; Normand, Alexandre; Bkaily, Ghassan; Jacques, Danielle

    2015-07-01

    In fetal human left ventricular endocardial endothelial cells (EECLs), both plasma membrane (PM) ET(A)R and ET(B)R were reported to mediate ET-1-induced increase of intracellular calcium [Ca](i); however, this effect was mediated by ET(A)R in right EECs (EECRs). In this study, we verified whether, as for the PM, nuclear membranes (NMs) ET-1 receptors activation in EECLs and EECRs induce an increase of nuclear calcium ([Ca](n)) and if this effect is mediated through the same receptor type as in PM. Using a plasmalemma-perforated technique and 3D confocal microscopy, our results showed that, as in PM intact cells, superfusion of nuclei of both cell types with cytosolic ET-1 induced a concentration-dependent sustained increase of [Ca](n). In EECRs, the ET(A)R antagonist prevented the effect of ET-1 on [Ca](n) without affecting EECLs. However, in both cell types, the effect of cytosolic ET-1 on [Ca](n) was prevented by the ETBR antagonist. In conclusion, both NMs' ET(A)R and ET(B)R mediated the effect of cytosolic ET-1 on [Ca](n) in EECRs. In contrast, only NMs' ET(B)R activation mediated the effect of cytosolic ET-1 in EECLs. Hence, the type of NMs' receptors mediating the effect of ET-1 on [Ca](n) are different from those of PM mediating the increase in [Ca](i).

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paterson, Carolyn P.; Ayalew, Lisanework E.; Veterinary Microbiology, University of Saskatchewan, Saskatoon, SK S7N 5E3 S7N 5B4 Canada

    The L1 region of bovine adenovirus (BAdV)-3 encodes a non-structural protein designated 52K. Anti-52K serum detected a protein of 40 kDa, which localized to the nucleus but not to the nucleolus in BAdV-3-infected or transfected cells. Analysis of mutant 52K proteins suggested that three basic residues ({sup 105}RKR{sup 107}) of the identified domain (amino acids {sup 102}GMPRKRVLT{sup 110}) are essential for nuclear localization of 52K. The nuclear import of a GST-52K fusion protein utilizes the classical importin {alpha}/{beta}-dependent nuclear transport pathway. The 52K protein is preferentially bound to the cellular nuclear import receptor importin {alpha}3. Although deletion of amino acidmore » 102-110 is sufficient to abrogate the nuclear localization of 52K, amino acid 90-133 are required for interaction with importin-{alpha}3 and localizing a cytoplasmic protein to the nucleus. These results suggest that 52K contains a bipartite NLS, which preferentially utilize an importin {alpha}3 nuclear import receptor-mediated pathway to transport 52K to the nucleus.« less

  6. Stress-specific p38 MAPK activation is sufficient to drive EGFR endocytosis but not its nuclear translocation.

    PubMed

    Tomas, Alejandra; Jones, Sylwia; Vaughan, Simon O; Hochhauser, Daniel; Futter, Clare E

    2017-08-01

    EGF receptor (EGFR) endocytosis is induced by stress in a manner dependent on the p38 MAPK family. Ligand and stresses such as X-rays, reportedly promote nuclear trafficking of endocytosed EGFR for regulation of gene transcription and DNA repair. We fail to detect EGFR endocytosis or nuclear transport following X-ray treatment of HeLa or head and neck cancer cells, despite extensive DNA damage induction. Apparent nuclear staining with EGFR extracellular domain antibody remained present despite reduced/absent EGFR expression, and so did not represent nuclear EGFR. UVB and UVC, but not X-ray or UVA, treatment induced p38 activation and EGFR endocytosis, although all of these stresses induced DNA damage, indicating that DNA damage alone is not sufficient to induce EGFR endocytosis. Increased reactive oxygen species (ROS) levels following UVB treatment, compared to that seen with X-rays, do not alone explain differences in p38 activation. UVB, like UVC, induced EGFR accumulation predominantly in perinuclear endosomes, rather than in the nucleus. Our morphological techniques identifying major changes in receptor distribution do not exclude the possibility that small but biologically relevant amounts of EGFR enter the nucleus. This study highlights the importance and limitations of morphological analyses of receptor distribution in understanding signaling outcome. © 2017. Published by The Company of Biologists Ltd.

  7. Nuclear Function of Smad7 Promotes Myogenesis▿

    PubMed Central

    Miyake, Tetsuaki; Alli, Nezeka S.; McDermott, John C.

    2010-01-01

    In the “canonical” view of transforming growth factor β (TGF-β) signaling, Smad7 plays an inhibitory role. While Smad7 represses Smad3 activation by TGF-β, it does not reverse the inhibitory effect of TGF-β on myogenesis, suggesting a different function in myogenic cells. We previously reported a promyogenic role of Smad7 mediated by an interaction with MyoD. Based on this association, we hypothesized a possible nuclear function of Smad7 independent of its role at the level of the receptor. We therefore engineered a chimera of Smad7 with a nuclear localization signal (NLS), which serves to prevent and therefore bypass binding to the TGF-β receptor while concomitantly constitutively localizing Smad7 to the nucleus. This Smad7-NLS did not repress Smad3 activation by TGF-β but did retain its ability to enhance myogenic gene activation and phenotypic myogenesis, indicating that the nuclear, receptor-independent function of Smad7 is sufficient to promote myogenesis. Furthermore, Smad7 physically interacts with MyoD and antagonizes the repressive effects of active MEK on MyoD. Reporter and myogenic conversion assays indicate a pivotal regulation of MyoD transcriptional properties by the balance between Smad7 and active MEK. Thus, Smad7 has a nuclear coactivator function that is independent of TGF-β signaling and necessary to promote myogenic differentiation. PMID:19995910

  8. Fatty acid amide hydrolase (FAAH) inhibition enhances memory acquisition through activation of PPAR-α nuclear receptors

    PubMed Central

    Mazzola, Carmen; Medalie, Julie; Scherma, Maria; Panlilio, Leigh V.; Solinas, Marcello; Tanda, Gianluigi; Drago, Filippo; Cadet, Jean Lud; Goldberg, Steven R.; Yasar, Sevil

    2009-01-01

    Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of anandamide (a cannabinoid CB1-receptor ligand) and oleoylethanolamide and palmitoylethanolamide (OEA and PEA, ligands for α-type peroxisome proliferator-activated nuclear receptors, PPAR-α) when and where they are naturally released in the brain. Using a passive-avoidance task in rats, we found that memory acquisition was enhanced by the FAAH inhibitor URB597 or by the PPAR-α agonist WY14643, and these enhancements were blocked by the PPAR-α antagonist MK886. These findings demonstrate novel mechanisms for memory enhancement by activation of PPAR-α, either directly by administering a PPAR-α agonist or indirectly by administering a FAAH inhibitor. PMID:19403796

  9. Nuclear receptor TLX inhibits TGF-β signaling in glioblastoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johansson, Erik; Zhai, Qiwei; Zeng, Zhao-jun

    TLX (also called NR2E1) is an orphan nuclear receptor that maintains stemness of neuronal stem cells. TLX is highly expressed in the most malignant form of glioma, glioblastoma multiforme (GBM), and is important for the proliferation and maintenance of the stem/progenitor cells of the tumor. Transforming Growth Factor-β (TGF-β) is a cytokine regulating many different cellular processes such as differentiation, migration, adhesion, cell death and proliferation. TGF-β has an important function in cancer where it can work as either a tumor suppressor or oncogene, depending on the cancer type and stage of tumor development. Since glioblastoma often have dysfunctional TGF-βmore » signaling we wanted to find out if there is any interaction between TLX and TGF-β in glioblastoma cells. We demonstrate that knockdown of TLX enhances the canonical TGF-β signaling response in glioblastoma cell lines. TLX physically interacts with and stabilizes Smurf1, which can ubiquitinate and target TGF-β receptor II for degradation, whereas knockdown of TLX leads to stabilization of TGF-β receptor II, increased nuclear translocation of Smad2/3 and enhanced expression of TGF-β target genes. The interaction between TLX and TGF-β may play an important role in the regulation of proliferation and tumor-initiating properties of glioblastoma cells. - Highlights: • TLX knockdown enhances TGF-β dependent Smad signaling in glioblastoma cells • TLX knockdown increases the protein level of TGF-β receptor II. • TLX stabilizes and retains Smurf1 in the cytoplasm. • TLX enhances Smurf1-dependent ubiquitination and degradation of TGF-β receptor II.« less

  10. Gene and protein expression of oestrogen-β and progesterone receptors in facial melasma and adjacent healthy skin in women.

    PubMed

    Tamega, A de A; Miot, H A; Moço, N P; Silva, M G; Marques, M E A; Miot, L D B

    2015-04-01

    Compare gene and protein expression for oestrogen receptor-β (ER-β) and progesterone receptor (PR) in facial melasma and adjacent healthy skin. A cross-sectional study including 42 women with facial melasma, conducted at the Dermatology Service of Botucatu Medical School of São Paulo State University, Brazil. Biopsies of the melasma skin were performed, together with healthy surrounding skin. The gene expression (real-time PCR) of the hormone receptors in the tissue was evaluated. Subsequently, skin fragments were immunostained for nuclear ER-β and PR, evaluated according to their HSCORE (epidermis) and percentage of staining per microscopic field (dermis). Messenger RNA tissue expression for ER-β and PR showed no difference between melasma-affected skin fragments and the healthy perilesional areas (P > 0.2). Median nuclear epithelial expression for ER-β and PR was higher in lesioned skin (HSCORE 157 and 58) than in the healthy perilesional skin (HSCORE 97 and 19; P < 0.01), with no difference in dermal immunostaining. Nuclear histological expression for ER-β was associated to sun-induced melasma and negative familiar background; PR expression was associated to sun-induced melasma and darker phototypes. No difference was observed in gene expression for oestrogen-β and progesterone receptors in melasma-affected skin compared with adjacent healthy skin. However, the higher protein expression of these receptors in melasma-affected epithelia suggests hormonal participation in the pathogenesis of this disease. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  11. Electron microscopy of lamin and the nuclear lamina in Caenorhabditis elegans.

    PubMed

    Cohen, Merav; Santarella, Rachel; Wiesel, Naama; Mattaj, Iain; Gruenbaum, Yosef

    2008-01-01

    The nuclear lamina is found between the inner nuclear membrane and the peripheral chromatin. Lamins are the main components of the nuclear lamina, where they form protein complexes with integral proteins of the inner nuclear membrane, transcriptional regulators, histones and chromatin modifiers. Lamins are required for mechanical stability, chromatin organization, Pol II transcription, DNA replication, nuclear assembly, and nuclear positioning. Mutations in human lamins cause at least 13 distinct human diseases, collectively termed laminopathies, affecting muscle, adipose, bone, nerve and skin cells, and range from muscular dystrophies to accelerated aging. Caenorhabditis elegans has unique advantages in studying lamins and nuclear lamina genes including low complexity of lamina genes and the unique ability of bacterially expressed C. elegans lamin protein to form stable 10 nm fibers. In addition, transgenic techniques, simple application of RNA interference, sophisticated genetic analyses, and the production of a large collection of mutant lines, all make C. elegans especially attractive for studying the functions of its nuclear lamina genes. In this chapter we will include a short review of our current knowledge of nuclear lamina in C. elegans and will describe electron microscopy techniques used for their analyses.

  12. A Systems Toxicology Approach Reveals Biological Pathways Dysregulated by Prenatal Arsenic Exposure

    PubMed Central

    Laine, Jessica E.; Fry, Rebecca C.

    2016-01-01

    BACKGROUND Prenatal exposure to inorganic arsenic (iAs) is associated with dysregulated gene and protein expression in the fetus, both evident at birth. Potential epigenetic mechanisms that underlie these changes include but are not limited to the methylation of cytosines (CpG). OBJECTIVE The aim of the present study was to compile datasets from studies on prenatal arsenic exposure to identify whether key genes, proteins, or both and their associated biological pathways are perturbed. METHODS We compiled datasets from 12 studies that analyzed the relationship between prenatal iAs exposure and fetal changes to the epigenome (5-methyl cytosine), transcriptome (mRNA expression), and/or proteome (protein expression changes). FINDINGS Across the 12 studies, a set of 845 unique genes was identified and found to enrich for their role in biological pathways, including those signaled by peroxisome proliferator-activated receptor, nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, and the glucocorticoid receptor. Tumor necrosis factor was identified as a putative cellular regulator underlying most (n = 277) of the identified iAs-associated genes or proteins. CONCLUSIONS Given their common identification across numerous human cohorts and their known toxicologic role in disease, the identified genes and pathways may underlie altered disease susceptibility associated with prenatal exposure to iAs. PMID:27325076

  13. Cex1p is a novel cytoplasmic component of the Saccharomyces cerevisiae nuclear tRNA export machinery.

    PubMed

    McGuire, Andrew T; Mangroo, Dev

    2007-01-24

    The Saccharomyces cerevisiae Yor112wp, which we named Cex1p, was identified using a yeast tRNA three-hybrid interaction approach and an in vivo nuclear tRNA export assay as a cytoplasmic component of the nuclear tRNA export machinery. Cex1p binds tRNA saturably, and associates with the nuclear pore complex by interacting directly with Nup116p. Cex1p co-purifies with the nuclear tRNA export receptors Los1p and Msn5p, the eukaryotic elongation factor eEF-1A, which delivers aminoacylated tRNAs to the ribosome, and the RanGTPase Gsp1p, but not with Cca1p, a tRNA maturation enzyme that facilitates translocation of non-aminoacylated tRNAs across the nuclear pore complex. Depletion of Cex1p and eEF-1A or Los1p significantly reduced the efficiency of nuclear tRNA export. Cex1p interacts with Los1p but not with eEF-1A in vitro. These findings suggest that Cex1p is a component of the nuclear aminoacylation-dependent tRNA export pathway in S. cerevisiae. They also suggest that Cex1p collects aminoacyl-tRNAs from the nuclear export receptors at the cytoplasmic side of the nuclear pore complex, and transfers them to eEF-1A using a channelling mechanism.

  14. Growth hormone-specific induction of the nuclear localization of porcine growth hormone receptor in porcine hepatocytes.

    PubMed

    Lan, H N; Hong, P; Li, R N; Shan, A S; Zheng, X

    2017-10-01

    The phenomenon of nuclear translocation of growth hormone receptor (GHR) in human, rat, and fish has been reported. To date, this phenomenon has not been described in a domestic animal (such as pig). In addition, the molecular mechanisms of GHR nuclear translocation have not been thoroughly elucidated. To this end, porcine hepatocytes were isolated and used as a cell model. We observed that porcine growth hormone (pGH) can induce porcine GHR's nuclear localization in porcine hepatocytes. Subsequently, the dynamics of pGH-induced pGHR's nuclear localization were analyzed and demonstrated that pGHR's nuclear localization occurs in a time-dependent manner. Next, we explored the mechanism of pGHR nuclear localization using different pGHR ligands, and we demonstrated that pGHR's nuclear translocation is GH(s)-dependent. We also observed that pGHR translocates into cell nuclei in a pGH dimerization-dependent fashion, whereas further experiments indicated that IMPα/β is involved in the nuclear translocation of the pGH-pGHR dimer. The pGH-pGHR dimer may form a pGH-GHR-JAK2 multiple complex in cell nuclei, which would suggest that similar to its function in the cell membrane, the nuclear-localized pGH-pGHR dimer might still have the ability to signal. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Nuclear uptake and dosimetry of 64Cu-labeled chelator somatostatin conjugates in an SSTr2-transfected human tumor cell line.

    PubMed

    Eiblmaier, Martin; Andrews, Rebecca; Laforest, Richard; Rogers, Buck E; Anderson, Carolyn J

    2007-08-01

    64Cu radiopharmaceuticals have shown tumor growth inhibition in tumor-bearing animal models with a relatively low radiation dose that may be related to nuclear localization of the 64Cu in tumor cells. Here we address whether the nuclear localization of 64Cu from a 64Cu-labeled chelator-somatostatin conjugate is related to the dissociation of the radio-copper from its chelator. The 64Cu complex of 1,4,8,11-tetraazacyclotetradecane-1,4,8,11-tetraacetic acid (TETA) has demonstrated instability in vivo, whereas 64Cu-CB-TE2A (CB-TE2A is 4,11-bis(carboxymethyl)-1,4,8,11-tetraazabicyclo[6.6.2]hexadecane) was highly stable. Receptor binding, nuclear uptake, internalization, and efflux assays were performed to characterize the interaction with the somatostatin receptor and the intracellular fate of 64Cu-labeled chelator-peptide conjugates in A427-7 cells. From these data, the absorbed dose to cells was calculated. 64Cu-TETA-Y3-TATE (64Cu-[1]) and 64Cu-CB-TE2A-Y3-TATE (64Cu-[2]) had high affinity for somatostatin receptor subtype 2 (SSTr2) in A427-7 cells. After 3 h, 64Cu-[2] showed greater internalization (>30%) compared with 64Cu-[1] (approximately 15%). There was uptake of 64Cu-[1] in nuclei of 427-7 cells (9.4% +/- 1.7% at 24 h), whereas 64Cu-[2] showed minimal nuclear accumulation out to 24 h (1.3% +/- 0.1%). A427-7 cells were exposed to 0.40 Gy from 64Cu-[1] and exposed to 1.06 Gy from 64Cu-[2]. External beam irradiation of A427-7 cells showed <20% cell killing at 1 Gy. These results are consistent with our hypothesis that dissociation of 64Cu from TETA leads to nuclear localization. Dosimetry calculations indicated that the nuclear localization of 64Cu-[1] was not significant enough to increase the absorbed dose to the nuclei of A427-7 cells. These studies show that 64Cu localization to cell nuclei from internalizing, receptor-targeted radiopharmaceuticals is related to chelate stability.

  16. Purinergic P2X(7) receptor antagonists: Chemistry and fundamentals of biological screening.

    PubMed

    Gunosewoyo, Hendra; Coster, Mark J; Bennett, Maxwell R; Kassiou, Michael

    2009-07-15

    The purinergic P2X(7) receptor is a unique member of the ATP-gated P2X family. This receptor has been implicated in numerous diseases and many structurally diverse ligands have been discovered via high throughput screening. This perspective will attempt to highlight some of the most recent key findings in both the biology and chemistry.

  17. The cannabinoid receptor CB1 modulates the signaling properties of the lysophosphatidylinositol receptor GPR55.

    PubMed

    Kargl, Julia; Balenga, Nariman; Parzmair, Gerald P; Brown, Andrew J; Heinemann, Akos; Waldhoer, Maria

    2012-12-28

    The G protein-coupled receptor (GPCR) 55 (GPR55) and the cannabinoid receptor 1 (CB1R) are co-expressed in many tissues, predominantly in the central nervous system. Seven transmembrane spanning (7TM) receptors/GPCRs can form homo- and heteromers and initiate distinct signaling pathways. Recently, several synthetic CB1 receptor inverse agonists/antagonists, such as SR141716A, AM251, and AM281, were reported to activate GPR55. Of these, SR141716A was marketed as a promising anti-obesity drug, but was withdrawn from the market because of severe side effects. Here, we tested whether GPR55 and CB1 receptors are capable of (i) forming heteromers and (ii) whether such heteromers could exhibit novel signaling patterns. We show that GPR55 and CB1 receptors alter each others signaling properties in human embryonic kidney (HEK293) cells. We demonstrate that the co-expression of FLAG-CB1 receptors in cells stably expressing HA-GPR55 specifically inhibits GPR55-mediated transcription factor activation, such as nuclear factor of activated T-cells and serum response element, as well as extracellular signal-regulated kinases (ERK1/2) activation. GPR55 and CB1 receptors can form heteromers, but the internalization of both receptors is not affected. In addition, we observe that the presence of GPR55 enhances CB1R-mediated ERK1/2 and nuclear factor of activated T-cell activation. Our data provide the first evidence that GPR55 can form heteromers with another 7TM/GPCR and that this interaction with the CB1 receptor has functional consequences in vitro. The GPR55-CB1R heteromer may play an important physiological and/or pathophysiological role in tissues endogenously co-expressing both receptors.

  18. The Cannabinoid Receptor CB1 Modulates the Signaling Properties of the Lysophosphatidylinositol Receptor GPR55*

    PubMed Central

    Kargl, Julia; Balenga, Nariman; Parzmair, Gerald P.; Brown, Andrew J.; Heinemann, Akos; Waldhoer, Maria

    2012-01-01

    The G protein-coupled receptor (GPCR) 55 (GPR55) and the cannabinoid receptor 1 (CB1R) are co-expressed in many tissues, predominantly in the central nervous system. Seven transmembrane spanning (7TM) receptors/GPCRs can form homo- and heteromers and initiate distinct signaling pathways. Recently, several synthetic CB1 receptor inverse agonists/antagonists, such as SR141716A, AM251, and AM281, were reported to activate GPR55. Of these, SR141716A was marketed as a promising anti-obesity drug, but was withdrawn from the market because of severe side effects. Here, we tested whether GPR55 and CB1 receptors are capable of (i) forming heteromers and (ii) whether such heteromers could exhibit novel signaling patterns. We show that GPR55 and CB1 receptors alter each others signaling properties in human embryonic kidney (HEK293) cells. We demonstrate that the co-expression of FLAG-CB1 receptors in cells stably expressing HA-GPR55 specifically inhibits GPR55-mediated transcription factor activation, such as nuclear factor of activated T-cells and serum response element, as well as extracellular signal-regulated kinases (ERK1/2) activation. GPR55 and CB1 receptors can form heteromers, but the internalization of both receptors is not affected. In addition, we observe that the presence of GPR55 enhances CB1R-mediated ERK1/2 and nuclear factor of activated T-cell activation. Our data provide the first evidence that GPR55 can form heteromers with another 7TM/GPCR and that this interaction with the CB1 receptor has functional consequences in vitro. The GPR55-CB1R heteromer may play an important physiological and/or pathophysiological role in tissues endogenously co-expressing both receptors. PMID:23161546

  19. Expression and potential role of the peptide orexin-A in prostate cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valiante, Salvatore; Liguori, Giovanna; Tafuri, Simona

    The peptides orexin-A and orexin-B and their G protein-coupled OX1 and OX2 receptors are involved in multiple physiological processes in the central nervous system and peripheral organs. Altered expression or signaling dysregulation of orexins and their receptors have been associated with a wide range of human diseases including narcolepsy, obesity, drug addiction, and cancer. Although orexin-A, its precursor molecule prepro-orexin and OX1 receptor have been detected in the human normal and hyperplastic prostate tissues, their expression and function in the prostate cancer (PCa) remains to be addressed. Here, we demonstrate for the first time the immunohistochemical localization of orexin-A inmore » human PCa specimens, and the expression of prepro-orexin and OX1 receptor at both protein and mRNA levels in these tissues. Orexin-A administration to the human androgen-dependent prostate carcinoma cells LNCaP up-regulates OX1 receptor expression resulting in a decrease of cell survival. Noteworthy, nanomolar concentrations of the peptide counteract the testosterone-induced nuclear translocation of the androgen receptor in the cells: the orexin-A action is prevented by the addition of the OX1 receptor antagonist SB-408124 to the test system. These findings indicate that orexin-A/OX1 receptor interaction interferes with the activity of the androgen receptor which regulates PCa onset and progression, thus suggesting that orexin-A and its receptor might represent novel therapeutic targets to challenge this aggressive cancer. - Highlights: • Orexin-A and OX1 receptor are present in human cancer prostate tissues. • Orexin-A up-regulates OX1 receptor expression in LNCaP cells. • Orexin-A inhibits testosterone-induced nuclear translocation of androgen receptor.« less

  20. [Roles of G protein-coupled estrogen receptor in the male reproductive system].

    PubMed

    Chen, Kai-hong; Zhang, Xian; Jiang, Xue-wu

    2016-02-01

    The G protein-coupled estrogen receptor (GPER), also known as G protein-coupled receptor 30 (GPR30), was identified in the recent years as a functional membrane receptor different from the classical nuclear estrogen receptors. This receptor is widely expressed in the cortex, cerebellum, hippocampus, heart, lung, liver, skeletal muscle, and the urogenital system. It is responsible for the mediation of nongenomic effects associated with estrogen and its derivatives, participating in the physiological activities of the body. The present study reviews the molecular structure, subcellular localization, signaling pathways, distribution, and function of GPER in the male reproductive system.

  1. Mitochondrial DNA as a non-invasive biomarker: Accurate quantification using real time quantitative PCR without co-amplification of pseudogenes and dilution bias

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Malik, Afshan N., E-mail: afshan.malik@kcl.ac.uk; Shahni, Rojeen; Rodriguez-de-Ledesma, Ana

    2011-08-19

    Highlights: {yields} Mitochondrial dysfunction is central to many diseases of oxidative stress. {yields} 95% of the mitochondrial genome is duplicated in the nuclear genome. {yields} Dilution of untreated genomic DNA leads to dilution bias. {yields} Unique primers and template pretreatment are needed to accurately measure mitochondrial DNA content. -- Abstract: Circulating mitochondrial DNA (MtDNA) is a potential non-invasive biomarker of cellular mitochondrial dysfunction, the latter known to be central to a wide range of human diseases. Changes in MtDNA are usually determined by quantification of MtDNA relative to nuclear DNA (Mt/N) using real time quantitative PCR. We propose that themore » methodology for measuring Mt/N needs to be improved and we have identified that current methods have at least one of the following three problems: (1) As much of the mitochondrial genome is duplicated in the nuclear genome, many commonly used MtDNA primers co-amplify homologous pseudogenes found in the nuclear genome; (2) use of regions from genes such as {beta}-actin and 18S rRNA which are repetitive and/or highly variable for qPCR of the nuclear genome leads to errors; and (3) the size difference of mitochondrial and nuclear genomes cause a 'dilution bias' when template DNA is diluted. We describe a PCR-based method using unique regions in the human mitochondrial genome not duplicated in the nuclear genome; unique single copy region in the nuclear genome and template treatment to remove dilution bias, to accurately quantify MtDNA from human samples.« less

  2. Reflections on the theory of "silver bullet" octreotide tracers: implications for ligand-receptor interactions in the age of peptides, heterodimers, receptor mosaics, truncated receptors, and multifractal analysis

    PubMed Central

    2011-01-01

    The classical attitude of Nuclear Medicine practitioners on matters of peptide-receptor interactions has maintained an intrinsic monogamic character since many years. New advances in the field of biochemistry and even in clinical Nuclear Medicine have challenged this type of thinking, which prompted me to work on this review. The central issue of this paper will be the use of somatostatin analogs, i.e., octreotide, in clinical imaging procedures as well as in relation to neuroendocirne tumors. Newly described characteristics of G-protein coupled receptors such as the formation of receptor mosaics will be discussed. A small section will enumerate the regulatory processes found in the cell membrane. Possible new interpretations, other than tumor detection, based on imaging procedures with somatostatin analogs will be presented. The readers will be taken to situations such as inflammation, nociception, mechanosensing, chemosensing, fibrosis, taste, and vascularity where somatostatin is involved. Thyroid-associated orbitopathy will be used as a model for the development of multi-agent therapeutics. The final graphical summary depicts the multifactorial properties of ligand binding. PMID:22214590

  3. Control of energy balance by hypothalamic gene circuitry involving two nuclear receptors, neuron-derived orphan receptor 1 and glucocorticoid receptor.

    PubMed

    Kim, Sun-Gyun; Lee, Bora; Kim, Dae-Hwan; Kim, Juhee; Lee, Seunghee; Lee, Soo-Kyung; Lee, Jae W

    2013-10-01

    Nuclear receptors (NRs) regulate diverse physiological processes, including the central nervous system control of energy balance. However, the molecular mechanisms for the central actions of NRs in energy balance remain relatively poorly defined. Here we report a hypothalamic gene network involving two NRs, neuron-derived orphan receptor 1 (NOR1) and glucocorticoid receptor (GR), which directs the regulated expression of orexigenic neuropeptides agouti-related peptide (AgRP) and neuropeptide Y (NPY) in response to peripheral signals. Our results suggest that the anorexigenic signal leptin induces NOR1 expression likely via the transcription factor cyclic AMP response element-binding protein (CREB), while the orexigenic signal glucocorticoid mobilizes GR to inhibit NOR1 expression by antagonizing the action of CREB. Also, NOR1 suppresses glucocorticoid-dependent expression of AgRP and NPY. Consistently, relative to wild-type mice, NOR1-null mice showed significantly higher levels of AgRP and NPY and were less responsive to leptin in decreasing the expression of AgRP and NPY. These results identify mutual antagonism between NOR1 and GR to be a key rheostat for peripheral metabolic signals to centrally control energy balance.

  4. Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptor.

    PubMed Central

    Göttlicher, M; Widmark, E; Li, Q; Gustafsson, J A

    1992-01-01

    Peroxisome proliferators such as clofibric acid, nafenopin, and WY-14,643 have been shown to activate PPAR (peroxisome proliferator-activated receptor), a member of the steroid nuclear receptor superfamily. We have cloned the cDNA from the rat that is homologous to that from the mouse [Issemann, I. & Green, S. (1990) Nature (London) 347, 645-650], which encodes a 97% similar protein with a particularly well-conserved putative ligand-binding domain. To search for physiologically occurring activators, we established a transcriptional transactivation assay by stably expressing in CHO cells a chimera of rat PPAR and the human glucocorticoid receptor that activates expression of the placental alkaline phosphatase reporter gene under the control of the mouse mammary tumor virus promoter. Testing of compounds related to lipid metabolism or peroxisomal proliferation revealed that 150 microM concentrations of arachidonic or linoleic acid but not of dehydroepiandrosterone, cholesterol, or 25-hydroxy-cholesterol, activate the receptor chimera. In addition, saturated fatty acids induce the reporter gene. Shortening the chain length to n = 6 or introduction of an omega-terminal carboxylic group abolished the activation potential of the fatty acid. In conclusion, the present results indicate that fatty acids can regulate gene expression mediated by a member of the steroid nuclear receptor superfamily. Images PMID:1316614

  5. Reengineering ribosome export.

    PubMed

    Lo, Kai-Yin; Johnson, Arlen W

    2009-03-01

    Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages.

  6. Reengineering Ribosome Export

    PubMed Central

    Lo, Kai-Yin

    2009-01-01

    Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages. PMID:19144820

  7. Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent defense.

    PubMed

    Wirthmueller, Lennart; Zhang, Yan; Jones, Jonathan D G; Parker, Jane E

    2007-12-04

    Recognition of specific pathogen molecules inside the cell by nucleotide-binding domain and leucine-rich repeat (NB-LRR) receptors constitutes an important layer of innate immunity in plants. Receptor activation triggers host cellular reprogramming involving transcriptional potentiation of basal defenses and localized programmed cell death. The sites and modes of action of NB-LRR receptors are, however, poorly understood. Arabidopsis Toll/Interleukin-1 (TIR) type NB-LRR receptor RPS4 recognizes the bacterial type III effector AvrRps4. We show that epitope-tagged RPS4 expressed under its native regulatory sequences distributes between endomembranes and nuclei in healthy and AvrRps4-triggered tissues. RPS4 accumulation in the nucleus, mediated by a bipartite nuclear localization sequence (NLS) at its C terminus, is necessary for triggering immunity through authentic activation by AvrRps4 in Arabidopsis or as an effector-independent "deregulated" receptor in tobacco. A strikingly conserved feature of TIR-NB-LRR receptors is their recruitment of the nucleocytoplasmic basal-defense regulator EDS1 in resistance to diverse pathogens. We find that EDS1 is an indispensable component of RPS4 signaling and that it functions downstream of RPS4 activation but upstream of RPS4-mediated transcriptional reprogramming in the nucleus.

  8. Peroxisome proliferator-activated receptor (PPAR)-binding protein (PBP) but not PPAR-interacting protein (PRIP) is required for nuclear translocation of constitutive androstane receptor in mouse liver.

    PubMed

    Guo, Dongsheng; Sarkar, Joy; Ahmed, Mohamed R; Viswakarma, Navin; Jia, Yuzhi; Yu, Songtao; Sambasiva Rao, M; Reddy, Janardan K

    2006-08-25

    The constitutive androstane receptor (CAR) regulates transcription of phenobarbital-inducible genes that encode xenobiotic-metabolizing enzymes in liver. CAR is localized to the hepatocyte cytoplasm but to be functional, it translocates into the nucleus in the presence of phenobarbital-like CAR ligands. We now demonstrate that adenovirally driven EGFP-CAR, as expected, translocates into the nucleus of normal wild-type hepatocytes following phenobarbital treatment under both in vivo and in vitro conditions. Using this approach we investigated the role of transcription coactivators PBP and PRIP in the translocation of EGFP-CAR into the nucleus of PBP and PRIP liver conditional null mouse hepatocytes. We show that coactivator PBP is essential for nuclear translocation of CAR but not PRIP. Adenoviral expression of both PBP and EGFP-CAR restored phenobarbital-mediated nuclear translocation of exogenously expressed CAR in PBP null livers in vivo and in PBP null primary hepatocytes in vitro. CAR translocation into the nucleus of PRIP null livers resulted in the induction of CAR target genes such as CYP2B10, necessary for the conversion of acetaminophen to its hepatotoxic intermediate metabolite, N-acetyl-p-benzoquinone imine. As a consequence, PRIP-deficiency in liver did not protect from acetaminophen-induced hepatic necrosis, unlike that exerted by PBP deficiency. These results establish that transcription coactivator PBP plays a pivotal role in nuclear localization of CAR, that it is likely that PBP either enhances nuclear import or nuclear retention of CAR in hepatocytes, and that PRIP is redundant for CAR function.

  9. Modulation of Long-Term Potentiation and Epileptiform Activity in the Rat Dentate Gyrus by the Group II Metabotropic Glutamate Receptor Subtype mGluR3

    DTIC Science & Technology

    2000-05-25

    subsequent transmitter release. The rat hippocampal slice is a preparation richly endowed with ionotropic and metabotropic glutamate receptors ...M. Zhao and R. J. Wenthold (1996b). Ionotropic and metabotropic glutamate receptors show unique postsynaptic, presynaptic, and glial localizations in...epileptiform activity in the rat cortex. Neuroreport 3(10): 916-8. Shen, W. and M. M. Slaughter (1998). Metabotropic and ionotropic glutamate receptors

  10. Quantitative High-Throughput Screening and Orthogonal Assays to Identify Modulators of the Vitamin D Receptor (SETAC)

    EPA Science Inventory

    The Vitamin D nuclear receptor (VDR) is a selective, ligand-inducible transcription factor involved in numerous biological processes such as cell proliferation, differentiation, detoxification, calcium homeostasis, neurodevelopment, immune system regulation, cardiovascular functi...

  11. PPARs and Xenobiotic-Induced Adverse Effects:Relevance to Human Health

    EPA Science Inventory

    The peroxisome proliferator-activated receptors (PPARs) are members of the nuclear receptor superfamily that act as transcription factors and play important roles in the regulation ofa variety of biological processes, such as adipocyte proliferation and differentiation, glucose h...

  12. Auto-antibodies to Receptor Tyrosine Kinases TrkA, TrkB and TrkC in Patients with Chronic Chagas’ Disease

    PubMed Central

    Lu, B.; Petrola, Z.; Luquetti, A. O.; PereiraPerrin, M.

    2010-01-01

    The Chagas’ disease parasite Trypanosoma cruzi promotes survival and differentiation of neurones by binding and activating nerve growth factor (NGF) receptor TrkA. The functional mimic of NGF in T. cruzi is a surface-bound and shed immunogenic protein [neurotrophic factor/trans-sialidase (TS)], which raised the possibility that immune response to T. cruzi in general and to neurotrophic factor/TS in particular leads to loss of immunological tolerance to host NGF and/or the NGF-binding partner TrkA. In testing this hypothesis, we found that sera of individuals with chronic Chagas’ disease bear unique IgG2 autoantibodies that bind TrkA and TrkA family members TrkB and TrkC (ATA). Binding of ATA to Trk receptors is specific because the autoantibodies did not cross-react with five other growth factor receptors, NGF and other neurotrophins, and T. cruzi. Thus, individuals with chronic Chagas’ disease produce unique antibodies that react with pan-Trk receptors, one of which (TrkA) T. cruzi exploits to inhibit host cell apoptosis and to promote cellular invasion. PMID:18410251

  13. Design and structure of stapled peptides binding to estrogen receptors.

    PubMed

    Phillips, Chris; Roberts, Lee R; Schade, Markus; Bazin, Richard; Bent, Andrew; Davies, Nichola L; Moore, Rob; Pannifer, Andrew D; Pickford, Andrew R; Prior, Stephen H; Read, Christopher M; Scott, Andrew; Brown, David G; Xu, Bin; Irving, Stephen L

    2011-06-29

    Synthetic peptides that specifically bind nuclear hormone receptors offer an alternative approach to small molecules for the modulation of receptor signaling and subsequent gene expression. Here we describe the design of a series of novel stapled peptides that bind the coactivator peptide site of estrogen receptors. Using a number of biophysical techniques, including crystal structure analysis of receptor-stapled peptide complexes, we describe in detail the molecular interactions and demonstrate that all-hydrocarbon staples modulate molecular recognition events. The findings have implications for the design of stapled peptides in general.

  14. Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

    DTIC Science & Technology

    2002-01-01

    the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

  15. Nuclear receptor TLX inhibits TGF-β signaling in glioblastoma.

    PubMed

    Johansson, Erik; Zhai, Qiwei; Zeng, Zhao-Jun; Yoshida, Takeshi; Funa, Keiko

    2016-05-01

    TLX (also called NR2E1) is an orphan nuclear receptor that maintains stemness of neuronal stem cells. TLX is highly expressed in the most malignant form of glioma, glioblastoma multiforme (GBM), and is important for the proliferation and maintenance of the stem/progenitor cells of the tumor. Transforming Growth Factor-β (TGF-β) is a cytokine regulating many different cellular processes such as differentiation, migration, adhesion, cell death and proliferation. TGF-β has an important function in cancer where it can work as either a tumor suppressor or oncogene, depending on the cancer type and stage of tumor development. Since glioblastoma often have dysfunctional TGF-β signaling we wanted to find out if there is any interaction between TLX and TGF-β in glioblastoma cells. We demonstrate that knockdown of TLX enhances the canonical TGF-β signaling response in glioblastoma cell lines. TLX physically interacts with and stabilizes Smurf1, which can ubiquitinate and target TGF-β receptor II for degradation, whereas knockdown of TLX leads to stabilization of TGF-β receptor II, increased nuclear translocation of Smad2/3 and enhanced expression of TGF-β target genes. The interaction between TLX and TGF-β may play an important role in the regulation of proliferation and tumor-initiating properties of glioblastoma cells. Copyright © 2016. Published by Elsevier Inc.

  16. Structural basis for corepressor assembly by the orphan nuclear receptor TLX.

    PubMed

    Zhi, Xiaoyong; Zhou, X Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten; Xu, H Eric

    2015-02-15

    The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX-Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. © 2015 Zhi et al.; Published by Cold Spring Harbor Laboratory Press.

  17. Use of High Throughput Screening Data in IARC Monograph ...

    EPA Pesticide Factsheets

    Purpose: Evaluation of carcinogenic mechanisms serves a critical role in IARC monograph evaluations, and can lead to “upgrade” or “downgrade” of the carcinogenicity conclusions based on human and animal evidence alone. Three recent IARC monograph Working Groups (110, 112, and 113) pioneered analysis of high throughput in vitro screening data from the U.S. Environmental Protection Agency’s ToxCast program in evaluations of carcinogenic mechanisms. Methods: For monograph 110, ToxCast assay data across multiple nuclear receptors were used to test the hypothesis that PFOA acts exclusively through the PPAR family of receptors, with activity profiles compared to several prototypical nuclear receptor-activating compounds. For monographs 112 and 113, ToxCast assays were systematically evaluated and used as an additional data stream in the overall evaluation of the mechanistic evidence. Specifically, ToxCast assays were mapped to 10 “key characteristics of carcinogens” recently identified by an IARC expert group, and chemicals’ bioactivity profiles were evaluated both in absolute terms (number of relevant assays positive for bioactivity) and relative terms (ranking with respect to other compounds evaluated by IARC, using the ToxPi methodology). Results: PFOA activates multiple nuclear receptors in addition to the PPAR family in the ToxCast assays. ToxCast assays offered substantial coverage for 5 of the 10 “key characteristics,” with the greates

  18. Abnormal XPD-induced nuclear receptor transactivation in DNA repair disorders: trichothiodystrophy and xeroderma pigmentosum

    PubMed Central

    Zhou, Xiaolong; Khan, Sikandar G; Tamura, Deborah; Ueda, Takahiro; Boyle, Jennifer; Compe, Emmanuel; Egly, Jean-Marc; DiGiovanna, John J; Kraemer, Kenneth H

    2013-01-01

    XPD (ERCC2) is a DNA helicase involved in nucleotide excision repair and in transcription as a structural bridge tying the transcription factor IIH (TFIIH) core with the cdk-activating kinase complex, which phosphorylates nuclear receptors. Mutations in XPD are associated with several different phenotypes, including trichothiodystrophy (TTD), with sulfur-deficient brittle hair, bone defects, and developmental abnormalities without skin cancer, xeroderma pigmentosum (XP), with pigmentary abnormalities and increased skin cancer, or XP/TTD with combined features, including skin cancer. We describe the varied clinical features and mutations in nine patients examined at the National Institutes of Health who were compound heterozygotes for XPD mutations but had different clinical phenotypes: four TTD, three XP, and two combined XP/TTD. We studied TFIIH-dependent transactivation by nuclear receptor for vitamin D (VDR) and thyroid in cells from these patients. The vitamin D stimulation ratio of CYP24 and osteopontin was associated with specific pairs of mutations (reduced in 5, elevated in 1) but not correlated with distinct clinical phenotypes. Thyroid receptor stimulation ratio for KLF9 was not significantly different from normal. XPD mutations frequently were associated with abnormal VDR stimulation in compound heterozygote patients with TTD, XP, or XP/TTD. PMID:23232694

  19. Ku proteins function as corepressors to regulate farnesoid X receptor-mediated gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ohno, Masae; Kunimoto, Masaaki; Nishizuka, Makoto

    2009-12-18

    The farnesoid X receptor (FXR; NR1H4) is a member of the nuclear receptor superfamily and regulates the expression of genes involved in enterohepatic circulation and the metabolism of bile acids. Based on functional analyses, nuclear receptors are divided into regions A-F. To explore the cofactors interacting with FXR, we performed a pull-down assay using GST-fused to the N-terminal A/B region and the C region, which are required for the ligand-independent transactivation and DNA-binding, respectively, of FXR, and nuclear extracts from HeLa cells. We identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ku80, and Ku70 as FXR associated factors. These proteins aremore » known to have an important role in DNA repair, recombination, and transcription. DNA-PKcs mainly interacted with the A/B region of FXR, whereas the Ku proteins interacted with the C region and with the D region (hinge region). Chromatin immunoprecipitation assays revealed that the Ku proteins associated with FXR on the bile salt export pump (BSEP) promoter. Furthermore, we demonstrated that ectopic expression of the Ku proteins decreased the promoter activity and expression of BSEP gene mediated by FXR. These results suggest that the Ku proteins function as corepressors for FXR.« less

  20. Mechanism of nitrofen teratogenesis.

    PubMed Central

    Manson, J M

    1986-01-01

    Nitrofen (2,4-dichloro-4'-nitrodiphenyl ether) is an herbicide with potent teratogenic activity in rats. When administered at doses as low as 0.15 mg/kg/day during organogenesis, abnormal development of the heart, kidneys, diaphragm, and lung occurs. The specific pattern of visceral malformations produced in the absence of overt maternal toxicity or embryolethality/cytotoxicity suggest that the compound perturbs processes unique or highly selective for embryonic differentiation. Despite findings of metabolic activation to mutagenic intermediates and carcinogenic activity in adult rodents, several lines of evidence indicate that teratogenicity is not based on mutagenic insult to the embryo. Rather, evidence is accumulating that nitrofen exerts a teratogenic effect via alterations in thyroid hormone status. The premature and pharmacologic exposure of the embryo to a nitrofen-derived thyromimetic challenge is believed to be the cause of abnormal morphogenesis of the heart, lungs, kidneys, and diaphragm. The parent compound itself could directly bind to embryonic nuclear receptors for T3, leading to altered differentiation of target organs. Alternatively, increased availability and placental transport of free thyroid hormones in the maternal compartment could be the source of thyromimetic challenge to the embryo. Overall, these studies indicate that, in the case of nitrofen, the mode of teratogenic activity is uniquely different from the mode of adult toxicity. PMID:3830099

  1. Structural and functional evidences for the interactions between nuclear hormone receptors and endocrine disruptors at low doses.

    PubMed

    Balaguer, Patrick; Delfosse, Vanessa; Grimaldi, Marina; Bourguet, William

    Endocrine-disrupting chemicals (EDCs) represent a broad class of exogenous substances that cause adverse effects in the endocrine system mainly by interacting with nuclear hormone receptors (NRs). Humans are generally exposed to low doses of pollutants, and current researches aim at deciphering the mechanisms accounting for the health impact of EDCs at environmental concentrations. Our correlative analysis of structural, interaction and cell-based data has revealed a variety of, sometimes unexpected, binding modes, reflecting a wide range of EDC affinities and specificities. Here, we present a few representative examples to illustrate various means by which EDCs achieve high-affinity binding to NRs. These examples include the binding of the mycoestrogen α-zearalanol to estrogen receptors, the covalent interaction of organotins with the retinoid X- and peroxisome proliferator-activated receptors, and the cooperative binding of two chemicals to the pregnane X receptor. We also discuss some hypotheses that could further explain low-concentration effects of EDCs with weaker affinity towards NRs. Copyright © 2017. Published by Elsevier Masson SAS.

  2. Identification of isosilybin a from milk thistle seeds as an agonist of peroxisome proliferator-activated receptor gamma.

    PubMed

    Pferschy-Wenzig, Eva-Maria; Atanasov, Atanas G; Malainer, Clemens; Noha, Stefan M; Kunert, Olaf; Schuster, Daniela; Heiss, Elke H; Oberlies, Nicholas H; Wagner, Hildebert; Bauer, Rudolf; Dirsch, Verena M

    2014-04-25

    Peroxisome proliferator-activated receptor gamma (PPARγ) is a key regulator of glucose and lipid metabolism. Agonists of this nuclear receptor are used in the treatment of type 2 diabetes and are also studied as a potential treatment of other metabolic diseases, including nonalcoholic fatty liver disease. Silymarin, a concentrated phenolic mixture from milk thistle (Silybum marianum) seeds, is used widely as a supportive agent in the treatment of a variety of liver diseases. In this study, the PPARγ activation potential of silymarin and its main constituents was investigated. Isosilybin A (3) caused transactivation of a PPARγ-dependent luciferase reporter in a concentration-dependent manner. This effect could be reversed upon co-treatment with the PPARγ antagonist T0070907. In silico docking studies suggested a binding mode for 3 distinct from that of the inactive silymarin constituents, with one additional hydrogen bond to Ser342 in the entrance region of the ligand-binding domain of the receptor. Hence, isosilybin A (3) has been identified as the first flavonolignan PPARγ agonist, suggesting its further investigation as a modulator of this nuclear receptor.

  3. A comprehensive data mining study shows that most nuclear receptors act as newly proposed homeostasis-associated molecular pattern receptors.

    PubMed

    Wang, Luqiao; Nanayakkara, Gayani; Yang, Qian; Tan, Hongmei; Drummer, Charles; Sun, Yu; Shao, Ying; Fu, Hangfei; Cueto, Ramon; Shan, Huimin; Bottiglieri, Teodoro; Li, Ya-Feng; Johnson, Candice; Yang, William Y; Yang, Fan; Xu, Yanjie; Xi, Hang; Liu, Weiqing; Yu, Jun; Choi, Eric T; Cheng, Xiaoshu; Wang, Hong; Yang, Xiaofeng

    2017-10-24

    Nuclear receptors (NRs) can regulate gene expression; therefore, they are classified as transcription factors. Despite the extensive research carried out on NRs, still several issues including (1) the expression profile of NRs in human tissues, (2) how the NR expression is modulated during atherosclerosis and metabolic diseases, and (3) the overview of the role of NRs in inflammatory conditions are not fully understood. To determine whether and how the expression of NRs are regulated in physiological/pathological conditions, we took an experimental database analysis to determine expression of all 48 known NRs in 21 human and 17 murine tissues as well as in pathological conditions. We made the following significant findings: (1) NRs are differentially expressed in tissues, which may be under regulation by oxygen sensors, angiogenesis pathway, stem cell master regulators, inflammasomes, and tissue hypo-/hypermethylation indexes; (2) NR sequence mutations are associated with increased risks for development of cancers and metabolic, cardiovascular, and autoimmune diseases; (3) NRs have less tendency to be upregulated than downregulated in cancers, and autoimmune and metabolic diseases, which may be regulated by inflammation pathways and mitochondrial energy enzymes; and (4) the innate immune sensor inflammasome/caspase-1 pathway regulates the expression of most NRs. Based on our findings, we propose a new paradigm that most nuclear receptors are anti-inflammatory homeostasis-associated molecular pattern receptors (HAMPRs). Our results have provided a novel insight on NRs as therapeutic targets in metabolic diseases, inflammations, and malignancies.

  4. Nuclear Receptors in Bone Physiology and Diseases

    PubMed Central

    Youn, Min-Young; Inoue, Kazuki; Takada, Ichiro; Kouzmenko, Alexander; Kato, Shigeaki

    2013-01-01

    During the last decade, our view on the skeleton as a mere solid physical support structure has been transformed, as bone emerged as a dynamic, constantly remodeling tissue with systemic regulatory functions including those of an endocrine organ. Reflecting this remarkable functional complexity, distinct classes of humoral and intracellular regulatory factors have been shown to control vital processes in the bone. Among these regulators, nuclear receptors (NRs) play fundamental roles in bone development, growth, and maintenance. NRs are DNA-binding transcription factors that act as intracellular transducers of the respective ligand signaling pathways through modulation of expression of specific sets of cognate target genes. Aberrant NR signaling caused by receptor or ligand deficiency may profoundly affect bone health and compromise skeletal functions. Ligand dependency of NR action underlies a major strategy of therapeutic intervention to correct aberrant NR signaling, and significant efforts have been made to design novel synthetic NR ligands with enhanced beneficial properties and reduced potential negative side effects. As an example, estrogen deficiency causes bone loss and leads to development of osteoporosis, the most prevalent skeletal disorder in postmenopausal women. Since administration of natural estrogens for the treatment of osteoporosis often associates with undesirable side effects, several synthetic estrogen receptor ligands have been developed with higher therapeutic efficacy and specificity. This review presents current progress in our understanding of the roles of various nuclear receptor-mediated signaling pathways in bone physiology and disease, and in development of advanced NR ligands for treatment of common skeletal disorders. PMID:23589826

  5. The emerging roles of orphan nuclear receptors in prostate cancer.

    PubMed

    Wu, Dinglan; Cheung, Alyson; Wang, Yuliang; Yu, Shan; Chan, Franky L

    2016-08-01

    Orphan nuclear receptors are members of the nuclear receptor (NR) superfamily and are so named because their endogenous physiological ligands are either unknown or may not exist. Because of their important regulatory roles in many key physiological processes, dysregulation of signalings controlled by these receptors is associated with many diseases including cancer. Over years, studies of orphan NRs have become an area of great interest because their specific physiological and pathological roles have not been well-defined, and some of them are promising drug targets for diseases. The recently identified synthetic small molecule ligands, acting as agonists or antagonists, to these orphan NRs not only help to understand better their functional roles but also highlight that the signalings mediated by these ligand-independent NRs in diseases could be therapeutically intervened. This review is a summary of the recent advances in elucidating the emerging functional roles of orphan NRs in cancers, especially prostate cancer. In particular, some orphan NRs, RORγ, TR2, TR4, COUP-IFII, ERRα, DAX1 and SHP, exhibit crosstalk or interference with androgen receptor (AR) signaling in either normal or malignant prostatic cells, highlighting their involvement in prostate cancer progression as androgen and AR signaling pathway play critical roles in this process. We also propose that a better understanding of the mechanism of actions of these orphan NRs in prostate gland or prostate cancer could help to evaluate their potential value as therapeutic targets for prostate cancer. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Mechanisms of action of nonpeptide hormones on resveratrol-induced antiproliferation of cancer cells.

    PubMed

    Lin, Hung-Yun; Hsieh, Meng-Ti; Cheng, Guei-Yun; Lai, Hsuan-Yu; Chin, Yu-Tang; Shih, Ya-Jung; Nana, André Wendindondé; Lin, Shin-Ying; Yang, Yu-Chen S H; Tang, Heng-Yuan; Chiang, I-Jen; Wang, Kuan

    2017-09-01

    Nonpeptide hormones, such as thyroid hormone, dihydrotestosterone, and estrogen, have been shown to stimulate cancer proliferation via different mechanisms. Aside from their cytosolic or membrane-bound receptors, there are receptors on integrin α v β 3 for nonpeptide hormones. Interaction between hormones and integrin α v β 3 can induce signal transduction and eventually stimulate cancer cell proliferation. Resveratrol induces inducible COX-2-dependent antiproliferation via integrin α v β 3 . Resveratrol and hormone-induced signals are both transduced by activated extracellular-regulated kinases 1 and 2 (ERK1/2); however, hormones promote cell proliferation, while resveratrol induces antiproliferation in cancer cells. Hormones inhibit resveratrol-stimulated phosphorylation of p53 on Ser15, resveratrol-induced nuclear COX-2 accumulation, and formation of p53-COX-2 nuclear complexes. Subsequently, hormones impair resveratrol-induced COX-2-/p53-dependent gene expression. The inhibitory effects of hormones on resveratrol action can be blocked by different antagonists of specific nonpeptide hormone receptors but not integrin α v β 3 blockers. Results suggest that nonpeptide hormones inhibit resveratrol-induced antiproliferation in cancer cells downstream of the interaction between ligand and receptor and ERK1/2 activation to interfere with nuclear COX-2 accumulation. Thus, the surface receptor sites for resveratrol and nonpeptide hormones are distinct and can induce discrete ERK1/2-dependent downstream antiproliferation biological activities. It also indicates the complex pathways by which antiproliferation is induced by resveratrol in various physiological hormonal environments. . © 2017 New York Academy of Sciences.

  7. Selective Imaging of VEGFR-1 and VEGFR-2 Using 89Zr-Labeled Single-Chain VEGF Mutants.

    PubMed

    Meyer, Jan-Philip; Edwards, Kimberly J; Kozlowski, Paul; Backer, Marina V; Backer, Joseph M; Lewis, Jason S

    2016-11-01

    Vascular endothelial growth factor-A (VEGF-A) acts via 2 vascular endothelial growth factor receptors, VEGFR-1 and VEGFR-2, that play important and distinct roles in tumor biology. We reasoned that selective imaging of these receptors could provide unique information for diagnostics and for monitoring and optimizing responses to anticancer therapy, including antiangiogenic therapy. Herein, we report the development of 2 first-in-class 89 Zr-labeled PET tracers that enable the selective imaging of VEGFR-1 and VEGFR-2. Functionally active mutants of scVEGF (an engineered single-chain version of pan-receptor VEGF-A with an N-terminal cysteine-containing tag for site-specific conjugation), named scVR1 and scVR2 with enhanced affinity to, respectively, VEGFR-1 and VEGFR-2, were constructed. Parental scVEGF and its receptor-specific mutants were site-specifically derivatized with the 89 Zr chelator desferroxamine B via a 3.4-kDa PEG linker. 89 Zr labeling of the desferroxamine B conjugates furnished scV/Zr, scVR1/Zr, and scVR2/Zr tracers with high radiochemical yield (>87%), high specific activity (≥9.8 MBq/nmol), and purity (>99%). Tracers were tested in an orthotopic breast cancer model using 4T1luc-bearing syngeneic BALB/c mice. For testing tracer specificity, tracers were coinjected with an excess of cold proteins of the same or opposite receptor specificity or pan-receptor scVEGF. PET imaging, biodistribution, and dosimetry studies in mice, as well as immunohistochemical analysis of harvested tumors, were performed. All tracers rapidly accumulated in orthotopic 4T1luc tumors, allowing for the successful PET imaging of the tumors as early as 2 h after injection. Blocking experiments with an excess of pan-receptor or receptor-specific cold proteins indicated that more than 80% of tracer tumor uptake is VEGFR-mediated, whereas uptake in all major organs is not affected by blocking within the margin of error. Critically, blocking experiments indicated that VEGFR-mediated tumor uptake of scVR1/Zr and scVR2/Zr was mediated exclusively by the corresponding receptor, VEGFR-1 or VEGFR-2, respectively. In contrast, uptake of pan-receptor scV/Zr was mediated by both VEGFR-1 and VEGFR-2 at an approximately 2:1 ratio. First-in-class selective PET tracers for imaging VEGFR-1 and VEGFR-2 were constructed and successfully validated in an orthotopic murine tumor model. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  8. Conventional and Non-Conventional Nuclear Material Signatures

    NASA Astrophysics Data System (ADS)

    Gozani, Tsahi

    2009-03-01

    The detection and interdiction of concealed special nuclear material (SNM) in all modes of transport is one of the most critical security issues facing the United States and the rest of the world. In principle, detection of nuclear materials is relatively easy because of their unique properties: all of them are radioactive and all emit some characteristic gamma rays. A few emit neutrons as well. These signatures are the basis for passive non-intrusive detection of nuclear materials. The low energy of the radiations necessitates additional means of detection and validation. These are provided by high-energy x-ray radiography and by active inspection based on inducing nuclear reactions in the nuclear materials. Positive confirmation that a nuclear material is present or absent can be provided by interrogation of the inspected object with penetrating probing radiation, such as neutrons and photons. The radiation induces specific reactions in the nuclear material yielding, in turn, penetrating signatures which can be detected outside the inspected object. The "conventional" signatures are first and foremost fission signatures: prompt and delayed neutrons and gamma rays. Their intensity (number per fission) and the fact that they have broad energy (non-discrete, though unique) distributions and certain temporal behaviors are key to their use. The "non- conventional" signatures are not related to the fission process but to the unique nuclear structure of each element or isotope in nature. This can be accessed through the excitation of isotopic nuclear levels (discrete and continuum) by neutron inelastic scattering or gamma resonance fluorescence. Finally there is an atomic signature, namely the high atomic number (Z>74), which obviously includes all the nuclear materials and their possible shielding. The presence of such high-Z elements can be inferred by techniques using high-energy x rays. The conventional signatures have been addressed in another article. Non-conventional signatures and some of their current or potential uses will be discussed here.

  9. Complementary Roles of Estrogen-Related Receptors in Brown Adipocyte Thermogenic Function

    PubMed Central

    Gantner, Marin L.; Hazen, Bethany C.; Eury, Elodie; Brown, Erin L.

    2016-01-01

    Brown adipose tissue (BAT) thermogenesis relies on a high abundance of mitochondria and the unique expression of the mitochondrial Uncoupling Protein 1 (UCP1), which uncouples substrate oxidation from ATP synthesis. Adrenergic stimulation of brown adipocytes activates UCP1-mediated thermogenesis; it also induces the expression of Ucp1 and other genes important for thermogenesis, thereby endowing adipocytes with higher oxidative and uncoupling capacities. Adipocyte mitochondrial biogenesis and oxidative capacity are controlled by multiple transcription factors, including the estrogen-related receptor (ERR)α. Whole-body ERRα knockout mice show decreased BAT mitochondrial content and oxidative function but normal induction of Ucp1 in response to cold. In addition to ERRα, brown adipocytes express ERRβ and ERRγ, 2 nuclear receptors that are highly similar to ERRα and whose function in adipocytes is largely unknown. To gain insights into the roles of all 3 ERRs, we assessed mitochondrial function and adrenergic responses in primary brown adipocytes lacking combinations of ERRs. We show that adipocytes lacking just ERRα, the most abundant ERR, show only mild mitochondrial defects. Adipocytes lacking ERRβ and ERRγ also show just mild defects. In contrast, adipocytes lacking all 3 ERRs have severe reductions in mitochondrial content and oxidative capacity. Moreover, adipocytes lacking all 3 ERRs have defects in the transcriptional and metabolic response to adrenergic stimulation, suggesting a wider role of ERRs in BAT function than previously appreciated. Our study shows that ERRs have a great capacity to compensate for each other in protecting mitochondrial function and the metabolic response to adrenergic signaling, processes vital to BAT function. PMID:27763777

  10. Estrogens in Male Physiology.

    PubMed

    Cooke, Paul S; Nanjappa, Manjunatha K; Ko, CheMyong; Prins, Gail S; Hess, Rex A

    2017-07-01

    Estrogens have historically been associated with female reproduction, but work over the last two decades established that estrogens and their main nuclear receptors (ESR1 and ESR2) and G protein-coupled estrogen receptor (GPER) also regulate male reproductive and nonreproductive organs. 17β-Estradiol (E2) is measureable in blood of men and males of other species, but in rete testis fluids, E2 reaches concentrations normally found only in females and in some species nanomolar concentrations of estrone sulfate are found in semen. Aromatase, which converts androgens to estrogens, is expressed in Leydig cells, seminiferous epithelium, and other male organs. Early studies showed E2 binding in numerous male tissues, and ESR1 and ESR2 each show unique distributions and actions in males. Exogenous estrogen treatment produced male reproductive pathologies in laboratory animals and men, especially during development, and studies with transgenic mice with compromised estrogen signaling demonstrated an E2 role in normal male physiology. Efferent ductules and epididymal functions are dependent on estrogen signaling through ESR1, whose loss impaired ion transport and water reabsorption, resulting in abnormal sperm. Loss of ESR1 or aromatase also produces effects on nonreproductive targets such as brain, adipose, skeletal muscle, bone, cardiovascular, and immune tissues. Expression of GPER is extensive in male tracts, suggesting a possible role for E2 signaling through this receptor in male reproduction. Recent evidence also indicates that membrane ESR1 has critical roles in male reproduction. Thus estrogens are important physiological regulators in males, and future studies may reveal additional roles for estrogen signaling in various target tissues. Copyright © 2017 the American Physiological Society.

  11. Highly multiplexed single-cell analysis of formalin-fixed, paraffin-embedded cancer tissue

    PubMed Central

    Gerdes, Michael J.; Sevinsky, Christopher J.; Sood, Anup; Adak, Sudeshna; Bello, Musodiq O.; Bordwell, Alexander; Can, Ali; Corwin, Alex; Dinn, Sean; Filkins, Robert J.; Hollman, Denise; Kamath, Vidya; Kaanumalle, Sireesha; Kenny, Kevin; Larsen, Melinda; Lazare, Michael; Lowes, Christina; McCulloch, Colin C.; McDonough, Elizabeth; Pang, Zhengyu; Rittscher, Jens; Santamaria-Pang, Alberto; Sarachan, Brion D.; Seel, Maximilian L.; Seppo, Antti; Shaikh, Kashan; Sui, Yunxia; Zhang, Jingyu; Ginty, Fiona

    2013-01-01

    Limitations on the number of unique protein and DNA molecules that can be characterized microscopically in a single tissue specimen impede advances in understanding the biological basis of health and disease. Here we present a multiplexed fluorescence microscopy method (MxIF) for quantitative, single-cell, and subcellular characterization of multiple analytes in formalin-fixed paraffin-embedded tissue. Chemical inactivation of fluorescent dyes after each image acquisition round allows reuse of common dyes in iterative staining and imaging cycles. The mild inactivation chemistry is compatible with total and phosphoprotein detection, as well as DNA FISH. Accurate computational registration of sequential images is achieved by aligning nuclear counterstain-derived fiducial points. Individual cells, plasma membrane, cytoplasm, nucleus, tumor, and stromal regions are segmented to achieve cellular and subcellular quantification of multiplexed targets. In a comparison of pathologist scoring of diaminobenzidine staining of serial sections and automated MxIF scoring of a single section, human epidermal growth factor receptor 2, estrogen receptor, p53, and androgen receptor staining by diaminobenzidine and MxIF methods yielded similar results. Single-cell staining patterns of 61 protein antigens by MxIF in 747 colorectal cancer subjects reveals extensive tumor heterogeneity, and cluster analysis of divergent signaling through ERK1/2, S6 kinase 1, and 4E binding protein 1 provides insights into the spatial organization of mechanistic target of rapamycin and MAPK signal transduction. Our results suggest MxIF should be broadly applicable to problems in the fields of basic biological research, drug discovery and development, and clinical diagnostics. PMID:23818604

  12. Highly multiplexed single-cell analysis of formalin-fixed, paraffin-embedded cancer tissue.

    PubMed

    Gerdes, Michael J; Sevinsky, Christopher J; Sood, Anup; Adak, Sudeshna; Bello, Musodiq O; Bordwell, Alexander; Can, Ali; Corwin, Alex; Dinn, Sean; Filkins, Robert J; Hollman, Denise; Kamath, Vidya; Kaanumalle, Sireesha; Kenny, Kevin; Larsen, Melinda; Lazare, Michael; Li, Qing; Lowes, Christina; McCulloch, Colin C; McDonough, Elizabeth; Montalto, Michael C; Pang, Zhengyu; Rittscher, Jens; Santamaria-Pang, Alberto; Sarachan, Brion D; Seel, Maximilian L; Seppo, Antti; Shaikh, Kashan; Sui, Yunxia; Zhang, Jingyu; Ginty, Fiona

    2013-07-16

    Limitations on the number of unique protein and DNA molecules that can be characterized microscopically in a single tissue specimen impede advances in understanding the biological basis of health and disease. Here we present a multiplexed fluorescence microscopy method (MxIF) for quantitative, single-cell, and subcellular characterization of multiple analytes in formalin-fixed paraffin-embedded tissue. Chemical inactivation of fluorescent dyes after each image acquisition round allows reuse of common dyes in iterative staining and imaging cycles. The mild inactivation chemistry is compatible with total and phosphoprotein detection, as well as DNA FISH. Accurate computational registration of sequential images is achieved by aligning nuclear counterstain-derived fiducial points. Individual cells, plasma membrane, cytoplasm, nucleus, tumor, and stromal regions are segmented to achieve cellular and subcellular quantification of multiplexed targets. In a comparison of pathologist scoring of diaminobenzidine staining of serial sections and automated MxIF scoring of a single section, human epidermal growth factor receptor 2, estrogen receptor, p53, and androgen receptor staining by diaminobenzidine and MxIF methods yielded similar results. Single-cell staining patterns of 61 protein antigens by MxIF in 747 colorectal cancer subjects reveals extensive tumor heterogeneity, and cluster analysis of divergent signaling through ERK1/2, S6 kinase 1, and 4E binding protein 1 provides insights into the spatial organization of mechanistic target of rapamycin and MAPK signal transduction. Our results suggest MxIF should be broadly applicable to problems in the fields of basic biological research, drug discovery and development, and clinical diagnostics.

  13. Physiological, Pharmacological, and Nutritional Regulation of Circulating Adiponectin Concentrations in Humans

    PubMed Central

    Swarbrick, Michael M.

    2008-01-01

    Abstract Adiponectin is an adipocyte hormone that links visceral adiposity with insulin resistance and atherosclerosis. It is unique among adipocyte-derived hormones in that its circulating concentrations are inversely proportional to adiposity, and low adiponectin concentrations predict the development of type 2 diabetes and cardiovascular disease. Consequently, in the decade since its discovery, adiponectin has generated immense interest as a potential therapeutic target for the metabolic syndrome and diabetes. This review summarizes current research regarding the regulation of circulating adiponectin concentrations by physiological, pharmacological, and nutritional factors, with an emphasis on human studies. In humans, plasma adiponectin concentrations are influenced by age and gender, and are inversely proportional to visceral adiposity. In vitro studies suggest that adiponectin production may be determined primarily by adipocyte size and insulin sensitivity, with larger, insulin-resistant adipocytes producing less adiponectin. While adiponectin concentrations are unchanged after meal ingestion, they are increased by significant weight loss, such as after bariatric surgery. In addition, adiponectin production is inhibited by a number of hormones, including testosterone, prolactin, glucocorticoids and growth hormone, and by inflammation and oxidative stress in adipose tissue. Smoking decreases, while moderate alcohol consumption increases, circulating adiponectin concentrations. Dietary fatty acid composition in rodents influences adiponectin production via ligand-activated nuclear receptors (PPARs); however, current evidence in humans is equivocal. In addition to PPAR agonists (such as thiazolidinediones and fibrates), a number of pharmacological agents (angiotensin receptor type 1 blockers, ACE inhibitors, and cannabinoid receptor antagonists) used in treatment of the metabolic syndrome also increase adiponectin concentrations in humans. PMID:18510434

  14. "Lactoferrin and Peptide-derivatives: Antimicrobial Agents with Potential Use in Nonspecific Immunity Modulation".

    PubMed

    Drago-Serrano, Maria Elisa; Campos-Rodriguez, Rafael; Carrero, Julio Cesar; de la Garza, Mireya

    2018-03-27

    Lactoferrin (Lf) is a conserved cationic non-heme glycoprotein that is part of the innate immune defense system of mammals. Lf is present in colostrum, milk and mucosal sites, and it is also produced by polymorphonuclear neutrophils and secreted at infection sites. Lf and Lf N-terminus peptide-derivatives named lactoferricins (Lfcins) are molecules with microbiostatic and microbicidal action in a wide array of pathogens. In addition, they display regulatory properties on components of nonspecific immunity, including toll-like receptors, pro- and anti-inflammatory cytokines, and reactive oxygen species. Mechanisms explaining the ability of Lf and Lfcins to display both up- and down-modulatory properties on cells are not fully understood but result, in part, from their interactions with membrane receptors that elicit biochemical signal pathways, whereas other receptors enable the nuclear translocation of these molecules for the modulation of target genes. The dual role of Lf and Lfcins as antimicrobials and immunomodulators is of biotechnological and pharmaceutical interest. Native Lf and its peptide-derivatives from human and bovine sources, the recombinant versions of the human protein, and their synthetic peptides have potential application as adjunctive agents in therapies to combat infections caused by multi-resistant bacteria and those caused by fungi, protozoa and viruses, as well as in the prevention and reduction of several types of cancer and response to LPS-shock, among other effects. In this review, we summarize the immunomodulatory properties of the unique multifunctional protein Lf and its N-terminus peptides. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  15. Importance of extranuclear estrogen receptor-alpha and membrane G protein-coupled estrogen receptor in pancreatic islet survival.

    PubMed

    Liu, Suhuan; Le May, Cedric; Wong, Winifred P S; Ward, Robert D; Clegg, Deborah J; Marcelli, Marco; Korach, Kenneth S; Mauvais-Jarvis, Franck

    2009-10-01

    We showed that 17beta-estradiol (E(2)) favors pancreatic beta-cell survival via the estrogen receptor-alpha (ERalpha) in mice. E(2) activates nuclear estrogen receptors via an estrogen response element (ERE). E(2) also activates nongenomic signals via an extranuclear form of ERalpha and the G protein-coupled estrogen receptor (GPER). We studied the contribution of estrogen receptors to islet survival. We used mice and islets deficient in estrogen receptor-alpha (alphaERKO(-/-)), estrogen receptor-beta (betaERKO(-/-)), estrogen receptor-alpha and estrogen receptor-beta (alphabetaERKO(-/-)), and GPER (GPERKO(-/-)); a mouse lacking ERalpha binding to the ERE; and human islets. These mice and islets were studied in combination with receptor-specific pharmacological probes. We show that ERalpha protection of islet survival is ERE independent and that E(2) favors islet survival through extranuclear and membrane estrogen receptor signaling. We show that ERbeta plays a minor cytoprotective role compared to ERalpha. Accordingly, betaERKO(-/-) mice are mildly predisposed to streptozotocin-induced islet apoptosis. However, combined elimination of ERalpha and ERbeta in mice does not synergize to provoke islet apoptosis. In alphabetaERKO(-/-) mice and their islets, E(2) partially prevents apoptosis suggesting that an alternative pathway compensates for ERalpha/ERbeta deficiency. We find that E(2) protection of islet survival is reproduced by a membrane-impermeant E(2) formulation and a selective GPER agonist. Accordingly, GPERKO(-/-) mice are susceptible to streptozotocin-induced insulin deficiency. E(2) protects beta-cell survival through ERalpha and ERbeta via ERE-independent, extra-nuclear mechanisms, as well as GPER-dependent mechanisms. The present study adds a novel dimension to estrogen biology in beta-cells and identifies GPER as a target to protect islet survival.

  16. International Union of Basic and Clinical Pharmacology. XCVII. G Protein–Coupled Estrogen Receptor and Its Pharmacologic Modulators

    PubMed Central

    2015-01-01

    Estrogens are critical mediators of multiple and diverse physiologic effects throughout the body in both sexes, including the reproductive, cardiovascular, endocrine, nervous, and immune systems. As such, alterations in estrogen function play important roles in many diseases and pathophysiological conditions (including cancer), exemplified by the lower prevalence of many diseases in premenopausal women. Estrogens mediate their effects through multiple cellular receptors, including the nuclear receptor family (ERα and ERβ) and the G protein–coupled receptor (GPCR) family (GPR30/G protein–coupled estrogen receptor [GPER]). Although both receptor families can initiate rapid cell signaling and transcriptional regulation, the nuclear receptors are traditionally associated with regulating gene expression, whereas GPCRs are recognized as mediating rapid cellular signaling. Estrogen-activated pathways are not only the target of multiple therapeutic agents (e.g., tamoxifen, fulvestrant, raloxifene, and aromatase inhibitors) but are also affected by a plethora of phyto- and xeno-estrogens (e.g., genistein, coumestrol, bisphenol A, dichlorodiphenyltrichloroethane). Because of the existence of multiple estrogen receptors with overlapping ligand specificities, expression patterns, and signaling pathways, the roles of the individual receptors with respect to the diverse array of endogenous and exogenous ligands have been challenging to ascertain. The identification of GPER-selective ligands however has led to a much greater understanding of the roles of this receptor in normal physiology and disease as well as its interactions with the classic estrogen receptors ERα and ERβ and their signaling pathways. In this review, we describe the history and characterization of GPER over the past 15 years focusing on the pharmacology of steroidal and nonsteroidal compounds that have been employed to unravel the biology of this most recently recognized estrogen receptor. PMID:26023144

  17. International Union of Basic and Clinical Pharmacology. XCVII. G Protein-Coupled Estrogen Receptor and Its Pharmacologic Modulators.

    PubMed

    Prossnitz, Eric R; Arterburn, Jeffrey B

    2015-07-01

    Estrogens are critical mediators of multiple and diverse physiologic effects throughout the body in both sexes, including the reproductive, cardiovascular, endocrine, nervous, and immune systems. As such, alterations in estrogen function play important roles in many diseases and pathophysiological conditions (including cancer), exemplified by the lower prevalence of many diseases in premenopausal women. Estrogens mediate their effects through multiple cellular receptors, including the nuclear receptor family (ERα and ERβ) and the G protein-coupled receptor (GPCR) family (GPR30/G protein-coupled estrogen receptor [GPER]). Although both receptor families can initiate rapid cell signaling and transcriptional regulation, the nuclear receptors are traditionally associated with regulating gene expression, whereas GPCRs are recognized as mediating rapid cellular signaling. Estrogen-activated pathways are not only the target of multiple therapeutic agents (e.g., tamoxifen, fulvestrant, raloxifene, and aromatase inhibitors) but are also affected by a plethora of phyto- and xeno-estrogens (e.g., genistein, coumestrol, bisphenol A, dichlorodiphenyltrichloroethane). Because of the existence of multiple estrogen receptors with overlapping ligand specificities, expression patterns, and signaling pathways, the roles of the individual receptors with respect to the diverse array of endogenous and exogenous ligands have been challenging to ascertain. The identification of GPER-selective ligands however has led to a much greater understanding of the roles of this receptor in normal physiology and disease as well as its interactions with the classic estrogen receptors ERα and ERβ and their signaling pathways. In this review, we describe the history and characterization of GPER over the past 15 years focusing on the pharmacology of steroidal and nonsteroidal compounds that have been employed to unravel the biology of this most recently recognized estrogen receptor. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

  18. Synthesis of new C-25 and C-26 steroidal acids as potential ligands of the nuclear receptors DAF-12, LXR and GR.

    PubMed

    Dansey, María V; Del Fueyo, María C; Veleiro, Adriana S; Di Chenna, Pablo H

    2017-05-01

    A new methodology to obtain C-25 and C-26 steroidal acids starting from pregnenolone is described. Construction of the side chain was achieved by applying the Mukaiyama aldol reaction with a non-hydrolytic work-up to isolate the trapped silyl enol ether with higher yields. Using this methodology we synthesized three new steroidal acids as potential ligands of DAF-12, Liver X and Glucocorticoid nuclear receptors and studied their activity in reporter gene assays. Our results show that replacement of the 21-CH 3 by a 20-keto group in the side chains of the cholestane scaffold of DAF-12 or Liver X receptors ligands causes the loss of the activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Regulation of antibacterial defense in the small intestine by the nuclear bile acid receptor.

    PubMed

    Inagaki, Takeshi; Moschetta, Antonio; Lee, Youn-Kyoung; Peng, Li; Zhao, Guixiang; Downes, Michael; Yu, Ruth T; Shelton, John M; Richardson, James A; Repa, Joyce J; Mangelsdorf, David J; Kliewer, Steven A

    2006-03-07

    Obstruction of bile flow results in bacterial proliferation and mucosal injury in the small intestine that can lead to the translocation of bacteria across the epithelial barrier and systemic infection. These adverse effects of biliary obstruction can be inhibited by administration of bile acids. Here we show that the farnesoid X receptor (FXR), a nuclear receptor for bile acids, induces genes involved in enteroprotection and inhibits bacterial overgrowth and mucosal injury in ileum caused by bile duct ligation. Mice lacking FXR have increased ileal levels of bacteria and a compromised epithelial barrier. These findings reveal a central role for FXR in protecting the distal small intestine from bacterial invasion and suggest that FXR agonists may prevent epithelial deterioration and bacterial translocation in patients with impaired bile flow.

  20. Innate scavenger receptor-A regulates adaptive T helper cell responses to pathogen infection

    PubMed Central

    Xu, Zhipeng; Xu, Lei; Li, Wei; Jin, Xin; Song, Xian; Chen, Xiaojun; Zhu, Jifeng; Zhou, Sha; Li, Yong; Zhang, Weiwei; Dong, Xiaoxiao; Yang, Xiaowei; Liu, Feng; Bai, Hui; Chen, Qi; Su, Chuan

    2017-01-01

    The pattern recognition receptor (PRR) scavenger receptor class A (SR-A) has an important function in the pathogenesis of non-infectious diseases and in innate immune responses to pathogen infections. However, little is known about the role of SR-A in the host adaptive immune responses to pathogen infection. Here we show with mouse models of helminth Schistosoma japonicum infection and heat-inactivated Mycobacterium tuberculosis stimulation that SR-A is regulated by pathogens and suppresses IRF5 nuclear translocation by direct interaction. Reduced abundance of nuclear IRF5 shifts macrophage polarization from M1 towards M2, which subsequently switches T-helper responses from type 1 to type 2. Our study identifies a role for SR-A as an innate PRR in regulating adaptive immune responses. PMID:28695899

  1. A Novel Cytosolic Isoform of Mitochondrial Trans-2-Enoyl-CoA Reductase Enhances Peroxisome Proliferator-Activated Receptor α Activity.

    PubMed

    Kim, Dong-Gyu; Yoo, Jae Cheal; Kim, Eunju; Lee, Young-Sun; Yarishkin, Oleg V; Lee, Da Yong; Lee, Kun Ho; Hong, Seong-Geun; Hwang, Eun Mi; Park, Jae-Yong

    2014-06-01

    Mitochondrial trans-2-enoyl-CoA reductase (MECR) is involved in mitochondrial synthesis of fatty acids and is highly expressed in mitochondria. MECR is also known as nuclear receptor binding factor-1, which was originally reported with yeast two-hybrid screening as a binding protein of the nuclear hormone receptor peroxisome proliferator-activated receptor α (PPARα). However, MECR and PPARα are localized at different compartment, mitochondria, and the nucleus, respectively. Therefore, the presence of a cytosolic or nuclear isoform of MECR is necessary for functional interaction between MECR and PPARα. To identify the expression pattern of MECR and the cytosolic form of MECR (cMECR), we performed reverse transcription polymerase chain reaction (RT-PCR) with various tissue samples from Sprague-Dawley rats. To confirm the interaction between cMECR and PPARα, we performed several binding assays such as yeast two-hybrid, coimmunoprecipitation, and bimolecular fluorescence complementation. To observe subcellular localization of these proteins, immunocytochemistry was performed. A luciferase assay was used to measure PPARα activity. We provide evidence of an alternatively spliced variant of the rat MECR gene that yields cMECR. The cMECR lacks the N-terminal 76 amino acids of MECR and shows uniform distribution in the cytoplasm and nucleus of HeLa cells. cMECR directly bound PPARα in the nucleus and increased PPARα-dependent luciferase activity in HeLa cells. We found the cytosolic form of MECR (cMECR) was expressed in the cytosolic and/or nuclear region, directly binds with PPARα, and enhances PPARα activity.

  2. Spatial distribution of the messenger ribonucleic acid and protein of the nuclear receptor coactivator, amplified in breast cancer-3, in mice.

    PubMed

    Zhang, Hao; Liao, Lan; Kuang, Shao-Qing; Xu, Jianming

    2003-04-01

    Transcriptional activities of nuclear receptors are modulated by coactivators and corepressors. The amplified in breast cancer-3 protein (AIB3, also known as ASC-2, RAP250, PRIP, TRBP, and NCR) is a newly identified nuclear receptor coactivator that is amplified and overexpressed in breast cancers. This study aims to investigate the spatial expression of AIB3 mRNA and protein in various murine tissues. Quantitative measurements revealed that the concentrations of AIB3 mRNA differ substantially in different tissues in a descending order from the following: testis, brain, thymus, white fat, pituitary, ovary, adrenal gland, lung, uterus, kidney, heart, skeletal muscle, liver, and virgin mammary gland. The AIB3 mRNA level in the testis is 165-fold higher than that in the virgin mammary gland. Specific antiserum was generated and used to map the distribution of AIB3 protein by immunohistochemistry. Although AIB3 protein was detected in many tissues, the AIB3 immunoreactivities varied significantly from cell type to cell type. High levels of AIB3 immunoreactivity were observed in hormone target cells including the testicular Sertoli cells, follicular granulosa cells, and epithelial cells of the prostate, uterus, mammary gland, and kidney tubules. Medium and low levels of AIB3 immunoreactivities were also detected in a variety of other cell types. These results demonstrate that AIB3 mRNA and protein are preferentially expressed in specific cell types, suggesting that AIB3 may support the function of nuclear receptors in a cell type-specific manner.

  3. Hashimoto's thyroiditis with heterogeneous antithyrotropin receptor antibodies: unique epitopes may contribute to the regulation of thyroid function by the antibodies.

    PubMed

    Akamizu, T; Kohn, L D; Hiratani, H; Saijo, M; Tahara, K; Nakao, K

    2000-06-01

    Blocking-type TSH-binding inhibitor Igs (TBIIs) are known to cause hypothyroidism and an atrophic thyroid gland in patients with primary myxedema. They can block the activity of thyroid-stimulating antibodies (TSAbs) in Graves' patients as well as the activity of TSH. The majority of the epitopes for these blocking-type TBIIs have been, and are shown herein, to be present on the C-terminal region of the extracellular domain of the human TSH receptor (TSHR), whereas those for Graves' TSAbs are on the N-terminus. We report on a patient with Hashimoto's thyroiditis who suffered from mild hypothyroidism and a moderately sized goiter. Her serum had a potent blocking-type TBII and a weak TSAb in human and porcine TSHR systems. Using human TSHR/lutropin-CG receptor chimeras, we determined that the functional epitope of her blocking-type TBII was uniquely present on the N-terminal, rather than the C-terminal, region of the extracellular domain of the TSHR, unlike the case for blocking-type TBIIs in primary myxedema patients. The epitope of her TSAb was also unusual. Although the functional epitopes of most TSAbs are known to involve the N-terminal region of the receptor, her TSAb epitope did not seem to be present solely on the N- or C-terminus of the extracellular domain of the receptor. Blocking-type TBIIs from patients with primary myxedema blocked her TSAb activity as well as stimulation by TSH; her blocking-type TBII was able to only partially block her TSAb. In contrast, her blocking-type TBII almost completely blocked TSAbs from Graves' patients. Thus, we suggest that the unique epitopes of this patient's heterogeneous population of TSH receptor antibodies, at least in part, contribute to regulation of her thyroid function.

  4. Unique allosteric regulation of 5-hydroxytryptamine receptor-mediated signal transduction by oleamide

    PubMed Central

    Thomas, Elizabeth A.; Carson, Monica J.; Neal, Michael J.; Sutcliffe, J. Gregor

    1997-01-01

    The effects of oleamide, an amidated lipid isolated from the cerebrospinal fluid of sleep-deprived cats, on serotonin receptor-mediated responses were investigated in cultured mammalian cells. In rat P11 cells, which endogenously express the 5-hydroxytryptamine2A (5HT2A) receptor, oleamide significantly potentiated 5HT-induced phosphoinositide hydrolysis. In HeLa cells expressing the 5HT7 receptor subtype, oleamide caused a concentration-dependent increase in cAMP accumulation but with lower efficacy than that observed by 5HT. This effect was not observed in untransfected HeLa cells. Clozapine did not prevent the increase in cAMP elicited by oleamide, and ketanserin caused an ≈65% decrease. In the presence of 5HT, oleamide had the opposite effect on cAMP, causing insurmountable antagonism of the concentration-effect curve to 5HT, but had no effect on cAMP levels elicited by isoproterenol or forskolin. These results indicate that oleamide can modulate 5HT-mediated signal transduction at different subtypes of mammalian 5HT receptors. Additionally, our data indicate that oleamide acts at an apparent allosteric site on the 5HT7 receptor and elicits functional responses via activation of this site. This represents a unique mechanism of activation for 5HT G protein-coupled receptors and suggests that G protein-coupled neurotransmitter receptors may act like their iontropic counterparts (i.e., γ-aminobutyric acid type A receptors) in that there may be several binding sites on the receptor that regulate functional activity with varying efficacies. PMID:9391162

  5. The Drosophila FTZ-F1 Nuclear Receptor Mediates Juvenile Hormone Activation of E75A Gene Expression through an Intracellular Pathway*

    PubMed Central

    Dubrovsky, Edward B.; Dubrovskaya, Veronica A.; Bernardo, Travis; Otte, Valerie; DiFilippo, Robert; Bryan, Heather

    2011-01-01

    Juvenile hormone (JH) regulates a wide variety of biological activities in holometabolous insects, ranging from vitellogenesis and caste determination in adults to the timing of metamorphosis in larvae. The mechanism of JH signaling in such a diverse array of processes remains either unknown or contentious. We previously found that the nuclear receptor gene E75A is activated in S2 cells as a primary response to JH. Here, by expressing an intracellular form of JH esterase, we demonstrate that JH must enter the cell in order to activate E75A. To find intracellular receptors involved in the JH response, we performed an RNAi screen against nuclear receptor genes expressed in this cell line and identified the orphan receptor FTZ-F1. Removal of FTZ-F1 prevents JH activation of E75A, whereas overexpression enhances activation, implicating FTZ-F1 as a critical component of the JH response. FTZ-F1 is bound in vivo to multiple enhancers upstream of E75A, suggesting that it participates in direct JH-mediated gene activation. To better define the role of FTZ-F1 in JH signaling, we investigated interactions with candidate JH receptors and found that the bHLH-PAS proteins MET and GCE both interact with FTZ-F1 and can activate transcription through the FTZ-F1 response element. Removal of endogenous GCE, but not MET, prevents JH activation of E75A. We propose that FTZ-F1 functions as a competence factor by loading JH signaling components to the promoter, thus facilitating the direct regulation of E75A gene expression by JH. PMID:21832074

  6. Combined therapeutic potential of nuclear receptors with receptor tyrosine kinase inhibitors in lung cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wairagu, Peninah M.; Institute of Lifestyle Medicine, Wonju College of Medicine, Yonsei University, Wonju, Gangwon-do 220-701; Nuclear Receptor Research Consortium, Wonju College of Medicine, Yonsei University, Wonju, Gangwon-do 220-701

    2014-05-09

    Highlights: • The 48 NR genes and 48 biological anti-cancer targets are profiled in paired-cells. • Growth inhibition by NR ligands or TKIs is target receptor level-dependent. • T0901317 with gefitinib/PHA665752 shows additive growth inhibition in lung cells. - Abstract: Cancer heterogeneity is a big hurdle in achieving complete cancer treatment, which has led to the emergence of combinational therapy. In this study, we investigated the potential use of nuclear receptor (NR) ligands for combinational therapy with other anti-cancer drugs. We first profiled all 48 NRs and 48 biological anti-cancer targets in four pairs of lung cell lines, where eachmore » pair was obtained from the same patient. Two sets of cell lines were normal and the corresponding tumor cell lines while the other two sets consisted of primary versus metastatic tumor cell lines. Analysis of the expression profile revealed 11 NRs and 15 cancer targets from the two pairs of normal versus tumor cell lines, and 9 NRs and 9 cancer targets from the primary versus metastatic tumor cell lines had distinct expression patterns in each category. Finally, the evaluation of nuclear receptor ligand T0901317 for liver X receptor (LXR) demonstrated its combined therapeutic potential with tyrosine kinase inhibitors. The combined treatment of cMET inhibitor PHA665752 or EGFR inhibitor gefitinib with T0901317 showed additive growth inhibition in both H2073 and H1993 cells. Mechanistically, the combined treatment suppressed cell cycle progression by inhibiting cyclinD1 and cyclinB expression. Taken together, this study provides insight into the potential use of NR ligands in combined therapeutics with other biological anti-cancer drugs.« less

  7. Nuclear accumulation of epidermal growth factor receptor and acceleration of G1/S stage by Epstein-Barr-encoded oncoprotein latent membrane protein 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tao Yongguang; Song Xing; Deng Xiyun

    Epstein-Barr virus (EBV)-encoded latent membrane protein 1 (LMP1) is considered to be the major oncogenic protein of EBV-encoded proteins and has always been the core of the oncogenic mechanism of EBV. Advanced studies on nuclear translocation of the epidermal growth factor receptor (EGFR) family have greatly improved our knowledge of the biological function of cell surface receptors. In this study, we used the Tet-on LMP1 HNE2 cell line as a cell model, which is a dual-stable LMP1-integrated nasopharyngeal carcinoma (NPC) cell line and the expression of LMP1 which could be regulated by the Tet system. We found that LMP1 couldmore » regulate the nuclear accumulation of EGFR in a dose-dependent manner quantitatively and qualitatively. We also demonstrated that the nuclear localization sequence of EGFR played some roles in the location of the protein within the nucleus under LMP1 regulation and EGFR in the nucleus could bind to the promoters of cyclinD1 and cyclinE, respectively. We further demonstrated that EGFR is involved in the acceleration of the G1/S phase transition by LMP1 through binding to cyclinD1 and cyclinE directly. These findings provided a novel view that the acceleration of LMP1 on the G1/S transition via the nuclear accumulation of EGFR was critical in the process of nasopharyngeal carcinoma.« less

  8. Modulation of Long-Term Potentiation and Epileptiform Activity in the Rat Dentate Gyrus by the Group II Metabotropic Glutamate Receptor Subtype mGluR3

    DTIC Science & Technology

    2000-05-25

    preparation richly endowed with ionotropic and metabotropic glutamate receptors , including mGluR3 (Shigemoto et al., 1997). NAAG is concentrated in...Zhao and R. J. Wenthold (1996b). Ionotropic and metabotropic glutamate receptors show unique postsynaptic, presynaptic, and glial localizations in...epileptiform activity in the rat cortex. Neuroreport 3(10): 916-8. Shen, W. and M. M. Slaughter (1998). Metabotropic and ionotropic glutamate receptors

  9. A novel point mutation of the human glucocorticoid receptor gene causes primary generalized glucocorticoid resistance through impaired interaction with the LXXLL motif of the p160 coactivators: dissociation of the transactivating and transreppressive activities.

    PubMed

    Nicolaides, Nicolas C; Roberts, Michael L; Kino, Tomoshige; Braatvedt, Geoffrey; Hurt, Darrell E; Katsantoni, Eleni; Sertedaki, Amalia; Chrousos, George P; Charmandari, Evangelia

    2014-05-01

    Primary generalized glucocorticoid resistance is a rare genetic disorder characterized by generalized, partial, target-tissue insensitivity to glucocorticoids. The molecular basis of the condition has been ascribed to inactivating mutations in the human glucocorticoid receptor (hGR) gene. The objective of the study was to present three new cases caused by a novel mutation in the hGR gene and to delineate the molecular mechanisms through which the mutant receptor impairs glucocorticoid signal transduction. The index case (father) and his two daughters presented with increased urinary free cortisol excretion and resistance of the hypothalamic-pituitary-adrenal axis to dexamethasone suppression in the absence of clinical manifestations suggestive of Cushing syndrome. All subjects harbored a novel, heterozygous, point mutation (T→G) at nucleotide position 1724 of the hGR gene, which resulted in substitution of valine by glycine at amino acid 575 of the receptor. Compared with the wild-type receptor, the hGRαV575G demonstrated a significant (33%) reduction in its ability to transactivate the mouse mammary tumor virus promoter in response to dexamethasone, a 50% decrease in its affinity for the ligand, and a 2.5-fold delay in nuclear translocation. Although it did not exert a dominant negative effect on the wild-type receptor and preserved its ability to bind to DNA, hGRαV575G displayed significantly enhanced (∼80%) ability to transrepress the nuclear factor-κΒ signaling pathway. Finally, the mutant receptor hGRαV575G demonstrated impaired interaction with the LXXLL motif of the glucocorticoid receptor-interacting protein 1 coactivator in vitro and in computer-based structural simulation via its defective activation function-2 (AF-2) domain. The natural mutant receptor hGRαV575G causes primary generalized glucocorticoid resistance by affecting multiple steps in the glucocorticoid signaling cascade, including the affinity for the ligand, the time required for nuclear translocation, and the interaction with the glucocorticoid-interacting protein-1 coactivator.

  10. The Orphan Nuclear Receptor TLX Is an Enhancer of STAT1-Mediated Transcription and Immunity to Toxoplasma gondii

    PubMed Central

    Beiting, Daniel P.; Hidano, Shinya; Baggs, Julie E.; Geskes, Jeanne M.; Fang, Qun; Wherry, E. John; Hunter, Christopher A.; Roos, David S.; Cherry, Sara

    2015-01-01

    The protozoan parasite, Toxoplasma, like many intracellular pathogens, suppresses interferon gamma (IFN-γ)-induced signal transducer and activator of transcription 1 (STAT1) activity. We exploited this well-defined host–pathogen interaction as the basis for a high-throughput screen, identifying nine transcription factors that enhance STAT1 function in the nucleus, including the orphan nuclear hormone receptor TLX. Expression profiling revealed that upon IFN-γ treatment TLX enhances the output of a subset of IFN-γ target genes, which we found is dependent on TLX binding at those loci. Moreover, infection of TLX deficient mice with the intracellular parasite Toxoplasma results in impaired production of the STAT1-dependent cytokine interleukin-12 by dendritic cells and increased parasite burden in the brain during chronic infection. These results demonstrate a previously unrecognized role for this orphan nuclear hormone receptor in regulating STAT1 signaling and host defense and reveal that STAT1 activity can be modulated in a context-specific manner by such “modifiers.” PMID:26196739

  11. Nuclear receptor TLX prevents retinal dystrophy and recruits the corepressor atrophin1.

    PubMed

    Zhang, Chun-Li; Zou, Yuhua; Yu, Ruth T; Gage, Fred H; Evans, Ronald M

    2006-05-15

    During mammalian embryogenesis, precise coordination of progenitor cell proliferation and differentiation is essential for proper organ size and function. The involvement of TLX (NR2E1), an orphan nuclear receptor, has been implicated in ocular development, as Tlx-/- mice exhibit visual impairment. Using genetic and biochemical approaches, we show that TLX modulates retinal progenitor cell proliferation and cell cycle re-entry by directly regulating the expression of Pten and its target cyclin D1. Additionally, TLX finely tunes the progenitor differentiation program by modulating the phospholipase C and mitogen-activated protein kinase (MAPK) pathways and the expression of an array of cell type-specific transcriptional regulators. Consequently, Tlx-/- mice have a dramatic reduction in retina thickness and enhanced generation of S-cones, and develop severe early onset retinal dystrophy. Furthermore, TLX interacts with atrophin1 (Atn1), a corepressor that is involved in human neurodegenerative dentatorubral-pallidoluysian atrophy (DRPLA) and that is essential for development of multiple tissues. Together, these results reveal a molecular strategy by which an orphan nuclear receptor can precisely orchestrate tissue-specific proliferation and differentiation programs to prevent retinal malformation and degeneration.

  12. Regulation of C. elegans fat uptake and storage by acyl-CoA synthase-3 is dependent on NR5A family nuclear hormone receptor nhr-25

    PubMed Central

    Mullaney, Brendan; Ashrafi, Kaveh

    2010-01-01

    Summary Acyl-CoA synthases are important for lipid synthesis and breakdown, generation of signaling molecules and lipid modification of proteins, highlighting the challenge of understanding metabolic pathways within intact organisms. From a C. elegans mutagenesis screen, we found that loss of ACS-3, a long-chain acyl-CoA synthase, causes enhanced intestinal lipid uptake, de novo fat synthesis, and accumulation of enlarged, neutral lipid rich intestinal depots. Here, we show that ACS-3 functions in seam cells, epidermal cells anatomically distinct from sites of fat uptake and storage, and that acs-3 mutant phenotypes require the nuclear hormone receptor NHR-25, a key regulator of C. elegans molting. Our findings suggest that ACS-3 derived long chain fatty acyl-CoAs, perhaps incorporated into complex ligands such as phosphoinositides, modulate NHR-25 function, which in turn regulates an endocrine program of lipid uptake and synthesis. These results reveal a link between acyl-CoA synthase function and an NR5A family nuclear receptor in C. elegans. PMID:20889131

  13. Hepatic Deletion of SIRT1 Decreases Hepatocyte Nuclear Factor 1α/Farnesoid X Receptor Signaling and Induces Formation of Cholesterol Gallstones in Mice

    PubMed Central

    Purushotham, Aparna; Xu, Qing; Lu, Jing; Foley, Julie F.; Yan, Xingjian; Kim, Dong-Hyun; Kemper, Jongsook Kim

    2012-01-01

    SIRT1, a highly conserved NAD+-dependent protein deacetylase, is a key metabolic sensor that directly links nutrient signals to animal metabolic homeostasis. Although SIRT1 has been implicated in a number of hepatic metabolic processes, the mechanisms by which hepatic SIRT1 modulates bile acid metabolism are still not well understood. Here we report that deletion of hepatic SIRT1 reduces the expression of farnesoid X receptor (FXR), a nuclear receptor that regulates bile acid homeostasis. We provide evidence that SIRT1 regulates the expression of FXR through hepatocyte nuclear factor 1α (HNF1α). SIRT1 deficiency in hepatocytes leads to decreased binding of HNF1α to the FXR promoter. Furthermore, we show that hepatocyte-specific deletion of SIRT1 leads to derangements in bile acid metabolism, predisposing the mice to development of cholesterol gallstones on a lithogenic diet. Taken together, our findings indicate that SIRT1 plays a vital role in the regulation of hepatic bile acid homeostasis through the HNF1α/FXR signaling pathway. PMID:22290433

  14. Cex1p is a novel cytoplasmic component of the Saccharomyces cerevisiae nuclear tRNA export machinery

    PubMed Central

    McGuire, Andrew T; Mangroo, Dev

    2007-01-01

    The Saccharomyces cerevisiae Yor112wp, which we named Cex1p, was identified using a yeast tRNA three-hybrid interaction approach and an in vivo nuclear tRNA export assay as a cytoplasmic component of the nuclear tRNA export machinery. Cex1p binds tRNA saturably, and associates with the nuclear pore complex by interacting directly with Nup116p. Cex1p co-purifies with the nuclear tRNA export receptors Los1p and Msn5p, the eukaryotic elongation factor eEF-1A, which delivers aminoacylated tRNAs to the ribosome, and the RanGTPase Gsp1p, but not with Cca1p, a tRNA maturation enzyme that facilitates translocation of non-aminoacylated tRNAs across the nuclear pore complex. Depletion of Cex1p and eEF-1A or Los1p significantly reduced the efficiency of nuclear tRNA export. Cex1p interacts with Los1p but not with eEF-1A in vitro. These findings suggest that Cex1p is a component of the nuclear aminoacylation-dependent tRNA export pathway in S. cerevisiae. They also suggest that Cex1p collects aminoacyl-tRNAs from the nuclear export receptors at the cytoplasmic side of the nuclear pore complex, and transfers them to eEF-1A using a channelling mechanism. PMID:17203074

  15. Regulation of calcium signals in the nucleus by a nucleoplasmic reticulum

    PubMed Central

    Echevarría, Wihelma; Leite, M. Fatima; Guerra, Mateus T.; Zipfel, Warren R.; Nathanson, Michael H.

    2013-01-01

    Calcium is a second messenger in virtually all cells and tissues1. Calcium signals in the nucleus have effects on gene transcription and cell growth that are distinct from those of cytosolic calcium signals; however, it is unknown how nuclear calcium signals are regulated. Here we identify a reticular network of nuclear calcium stores that is continuous with the endoplasmic reticulum and the nuclear envelope. This network expresses inositol 1,4,5-trisphosphate (InsP3) receptors, and the nuclear component of InsP3-mediated calcium signals begins in its locality. Stimulation of these receptors with a little InsP3 results in small calcium signals that are initiated in this region of the nucleus. Localized release of calcium in the nucleus causes nuclear protein kinase C (PKC) to translocate to the region of the nuclear envelope, whereas release of calcium in the cytosol induces translocation of cytosolic PKC to the plasma membrane. Our findings show that the nucleus contains a nucleoplasmic reticulum with the capacity to regulate calcium signals in localized subnuclear regions. The presence of such machinery provides a potential mechanism by which calcium can simultaneously regulate many independent processes in the nucleus. PMID:12717445

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Piccioli, Zachary; McKee, Courtney H.; Leszczynski, Anna

    We investigated the nuclear import of low risk HPV11 E7 protein using 1) transfection assays in HeLa cells with EGFP fusion plasmids containing 11E7 and its domains and 2) nuclear import assays in digitonin-permeabilized HeLa cells with GST fusion proteins containing 11E7 and its domains. The EGFP-11E7 and EGFP-11cE7{sub 39-98} localized mostly to the nucleus. The GST-11E7 and GST-11cE7{sub 39-98} were imported into the nuclei in the presence of either Ran-GDP or RanG19V-GTP mutant and in the absence of nuclear import receptors. This suggests that 11E7 enters the nucleus via a Ran-dependent pathway, independent of nuclear import receptors, mediated bymore » a nuclear localization signal located in its C-terminal domain (cNLS). This cNLS contains the zinc binding domain consisting of two copies of Cys-X-X-Cys motif. Mutagenesis of Cys residues in these motifs changed the localization of the EGFP-11cE7/-11E7 mutants to cytoplasmic, suggesting that the zinc binding domain is essential for nuclear localization of 11E7.« less

  17. Leukemia-Associated Nup214 Fusion Proteins Disturb the XPO1-Mediated Nuclear-Cytoplasmic Transport Pathway and Thereby the NF-κB Signaling Pathway.

    PubMed

    Saito, Shoko; Cigdem, Sadik; Okuwaki, Mitsuru; Nagata, Kyosuke

    2016-07-01

    Nuclear-cytoplasmic transport through nuclear pore complexes is mediated by nuclear transport receptors. Previous reports have suggested that aberrant nuclear-cytoplasmic transport due to mutations or overexpression of nuclear pore complexes and nuclear transport receptors is closely linked to diseases. Nup214, a component of nuclear pore complexes, has been found as chimeric fusion proteins in leukemia. Among various Nup214 fusion proteins, SET-Nup214 and DEK-Nup214 have been shown to be engaged in tumorigenesis, but their oncogenic mechanisms remain unclear. In this study, we examined the functions of the Nup214 fusion proteins by focusing on their effects on nuclear-cytoplasmic transport. We found that SET-Nup214 and DEK-Nup214 interact with exportin-1 (XPO1)/CRM1 and nuclear RNA export factor 1 (NXF1)/TAP, which mediate leucine-rich nuclear export signal (NES)-dependent protein export and mRNA export, respectively. SET-Nup214 and DEK-Nup214 decreased the XPO1-mediated nuclear export of NES proteins such as cyclin B and proteins involved in the NF-κB signaling pathway by tethering XPO1 onto nuclear dots where Nup214 fusion proteins are localized. We also demonstrated that SET-Nup214 and DEK-Nup214 expression inhibited NF-κB-mediated transcription by abnormal tethering of the complex containing p65 and its inhibitor, IκB, in the nucleus. These results suggest that SET-Nup214 and DEK-Nup214 perturb the regulation of gene expression through alteration of the nuclear-cytoplasmic transport system. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. AOP description: Androgen receptor agonism leading to reproductive dysfunction (in fish)

    EPA Science Inventory

    This adverse outcome pathway details the linkage between binding and activation of androgen receptor as a nuclear transcription factor in females and the adverse effect of reduced cumulative fecundity in repeat-spawning fish species. Cumulative fecundity is the most apical endpoi...

  19. The PPARα-dependent rodent liver tumor response is not relevant to humans: Addressing misconceptions

    EPA Science Inventory

    A number of industrial chemicals and therapeutic agents cause liver tumors in rats and mice by activating the nuclear receptor peroxisome proliferator-activated receptor α (PPARα). The molecular and cellular events by which PPARα activators induce rodent hepatoc...

  20. Cloning and initial characterization of nuclear and four membrane progesterone receptors in the fathead minnow(Pimephales promelas)

    EPA Science Inventory

    Both native progestagens and synthetic progestins have important effects on reproduction that are mediated through progesterone receptors (PRs). Progestagens regulate gamete maturation in vertebrates, are critical regulators of placental mammal pregnancy, and act as reproductive ...

  1. Stabilization of peroxisome proliferator-activated receptor alpha by the ligand.

    PubMed

    Hirotani, M; Tsukamoto, T; Bourdeaux, J; Sadano, H; Osumi, T

    2001-10-19

    Peroxisome proliferator-activated receptor (PPAR) constitutes a subfamily among a large group of ligand-activated transcription factors, the nuclear receptor superfamily. We studied the effects of ligand on the intracellular behaviors of PPARalpha. Although nuclear localization of PPARalpha was not affected by a selective ligand, Wy14643, we observed that exogenously expressed PPARalpha was rapidly degraded in HeLa cells, and the ligand significantly stabilized the protein. The stability of PPARalpha was also improved by coexpression of the heterodimer partner retinoid X receptor (RXR) alpha, and further stabilization was not observed with the ligand. These results indicate that PPARalpha is stabilized through heterodimerization with RXR, and the excess protein unpaired with RXR is rapidly turned over, if not bound by an appropriate ligand. These observations on PPARalpha are in sharp contrast to the ligand-stimulated degradation reported on PPARgamma. The ligand-dependent stabilization would have physiological significance when the synthesis of PPARalpha is elevated exceeding the available level of RXR. Copyright 2001 Academic Press.

  2. A novel formulation of veggies with potent liver detoxifying activity.

    PubMed

    Jain, Mohit M; Kumari, Nirmala; Rai, Geeta

    2015-01-01

    LXR (encoded by NR1H2 and 3) and FXR (known as bile acid receptor) encoded by NR1H4 (nuclear receptor subfamily 1, group H and member 4) are nuclear receptors in humans and are important regulators of bile acid production, cholesterol, fatty acid and glucose homeostasis hence responsible for liver detoxification. Several strategies for drug design with numerous ligands for this target have failed owing to the inability of the ligand to access the target/receptor or their early metabolisation. In this work, we have evaluated FXR and LXR structure bound with agonist and compared the binding energy affinity of active ligands present in live green-real veggies with reference drugs (ligands) present in the market. A high throughput screening combined with molecular docking, absorption, distribution, metabolism, excretion and toxicity (ADMET) predictions, log P values and percentage of human oral absorption value led to the identification of two compounds present in live green-real veggies with strong potential for liver detoxification.

  3. A live zebrafish-based screening system for human nuclear receptor ligand and cofactor discovery.

    PubMed

    Tiefenbach, Jens; Moll, Pamela R; Nelson, Meryl R; Hu, Chun; Baev, Lilia; Kislinger, Thomas; Krause, Henry M

    2010-03-22

    Nuclear receptors (NRs) belong to a superfamily of transcription factors that regulate numerous homeostatic, metabolic and reproductive processes. Taken together with their modulation by small lipophilic molecules, they also represent an important and successful class of drug targets. Although many NRs have been targeted successfully, the majority have not, and one third are still orphans. Here we report the development of an in vivo GFP-based reporter system suitable for monitoring NR activities in all cells and tissues using live zebrafish (Danio rerio). The human NR fusion proteins used also contain a new affinity tag cassette allowing the purification of receptors with bound molecules from responsive tissues. We show that these constructs 1) respond as expected to endogenous zebrafish hormones and cofactors, 2) facilitate efficient receptor and cofactor purification, 3) respond robustly to NR hormones and drugs and 4) yield readily quantifiable signals. Transgenic lines representing the majority of human NRs have been established and are available for the investigation of tissue- and isoform-specific ligands and cofactors.

  4. Type 1 IGF Receptor Localization in Paediatric Gliomas: Significant Association with WHO Grading and Clinical Outcome.

    PubMed

    Clément, Florencia; Martin, Ayelen; Venara, Marcela; de Luján Calcagno, Maria; Mathó, Cecilia; Maglio, Silvana; Lombardi, Mercedes García; Bergadá, Ignacio; Pennisi, Patricia A

    2018-06-01

    Nuclear localization of insulin-like growth factor receptor type 1 (IGF-1R) has been described as adverse prognostic factor in some cancers. We studied the expression and localization of IGF-1R in paediatric patients with gliomas, as well as its association with World Health Organization (WHO) grading and survival. We conducted a single cohort, prospective study of paediatric patients with gliomas. Samples were taken at the time of the initial surgery; IGF-1R expression and localization were characterized by immunohistochemistry (IHC), subcellular fractionation and western blotting. Tumours (47/53) showed positive staining for IGF-1R by IHC. IGF-1R nuclear labelling was observed in 10/47 cases. IGF-1R staining was mostly non-nuclear in low-grade tumours, while IGF-1R nuclear labelling was predominant in high-grade gliomas (p = 0.0001). Survival was significantly longer in patients with gliomas having non-nuclear IGF-1R localization than in patients with nuclear IGF-1R tumours (p = 0.016). In gliomas, IGF-1R nuclear localization was significantly associated with both high-grade tumours and increased risk of death. Based on a prospective design, we provide evidence of a potential usefulness of intracellular localization of IGF-1R as prognostic factor in paediatric patients with gliomas.

  5. Economic Analysis of National Nuclear Security Administration (NNSA) Modernization Alternatives

    DTIC Science & Technology

    2007-11-01

    without nuclear testing; works to reduce global danger from weapons of mass destruction; provides the U.S. Navy with safe and effective nuclear...SFE) covers the acquisition of glove boxes, long-lead facility, and actinide chemistry/materials characterization (AC/MC) equipment whose uniqueness...Hazard Category II AC/MC and actinide Research and Development operations, special nuclear 5 Babcock

  6. Blm10 facilitates nuclear import of proteasome core particles

    PubMed Central

    Weberruss, Marion H; Savulescu, Anca F; Jando, Julia; Bissinger, Thomas; Harel, Amnon; Glickman, Michael H; Enenkel, Cordula

    2013-01-01

    Short-lived proteins are degraded by proteasome complexes, which contain a proteolytic core particle (CP) but differ in the number of regulatory particles (RPs) and activators. A recently described member of conserved proteasome activators is Blm10. Blm10 contains 32 HEAT-like modules and is structurally related to the nuclear import receptor importin/karyopherin β. In proliferating yeast, RP-CP assemblies are primarily nuclear and promote cell division. During quiescence, RP-CP assemblies dissociate and CP and RP are sequestered into motile cytosolic proteasome storage granuli (PSG). Here, we show that CP sequestration into PSG depends on Blm10, whereas RP sequestration into PSG is independent of Blm10. PSG rapidly clear upon the resumption of cell proliferation and proteasomes are relocated into the nucleus. Thereby, Blm10 facilitates nuclear import of CP. Blm10-bound CP serves as an import receptor–cargo complex, as Blm10 mediates the interaction with FG-rich nucleoporins and is dissociated from the CP by Ran-GTP. Thus, Blm10 represents the first CP-dedicated nuclear import receptor in yeast. PMID:23982732

  7. Characterization of a Novel Small Molecule Subtype Specific Estrogen-Related Receptor α Antagonist in MCF-7 Breast Cancer Cells

    PubMed Central

    Chisamore, Michael J.; Cunningham, Michael E.; Flores, Osvaldo; Wilkinson, Hilary A.; Chen, J. Don

    2009-01-01

    Background The orphan nuclear receptor estrogen-related receptor α (ERRα) is a member of the nuclear receptor superfamily. It was identified through a search for genes encoding proteins related to estrogen receptor α (ERα). An endogenous ligand has not been found. Novel ERRα antagonists that are highly specific for binding to the ligand binding domain (LBD) of ERRα have been recently reported. Research suggests that ERRα may be a novel drug target to treat breast cancer and/or metabolic disorders and this has led to an effort to characterize the mechanisms of action of N-[(2Z)-3-(4,5-dihydro-1,3-thiazol-2-yl)-1,3-thiazolidin-2-yl idene]-5H dibenzo[a,d][7]annulen-5-amine, a novel ERRα specific antagonist. Methodology/Principal Findings We demonstrate this ERRα ligand inhibits ERRα transcriptional activity in MCF-7 cells by luciferase assay but does not affect mRNA levels measured by real-time RT-PCR. Also, ERα (ESR1) mRNA levels were not affected upon treatment with the ERRα antagonist, but other ERRα (ESRRA) target genes such as pS2 (TFF1), osteopontin (SPP1), and aromatase (CYP19A1) mRNA levels decreased. In vitro, the ERRα antagonist prevents the constitutive interaction between ERRα and nuclear receptor coactivators. Furthermore, we use Western blots to demonstrate ERRα protein degradation via the ubiquitin proteasome pathway is increased by the ERRα-subtype specific antagonist. We demonstrate by chromatin immunoprecipitation (ChIP) that the interaction between ACADM, ESRRA, and TFF1 endogenous gene promoters and ERRα protein is decreased when cells are treated with the ligand. Knocking-down ERRα (shRNA) led to similar genomic effects seen when MCF-7 cells were treated with our ERRα antagonist. Conclusions/Significance We report the mechanism of action of a novel ERRα specific antagonist that inhibits transcriptional activity of ERRα, disrupts the constitutive interaction between ERRα and nuclear coactivators, and induces proteasome-dependent ERRα protein degradation. Additionally, we confirmed that knocking-down ERRα lead to similar genomic effects demonstrated in vitro when treated with the ERRα specific antagonist. PMID:19462000

  8. Distinctive Modulation of Dopamine Release in the Nucleus Accumbens Shell Mediated by Dopamine and Acetylcholine Receptors.

    PubMed

    Shin, Jung Hoon; Adrover, Martin F; Alvarez, Veronica A

    2017-11-15

    Nucleus accumbens (NAc) shell shows unique dopamine (DA) signals in vivo and plays a unique role in DA-dependent behaviors such as reward-motivated learning and the response to drugs of abuse. A disynaptic mechanism for DA release was reported and shown to require synchronized firing of cholinergic interneurons (CINs) and activation of nicotinic acetylcholine (ACh) receptors (nAChRs) in DA neuron (DAN) axons. The properties of this disynaptic mechanism of DA transmission are not well understood in the NAc shell. In this study, in vitro fast-scan cyclic voltammetry was used to examine the modulation of DA transmission evoked by CINs firing in the shell of mice and compared with other striatal regions. We found that DA signals in the shell displayed significant degree of summation in response to train stimulation of CINs, contrary to core and dorsal striatum. The summation was amplified by a D2-like receptor antagonist and experiments with mice with targeted deletion of D2 receptors to DANs or CINs revealed that D2 receptors in CINs mediate a fast inhibition observed within 100 ms of the first pulse, whereas D2 autoreceptors in DAN terminals are engaged in a slower inhibition that peaks at ∼500 ms. ACh also contributes to the use-dependent inhibition of DA release through muscarinic receptors only in the shell, where higher activity of acetylcholinesterase minimizes nAChR desensitization and promotes summation. These findings show that DA signals are modulated differentially by endogenous DA and ACh in the shell, which may underlie the unique features of shell DA signals in vivo SIGNIFICANCE STATEMENT The present study reports that dopamine (DA) release evoked by activation of cholinergic interneurons displays a high degree of summation in the shell and shows unique modulation by endogenous DA and acetylcholine. Desensitization of nicotinic receptors, which is a prevailing mechanism for use-dependent inhibition in the nucleus accumbens core and dorsal striatum, is also minimal in the shell in part due to elevated acetylcholinesterase activity. This distinctive modulation of DA transmission in the shell may have functional implications in the acquisition of reward-motivated behaviors and reward seeking. Copyright © 2017 the authors 0270-6474/17/3711166-15$15.00/0.

  9. Evolution of the nuclear receptor superfamily: early diversification from an ancestral orphan receptor.

    PubMed

    Laudet, V

    1997-12-01

    From a database containing the published nuclear hormone receptor (NR) sequences I constructed an alignment of the C, D and E domains of these molecules. Using this alignment, I have performed tree reconstruction using both distance matrix and parsimony analysis. The robustness of each branch was estimated using bootstrap resampling methods. The trees constructed by these two methods gave congruent topologies. From these analyses I defined six NR subfamilies: (i) a large one clustering thyroid hormone receptors (TRs), retinoic acid receptors (RARs), peroxisome proliferator-activated receptors (PPARs), vitamin D receptors (VDRs) and ecdysone receptors (EcRs) as well as numerous orphan receptors such as RORs or Rev-erbs; (ii) one containing retinoid X receptors (RXRs) together with COUP, HNF4, tailless, TR2 and TR4 orphan receptors; (iii) one containing steroid receptors; (iv) one containing the NGFIB orphan receptors; (v) one containing FTZ-F1 orphan receptors; and finally (vi) one containing to date only one gene, the GCNF1 orphan receptor. The relationships between the six subfamilies are not known except for subfamilies I and IV which appear to be related. Interestingly, most of the liganded receptors appear to be derived when compared with orphan receptors. This suggests that the ligand-binding ability of NRs has been gained by orphan receptors during the course of evolution to give rise to the presently known receptors. The distribution into six subfamilies correlates with the known abilities of the various NRs to bind to DNA as homo- or heterodimers. For example, receptors heterodimerizing efficiently with RXR belong to the first or the fourth subfamilies. I suggest that the ability to heterodimerize evolved once, just before the separation of subfamilies I and IV and that the first NR was able to bind to DNA as a homodimer. From the study of NR sequences existing in vertebrates, arthropods and nematodes, I define two major steps of NR diversification: one that took place very early, probably during the multicellularization event leading to all the metazoan phyla, and a second occurring later on, corresponding to the advent of vertebrates. Finally, I show that in vertebrate species the various groups of NRs accumulated mutations at very different rates.

  10. Toll like receptors TLR1/2, TLR6 and MUC5B as binding interaction partners with cytostatic proline rich polypeptide 1 in human chondrosarcoma.

    PubMed

    Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen

    2018-01-01

    Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function.

  11. Toll like receptors TLR1/2, TLR6 and MUC5B as binding interaction partners with cytostatic proline rich polypeptide 1 in human chondrosarcoma

    PubMed Central

    Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen

    2018-01-01

    Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function. PMID:29138803

  12. Possible Involvement of Tight Junctions, Extracellular Matrix and Nuclear Receptors in Epithelial Differentiation

    PubMed Central

    Ichikawa-Tomikawa, Naoki; Sugimoto, Kotaro; Satohisa, Seiro; Nishiura, Keisuke; Chiba, Hideki

    2011-01-01

    Tight junctions are intercellular junctions localized at the most apical end of the lateral plasma membrane. They consist of four kinds of transmembrane proteins (occludin, claudins, junctional adhesion molecules, and tricellulin) and huge numbers of scaffolding proteins and contribute to the paracellular barrier and fence function. The mutation and deletion of these proteins impair the functions of tight junctions and cause various human diseases. In this paper, we provide an overview of recent studies on transmembrane proteins of tight junctions and highlight the functional significance of tight junctions, extracellular matrix, and nuclear receptors in epithelial differentiation. PMID:22162632

  13. Progesterone treatment shows greater protection in brain vs. retina in a rat model of middle cerebral artery occlusion: Progesterone receptor levels may play an important role

    PubMed Central

    Allen, Rachael S.; Sayeed, Iqbal; Oumarbaeva, Yuliya; Morrison, Katherine C.; Choi, Paul H.; Pardue, Machelle T.; Stein, Donald G.

    2018-01-01

    Background/Objective To determine whether inflammation increases in retina as it does in brain following middle cerebral artery occlusion (MCAO), and whether the neurosteroid progesterone, shown to have protective effects in both retina and brain after MCAO, reduces inflammation in retina as well as brain. Methods MCAO rats treated systemically with progesterone or vehicle were compared with shams. Protein levels of cytosolic NF-κB, nuclear NF-κB, phosphorylated NF-κB, IL-6, TNF-α, CD11b, progesterone receptor A and B, and pregnane × receptor were assessed in retinas and brains at 24 and 48 h using western blots. Results Following MCAO, significant increases were observed in the following inflammatory markers: pNF-κB and CD11b at 24 h in both brain and retina, nuclear NF-κB at 24 h in brain and 48 h in retina, and TNF-α at 24 h in brain. Progesterone treatment in MCAO animals significantly attenuated levels of the following markers in brain: pNF-κB, nuclear NF-κB, IL-6, TNF-α, and CD11b, with significantly increased levels of cytosolic NF-κB. Retinas from progesterone-treated animals showed significantly reduced levels of nuclear NF-κB and IL-6 and increased levels of cytosolic NF-κB, with a trend for reduction in other markers. Post-MCAO, progesterone receptors A and B were upregulated in brain and downregulated in retina. Conclusion Inflammatory markers increased in both brain and retina after MCAO, with greater increases observed in brain. Progesterone treatment reduced inflammation, with more dramatic reductions observed in brain than retina. This differential effect may be due to differences in the response of progesterone receptors in brain and retina after injury. PMID:27802245

  14. Progesterone treatment shows greater protection in brain vs. retina in a rat model of middle cerebral artery occlusion: Progesterone receptor levels may play an important role.

    PubMed

    Allen, Rachael S; Sayeed, Iqbal; Oumarbaeva, Yuliya; Morrison, Katherine C; Choi, Paul H; Pardue, Machelle T; Stein, Donald G

    2016-11-22

    To determine whether inflammation increases in retina as it does in brain following middle cerebral artery occlusion (MCAO), and whether the neurosteroid progesterone, shown to have protective effects in both retina and brain after MCAO, reduces inflammation in retina as well as brain. MCAO rats treated systemically with progesterone or vehicle were compared with shams. Protein levels of cytosolic NF-κB, nuclear NF-κB, phosphorylated NF-κB, IL-6, TNF-α, CD11b, progesterone receptor A and B, and pregnane X receptor were assessed in retinas and brains at 24 and 48 h using western blots. Following MCAO, significant increases were observed in the following inflammatory markers: pNF-κB and CD11b at 24 h in both brain and retina, nuclear NF-κB at 24 h in brain and 48 h in retina, and TNF-α at 24 h in brain.Progesterone treatment in MCAO animals significantly attenuated levels of the following markers in brain: pNF-κB, nuclear NF-κB, IL-6, TNF-α, and CD11b, with significantly increased levels of cytosolic NF-κB. Retinas from progesterone-treated animals showed significantly reduced levels of nuclear NF-κB and IL-6 and increased levels of cytosolic NF-κB, with a trend for reduction in other markers. Post-MCAO, progesterone receptors A and B were upregulated in brain and downregulated in retina. Inflammatory markers increased in both brain and retina after MCAO, with greater increases observed in brain. Progesterone treatment reduced inflammation, with more dramatic reductions observed in brain than retina. This differential effect may be due to differences in the response of progesterone receptors in brain and retina after injury.

  15. COPI-mediated retrograde trafficking from the Golgi to the ER regulates EGFR nuclear transport

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Ying-Nai; Wang, Hongmei; Yamaguchi, Hirohito

    2010-09-03

    Research highlights: {yields} ARF1 activation is involved in the EGFR transport to the ER and the nucleus. {yields} Assembly of {gamma}-COP coatomer mediates EGFR transport to the ER and the nucleus. {yields} Golgi-to-ER retrograde trafficking regulates nuclear transport of EGFR. -- Abstract: Emerging evidence indicates that cell surface receptors, such as the entire epidermal growth factor receptor (EGFR) family, have been shown to localize in the nucleus. A retrograde route from the Golgi to the endoplasmic reticulum (ER) is postulated to be involved in the EGFR trafficking to the nucleus; however, the molecular mechanism in this proposed model remains unexplored.more » Here, we demonstrate that membrane-embedded vesicular trafficking is involved in the nuclear transport of EGFR. Confocal immunofluorescence reveals that in response to EGF, a portion of EGFR redistributes to the Golgi and the ER, where its NH{sub 2}-terminus resides within the lumen of Golgi/ER and COOH-terminus is exposed to the cytoplasm. Blockage of the Golgi-to-ER retrograde trafficking by brefeldin A or dominant mutants of the small GTPase ADP-ribosylation factor, which both resulted in the disassembly of the coat protein complex I (COPI) coat to the Golgi, inhibit EGFR transport to the ER and the nucleus. We further find that EGF-dependent nuclear transport of EGFR is regulated by retrograde trafficking from the Golgi to the ER involving an association of EGFR with {gamma}-COP, one of the subunits of the COPI coatomer. Our findings experimentally provide a comprehensive pathway that nuclear transport of EGFR is regulated by COPI-mediated vesicular trafficking from the Golgi to the ER, and may serve as a general mechanism in regulating the nuclear transport of other cell surface receptors.« less

  16. The Biarylpyrazole Compound AM251 Alters Mitochondrial Physiology via Proteolytic Degradation of ERRα

    PubMed Central

    Krzysik-Walker, Susan M.; González-Mariscal, Isabel; Scheibye-Knudsen, Morten; Indig, Fred E.

    2013-01-01

    The orphan nuclear receptor estrogen-related receptor alpha (ERRα) directs the transcription of nuclear genes involved in energy homeostasis control and the regulation of mitochondrial mass and function. A crucial role for controlling ERRα-mediated target gene expression has been ascribed to the biarylpyrazole compound 1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl-N-1-piperidinyl-1H-pyrazole-3-carboxamide (AM251) through direct binding to and destabilization of ERRα protein. Here, we provide evidence that structurally related AM251 analogs also have negative impacts on ERRα protein levels in a cell-type-dependent manner while having no deleterious actions on ERRγ. We show that these off-target cellular effects of AM251 are mediated by proteasomal degradation of nuclear ERRα. Cell treatment with the nuclear export inhibitor leptomycin B did not prevent AM251-induced destabilization of ERRα protein, whereas proteasome inhibition with MG132 stabilized and maintained its DNA-binding function, indicative of ERRα being a target of nuclear proteasomal complexes. NativePAGE analysis revealed that ERRα formed a ∼220-kDa multiprotein nuclear complex that was devoid of ERRγ and the coregulator peroxisome proliferator-activated receptor γ coactivator-1. AM251 induced SUMO-2,3 incorporation in ERRα in conjunction with increased protein kinase C activity, whose activation by phorbol ester also promoted ERRα protein loss. Down-regulation of ERRα by AM251 or small interfering RNA led to increased mitochondria biogenesis while negatively impacting mitochondrial membrane potential. These results reveal a novel molecular mechanism by which AM251 and related compounds alter mitochondrial physiology through destabilization of ERRα. PMID:23066093

  17. In vitro study on the agonistic and antagonistic activities of bisphenol-S and other bisphenol-A congeners and derivatives via nuclear receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Molina-Molina, José-Manuel, E-mail: molinajm@ugr.es; Amaya, Esperanza; Grimaldi, Marina

    Bisphenols are a group of chemicals structurally similar to bisphenol-A (BPA) in current use as the primary raw material in the production of polycarbonate and epoxy resins. Some bisphenols are intended to replace BPA in several industrial applications. This is the case of bisphenol-S (BPS), which has an excellent stability at high temperature and resistance to sunlight. Studies on the endocrine properties of BPS have focused on its interaction with human estrogen receptor alpha (hERα), but information on its interaction with other nuclear receptors is scarce. The aim of this study was to investigate interactions of BPS, BPF, BPA andmore » its halogenated derivatives, tetrachlorobisphenol A (TCBPA), and tetrabromobisphenol A (TBBPA), with human estrogen receptors (hERα and hERβ), androgen receptor (hAR), and pregnane X receptor (hPXR), using a panel of in vitro bioassays based on competitive binding to nuclear receptors (NRs), reporter gene expression, and cell proliferation assessment. BPS, BPF, and BPA efficiently activated both ERs, while TCBPA behaved as weak hERα agonist. Unlike BPF and BPA, BPS was more active in the hERβ versus hERα assay. BPF and BPA were full hAR antagonists (BPA > BPF), whereas BPA and BPS were weak hAR agonists. Only BPA, TCBPA, and TBBPA, were hPXR agonists (TCBPA > TBBPA > BPA). These findings provide evidence that BPA congeners and derivatives disrupt multiple NRs and may therefore interfere with the endocrine system. Hence, further research is needed to evaluate the potential endocrine-disrupting activity of putative BPA substitutes. - Highlights: • We investigated the agonist/antagonist activities of BPS, BPF, BPA, TCBPA and TBBPA. • The direct interaction of these compounds with hERα, hERβ, hAR and hPXR was studied. • BPA congeners and derivatives were found to disrupt multiple NRs. • Further evaluation of their role as endocrine-disrupting chemicals is needed.« less

  18. The oxidative stress mediator 4-hydroxynonenal is an intracellular agonist of the nuclear receptor peroxisome proliferator-activated receptor-β/δ (PPARβ/δ)

    PubMed Central

    Coleman, Jeffrey D.; Prabhu, K. Sandeep; Thompson, Jerry T.; Reddy, P. Sreenivasula; Peters, Jeffrey M.; Peterson, Blake R.; Reddy, C. Channa; Vanden Heuvel, John P.

    2007-01-01

    Liver insufficiency and damage is a major cause of death and disease worldwide and may result from exposure to environmental toxicants, specific combinations or dosages of pharmaceuticals and microbial metabolites. The generation of reactive intermediates, in particular 4-hydroxynonenal (4-HNE), is a common event in liver damage caused by a variety of hepatotoxic drugs and solvents. The peroxisome proliferator-activated receptors (PPARs) are nuclear receptors that are involved in the transcriptional regulation of lipid metabolism as well as other biological functions. Importantly, we have observed that the PPARβ/δ−/− mouse is more susceptible to chemically-induced hepatotoxicity than its wildtype counterpart, and our objective in this study was to elucidate the mechanism(s) by which PPARβ/δ confers protection to hepatocytes. We hypothesized that PPARβ/δ plays a protective role by responding to toxic lipids and altering gene expression accordingly. In support, oxidized-VLDL and constituents including 13-S-hydroxyoctadeca-dienoic acid (13(S)-HODE) and 4-HNE are PPARβ/δ ligands. A structure-activity relationship was established where 4-HNE and 4-hydroperoxynonenal (4-HpNE) enhanced the activity of the PPARβ/δ subtype while 4-hyroxy-hexenal (4-HHE), 4-oxo-2-Nonenal (4-ONE), and trans-4,5-epoxy-2(E)-decenal did not activate this receptor. Increasing PPARβ/δ activity with a synthetic agonist decreased sensitivity of hepatocytes to 4-HNE and other toxic agents, whereas inhibition of this receptor had the opposite result. Gene expression microarray analysis identified several important PPARβ/δ-regulated detoxification enzymes involved in 4-HNE metabolism that are regulated at the transcript level. This research established 4-HNE as an endogenous modulator of PPARβ/δ activity and raises the possibility that agonists of this nuclear receptor may be utilized to prevent or treat liver disease associated with oxidative damage. PMID:17382197

  19. Regulation of Liver Energy Balance by the Nuclear Receptors Farnesoid X Receptor and Peroxisome Proliferator Activated Receptor α.

    PubMed

    Kim, Kang Ho; Moore, David D

    2017-01-01

    The liver undergoes major changes in substrate utilization and metabolic output over the daily feeding and fasting cycle. These changes occur acutely in response to hormones such as insulin and glucagon, with rapid changes in signaling pathways mediated by protein phosphorylation and other post-translational modifications. They are also reflected in chronic alterations in gene expression in response to nutrient-sensitive transcription factors. Among these, the nuclear receptors farnesoid X receptor (FXR) and peroxisome proliferator activated receptor α (PPARα) provide an intriguing, coordinated response to maintain energy balance in the liver. FXR is activated in the fed state by bile acids returning to the liver, while PPARα is activated in the fasted state in response to the free fatty acids produced by adipocyte lipolysis or possibly other signals. Key Messages: Previous studies indicate that FXR and PPARα have opposing effects on each other's primary targets in key metabolic pathways including gluconeogenesis. Our more recent work shows that these 2 nuclear receptors coordinately regulate autophagy: FXR suppresses this pathway of nutrient and energy recovery, while PPARα activates it. Another recent study indicates that FXR activates the complement and coagulation pathway, while earlier studies identify this as a negative target of PPARα. Since secretion is a very energy- and nutrient-intensive process for hepatocytes, it is possible that FXR licenses it in the nutrient-rich fed state, while PPARα represses it to spare resources in the fasted state. Energy balance is a potential connection linking FXR and PPARα regulation of autophagy and secretion, 2 seemingly unrelated aspects of hepatocyte function. FXR and PPARα act coordinately to promote energy balance and homeostasis in the liver by regulating autophagy and potentially protein secretion. It is quite likely that their impact extends to additional pathways relevant to hepatic energy balance, and that these pathways will in turn interface with other well-known nutrient-responsive mechanisms of energy control. © 2017 S. Karger AG, Basel.

  20. Quantitative in vivo cell-surface receptor imaging in oncology: kinetic modeling & paired-agent principles from nuclear medicine and optical imaging

    PubMed Central

    Tichauer, Kenneth M.; Wang, Yu; Pogue, Brian W.; Liu, Jonathan T. C.

    2015-01-01

    The development of methods to accurately quantify cell-surface receptors in living tissues would have a seminal impact in oncology. For example, accurate measures of receptor density in vivo could enhance early detection or surgical resection of tumors via protein-based contrast, allowing removal of cancer with high phenotype specificity. Alternatively, accurate receptor expression estimation could be used as a biomarker to guide patient-specific clinical oncology targeting of the same molecular pathway. Unfortunately, conventional molecular contrast-based imaging approaches are not well adapted to accurately estimating the nanomolar-level cell-surface receptor concentrations in tumors, as most images are dominated by nonspecific sources of contrast such as high vascular permeability and lymphatic inhibition. This article reviews approaches for overcoming these limitations based upon tracer kinetic modeling and the use of emerging protocols to estimate binding potential and the related receptor concentration. Methods such as using single time point imaging or a reference-tissue approach tend to have low accuracy in tumors, whereas paired-agent methods or advanced kinetic analyses are more promising to eliminate the dominance of interstitial space in the signals. Nuclear medicine and optical molecular imaging are the primary modalities used, as they have the nanomolar level sensitivity needed to quantify cell-surface receptor concentrations present in tissue, although each likely has a different clinical niche. PMID:26134619

Top